Kainate receptors coming of age: milestones of two decades of research
Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T
2011-01-01
Two decades have passed since the first report of the cloning of a kainate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of kainate receptors in the brain. This research has led to an appreciation that kainate receptors play quite distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact on neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cellular excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. PMID:21256604
Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe
2005-12-14
Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.
Negrete-Díaz, José Vicente; Duque-Feria, Paloma; Andrade-Talavera, Yuniesky; Carrión, Miriam; Flores, Gonzalo; Rodríguez-Moreno, Antonio
2012-04-01
Kainate receptors (KARs) have been described as modulators of synaptic transmission at different synapses. However, this role of KARs has not been well characterized in the amygdala. We have explored the effect of kainate receptor activation at the synapse established between fibers originating at medial geniculate nucleus and the principal cells in the lateral amygdala. We have observed an inhibition of evoked excitatory postsynaptic currents (eEPSCs) amplitude after a brief application of KARs agonists KA and ATPA. Paired-pulse recordings showed a clear pair pulse facilitation that was enhanced after KA or ATPA application. When postsynaptic cells were loaded with BAPTA, the depression of eEPSC amplitude observed after the perfusion of KAR agonists was not prevented. We have also observed that the inhibition of the eEPSCs by KARs agonists was prevented by protein kinase A but not by protein kinase C inhibitors. Taken together our results indicate that KARs present at this synapse are pre-synaptic and their activation mediate the inhibition of glutamate release through a mechanism that involves the activation of protein kinase A. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.
Kainate receptors coming of age: milestones of two decades of research.
Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T
2011-03-01
Two decades have passed since the first report of the cloning of a kainate-type glutamate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of KARs in the brain. This research has led to an appreciation that KARs play very distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact upon neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cell excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.
PSD-95 regulates synaptic kainate receptors at mouse hippocampal mossy fiber-CA3 synapses.
Suzuki, Etsuko; Kamiya, Haruyuki
2016-06-01
Kainate-type glutamate receptors (KARs) are the third class of ionotropic glutamate receptors whose activation leads to the unique roles in regulating synaptic transmission and circuit functions. In contrast to AMPA receptors (AMPARs), little is known about the mechanism of synaptic localization of KARs. PSD-95, a major scaffold protein of the postsynaptic density, is a candidate molecule that regulates the synaptic KARs. Although PSD-95 was shown to bind directly to KARs subunits, it has not been tested whether PSD-95 regulates synaptic KARs in intact synapses. Using PSD-95 knockout mice, we directly investigated the role of PSD-95 in the KARs-mediated components of synaptic transmission at hippocampal mossy fiber-CA3 synapse, one of the synapses with the highest density of KARs. Mossy fiber EPSCs consist of AMPA receptor (AMPAR)-mediated fast component and KAR-mediated slower component, and the ratio was significantly reduced in PSD-95 knockout mice. The size of KARs-mediated field EPSP reduced in comparison with the size of the fiber volley. Analysis of KARs-mediated miniature EPSCs also suggested reduced synaptic KARs. All the evidence supports critical roles of PSD-95 in regulating synaptic KARs. Copyright © 2015 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.
Wondolowski, Joyce; Frerking, Matthew
2009-01-01
Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856
Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation
Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.
2009-01-01
Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838
Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Negrete-Díaz, José Vicente; Sihra, Talvinder S; Flores, Gonzalo; Rodríguez-Moreno, Antonio
2012-09-01
Presynaptic kainate receptors (KARs) modulate the release of glutamate at synapses established between mossy fibers (MF) and CA3 pyramidal cells in the hippocampus. The activation of KAR by low, nanomolar, kainate concentrations facilitates glutamate release. KAR-mediated facilitation of glutamate release involves the activation of an adenylate cyclase/cyclic adenosine monophosphate/protein kinase A cascade at MF-CA3 synapses. Here, we studied the mechanisms by which KAR activation produces this facilitation of glutamate release in slices and synaptosomes. We find that the facilitation of glutamate release mediated by KAR activation requires an increase in Ca(2+) levels in the cytosol and the formation of a Ca(2+) -calmodulin complex to activate adenylate cyclase. The increase in cytosolic Ca(2+) underpinning this modulation is achieved, both, by Ca(2+) entering via Ca(2+) -permeable KARs and, by the mobilization of intraterminal Ca(2+) stores. Finally, we find that, congruent with the Ca(2+) -calmodulin support of KAR-mediated facilitation of glutamate release, induction of long-term potentiation at MF-CA3 synapses has an obligate requirement for Ca(2+) -calmodulin activity. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.
Paternain, A V; Morales, M; Lerma, J
1995-01-01
Although both protein and mRNAs for kainate receptor subunits are abundant in several brain regions, the responsiveness of AMPA receptors to kainate has made it difficult to demonstrate the presence of functional kainate-type receptors in native cells. Recently, however, we have shown that many hippocampal neurons in culture express glutamate receptors of the kainate type. The large nondesensitizing response that kainate induces at AMPA receptors precludes detection and analysis of smaller, rapidly desensitizing currents induced by kainate at kainate receptors. Consequently, the functional significance of these strongly desensitizing glutamate receptors remains enigmatic. We report here that the family of new noncompetitive antagonists of AMPA receptors (GYKI 52466 and 53655) minimally affects kainate-induced responses at kainate receptors while completely blocking AMPA receptor-mediated currents, making it possible to separate the responses mediated by each receptor. These compounds will allow determination of the role played by kainate receptors in synaptic transmission and plasticity in the mammalian brain, as well as evaluation of their involvement in neurotoxicity.
Vernon, Claire G.
2017-01-01
Peripheral sensory neurons in the dorsal root ganglia (DRG) are the initial transducers of sensory stimuli, including painful stimuli, from the periphery to central sensory and pain-processing centers. Small- to medium-diameter non-peptidergic neurons in the neonatal DRG express functional kainate receptors (KARs), one of three subfamilies of ionotropic glutamate receptors, as well as the putative KAR auxiliary subunit Neuropilin- and tolloid-like 2 (Neto2). Neto2 alters recombinant KAR function markedly but has yet to be confirmed as an auxiliary subunit that assembles with and alters the function of endogenous KARs. KARs in neonatal DRG require the GluK1 subunit as a necessary constituent, but it is unclear to what extent other KAR subunits contribute to the function and proposed roles of KARs in sensory ganglia, which include promotion of neurite outgrowth and modulation of glutamate release at the DRG–dorsal horn synapse. In addition, KARs containing the GluK1 subunit are implicated in modes of persistent but not acute pain signaling. We show here that the Neto2 protein is highly expressed in neonatal DRG and modifies KAR gating in DRG neurons in a developmentally regulated fashion in mice. Although normally at very low levels in adult DRG neurons, Neto2 protein expression can be upregulated via MEK/ERK signaling and after sciatic nerve crush and Neto2−/− neurons from adult mice have stunted neurite outgrowth. These data confirm that Neto2 is a bona fide KAR auxiliary subunit that is an important constituent of KARs early in sensory neuron development and suggest that Neto2 assembly is critical to KAR modulation of DRG neuron process outgrowth. SIGNIFICANCE STATEMENT Pain-transducing peripheral sensory neurons of the dorsal root ganglia (DRG) express kainate receptors (KARs), a subfamily of glutamate receptors that modulate neurite outgrowth and regulate glutamate release at the DRG–dorsal horn synapse. The putative KAR auxiliary subunit Neuropilin- and
Potentiation of tonic GABAergic inhibition by activation of postsynaptic kainate receptors.
Jiang, L; Kang, D; Kang, J
2015-07-09
Presynaptic kainate-type glutamate ionotropic receptors (KARs) that mediate either the depression or the facilitation of GABA release have been intensively studied. Little attention has been given to the modulation of GABAA receptors (GABAARs) by postsynaptic KARs. Recent studies suggest that two GABAAR populations, synaptic (sGABAAR) and extrasynaptic (eGABAAR) GABAARs, mediate phasic and tonic forms of inhibition, respectively. Tonic inhibition plays an important role in the excitability of neuronal circuits and the occurrence of epileptic seizures. For this study, we are the first to report that the activation of postsynaptic KARs by the KAR agonist, Kainic acid (KA, 5 μM), enhanced tonic inhibition by potentiating eGABAARs. KA enhanced THIP-induced eGABAAR currents and prolonged the rise and decay time of muscimol-induced sGABAAR/eGABAAR currents, but also depressed the amplitude of evoked inhibitory postsynaptic currents (IPSCs), unitary IPSCs (uIPSCs), and muscimol-induced sGABAAR/eGABAAR currents. The PKC inhibitor, staurosporine (1 μM), in the patch pipette solution fully blocked the KA-induced potentiation of tonic inhibition, suggesting the involvement of an intracellular PKC pathway. Our study suggests that the activation of postsynaptic KARs potentiates eGABAARs but depresses sGABAARs. By activating postsynaptic KARs, synaptically released glutamate depresses phasic inhibition to facilitate neuronal plasticity, but potentiates tonic inhibition to protect neurons from over-excitation. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Vernon, Claire G; Swanson, Geoffrey T
2017-03-22
Peripheral sensory neurons in the dorsal root ganglia (DRG) are the initial transducers of sensory stimuli, including painful stimuli, from the periphery to central sensory and pain-processing centers. Small- to medium-diameter non-peptidergic neurons in the neonatal DRG express functional kainate receptors (KARs), one of three subfamilies of ionotropic glutamate receptors, as well as the putative KAR auxiliary subunit Neuropilin- and tolloid-like 2 (Neto2). Neto2 alters recombinant KAR function markedly but has yet to be confirmed as an auxiliary subunit that assembles with and alters the function of endogenous KARs. KARs in neonatal DRG require the GluK1 subunit as a necessary constituent, but it is unclear to what extent other KAR subunits contribute to the function and proposed roles of KARs in sensory ganglia, which include promotion of neurite outgrowth and modulation of glutamate release at the DRG-dorsal horn synapse. In addition, KARs containing the GluK1 subunit are implicated in modes of persistent but not acute pain signaling. We show here that the Neto2 protein is highly expressed in neonatal DRG and modifies KAR gating in DRG neurons in a developmentally regulated fashion in mice. Although normally at very low levels in adult DRG neurons, Neto2 protein expression can be upregulated via MEK/ERK signaling and after sciatic nerve crush and Neto2 -/- neurons from adult mice have stunted neurite outgrowth. These data confirm that Neto2 is a bona fide KAR auxiliary subunit that is an important constituent of KARs early in sensory neuron development and suggest that Neto2 assembly is critical to KAR modulation of DRG neuron process outgrowth. SIGNIFICANCE STATEMENT Pain-transducing peripheral sensory neurons of the dorsal root ganglia (DRG) express kainate receptors (KARs), a subfamily of glutamate receptors that modulate neurite outgrowth and regulate glutamate release at the DRG-dorsal horn synapse. The putative KAR auxiliary subunit Neuropilin- and
Functional kainate-selective glutamate receptors in cultured hippocampal neurons.
Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B
1993-12-15
Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.
Functional kainate-selective glutamate receptors in cultured hippocampal neurons.
Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B
1993-01-01
Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445
Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Sihra, Talvinder S; Rodríguez-Moreno, Antonio
2013-09-01
We have investigated the mechanisms underlying the facilitatory modulation mediated by kainate receptor (KAR) activation in the cortex, using isolated nerve terminals (synaptosomes) and slice preparations. In cortical nerve terminals, kainate (KA, 100 μM) produced an increase in 4-aminopyridine (4-AP)-evoked glutamate release. In thalamocortical slices, KA (1 μM) produced an increase in the amplitude of evoked excitatory post-synaptic currents (eEPSCs) at synapses established between thalamic axon terminals from the ventrobasal nucleus onto stellate neurons of L4 of the somatosensory cortex. In both, synaptosomes and slices, the effect of KA was antagonized by 6-cyano-7-nitroquinoxaline-2,3-dione, and persisted after pre-treatment with a cocktail of antagonists of other receptors whose activation could potentially have produced facilitation of release indirectly. Mechanistically, the observed effects of KA appear to be congruent in synaptosomal and slice preparations. Thus, the facilitation by KA of synaptosomal glutamate release and thalamocortical synaptic transmission were suppressed by the inhibition of protein kinase A and occluded by the stimulation of adenylyl cyclase. Dissecting this G-protein-independent regulation further in thalamocortical slices, the KAR-mediated facilitation of synaptic transmission was found to be sensitive to the block of Ca(2+) permeant KARs by philanthotoxin. Intriguingly, the synaptic facilitation was abrogated by depletion of intracellular Ca(2+) stores by thapsigargin, or inhibition of Ca(2+) -induced Ca(2+) -release by ryanodine. Thus, the KA-mediated modulation was contingent on both Ca(2+) entry through Ca(2+) -permeable KARs and liberation of intracellular Ca(2+) stores. Finally, sensitivity to W-7 indicated that the increased cytosolic [Ca(2+) ] underpinning KAR-mediated regulation of synaptic transmission at thalamocortical synapses, requires downstream activation of calmodulin. We conclude that neocortical pre
Kainate receptor pore‐forming and auxiliary subunits regulate channel block by a novel mechanism
Brown, Patricia M. G. E.; Aurousseau, Mark R. P.; Musgaard, Maria; Biggin, Philip C.
2016-01-01
Key points Kainate receptor heteromerization and auxiliary subunits, Neto1 and Neto2, attenuate polyamine ion‐channel block by facilitating blocker permeation.Relief of polyamine block in GluK2/GluK5 heteromers results from a key proline residue that produces architectural changes in the channel pore α‐helical region.Auxiliary subunits exert an additive effect to heteromerization, and thus relief of polyamine block is due to a different mechanism.Our findings have broad implications for work on polyamine block of other cation‐selective ion channels. Abstract Channel block and permeation by cytoplasmic polyamines is a common feature of many cation‐selective ion channels. Although the channel block mechanism has been studied extensively, polyamine permeation has been considered less significant as it occurs at extreme positive membrane potentials. Here, we show that kainate receptor (KAR) heteromerization and association with auxiliary proteins, Neto1 and Neto2, attenuate polyamine block by enhancing blocker permeation. Consequently, polyamine permeation and unblock occur at more negative and physiologically relevant membrane potentials. In GluK2/GluK5 heteromers, enhanced permeation is due to a single proline residue in GluK5 that alters the dynamics of the α‐helical region of the selectivity filter. The effect of auxiliary proteins is additive, and therefore the structural basis of polyamine permeation and unblock is through a different mechanism. As native receptors are thought to assemble as heteromers in complex with auxiliary proteins, our data identify an unappreciated impact of polyamine permeation in shaping the signalling properties of neuronal KARs and point to a structural mechanism that may be shared amongst other cation‐selective ion channels. PMID:26682513
Rutkowska-Wlodarczyk, Izabela; Aller, M Isabel; Valbuena, Sergio; Bologna, Jean-Charles; Prézeau, Laurent; Lerma, Juan
2015-04-01
Kainate receptors (KARs) are found ubiquitously in the CNS and are present presynaptically and postsynaptically regulating synaptic transmission and excitability. Functional studies have proven that KARs act as ion channels as well as potentially activating G-proteins, thus indicating the existance of a dual signaling system for KARs. Nevertheless, it is not clear how these ion channels activate G-proteins and which of the KAR subunits is involved. Here we performed a proteomic analysis to define proteins that interact with the C-terminal domain of GluK1 and we identified a variety of proteins with many different functions, including a Go α subunit. These interactions were verified through distinct in vitro and in vivo assays, and the activation of the Go protein by GluK1 was validated in bioluminescence resonance energy transfer experiments, while the specificity of this association was confirmed in GluK1-deficient mice. These data reveal components of the KAR interactome, and they show that GluK1 and Go proteins are natural partners, accounting for the metabotropic effects of KARs. Copyright © 2015 the authors 0270-6474/15/355171-09$15.00/0.
Dancing partners at the synapse: auxiliary subunits that shape kainate receptor function
Copits, Bryan A.; Swanson, Geoffrey T.
2012-01-01
Kainate receptors are a family of ionotropic glutamate receptors whose physiological roles differ from those of other subtypes of glutamate receptors in that they predominantly serve as modulators, rather than mediators, of synaptic transmission. Neuronal kainate receptors exhibit unusually slow kinetic properties that have been difficult to reconcile with the behaviour of recombinant kainate receptors. Recently, however, the neuropilin and tolloid-like 1 (NETO1) and NETO2 proteins were identified as auxiliary kainate receptor subunits that shape both the biophysical properties and synaptic localization of these receptors. PMID:22948074
High-affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling.
Fernandes, Herman B; Catches, Justin S; Petralia, Ronald S; Copits, Bryan A; Xu, Jian; Russell, Theron A; Swanson, Geoffrey T; Contractor, Anis
2009-09-24
Kainate receptors signal through both ionotropic and metabotropic pathways. The high-affinity subunits, GluK4 and GluK5, are unique among the five receptor subunits, as they do not form homomeric receptors but modify the properties of heteromeric assemblies. Disruption of the Grik4 gene locus resulted in a significant reduction in synaptic kainate receptor currents. Moreover, ablation of GluK4 and GluK5 caused complete loss of synaptic ionotropic kainate receptor function. The principal subunits were distributed away from postsynaptic densities and presynaptic active zones. There was also a profound alteration in the activation properties of the remaining kainate receptors. Despite this, kainate receptor-mediated inhibition of the slow afterhyperpolarization current (I(sAHP)), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown obligatory role for the high-affinity subunits for ionotropic kainate receptor function and further demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels.
Benzodiazepine and kainate receptor binding sites in the RCS rat retina.
Stasi, Kalliopi; Naskar, Rita; Thanos, Solon; Kouvelas, Elias D; Mitsacos, Ada
2003-02-01
The effect of age and photoreceptor degeneration on the kainate subtype of glutamate receptors and on the benzodiazepine-sensitive gamma-aminobutyric acid-A receptors (GABA(A)) in normal and RCS (Royal College of Surgeons) rats were investigated. [(3)H]Kainate and [(3)H]flunitrazepam were used as radioligands for kainate and GABA(A)/benzodiazepine()receptors, respectively, using the quantitative receptor autoradiography technique. In both normal and RCS rat retina we observed that [(3)Eta]flunitrazepam and [(3)Eta]kainate binding levels were several times higher in inner plexiform layer (IPL) than in outer plexiform layer (OPL) at all four ages studied (P17, P35, P60 and P180). Age-related changes in receptor binding were observed in normal rat retina: [(3)Eta]flunitrazepam binding showed a significant decrease of 25% between P17 and P60 in IPL,and [(3)Eta]kainate binding showed significant decreases between P17 and P35 in both synaptic layers (71% in IPL and 63% in OPL). Degeneration-related changes in benzodiazepine and kainate receptor binding were observed in RCS rat retina. In IPL, [(3)Eta]flunitrazepam and [(3)Eta]kainate binding levels were higher than in normal retina at P35 (by 24% and 86%, respectively). In OPL, [(3)Eta]flunitrazepam binding was higher in RCS than in normal retina on P35 (74%) and also on P60 (62%). The results indicate that postnatal changes occur in kainate and benzodiazepine receptor binding sites in OPL and IPL of the rat retina up to 6 months of age. The data also suggest that the receptor binding changes observed in the RCS retina could be a consequence of the primary photoreceptor degeneration.
High affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling
Fernandes, Herman B.; Catches, Justin S.; Petralia, Ronald S.; Copits, Bryan A.; Xu, Jian; Russell, Theron A.; Swanson, Geoffrey T.; Contractor, Anis
2009-01-01
Summary Kainate receptors are atypical members of the glutamate receptor family which are able to signal through both ionotropic and metabotropic pathways. Of the five individual kainate receptor subunits the high-affinity subunits, GluK4 (KA1) and GluK5 (KA2), are unique in that they do not form functional homomeric receptors in recombinant expression systems, but combine with the primary subunits GluK1-3 (GluR5-7) to form heteromeric assemblies. Here we generated a GluK4 mutant mouse by disrupting the Grik4 gene locus. We found that loss of the GluK4 subunit leads to a significant reduction in synaptic kainate receptor currents. Moreover, ablation of both high-affinity subunits in GluK4/GluK5 double knockout mice leads to a complete loss of pre- and postsynaptic ionotropic function of synaptic kainate receptors. The principal subunits remain at the synaptic plasma membrane, but are distributed away from postsynaptic densities and presynaptic active zones. There is also an alteration in the properties of the remaining kainate receptors, as kainic acid application fails to elicit responses in GluK4/GluK5 knockout neurons. Despite the lack of detectable ionotropic synaptic receptors, the kainate receptor-mediated inhibition of the slow afterhyperpolarization current (IsAHP), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown critical role for the high-affinity kainate receptor subunits as obligatory components of ionotropic kainate receptor function, and further, demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels. PMID:19778510
Functional Validation of Heteromeric Kainate Receptor Models.
Paramo, Teresa; Brown, Patricia M G E; Musgaard, Maria; Bowie, Derek; Biggin, Philip C
2017-11-21
Kainate receptors require the presence of external ions for gating. Most work thus far has been performed on homomeric GluK2 but, in vivo, kainate receptors are likely heterotetramers. Agonists bind to the ligand-binding domain (LBD) which is arranged as a dimer of dimers as exemplified in homomeric structures, but no high-resolution structure currently exists of heteromeric kainate receptors. In a full-length heterotetramer, the LBDs could potentially be arranged either as a GluK2 homomer alongside a GluK5 homomer or as two GluK2/K5 heterodimers. We have constructed models of the LBD dimers based on the GluK2 LBD crystal structures and investigated their stability with molecular dynamics simulations. We have then used the models to make predictions about the functional behavior of the full-length GluK2/K5 receptor, which we confirmed via electrophysiological recordings. A key prediction and observation is that lithium ions bind to the dimer interface of GluK2/K5 heteromers and slow their desensitization. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Presynaptic Kainate Receptor Mediation of Frequency Facilitation at Hippocampal Mossy Fiber Synapses
NASA Astrophysics Data System (ADS)
Schmitz, Dietmar; Mellor, Jack; Nicoll, Roger A.
2001-03-01
Inhibition of transmitter release by presynaptic receptors is widespread in the central nervous system and is typically mediated via metabotropic receptors. In contrast, very little is known about facilitatory receptors, and synaptic activation of a facilitatory autoreceptor has not been established. Here we show that activation of presynaptic kainate receptors can facilitate transmitter release from hippocampal mossy fiber synapses. Synaptic activation of these presumed ionotropic kainate receptors is very fast (<10 ms) and lasts for seconds. Thus, these presynaptic kainate receptors contribute to the short-term plasticity characteristics of mossy fiber synapses, which were previously thought to be an intrinsic property of the synapse.
Preferential assembly of heteromeric kainate and AMPA receptor amino terminal domains
Lomash, Suvendu; Chittori, Sagar; Glasser, Carla
2017-01-01
Ion conductivity and the gating characteristics of tetrameric glutamate receptor ion channels are determined by their subunit composition. Competitive homo- and hetero-dimerization of their amino-terminal domains (ATDs) is a key step controlling assembly. Here we measured systematically the thermodynamic stabilities of homodimers and heterodimers of kainate and AMPA receptors using fluorescence-detected sedimentation velocity analytical ultracentrifugation. Measured affinities span many orders of magnitude, and complexes show large differences in kinetic stabilities. The association of kainate receptor ATD dimers is generally weaker than the association of AMPA receptor ATD dimers, but both show a general pattern of increased heterodimer stability as compared to the homodimers of their constituents, matching well physiologically observed receptor combinations. The free energy maps of AMPA and kainate receptor ATD dimers provide a framework for the interpretation of observed receptor subtype combinations and possible assembly pathways. PMID:29058671
Preferential assembly of heteromeric kainate and AMPA receptor amino terminal domains.
Zhao, Huaying; Lomash, Suvendu; Chittori, Sagar; Glasser, Carla; Mayer, Mark L; Schuck, Peter
2017-10-23
Ion conductivity and the gating characteristics of tetrameric glutamate receptor ion channels are determined by their subunit composition. Competitive homo- and hetero-dimerization of their amino-terminal domains (ATDs) is a key step controlling assembly. Here we measured systematically the thermodynamic stabilities of homodimers and heterodimers of kainate and AMPA receptors using fluorescence-detected sedimentation velocity analytical ultracentrifugation. Measured affinities span many orders of magnitude, and complexes show large differences in kinetic stabilities. The association of kainate receptor ATD dimers is generally weaker than the association of AMPA receptor ATD dimers, but both show a general pattern of increased heterodimer stability as compared to the homodimers of their constituents, matching well physiologically observed receptor combinations. The free energy maps of AMPA and kainate receptor ATD dimers provide a framework for the interpretation of observed receptor subtype combinations and possible assembly pathways.
Wyeth, Megan S.; Pelkey, Kenneth A.; Petralia, Ronald S.; Salter, Michael W.; McInnes, Roderick R.
2014-01-01
Neto1 and Neto2 auxiliary subunits coassemble with NMDA receptors (NMDARs) and kainate receptors (KARs) to modulate their function. In the hippocampus, Neto1 enhances the amplitude and prolongs the kinetics of KAR-mediated currents at mossy fiber (MF)–CA3 pyramidal cell synapses. However, whether Neto1 trafficks KARs to synapses or simply alters channel properties is unresolved. Therefore, postembedding electron microscopy was performed to investigate the localization of GluK2/3 subunits at MF–CA3 synapses in Neto-null mice. Postsynaptic GluK2/3 Immunogold labeling was substantially reduced in Neto-null mice compared with wild types. Moreover, spontaneous KAR-mediated synaptic currents and metabotropic KAR signaling were absent in CA3 pyramidal cells of Neto-null mice. A similar loss of ionotropic and metabotropic KAR function was observed in Neto1, but not Neto2, single knock-out mice, specifically implicating Neto1 in regulating CA3 pyramidal cell KAR localization and function. Additional controversy pertains to the role of Neto proteins in modulating synaptic NMDARs. While Immunogold labeling for GluN2A at MF–CA3 synapses was comparable between wild-type and Neto-null mice, labeling for postsynaptic GluN2B was robustly increased in Neto-null mice. Accordingly, NMDAR-mediated currents at MF–CA3 synapses exhibited increased sensitivity to a GluN2B-selective antagonist in Neto1 knockouts relative to wild types. Thus, despite preservation of the overall MF–CA3 synaptic NMDAR-mediated current, loss of Neto1 alters NMDAR subunit composition. These results confirm that Neto protein interactions regulate synaptic localization of KAR and NMDAR subunits at MF–CA3 synapses, with implications for both ionotropic and metabotropic glutamatergic recruitment of the CA3 network. PMID:24403160
Xu, Jian; Marshall, John J; Fernandes, Herman B; Nomura, Toshihiro; Copits, Bryan A; Procissi, Daniele; Mori, Susumu; Wang, Lei; Zhu, Yongling; Swanson, Geoffrey T; Contractor, Anis
2017-02-21
Kainate receptors are members of the glutamate receptor family that regulate synaptic function in the brain. They modulate synaptic transmission and the excitability of neurons; however, their contributions to neural circuits that underlie behavior are unclear. To understand the net impact of kainate receptor signaling, we generated knockout mice in which all five kainate receptor subunits were ablated (5ko). These mice displayed compulsive and perseverative behaviors, including over-grooming, as well as motor problems, indicative of alterations in striatal circuits. There were deficits in corticostriatal input to spiny projection neurons (SPNs) in the dorsal striatum and correlated reductions in spine density. The behavioral alterations were not present in mice only lacking the primary receptor subunit expressed in adult striatum (GluK2 KO), suggesting that signaling through multiple receptor types is required for proper striatal function. This demonstrates that alterations in striatal function dominate the behavioral phenotype in mice without kainate receptors. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Marshall, John J; Xu, Jian; Contractor, Anis
2018-04-18
Kainate receptors are members of the glutamate receptor family that function by both generating ionotropic currents through an integral ion channel pore and coupling to downstream metabotropic signaling pathways. They are highly expressed in the striatum, yet their roles in regulating striatal synapses are not known. Using mice of both sexes, we demonstrate that GluK2-containing kainate receptors expressed in direct pathway spiny projection neurons (dSPNs) inhibit glutamate release at corticostriatal synapses in the dorsolateral striatum. This inhibition requires postsynaptic kainate-receptor-mediated mobilization of a retrograde endocannabinoid (eCB) signal and activation of presynaptic CB1 receptors. This pathway can be activated during repetitive 25 Hz trains of synaptic stimulation, causing short-term depression of corticostriatal synapses. This is the first study to demonstrate a role for kainate receptors in regulating eCB-mediated plasticity at the corticostriatal synapse and demonstrates an important role for these receptors in regulating basal ganglia circuits. SIGNIFICANCE STATEMENT The GRIK2 gene, encoding the GluK2 subunit of the kainate receptor, has been linked to several neuropsychiatric and neurodevelopmental disorders including obsessive compulsive disorder (OCD). Perseverative behaviors associated with OCD are known to result from pathophysiological changes in the striatum and kainate receptor knock-out mice have striatal-dependent phenotypes. However, the role of kainate receptors in striatal synapses is not known. We demonstrate that GluK2-containing kainate receptors regulate corticostriatal synapses by mobilizing endocannabinoids from direct pathway spiny projection neurons. Synaptic activation of GluK2 receptors during trains of synaptic input causes short-term synaptic depression, demonstrating a novel role for these receptors in regulating striatal circuits. Copyright © 2018 the authors 0270-6474/18/383901-10$15.00/0.
Rojas, Asheebo; Gueorguieva, Paoula; Lelutiu, Nadia; Quan, Yi; Shaw, Renee; Dingledine, Raymond
2014-01-01
Prostaglandin E2 (PGE2) regulates membrane excitability, synaptic transmission, plasticity, and neuronal survival. The consequences of PGE2 release following seizures has been the subject of much study. Here we demonstrate that the prostaglandin E2 receptor 1 (EP1, or Ptger1) modulates native kainate receptors, a family of ionotropic glutamate receptors widely expressed throughout the central nervous system. Global ablation of the EP1 gene in mice (EP1-KO) had no effect on seizure threshold after kainate injection but reduced the likelihood to enter status epilepticus. EP1-KO mice that did experience typical status epilepticus had reduced hippocampal neurodegeneration and a blunted inflammatory response. Further studies with native prostanoid and kainate receptors in cultured cortical neurons, as well as with recombinant prostanoid and kainate receptors expressed in Xenopus oocytes, demonstrated that EP1 receptor activation potentiates heteromeric but not homomeric kainate receptors via a second messenger cascade involving phospholipase C, calcium and protein kinase C. Three critical GluK5 C-terminal serines underlie the potentiation of the GluK2/GluK5 receptor by EP1 activation. Taken together, these results indicate that EP1 receptor activation during seizures, through a protein kinase C pathway, increases the probability of kainic acid induced status epilepticus, and independently promotes hippocampal neurodegeneration and a broad inflammatory response. PMID:24952362
Borghuis, Bart G; Looger, Loren L; Tomita, Susumu; Demb, Jonathan B
2014-04-30
A fundamental question in sensory neuroscience is how parallel processing is implemented at the level of molecular and circuit mechanisms. In the retina, it has been proposed that distinct OFF cone bipolar cell types generate fast/transient and slow/sustained pathways by the differential expression of AMPA- and kainate-type glutamate receptors, respectively. However, the functional significance of these receptors in the intact circuit during light stimulation remains unclear. Here, we measured glutamate release from mouse bipolar cells by two-photon imaging of a glutamate sensor (iGluSnFR) expressed on postsynaptic amacrine and ganglion cell dendrites. In both transient and sustained OFF layers, cone-driven glutamate release from bipolar cells was blocked by antagonists to kainate receptors but not AMPA receptors. Electrophysiological recordings from bipolar and ganglion cells confirmed the essential role of kainate receptors for signaling in both transient and sustained OFF pathways. Kainate receptors mediated responses to contrast modulation up to 20 Hz. Light-evoked responses in all mouse OFF bipolar pathways depend on kainate, not AMPA, receptors.
Andreou, Anna P; Holland, Philip R; Lasalandra, Michele P; Goadsby, Peter J
2015-03-01
Migraine is a common and disabling neurologic disorder, with important psychiatric comorbidities. Its pathophysiology involves activation of neurons in the trigeminocervical complex (TCC). Kainate receptors carrying the glutamate receptor subunit 5 (GluK1) are present in key brain areas involved in migraine pathophysiology. To study the influence of kainate receptors on trigeminovascular neurotransmission, we determined the presence of GluK1 receptors within the trigeminal ganglion and TCC with immunohistochemistry. We performed in vivo electrophysiologic recordings from TCC neurons and investigated whether local or systemic application of GluK1 receptor antagonists modulated trigeminovascular transmission. Microiontophoretic application of a selective GluK1 receptor antagonist, but not of a nonspecific ionotropic glutamate receptor antagonist, markedly attenuated cell firing in a subpopulation of neurons activated in response to dural stimulation, consistent with selective inhibition of postsynaptic GluK1 receptor-evoked firing seen in all recorded neurons. In contrast, trigeminovascular activation was significantly facilitated in a different neuronal population. The clinically active kainate receptor antagonist LY466195 attenuated trigeminovascular activation in all neurons. In addition, LY466195 demonstrated an N-methyl-d-aspartate receptor-mediated effect. This study demonstrates a differential role of GluK1 receptors in the TCC, antagonism of which can inhibit trigeminovascular activation through postsynaptic mechanisms. Furthermore, the data suggest a novel, possibly presynaptic, modulatory role of trigeminocervical kainate receptors in vivo. Differential activation of kainate receptors suggests unique roles for this receptor in pro- and antinociceptive mechanisms in migraine pathophysiology.
Mori, Yasunori; Fukuda, Mitsunori; Henley, Jeremy M.
2014-01-01
Glutamate receptors are fundamental for control synaptic transmission, synaptic plasticity, and neuronal excitability. However, many of the molecular mechanisms underlying their trafficking remain elusive. We previously demonstrated that the small GTPase Rab17 regulates dendritic trafficking in hippocampal neurons. Here, we investigated the role(s) of Rab17 in AMPA receptor (AMPAR) and kainate receptor (KAR) trafficking. Although Rab17 knockdown did not affect surface expression of the AMPAR subunit GluA1 under basal or chemically induced long term potentiation conditions, it significantly reduced surface expression of the KAR subunit GluK2. Rab17 co-localizes with Syntaxin-4 in the soma, dendritic shaft, the tips of developing hippocampal neurons, and in spines. Rab17 knockdown caused Syntaxin-4 redistribution away from dendrites and into axons in developing hippocampal neurons. Syntaxin-4 knockdown reduced GluK2 but had no effect on GluA1 surface expression. Moreover, overexpression of constitutively active Rab17 promoted dendritic surface expression of GluK2 by enhancing Syntaxin-4 translocation to dendrites. These data suggest that Rab17 mediates the dendritic trafficking of Syntaxin-4 to selectively regulate dendritic surface insertion of GluK2-containing KARs in rat hippocampal neurons. PMID:24895134
Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A
2012-09-01
Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.
Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F
2000-11-15
To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.
Catches, Justin S; Xu, Jian; Contractor, Anis
2012-03-17
There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4(-/-) mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4(-/-) mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4(-/-) mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. Copyright © 2011 Elsevier B.V. All rights reserved.
Catches, Justin S.; Xu, Jian; Contractor, Anis
2012-01-01
There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4−/− mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4−/− mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4−/− mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. PMID:22203159
Pourcho, Roberta G; Qin, Pu; Goebel, Dennis J; Fyk-Kolodziej, Bozena
2002-12-16
Fast-acting excitatory neurotransmission in the retina is mediated primarily by glutamate, acting at alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) -selective and kainate-selective receptors. To localize these sites of action, cat retinas were stimulated with either AMPA or kainate and processed for histochemical visualization of cobalt uptake through calcium-permeable channels. Treatment with both agonists resulted in staining of A- and B-type horizontal cells and several types of OFF cone bipolar cells; there was no evidence for staining of ON cone bipolar cells or rod bipolar cells. The subpopulations of OFF cone bipolar cells differed in their responses with two distinct types that stained heavily with cobalt after exposure to AMPA and three different types that were preferentially labeled after exposure to kainate. Although many amacrine and ganglion cells appeared to respond to both agonists, AII amacrine cells were stained after stimulation by AMPA but not by kainate. The OFF cone bipolar cells that exhibit AMPA-stimulated cobalt uptake were found to have a high level of correspondence with cells that show immunocytochemical staining for the AMPA-selective glutamate receptor subunits GluR1 and GluR2/3. Similarly, the cone bipolar cells exhibiting kainate-stimulated cobalt uptake resemble those that are immunoreactive for the kainate subunit GluR5. The results indicate that, whereas many retinal neurons express both AMPA and kainate receptors, AII amacrine cells and subpopulations of OFF cone bipolar cells are limited to the expression of either AMPA or kainate receptors. This differential expression may contribute to the unique character of transmission by these cell types. Copyright 2002 Wiley-Liss, Inc.
Mapping Kainate Activation of Inner Neurons in the Rat Retina
Nivison-Smith, Lisa; Sun, Daniel; Fletcher, Erica L.; Marc, Robert E.; Kalloniatis, Michael
2014-01-01
Kainate receptors mediate fast, excitatory synaptic transmission for a range of inner neurons in the mammalian retina. However, allocation of functional kainate receptors to known cell types and their sensitivity remains unresolved. Using the cation channel probe 1-amino-4-guanidobutane agmatine (AGB), we investigated kainate sensitivity of neurochemically identified cell populations within the structurally intact rat retina. Most inner retinal neuron populations responded to kainate in a concentration-dependent manner. OFF cone bipolar cells demonstrated the highest sensitivity of all inner neurons to kainate. Immunocytochemical localization of AGB and macromolecular markers confirmed that type 2 bipolar cells were part of this kainate-sensitive population. The majority of amacrine (ACs) and ganglion cells (GCs) showed kainate responses with different sensitivities between major neurochemical classes (γ-aminobutyric acid [GABA]/glycine ACs > glycine ACs > GABA ACs; glutamate [Glu]/weakly GABA GCs > Glu GCs). Conventional and displaced cholinergic ACs were highly responsive to kainate, whereas dopaminergic ACs do not appear to express functional kainate receptors. These findings further contribute to our understanding of neuronal networks in complex multicellular tissues. PMID:23348566
NASA Technical Reports Server (NTRS)
Stegenga, S. L.; Kalb, R. G.
2001-01-01
Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.
Structure and assembly mechanism for heteromeric kainate receptors.
Kumar, Janesh; Schuck, Peter; Mayer, Mark L
2011-07-28
Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.
Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.
Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U
2005-04-01
The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.
de Freitas, Renato Leonardo; Salgado-Rohner, Carlos José; Biagioni, Audrey Francisco; Medeiros, Priscila; Hallak, Jaime Eduardo Cecílio; Crippa, José Alexandre S; Coimbra, Norberto Cysne
2014-06-01
The aim of the present study was to investigate the involvement of N-methyl-d-aspartate (NMDA) and amino-3-hydroxy-5-methyl-isoxazole-4-proprionate (AMPA)/kainate receptors of the prelimbic (PL) division of the medial prefrontal cortex (MPFC) on the panic attack-like reactions evoked by γ-aminobutyric acid-A receptor blockade in the medial hypothalamus (MH). Rats were pretreated with NaCl 0.9%, LY235959 (NMDA receptor antagonist), and NBQX (AMPA/kainate receptor antagonist) in the PL at 3 different concentrations. Ten minutes later, the MH was treated with bicuculline, and the defensive responses were recorded for 10 min. The antagonism of NMDA receptors in the PL decreased the frequency and duration of all defensive behaviors evoked by the stimulation of the MH and reduced the innate fear-induced antinociception. However, the pretreatment of the PL cortex with NBQX was able to decrease only part of defensive responses and innate fear-induced antinociception. The present findings suggest that the NMDA-glutamatergic system of the PL is critically involved in panic-like responses and innate fear-induced antinociception and those AMPA/kainate receptors are also recruited during the elaboration of fear-induced antinociception and in panic attack-related response. The activation of the glutamatergic neurotransmission of PL division of the MPFC during the elaboration of oriented behavioral reactions elicited by the chemical stimulation of the MH recruits mainly NMDA receptors in comparison with AMPA/kainate receptors.
Wang, Linxiao; Liu, Yanyan; Lu, Rulan; Dong, Guoying; Chen, Xia; Yun, Wenwei; Zhou, Xianju
2018-02-01
Epilepsy is a chronic brain disease affecting millions of individuals. Kainate receptors, especially kainate-type of ionotropic glutamate receptor 2 (GluK2), play an important role in epileptogenesis. Recent data showed that GluK2 could undergo post-translational modifications in terms of S-nitrosylation (SNO), and affect the signaling pathway of cell death in cerebral ischemia-reperfusion. However, it is unclear whether S-nitrosylation of GluK2 (SNO-GluK2) contributes to cell death induced by epilepsy. Here, we report that kainic acid-induced SNO-GluK2 is mediated by GluK2 itself, regulated by neuronal nitric oxide synthase (nNOS) and the level of cytoplasmic calcium in vivo and in vitro hippocampus neurons. The whole-cell patch clamp recordings showed the influence of SNO-GluK2 on ion channel characterization of GluK2-Kainate receptors. Moreover, immunohistochemistry staining results showed that inhibition of SNO-GluK2 by blocking nNOS or GluK2 or by reducing the level of cytoplasmic calcium-protected hippocampal neurons from kainic acid-induced injury. Finally, immunoprecipitation and western blotting data revealed the involvement of assembly of a GluK2-PSD95-nNOS signaling complex in epilepsy. Taken together, our results showed that the SNO-GluK2 plays an important role in neuronal injury of epileptic rats by forming GluK2-PSD95-nNOS signaling module in a cytoplasmic calcium-dependent way, suggesting a potential therapeutic target site for epilepsy. © 2017 International Society for Neurochemistry.
Type II and III Taste Bud Cells Preferentially Expressed Kainate Glutamate Receptors in Rats.
Lee, Sang-Bok; Lee, Cil-Han; Kim, Se-Nyun; Chung, Ki-Myung; Cho, Young-Kyung; Kim, Kyung-Nyun
2009-12-01
Glutamate-induced cobalt uptake reveals that non-NMDA glutamate receptors (GluRs) are present in rat taste bud cells. Previous studies involving glutamate induced cobalt staining suggest this uptake mainly occurs via kainate type GluRs. It is not known which of the 4 types of taste bud cells express subunits of kainate GluR. Circumvallate and foliate papillae of Sprague-Dawley rats (45~60 days old) were used to search for the mRNAs of subunits of non-NMDA GluRs using RT-PCR with specific primers for GluR1-7, KA1 and KA2. We also performed RT-PCR for GluR5, KA1, PLCbeta2, and NCAM/SNAP 25 in isolated single cells from taste buds. Taste epithelium, including circumvallate or foliate papilla, express mRNAs of GluR5 and KA1. However, non-taste tongue epithelium expresses no subunits of non-NMDA GluRs. Isolated single cell RT-PCR reveals that the mRNAs of GluR5 and KA1 are preferentially expressed in Type II and Type III cells over Type I cells.
Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant
Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li
2012-01-01
GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429
Butini, Stefania; Pickering, Darryl S; Morelli, Elena; Coccone, Salvatore Sanna; Trotta, Francesco; De Angelis, Meri; Guarino, Egeria; Fiorini, Isabella; Campiani, Giuseppe; Novellino, Ettore; Schousboe, Arne; Christensen, Jeppe K; Gemma, Sandra
2008-10-23
(S)-CPW399 ((S)-1) is a potent and excitotoxic AMPA receptor partial agonist. Modifying the cyclopentane ring of (S)-1, we developed two of the most potent and selective functional antagonists (5 and 7) for kainate receptor (KA-R) subunit iGluR5. Derivatives 5 and 7, with their unique pharmacological profile, may lead to a better understanding of the different roles and modes of action of iGluR1-5 subunits, paving the way for the synthesis of new potent, subunit selective iGluR5 modulators.
Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A
2007-09-01
Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.
Undifferentiated embryonic stem cells express ionotropic glutamate receptor mRNAs
Pachernegg, Svenja; Joshi, Illah; Muth-Köhne, Elke; Pahl, Steffen; Münster, Yvonne; Terhag, Jan; Karus, Michael; Werner, Markus; Ma-Högemeier, Zhan-Lu; Körber, Christoph; Grunwald, Thomas; Faissner, Andreas; Wiese, Stefan; Hollmann, Michael
2013-01-01
Ionotropic glutamate receptors (iGluRs) do not only mediate the majority of excitatory neurotransmission in the vertebrate CNS, but also modulate pre- and postnatal neurogenesis. Most of the studies on the developmental role of iGluRs are performed on neural progenitors and neural stem cells (NSCs). We took a step back in our study by examining the role of iGluRs in the earliest possible cell type, embryonic stem cells (ESCs), by looking at the mRNA expression of the major iGluR subfamilies in undifferentiated mouse ESCs. For that, we used two distinct murine ES cell lines, 46C ESCs and J1 ESCs. Regarding 46C ESCs, we found transcripts of kainate receptors (KARs) (GluK2 to GluK5), AMPA receptors (AMPARs) (GluA1, GluA3, and GluA4), and NMDA receptors (NMDARs) (GluN1, and GluN2A to GluN2D). Analysis of 46C-derived cells of later developmental stages, namely neuroepithelial precursor cells (NEPs) and NSCs, revealed that the mRNA expression of KARs is significantly upregulated in NEPs and, subsequently, downregulated in NSCs. However, we could not detect any protein expression of any of the KAR subunits present on the mRNA level either in ESCs, NEPs, or NSCs. Regarding AMPARs and NMDARs, GluN2A is weakly expressed at the protein level only in NSCs. Matching our findings for iGluRs, all three cell types were found to weakly express pre- and postsynaptic markers of glutamatergic synapses only at the mRNA level. Finally, we performed patch-clamp recordings of 46C ESCs and could not detect any current upon iGluR agonist application. Similar to 46C ESCs, J1 ESCs express KARs (GluK2 to GluK5), AMPARs (GluA3), and NMDARs (GluN1, and GluN2A to GluN2D) at the mRNA level, but these transcripts are not translated into receptor proteins either. Thus, we conclude that ESCs do not contain functional iGluRs, although they do express an almost complete set of iGluR subunit mRNAs. PMID:24348335
Johansen, T H; Chaudhary, A; Verdoorn, T A
1995-11-01
We examined the actions of cyclothiazide, aniracetam, and 1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI-52466) on recombinant alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and kainate receptors. Receptors expressed in Xenopus oocytes or human embryonic kidney 293 cells were characterized using voltage and patch-clamp electrophysiology. Aniracetam and cyclothiazide potentiated AMPA receptor currents by slowing or blocking desensitization. Cyclothiazide was more potent at receptors consisting of flip subunits compared with receptors consisting of flop subunits, whereas aniracetam appeared to be more efficacious at flop receptors. The potency of GYKI-52466 did not differ in heteromeric flip or flop containing AMPA receptors, but GYKI-52466 was less potent at homomeric GluRAi and GluRDi receptors. At heteromeric AMPA receptors, 50 microM cyclothiazide increased the IC50 value for GYKI-52466 significantly. The increase was largest in GluRBi/Di receptors where the IC50 value shifted from 21.9 microM (95% confidence interval, 12.0-39.8 microM) to 126 microM (95% confidence interval, 72.4-214 microM) in the presence of cyclothiazide. In contrast, 100 microM GYKI-52466 did not alter the EC50 of cyclothiazide at GluRBi/Di receptors nor did it markedly change the maximal potentiation induced by cyclothiazide. At GluRBi/Di receptors transiently expressed in human embryonic kidney 293 cells, 30 microM GYKI-52466 inhibited the steady state and the peak current evoked by 300 microns L-glutamate to the same extent (34.5 +/- 12% and 27.3 +/- 13.0%, respectively; five experiments), and GYKI-52466 did not alter the apparent rate of desensitization (tau = 15.7 +/- 4.7 and 17.5 +/- 8.3 msec in the absence and presence of GYKI-52466, respectively; five experiments). GYKI-52466 inhibited L-glutamate currents in the presence and absence of 10 microM cyclothiazide, but GYKI-52466 never restored the desensitization that was blocked by cyclothiazide
Jayaraman, Anusha; Christensen, Amy; Moser, V. Alexandra; Vest, Rebekah S.; Miller, Chris P.; Hattersley, Gary
2014-01-01
The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed “selective androgen receptor modulators” (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in select androgen-responsive tissues. The efficacy of SARMs in brain is largely unknown. In this study, we investigate the SARM RAD140 in cultured rat neurons and male rat brain for its ability to provide neuroprotection, an important neural action of endogenous androgens that is relevant to neural health and resilience to neurodegenerative diseases. In cultured hippocampal neurons, RAD140 was as effective as testosterone in reducing cell death induced by apoptotic insults. Mechanistically, RAD140 neuroprotection was dependent upon MAPK signaling, as evidenced by elevation of ERK phosphorylation and inhibition of protection by the MAPK kinase inhibitor U0126. Importantly, RAD140 was also neuroprotective in vivo using the rat kainate lesion model. In experiments with gonadectomized, adult male rats, RAD140 was shown to exhibit peripheral tissue-specific androgen action that largely spared prostate, neural efficacy as demonstrated by activation of androgenic gene regulation effects, and neuroprotection of hippocampal neurons against cell death caused by systemic administration of the excitotoxin kainate. These novel findings demonstrate initial preclinical efficacy of a SARM in neuroprotective actions relevant to Alzheimer's disease and related neurodegenerative diseases. PMID:24428527
Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H
2013-08-21
Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.
Modulation of ionotropic glutamate receptor function by vertebrate galectins
Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T
2014-01-01
AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. PMID:24614744
Jia, Yousheng; Jeng, Jade-Ming; Sensi, Stefano L; Weiss, John H
2002-01-01
Permeation of the endogenous cation Zn2+ through calcium-permeable AMPA/kainate receptor-gated (Ca-A/K) channels might subserve pathological and/or physiological signalling roles. Voltage-clamp recording was used to directly assess Zn2+ flux through these channels on cultured murine hippocampal neurones. Ca-A/K channels were present in large numbers only on a minority of neurones (Ca-A/K(+) neurones), many of which were GABAergic. The presence of these channels was assessed in whole-cell or outside-out patch recording as the degree of inward rectification of kainate-activated currents, quantified via a rectification index (RI = G+40/G-60), which ranged from <0.4 (strongly inwardly rectifying) to >2 (outwardly rectifying). The specificity of a low RI as an indication of robust Ca-A/K channel expression was verified by two other techniques, kainate-stimulated cobalt-uptake labelling, and fluorescence imaging of kainate-induced increases in intracellular Ca2+. In addition, the degree of inward rectification of kainate-activated currents correlated strongly with the positive shift of the reversal potential (Vrev) upon switching to a sodium-free, 10 mm Ca2+ buffer. With Zn2+ (3 mm) as the only permeant extracellular cation, kainate-induced inward currents were only observed in neurones that had previously been identified as Ca-A/K(+). A comparison between the Vrev observed with 3 mm Zn2+ and that observed with Ca2+ as the permeant cation revealed a PCa/PZn of ≈1.8. Inward currents recorded in 3 mm Ca2+ were unaffected by the addition of 0.3 mm Zn2+, while microfluorimetrically detected increases in the intracellular concentration of Zn2+ in Ca-A/K(+) neurones upon kainate exposure in the presence of 0.3 mm Zn2+ were only mildly attenuated by the addition of 1.8 mm Ca2+. These results provide direct evidence that Zn2+ can carry currents through Ca-A/K channels, and that there is little interference between Ca2+ and Zn2+ in permeating these channels. PMID:12181280
de Souza Silva, Maria A; Huston, Joseph P; Wang, An-Li; Petri, David; Chao, Owen Yuan-Hsin
2016-07-01
We asked whether episodic-like memory requires neural mechanisms independent of those that mediate its component memories for "what," "when," and "where," and if neuronal connectivity between the medial prefrontal cortex (mPFC) and the hippocampus (HPC) CA3 subregion is essential for episodic-like memory. Unilateral lesion of the mPFC was combined with unilateral lesion of the CA3 in the ipsi- or contralateral hemispheres in rats. Episodic-like memory was tested using a task, which assesses the integration of memories for "what, where, and when" concomitantly. Tests for novel object recognition (what), object place (where), and temporal order memory (when) were also applied. Bilateral disconnection of the mPFC-CA3 circuit by N-methyl-d-aspartate (NMDA) lesions disrupted episodic-like memory, but left the component memories for object, place, and temporal order, per se, intact. Furthermore, unilateral NMDA lesion of the CA3 plus injection of (6-cyano-7-nitroquinoxaline-2,3-dione) (CNQX) (AMPA/kainate receptor antagonist), but not AP-5 (NMDA receptor antagonist), into the contralateral mPFC also disrupted episodic-like memory, indicating the mPFC AMPA/kainate receptors as critical for this circuit. These results argue for a selective neural system that specifically subserves episodic memory, as it is not critically involved in the control of its component memories for object, place, and time. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Pressey, Jessica C; Mahadevan, Vivek; Khademullah, C Sahara; Dargaei, Zahra; Chevrier, Jonah; Ye, Wenqing; Huang, Michelle; Chauhan, Alamjeet K; Meas, Steven J; Uvarov, Pavel; Airaksinen, Matti S; Woodin, Melanie A
2017-04-14
Synaptic inhibition depends on a transmembrane gradient of chloride, which is set by the neuron-specific K + -Cl - co-transporter KCC2. Reduced KCC2 levels in the neuronal membrane contribute to the generation of epilepsy, neuropathic pain, and autism spectrum disorders; thus, it is important to characterize the mechanisms regulating KCC2 expression. In the present study, we determined the role of KCC2-protein interactions in regulating total and surface membrane KCC2 expression. Using quantitative immunofluorescence in cultured mouse hippocampal neurons, we discovered that the kainate receptor subunit GluK2 and the auxiliary subunit Neto2 significantly increase the total KCC2 abundance in neurons but that GluK2 exclusively increases the abundance of KCC2 in the surface membrane. Using a live cell imaging assay, we further determined that KCC2 recycling primarily occurs within 1-2 h and that GluK2 produces an ∼40% increase in the amount of KCC2 recycled to the membrane during this time period. This GluK2-mediated increase in surface recycling translated to a significant increase in KCC2 expression in the surface membrane. Moreover, we found that KCC2 recycling is enhanced by protein kinase C-mediated phosphorylation of the GluK2 C-terminal residues Ser-846 and Ser-868. Lastly, using gramicidin-perforated patch clamp recordings, we found that the GluK2-mediated increase in KCC2 recycling to the surface membrane translates to a hyperpolarization of the reversal potential for GABA (E GABA ). In conclusion, our results have revealed a mechanism by which kainate receptors regulate KCC2 expression in the hippocampus. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael
2008-10-01
Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.
Modulation of ionotropic glutamate receptor function by vertebrate galectins.
Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T
2014-05-15
AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.
Atanasova, Dimitrinka; Tchekalarova, Jana; Ivanova, Natasha; Nenchovska, Zlatina; Pavlova, Ekaterina; Atanassova, Nina; Lazarov, Nikolai
2018-01-15
Experimental and clinical studies have demonstrated that components of renin-angiotensin system are elevated in the hippocampus in epileptogenic conditions. In the present work, we explored the changes in the expression of angiotensin II receptor, type 1 (AT 1 receptor) in limbic structures, as well as the effect of the AT1 receptor antagonist losartan in a model of comorbid hypertension and epilepsy. The expression of AT 1 receptors was compared between spontaneously hypertensive rats (SHRs) and Wistar rats by using immunohistochemistry in the kainate (KA) model of temporal lobe epilepsy (TLE). The effect of losartan was studied on AT 1 receptor expression in epileptic rats that were treated for a period of 4weeks after status epilepticus. The naive and epileptic SHRs were characterized by stronger protein expression of AT 1 receptor than normotensive Wistar rats in the CA1, CA3a, CA3b, CA3c field and the hilus of the dentate gyrus of the dorsal hippocampus but fewer cells were immunostained in the piriform cortex. Increased AT 1 immunostaining was observed in the basolateral amygdala of epileptic SHRs but not of epileptic Wistar rats. Losartan exerted stronger and structure-dependent suppression of AT 1 receptor expression in SHRs compared to Wistar rats. Our results confirm the important role of AT 1 receptor in epilepsy and suggest that the AT 1 receptor antagonists could be used as a therapeutic strategy for treatment of comorbid hypertension and epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Raman, I M; Trussell, L O
1995-01-01
We have examined the mechanisms underlying the voltage sensitivity of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors in voltage-clamped outside-out patches and whole cells taken from the nucleus magnocellularis of the chick. Responses to either glutamate or kainate had outwardly rectifying current-voltage relations. The rate and extent of desensitization during prolonged exposure to agonist, and the rate of deactivation after brief exposure to agonist, decreased at positive potentials, suggesting that a kinetic transition was sensitive to membrane potential. Voltage dependence of the peak conductance and of the deactivation kinetics persisted when desensitization was reduced with aniracetam or blocked with cyclothiazide. Furthermore, the rate of recovery from desensitization to glutamate was not voltage dependent. Upon reduction of extracellular divalent cation concentration, kainate-evoked currents increased but preserved rectifying current-voltage relations. Rectification was strongest at lower kainate concentrations. Surprisingly, nonstationary variance analysis of desensitizing responses to glutamate or of the current deactivation after kainate removal revealed an increase in the mean single-channel conductance with more positive membrane potentials. These data indicate that the rectification of the peak response to a high agonist concentration reflects an increase in channel conductance, whereas rectification of steady-state current is dominated by voltage-sensitive channel kinetics. Images FIGURE 2 FIGURE 3 PMID:8580330
Tabor, Rico; Friedrich, Rainer W.
2008-01-01
Although synaptic functions of ionotropic glutamate receptors in the olfactory bulb have been studied in vitro, their roles in pattern processing in the intact system remain controversial. We therefore examined the functions of ionotropic glutamate receptors during odor processing in the intact olfactory bulb of zebrafish using pharmacological manipulations. Odor responses of mitral cells and interneurons were recorded by electrophysiology and 2-photon Ca2+ imaging. The combined blockade of AMPA/kainate and NMDA receptors abolished odor-evoked excitation of mitral cells. The blockade of AMPA/kainate receptors alone, in contrast, increased the mean response of mitral cells and decreased the mean response of interneurons. The blockade of NMDA receptors caused little or no change in the mean responses of mitral cells and interneurons. However, antagonists of both receptor types had diverse effects on the magnitude and time course of individual mitral cell and interneuron responses and, thus, changed spatio-temporal activity patterns across neuronal populations. Oscillatory synchronization was abolished or reduced by AMPA/kainate and NMDA receptor antagonists, respectively. These results indicate that (1) interneuron responses depend mainly on AMPA/kainate receptor input during an odor response, (2) interactions among mitral cells and interneurons regulate the total olfactory bulb output activity, (3) AMPA/kainate receptors participate in the synchronization of odor-dependent neuronal ensembles, and (4) ionotropic glutamate receptor-containing synaptic circuits shape odor-specific patterns of olfactory bulb output activity. These mechanisms are likely to be important for the processing of odor-encoding activity patterns in the olfactory bulb. PMID:18183297
High Concentrations of Tranexamic Acid Inhibit Ionotropic Glutamate Receptors.
Lecker, Irene; Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Mazer, C David; Orser, Beverley A
2017-07-01
The antifibrinolytic drug tranexamic acid is structurally similar to the amino acid glycine and may cause seizures and myoclonus by acting as a competitive antagonist of glycine receptors. Glycine is an obligatory co-agonist of the N-methyl-D-aspartate (NMDA) subtype of glutamate receptors. Thus, it is plausible that tranexamic acid inhibits NMDA receptors by acting as a competitive antagonist at the glycine binding site. The aim of this study was to determine whether tranexamic acid inhibits NMDA receptors, as well as α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate subtypes of ionotropic glutamate receptors. Tranexamic acid modulation of NMDA, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and kainate receptors was studied using whole cell voltage-clamp recordings of current from cultured mouse hippocampal neurons. Tranexamic acid rapidly and reversibly inhibited NMDA receptors (half maximal inhibitory concentration = 241 ± 45 mM, mean ± SD; 95% CI, 200 to 281; n = 5) and shifted the glycine concentration-response curve for NMDA-evoked current to the right. Tranexamic acid also inhibited α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (half maximal inhibitory concentration = 231 ± 91 mM; 95% CI, 148 to 314; n = 5 to 6) and kainate receptors (half maximal inhibitory concentration = 90 ± 24 mM; 95% CI, 68 to 112; n = 5). Tranexamic acid inhibits NMDA receptors likely by reducing the binding of the co-agonist glycine and also inhibits α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate receptors. Receptor blockade occurs at high millimolar concentrations of tranexamic acid, similar to the concentrations that occur after topical application to peripheral tissues. Glutamate receptors in tissues including bone, heart, and nerves play various physiologic roles, and tranexamic acid inhibition of these receptors may contribute to adverse drug effects.
Shen, Wen; Slaughter, Malcolm M
1998-01-01
Glutamate suppressed high-voltage-activated barium currents (IBa,HVA) in tiger salamander retinal ganglion cells. Both ionotropic (iGluR) and metabotropic (mGluR) receptors contributed to this calcium channel inhibition. Trans-ACPD (1-aminocyclopentane-trans-1S,3R-dicarboxylic acid), a broad-spectrum metabotropic glutamate receptor agonist, suppressed a dihydropyridine-sensitive barium current. Kainate, an ionotropic glutamate receptor agonist, reduced an ω-conotoxin GVIA-sensitive current. The relative effectiveness of selective agonists indicated that the predominant metabotropic receptor was the L-2-amino-4-phosphonobutyrate (l-AP4)-sensitive, group III receptor. This receptor reversed the action of forskolin, but this was not responsible for calcium channel suppression. l-AP4 raised internal calcium concentration. Antagonists of phospholipase C, inositol trisphosphate (IP3) receptors and ryanodine receptors inhibited the action of metabotropic agonists, indicating that group III receptor transduction was linked to this pathway. The action of kainate was partially suppressed by BAPTA, by calmodulin antagonists and by blockers of calmodulin-dependent phosphatase. Suppression by kainate of the calcium channel current was more rapid when calcium was the charge carrier, instead of barium. The results indicate that calcium influx through kainate-sensitive glutamate receptors can activate calmodulin, which stimulates phosphatases that may directly suppress voltage-sensitive calcium channels. Thus, ionotropic and metabotropic glutamate receptors inhibit distinct calcium channels. They could act synergistically, since both increase internal calcium. These pathways provide negative feedback that can reduce calcium influx when ganglion cells are depolarized. PMID:9660896
Kainate-induced network activity in the anterior cingulate cortex.
Shinozaki, R; Hojo, Y; Mukai, H; Hashizume, M; Murakoshi, T
2016-06-14
Anterior cingulate cortex (ACC) plays a pivotal role in higher order processing of cognition, attention and emotion. The network oscillation is considered an essential means for integration of these CNS functions. The oscillation power and coherence among related areas are often dis-regulated in several psychiatric and pathological conditions with a hemispheric asymmetric manner. Here we describe the network-based activity of field potentials recorded from the superficial layer of the mouse ACC in vitro using submerged type recordings. A short activation by kainic acid administration to the preparation induced populational activities ranging over several frequency bands including theta (3-8Hz), alpha (8-12Hz), beta (13-30Hz), low gamma (30-50Hz) and high gamma (50-80Hz). These responses were repeatable and totally abolished by tetrodotoxin, and greatly diminished by inhibitors of ionotropic and metabotropic glutamate receptors, GABAA receptor or gap-junctions. These observations suggest that the kainate-induced network activity can be a useful model of the network oscillation in the ACC circuit. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Shin, Eun-Joo; Nah, Seung-Yeol; Kim, Won-Ki; Ko, Kwang Ho; Jhoo, Wang-Kee; Lim, Yong-Kwang; Cha, Joo Young; Chen, Chieh-Fu; Kim, Hyoung-Chun
2005-01-01
In a previous study, we demonstrated that a dextromethorphan analog, dimemorfan, has neuroprotective effects. Dextromethorphan and dimemorfan are high-affinity ligands at σ1 receptors. Dextromethorphan has moderate affinities for phencyclidine sites, while dimemorfan has very low affinities for such sites, suggesting that these sites are not essential for the anticonvulsant actions of dimemorfan. Kainate (KA) administration (10 mg kg−1, i.p.) produced robust convulsions lasting 4–6 h in rats. Pre-treatment with dimemorfan (12 or 24 mg kg−1) reduced seizures in a dose-dependent manner. Dimemorfan pre-treatment also attenuated the KA-induced increases in c-fos/c-jun expression, activator protein (AP)-1 DNA-binding activity, and loss of cells in the CA1 and CA3 fields of the hippocampus. These effects of dimemorfan were comparable to those of dextromethorphan. The anticonvulsant action of dextromethorphan or dimemorfan was significantly counteracted by a selective σ1 receptor antagonist BD 1047, suggesting that the anticonvulsant action of dextromethorphan or dimemorfan is, at least in part, related to σ1 receptor-activated modulation of AP-1 transcription factors. We asked whether dimemorfan produces the behavioral side effects seen with dextromethorphan or dextrorphan (a phencyclidine-like metabolite of dextromethorphan). Conditioned place preference and circling behaviors were significantly increased in mice treated with phencyclidine, dextrorphan or dextromethorphan, while mice treated with dimemorfan showed no behavioral side effects. Our results suggest that dimemorfan is equipotent to dextromethorphan in preventing KA-induced seizures, while it may lack behavioral effects, such as psychotomimetic reactions. PMID:15723099
Walls, Anne B; Eyjolfsson, Elvar M; Schousboe, Arne; Sonnewald, Ursula; Waagepetersen, Helle S
2014-08-01
Despite the well-established use of kainate as a model for seizure activity and temporal lobe epilepsy, most studies have been performed at doses giving rise to general limbic seizures and have mainly focused on neuronal function. Little is known about the effect of lower doses of kainate on cerebral metabolism and particularly that associated with astrocytes. We investigated astrocytic and neuronal metabolism in the cerebral cortex of adult mice after treatment with saline (controls), a subconvulsive or a mildly convulsive dose of kainate. A combination of [1,2-(13)C]acetate and [1-(13)C]glucose was injected and subsequent nuclear magnetic resonance spectroscopy of cortical extracts was employed to distinctively map astrocytic and neuronal metabolism. The subconvulsive dose of kainate led to an instantaneous increase in the cortical lactate content, a subsequent reduction in the amount of [4,5-(13)C]glutamine and an increase in the calculated astrocytic TCA cycle activity. In contrast, the convulsive dose led to decrements in the cortical content and (13)C labeling of glutamate, glutamine, GABA, and aspartate. Evidence is provided that astrocytic metabolism is affected by a subconvulsive dose of kainate, whereas a higher dose is required to affect neuronal metabolism. The cerebral glycogen content was dose-dependently reduced by kainate supporting a role for glycogen during seizure activity.
Walls, Anne B; Eyjolfsson, Elvar M; Schousboe, Arne; Sonnewald, Ursula; Waagepetersen, Helle S
2014-01-01
Despite the well-established use of kainate as a model for seizure activity and temporal lobe epilepsy, most studies have been performed at doses giving rise to general limbic seizures and have mainly focused on neuronal function. Little is known about the effect of lower doses of kainate on cerebral metabolism and particularly that associated with astrocytes. We investigated astrocytic and neuronal metabolism in the cerebral cortex of adult mice after treatment with saline (controls), a subconvulsive or a mildly convulsive dose of kainate. A combination of [1,2-13C]acetate and [1-13C]glucose was injected and subsequent nuclear magnetic resonance spectroscopy of cortical extracts was employed to distinctively map astrocytic and neuronal metabolism. The subconvulsive dose of kainate led to an instantaneous increase in the cortical lactate content, a subsequent reduction in the amount of [4,5-13C]glutamine and an increase in the calculated astrocytic TCA cycle activity. In contrast, the convulsive dose led to decrements in the cortical content and 13C labeling of glutamate, glutamine, GABA, and aspartate. Evidence is provided that astrocytic metabolism is affected by a subconvulsive dose of kainate, whereas a higher dose is required to affect neuronal metabolism. The cerebral glycogen content was dose-dependently reduced by kainate supporting a role for glycogen during seizure activity. PMID:24824917
Soós, Vilmos; Sebestyén, Endre; Juhász, Angéla; Light, Marnie E; Kohout, Ladislav; Szalai, Gabriella; Tandori, Júlia; Van Staden, Johannes; Balázs, Ervin
2010-11-02
Smoke released from burning vegetation functions as an important environmental signal promoting the germination of many plant species following a fire. It not only promotes the germination of species from fire-prone habitats, but several species from non-fire-prone areas also respond, including some crops. The germination stimulatory activity can largely be attributed to the presence of a highly active butenolide compound, 3-methyl-2H-furo[2,3-c]pyran-2-one (referred to as karrikin 1 or KAR1), that has previously been isolated from plant-derived smoke. Several hypotheses have arisen regarding the molecular background of smoke and KAR1 action. In this paper we demonstrate that although smoke-water and KAR1 treatment of maize kernels result in a similar physiological response, the gene expression and the protein ubiquitination patterns are quite different. Treatment with smoke-water enhanced the ubiquitination of proteins and activated protein-degradation-related genes. This effect was completely absent from KAR1-treated kernels, in which a specific aquaporin gene was distinctly upregulated. Our findings indicate that the array of bioactive compounds present in smoke-water form an environmental signal that may act together in germination stimulation. It is highly possible that the smoke/KAR1 'signal' is perceived by a receptor that is shared with the signal transduction system implied in perceiving environmental cues (especially stresses and light), or some kind of specialized receptor exists in fire-prone plant species which diverged from a more general one present in a common ancestor, and also found in non fire-prone plants allowing for a somewhat weaker but still significant response. Besides their obvious use in agricultural practices, smoke and KAR1 can be used in studies to gain further insight into the transcriptional changes during germination.
2010-01-01
Background Smoke released from burning vegetation functions as an important environmental signal promoting the germination of many plant species following a fire. It not only promotes the germination of species from fire-prone habitats, but several species from non-fire-prone areas also respond, including some crops. The germination stimulatory activity can largely be attributed to the presence of a highly active butenolide compound, 3-methyl-2H-furo[2,3-c]pyran-2-one (referred to as karrikin 1 or KAR1), that has previously been isolated from plant-derived smoke. Several hypotheses have arisen regarding the molecular background of smoke and KAR1 action. Results In this paper we demonstrate that although smoke-water and KAR1 treatment of maize kernels result in a similar physiological response, the gene expression and the protein ubiquitination patterns are quite different. Treatment with smoke-water enhanced the ubiquitination of proteins and activated protein-degradation-related genes. This effect was completely absent from KAR1-treated kernels, in which a specific aquaporin gene was distinctly upregulated. Conclusions Our findings indicate that the array of bioactive compounds present in smoke-water form an environmental signal that may act together in germination stimulation. It is highly possible that the smoke/KAR1 'signal' is perceived by a receptor that is shared with the signal transduction system implied in perceiving environmental cues (especially stresses and light), or some kind of specialized receptor exists in fire-prone plant species which diverged from a more general one present in a common ancestor, and also found in non fire-prone plants allowing for a somewhat weaker but still significant response. Besides their obvious use in agricultural practices, smoke and KAR1 can be used in studies to gain further insight into the transcriptional changes during germination. PMID:21044315
Rogers, Jason V; Rose, Mark D
2014-12-02
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide-sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p's functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. Copyright © 2015 Rogers and Rose.
Rogers, Jason V.; Rose, Mark D.
2014-01-01
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide–sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p’s functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. PMID:25467943
Emerging structural insights into the function of ionotropic glutamate receptors
Karakas, Erkan; Regan, Michael C.; Furukawa, Hiro
2015-01-01
Summary Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function including learning and memory formation. Recently a wealth of structural studies on iGluRs, including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available.. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, which illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. Here we review mechanistic insights into iGluR functions gained through structural studies of multiple groups. PMID:25941168
Emerging structural insights into the function of ionotropic glutamate receptors.
Karakas, Erkan; Regan, Michael C; Furukawa, Hiro
2015-06-01
Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function, including learning and memory formation. Recently a wealth of structural studies on iGluRs including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, and this illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. We review mechanistic insights into iGluR functions gained through structural studies of multiple groups. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nguyen, Quoc-Thang; Matute, Carlos; Miledi, Ricardo
1998-01-01
It has been postulated that, in the adult visual cortex, visual inputs modulate levels of mRNAs coding for neurotransmitter receptors in an activity-dependent manner. To investigate this possibility, we performed a monocular enucleation in adult rabbits and, 15 days later, collected their left and right visual cortices. Levels of mRNAs coding for voltage-activated sodium channels, and for receptors for kainate/α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA), N-methyl-d-aspartate (NMDA), γ-aminobutyric acid (GABA), and glycine were semiquantitatively estimated in the visual cortices ipsilateral and contralateral to the lesion by the Xenopus oocyte/voltage-clamp expression system. This technique also allowed us to study some of the pharmacological and physiological properties of the channels and receptors expressed in the oocytes. In cells injected with mRNA from left or right cortices of monocularly enucleated and control animals, the amplitudes of currents elicited by kainate or AMPA, which reflect the abundance of mRNAs coding for kainate and AMPA receptors, were similar. There was no difference in the sensitivity to kainate and in the voltage dependence of the kainate response. Responses mediated by NMDA, GABA, and glycine were unaffected by monocular enucleation. Sodium channel peak currents, activation, steady-state inactivation, and sensitivity to tetrodotoxin also remained unchanged after the enucleation. Our data show that mRNAs for major neurotransmitter receptors and ion channels in the adult rabbit visual cortex are not obviously modified by monocular deafferentiation. Thus, our results do not support the idea of a widespread dynamic modulation of mRNAs coding for receptors and ion channels by visual activity in the rabbit visual system. PMID:9501250
Novel Functional Properties of Drosophila CNS Glutamate Receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yan; Dharkar, Poorva; Han, Tae-Hee
Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation bymore » its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation.« less
Novel Functional Properties of Drosophila CNS Glutamate Receptors.
Li, Yan; Dharkar, Poorva; Han, Tae-Hee; Serpe, Mihaela; Lee, Chi-Hon; Mayer, Mark L
2016-12-07
Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation by its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation. VIDEO ABSTRACT. Published by Elsevier Inc.
Shen, Y; Lu, T; Yang, X L
1999-03-01
In horizontal cells freshly dissociated from crucian carp (Carassius auratus) retina, we examined the effects of modulators of glutamate receptor desensitization, concanavalin A, cyclothiazide, aniracetam and 4-[2-(phenylsulfonylamino)ethylthio]-2,6-difluoro-phenoxyacetam ide (PEPA), on responses to rapid application of glutamate and kainate, using whole-cell voltage-clamp techniques. Incubation of concanavalin A suppressed the peak response but weakly potentiated the equilibrium response of horizontal cells to glutamate. Cyclothiazide blocked glutamate-induced desensitization in a dose-dependent manner, which resulted in a steady increase of the equilibrium current. The concentration of cyclothiazide causing a half-maximal potentiation for the equilibrium response was 85 microM. Furthermore, cyclothiazide shifted the dose-response relationship of the equilibrium current to the right, but slightly suppressed the kainate-induced sustained current. These effects of concanavalin A and cyclothiazide are consistent with the supposition that glutamate receptors of carp horizontal cells may be an alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)-preferring subtype. In order to further characterize the AMPA receptors of horizontal cells, modulation by aniracetam and PEPA of glutamate- and kainate-induced currents was studied. Aniracetam, a preferential modulator of flop variants of AMPA receptors, considerably blocked desensitization of glutamate-induced currents, but only slightly potentiated kainate-induced currents. It was further found that PEPA, a flop-preferring allosteric modulator of AMPA receptor desensitization, slightly suppressed the peak current, while it dramatically potentiated the equilibrium current induced by glutamate in a dose-dependent manner. PEPA was much potent than aniracetam at these receptors and showed the effect on glutamate-induced desensitization even at a concentration as low as 3 microM. PEPA also potentiated non
Glutamate receptor activation in the kindled dentate gyrus.
Behr, J; Heinemann, U; Mody, I
2000-01-01
The contribution of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), N-methyl-D-aspartate (NMDA), and kainate receptor activation to the enhanced seizure susceptibility of the dentate gyrus was investigated in an experimental model of temporal lobe epilepsy. Using the specific NMDA and AMPA receptor antagonists D-APV and SYM 2206, we examined alterations in glutamate receptor-dependent synaptic currents 48 hours and 28 days after kindling in field-potential and voltage-clamp recordings. Forty-eight hours after kindling, the fractions of AMPA and NMDA receptor-mediated excitatory postsynaptic current components shifted dramatically in favor of the NMDA receptor-mediated response. Four weeks after kindling, however, AMPA and NMDA receptor-mediated excitatory postsynaptic currents reverted to control-like values. Neither single nor repetitive perforant path stimuli evoked kainate receptor-mediated excitatory postsynaptic currents in dentate gyrus granule cells of control or kindled rats. The enhanced excitability of the kindled dentate gyrus 48 hours after the last seizure most likely results from transiently enhanced NMDA receptor activation. The NMDA receptor seems to play a critical role in the induction of the kindled state rather than in the persistence of the enhanced seizure susceptibility.
Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.
2009-01-01
Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803
Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes
Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...
2015-10-12
Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less
The Role of GluK4 in Synaptic Plasticity and Affective Behavior in Mice
NASA Astrophysics Data System (ADS)
Catches, Justin Samuel
Kainate receptors (KARs) are glutamate-gated ion channels that signal through both ionotropic and metabotropic pathways (Contractor et al., 2011). Combinations of five KAR subunits (GluK1-5) form tetrameric receptors with GluK1, GluK2, and GluK3 able to form functional homomeric channels. The high-affinity subunits, GluK4 and GluK5, do not form homomeric channels but modify the properties of heteromeric receptors. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs modulate synaptic plasticity. In this study, ablation of Grik4, which encodes GluK4, in mice reduced KAR synaptic currents and altered activation properties of postsynaptic receptors but left two forms of presynaptic short-term plasticity intact. Disruption of both Grik4 and Grik5 caused complete loss of the postsynaptic ionotropic KAR current and impaired presynaptic frequency facilitation. Additionally, KAR surface expression was altered at pre- and postsynaptic sites at the MF synapse. Despite the loss of ionotropic signaling, KAR-mediated inhibition of the slow afterhyperpolarization current, which is dependent on metabotropic signaling, was intact in CA3 neurons. Long-term potentiation at the MF-CA3 synapse was reduced, likely through a loss of KAR modulation of excitability of the presynaptic MF axons. Genetic variants in the human GRIK4 gene alter the susceptibility for affective disorders (Bloss and Hunter, 2010). We found that ablation of Grik4 in mice resulted in reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, and in two anxiogenic tests, marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim, a test of learned helplessness used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting
Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.
Tsuzuki, K; Takeuchi, T; Ozawa, S
1992-11-01
GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.
AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina
FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.
2012-01-01
The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241
The N-terminal domain of GluR6-subtype glutamate receptor ion channels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Janesh; Schuck, Peter; Jin, Rongsheng
2009-09-25
The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less
Kiasalari, Zahra; Khalili, Mohsen; Shafiee, Samaneh; Roghani, Mehrdad
2016-01-01
Since temporal lobe epilepsy (TLE) is associated with learning and memory impairment, we investigated the beneficial effect of Vitamin E on the impaired learning and memory in the intrahippocampal kainate model of TLE in rats. Rats were divided into sham, Vitamin E-treated sham, kainate, and Vitamin E-treated kainate. Intrahippocampal kainate was used for induction of epilepsy. Vitamin E was injected intraperitoneal (i.p.) at a dose of 200 mg/kg/day started 1 week before surgery until 1 h presurgery. Initial and step-through latencies in the passive avoidance test and alternation behavior percentage in Y-maze were finally determined in addition to measurement of some oxidative stress markers. Kainate injection caused a higher severity and rate of seizures and deteriorated learning and memory performance in passive avoidance paradigm and spontaneous alternation as an index of spatial recognition memory in Y-maze task. Intrahippocampal kainate also led to the elevation of malondialdehyde (MDA) and nitrite and reduced activity of superoxide dismutase (SOD). Vitamin E pretreatment significantly attenuated severity and incidence rate of seizures, significantly improved retrieval and recall in passive avoidance, did not ameliorate spatial memory deficit in Y-maze, and lowered MDA and enhanced SOD activity. Vitamin E improves passive avoidance learning and memory and part of its beneficial effect is due to its potential to mitigate hippocampal oxidative stress.
Bhandage, Amol K; Jin, Zhe; Hellgren, Charlotte; Korol, Sergiy V; Nowak, Krzysztof; Williamsson, Louise; Sundström-Poromaa, Inger; Birnir, Bryndis
2017-04-15
The amino acid glutamate opens cation permeable ion channels, the iGlu receptors. These ion channels are abundantly expressed in the mammalian brain where glutamate is the main excitatory neurotransmitter. The neurotransmitters and their receptors are being increasingly detected in the cells of immune system. Here we examined the expression of the 18 known subunits of the iGlu receptors families; α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), kainate, N-methyl-d-aspartate (NMDA) and delta in human peripheral blood mononuclear cells (PBMCs). We compared the expression of the subunits between four groups: men, non-pregnant women, healthy pregnant women and depressed pregnant women. Out of 18 subunits of the iGlu receptors, mRNAs for 11 subunits were detected in PBMCs from men and non-pregnant women; AMPA: GluA3, GluA4, kainate: GluK2, GluK4, GluK5, NMDA: GluN1, GluN2C, GluN2D, GluN3A, GluN3B, and delta: GluD1. In the healthy and the depressed pregnant women, in addition, the delta GluD2 subunit was identified. The mRNAs for GluK4, GluK5, GluN2C and GluN2D were expressed at a higher level than other subunits. Gender, pregnancy or depression during pregnancy altered the expression of GluA3, GluK4, GluN2D, GluN3B and GluD1 iGlu subunit mRNAs. The greatest changes recorded were the lower GluA3 and GluK4 mRNA levels in pregnant women and the higher GluN2D mRNA level in healthy but not in depressed pregnant women as compared to non-pregnant individuals. Using subunit specific antibodies, the GluK4, GluK5, GluN1, GluN2C and GluN2D subunit proteins were identified in the PBMCs. The results show expression of specific iGlu receptor subunit in the PBMCs and support the idea of physiology-driven changes of iGlu receptors subtypes in the immune cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley
2006-01-01
Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965
Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley
2006-11-15
Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.
Blatt, G J; Fitzgerald, C M; Guptill, J T; Booker, A B; Kemper, T L; Bauman, M L
2001-12-01
Neuropathological studies in autistic brains have shown small neuronal size and increased cell packing density in a variety of limbic system structures including the hippocampus, a change consistent with curtailment of normal development. Based on these observations in the hippocampus, a series of quantitative receptor autoradiographic studies were undertaken to determine the density and distribution of eight types of neurotransmitter receptors from four neurotransmitter systems (GABAergic, serotoninergic [5-HT], cholinergic, and glutamatergic). Data from these single concentration ligand binding studies indicate that the GABAergic receptor system (3[H]-flunitrazepam labeled benzodiazepine binding sites and 3[H]-muscimol labeled GABA(A) receptors) is significantly reduced in high binding regions, marking for the first time an abnormality in the GABA system in autism. In contrast, the density and distribution of the other six receptors studied (3[H]-80H-DPAT labeled 5-HT1A receptors, 3[H]-ketanserin labeled 5-HT2 receptors, 3[H]-pirenzepine labled M1 receptors, 3[H]-hemicholinium labeled high affinity choline uptake sites, 3[H]-MK801 labeled NMDA receptors, and 3[H]-kainate labeled kainate receptors) in the hippocampus did not demonstrate any statistically significant differences in binding.
How glutamate receptor subunits mix and match: details uncovered.
Hansen, Kasper B; Traynelis, Stephen F
2011-07-28
Until now, the atomic details explaining why certain subunits prefer to coassemble has been lacking in our understanding of glutamate receptor biogenesis. In this issue, Kumar et al. describe the structural basis by which preferential subunit assembly occurs for homomeric and heteromeric kainate-type glutamate receptors. Copyright © 2011 Elsevier Inc. All rights reserved.
K/Ar dating of lunar soils. II
NASA Technical Reports Server (NTRS)
Alexander, E. C., Jr.; Bates, A.; Coscio, M. R., Jr.; Dragon, J. C.; Murthy, V. R.; Pepin, R. O.; Venkatesan, T. R.
1976-01-01
An attempt is made to identify those K/Ar techniques which extract the most reliable chronological information from lunar soils and to define the situations in which the best data are obtainable. Results are presented for determinations of the exposure and K/Ar ages of five lunar soil samples, which were performed by applying correlation techniques for a two-component argon structure to stepwise-heated and neutron-irradiated aliquots of grain-sized separates. It is found that ages deduced from Ar-40/surface-correlated Ar-36 vs K-40/surface-correlated Ar-36 and analogous plots of data from grain-sized separates appear to be the best available K/Ar ages of submature to mature lunar soils, that ages deduced from Ar-40 vs Ar-36 and analogous plots which assume a uniform K content can be significantly in error, and that stepwise-heating (Ar-40)-(Ar-39) experiments yield useful information only for simple immature soils where the K-Ar systematics are dominated by a single component.
Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J
2015-01-01
Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267
Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris
2002-09-01
GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the
Núñez-Acuña, Gustavo; Valenzuela-Muñoz, Valentina; Marambio, Jorge Pino; Wadsworth, Simon; Gallardo-Escárate, Cristian
2014-10-01
Although various elements of the olfactory system have been elucidated in insects, it remains practically unstudied in crustaceans at a molecular level. Among crustaceans, some species are classified as ectoparasites that impact the finfish aquaculture industry. Thus, there is an urgent need to identify and comprehend the signaling pathways used by these in host recognition. The present study, through RNA-seq and qPCR analyses, found novel transcripts involved in the olfactory system of Caligus rogercresseyi, in addition to the transcriptomic patterns expressed during different stages of salmon lice development. From a transcriptomic library generated by Illumina sequencing, contigs that annotated for ionotropic receptors and other genes implicated in the olfactory system were identified and extracted. Full length mRNA was obtained for the ionotropic glutamate receptor 25, which had 3923 bp, and for the glutamate receptor ionotropic kainate 2, which had 2737 bp. Furthermore, two other transcripts identified as glutamate receptor, ionotropic kainate 2-like were found. In silico analysis was performed for the transcription expression from different stages of development in C. rogercresseyi, and clusters according to RPKM values were constructed. Gene transcription data were validated through qPCR assays in ionotropic receptors, and showed an expression of glutamate receptor 25 associated with the copepodid stage whereas adults, especially male adults, were associated with the kainate 2 and kainate 2-like transcripts. Additionally, gene transcription analysis of the ionotropic receptors showed an overexpression in response to the presence of masking compounds and immunostimulant in salmon diets. This response correlated to a reduction in sea lice infection following in vivo challenge. Diets with masking compounds showed a decrease of lice infestation of up to 25%. This work contributes to the available knowledge on chemosensory systems in this ectoparasite, providing
Borbély, Sándor; Jócsák, Gergely; Moldován, Kinga; Sedlák, Éva; Preininger, Éva; Boldizsár, Imre; Tóth, Attila; Atlason, Palmi T; Molnár, Elek; Világi, Ildikó
2016-07-01
Lignans are biologically active phenolic compounds related to lignin, produced in different plants. Arctigenin, a dibenzylbutyrolactone-type lignan, has been used as a neuroprotective agent for the treatment of encephalitis. Previous studies of cultured rat cerebral cortical neurones raised the possibility that arctigenin inhibits kainate-induced excitotoxicity. The aims of the present study were: 1) to analyse the effect of arctigenin on normal synaptic activity in ex vivo brain slices, 2) to determine its receptor binding properties and test the effect of arctigenin on AMPA/kainate receptor activation and 3) to establish its effects on neuronal activity in vivo. Arctigenin inhibited glutamatergic transmission and reduced the evoked field responses. The inhibitory effect of arctigenin on the evoked field responses proved to be substantially dose dependent. Our results indicate that arctigenin exerts its effects under physiological conditions and not only on hyper-excited neurons. Furthermore, arctigenin can cross the blood-brain barrier and in the brain it interacts with kainate sensitive ionotropic glutamate receptors. These results indicate that arctigenin is a potentially useful new pharmacological tool for the inhibition of glutamate-evoked responses in the central nervous system in vivo. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hellier, J L; Patrylo, P R; Buckmaster, P S; Dudek, F E
1998-06-01
Human temporal lobe epilepsy is associated with complex partial seizures that can produce secondarily generalized seizures and motor convulsions. In some patients with temporal lobe epilepsy, the seizures and convulsions occur following a latent period after an initial injury and may progressively increase in frequency for much of the patient's life. Available animal models of temporal lobe epilepsy are produced by acute treatments that often have high mortality rates and/or are associated with a low proportion of animals developing spontaneous chronic motor seizures. In this study, rats were given multiple low-dose intraperitoneal (i.p.) injections of kainate in order to minimize the mortality rate usually associated with single high-dose injections. We tested the hypothesis that these kainate-treated rats consistently develop a chronic epileptic state (i.e. long-term occurrence of spontaneous, generalized seizures and motor convulsions) following a latent period after the initial treatment. Kainate (5 mg/kg per h, i.p.) was administered to rats every hour for several hours so that class III-V seizures were elicited for > or = 3 h, while control rats were treated similarly with saline. This treatment protocol had a relatively low mortality rate (15%). After acute treatment, rats were observed for the occurrence of motor seizures for 6-8 h/week. Nearly all of the kainate-treated rats (97%) had two or more spontaneous motor seizures months after treatment. With this observation protocol, the average latency for the first spontaneous motor seizure was 77+/-38 (+/-S.D.) days after treatment. Although variability was observed between rats, seizure frequency initially increased with time after treatment, and nearly all of the kainate-treated rats (91%) had spontaneous motor seizures until the time of euthanasia (i.e. 5-22 months after treatment). Therefore, multiple low-dose injections of kainate, which cause recurrent motor seizures for > or = 3 h, lead to the
Motaghinejad, Majid; Motevalian, Manijeh; Fatima, Sulail; Beiranvand, Tabassom; Mozaffari, Shiva
2017-11-01
Chronic abuse of methylphenidate (MPH) often causes neuronal cell death. Topiramate (TPM) carries neuroprotective effects, but its exact mechanism of action remains unclear. In the present study, the role of various doses of TPM and its possible mechanisms, receptors and signaling pathways involved against MPH-induced hippocampal neurodegeneration were evaluated in vivo. Thus, domoic acid (DOM) was used as AMPA/kainate receptor agonist, bicuculline (BIC) as GABA A receptor antagonist, ketamine (KET) as NMDA receptor antagonist, yohimbine (YOH) as α 2 adrenergic receptor antagonist and haloperidol (HAL) was used as dopamine D 2 receptor antagonist. Open field test (OFT) was used to investigate the disturbances in motor activity. Hippocampal neurodegenerative parameters were evaluated. Protein expressions of CREB/BDNF and Akt/GSK3 signaling pathways were also evaluated. Cresyl violet staining was performed to show and confirm the changes in the shape of the cells. TPM (70 and 100 mg/kg) reduced MPH-induced rise in lipid peroxidation, oxidized form of glutathione (GSSG), IL-1β and TNF-α levels, Bax expression and motor activity disturbances. In addition, TPM treatment increased Bcl-2 expression, the level of reduced form of glutathione (GSH) and the levels and activities of superoxide dismutase, glutathione peroxidase and glutathione reductase enzymes. TPM also inhibited MPH-induced hippocampal degeneration. Pretreatment of animals with DOM, BIC, KET and YOH inhibited TPM-induced neuroprotection and increased oxidative stress, neuroinflammation, neuroapoptosis and neurodegeneration while reducing CREB, BDNF and Akt protein expressions. Also pretreatment with DOM, BIC, KET and YOH inhibited TPM-induced decreases in GSK3. It can be concluded that the mentioned receptors by modulation of CREB/BDNF and Akt/GSK3 pathways, are involved in neuroprotection of TPM against MPH-induced neurodegeneration.
Saransaari, P; Oja, S S
1997-12-30
The inhibitory amino acid taurine has been held to function as a modulator and osmoregulator in the brain, being of particular importance in the immature brain. The release of preloaded [3H]taurine was now studied in hippocampal slices from developing (7-day-old), adult (3-month-old) and ageing (6-24-month-old) mice focussing on the effects of agonists of ionotropic glutamate receptors. N-methyl-D-aspartate (NMDA), kainate and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) potentiated taurine release concentration-dependently at each age, more so in the immature than in the adult and ageing hippocampus. The effect of kainate was blocked by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) in the developing and aged hippocampus and those of AMPA and NMDA by 6-nitro-7-sulphamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and dizocilpine a(MK-801) at every age studied. This indicates the involvement of NMDA and AMPA receptors in taurine release throughout the life-span of mice, while the kainate-receptor-mediated release does not appear to function in adults. The increased hippocampal taurine release evoked by ionotropic glutamate receptors could act neuroprotectively, counteracting by several mechanisms the harmful effects of the simultaneous release of excitatory amino acids. The substantial release of taurine in the immature hippocampus might be particularly significant in view of the vulnerability of brain tissue to excitotoxicity at early age.
Nivison-Smith, Lisa; Khoo, Pauline; Acosta, Monica L; Kalloniatis, Michael
2018-02-01
Retinal ischemia is involved in the pathogenesis of many major vision threatening diseases. Vinpocetine is a natural drug, which has a range of neuroprotective actions against retinal ischemia including modulating cation flow, improving metabolic activity and preventing apoptosis. The exact mechanism behind these actions remains unknown but may involve glutamate receptors, major components of the ischemic cascade. This study examined the effects of vinpocetine in association with specific ionotropic glutamate receptor agonists: N-methyl-D-aspartate (NMDA) and kainate. Vinpocetine's actions to improve cation channel permeability and cell marker immunoreactivity following ischemia appeared to be limited to NMDA activation with no changes observed following kainate stimulation. Vinpocetine's actions were lost in the presence of an NMDA receptor inhibitor further suggesting they may be secondary to NMDA receptor activation. NMDA receptor function was also necessary for vinpocetine's actions on glucose availability during ischemia but not lactate dehydrogenase (LDH) activity in the ischemic retina suggesting not all of vinpocetine's actions are linked to NMDA receptor function. These results may explain vinpocetine's effectiveness as a neuroprotective agent as the NMDA receptor is implicated in the pathogenesis of ischemia in a range of tissues of the central nervous system. Copyright © 2017 Elsevier Ltd. All rights reserved.
Osgood, Doreen B; Harrington, William F; Kenney, Elizabeth V; Harrington, J Frederick
2013-01-01
The authors have previously demonstrated that human herniated disc material contains high concentrations of free glutamate. In an experimental model, elevated epidural glutamate concentrations in the lumbar spine can cause a focal hyperesthetic state. Rats underwent epidural glutamate infusion in the lumbar spine by a miniosmotic pump over a 72-hour period. Some rats underwent coinfusion with glutamate and ionotropic glutamate antagonists. Nociception was assessed by von Frey fibers and by assessment of glutamate receptor expression in the corresponding dorsal horn of the spinal cord. The kainic acid antagonist, UBP 301, decreased epidural glutamate-based hyperesthesia in a dose dependent manner. Concordant with these findings, there was significant decrease in kainate receptor expression in the dorsal horn. The N-Methyl-4-isoxazoleproionic acid (NMDA) antagonist Norketamine also significantly diminished hyperesthesia and decreased receptor expression in the dorsal horn. Both UBP 301, the kainic acid receptor antagonist and Norketamine, an NMDA receptor antagonist, dampened epidural glutamate-based nociception. Focal epidural injections of Kainate or NMDA receptor antagonists could be effective treatments for disc herniation-based lumbar radiculopathy.
Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila
Benton, Richard; Vannice, Kirsten S.; Gomez-Diaz, Carolina; Vosshall, Leslie B.
2009-01-01
Summary Ionotropic glutamate receptors (iGluRs) mediate neuronal communication at synapses throughout vertebrate and invertebrate nervous systems. We have characterized a novel family of iGluR-related genes in Drosophila, which we name Ionotropic Receptors (IRs). These receptors do not belong to the well-described Kainate, AMPA, or NMDA classes of iGluRs, and have divergent ligand-binding domains that lack their characteristic glutamate-interacting residues. IRs are expressed in a combinatorial fashion in sensory neurons that respond to many distinct odors but do not express either insect odorant receptors (ORs) or gustatory receptors (GRs). IR proteins accumulate in sensory dendrites and not at synapses. Mis-expression of IRs induces novel odor responses in ectopic neurons. Together, these results lead us to propose that the IRs comprise a novel family of chemosensory receptors. Conservation of IR/iGluR-related proteins in bacteria, plants, and animals suggests that this receptor family represents an evolutionarily ancient mechanism for sensing both internal and external chemical cues. PMID:19135896
Young, Barry P.; Craven, Rachel A.; Reid, Peter J.; Willer, Martin; Stirling, Colin J.
2001-01-01
The translocation of secretory polypeptides into the endoplasmic reticulum (ER) occurs at the translocon, a pore-forming structure that orchestrates the transport and maturation of polypeptides at the ER membrane. In yeast, targeting of secretory precursors to the translocon can occur by two distinct pathways that are distinguished by their dependence upon the signal recognition particle (SRP). The SRP-dependent pathway requires SRP and its membrane-bound receptor, whereas the SRP-independent pathway requires a separate receptor complex consisting of Sec62p, Sec63p, Sec71p, Sec72p plus lumenal Kar2p/BiP. Here we demonstrate that Sec63p and Kar2p are also required for the SRP-dependent targeting pathway in vivo. Furthermore, we demonstrate multiple roles for Sec63p, at least one of which is exclusive to the SRP-independent pathway. PMID:11226176
Dopamine Modulation of Avoidance Behavior in Caenorhabditis elegans Requires the NMDA Receptor NMR-1
Baidya, Melvin; Genovez, Marx; Torres, Marissa; Chao, Michael Y.
2014-01-01
The nematode C. elegans utilizes a relatively simple neural circuit to mediate avoidance responses to noxious stimuli such as the volatile odorant octanol. This avoidance behavior is modulated by dopamine. cat-2 mutant animals that are deficient in dopamine biosynthesis have an increased response latency to octanol compared to wild type animals, and this defect can be fully restored with the application of exogenous dopamine. Because this avoidance behavior is mediated by glutamatergic signaling between sensory neurons and premotor interneurons, we investigated the genetic interactions between dopaminergic signaling and ionotropic glutamate receptors. cat-2 mutant animals lacking either the GLR-1 or GLR-2 AMPA/kainate receptors displayed an increased response latency to octanol, which could be restored via exogenous dopamine. However, whereas cat-2 mutant animals lacking the NMR-1 NMDA receptor had increased response latency to octanol they were insensitive to exogenous dopamine. Mutants that lacked both AMPA/kainate and NMDA receptors were also insensitive to exogenous dopamine. Our results indicate that dopamine modulation of octanol avoidance requires NMR-1, consistent with NMR-1 as a potential downstream signaling target for dopamine. PMID:25089710
Molecular basis of Kar9-Bim1 complex function during mating and spindle positioning
Manatschal, Cristina; Farcas, Ana-Maria; Degen, Miriam Steiner; Bayer, Mathias; Kumar, Anil; Landgraf, Christiane; Volkmer, Rudolf; Barral, Yves; Steinmetz, Michel O.
2016-01-01
The Kar9 pathway promotes nuclear fusion during mating and spindle alignment during metaphase in budding yeast. How Kar9 supports the different outcome of these two divergent processes is an open question. Here, we show that three sites in the C-terminal disordered domain of Kar9 mediate tight Kar9 interaction with the C-terminal dimerization domain of Bim1 (EB1 orthologue). Site1 and Site2 contain SxIP motifs; however, Site3 defines a novel type of EB1-binding site. Whereas Site2 and Site3 mediate Kar9 recruitment to microtubule tips, nuclear movement, and karyogamy, only Site2 functions in spindle positioning during metaphase. Site1 in turn plays an inhibitory role during mating. Additionally, the Kar9-Bim1 complex is involved in microtubule-independent activities during mating. Together, our data reveal how multiple and partially redundant EB1-binding sites provide a microtubule-associated protein with the means to modulate its biochemical properties to promote different molecular processes during cell proliferation and differentiation. PMID:27682587
Rectification properties and Ca2+ permeability of glutamate receptor channels in hippocampal cells.
Lerma, J; Morales, M; Ibarz, J M; Somohano, F
1994-07-01
Excitatory amino acids exert a depolarizing action on central nervous system cells through an increase in cationic conductances. Non-NMDA receptors have been considered to be selectively permeable to Na+ and K+, while Ca2+ influx has been thought to occur through the NMDA receptor subtype. Recently, however, the expression of cloned non-NMDA receptor subunits has shown that alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are permeable to Ca2+ whenever the receptor lacks a particular subunit (edited GluR-B). The behaviour of recombinant glutamate receptor channels predicts that Ca2+ would only permeate through receptors that show strong inward rectification and vice versa, i.e. AMPA receptors with linear current-voltage relationships would be impermeable to Ca2+. Using the whole-cell configuration of the patch-clamp technique, we have studied the Ca2+ permeability and the rectifying properties of AMPA receptors, when activated by kainate, in hippocampal neurons kept in culture or acutely dissociated from differentiated hippocampus. Cells were classified according to whether they showed outward rectifying (type I), inward rectifying (type II) or almost linear (type III) current-voltage relationships for kainate-activated responses. AMPA receptors of type I cells (52.2%) were mostly Ca(2+)-impermeable (PCa/PCs = 0.1), while type II cells (6.5%) expressed Ca(2+)-permeable receptors (PCa/PCs = 0.9). Type III cells (41.3%) showed responses with low but not negligible Ca2+ permeability (PCa/PCs = 0.18). The degree of Ca2+ permeability and inward rectification were well correlated in cultured cells, i.e. more inward rectification corresponded to higher Ca2+ permeability.(ABSTRACT TRUNCATED AT 250 WORDS)
K-Ar dating of young volcanic rocks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Damon, P.E.; Shafiqullah, M.
1991-01-31
Potassium-Argon (K-Ar) age dates were determined for forty-two young geologic samples by the Laboratory of Isotope Geochemistry, Department of Geosciences, in the period February 1, 1986 to June 30, 1989. Under the terms of Department of Energy Grant No. FG07-86ID12622, The University of Arizona was to provide state-of-the-art K-Ar age dating services, including sample preparation, analytical procedures, and computations, for forty-two young geologic samples submitted by DOE geothermal researchers. We billed only for forty samples. Age dates were determined for geologic samples from five regions with geothermal potential: the Cascade Mountains (Oregon); the Cascade Mountains (Washington); Ascension Island, South Atlanticmore » Ocean; Cerro Prieto, Mexico; and Las Azufres, Mexico. The ages determined varied from 5.92 m.a. to 0.62 m.a. The integration of K-Ar dates with geologic data and the interpretation in terms of geologic and geothermal significance has been reported separately by the various DOE geothermal researchers. Table 1 presents a detailed listing of all samples dated, general sample location, researcher, researcher's organization, rock type, age, and probable error (1 standard deviation). Additional details regarding the geologic samples may be obtained from the respective geothermal researcher. 1 tab.« less
Crystal structure of the Candida albicans Kar3 kinesin motor domain fused to maltose-binding protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delorme, Caroline; Joshi, Monika; Allingham, John S., E-mail: allinghj@queensu.ca
2012-11-30
Highlights: Black-Right-Pointing-Pointer The Candida albicans Kar3 motor domain structure was solved as a maltose-binding protein fusion. Black-Right-Pointing-Pointer The electrostatic surface and part of the ATPase pocket of the motor domain differs markedly from other kinesins. Black-Right-Pointing-Pointer The MBP-Kar3 interface highlights a new site for intramolecular or intermolecular interactions. -- Abstract: In the human fungal pathogen Candida albicans, the Kinesin-14 motor protein Kar3 (CaKar3) is critical for normal mitotic division, nuclear fusion during mating, and morphogenic transition from the commensal yeast form to the virulent hyphal form. As a first step towards detailed characterization of this motor of potential medical significance,more » we have crystallized and determined the X-ray structure of the motor domain of CaKar3 as a maltose-binding protein (MBP) fusion. The structure shows strong conservation of overall motor domain topology to other Kar3 kinesins, but with some prominent differences in one of the motifs that compose the nucleotide-binding pocket and the surface charge distribution. The MBP and Kar3 modules are arranged such that MBP interacts with the Kar3 motor domain core at the same site where the neck linker of conventional kinesins docks during the 'ATP state' of the mechanochemical cycle. This site differs from the Kar3 neck-core interface in the recent structure of the ScKar3Vik1 heterodimer. The position of MBP is also completely distinct from the Vik1 subunit in this complex. This may suggest that the site of MBP interaction on the CaKar3 motor domain provides an interface for the neck, or perhaps a partner subunit, at an intermediate state of its motile cycle that has not yet been observed for Kinesin-14 motors.« less
Sensi, Stefano L.; Yin, Hong Z.; Carriedo, Sean G.; Rao, Shyam S.; Weiss, John H.
1999-01-01
Synaptically released Zn2+ can enter and cause injury to postsynaptic neurons. Microfluorimetric studies using the Zn2+-sensitive probe, Newport green, examined levels of [Zn2+]i attained in cultured cortical neurons on exposure to N-methyl-d-asparte, kainate, or high K+ (to activate voltage-sensitive Ca2+ channels) in the presence of 300 μM Zn2+. Indicating particularly high permeability through Ca2+-permeable α-amino3-hydroxy-5-methyl-4-isoxazolepropionic-acid/kainate (Ca-A/K) channels, micromolar [Zn2+]i rises were observed only after kainate exposures and only in neurons expressing these channels [Ca-A/K(+) neurons]. Further studies using the oxidation-sensitive dye, hydroethidine, revealed Zn2+-dependent reactive oxygen species (ROS) generation that paralleled the [Zn2+]i rises, with rapid oxidation observed only in the case of Zn2+ entry through Ca-A/K channels. Indicating a mitochondrial source of this ROS generation, hydroethidine oxidation was inhibited by the mitochondrial electron transport blocker, rotenone. Additional evidence for a direct interaction between Zn2+ and mitochondria was provided by the observation that the Zn2+ entry through Ca-A/K channels triggered rapid mitochondrial depolarization, as assessed by using the potential-sensitive dye tetramethylrhodamine ethylester. Whereas Ca2+ influx through Ca-A/K channels also triggers ROS production, the [Zn2+]i rises and subsequent ROS production are of more prolonged duration. PMID:10051656
Meednu, Nida; Hoops, Harold; D'Silva, Sonia; Pogorzala, Leah; Wood, Schuyler; Farkas, David; Sorrentino, Mark; Sia, Elaine; Meluh, Pam; Miller, Rita K.
2008-01-01
Accurate positioning of the mitotic spindle is important for the genetic material to be distributed evenly in dividing cells, but little is known about the mechanisms that regulate this process. Here we report that two microtubule-associated proteins important for spindle positioning interact with several proteins in the sumoylation pathway. By two-hybrid analysis, Kar9p and Bim1p interact with the yeast SUMO Smt3p, the E2 enzyme Ubc9p, an E3 Nfi1p, as well as Wss1p, a weak suppressor of a temperature-sensitive smt3 allele. The physical interaction between Kar9p and Ubc9p was confirmed by in vitro binding assays. A single-amino-acid substitution in Kar9p, L304P disrupted its two-hybrid interaction with proteins in the sumoylation pathway, but retained its interactions with the spindle positioning proteins Bim1p, Stu2p, Bik1p, and Myo2p. The kar9-L304P mutant showed defects in positioning the mitotic spindle, with the spindle located more distally than normal. Whereas wild-type Kar9p-3GFP normally localizes to only the bud-directed spindle pole body (SPB), Kar9p-L304P-3GFP was mislocalized to both SPBs. Using a reconstitution assay, Kar9p was sumoylated in vitro. We propose a model in which sumoylation regulates spindle positioning by restricting Kar9p to one SPB. These findings raise the possibility that sumoylation could regulate other microtubule-dependent processes. PMID:18832349
Synthesis of tricyclic butenolides and comparison their effects with known smoke-butenolide, KAR1.
Krawczyk, Ewa; Koprowski, Marek; Cembrowska-Lech, Danuta; Wójcik, Agata; Kępczyński, Jan
2017-08-01
Plant-derived smoke - butenolide, called at present karrikin 1 (KAR 1 ) is known as an important inductor of seed germination and seedling growth. In this study, tricyclic butenolides were synthesized and their effects on germination of dormant and non-dormant Avena fatua caryopses were compared, as were also their effects versus those of KAR 1 on seedling growth. KAR 1 was found to be most effective and to completely remove dormancy. Butenolides, rac-8 and (S)-8a, showed a low stimulatory effect on germination of dormant caryopses, visible only when applied at very high concentrations. These compounds used at concentrations 100 times those of KAR 1 similarly increased the speed of germination and vigor of non-dormant caryopses. Likewise, growth of coleoptiles and their fresh weight were increased by KAR 1 as well as by rac-8 and (S)-8a to a similar value. KAR 1 and rac-8 were more effective than (S)-8a in increasing root growth. The results shown indicate that the presence of an aromatic ring in the absence of methyl group at C3 induced a much lower, or a similar, effect on germination of dormant and non-dormant Avena fatua caryopses and seedling growth compared to KAR 1 , but only when used at much higher concentrations. The simultaneous presence of a methyl group at C3 and an aromatic ring in the compound rac-7 exerted only a slight effect on the root growth. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kainate Receptors in the Striatum: Implications for Excitotoxicity in Huntington’s Disease
2005-08-01
called ionotropic glutamate receptors. Using specific antibodies and glutamate-related compounds, we have achieved successfully a series of studies of the...them from AMPA receptors. However, the recent development of specific antibodies and selective AMPA receptor antagonists allowed various groups to...highly specific antibodies and/or cDNA probes allowed the better characterization of the cellular localization of various GABA and glutamate receptor
The ID-KArD technique: In-situ dating on Mars
NASA Astrophysics Data System (ADS)
Cartwright, J. A.; Farley, K. A.; Hurowitz, J.; Asimow, P. D.; Jacobson, N. S.
2013-12-01
The ability to measure absolute ages on the Martian surface is crucial for understanding the planet's evolution. A detailed geological history of the Moon has been determined through analysis of returned samples from specific units, and relative ages calculated by crater counting techniques. However, without returned samples or in-situ dating analyses, we lack absolute age markers for Mars and thus cannot accurately or precisely date its well-documented surface. Instead, we have relied on an estimated Mars/Moon cratering ratio and relative crater counting techniques in an attempt to calculate surface ages and classify geological units. The use of such relative parameters diminishes the precision and accuracy for surface age calculations, and thus highlights the need for independent age determinations from returned samples or in-situ dating. In this research, we describe our technique - ID-KArD (Isotope Dilution K-Ar Dating) - intended for in-situ age dating of geological units on the Martian surface. ID-KArD resolves two challenges that have previously obstructed in-situ age dating on Mars: 1) High fusion temperatures are avoided with the use of a lithium-borate flux; 2) Sample mass measurement is not required, due to the addition of an isotope dilution doubly-spiked glass. The glass has a known 39Ar/41K ratio, which removes the need for concentration measurements. Thus, only isotope ratios are required for a K-Ar age determination. ID-KArD has the potential to address Mars chronology inaccuracies, and would be a suitable technique for consideration on future missions. In the first phase of ID-KArD proof of concept, we selected a Viluy trap basalt (K2O ~ 0.7 wt%), with concordant K-Ar and Ar-Ar ages of 354.3 × 3.5 and 357.7 × 1.4 Ma respectively (Courtillot et al., 2010). An aliquot was combined into a crucible with the flux and the spike glass for separate Ar (MAP 215:50, Caltech), followed by K (KEMS, GRC) isotopic analysis. Combining our results, we obtained
Cyto- and receptor architecture of area 32 in human and macaque brains.
Palomero-Gallagher, Nicola; Zilles, Karl; Schleicher, Axel; Vogt, Brent A
2013-10-01
Human area 32 plays crucial roles in emotion and memory consolidation. It has subgenual (s32), pregenual (p32), dorsal, and midcingulate components. We seek to determine whether macaque area 32 has subgenual and pregenual subdivisions and the extent to which they are comparable to those in humans by means of NeuN immunohistochemistry and multireceptor analysis of laminar profiles. The macaque has areas s32 and p32. In s32, layer IIIa/b neurons are larger than those of layer IIIc. This relationship is reversed in p32. Layer Va is thicker and Vb thinner in s32. Area p32 contains higher kainate, benzodiazepine (BZ), and serotonin (5-HT)1A but lower N-methyl-D-aspartate (NMDA) and α2 receptor densities. Most differences were found in layers I, II, and VI. Together, these differences support the dual nature of macaque area 32. Comparative analysis of human and macaque s32 and p32 supports equivalences in cyto- and receptor architecture. Although there are differences in mean areal receptor densities, there are considerable similarities at the layer level. Laminar receptor distribution patterns in each area are comparable in the two species in layers III-Va for kainate, NMDA, γ-aminobutyric acid (GABA)B , BZ, and 5-HT1A receptors. Multivariate statistical analysis of laminar receptor densities revealed that human s32 is more similar to macaque s32 and p32 than to human p32. Thus, macaque 32 is more complex than hitherto known. Our data suggest a homologous neural architecture in anterior cingulate s32 and p32 in human and macaque brains. © 2013 Wiley Periodicals, Inc.
Developement of the Potassium-Argon Laser Experiment (KArLE) for In Situ Geochronology
NASA Technical Reports Server (NTRS)
Cohen, Barbara A.
2012-01-01
Absolute dating of planetary samples is an essential tool to establish the chronology of geological events, including crystallization history, magmatic evolution, and alteration. Thus far, radiometric geochronology of planetary samples has only been accomplishable in terrestrial laboratories on samples from dedicated sample return missions and meteorites. In situ instruments to measure rock ages have been proposed, but none have yet reached TRL 6, because isotopic measurements with sufficient resolution are challenging. We have begun work under the NASA Planetary Instrument Definition and Development Program (PIDDP) to develop the Potassium (K) - Argon Laser Experiment (KArLE), a novel combination of several flight-proven components that will enable accurate KAr isochron dating of planetary rocks. KArLE will ablate a rock sample, measure the K in the plasma state using laser-induced breakdown spectroscopy (LIBS), measure the liberated Ar using quadrupole mass spectrometry (QMS), and relate the two by measuring the volume of the abated pit using a optical methods such as a vertical scanning interferometer (VSI). Our preliminary work indicates that the KArLE instrument will be capable of determining the age of several kinds of planetary samples to 100 Myr, sufficient to address a wide range of geochronology problems in planetary science. Additional benefits derive from the fact that each KArLE component achieves analyses common to most planetary surface missions.
Pizzi, M; Fallacara, C; Arrighi, V; Memo, M; Spano, P F
1993-08-01
Activation of glutamate ionotropic receptors represents the primary event in the neurotoxicity process triggered by excitatory amino acids. We demonstrate here that the concentration-dependent stimulation of metabotropic glutamate receptor (mGluR) by the selective agonist trans-1-aminocyclopentane-1,3-dicarboxylate or by quisqualate counteracts both glutamate- and kainate-induced neurotoxicity in primary cultures of rat cerebellar granule cells. The mGluR-evoked responses are potentiated by aniracetam, which per se also elicits neuroprotection. Aniracetam concentration-dependently counteracted glutamate-, kainate-, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-induced cell death and greatly facilitated neuroprotective response achieved by different concentrations of both quisqualate and trans-1-aminocyclopentane-1,3-dicarboxylate. In addition, aniracetam potentiated the mGluR-coupled stimulation of phospholipase C, as revealed by the measurement of 3H-inositol phosphate formation. Thus, mGluRs could be a suitable target for novel pharmacological strategies pointing to the treatment of neurodegenerative diseases.
Schurr, A; Rigor, B M
1993-06-18
The effects of kainate (KA) on the recovery of neuronal function in rat hippocampal slices after hypoxia or glucose deprivation (GD) were investigated and compared to those of (R,S)-alpha-amino-3-hydroxy-5-methyl-4- isoxazoleproprionate (AMPA). KA and AMPA were found to be more toxic than either N-methyl-D-aspartate (NMDA), quinolinate, or glutamate, both under normal conditions and under states of energy deprivation. Doses as low as 1 microM KA or AMPA were sufficient to significantly reduce the recovery rate of neuronal function in slices after a standardized period of hypoxia or GD. The enhancement of hypoxic neuronal damage by both agonists could be partially blocked by the antagonist kynurenate, by the NMDA competitive antagonist AP5, and by elevating [Mg2+] in or by omitting Ca2+ from the perfusion medium. The AMPA antagonist glutamic acid diethyl ester was ineffective in preventing the enhanced hypoxic neuronal damage by either KA or AMPA. The antagonist of the glycine modulatory site on the NMDA receptor, 7-chlorokynurenate, did not block the KA toxicity but was able to block the toxicity of AMPA. 2,3-Dihydroxyquinoxaline completely blocked the KA- and AMPA-enhanced hypoxic neuronal damage. The KA-enhanced, GD-induced neuronal damage was prevented by Ca2+ depletion and partially antagonized by kynurenate but not by AP5 or elevated [Mg2+]. The results of the present study indicate that the KA receptor is involved in the mechanism of neuronal damage induced by hypoxia and GD, probably allowing Ca2+ influx and subsequent intracellular Ca2+ overload.(ABSTRACT TRUNCATED AT 250 WORDS)
Single Chondrule K/Ar ages of Mexican Meteorites Using ID-TIMS.
NASA Astrophysics Data System (ADS)
Hernandez, M.; Sole, J.
2007-05-01
We have determined the K/Ar ages of two H5 ordinary meteorites: Cosina and Nuevo Mercurio, neither dated until this study. We analyzed several single chondrules - weighing few milligrams - of each meteorite. Ages were obtained by using very precise K content determined by isotope dilution mass spectrometry. The K content in chondrules ranges between 650 and 1400 ppm. The 40Ar was measured by static vacuum noble gas mass spectrometry. Samples were fused with an infrared CO2 laser. Chondrule ages vary from 3.66 to 4.59 Ga for Cosina and from 4.20 to 4.87 Ga for Nuevo Mercurio. A comparison between our data and the published K/Ar ages of H and L whole rocks shows that dates obtained from single chondrules are older than those obtained from whole rocks and seem to preserve older events not evidenced in the WR ages. This implies that chondrules can preserve K/Ar ages very close to U-Pb crystallization ages.
Development of the Potassium-Argon Laser Experiment (KArLE) Instrument for In Situ Geochronology
NASA Technical Reports Server (NTRS)
Cohen, Barbara A.; Li, Z.-H.; Miller, J. S.; Brinckerhoff, W. B.; Clegg, S. M.; Mahaffy, P. R.; Swindle, T. D.; Wiens, R. C.
2012-01-01
Absolute dating of planetary samples is an essential tool to establish the chronology of geological events, including crystallization history, magmatic evolution, and alteration. Traditionally, geochronology has only been accomplishable on samples from dedicated sample return missions or meteorites. The capability for in situ geochronology is highly desired, because it will allow one-way planetary missions to perform dating of large numbers of samples. The success of an in situ geochronology package will not only yield data on absolute ages, but can also complement sample return missions by identifying the most interesting rocks to cache and/or return to Earth. In situ dating instruments have been proposed, but none have yet reached TRL 6 because the required high-resolution isotopic measurements are very challenging. Our team is now addressing this challenge by developing the Potassium (K) - Argon Laser Experiment (KArLE) under the NASA Planetary Instrument Definition and Development Program (PIDDP), building on previous work to develop a K-Ar in situ instrument [1]. KArLE uses a combination of several flight-proven components that enable accurate K-Ar isochron dating of planetary rocks. KArLE will ablate a rock sample, determine the K in the plasma state using laser-induced breakdown spectroscopy (LIBS), measure the liberated Ar using quadrupole mass spectrometry (QMS), and relate the two by the volume of the ablated pit using an optical method such as a vertical scanning interferometer (VSI). Our preliminary work indicates that the KArLE instrument will be capable of determining the age of several kinds of planetary samples to +/-100 Myr, sufficient to address a wide range of geochronology problems in planetary science.
NASA Technical Reports Server (NTRS)
Cohen, Barbara A.; Li, Z.-H.; Miller, J. S.; Brinckerhoff, W. B.; Clegg, S. M.; Mahaffy, P. R.; Swindle, T. D.; Wiens, R. C.
2013-01-01
Absolute dating of planetary samples is an essential tool to establish the chronology of geological events, including crystallization history, magmatic evolution, and alteration. We are addressing this challenge by developing the Potassium (K) -- Argon Laser Experiment (KArLE), building on previous work to develop a K-Ar in situ instrument. KArLE ablates a rock sample, determines the K in the plasma state using laser-induced breakdown spectroscopy (LIBS), measures the liberated Ar using quadrupole mass spectrometry (QMS), and relates the two by the volume of the ablated pit using laser confocal microscopy (LCM). Our goal is for the KArLE instrument to be capable of determining the age of several kinds of planetary samples to address a wide range of geochronolgy problems in planetary science.
Yi, Jung-Sun; Lee, Soon-Keum; Sato, Taka-Aki; Koh, Jae-Young
2003-08-21
Zinc induces in cultured cortical neurons both p75(NTR) and p75(NTR)-associated death executor (NADE), which together contribute to caspase-dependent neuronal apoptosis. Since zinc neurotoxicity may contribute to neuronal death following seizures, we examined whether p75(NTR) and NADE are co-induced also in rat hippocampal neurons degenerating after seizures. Staining of brain sections with a zinc-specific fluorescent dye (N-(6-methoxy-8-quinolyl)-p-carboxybenzoylsulphonamide) and acid fuchsin revealed zinc accumulation in degenerating neuronal cell bodies in CA1 and CA3 of hippocampus 24 h after kainate injection. Both anti-p75(NTR) and anti-NADE immunoreactivities appeared in zinc-accumulating/degenerating neurons in both areas. Intraventricular injection of CaEDTA, without altering the severity or time course of kainate-induced seizures, markedly attenuated the induction of p75(NTR)/NADE in hippocampus, which correlated with the decrease of caspase-3 activation and zinc accumulation/cell death. The present study has demonstrated that p75(NTR) and NADE are co-induced in neurons degenerating after kainate-induced seizures in rats, likely in a zinc-dependent manner.
Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus
Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo
2007-01-01
Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566
Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.
Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo
2007-09-25
Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.
Loss of Hippocampal Neurons after Kainate Treatment Correlates with Behavioral Deficits
Maia, Gisela H.; Quesado, José L.; Soares, Joana I.; do Carmo, Joana M.; Andrade, Pedro A.; Andrade, José P.; Lukoyanov, Nikolai V.
2014-01-01
Treating rats with kainic acid induces status epilepticus (SE) and leads to the development of behavioral deficits and spontaneous recurrent seizures later in life. However, in a subset of rats, kainic acid treatment does not induce overt behaviorally obvious acute SE. The goal of this study was to compare the neuroanatomical and behavioral changes induced by kainate in rats that developed convulsive SE to those who did not. Adult male Wistar rats were treated with kainic acid and tested behaviorally 5 months later. Rats that had experienced convulsive SE showed impaired performance on the spatial water maze and passive avoidance tasks, and on the context and tone retention tests following fear conditioning. In addition, they exhibited less anxiety-like behaviors than controls on the open-field and elevated plus-maze tests. Histologically, convulsive SE was associated with marked neuron loss in the hippocampal CA3 and CA1 fields, and in the dentate hilus. Rats that had not experienced convulsive SE after kainate treatment showed less severe, but significant impairments on the spatial water maze and passive avoidance tasks. These rats had fewer neurons than control rats in the dentate hilus, but not in the hippocampal CA3 and CA1 fields. Correlational analyses revealed significant relationships between spatial memory indices of rats and neuronal numbers in the dentate hilus and CA3 pyramidal field. These results show that a part of the animals that do not display intense behavioral seizures (convulsive SE) immediately after an epileptogenic treatment, later in life, they may still have noticeable structural and functional changes in the brain. PMID:24409306
Ionotropic and metabotropic glutamate receptor antagonism attenuates cue-induced cocaine seeking.
Bäckström, Pia; Hyytiä, Petri
2006-04-01
Neuroanatomical and pharmacological evidence implicates glutamate transmission in drug-environment conditioning that partly controls drug seeking and relapse. Glutamate receptors could be targets for pharmacological attenuation of the motivational properties of drug-paired cues and for relapse prevention. The purpose of the present study was therefore to investigate the involvement of ionotropic and metabotropic glutamate receptor subtypes in cue-induced reinstatement of cocaine-seeking behavior. Rats were trained to self-administer cocaine using a second-order schedule of reinforcement (FR4(FR5:S)) under which a compound stimulus (light and tone) associated with cocaine infusions was presented contingently. Following extinction, the effects of the competitive NMDA receptor antagonist CGP 39551 (0, 2.5, 5, 10 mg/kg intraperitoneally (i.p.)), two competitive AMPA/kainate antagonists, CNQX (0, 0.75, 1.5, 3 mg/kg i.p.) and NBQX (0, 1.25, 2.5, 5 mg/kg i.p.), the NMDA/glycine site antagonist L-701,324 (0, 0.63, 1.25, 2.5 mg/kg i.p.), and the mGluR5 antagonist MPEP (0, 1.25, 2.5, 5 mg/kg i.p.) on cue-induced reinstatement of cocaine seeking were examined. The AMPA/kainate receptor antagonists CNQX and NBQX, the NMDA/glycine site antagonist L-701,324, and the mGluR5 antagonist MPEP attenuated significantly cue-induced reinstatement. The NMDA antagonist CGP 39551 failed to affect reinstatement. Additional control experiments indicated that attenuation of cue-induced reinstatement by CNQX, NBQX, L-701,324, and MPEP was not accompanied by significant suppression of spontaneous locomotor activity. These results suggest that conditioned influences on cocaine seeking depend on glutamate transmission. Accordingly, drugs with antagonist properties at various glutamate receptor subtypes could be useful in prevention of relapse induced by conditioned stimuli.
Deep g'r'i'z' GMOS Imaging of the Dwarf Irregular Galaxy Kar 50
NASA Astrophysics Data System (ADS)
Davidge, T. J.
2002-11-01
Images obtained with the Gemini Multi-Object Spectrograph (GMOS) are used to investigate the stellar content and distance of the dwarf irregular galaxy Kar 50. The brightest object is an H II region, and the bright stellar content is dominated by stars with g'-r'<0. The tips of the main sequence and the red giant branch (RGB) are tentatively identified near r'=24.9 and i'=25.5, respectively. The galaxy has a blue integrated color and no significant color gradient, and we conclude that Kar 50 has experienced a recent galaxy-wide episode of star formation. The distance estimated from the brightest blue stars indicates that Kar 50 is behind the M81 group, and this is consistent with the tentative RGB-tip brightness. Kar 50 has a remarkably flat central surface brightness profile, even at wavelengths approaching 1 μm, although there is no evidence of a bar. In the absence of another large star-forming episode, Kar 50 will evolve into a very low surface brightness galaxy. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the Particle Physics and Astronomy Research Council (United Kingdom), the National Research Council of Canada (Canada), CONICYT (Chile), the Australian Research Council (Australia), CNPq (Brazil), and CONICET (Argentina).
2004-09-01
hippocampus and hypothalamus. J Neurosci Res 63:200-208. Thorpe GH et al. (1989) Chemiluminescent enzyme immunoassay of alpha - fetoprotein based on an...cells. Proc Natl Acad Sci USA 83:6213-6215. Montpied Pet al. (1991) Prolonged ethanol inhalation decreases gamma-aminobutyric acidA receptor alpha ...potentials mediated via alpha -bungarotoxin-sensitive nico- tinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci 18:8228- 8235
Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping
2006-01-01
The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABAA receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABAA receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca2+ concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABAA receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABAA receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves. PMID:18615134
2017-01-01
The objective is to examine how the flux of neurotransmitter glutamate from neurons to the extracellular fluid, as measured by the rate of 13C enrichment of extracellular glutamate (GLUECF), changes in response to seizures in the kainate-induced rat model of temporal-lobe epilepsy. Following unilateral intrahippocampal injection of kainate, GLUECF was collected by microdialysis from the CA1/CA3 region of awake rats, in combination with EEG recording of chronic-phase recurrent seizures and intravenous infusion of [2,5-13C]glucose. The 13C enrichment of GLUECF C5 at ~ 10 picomol level was measured by gas-chromatography mass-spectrometry. The rate of 13C enrichment, expressed as the increase of the fractional enrichment/min, was 0.0029 ± 0.0001/min in frequently seizing rats (n = 4); this was significantly higher (p < 0.01) than in the control (0.00167 ± 0.0001/min; n = 6) or in rats with infrequent seizures (0.00172 ± 0.0001/min; n = 6). This result strongly suggests that the flux of the excitatory neurotransmitter from neurons to the extracellular fluid is significantly increased by frequent seizures. The extracellular [12C + 13C]glutamate concentration increased progressively in frequently seizing rats. Taken together, these results strongly suggest that the observed seizure-induced high flux of glutamate overstimulated glutamate receptors, which triggered a chain reaction of excitation in the CA3 recurrent glutamatergic networks. The rate of 13C enrichment of extracellular glutamine (GLNECF) at C5 was 0.00299 ± 0.00027/min in frequently seizing rats, which was higher (p < 0.05) than in controls (0.00227 ± 0.00008/min). For the first time in vivo, this study examined the effects of epileptic seizures on fluxes of the neurotransmitter glutamate and its precursor glutamine in the extracellular fluid of the hippocampus. The advantages, limitations and the potential for improvement of this approach for pre-clinical and clinical studies of temporal-lobe epilepsy
The Potassium-Argon Laser Experiment (KArLE): In Situ Geochronology for Planetary Robotic Missions
NASA Technical Reports Server (NTRS)
Cohen, Barbara
2016-01-01
The Potassium (K) - Argon (Ar) Laser Experiment (KArLE) will make in situ noble-gas geochronology measurements aboard planetary robotic landers and roverss. Laser-Induced Breakdown Spectroscopy (LIBS) is used to measure the K abun-dance in a sample and to release its noble gases; the evolved Ar is measured by mass spectrometry (MS); and rela-tive K content is related to absolute Ar abundance by sample mass, determined by optical measurement of the ablated volume. KArLE measures a whole-rock K-Ar age to 10% or better for rocks 2 Ga or older, sufficient to resolve the absolute age of many planetary samples. The LIBS-MS approach is attractive because the analytical components have been flight proven, do not require further technical development, and provide complementary measurements as well as in situ geochronology.
Chemical analyses and K-Ar ages of samples from 13 drill holes, Medicine Lake volcano, California
Donnelly-Nolan, Julie M.
2006-01-01
Chemical analyses and K-Ar ages are presented for rocks sampled from drill holes at Medicine Lake volcano, northern California. A location map and a cross-section are included, as are separate tables for drill hole information, major and trace element data, and for K-Ar dates.
Calcium permeable AMPA receptors and autoreceptors in external tufted cells of rat olfactory bulb
Ma, Jie; Lowe, Graeme
2007-01-01
Glomeruli are functional units of the olfactory bulb responsible for early processing of odor information encoded by single olfactory receptor genes. Glomerular neural circuitry includes numerous external tufted (ET) cells whose rhythmic burst firing may mediate synchronization of bulbar activity with the inhalation cycle. Bursting is entrained by glutamatergic input from olfactory nerve terminals, so specific properties of ionotropic glutamate receptors on ET cells are likely to be important determinants of olfactory processing. Particularly intriguing is recent evidence that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors of juxta-glomerular neurons may permeate calcium. This could provide a novel pathway for regulating ET cell signaling. We tested the hypothesis that ET cells express functional calcium-permeable AMPA receptors. In rat olfactory bulb slices, excitatory postsynaptic currents (EPSCs) in ET cells were evoked by olfactory nerve shock, and by uncaging glutamate. We found attenuation of AMPA/kainate EPSCs by 1-naphthyl acetyl-spermine (NAS), an open-channel blocker specific for calcium permeable AMPA receptors. Cyclothiazide strongly potentiated EPSCs, indicating a major contribution from AMPA receptors. The current-voltage (I-V) relation of uncaging EPSCs showed weak inward rectification which was lost after > ~ 10 min of whole-cell dialysis, and was absent in NAS. In kainate-stimulated slices, Co2+ ions permeated cells of the glomerular layer. Large AMPA EPSCs were accompanied by fluorescence signals in fluo-4 loaded cells, suggesting calcium permeation. Depolarizing pulses evoked slow tail currents with pharmacology consistent with involvement of calcium permeable AMPA autoreceptors. Tail currents were abolished by Cd2+ and NBQX, and were sensitive to NAS block. Glutamate autoreceptors were confirmed by uncaging intracellular calcium to evoke a large inward current. Our results provide evidence that calcium permeable AMPA
Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping
2006-01-01
The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABA(A) receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABA(A) receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca(2+) concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABA(A) receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABA(A) receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves.
Ionotropic glutamate receptors: regulation by G-protein-coupled receptors.
Rojas, Asheebo; Dingledine, Raymond
2013-04-01
The function of many ion channels is under dynamic control by coincident activation of G-protein-coupled receptors (GPCRs), particularly those coupled to the Gαs and Gαq family members. Such regulation is typically dependent on the subunit composition of the ionotropic receptor or channel as well as the GPCR subtype and the cell-specific panoply of signaling pathways available. Because GPCRs and ion channels are so highly represented among targets of U.S. Food and Drug Administration-approved drugs, functional cross-talk between these drug target classes is likely to underlie many therapeutic and adverse effects of marketed drugs. GPCRs engage a myriad of signaling pathways that involve protein kinases A and C (PKC) and, through PKC and interaction with β-arrestin, Src kinase, and hence the mitogen-activated-protein-kinase cascades. We focus here on the control of ionotropic glutamate receptor function by GPCR signaling because this form of regulation can influence the strength of synaptic plasticity. The amino acid residues phosphorylated by specific kinases have been securely identified in many ionotropic glutamate (iGlu) receptor subunits, but which of these sites are GPCR targets is less well known even when the kinase has been identified. N-methyl-d-aspartate, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and heteromeric kainate receptors are all downstream targets of GPCR signaling pathways. The details of GPCR-iGlu receptor cross-talk should inform a better understanding of how synaptic transmission is regulated and lead to new therapeutic strategies for neuropsychiatric disorders.
NASA Technical Reports Server (NTRS)
Cho, Yuichiro; Cohen, Barbara A.
2018-01-01
We report new K-Ar isochron data for two approximately 380 Ma basaltic rocks, using an updated version of the Potassium-Argon Laser Experiment (KArLE). These basalts have K contents comparable to lunar KREEP basalts or igneous lithologies found by Mars rovers, whereas previous proof-of-concept studies focused primarily on more K-rich rocks. We continue to measure these analogue samples to show the advancing capability of in situ K-Ar geochronology. KArLE is applicable to other bodies including the Moon or asteroids.
The Potassium-Argon Laser Experiment (KarLE): In Situ Geochronology for Mars and Beyond
NASA Technical Reports Server (NTRS)
Cohen, Barbara A.
2014-01-01
The search for life in the solar system depends upon discovering the right moments in planetary evolution: when habitable environments existed, when they declined, and when geologic processes operated to preserve traces of life after death. However, an incomplete knowledge of absolute Martian geochronology limits our ability to understand the timing of Martian evolutionary milestones, major climate changes, and stratigraphic epochs [1, 2]. Absolute dating relates these habitability markers to planetarywide geologic, atmospheric, and climate history places, and ties their occurrence to the history of the solar system, especially the Earth-Moon system and the timescale of evolution of life on Earth. KArLE is being developed to anchor the relative timeline of geological events to an absolute chronology that puts Mars into a wider solar system context. KArLE makes its measurements on rock samples that can be obtained by landers or rovers and inserted into a small, mechanically simple chamber. KArLE interrogates the samples using laser-induced breakdown spectrocopy (LIBS), mass spectrometry, and optical imaging. The KArLE experiment is flexible enough to accommodate any partner providing these instrument components, a creative approach that extends the ability of mission payloads to accomplish an additional highly-desirable science measurement for low cost and risk and minimal extra hardware.
Ionotropic Glutamate Receptors & CNS Disorders
Bowie, Derek
2008-01-01
Disorders of the central nervous system (CNS) are complex disease states that represent a major challenge for modern medicine. Although etiology is often unknown, it is established that multiple factors such as defects in genetics and/or epigenetics, the environment as well as imbalance in neurotransmitter receptor systems are all at play in determining an individual’s susceptibility to disease. Gene therapy is currently not available and therefore, most conditions are treated with pharmacological agents that modify neurotransmitter receptor signaling. Here, I provide a review of ionotropic glutamate receptors (iGluRs) and the roles they fulfill in numerous CNS disorders. Specifically, I argue that our understanding of iGluRs has reached a critical turning point to permit, for the first time, a comprehensive re-evaluation of their role in the cause of disease. I illustrate this by highlighting how defects in AMPA receptor trafficking are important to Fragile X mental retardation and ectopic expression of kainate (KA) receptor synapses contributes to the pathology of temporal lobe epilepsy. Finally, I discuss how parallel advances in studies of other neurotransmitter systems may allow pharmacologists to work towards a cure for many CNS disorders rather than developing drugs to treat their symptoms. PMID:18537642
In Situ Geochronology on the Mars 2020 Rover with KArLE (Potassium-Argon Laser Experiment)
NASA Technical Reports Server (NTRS)
Cohen, B. A.; Swindle, T. D.; Roark, S. E.
2014-01-01
If extinct and/or extant life is discovered on Mars, knowledge of the chronology of the biosphere will be of paramount importance. KArLE will provide absolute ages of Mars 2020 rocks, which will allow us to understand them in the context of Mars' geologic history, connect them to other landing sites, and compare Martian epochs of habitability with the Earth's history and evolution of life. KArLE significantly enhances the ability of Mars 2020 to meet its science objectives by performing in situ age dating on key lithologies, enabling targeted searches for ancient biosignatures and increasing the chances of identifying evidence for Martian microbial life. The KArLE investigation makes its measurements on a core sample obtained with the rover drill, inserted into a small, mechanically simple chamber, followed by interrogation by laser-induced breakdown spectroscopy (LIBS), mass spectrometry, and optical imaging. The KArLE experiment is flexible enough to accommodate any partner providing these instrument components, a creative approach that extends the ability of the Mars 2020 payload to accomplish an additional highly-desirable science measurement for low cost and risk and minimal extra hardware.
Profiling neurotransmitter receptor expression in the Ambystoma mexicanum brain.
Reyes-Ruiz, Jorge Mauricio; Limon, Agenor; Korn, Matthew J; Nakamura, Paul A; Shirkey, Nicole J; Wong, Jamie K; Miledi, Ricardo
2013-03-22
Ability to regenerate limbs and central nervous system (CNS) is unique to few vertebrates, most notably the axolotl (Ambystoma sp.). However, despite the fact the neurotransmitter receptors are involved in axonal regeneration, little is known regarding its expression profile. In this project, RT-PCR and qPCR were performed to gain insight into the neurotransmitter receptors present in Ambystoma. Its functional ability was studied by expressing axolotl receptors in Xenopus laevis oocytes by either injection of mRNA or by direct microtransplantation of brain membranes. Oocytes injected with axolotl mRNA expressed ionotropic receptors activated by GABA, aspartate+glycine and kainate, as well as metabotropic receptors activated by acetylcholine and glutamate. Interestingly, we did not see responses following the application of serotonin. Membranes from the axolotl brain were efficiently microtransplanted into Xenopus oocytes and two types of native GABA receptors that differed in the temporal course of their responses and affinities to GABA were observed. Results of this study are necessary for further characterization of axolotl neurotransmitter receptors and may be useful for guiding experiments aimed at understanding activity-dependant limb and CNS regeneration. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Radial symmetry in a chimeric glutamate receptor pore
NASA Astrophysics Data System (ADS)
Wilding, Timothy J.; Lopez, Melany N.; Huettner, James E.
2014-02-01
Ionotropic glutamate receptors comprise two conformationally different A/C and B/D subunit pairs. Closed channels exhibit fourfold radial symmetry in the transmembrane domain (TMD) but transition to twofold dimer-of-dimers symmetry for extracellular ligand binding and N-terminal domains. Here, to evaluate symmetry in open pores we analysed interaction between the Q/R editing site near the pore loop apex and the transmembrane M3 helix of kainate receptor subunit GluK2. Chimeric subunits that combined the GluK2 TMD with extracellular segments from NMDA receptors, which are obligate heteromers, yielded channels made up of A/C and B/D subunit pairs with distinct substitutions along M3 and/or Q/R site editing status, in an otherwise identical homotetrameric TMD. Our results indicate that Q/R site interaction with M3 occurs within individual subunits and is essentially the same for both A/C and B/D subunit conformations, suggesting that fourfold pore symmetry persists in the open state.
Electron microprobe evaluation of terrestrial basalts for whole-rock K-Ar dating
Mankinen, E.A.; Brent, Dalrymple G.
1972-01-01
Four basalt samples for whole-rock K-Ar dating were analyzed with an electron microprobe to locate potassium concentrations. Highest concentrations of potassium were found in those mineral phases which were the last to crystallize. The two reliable samples had potassium concentrated in fine-grained interstitial feldspar and along grain boundaries of earlier formed plagioclase crystals. The two unreliable samples had potassium concentrated in the glassy matrix, demonstrating the ineffectiveness of basaltic glass as a retainer of radiogenic argon. In selecting basalt samples for whole-rock K-Ar dating, particular emphasis should be placed on determining the nature and condition of the fine-grained interstitial phases. ?? 1972.
Hale, Sarah J.; Lovell, Simon C.; de Keyzer, Jeanine; Stirling, Colin J.
2010-01-01
Kar2p, an essential Hsp70 chaperone in the endoplasmic reticulum of Saccharomyces cerevisiae, facilitates the transport and folding of nascent polypeptides within the endoplasmic reticulum lumen. The chaperone activity of Kar2p is regulated by its intrinsic ATPase activity that can be stimulated by two different nucleotide exchange factors, namely Sil1p and Lhs1p. Here, we demonstrate that the binding requirements for Lhs1p are complex, requiring both the nucleotide binding domain plus the linker domain of Kar2p. In contrast, the IIB domain of Kar2p is sufficient for binding of Sil1p, and point mutations within IIB specifically blocked Sil1p-dependent activation while remaining competent for activation by Lhs1p. Taken together, these results demonstrate that the interactions between Kar2p and its two nucleotide exchange factors can be functionally resolved and are thus mechanistically distinct. PMID:20430899
HOMEOSTATIC REGULATION OF KCC2 ACTIVITY BY THE ZINC RECEPTOR mZnR/GPR39 DURING SEIZURES
Gilad, David; Shorer, Sharon; Ketzef, Maya; Friedman, Alon; Sekler, Israel; Aizenman, Elias; Hershfinkel, Michal
2015-01-01
The aim of this study was to investigate the role of the synaptic metabotropic zinc receptor mZnR/GPR39 in physiological adaptation to epileptic seizures. We previously demonstrated that synaptic activation of mZnR/GPR39 enhances inhibitory drive in the hippocampus by upregulating neuronal K+/Cl− co-transporter 2 (KCC2) activity. Here, we first show that mZnR/GPR39 knockout (KO) adult mice have dramatically enhanced susceptibility to seizures triggered by a single intraperitoneal injection of kainic acid, when compared to wild type (WT) littermates. Kainate also substantially enhances seizure-associated gamma oscillatory activity in juvenile mZnR/GPR39 KO hippocampal slices, a phenomenon that can be reproduced in WT tissue by extracellular Zn2+ chelation. Importantly, kainate-induced synaptic Zn2+ release enhances surface expression and transport activity of KCC2 in WT, but not mZnR/GPR39 KO hippocampal neurons. Kainate-dependent upregulation of KCC2 requires mZnR/GPR39 activation of the Gαq/phospholipase C/extracellular regulated kinase (ERK1/2) signaling cascade. We suggest that mZnR/GPR39-dependent upregulation of KCC2 activity provides homeostatic adaptation to an excitotoxic stimulus by increasing inhibition. As such, mZnR/GPR39 may provide a novel pharmacological target for dampening epileptic seizure activity. PMID:25562657
Cholesterol modulates open probability and desensitization of NMDA receptors
Korinek, Miloslav; Vyklicky, Vojtech; Borovska, Jirina; Lichnerova, Katarina; Kaniakova, Martina; Krausova, Barbora; Krusek, Jan; Balik, Ales; Smejkalova, Tereza; Horak, Martin; Vyklicky, Ladislav
2015-01-01
NMDA receptors (NMDARs) are glutamate-gated ion channels that mediate excitatory neurotransmission in the CNS. Although these receptors are in direct contact with plasma membrane, lipid–NMDAR interactions are little understood. In the present study, we aimed at characterizing the effect of cholesterol on the ionotropic glutamate receptors. Whole-cell current responses induced by fast application of NMDA in cultured rat cerebellar granule cells (CGCs) were almost abolished (reduced to 3%) and the relative degree of receptor desensitization was increased (by seven-fold) after acute cholesterol depletion by methyl-β-cyclodextrin. Both of these effects were fully reversible by cholesterol repletion. By contrast, the responses mediated by AMPA/kainate receptors were not affected by cholesterol depletion. Similar results were obtained in CGCs after chronic inhibition of cholesterol biosynthesis by simvastatin and acute enzymatic cholesterol degradation to 4-cholesten-3-one by cholesterol oxidase. Fluorescence anisotropy measurements showed that membrane fluidity increased after methyl-β-cyclodextrin pretreatment. However, no change in fluidity was observed after cholesterol enzymatic degradation, suggesting that the effect of cholesterol on NMDARs is not mediated by changes in membrane fluidity. Our data show that diminution of NMDAR responses by cholesterol depletion is the result of a reduction of the open probability, whereas the increase in receptor desensitization is the result of an increase in the rate constant of entry into the desensitized state. Surface NMDAR population, agonist affinity, single-channel conductance and open time were not altered in cholesterol-depleted CGCs. The results of our experiments show that cholesterol is a strong endogenous modulator of NMDARs. Key points NMDA receptors (NMDARs) are tetrameric cation channels permeable to calcium; they mediate excitatory synaptic transmission in the CNS and their excessive activation can lead to
Structure and symmetry inform gating principles of ionotropic glutamate receptors.
Zhu, Shujia; Gouaux, Eric
2017-01-01
Ionotropic glutamate receptors (iGluRs) transduce signals derived from release of the excitatory neurotransmitter glutamate from pre-synaptic neurons into excitation of post-synaptic neurons on a millisecond time-scale. In recent years, the elucidation of full-length iGluR structures of NMDA, AMPA and kainate receptors by X-ray crystallography and single particle cryo-electron microscopy has greatly enhanced our understanding of the interrelationships between receptor architecture and gating mechanism. Here we briefly review full-length iGluR structures and discuss the similarities and differences between NMDA receptors and non-NMDA iGluRs. We focus on distinct conformations, including ligand-free, agonist-bound active, agonist-bound desensitized and antagonist-bound conformations as well as modulator and auxiliary protein-bound states. These findings provide insights into structure-based mechanisms of iGluR gating and modulation which together shape the amplitude and time course of the excitatory postsynaptic potential. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.
MacGregor, D. G.; Miller, W. J.; Stone, T. W.
1993-01-01
1. Systemic injections of kainic acid, 10 mg kg-1, into adult rats resulted in lesions in the hippocampus, as assessed by peripheral benzodiazepine ligand binding. Co-administration of clonazepam at 1 mg kg-1 or 0.2 mg kg-1 prevented major seizures associated with kainate injections, but did not alter significantly the production of hippocampal damage. 2. The co-administration of the adenosine A1 agonist R-phenylisopropyladenosine (R-PIA, 25 micrograms kg-1, i.p.) abolished the lesions induced by kainic acid. 3. The presence of the selective A1 antagonist, 8-cyclopentyl-1,3-dipropylxanthine (250 or 50 micrograms kg-1, i.p.) abolished the R-PIA neuroprotective action. 4. The A1/A2 antagonist, 8-(p-sulphophenyl)theophylline (20 mg kg-1, i.p.) which cannot cross the blood brain barrier, did not alter significantly the neuroprotective action of R-PIA, indicating that the neuroprotective action of the purine may be predominantly central. 5. The time course of the neuroprotection was also examined. R-PIA was effective when administered 2 h before or after kainate administration. 6. The results emphasise the potential utility of systemically active adenosine A1 receptor ligands in reducing CNS gliosis induced by the activation of excitatory amino acid receptors. PMID:8220909
Crystal Structures of the Glutamate Receptor Ion Channel GluK3 and GluK5 Amino-Terminal Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Janesh; Mayer, Mark L.
2010-11-30
Ionotropic glutamate receptors (iGluRs) mediate the majority of fast excitatory synaptic neurotransmission in the central nervous system. The selective assembly of iGluRs into AMPA, kainate, and N-methyl-d-aspartic acid (NMDA) receptor subtypes is regulated by their extracellular amino-terminal domains (ATDs). Kainate receptors are further classified into low-affinity receptor families (GluK1-GluK3) and high-affinity receptor families (GluK4-GluK5) based on their affinity for the neurotoxin kainic acid. These two families share a 42% sequence identity for the intact receptor but only a 27% sequence identity at the level of ATD. We have determined for the first time the high-resolution crystal structures of GluK3 andmore » GluK5 ATDs, both of which crystallize as dimers but with a strikingly different dimer assembly at the R1 interface. By contrast, for both GluK3 and GluK5, the R2 domain dimer assembly is similar to those reported previously for other non-NMDA iGluRs. This observation is consistent with the reports that GluK4-GluK5 cannot form functional homomeric ion channels and require obligate coassembly with GluK1-GluK3. Our analysis also reveals that the relative orientation of domains R1 and R2 in individual non-NMDA receptor ATDs varies by up to 10{sup o}, in contrast to the 50{sup o} difference reported for the NMDA receptor GluN2B subunit. This restricted domain movement in non-NMDA receptor ATDs seems to result both from extensive intramolecular contacts between domain R1 and domain R2 and from their assembly as dimers, which interact at both R1 and R2 domains. Our results provide the first insights into the structure and function of GluK4-GluK5, the least understood family of iGluRs.« less
Greger, Ingo H; Watson, Jake F; Cull-Candy, Stuart G
2017-05-17
AMPA receptors (AMPARs) are tetrameric ion channels that together with other ionotropic glutamate receptors (iGluRs), the NMDA and kainate receptors, mediate a majority of excitatory neurotransmission in the central nervous system. Whereas NMDA receptors gate channels with slow kinetics, responsible primarily for generating long-term synaptic potentiation and depression, AMPARs are the main fast transduction elements at synapses and are critical for the expression of plasticity. The kinetic and conductance properties of AMPARs are laid down during their biogenesis and are regulated by post-transcriptional RNA editing, splice variation, post-translational modification, and subunit composition. Furthermore, AMPAR assembly, trafficking, and functional heterogeneity depends on a large repertoire of auxiliary subunits-a feature that is particularly striking for this type of iGluR. Here, we discuss how the subunit structure, stoichiometry, and auxiliary subunits generate a heterogeneous plethora of receptors, each tailored to fulfill a vital role in fast synaptic signaling and plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.
Haghparast, Abbas; Soltani-Hekmat, Ava; Khani, Abbas; Komaki, Alireza
2007-10-29
Neurons in the nucleus cuneiformis (CnF), located just ventrolateral to the periaqueductal gray, project to medullary nucleus raphe magnus (NRM), which is a key medullary relay for descending pain modulation and is critically involved in opioid-induced analgesia. Previous studies have shown that antinociceptive response of CnF-microinjected morphine can be modulated by the specific subtypes of glutamatergic receptors within the CnF. In this study, we evaluated the role of NMDA and kainate/AMPA receptors that are widely distributed within the NRM on morphine-induced antinociception elicited from the CnF. Hundred and five male Wistar rats weighing 250-300 g were used. Morphine (10, 20 and 40 microg) and NMDA receptor antagonist, MK-801 (10 microg) or kainate/AMPA receptor antagonist, DNQX (0.5 microg) in 0.5 microl saline were stereotaxically microinjected into the CnF and NRM, respectively. The latency of tail-flick response was measured at set intervals (2, 7, 12, 17, 22, 27 min after microinjection) by using an automated tail-flick analgesiometer. The results showed that morphine microinjection into the CnF dose-dependently causes increase in tail-flick latency (TFL). MK-801 microinjected into the NRM, just 1 min before morphine injection into the CnF, significantly attenuated antinociceptive effects of morphine. On the other hand, DNQX microinjected into the NRM, significantly increased TFL after local application of morphine into the CnF. We suggest that morphine related antinociceptive effect elicited from the CnF is mediated, in part, by NMDA receptor at the level of the NRM whereas kainite/AMPA receptor has a net inhibitory influence at the same pathway.
K-Ar age constrains on chemically weathered granitic basement rocks (saprolites) in Scandinavia
NASA Astrophysics Data System (ADS)
Margreth, Annina; Fredin, Ola; Viola, Giulio; Knies, Jochen; Sørlie, Ronald; Lie, Jan-Erik; Margrethe Grandal, Else; Zwingmann, Horst; Vogt, Christoph
2017-04-01
Remnants of in-situ weathered bedrock, saprolite, are found in several locations in Scandinavia. Saprolites contain important information about past climate conditions and landscape evolution, although their age and genesis are commonly difficult to constrain. It is generally thought that clay-poor, coarse-grained (arêne) saprolites, mostly occurring as thin regolith blankets or in larger outcrops, formed in temperate climate during the Cenozoic, whereas clay-rich (argillic) saprolites, commonly restricted to small, fracture-bounded outcrops, formed in (sub-)tropical climate during the Mesozoic. Recent methodological and conceptual advances in K-Ar dating of illite-bearing fault rocks have been applied to date clay-rich saprolites. To test the K-Ar dating technique for saprolites, we first selected an offshore site in the Viking Graben of the North Sea, where weathered and fractured granitic basement highs have been drilled during petroleum exploration, and an abandoned kaolin mine in Southern Sweden. Both targets provide independent age control through the presence of overlying Mesozoic sedimentary rocks. Clay-rich saprolites occurring in fractured basement rocks were additionally sampled in a joint valley landscape on the southwestern coast of Norway, which can be regarded as the possible onland correlative to the offshore basement high. In order to offer a sound interpretation of the obtained K-Ar ages, the mineralogical and chemical composition of the saprolites requires a thorough characterization. Scanning electron microscopy of thin sections, integrated by XRD and XRF analysis, reveals the progressive transformation of primary granitic rock minerals into secondary clay minerals. The authigenesis of illite is particularly important to understand, since it is the only K-bearing clay mineral that can be dated by the K-Ar method. K-feldspars and mica are the common primary K-bearing minerals, from which illite can be formed. While progressive leaching of
Hoyt, M A; He, L; Totis, L; Saunders, W S
1993-09-01
The kinesin-related products of the CIN8 and KIP1 genes of Saccharomyces cerevisiae redundantly perform an essential function in mitosis. The action of either gene-product is required for an outwardly directed force that acts upon the spindle poles. We have selected mutations that suppress the temperature-sensitivity of a cin8-temperature-sensitive kip1-delta strain. The extragenic suppressors analyzed were all found to be alleles of the KAR3 gene. KAR3 encodes a distinct kinesin-related protein whose action antagonizes Cin8p/Kip1p function. All seven alleles analyzed were altered within the region of KAR3 that encodes the putative force-generating (or "motor") domain. These mutations also suppressed the inviability associated with the cin8-delta kip1-delta genotype, a property not shared by a deletion of KAR3. Other properties of the suppressing alleles revealed that they were not null for function. Six of the seven were unaffected for the essential karyogamy and meiosis properties of KAR3 and the seventh was dominant for the suppressing trait. Our findings suggest that despite an antagonistic relationship between Cin8p/Kip1p and Kar3p, aspects of their mitotic roles may be similar.
Glutamate mediates platelet activation through the AMPA receptor
Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.
2008-01-01
Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118
Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin,R.; Clark, S.; Weeks, A.
2005-01-01
Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less
Drosophila Spidey/Kar Regulates Oenocyte Growth via PI3-Kinase Signaling
Cinnamon, Einat; Sawala, Annick; Tittiger, Claus; Paroush, Ze'ev
2016-01-01
Cell growth and proliferation depend upon many different aspects of lipid metabolism. One key signaling pathway that is utilized in many different anabolic contexts involves Phosphatidylinositide 3-kinase (PI3K) and its membrane lipid products, the Phosphatidylinositol (3,4,5)-trisphosphates. It remains unclear, however, which other branches of lipid metabolism interact with the PI3K signaling pathway. Here, we focus on specialized fat metabolizing cells in Drosophila called larval oenocytes. In the presence of dietary nutrients, oenocytes undergo PI3K-dependent cell growth and contain very few lipid droplets. In contrast, during starvation, oenocytes decrease PI3K signaling, shut down cell growth and accumulate abundant lipid droplets. We now show that PI3K in larval oenocytes, but not in fat body cells, functions to suppress lipid droplet accumulation. Several enzymes of fatty acid, triglyceride and hydrocarbon metabolism are required in oenocytes primarily for lipid droplet induction rather than for cell growth. In contrast, a very long chain fatty-acyl-CoA reductase (FarO) and a putative lipid dehydrogenase/reductase (Spidey, also known as Kar) not only promote lipid droplet induction but also inhibit oenocyte growth. In the case of Spidey/Kar, we show that the growth suppression mechanism involves inhibition of the PI3K signaling pathway upstream of Akt activity. Together, the findings in this study show how Spidey/Kar and FarO regulate the balance between the cell growth and lipid storage of larval oenocytes. PMID:27500738
Taccola, G; Margaryan, G; Mladinic, M; Nistri, A
2008-08-13
Acute spinal cord injury evolves rapidly to produce secondary damage even to initially spared areas. The result is loss of locomotion, rarely reversible in man. It is, therefore, important to understand the early pathophysiological processes which affect spinal locomotor networks. Regardless of their etiology, spinal lesions are believed to include combinatorial effects of excitotoxicity and severe stroke-like metabolic perturbations. To clarify the relative contribution by excitotoxicity and toxic metabolites to dysfunction of locomotor networks, spinal reflexes and intrinsic network rhythmicity, we used, as a model, the in vitro thoraco-lumbar spinal cord of the neonatal rat treated (1 h) with either kainate or a pathological medium (containing free radicals and hypoxic/aglycemic conditions), or their combination. After washout, electrophysiological responses were monitored for 24 h and cell damage analyzed histologically. Kainate suppressed fictive locomotion irreversibly, while it reversibly blocked neuronal excitability and intrinsic bursting induced by synaptic inhibition block. This result was associated with significant neuronal loss around the central canal. Combining kainate with the pathological medium evoked extensive, irreversible damage to the spinal cord. The pathological medium alone slowed down fictive locomotion and intrinsic bursting: these oscillatory patterns remained throughout without regaining their control properties. This phenomenon was associated with polysynaptic reflex depression and preferential damage to glial cells, while neurons were comparatively spared. Our model suggests distinct roles of excitotoxicity and metabolic dysfunction in the acute damage of locomotor networks, indicating that different strategies might be necessary to treat the various early components of acute spinal cord lesion.
Tobi, Dror
2017-08-01
A new algorithm for comparison of protein dynamics is presented. Compared protein structures are superposed and their modes of motions are calculated using the anisotropic network model. The obtained modes are aligned using the dynamic programming algorithm of Needleman and Wunsch, commonly used for sequence alignment. Dynamical comparison of hemoglobin in the T and R2 states reveals that the dynamics of the allosteric effector 2,3-bisphosphoglycerate binding site is different in the two states. These differences can contribute to the selectivity of the effector to the T state. Similar comparison of the ionotropic glutamate receptor in the kainate+(R,R)-2b and ZK bound states reveals that the kainate+(R,R)-2b bound states slow modes describe upward motions of ligand binding domain and the transmembrane domain regions. Such motions may lead to the opening of the receptor. The upper lobes of the LBDs of the ZK bound state have a smaller interface with the amino terminal domains above them and have a better ability to move together. The present study exemplifies the use of dynamics comparison as a tool to study protein function. Proteins 2017; 85:1507-1517. © 2014 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Review of traffic provisions of KRS/KAR and Kentucky drivers manual.
DOT National Transportation Integrated Search
2005-03-01
This study included a review of selected sections of KRS and KAR that relate to traffic and safety. Also, the entire Kentucky Drivers Manual was reviewed. The review involved an evaluation of applicability and consistency of these documents as well a...
Lee, Sun Haeng; Moon, Byeong-Yeon; Cho, Hyun Gug
2014-02-01
[Purpose] To determine whether the improvement of vergence movements by vision therapy can decrease the K-ARS scores of symptomatic ADHD children. [Methods] Eighty-one out of 1,123 children surveyed using the K-ARS, a parents'-reported questionnaire, led to 16 of these 81 children being showed scores of ≥19, and measurement of binocular function diagnosed as having convergence insufficiency. The 16 children were divided equally into a control group and a vision therapy group. [Results] After vision therapy for 12 weeks, near point convergence (4.38±0.69 cm) significantly neared compared to the near point convergence before vision therapy (11.50±2.28 cm), and both the break point (32.38±2.53 Δ) and recovery point (19.75±2.11 Δ) of near positive fusional vergence significantly improved compared to their values before vision therapy (15.88±2.64 Δ, 6.38±6.70 Δ, respectively). Near exophoria after vision therapy (7.81±2.00 Δ BI) significantly decreased compared to its value before vision therapy (12.00±1.16 Δ BI). The K-ARS scores referring to symptomatic ADHD significantly decreased after vision therapy (17.13±2.84) compared to before vision therapy (23.25±1.49). [Conclusions] Convergence insufficiency symptoms are closely related to symptoms screened for ADHD, and vision therapy to improve vergence movements is an effective method of decreasing the K-ARS scores.
Neuroplasticity and Calcium Signaling in Stressed Rat Amygdala
2005-02-01
kainate receptor and neuroplasticity in the amygdala. National Institute of aging, November, 2001. • He Li: GluR5 kainate receptor mediated synaptic...functions in the amygdala. National Institute of Mental Health, April, 2002. 50 " Maria F. M. Braga: Chronic Stress Causes Impairment of aI-Adrenoceptor...resistance All animal experiments were performed in accordance with of 1.5-5.0 Mf when filled with a solution containing (in our institutional guidelines
Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K
1997-01-01
We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754
40Ar/39Ar technique of KAr dating: a comparison with the conventional technique
Brent, Dalrymple G.; Lanphere, M.A.
1971-01-01
K-Ar ages have been determined by the 40Ar/39Ar total fusion technique on 19 terrestrial samples whose conventional K-Ar ages range from 3.4 my to nearly 1700 my. Sample materials included biotite, muscovite, sanidine, adularia, plagioclase, hornblende, actinolite, alunite, dacite, and basalt. For 18 samples there are no significant differences at the 95% confidence level between the KAr ages obtained by these two techniques; for one sample the difference is 4.3% and is statistically significant. For the neutron doses used in these experiments (???4 ?? 1018 nvt) it appears that corrections for interfering Ca- and K-derived Ar isotopes can be made without significant loss of precision for samples with K/Ca > 1 as young as about 5 ?? 105 yr, and for samples with K/Ca < 1 as young as about 107 yr. For younger samples the combination of large atmospheric Ar corrections and large corrections for Ca- and K-derived Ar may make the precision of the 40Ar/39Ar technique less than that of the conventional technique unless the irradiation parameters are adjusted to minimize these corrections. ?? 1971.
The Potassium-Argon Laser Experiment (KArLE): Design Concepts
NASA Technical Reports Server (NTRS)
Cho, Y.; Cohen, B. A.
2017-01-01
The absolute ages of geologic events are fundamental information for understanding the timing and duration of surface processes on planetary bodies. Absolute ages can place a planet's history in the context of the solar system evolution. For example, "when was Mars warm and wet?" is one of the key questions of planetary science. If Mars was warm and wet until 3.7 billion years ago, for instance, it suggests that Mars was still warm and wet when life appeared on Earth. Mars history has been discussed so far based on crater chronology, but the current constraints for Martian chronology models come from the cratering history of the Moon [1]. Moreover, the lunar chronology model itself is fraught with uncertainty because our understanding of lunar chronology is constrained only in a few time periods and itself needs further investigation relating crater-counting ages to absolute ages [2]. Although sample return missions would provide highly accurate radiometric ages of returned samples, they are very expensive and technically challenging. In situ geochronology is highly valuable because they would have larger number of mission opportunities and the capability of iterative measurements for multiple rocks from multiple geologic units. The capability of flight instruments to perform in situ dating is required in the NASA Planetary Science Decadal Survey and the NASA Technology Roadmap. Beagle 2 is the only mission launched to date with the explicit aim to perform in situ potassium-argon (K-Ar) dating [3], but it did not happen because of the communication failure to the spacecraft. The first in situ K-Ar dating on Mars, using SAM and APXS measurements on the Cumberland mudstone [4], yielded an age of 4.21 +/- 0.35 Ga and validated the idea of K-Ar dating on other planets. However, the Curiosity method is not purposebuilt for dating and requires many assumptions that degrade its accuracy. To obtain more accurate and meaningful ages, multiple groups are developing dedicated
Effect of sample inhomogeneity in KAr dating
Engels, J.C.; Ingamells, C.O.
1970-01-01
Error in K-Ar ages is often due more to deficiencies in the splitting process, whereby portions of the sample are taken for potassium and for argon determination, than to imprecision in the analytical methods. The effect of the grain size of a sample and of the composition of a contaminating mineral can be evaluated, and this provides a useful guide in attempts to minimize error. Rocks and minerals should be prepared for age determination with the effects of contaminants and grain size in mind. The magnitude of such effects can be much larger than intuitive estimates might indicate. ?? 1970.
Therapeutic potential of metabotropic glutamate receptor modulators.
Hovelsø, N; Sotty, F; Montezinho, L P; Pinheiro, P S; Herrik, K F; Mørk, A
2012-03-01
Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson's disease, Alzheimer's disease and pain.
Therapeutic Potential of Metabotropic Glutamate Receptor Modulators
Hovelsø, N; Sotty, F; Montezinho, L.P; Pinheiro, P.S; Herrik, K.F; Mørk, A
2012-01-01
Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson’s disease, Alzheimer’s disease and pain. PMID:22942876
Characterizing Cretaceous Glaciation Events: K-Ar Ages of Southern Ocean Sediments
NASA Astrophysics Data System (ADS)
Wright, M. A.; Hemming, S. R.; Barbeau, D. L.; Torfstein, A.; Pierce, E. L.; Williams, T.; McManus, J. F.; Gombiner, J.
2012-12-01
Evidence from paleosols and carbonate weathering models suggest that the Late Cretaceous had a supergreenhouse climate due to atmospheric CO2 concentrations two to four times greater than modern levels, tropical sea surface temperatures exceeding 35°C, and high-latitude temperatures exceeding 20°C. Despite this warmth, the Late Cretaceous was apparently punctuated by large (>25 m) and rapid (<<1 million year) sea-level changes, as recorded by marginal marine stratigraphic architectures and pelagic stable isotope compositions. The magnitude and tempo of these changes suggest a glacio-eustatic control, presumably from the growth and decay of continental ice sheets on Antarctica. Because continental glaciation tends to increase the weathering of bedrock and production of sediment delivered to the oceans, circum-Antarctic marine sediment flux would be expected to increase during periods of glaciation. In order to identify a Late Cretaceous glaciation signal from such marine records, we must first constrain the compositional signal of continental detritus in marine sediments. Here we report the results of downcore K-Ar analysis of the terrigenous sediments of Quaternary Weddell Sea cores PS1170-1 and PS1388-3 in order to identify the compositional signature of continent-derived detritus deposited in the Weddell Sea during a known glacial period. Further, we use our K-Ar analyses of circum-Antarctic Quaternary sediment cores to pinpoint potential sediment source areas. Having constrained this glaciation signal, we also present preliminary K-Ar and Sm-Nd analysis of the Campanian-Maastrictian boundary event (69 Ma) at Ocean Drilling Project site 690C to assess the controversial hypothesis of Late Cretaceous glaciation of Antarctica.
Schmidt, K F; Kruse, M; Hatt, H
1994-01-01
The patch-clamp technique in combination with a fast liquid filament application system was used to study the effect of dopamine on the glutamate receptor desensitization in horizontal cells of the perch (Perca fluviatilis). Kinetics of ligand-gated ion channels in fish horizontal cells are modulated by dopamine. This modulation is presumably mediated by a cAMP-dependent protein phosphorylation. Before incubation with dopamine, the glutamate receptors of horizontal cells activate and desensitize with fast time constants. In the whole-cell recording mode, fast application of the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid prior to the dopamine incubation gives rise to fast transient currents with peak values of about 200 pA that desensitize within 100 ms. Kainate as agonist produced higher steady-state currents but no transient currents. After incubation of the cells with dopamine for 3 min, the desensitization was significantly reduced and the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid induced steady-state currents with amplitudes that were similar to the previously observed transient currents. Kainate-induced currents were only slightly affected. Fast desensitizing currents upon fast application of L-glutamate were also recorded from outside-out patches that were excised from horizontal cells before incubation with dopamine. The currents from excised patches desensitized to a steady-state level of about 0.2 of the peak amplitude with time constants of less than 2 ms. When the outside-out patches were excised from cells after dopamine incubation, steady-state currents were enhanced and no transient currents were observed. The results may indicate that the dopamine-dependent modulation of glutamate-induced currents, which is presumably mediated by a protein phosphorylation, is due to an alteration of the desensitization of the glutamate receptors. PMID:7520178
Discordant K-Ar and Young Exposure Dates for the Windjana Sandstone, Kimberley, Gale Crater, Mars
NASA Technical Reports Server (NTRS)
Vasconcelos, P. M.; Farley, K. A.; Malespin, C. A.; Mahaffy, P.; Ming, D.; McLennan, S. M.; Hurowitz, J. A.; Rice, Melissa S.
2016-01-01
K-Ar and noble gas surface exposure age measurements were carried out on the Windjana sandstone, Kimberley region, Gale Crater, Mars, by using the Sample Analysis at Mars instrument on the Curiosity rover. The sandstone is unusually rich in sanidine, as determined by CheMin X-ray diffraction, contributing to the high K2O concentration of 3.09 +/- 0.20 wt % measured by Alpha-Particle X-ray Spectrometer analysis. A sandstone aliquot heated to approximately 915 C yielded a K-Ar age of 627 +/- 50 Ma. Reheating this aliquot yielded no additional Ar. A second aliquot heated in the same way yielded a much higher K-Ar age of 1710 +/- 110 Ma. These data suggest incomplete Ar extraction from a rock with a K-Ar age older than 1710 Ma. Incomplete extraction at approximately 900 C is not surprising for a rock with a large fraction of K carried by Ar-retentive K-feldspar. Likely, variability in the exact temperature achieved by the sample from run to run, uncertainties in sample mass estimation, and possible mineral fractionation during transport and storage prior to analysis may contribute to these discrepant data. Cosmic ray exposure ages from He-3 and Ne-21 in the two aliquots are minimum values given the possibility of incomplete extraction. However, the general similarity between the He-3 (57 +/- 49 and 18 +/- 32 Ma, mean 30 Ma) and Ne-21 (2 +/- 32 and 83 +/- 24 Ma, mean 54 Ma) exposure ages provides no evidence for underextraction. The implied erosion rate at the Kimberley location is similar to that reported at the nearby Yellowknife Bay outcrop.
NASA Technical Reports Server (NTRS)
Devismes, D.; Cohen, B. A.
2016-01-01
Geochronology is a fundamental measurement for planetary samples, providing the ability to establish an absolute chronology for geological events, including crystallization history, magmatic evolution, and alteration events, and providing global and solar system context for such events. The capability for in situ geochronology will open up the ability for geochronology to be accomplished as part of lander or rover complement, on multiple samples rather than just those returned. An in situ geochronology package can also complement sample return missions by identifying the most interesting rocks to cache or return to Earth. The K-Ar radiometric dating approach to in situ dating has been validated by the Curiosity rover on Mars as well as several laboratories on Earth. Several independent projects developing in situ rock dating for planetary samples, based on the K-Ar method, are giving promising results. Among them, the Potassium (K)-Argon Laser Experiment (KArLE) at MSFC is based on techniques already in use for in planetary exploration, specifically, Laser-induced Breakdown Spectroscopy (LIBS, used on the Curiosity Chemcam), mass spectroscopy (used on multiple planetary missions, including Curiosity, ExoMars, and Rosetta), and optical imaging (used on most missions).
Ardissone, Anna; Tonduti, Davide; Legati, Andrea; Lamantea, Eleonora; Barone, Rita; Dorboz, Imen; Boespflug-Tanguy, Odile; Nebbia, Gabriella; Maggioni, Marco; Garavaglia, Barbara; Moroni, Isabella; Farina, Laura; Pichiecchio, Anna; Orcesi, Simona; Chiapparini, Luisa; Ghezzi, Daniele
2018-04-04
KARS encodes lysyl- transfer ribonucleic acid (tRNA) synthetase, which catalyzes the aminoacylation of tRNA-Lys in the cytoplasm and mitochondria. Eleven families/sporadic patients and 16 different mutations in KARS have been reported to date. The associated clinical phenotype is heterogeneous ranging from early onset encephalopathy to isolated peripheral neuropathy or nonsyndromic hearing impairment. Recently additional presentations including leukoencephalopathy as predominant cerebral involvement or cardiomyopathy, isolated or associated with muscular and cerebral involvement, have been reported. A progressive Leukoencephalopathy with brainstem and spinal cord calcifications was previously described in a singleton patient and in two siblings, without the identification of the genetic cause. We reported here about a new severe phenotype associated with biallelic KARS mutations and sharing some common points with the other already reported phenotypes, but with a distinct clinical and neuroimaging picture. Review of KARS mutant patients published to date will be also discussed. Herein, we report the clinical, biochemical and molecular findings of 2 unreported Italian patients affected by developmental delay, acquired microcephaly, spastic tetraparesis, epilepsy, sensory-neural hypoacusia, visual impairment, microcytic hypochromic anaemia and signs of hepatic dysfunction. MRI pattern in our patients was characterized by progressive diffuse leukoencephalopathy and calcifications extending in cerebral, brainstem and cerebellar white matter, with spinal cord involvement. Genetic analysis performed on these 2 patients and in one subject previously described with similar MRI pattern revealed the presence of biallelic mutations in KARS in all 3 subjects. With our report we define the molecular basis of the previously described Leukoencephalopathy with Brainstem and Spinal cord Calcification widening the spectrum of KARS related disorders, particularly in childhood onset
Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor
Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.
2011-01-01
The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591
Different Classes of Glutamate Receptors Mediate Distinct Behaviors in a Single Brainstem Nucleus
NASA Astrophysics Data System (ADS)
Dye, John; Heiligenberg, Walter; Keller, Clifford H.; Kawasaki, Masashi
1989-11-01
We have taken advantage of the increasing understanding of glutamate neuropharmacology to probe mechanisms of well-defined vertebrate behaviors. Here we report a set of experiments that suggests distinct roles for two major classes of glutamate receptors in a discrete premotor nucleus of the brainstem. The medullary pacemaker nucleus of weakly electric fish is an endogenous oscillator that controls the electric organ discharge (EOD). Its regular frequency of firing is modulated during several distinct behaviors. The pacemaker nucleus continues firing regularly when isolated in vitro, and modulatory behaviors can be reproduced by stimulating the descending input pathway. Glutamate agonists applied to the pacemaker in vitro produced increases in frequency, while glutamate antagonists selectively blocked stimulus-induced modulations. Experiments with glutamate antagonists in the intact animal resulted in specific effects on two well-characterized behaviors. Our data indicate that these behaviors are separately mediated in the pacemaker by receptors displaying characteristics of the kainate/quisqualate and N-methyl-D-aspartate subtypes of glutamate receptor, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Loo, P.; Braunwalder, A.; Lehmann, J.
PCP and other dissociative anesthetica block the increase in neuronal firing rate evoked by the EAAR agonist, N-methyl-Daspartate. NMDA and other EAAs such as glutamate (glu) have not been previously shown to affect PCP ligand binding. In the present study, using once washed rat forebrain membranes, 10 ..mu..M-glu was found to increase the binding of (/sup 3/H)TCP, a PCP analog, to defined PCP recognition sites by 20%. Removal of glu and aspartate (asp) by extensive washing decreased TCP binding by 75-90%. In these membranes, 10 ..mu..M L-glu increased TCP binding 3-fold. This effect was stereospecific and evoked by other EAAsmore » with the order of activity, L-glu > D-asp > L- asp > NMDA > D-glu > quisqualate. Kainate, GABA, NE, DA, 5-HT, 2-chloroadenosine, oxotremorine and histamine had no effect on TCP binding at concentrations up to 100 ..mu..M. The effects of L-glu were attenuated by the NMDA-type receptor antagonist, 2-amino-7--phosphonoheptanoate (AP7; 10 ..mu..M-1 mM). These findings indicate that EAAS facilitate TCP binding, possibly through NMDA-type receptors. The observed interaction between the PCP receptor and EAARs may reflect the existence of a macromolecular receptor complex similar to that demonstrated for the benzodiazepines and GABA.« less
Kinetic Contributions to Gating by Interactions Unique to N-methyl-d-aspartate (NMDA) Receptors*
Borschel, William F.; Cummings, Kirstie A.; Tindell, LeeAnn K.; Popescu, Gabriela K.
2015-01-01
Among glutamate-gated channels, NMDA receptors produce currents that subside with unusually slow kinetics, and this feature is essential to the physiology of central excitatory synapses. Relative to the homologous AMPA and kainate receptors, NMDA receptors have additional intersubunit contacts in the ligand binding domain that occur at both conserved and non-conserved sites. We examined GluN1/GluN2A single-channel currents with kinetic analyses and modeling to probe these class-specific intersubunit interactions for their role in glutamate binding and receptor gating. We found that substitutions that eliminate such interactions at non-conserved sites reduced stationary gating, accelerated deactivation, and imparted sensitivity to aniracetam, an AMPA receptor-selective positive modulator. Abolishing unique contacts at conserved sites also reduced stationary gating and accelerated deactivation. These results show that contacts specific to NMDA receptors, which brace the heterodimer interface within the ligand binding domain, stabilize actively gating receptor conformations and result in longer bursts and slower deactivations. They support the view that the strength of the heterodimer interface modulates gating in both NMDA and non-NMDA receptors and that unique interactions at this interface are responsible in part for basic differences between the kinetics of NMDA and non-NMDA currents at glutamatergic synapses. PMID:26370091
Alkaloids from Mongolian species Hypecoum lactiflorum Kar. et Kir. Pazij.
Philipov, Stefan; Istatkova, Ralitsa; Denkova, Pavletta; Dangaa, Selenge; Samdan, Javzan; Krosnova, Marieta; Munkh-Amgalan, Chogsom
2009-01-01
A new secoberbine alkaloid (-)-N-methylcorydalisol was isolated from the aerial parts of Hypecoum lactiflorum Kar. et Kir. Pazij. (Papaveraceae) of Mongolian origin and was characterised. The known alkaloids of protopine and protoberberine type protopine, allocryptopine, (-)-N-methylcanadine and (-)-N-methylstylopine were also isolated. (-)-N-methylstylopine is a new alkaloid for the genus, while (-)-N-methylcanadine is new for the species. All structures were established by physical and spectral analysis.
Role of AMPA glutamate receptors in the conditioned rewarding effects of MDMA in mice.
García-Pardo, M P; Miñarro, J; Aguilar, M A
2018-07-16
Currently, there is not an effective treatment for 3,4-methylenedioxymethamphetamine (MDMA) dependence but pharmacotherapies targeting glutamate neurotransmission are a promising strategy. Previously, we showed that blockade of glutamate NMDA and AMPA receptors impairs the conditioned rewarding effects of MDMA and cocaine, respectively. In this study we evaluated the role of AMPA receptors in the rewarding effects of MDMA in mice using the conditioned place preference (CPP) paradigm. Mice were conditioned with MDMA (1.25 mg/kg) 60 min after the treatment with saline or different doses (0.25, 1 and 5 mg/kg) of the AMPA/kainate receptor antagonist, 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Mice conditioned with MDMA acquired CPP while those treated with any dose of CNQX + MDMA did not. These results supported the involvement of the glutamatergic system in the rewarding properties of MDMA, and suggest that AMPA receptor blockade could be a new therapeutic option for the treatment of those individuals that develop MDMA dependence. Copyright © 2018 Elsevier B.V. All rights reserved.
Grassi, Silvarosa; Frondaroli, Adele; Dieni, Cristina; Dutia, Mayank B; Pettorossi, Vito E
2007-07-01
In rat brainstem slices, we investigated the influence of the neurosteroids tetrahydrodeoxycorticosterone (THDOC) and allopregnanolone (ALLO) on the synaptically driven and spontaneous activity of vestibular neurons, by analysing their effects on the amplitude of the field potentials evoked in the medial vestibular nuclei (MVN) by vestibular afferent stimulation and on the spontaneous firing rate of MVN neurons. Furthermore, the interaction with gamma-aminobutyric acid (GABA) and glutamate receptors was analysed by using specific antagonists for GABA(A) (bicuculline), alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)/ kainate [2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo(f)quinoxaline-7-sulphonamide disodium salt (NBQX)], N-methyl-D-aspartate (NMDA) [D-(-)-2-amino-5-phosphonopentanoic acid (AP-5)] and group I metabotropic glutamate receptors (mGlu-I) [(R,S)-1-aminoindan-1,5-dicarboxylic acid (AIDA)] receptors. THDOC and ALLO evoked two opposite long-lasting effects, consisting of either a potentiation or a reduction of field potential and firing rate, which showed early and late components, occurring in conjunction or separately after neurosteroid application. The depressions depended on GABA(A) receptors, as they were abolished by bicuculline, while early potentiation involved glutamate AMPA/kainate receptors, as NBQX markedly reduced the incidence of early firing rate enhancement and, in the case of ALLO, even provoked depression. This suggests that THDOC and ALLO enhance the GABA(A) inhibitory influence on the MVN neurons and facilitate the AMPA/kainate facilitatory one. Conversely, a late potentiation effect, which was still induced after glutamate and GABA(A) receptor blockade, might involve a different mechanism. We conclude that the modulation of neuronal activity in the MVN by THDOC and ALLO, through their actions on GABA(A) and AMPA/kainate receptors, may have a physiological role in regulating the vestibular system function under normal
NASA Technical Reports Server (NTRS)
French, R. A.; Cohen, B. A.; Miller, J. S.
2014-01-01
KArLE (Potassium--Argon Laser Experiment) has been developed for in situ planetary geochronology using the K - Ar (potassium--argon) isotope system, where material ablated by LIBS (Laser--Induced Breakdown Spectroscopy) is used to calculate isotope abundances. We are determining the accuracy and precision of volume measurements of these pits using stereo and laser microscope data to better understand the ablation process for isotope abundance calculations. If a characteristic volume can be determined with sufficient accuracy and precision for specific rock types, KArLE will prove to be a useful instrument for future planetary rover missions.
2013-01-01
Background Previous work showed differences in the polysynaptic activation of GABAergic synapses during corticostriatal suprathreshold responses in direct and indirect striatal projection neurons (dSPNs and iSPNs). Here, we now show differences and similarities in the polysynaptic activation of cortical glutamatergic synapses on the same responses. Corticostriatal contacts have been extensively studied. However, several questions remain unanswered, e.g.: what are the differences and similarities in the responses to glutamate in dSPNs and iSPNs? Does glutamatergic synaptic activation exhibits a distribution of latencies over time in vitro? That would be a strong suggestion of polysynaptic cortical convergence. What is the role of kainate receptors in corticostriatal transmission? Current-clamp recordings were used to answer these questions. One hypothesis was: if prolonged synaptic activation distributed along time was present, then it would be mainly generated from the cortex, and not from the striatum. Results By isolating responses from AMPA-receptors out of the complex suprathreshold response of SPNs, it is shown that a single cortical stimulus induces early and late synaptic activation lasting hundreds of milliseconds. Prolonged responses depended on cortical stimulation because they could not be elicited using intrastriatal stimulation, even if GABAergic transmission was blocked. Thus, the results are not explained by differences in evoked inhibition. Moreover, inhibitory participation was larger after cortical than after intrastriatal stimulation. A strong activation of interneurons was obtained from the cortex, demonstrating that polysynaptic activation includes the striatum. Prolonged kainate (KA) receptor responses were also elicited from the cortex. Responses of dSPNs and iSPNs did not depend on the cortical area stimulated. In contrast to AMPA-receptors, responses from NMDA- and KA-receptors do not exhibit early and late responses, but generate slow
Wang, Yi; Liang, Jiao; Xu, Cenglin; Wang, Ying; Kuang, Yifang; Xu, Zhenghao; Guo, Yi; Wang, Shuang; Gao, Feng; Chen, Zhong
2016-02-01
High-frequency stimulation (HFS) of the anterior nucleus of thalamus (ANT) is a new and alternative option for the treatment of intractable epilepsy. However, the responder rate is relatively low. The present study was designed to determine the effect of low-frequency stimulation (LFS) in ANT on chronic spontaneous recurrent seizures and related pathological pattern in intra-hippocampal kainate mouse model. We found that LFS (1 Hz, 100 μs, 300 μA), but not HFS (100 Hz, 100 μs, 30 μA), in bilateral ANT significantly decreased the frequency of spontaneous recurrent seizures, either non-convulsive focal seizures or tonic-clonic generalized seizures. The anti-epileptic effect persisted for one week after LFS cessation, which manifested as a long-term inhibition of the frequency of seizures with short (20-60 s) and intermediate duration (60-120 s). Meanwhile, LFS decreased the frequency of high-frequency oscillations (HFOs) and interictal spikes, two indicators of seizure severity, whereas HFS increased the HFO frequency. Furthermore, LFS decreased the power of the delta band and increased the power of the gamma band of hippocampal background EEG. In addition, LFS, but not HFS, improved the performance of chronic epileptic mice in objection-location task, novel objection recognition and freezing test. These results provide the first evidence that LFS in ANT alleviates kainate-induced chronic epilepsy and cognitive impairment, which may be related to the modulation of the hippocampal EEG rhythm. This may be of great therapeutic significance for clinical treatment of epilepsy with deep brain stimulation. Copyright © 2015 Elsevier Inc. All rights reserved.
Modulation of taurine release by glutamate receptors and nitric oxide.
Oja, S S; Saransaari, P
2000-11-01
Taurine is held to function as a modulator and osmoregulator in the central nervous system, being of particular importance in the immature brain. In view of the possible involvement of excitatory pathways in the regulation of taurine function in the brain, the interference of glutamate receptors with taurine release from different tissue preparations in vitro and from the brain in vivo is of special interest. The release of taurine from the brain is enhanced by glutamate receptor agonists. This enhancement is inhibited by the respective receptor antagonists both in vitro and in vivo. The ionotropic N-methyl-D-aspartate (NMDA) and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor agonists appear to be the most effective in enhancing taurine release, their effects being receptor-mediated. Kainate is less effective, particularly in adults. Of the glutamate receptors, the NMDA class seems to be the most susceptible to modulation by nitric oxide. Nitric oxide also modulates taurine release, enhancing the basal release in both immature and mature hippocampus, whereas the K(+)-stimulated release is generally inhibited. Metabotropic glutamate receptors also participate in the regulation of taurine release, group I metabotropic glutamate receptors potentiating the release in the developing hippocampus, while group III receptors may be involved in the adult. Under various cell-damaging conditions, including ischemia, hypoxia and hypoglycemia, taurine release is enhanced, together with an enhanced release of excitatory amino acids. The increase in extracellular taurine upon excessive stimulation of glutamate receptors and under cell-damaging conditions may serve as an important protective mechanism against excitotoxicity, being particularly effective in the immature brain.
McCulloch, P. F.; DiNovo, K. M.; Westerhaus, D. J.; Vizinas, T. A.; Peevey, J. F.; Lach, M. A.; Czarnocki, P.
2013-01-01
Afferent information initiating the cardiorespiratory responses during nasal stimulation projects from the nasal passages to neurons within the trigeminal medullary dorsal horn (MDH) via the anterior ethmoidal nerve (AEN). Central AEN terminals are thought to release glutamate to activate the MDH neurons. This study was designed to determine which neurotransmitter receptors (AMPA, kainate, or NMDA glutamate receptor subtypes or the Substance P receptor NK1) are expressed by these activated MDH neurons. Fos was used as a neuronal marker of activated neurons, and immunohistochemistry combined with epifluorescent microscopy was used to determine which neurotransmitter receptor subunits were coexpressed by activated MDH neurons. Results indicate that, during nasal stimulation with ammonia vapors in urethane-anesthetized Sprague-Dawley rats, activated neurons within the superficial MDH coexpress the AMPA glutamate receptor subunits GluA1 (95.8%) and GluA2/3 (88.2%), the NMDA glutamate receptor subunits GluN1 (89.1%) and GluN2A (41.4%), and NK1 receptors (64.0%). It is therefore likely that during nasal stimulation the central terminals of the AEN release glutamate and substance P that then produces activation of these MDH neurons. The involvement of AMPA and NMDA receptors may mediate fast and slow neurotransmission, respectively, while NK1 receptor involvement may indicate activation of a nociceptive pathway. PMID:24967301
Glutamatergic targets for new alcohol medications
Spanagel, Rainer; Krystal, John H.
2013-01-01
Rationale An increasingly compelling literature points to a major role for the glutamate system in mediating the effects of alcohol on behavior and the pathophysiology of alcoholism. Preclinical studies indicate that glutamate signaling mediates certain aspects of ethanol’s intoxicating and rewarding effects, and undergoes adaptations following chronic alcohol exposure that may contribute to the withdrawal, craving and compulsive drug-seeking that drive alcohol abuse and alcoholism. Objectives We discuss the potential for targeting the glutamate system as a novel pharmacotherapeutic approach to treating alcohol use disorders, focusing on five major components of the glutamate system: the N-methyl-D-aspartate (NMDA) receptor and specific NMDA subunits, the glycineB site on the NMDA receptors (NMDAR), L-alpha-amino-3-hydroxy-5-methyl-isoxazole-4-propionic acid ionotropic (AMPA) and kainate (KAR) receptors, metabotropic receptors (mGluR), and glutamate transporters. Results Chronic alcohol abuse produces a hyperglutamatergic state, characterized by elevated extracellular glutamate and altered glutamate receptors and transporters. Pharmacologically manipulating glutamatergic neurotransmission alters alcohol-related behaviors including intoxication, withdrawal, and alcohol-seeking, in rodents and human subjects. Blocking NMDA and AMPA receptors reduces alcohol consumption in rodents, but side-effects may limit this as a therapeutic approach. Selectively targeting NMDA and AMPA receptor subunits (e.g., GluN2B, GluA3), or the NMDAR glycineB site offers an alternative approach. Blocking mGluR5 potently affects various alcohol-related behaviors in rodents, and mGluR2/3 agonism also suppresses alcohol consumption. Finally, glutamate transporter upregulation may mitigate behavioral and neurotoxic sequelae of excess glutamate caused by alcohol. Conclusions Despite the many challenges that remain, targeting the glutamate system offers genuine promise for developing new
An investigation of the source of air Ar contamination in KAr dating
Mussett, A.E.; Brent, Dalrymple G.
1968-01-01
Precision of young KAr ages is limited by air argon contamination. A series of experiments in which the exposure of basalt and sanidine samples to air argon was controlled, shows that most of the air contamination does not arise in the laboratory. Because of this, it seems unlikely that air argon contamination can be significantly reduced by special sample handling and preparation techniques. ?? 1968.
NASA Astrophysics Data System (ADS)
Miledi, Ricardo; Eusebi, Fabrizio; Martínez-Torres, Ataúlfo; Palma, Eleonora; Trettel, Flavia
2002-10-01
The Xenopus oocyte is a very powerful tool for studies of the structure and function of membrane proteins, e.g., messenger RNA extracted from the brain and injected into oocytes leads to the synthesis and membrane incorporation of many types of functional receptors and ion channels, and membrane vesicles from Torpedo electroplaques injected into oocytes fuse with the oocyte membrane and cause the appearance of functional Torpedo acetylcholine receptors and Cl channels. This approach was developed further to transplant already assembled neurotransmitter receptors from human brain cells to the plasma membrane of Xenopus oocytes. Membranes isolated from the temporal neocortex of a patient, operated for intractable epilepsy, were injected into oocytes and, within a few hours, the oocyte membrane acquired functional neurotransmitter receptors to -aminobutyric acid, -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate, and glycine. These receptors were also expressed in the plasma membrane of oocytes injected with mRNA extracted from the temporal neocortex of the same patient. All of this makes the Xenopus oocyte a more useful model than it already is for studies of the structure and function of many human membrane proteins and opens the way to novel pathophysiological investigations of some human brain disorders.
Akgül, Gülcan; McBain, Chris J
2016-10-01
Glutamate receptor-mediated recruitment of GABAergic inhibitory interneurons is a critical determinant of network processing. Early studies observed that many, but not all, interneuron glutamatergic synapses contain AMPA receptors that are GluA2-subunit lacking and Ca(2+) permeable, making them distinct from AMPA receptors at most principal cell synapses. Subsequent studies demonstrated considerable alignment of synaptic AMPA and NMDA receptor subunit composition within specific subtypes of interneurons, suggesting that both receptor expression profiles are developmentally and functionally linked. Indeed glutamate receptor expression profiles are largely predicted by the embryonic origins of cortical interneurons within the medial and caudal ganglionic eminences of the developing telencephalon. Distinct complements of AMPA and NMDA receptors within different interneuron subpopulations contribute to the differential recruitment of functionally divergent interneuron subtypes by common afferent inputs for appropriate feed-forward and feedback inhibitory drive and network entrainment. In contrast, the lesser-studied kainate receptors, which are often present at both pre- and postsynaptic sites, appear to follow an independent developmental expression profile. Loss of specific ionotropic glutamate receptor (iGluR) subunits during interneuron development has dramatic consequences for both cellular and network function, often precipitating circuit inhibition-excitation imbalances and in some cases lethality. Here we briefly review recent findings highlighting the roles of iGluRs in interneuron development. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Changes in flip/flop splicing of astroglial AMPA receptors in human temporal lobe epilepsy.
Seifert, Gerald; Schröder, Wolfgang; Hinterkeuser, Stefan; Schumacher, Thekla; Schramm, Johannes; Steinhäuser, Christian
2002-01-01
Recent data suggested a role for glial cells in epilepsy. This study sought to identify and functionally characterize AMPA receptors expressed by astrocytes in human hippocampal tissue resected from patients with intractable temporal lobe epilepsy. Patch-clamp and fast application methods were combined to investigate astrocytes in situ and after fresh isolation from the stratum radiatum of the hippocampal CA1 subfield. Relying on presurgical and histopathologic analysis, we divided human specimens into two groups, Ammon's horn sclerosis (AHS) and lesion-associated epilepsy. Fast application of glutamate and kainate evoked receptor currents in all cells studied. Reversal-potential analysis revealed an intermediate Ca2+ permeability of the receptor channels that did not vary between the two groups of patients. However, preapplication of the AMPA receptor-specific modulator, cyclothiazide, disclosed differences in flip-flop splicing. This treatment considerably enhanced the receptor conductance, with potentiation being significantly stronger in cells from AHS specimens compared with lesion-associated cells, suggesting upregulation of AMPA receptor flip splice variants in astrocytes of the sclerotic tissue. Compelling evidence has been accumulated showing direct and rapid signaling between neurons and glial cells. Our data suggest that in AHS patients, neuronally released glutamate will lead to an enhanced and prolonged depolarization of astrocytes, which might be involved in seizure generation and spread in this particular condition of human temporal lobe epilepsy.
Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus
Minbay, Zehra; Kocoglu, Sema Serter; Yurtseven, Duygu Gok; Eyigor, Ozhan
2017-01-01
In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus. PMID:28027456
Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus.
Minbay, Zehra; Serter Kocoglu, Sema; Gok Yurtseven, Duygu; Eyigor, Ozhan
2017-02-21
In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus.
Hachem, Laureen D; Mothe, Andrea J; Tator, Charles H
2016-08-15
Traumatic spinal cord injury (SCI) leads to a cascade of secondary chemical insults, including oxidative stress and glutamate excitotoxicity, which damage host neurons and glia. Transplantation of exogenous neural stem/progenitor cells (NSPCs) has shown promise in enhancing regeneration after SCI, although survival of transplanted cells remains poor. Understanding the response of NSPCs to the chemical mediators of secondary injury is essential in finding therapies to enhance survival. We examined the in vitro effects of glutamate and glutamate receptor agonists on adult rat spinal cord-derived NSPCs. NSPCs isolated from the periventricular region of the adult rat spinal cord were exposed to various concentrations of glutamate for 96 h. We found that glutamate treatment (500 μM) for 96 h significantly increased live cell numbers, reduced cell death, and increased proliferation, but did not significantly alter cell phenotype. Concurrent glutamate treatment (500 μM) in the setting of H2O2 exposure (500 μM) for 10 h increased NSPC survival compared to H2O2 exposure alone. The effects of glutamate on NSPCs were blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)/kainate receptor antagonist GYKI-52466, but not by the N-methyl-D-aspartic acid receptor antagonist MK-801 or DL-AP5, or the mGluR3 antagonist LY-341495. Furthermore, treatment of NSPCs with AMPA, kainic acid, or the kainate receptor-specific agonist (RS)-2-amino-3-(3-hydroxy-5-tert-butylisoxazol-4-yl)propanoic acid mimicked the responses seen with glutamate both alone and in the setting of oxidative stress. These findings offer important insights into potential mechanisms to enhance NSPC survival and implicate a potential role for glutamate in promoting NSPC survival and proliferation after traumatic SCI.
Loureiro-Dos-Santos, N E; Reis, R A; Kubrusly, R C; de Almeida, O M; Gardino, P F; de Mello, M C; de Mello, F G
2001-05-01
Choline acetyltransferase (ChAT) activity was reduced by more than 85% in cultured retina cells after 16 h treatment with 150 microM kainate (T(1/2) : 3.5 h). Glutamate, AMPA and quisqualate also inhibited the enzyme in equivalent proportion. Cell lesion measured by lactate dehydrogenase (LDH) release, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide - thiazolyl blue (MTT) reduction and microscopic observation was not detected even after 48 h with kainate. Other retina neurochemical markers were not affected by kainate and full recovery of the enzyme was achieved 9 days after kainate removal. Moreover, hemicolinium-3 sensitive choline uptake and hemicolinium-3 binding sites were maintained intact after kainate treatment. The immunoblot and immunohistochemical analysis of the enzyme revealed that ChAT molecules were maintained in cholinergic neurons. The use of antagonists showed that ionotropic and group 1 metabotropic receptors mediated the effect of glutamate on ChAT inhibition, in a calcium dependent manner. The quisqualate mediated ChAT inhibition and part of the kainate effect (30%) was prevented by 5 mM N(G)-nitro-L-arginine methyl ester (L-NAME). Veratridine (3 microM) also reduced ChAT by a Ca(2+) dependent, but glutamate independent mechanism and was prevented by 1 microM tetrodotoxin.
Santangelo Freel, Rose M.; Ogden, Kevin K.; Strong, Katie L.; Khatri, Alpa; Chepiga, Kathryn M.; Jensen, Henrik S.; Traynelis, Stephen F.; Liotta, Dennis C.
2015-01-01
We describe here the synthesis and evaluation of a series of tetrahydroisoquinolines that show subunit-selective potentiation of NMDA receptors containing the GluN2C or GluN2D subunits. Bischler-Napieralski conditions were employed in the key step for the conversion of acyclic amides to the corresponding tetrahydroisoquinoline containing analogs. Compounds were evaluated using both two electrode voltage clamp recordings from Xenopus laevis oocytes and imaging of mammalian BHK cells loaded with Ca2+-sensitive dyes. The most potent analogues had EC50 values of 300 nM and showed over 2-fold potentiation of the response to maximally effective concentrations of glutamate and glycine, but had no effect on responses from NMDA receptors containing the GluN2A or GluN2B subunits, AMPA, kainate, GABA, or glycine receptors or a variety of other potential targets. These compounds represent a potent class of small molecule subunit-selective potentiators of NMDA receptors. PMID:23627311
Stress state and movement potential of the Kar-e-Bas fault zone, Fars, Iran
NASA Astrophysics Data System (ADS)
Sarkarinejad, Khalil; Zafarmand, Bahareh
2017-08-01
The Kar-e-Bas or Mengharak basement-inverted fault is comprised of six segments in the Zagros foreland folded belt of Iran. In the Fars region, this fault zone associated with the Kazerun, Sabz-Pushan and Sarvestan faults serves as a lateral transfer zone that accommodates the change in shortening direction from the western central to the eastern Zagros. This study evaluates the recent tectonic stress regime of the Kar-e-Bas fault zone based on inversion of earthquake focal mechanism data, and quantifies the fault movement potential of this zone based on the relationship between fault geometric characteristics and recent tectonic stress regimes. The trend and plunge of σ 1 and σ 3 are S25°W/04°-N31°E/05° and S65°E/04°-N60°W/10°, respectively, with a stress ratio of Φ = 0.83. These results are consistent with the collision direction of the Afro-Arabian continent and the Iranian microcontinent. The near horizontal plunge of maximum and minimum principle stresses and the value of stress ratio Φ indicate that the state of stress is nearly strike-slip dominated with little relative difference between the value of two principal stresses, σ 1 and σ 2. The obliquity of the maximum compressional stress into the fault trend reveals a typical stress partitioning of thrust and strike-slip motion in the Kar-e-Bas fault zone. Analysis of the movement potential of this fault zone shows that its northern segment has a higher potential of fault activity (0.99). The negligible difference between the fault-plane dips of the segments indicates that their strike is a controlling factor in the changes in movement potential.
Moon, C; Fraser, S P; Djamgoz, M B
2000-02-01
The GABA(A) receptor and the non-NMDA subtype of the ionotropic glutamate receptor were co-expressed in Xenopus oocytes by injection of quail brain mRNA. The oocytes were treated with various protein kinase (PK) and protein phosphatase (PP) activators and inhibitors and the effects on receptor functioning were monitored. Two phorbol esters, 4-beta-phorbol 12-myristate-13-acetate (PMA) and 4-beta-phorbol 12,13-dibutyrate (PDBu); the cGMP-dependent PK activators sodium nitroprusside (SNP) and S-nitrosoglutathione (SNOG); and the PP inhibitor okadaic acid (OA) reduced the amplitude of the GABA-induced currents, whilst the PK inhibitor staurosporine potentiated it. In addition, PMA, PDBu, SNP, and OA reduced the desensitization of the GABA-induced response. Identical treatments generally had similar but less pronounced effects on responses generated by kainate (KA) but the desensitization characteristic of the non-NMDA receptor was not affected. None of the treatments had any effect on the reversal potentials of the induced currents. Immunoblots revealed that the oocytes express endogenous PKG and guanylate cyclase. The results are discussed in terms of the molecular structures of GABA(A) and non-NMDA receptors and the potential functional consequences of phosphorylation/dephosphorylation.
Interpretation of K-Ar dates of illitic clays from sedimentary rocks aided by modeling
Srodon, J.; Clauer, Norbert; Eberl, D.D.D.
2002-01-01
K-Ar dates of illitic clays from sedimentary rocks may contain "mixed ages," i.e., may have ages that are intermediate between the ages of end-member events. Two phenomena that may cause mixed ages are: (1) long-lasting reaction during the burial illitization of smectite: and (2) physical mixing of detrital and diagenetic components. The first phenomenon was investigated by simulation of illitization reactions using a nucleation and growth mechanism. These calculations indicate that values for mixed ages are related to burial history: for an equivalent length of reaction time, fast burial followed by slow burial produces much older mixed ages than slow burial followed by fast. The type of reaction that occured in a rock can be determined from the distribution of ages with respect to the thickness of illite crystals. Dating of artificial mixtures confirms a non-linear relation between mixed ages and the proportions of the components. Vertical variation of K-Ar age dates from Gulf Coast shales can be modeled by assuming diagenetic illitization that overprints a subtle vertical trend (presumably of sedimentary origin) in detrital mineral content.
Uzunova, Genoveva; Hollander, Eric; Shepherd, Jason
2014-01-01
Autism spectrum disorder (ASD) and Fragile X syndrome (FXS) are relatively common childhood neurodevelopmental disorders with increasing incidence in recent years. They are currently accepted as disorders of the synapse with alterations in different forms of synaptic communication and neuronal network connectivity. The major excitatory neurotransmitter system in brain, the glutamatergic system, is implicated in learning and memory, synaptic plasticity, neuronal development. While much attention is attributed to the role of metabotropic glutamate receptors in ASD and FXS, studies indicate that the ionotropic glutamate receptors (iGluRs) and their regulatory proteins are also altered in several brain regions. Role of iGluRs in the neurobiology of ASD and FXS is supported by a weight of evidence that ranges from human genetics to in vitro cultured neurons. In this review we will discuss clinical, molecular, cellular and functional changes in NMDA, AMPA and kainate receptors and the synaptic proteins that regulate them in the context of ASD and FXS. We will also discuss the significance for the development of translational biomarkers and treatments for the core symptoms of ASD and FXS.
Chida, Kuniaki; Kaneko, Kenya; Fujii, Satoshi; Yamazaki, Yoshihiko
2015-01-01
The axonal conduction of action potentials in the nervous system is generally considered to be a stable signal for the relaying of information, and its dysfunction is involved in impairment of cognitive function. Recent evidence suggests that the conduction properties and excitability of axons are more variable than traditionally thought. To investigate possible changes in the conduction of action potentials along axons in the central nervous system, we recorded action potentials from granule cells that were evoked and conducted antidromically along unmyelinated mossy fibers in the rat hippocampus. To evaluate changes in axons by eliminating any involvement of changes in the somata, two latency values were obtained by stimulating at two different positions and the latency difference between the action potentials was measured. A conditioning electrical stimulus of 20 pulses at 1 Hz increased the latency difference and this effect, which lasted for approximately 30 s, was inhibited by the application of an α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)/kainate receptor antagonist or a GluK1-containing kainate receptor antagonist, but not by an AMPA receptor-selective antagonist or an N-methyl-d-aspartate receptor antagonist. These results indicated that axonal conduction in mossy fibers is modulated in an activity-dependent manner through the activation of GluK1-containing kainate receptors. These dynamic changes in axonal conduction may contribute to the physiology and pathophysiology of the brain. © 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Application of K-Ar Dating to the Chronology of Young Volcanic Centers
NASA Astrophysics Data System (ADS)
Lanphere, M. A.
2003-12-01
K-Ar dating and a derivative technique, 40Ar/39Ar dating, are methods of high-precision chronology applicable to young volcanic centers. Cascade volcanoes studied in detail by several USGS volcanologists, Duane Champion paleomagetist, and me include Mt. Baker, WA; Mt. Rainier, WA; Mt. Adams, WA; Mt. Hood, OR; Crater Lake, OR; and Medicine Lake, CA. For Mt. Adams using detailed geologic mapping by Hildreth and Fierstein and 74 K-Ar ages for 63 mapped units, Hildreth and Lanphere established a detailed chronology for the stratovolcano. Good agreement has been achieved for K-Ar ages and 40Ar/39Ar ages of rocks from Mt. Adams as young as 36 ka. A similar detailed chronology has been established for other Cascade volcanoes using andesites, in particular. These chronologies often take 10 years or more to develop. Major advantages of the 40Ar/39Ar technique are the ability to work with small sample sizes and the possibility to push the technique to very young ages. The Campanian Ignimbrite erupted from the Campi Flegrei crater near Naples, Italy is an example of the use of small samples. Nine incremental-heating ages were determined on samples of sanidine ranging in size from 47 mg to 67 mg. These samples yielded ages for the Campanian Ignimbrite ranging from 37.1 +/- 0.75 ka to 39.5 +/- 0.62 ka and averaging 38.1 +/- 0.8 ka. Other workers have proposed 40Ar/39Ar ages for the Campanian Ignimbrite of 37.1 +/- 0.4 ka and 39.3 +/- 0.1 ka. An example of the use of 40Ar/39Ar dating of very young samples is the Christian Era (CE) age of the Vesuvius eruption of year 79. Eight packets of sanidine weighing 213-296 mg from two localities, Casti Amanti in Pompeii and Villa Poppea in nearby Oplontis, yielded a weighted-mean incremental-heating age of 1924 +/- 66 years. The known age for the CE 79 eruption of Vesuvius is 1924 years. Earlier studies of Vesuvius by other workers yielded an 40Ar/39Ar age for the Villa Poppea locality of 1922 +/- 72 years.
Archaeogeophysical Studies in the Ruins of Kars-Ani (Turkey) in the 2009 Excavation Season
NASA Astrophysics Data System (ADS)
Hoskan, Nihan; Ahmet Yuksel, Fethi; Gorucu, Ziya; Coruhlu, Yasar
2010-05-01
The Ani ancient city, which is at 48 km distance to Kars (Turkey), is founded at the banks of the Arpacay River flowing in the vicinity of Turkey - Armenia border and is in the borders of Mevcut Ocakli Village. Recent studies show that the first settlement in Ani ancient city could be in the 5th millenium B.C.(Chalcolithic Period) and moreover, there were some buildings built in the Iron and Bronze Period. In the early 9th century, Ashot Msaker, who was Bagratuni dynasty (806-827), declared their first capital city at Bagaran, some 40 km south of Ani, and then transferred it to Kars in the year 929. In 961, King Ashot III (953-977) transferred the capital city from Kars to Ani. Ani expanded during the reign of King Smbat II (977-989). Recent research shows that by the early 11th century the population of Ani was over 100,000. After capture of Ashot, Ani surrendered to Byzantine controlled in 1045. A Greek governor was installed in the city. In 1064 a Seljuk Turkish army, headed by Sultan Alparslan, attacked and captured Ani. Then the Georgians captured Ani in 1124, 1161 and 1174. By the 14th century Ani was ruled by the Turkish dynasties, namely Jalayrids and the Kara Koyunlu. After the Persian Safavids ruled Ani, it became part of the Turkish Ottoman Empire in 1579. A small town remained within its walls until 1650 A.C. and it was completely abandoned by the middle of the 18th century. Examples of Sasani, Arabic, Armenian, and Seljuk architecture can be found among the Ani ruins. Ani is home to the first Turkish mosque built in Anatolia, namely Ebul Menucehr. The mosque was erected by the members of the Seljuk Dynasty in 1072. The first archaeological excavations were conducted at Ani in 1892. Since then, several archaeological excavations have been done in Ani. In the 2009 excavation season, magnetic methods were applied in Ani ruins to find the exact locations of the ruins. Magnetic Gradient Measurements were taken in front of Ebul Menucehr Mosque. After
Chalokwu, C.I.; Ghazi, M.A.; Foord, E.E.
1997-01-01
The pegmatite-aplite rocks at Mankwadzi (Ejisimanku Hills) in southeastern Ghana are part of the pegmatite district that extends from Cape Coast to Winneba along the Atlantic coastline. The pegmatites are associated with the Cape Coast granite complex and were intruded during the waning phase of the Eburnian Orogeny (???2.0 Ga). Three muscovite separates from pegmatite give K-Ar retention ages of 1909 ?? 13 Ma, 1965 ?? 13 Ma and 2019 ?? 14 Ma. A biotite separate from granite yields a K-Ar age of 1907 ?? 13 Ma. These ages are similar to K-Ar dates previously reported for the Cape Coast granites, indicating that the granites and pegmatites are coeval and probably genetically linked. The pegmatites are enriched in Li, Be, Nb and Sn and considerably impoverished in Rb, Th, Y and REEs. Microscopic examination of quartz from the pegmatites shows a large number of low salinity fluid inclusions that can be divided into two types: (1) one-phase liquid or gas-filled inclusions; and (2) two-phase liquid-vapour inclusions, with the vapour occupying 2-5% of the volume. The homogenisation temperature of the fluid inclusions clusters between 129 and 144??C. These homogenisation temperatures lead to an inferred entrapment temperature of ???300??C at a pressure of ???2.5 kbar, which is estimated for the metamorphism of host hornblende schists. The pegmatite fluid inclusions are interpreted as being secondary to the quartz hosts. ?? 1997 Elsevier Science Limited.
Potentiation of NMDA receptor-mediated transmission in striatal cholinergic interneurons
Oswald, Manfred J.; Schulz, Jan M.; Kelsch, Wolfgang; Oorschot, Dorothy E.; Reynolds, John N. J.
2015-01-01
Pauses in the tonic firing of striatal cholinergic interneurons (CINs) emerge during reward-related learning in response to conditioning of a neutral cue. We have previously reported that augmenting the postsynaptic response to cortical afferents in CINs is coupled to the emergence of a cell-intrinsic afterhyperpolarization (AHP) underlying pauses in tonic activity. Here we investigated in a bihemispheric rat-brain slice preparation the mechanisms of synaptic plasticity of excitatory afferents to CINs and the association with changes in the AHP. We found that high frequency stimulation (HFS) of commissural corticostriatal afferents from the contralateral hemisphere induced a robust long-term depression (LTD) of postsynaptic potentials (PSP) in CINs. Depression of the PSP of smaller magnitude and duration was observed in response to HFS of the ipsilateral white matter or cerebral cortex. In Mg2+-free solution HFS induced NMDA receptor-dependent potentiation of the PSP, evident in both the maximal slope and amplitude of the PSP. The increase in maximal slope corroborates previous findings, and was blocked by antagonism of either D1-like dopamine receptors with SCH23390 or D2-like dopamine receptors with sulpiride during HFS in Mg2+-free solution. Potentiation of the slower PSP amplitude component was due to augmentation of the NMDA receptor-mediated potential as this was completely reversed on subsequent application of the NMDA receptor antagonist AP5. HFS similarly potentiated NMDA receptor currents isolated by blockade of AMPA/kainate receptors with CNQX. The plasticity-induced increase in the slow PSP component was directly associated with an increase in the subsequent AHP. Thus plasticity of cortical afferent synapses is ideally suited to influence the cue-induced firing dynamics of CINs, particularly through potentiation of NMDA receptor-mediated synaptic transmission. PMID:25914618
Potentiation of NMDA receptor-mediated transmission in striatal cholinergic interneurons.
Oswald, Manfred J; Schulz, Jan M; Kelsch, Wolfgang; Oorschot, Dorothy E; Reynolds, John N J
2015-01-01
Pauses in the tonic firing of striatal cholinergic interneurons (CINs) emerge during reward-related learning in response to conditioning of a neutral cue. We have previously reported that augmenting the postsynaptic response to cortical afferents in CINs is coupled to the emergence of a cell-intrinsic afterhyperpolarization (AHP) underlying pauses in tonic activity. Here we investigated in a bihemispheric rat-brain slice preparation the mechanisms of synaptic plasticity of excitatory afferents to CINs and the association with changes in the AHP. We found that high frequency stimulation (HFS) of commissural corticostriatal afferents from the contralateral hemisphere induced a robust long-term depression (LTD) of postsynaptic potentials (PSP) in CINs. Depression of the PSP of smaller magnitude and duration was observed in response to HFS of the ipsilateral white matter or cerebral cortex. In Mg(2+)-free solution HFS induced NMDA receptor-dependent potentiation of the PSP, evident in both the maximal slope and amplitude of the PSP. The increase in maximal slope corroborates previous findings, and was blocked by antagonism of either D1-like dopamine receptors with SCH23390 or D2-like dopamine receptors with sulpiride during HFS in Mg(2+)-free solution. Potentiation of the slower PSP amplitude component was due to augmentation of the NMDA receptor-mediated potential as this was completely reversed on subsequent application of the NMDA receptor antagonist AP5. HFS similarly potentiated NMDA receptor currents isolated by blockade of AMPA/kainate receptors with CNQX. The plasticity-induced increase in the slow PSP component was directly associated with an increase in the subsequent AHP. Thus plasticity of cortical afferent synapses is ideally suited to influence the cue-induced firing dynamics of CINs, particularly through potentiation of NMDA receptor-mediated synaptic transmission.
Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases.
Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A; Jenkins, Andrew; Traynelis, Stephen F
2015-07-01
The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. Copyright © 2015 by The American Society for Pharmacology and Experimental
Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases
Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A.; Jenkins, Andrew
2015-01-01
The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. PMID:25904555
K-Ar age of the late Pleistocene eruption of Toba, north Sumatra
Ninkovich, D.; Shackleton, N.J.; Abdel-Monem, A. A.; Obradovich, J.D.; Izett, G.
1978-01-01
The late Pleistocene eruption of Toba is the largest magnitude explosive eruption documented from the Quaternary. K-Ar dating of the uppermost unit of the Toba Tuff gives an age of [~amp]sim; 75,000 yr. A chemically and petrographically equivalent ash layer in deep-sea cores helps calibrate the Stage 4-5 boundary of the standard oxygen isotope stratigraphy. A similar ash in Malaya that overlies finds of Tampan Palaeolithic tools indicates that they are older than 75,000 yr. ?? 1978 Nature Publishing Group.
Aoshima, H; Tenpaku, Y
1997-12-01
To study the effects of 13-L-hydroxylinoleic acid (LOH) and food additives on gamma-aminobutyric acid (GABA) receptors, ionotropic GABA receptors were expressed in Xenopus oocytes by injecting mRNAs prepared from rat whole brain. LOH, which was prepared by reduction of 13-L-hydroperoxylinoleic acid (LOOH), inhibited the response of GABA receptors in the presence of high concentrations of GABA. LOH also inhibited nicotinic acetylcholine, glycine, and kainate receptors, while it had little effect on NMDA receptors expressed in Xenopus oocytes. However, LOH potentiated the response of GABA receptors as well as LOOH in the presence of low concentrations of GABA, possibly increasing the affinity of GABA for the receptors, while linoleic acid did not. Since some modification of the compounds seemed to change their effects on GABA receptors, the responses of GABA receptors elicited by 10 microM GABA were measured in the presence of compounds with various kinds of functional groups or the structural isomers of pentanol. Potentiation of GABA receptors depended strongly on the species of functional groups and also depended on the structure of the isomers. Then effects of various kinds of food additives on GABA receptors were also examined; perfumes such as alcohols or esters potentiated the responses strongly, while hexylamine, nicotinamide, or caffeine inhibited the responses, mainly in a competitive manner, and vanillin inhibited the responses noncompetitively. These results suggest the possibility that production of LOOH and LOH, or intake of much of some food additives, modulates the neural transmission in the brain, especially through ionotropic GABA receptors and changes the frame of the human mind, as alcohol or tobacco does.
K-Ar geochronology of basement rocks on the northern flank of the Huancabama deflection, Ecuador
Feininger, Tomas; Silberman, M.L.
1982-01-01
The Huancabamba deflection, a major Andean orocline located at the Ecuador-Peru border, constitutes an important geologic boundary on the Pacific coast of South America. Crust to the north of the deflection is oceanic and the basement is composed of basic igneous rocks of Cretaceous age, whereas crust to the south is continental and felsic rocks of Precambrian to Cretaceous age make up the basement. The northern flank of the Huancabamba Deflection in El Oro Province, Ecuador, is underlain by Precambrian polymetamorphic basic rocks of the Piedras Group; shale, siltstone, sandstone, and their metamorphosed equivalents in the Tahuin Group (in part of Devonian age); concordant syntectonic granitic rocks; quartz diorite and alaskite of the Maroabeli pluton; a protrusion of serpentinized harzburgite that contains a large inclusion of blueschist-facies metamorphic rocks, the Raspas Formation, and metamorphic rocks north of the La Palma fault. Biotite from gneiss of the Tahuin Group yields a Late Triassic K-Ar age (210 ? 8 m.y.). This is interpreted as an uplift age and is consistent with a regional metamorphism of Paleozoic age. A nearby sample from the Piedras Group that yielded a hornblende K-Ar age of 196 ? 8 m.y. was affected by the same metamorphic event. Biotite from quartz diorite of the mesozonal Maroabeli pluton yields a Late Triassic age (214 ? 6 m.y.) which is interpreted as an uplift age which may be only slightly younger than the age of magmatic crystallization. Emplacement of the pluton may postdate regional metamorphism of the Tahuin Group. Phengite from politic schist of the Raspas Formation yields an Early Cretaceous K-Ar age (132 ? 5 m.y.). This age is believed to date the isostatic rise of the encasing serpentinized harzburgite as movement along a subjacent subduction zone ceased, and it is synchronous with the age of the youngest lavas of a coeval volcanic arc in eastern Ecuador. A Late Cretaceous K-Ar age (74.4 ? 1.1 m.y.) from hornblende in
Hill, R A; Wallace, L J; Miller, D D; Weinstein, D M; Shams, G; Tai, H; Layer, R T; Willins, D; Uretsky, N J; Danthi, S N
1997-09-26
Antagonists of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropanoic acid (AMPA) receptors may have therapeutic potential as psychotropic agents. A series of mononitro- and dinitro-2- and 3-hydroxyphenylalanines was prepared, and their activity compared with willardiine, 5-nitrowillardiine, AMPA, and 2,4,5-trihydroxyphenylalanine (6-hydroxydopa) as inhibitors of specific [3H]AMPA and [3H]kainate binding in rat brain homogenates. The most active compounds were highly acidic (pKa 3-4), namely, 2-hydroxy-3,5-dinitro-DL-phenylalanine (13; [3H]AMPA IC50 approximately equal to 25 microM) and 3-hydroxy-2,4-dinitro-DL-phenylalanine (19; [3H]AMPA IC50 approximately equal to 5 microM). Two other dinitro-3-hydroxyphenylalanines, and 3,5-dinitro-DL-tyrosine, were considerably less active. Various mononitrohydroxyphenylalanines, which are less acidic, were also less active or inactive, and 2- and 3-hydroxyphenylalanine (o- and m-tyrosine) were inactive. Compounds 13 and 19, DL-willardiine (pKa 9.3, [3H]AMPA IC50 = 2 microM), and 5-nitro-DL-willardiine (pKa 6.4, [3H]AMPA IC50 = 0.2 microM) displayed AMPA > kainate selectivity in binding studies. Compound 19 was an AMPA-like agonist, but 13 was an antagonist in an AMPA-evoked norepinephrine release assay in rat hippocampal nerve endings. Also, compound 13 injected into the rat ventral pallidum antagonized the locomotor activity elicited by systemic amphetamine.
Cytochemical Organization of the Retino-Suprachiasmatic System
1994-03-11
strongly expiessed of the, non-NMDA ionotropic receptors . Other AMPA-preferring receptors , GluR3 and -R4, were also found, but to lesser extent...kainate, and NMDA receptor RN was found in the hypothalamus. GluRi and GluR2 were ang the nmst strongly expressed of the non-NvDA ionotropic receptors ...several different glutamate receptors . The expression of many different types of ionotropic glutamate receptors throughout the hypothalamus suggests that
Downes, Katherine S.; Light, Marnie E.; Pošta, Martin; Kohout, Ladislav; van Staden, Johannes
2013-01-01
Background and Aims A major germination-promoting chemical in smoke-water is 3-methyl-2H-furo[2,3-c]pyran-2-one (karrikinolide, KAR1). However, not all species that germinate in response to smoke-water are responsive to KAR1, such as Tersonia cyathiflora (Gyrostemonaceae). In this study, a test was made of whether two Gyrostemon species (Gyrostemonaceae) that have previously been shown to respond to smoke-water, respond to KAR1. If not, then the smoke-derived chemical that stimulates germination of these species is currently unknown. Recently, glyceronitrile was isolated from smoke-water and promoted the germination of certain Anigozanthos species (Haemodoraceae). Whether this chemical promotes Gyrostemon racemiger germination is also examined. Furthermore, an investigation was carried out into whether these species germinate in response to smoke-water derived from burning cellulose alone. Methods Gyrostemon racemiger and G. ramulosus seeds were buried after collection and retrieved in autumn the following year when dormancy was alleviated and seeds had become responsive to smoke-water. Anigozanthos flavidus seeds were after-ripened at 35 °C to alleviate dormancy. Gyrostemon and Anigozanthos seeds were then tested with ‘Seed Starter’ smoke-water, KAR1, glyceronitrile and cellulose-derived smoke-water. Key Results Although Gyrostemon racemiger, G. ramulosus and A. flavidus were all stimulated to germinate by ‘Seed Starter’ smoke-water, none of these species responded to KAR1. Gyrostemon racemiger germination was not promoted by glyceronitrile. This is in contrast to A. flavidus, where glyceronitrile, at concentrations of 1–500 µm, promoted germination, although seedling growth was inhibited at ≥400 µm. Maximum A. flavidus germination occurred at glyceronitrile concentrations of 25–300 µm. Some Gyrostemon germination was promoted by cellulose-derived smoke-water. Conclusions KAR1 and glyceronitrile, chemicals in smoke-water that are known to
Downes, Katherine S; Light, Marnie E; Pošta, Martin; Kohout, Ladislav; van Staden, Johannes
2013-03-01
A major germination-promoting chemical in smoke-water is 3-methyl-2H-furo[2,3-c]pyran-2-one (karrikinolide, KAR(1)). However, not all species that germinate in response to smoke-water are responsive to KAR(1), such as Tersonia cyathiflora (Gyrostemonaceae). In this study, a test was made of whether two Gyrostemon species (Gyrostemonaceae) that have previously been shown to respond to smoke-water, respond to KAR(1). If not, then the smoke-derived chemical that stimulates germination of these species is currently unknown. Recently, glyceronitrile was isolated from smoke-water and promoted the germination of certain Anigozanthos species (Haemodoraceae). Whether this chemical promotes Gyrostemon racemiger germination is also examined. Furthermore, an investigation was carried out into whether these species germinate in response to smoke-water derived from burning cellulose alone. Gyrostemon racemiger and G. ramulosus seeds were buried after collection and retrieved in autumn the following year when dormancy was alleviated and seeds had become responsive to smoke-water. Anigozanthos flavidus seeds were after-ripened at 35 °C to alleviate dormancy. Gyrostemon and Anigozanthos seeds were then tested with 'Seed Starter' smoke-water, KAR(1), glyceronitrile and cellulose-derived smoke-water. Although Gyrostemon racemiger, G. ramulosus and A. flavidus were all stimulated to germinate by 'Seed Starter' smoke-water, none of these species responded to KAR(1). Gyrostemon racemiger germination was not promoted by glyceronitrile. This is in contrast to A. flavidus, where glyceronitrile, at concentrations of 1-500 µm, promoted germination, although seedling growth was inhibited at ≥400 µm. Maximum A. flavidus germination occurred at glyceronitrile concentrations of 25-300 µm. Some Gyrostemon germination was promoted by cellulose-derived smoke-water. KAR(1) and glyceronitrile, chemicals in smoke-water that are known to stimulate germination in other species, did not promote the
NASA Technical Reports Server (NTRS)
French, R. A.; Cohen, B. A.; Miller, J. S.
2014-01-01
The Potassium-Argon Laser Experiment( KArLE), is composed of two main instruments: a spectrometer as part of the Laser-Induced Breakdown Spectroscopy (LIBS) method and a Mass Spectrometer (MS). The LIBS laser ablates a sample and creates a plasma cloud, generating a pit in the sample. The LIBS plasma is measured for K abundance in weight percent and the released gas is measured using the MS, which calculates Ar abundance in mols. To relate the K and Ar measurements, total mass of the ablated sample is needed but can be difficult to directly measure. Instead, density and volume are used to calculate mass, where density is calculated based on the elemental composition of the rock (from the emission spectrum) and volume is determined by pit morphology. This study aims to reduce the uncertainty for KArLE by analyzing pit volume relationships in several analog materials and comparing methods of pit volume measurements and their associated uncertainties.
Expression of ionotropic glutamate receptors, AMPA, kainite and NMDA, in the pigeon retina.
Atoji, Yasuro
2015-07-01
Glutamate is an excitatory neurotransmitter in the vertebrate retina. A previous study found vesicular glutamate transporter 2 (vGluT2) mRNA in the pigeon retina, suggesting that bipolar and ganglion cells are glutamatergic. The present study examined the localization of ionotropic glutamate receptors to identify receptor cells in the pigeon retina using in situ hybridization histochemistry. Nine subunits of AMPA receptor (GluA1, GluA2, GluA3, and GluA4), kainate receptor (GluK1, GluK2, and GluK4), and NMDA receptor (GluN1 and GluN2A) were found to be expressed in the inner nuclear layer (INL) and ganglion cell layers. GluA1, GluA2, GluA3, and GluA4 were primarily expressed in the inner half of INL, and the signal intensity was strong for GluA2, GluA3, and GluA4. GluK1 was intensely expressed in the outer half of INL, whereas GluK2 and GluK4 were mainly localized in the inner half of INL. GluN1 and GluN2A were moderately expressed in the inner half of INL. Horizontal cells expressed GluA3 and GluA4, and ganglion cells expressed all subunits examined. These results suggest that the glutamatergic neurotransmission in the pigeon retina is similar to that in mammals. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gibeaux, Romain; Politi, Antonio Z; Nédélec, François; Antony, Claude; Knop, Michael
2013-02-01
Nuclear migration during yeast karyogamy, termed nuclear congression, is required to initiate nuclear fusion. Congression involves a specific regulation of the microtubule minus end-directed kinesin-14 motor Kar3 and a rearrangement of the cytoplasmic microtubule attachment sites at the spindle pole bodies (SPBs). However, how these elements interact to produce the forces necessary for nuclear migration is less clear. We used electron tomography, molecular genetics, quantitative imaging, and first principles modeling to investigate how cytoplasmic microtubules are organized during nuclear congression. We found that Kar3, with the help of its light chain, Cik1, is anchored during mating to the SPB component Spc72 that also serves as a nucleator and anchor for microtubules via their minus ends. Moreover, we show that no direct microtubule-microtubule interactions are required for nuclear migration. Instead, SPB-anchored Kar3 exerts the necessary pulling forces laterally on microtubules emanating from the SPB of the mating partner nucleus. Therefore, a twofold symmetrical application of the core principle that drives nuclear migration in higher cells is used in yeast to drive nuclei toward each other before nuclear fusion.
Gibeaux, Romain; Politi, Antonio Z.; Nédélec, François; Antony, Claude; Knop, Michael
2013-01-01
Nuclear migration during yeast karyogamy, termed nuclear congression, is required to initiate nuclear fusion. Congression involves a specific regulation of the microtubule minus end-directed kinesin-14 motor Kar3 and a rearrangement of the cytoplasmic microtubule attachment sites at the spindle pole bodies (SPBs). However, how these elements interact to produce the forces necessary for nuclear migration is less clear. We used electron tomography, molecular genetics, quantitative imaging, and first principles modeling to investigate how cytoplasmic microtubules are organized during nuclear congression. We found that Kar3, with the help of its light chain, Cik1, is anchored during mating to the SPB component Spc72 that also serves as a nucleator and anchor for microtubules via their minus ends. Moreover, we show that no direct microtubule–microtubule interactions are required for nuclear migration. Instead, SPB-anchored Kar3 exerts the necessary pulling forces laterally on microtubules emanating from the SPB of the mating partner nucleus. Therefore, a twofold symmetrical application of the core principle that drives nuclear migration in higher cells is used in yeast to drive nuclei toward each other before nuclear fusion. PMID:23388829
Scheperjans, Filip; Palomero-Gallagher, Nicola; Grefkes, Christian; Schleicher, Axel; Zilles, Karl
2005-11-01
Regional distributions of ligand binding sites of 12 different neurotransmitter receptors (glutamatergic: AMPA, kainate, NMDA; GABAergic: GABA(A), GABA(B); cholinergic: muscarinic M2, nicotinic; adrenergic: alpha1, alpha2; serotonergic: 5-HT1A, 5-HT2; dopaminergic: D1) were studied in human postmortem brains by means of quantitative receptor autoradiography. Binding site densities were measured in the superior parietal lobule (SPL) (areas 5L, 5M, 5Ci, and different locations within Brodmann's area (BA) 7), somatosensory (BA 2), and visual cortical areas (BA 17, and different locations within BAs 18 and 19). Similarities of receptor distribution between cortical areas were analyzed by cluster analysis, uni- and multivariate statistics of mean receptor densities (averaged over all cortical layers), and profiles representing the laminar distribution patterns of receptors. A considerable heterogeneity of regional receptor densities and laminar patterns between the sites was found in the SPL and the visual cortex. The most prominent regional differences were found for M2 receptors. In the SPL, rostrocaudally oriented changes of receptor densities were more pronounced than those in mediolateral direction. The receptor distribution in the rostral SPL was more similar to that of the somatosensory cortex, whereas caudal SPL resembled the receptor patterns of the dorsolateral extrastriate visual areas. These results suggest a segregation of the different SPL areas based on receptor distribution features typical for somatosensory or visual areas, which fits to the dual functional role of this cortical region, i.e., the involvement of the human SPL in visuomotor and somatosensory motor transformations.
Dalrymple, G.B.; Burke, R.M.; Birkeland, P.W.
1982-01-01
New KAr ages for a basalt flow interbedded with Tahoe and Tioga tills in Sawmill Canyon, southeastern Sierra Nevada, slightly refine previously published ages for the flow and provide an estimate of 53,000 ± 44,000 yr for the Tahoe-Tioga interglaciation.
Uzunova, Genoveva; Hollander, Eric; Shepherd, Jason
2014-01-01
Autism spectrum disorder (ASD) and Fragile X syndrome (FXS) are relatively common childhood neurodevelopmental disorders with increasing incidence in recent years. They are currently accepted as disorders of the synapse with alterations in different forms of synaptic communication and neuronal network connectivity. The major excitatory neurotransmitter system in brain, the glutamatergic system, is implicated in learning and memory, synaptic plasticity, neuronal development. While much attention is attributed to the role of metabotropic glutamate receptors in ASD and FXS, studies indicate that the ionotropic glutamate receptors (iGluRs) and their regulatory proteins are also altered in several brain regions. Role of iGluRs in the neurobiology of ASD and FXS is supported by a weight of evidence that ranges from human genetics to in vitro cultured neurons. In this review we will discuss clinical, molecular, cellular and functional changes in NMDA, AMPA and kainate receptors and the synaptic proteins that regulate them in the context of ASD and FXS. We will also discuss the significance for the development of translational biomarkers and treatments for the core symptoms of ASD and FXS. PMID:24533017
Jin, Zhe; Bhandage, Amol K; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R; Birnir, Bryndis
2014-01-01
The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence.
Jin, Zhe; Bhandage, Amol K.; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R.; Birnir, Bryndis
2014-01-01
The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence. PMID:25278838
Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells.
Campana, Wendy M; Mantuano, Elisabetta; Azmoon, Pardis; Henry, Kenneth; Banki, Michael A; Kim, John H; Pizzo, Donald P; Gonias, Steven L
2017-04-01
In the peripheral nervous system, Schwann cells (SCs) demonstrate surveillance activity, detecting injury and undergoing trans -differentiation to support repair. SC receptors that detect peripheral nervous system injury remain incompletely understood. We used RT-PCR to profile ionotropic glutamate receptor expression in cultured SCs. We identified subunits required for assembly of N -methyl-d-aspartic acid (NMDA) receptors (NMDA-Rs), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, and kainate receptors. Treatment of SCs with 40-100 µM glutamate or with 0.5-1.0 µM NMDA robustly activated Akt and ERK1/2. The response was transient and bimodal; glutamate concentrations that exceeded 250 µM failed to activate cell signaling. Phosphoprotein profiling identified diverse phosphorylated proteins in glutamate-treated SCs in addition to ERK1/2 and Akt, including p70 S6-kinase, glycogen synthase kinase-3, ribosomal S6 kinase, c-Jun, and cAMP response element binding protein. Activation of SC signaling by glutamate was blocked by EGTA and dizocilpine and by silencing expression of the NMDA-R NR1 subunit. Phosphoinositide 3-kinase/PI3K functioned as an essential upstream activator of Akt and ERK1/2 in glutamate-treated SCs. When glutamate or NMDA was injected directly into crush-injured rat sciatic nerves, ERK1/2 phosphorylation was observed in myelinated and nonmyelinating SCs. Glutamate promoted SC migration by a pathway that required PI3K and ERK1/2. These results identified ionotropic glutamate receptors and NMDA-Rs, specifically, as potentially important cell signaling receptors in SCs.-Campana, W. M., Mantuano, E., Azmoon, P., Henry, K., Banki, M. A., Kim, J. H., Pizzo, D. P., Gonias, S. L. Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells. © FASEB.
NASA Astrophysics Data System (ADS)
Ali, S.; Hemming, S. R.; Torgersen, T.; Fleisher, M. Q.; Cox, S. E.; Stute, M.
2009-12-01
The San Andreas Fault Observatory at Depth (SAFOD) was drilled to study the physical and chemical processes responsible for faulting and earthquake generation along an active, plate-bounding fault at depth. SAFOD drill cores show multiple zones of alteration and deformation due to fluid-rock interaction in the fault rocks(Schleicher et al. 2008). In context of fluid studies in the SAFZ, noble gas and potassium measurements were performed on solid samples of sedimentary rocks obtained from drill cores across the fault (3050-4000m-MD). We used a combination of 40Ar/39Ar and K-Ar methods on crushed samples of mudrock with variable amounts of visible slickensides to constrain the degree of resetting of the K-Ar system across the San Andreas Fault zone. 40Ar/39Ar was analyzed from small fragments (sand sized grains) while K-Ar was measured in crushed bulk rock samples (100-250 mg for Ar, and 5-10 mg for K analyses). The apparent 40Ar/39Ar ages based on single step laser fusion of small fragments corresponding to the detrital component in the coarse fraction, show varying ages ranging from the provenance age to <13Ma. Although more data are needed to make detailed comparisons, the apparent K-Ar ages of bulk samples in the fault zone are biased toward authigenic materials contained in the fine fraction, similar to the 40Ar/39Ar ages reported for mineralogical separates from very fine size fractions of samples obtained from 3065.98m-MD and 3294.89m-MD (Schleicher et al., submitted to Geology). The small samples measured for 40Ar/39Ar show scatter in the apparent ages, generally bracketing the bulk ages. However they are picked from sieved portions of the samples, and it is likely that there may be a loss of the younger (finer) material. Detrital provenance ages appear to be 50-60Ma in the Pacific Plate, and 100Ma in the North American Plate. 40Ar/39Ar ages within the SAFZ, as defined by geophysical logs (3200-3400m MD), are dominated by apparent detrital ages of ˜100Ma
Allosteric potentiation of quisqualate receptors by a nootropic drug aniracetam.
Ito, I; Tanabe, S; Kohda, A; Sugiyama, H
1990-05-01
1. Allosteric potentiation of the ionotropic quisqualate (iQA) receptor by a nootropic drug aniracetam (1-p-anisoyl-2-pyrrolidinone) was investigated using Xenopus oocytes injected with rat brain mRNA and rat hippocampal slices. 2. Aniracetam potentiates the iQA responses induced in Xenopus oocytes by rat brain mRNA in a reversible manner. This effect was observed above the concentrations of 0.1 mM. Kainate. N-methyl-D-aspartate and gamma-aminobutyric acid responses induced in the same oocytes were not affected. 3. The specific potentiation of iQA responses was accompanied by an increase in the conductance change of iQA and alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) responses, but the affinity of receptors for agonist and the ion-selectivity of the channels (reversal potentials) were not changed. 4. Aniracetam reversibly potentiated the iQA responses recorded intracellularly from the pyramidal cells in the CA1 region of rat hippocampal slices. The excitatory postsynaptic potentials (EPSPs) in Schaffer collateral-commissural-CA1 synapses were also potentiated by aniracetam. 5. Population EPSPs recorded in the mossy fibre-CA3 synapses as well as Schaffer-commissural synapses were also potentiated by aniracetam. The amplitudes of the potentiation were not changed by the formation of long-term potentiation.
NASA Astrophysics Data System (ADS)
Guillou, H.; Carracedo, J.; Perez Torrado, F.
2003-12-01
The combined use of radioisotopic dating, magnetostratigraphy and field geology is a powerful tool to provide reliable chronological frameworks of volcanic edifices. This approach has been used to investigate the last two stages of the volcanic evolution of Gran Canaria. Fifty samples were dated using the unspiked K-Ar method and had their magnetic polarity measured both in the field and in laboratory. Ages were compared to their stratigraphic positions and magnetic polarities before accepting their validity. The unspiked K-Ar chronology constrains the timing of lateral collapses, eruption rates and the contemporaneity of different volcano-magmatic stages at Gran Canaria. Our new data set modifies significantly the previous chronological framework of Gran Canaria, especially between 4 and 2.8 Ma. Based on these new ages, we can bracket the age of the multiple lateral collapses of the Roque Nublo stratovolcano flanks between 3.5 and 3.1 Ma .This time interval corresponds to a main period of volcanic quiescence. Calculated eruptive rates during the stratovolcano edification are about 0.1 km3/kyr which is significantly lower than the published estimates. The dating also reveals that the two main last stages are not separated by a major time gap, but that the early stages of the rift forming eruption and the vanishing activity of the Roque Nublo strato-volcano were contemporaneous for at least 600 kyrs. These results support that our combined approach provides a rapid first-pass and reliable geochronology. Nevertheless, this chronology can be amplified and made more precise where necessary through detailed Ar-Ar incremental-heating methods. Samples which should be investigated using this method are the oldest and youngest K-Ar dated flows of each volcanic stage, and samples from stratigraphic sections that hold potential to study the behaviour of the earth's magnetic field during reversals (Gauss-Gilbert transition, Olduvai and Reunion events).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chalmers, D.T.; Dewar, D.; Graham, D.I.
1990-02-01
Involvement of cortical glutamatergic mechanisms in senile dementia of the Alzheimer type (SDAT) has been investigated with quantitative ligand-binding autoradiography. The distribution and density of Na(+)-dependent glutamate uptake sites and glutamate receptor subtypes--kainate, quisqualate, and N-methyl-D-aspartate--were measured in adjacent sections of frontal cortex obtained postmortem from six patients with SDAT and six age-matched controls. The number of senile plaques was determined in the same brain region. Binding of D-(3H)aspartate to Na(+)-dependent uptake sites was reduced by approximately 40% throughout SDAT frontal cortex relative to controls, indicating a general loss of glutamatergic presynaptic terminals. (3H)Kainate receptor binding was significantly increased bymore » approximately 70% in deep layers of SDAT frontal cortex compared with controls, whereas this binding was unaltered in superficial laminae. There was a positive correlation (r = 0.914) between kainate binding and senile plaque number in deep cortical layers. Quisqualate receptors, as assessed by 2-amino-3-hydroxy-5-(3H)methylisoxazole-4-propionic acid binding, were unaltered in SDAT frontal cortex compared with controls. There was a small reduction (25%) in N-methyl-D-aspartate-sensitive (3H)glutamate binding only in superficial cortical layers of SDAT brains relative to control subjects. (3H)Glutamate binding in SDAT subjects was unrelated to senile plaque number in superficial cortical layers (r = 0.104). These results indicate that in the presence of cortical glutamatergic terminal loss in SDAT plastic alterations occur in some glutamate receptor subtypes but not in others.« less
NASA Astrophysics Data System (ADS)
Cho, Yuichiro; Sugita, Seiji; Miura, Yayoi N.; Okazaki, Ryuji; Iwata, Naoyoshi; Morota, Tomokatsu; Kameda, Shingo
2016-09-01
Age is essential information for interpreting the geologic record on planetary surfaces. Although crater counting has been widely used to estimate the planetary surface ages, crater chronology in the inner solar system is largely built on radiometric age data from limited sites on the Moon. This has resulted in major uncertainty in planetary chronology. Because opportunities for sample-return missions are limited, in-situ geochronology measurements from one-way lander/rover missions are extremely valuable. Here we developed an in-situ isochron-based dating method using the K-Ar system, with K and Ar in a single rock sample extracted locally by laser ablation and measured using laser-induced breakdown spectroscopy (LIBS) and a quadrupole mass spectrometer (QMS), respectively. We built an experimental system combining flight-equivalent instruments and measured K-Ar ages for mineral samples with known ages (~1.8 Ga) and K contents (1-8 wt%); we achieved precision of 20% except for a mineral with low mechanical strength. Furthermore, validation measurements with two natural rocks (gneiss slabs) obtained K-Ar isochron ages and initial 40Ar consistent with known values for both cases. This result supports that our LIBS-MS approach can derive both isochron ages and contributions of non-in situ radiogenic 40Ar from natural rocks. Error assessments suggest that the absolute ages of key geologic events including the Noachian/Hesperian- and the Hesperian/Amazonian-transition can be dated with 10-20% errors for a rock containing ~1 wt% K2O, greatly reducing the uncertainty of current crater chronology models on Mars.
Krizaj, D; Akopian, A; Witkovsky, P
1994-09-01
We studied the responses of isolated and intact luminosity-type horizontal cells (L-HC) in the Xenopus retina to L-glutamate (L-glu) and its analogs. Isolated L-HCs studied with whole-cell patch clamp responded to L-glu, kainate (KA), AMPA, or quisqualate (quis) with inward currents from a holding potential of -60 mV, associated with a conductance increase. The current elicited by KA was relatively large and sustained, whereas AMPA or quis evoked a desensitizing current. Coapplication of quis and KA resulted in a smaller current and conductance change than that evoked by a pulse of either alone at the same concentration. This finding suggests that the L-HC has a single subtype of glutamate receptor that responds to both quis and KA. Prior exposure to dopamine enhanced the KA-evoked current about twofold. In the superfused eyecup we found that L-HC responses to quinoxalinediones (CNQX or DNQX) and to L-glu, KA, AMPA, and quis varied as a function of adaptational state. When driven exclusively by either cones or by rods, CNQX/DNQX hyperpolarized the L-HC and reduced its light response, without altering response kinetics, indicating that both rods and cones communicate with L-HCs at ionotropic glutamatergic synapses. Under mesopic conditions, however, as CNQX or DNQX reduced cone input, the rod input to the L-HC increased up to fivefold in magnitude and had slowed kinetics. The depolarizing response of the L-HC to L-glu, AMPA, or quis was relatively small and transient under photopic conditions, but was much larger and sustained when the eyecup was dark adapted. The D1 dopamine antagonist SCH 23390 potentiated the response to quis. In contrast, responses to KA were largest in light-adapted eyecups, were potentiated by a D1 dopamine agonist, SKF 38393, and were reduced by SCH 23390. We hypothesize that the segregated populations of glutamate receptors in the L-HC opposite cone and rod synaptic endings can be separately modulated to respond differentially to the native
NASA Astrophysics Data System (ADS)
Westergaard, Niels; Banke, Tue; Wahl, Philip; Sonnewald, Ursula; Schousboe, Arne
1995-04-01
The effect of the two metal-ion chelators EDTA and citrate on the action of N-methyl-D-aspartate (NMDA) receptors was investigated by use of cultured mouse cerebellar granule neurons and Xenopus oocytes, respectively, to monitor either NMDA-evoked transmitter release or membrane currents. Transmitter release from the glutamatergic neurons was determined by superfusion of the cells after preloading with the glutamate analogue D-[^3H]aspartate. The oocytes were injected with mRNA isolated from mouse cerebellum and, after incubation to allow translation to occur, currents mediated by NMDA were recorded electrophysiologically by voltage clamp at a holding potential of -80 mV. It was found that citrate as well as EDTA could attenuate the inhibitory action of Zn2+ on NMDA receptor-mediated transmitter release from the neurons and membrane currents in the oocytes. These effects were specifically related to the NMDA receptor, since the NMDA receptor antagonist MK-801 abolished the action and no effects of Zn2+ and its chelators were observed when kainate was used to selectively activate non-NMDA receptors. Since it was additionally demonstrated that citrate (and EDTA) preferentially chelated Zn2+ rather than Ca2+, the present findings strongly suggest that endogenous citrate released specifically from astrocytes into the extracellular space in the brain may function as a modulator of NMDA receptor activity. This is yet another example of astrocytic influence on neuronal activity.
Role of glutamate and substance P in the amphibian respiratory network during development
Chen, Anna K.; Hedrick, Michael S.
2008-01-01
This study tested the hypothesis that glutamatergic ionotropic (AMPA/kainate) receptors and neurokinin receptors (NKR) are important in the regulation of respiratory motor output during development in the bullfrog. The roles of these receptors were studied with in vitro brainstem preparations from pre-metamorphic tadpoles and post-metamorphic frogs. Brainstems were superfused with an artificial cerebrospinal fluid at 20–22°C containing CNQX, a selective non-NMDA antagonist, or with substance P (SP), an agonist of NKR. Blockade of glutamate receptors with CNQX in both groups caused a reduction of lung burst frequency that was reversibly abolished at 5 μM (P<0.01). CNQX, but not SP, application produced a significant increase (P<0.05) in gill and buccal frequency in tadpoles and frogs, respectively. SP caused a significant increase (P<0.05) in lung burst frequency at 5 μM in both groups. These results suggest that glutamatergic activation of AMPA/kainate receptors is necessary for generation of lung burst activity and that SP is an excitatory neurotransmitter for lung burst frequency generation. Both glutamate and SP provide excitatory input for lung burst generation throughout the aquatic to terrestrial developmental transition in bullfrogs. PMID:18450524
Role of glutamate and substance P in the amphibian respiratory network during development.
Chen, Anna K; Hedrick, Michael S
2008-06-30
This study tested the hypothesis that glutamatergic ionotropic (AMPA/kainate) receptors and neurokinin receptors (NKR) are important in the regulation of respiratory motor output during development in the bullfrog. The roles of these receptors were studied with in vitro brainstem preparations from pre-metamorphic tadpoles and post-metamorphic frogs. Brainstems were superfused with an artificial cerebrospinal fluid at 20-22 degrees C containing CNQX, a selective non-NMDA antagonist, or with substance P (SP), an agonist of NKR. Blockade of glutamate receptors with CNQX in both groups caused a reduction of lung burst frequency that was reversibly abolished at 5 microM (P<0.01). CNQX, but not SP, application produced a significant increase (P<0.05) in gill and buccal frequency in tadpoles and frogs, respectively. SP caused a significant increase (P<0.05) in lung burst frequency at 5 microM in both groups. These results suggest that glutamatergic activation of AMPA/kainate receptors is necessary for generation of lung burst activity and that SP is an excitatory neurotransmitter for lung burst frequency generation. Both glutamate and SP provide excitatory input for lung burst generation throughout the aquatic to terrestrial developmental transition in bullfrogs.
Evolution of strigolactone receptors by gradual neo-functionalization of KAI2 paralogues.
Bythell-Douglas, Rohan; Rothfels, Carl J; Stevenson, Dennis W D; Graham, Sean W; Wong, Gane Ka-Shu; Nelson, David C; Bennett, Tom
2017-06-29
Strigolactones (SLs) are a class of plant hormones that control many aspects of plant growth. The SL signalling mechanism is homologous to that of karrikins (KARs), smoke-derived compounds that stimulate seed germination. In angiosperms, the SL receptor is an α/β-hydrolase known as DWARF14 (D14); its close homologue, KARRIKIN INSENSITIVE2 (KAI2), functions as a KAR receptor and likely recognizes an uncharacterized, endogenous signal ('KL'). Previous phylogenetic analyses have suggested that the KAI2 lineage is ancestral in land plants, and that canonical D14-type SL receptors only arose in seed plants; this is paradoxical, however, as non-vascular plants synthesize and respond to SLs. We have used a combination of phylogenetic and structural approaches to re-assess the evolution of the D14/KAI2 family in land plants. We analysed 339 members of the D14/KAI2 family from land plants and charophyte algae. Our phylogenetic analyses show that the divergence between the eu-KAI2 lineage and the DDK (D14/DLK2/KAI2) lineage that includes D14 occurred very early in land plant evolution. We show that eu-KAI2 proteins are highly conserved, and have unique features not found in DDK proteins. Conversely, we show that DDK proteins show considerable sequence and structural variation to each other, and lack clearly definable characteristics. We use homology modelling to show that the earliest members of the DDK lineage structurally resemble KAI2 and that SL receptors in non-seed plants likely do not have D14-like structure. We also show that certain groups of DDK proteins lack the otherwise conserved MORE AXILLARY GROWTH2 (MAX2) interface, and may thus function independently of MAX2, which we show is highly conserved throughout land plant evolution. Our results suggest that D14-like structure is not required for SL perception, and that SL perception has relatively relaxed structural requirements compared to KAI2-mediated signalling. We suggest that SL perception gradually evolved
Cremer, J N; Amunts, K; Schleicher, A; Palomero-Gallagher, N; Piel, M; Rösch, F; Zilles, K
2015-12-17
Parkinson's disease (PD) is a well-characterized neurological disorder with regard to its neuropathological and symptomatic appearance. At the genetic level, mutations of particular genes, e.g. Parkin and DJ-1, were found in human hereditary PD with early onset. Neurotransmitter receptors constitute decisive elements in neural signal transduction. Furthermore, since they are often altered in neurological and psychiatric diseases, receptors have been successful targets for pharmacological agents. However, the consequences of PD-associated gene mutations on the expression of transmitter receptors are largely unknown. Therefore, we studied the expression of 16 different receptor binding sites of the neurotransmitters glutamate, GABA, acetylcholine, adrenaline, serotonin, dopamine and adenosine by means of quantitative receptor autoradiography in Parkin and DJ-1 knockout mice. These knockout mice exhibit electrophysiological and behavioral deficits, but do not show the typical dopaminergic cell loss. We demonstrated differential changes of binding site densities in eleven brain regions. Most prominently, we found an up-regulation of GABA(B) and kainate receptor densities in numerous cortical areas of Parkin and DJ-1 knockout mice, as well as increased NMDA but decreased AMPA receptor densities in different brain regions of the Parkin knockout mice. The alterations of three different glutamate receptor types may indicate the potential relevance of the glutamatergic system in the pathogenesis of PD. Furthermore, the cholinergic M1, M2 and nicotinic receptors as well as the adrenergic α2 and the adenosine A(2A) receptors showed differentially increased densities in Parkin and DJ-1 knockout mice. Taken together, knockout of the PD-associated genes Parkin or DJ-1 results in differential changes of neurotransmitter receptor densities, highlighting a possible role of altered non-dopaminergic, and in particular of glutamatergic neurotransmission in PD pathogenesis. Copyright
Turner, Donald L.; Forbes, R.B.; Mayfield, C.F.
1978-01-01
We report 76 previously unpublished K-Ar mineral ages from 47 metamorphic and igneous rocks in the southwestern Brooks Range. The pattern of radiometric ages is complex, reflecting the complex geologic history of this area. Local and regional radiometric evidence suggests that the southern Brooks Range schist belt has, at least in part, undergone a late Precambrian metamorphism and that the parent sedimentary and igneous rocks for the metamorphic rocks dated as late Precambrian are at least this old (Precambrian Z). This schist terrane experienced a major thermal event in mid-Cretaceous time, causing widespread resetting of nearly all K-Ar mica ages. A series of apparent ages intermediate between late Precambrian and mid-Cretaceous are interpreted as indicating varying amounts of partial argon loss from older rocks during the Cretaceous event. The schist belt is characterized by dominant metasediments and subordinate metabasites and metafelsites. Blueschists occur within the schist belt from the Chandalar quadrangle westward to the Baird Mountains quadrangle, but geologic evidence does not support the existence of a fossil subduction zone.
Ben-Ari, Yehezkel; Crepel, Valérie; Represa, Alfonso
2008-01-01
Do temporal lobe epilepsy (TLE) seizures in adults promote further seizures? Clinical and experimental data suggest that new synapses are formed after an initial episode of status epilepticus, however their contribution to the transformation of a naive network to an epileptogenic one has been debated. Recent experimental data show that newly formed aberrant excitatory synapses on the granule cells of the fascia dentate operate by means of kainate receptor-operated signals that are not present on naive granule cells. Therefore, genuine epileptic networks rely on signaling cascades that differentiate them from naive networks. Recurrent limbic seizures generated by the activation of kainate receptors and synapses in naive animals lead to the formation of novel synapses that facilitate the emergence of further seizures. This negative, vicious cycle illustrates the central role of reactive plasticity in neurological disorders.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Girard, J.P.; Barnes, D.A.
1995-01-01
Hydrocarbon reservoirs occur in the Middle Ordovician St. Peter Sandstone in the central Michigan basin at depths of 1.5-3.5 km and are diagenetically altered. Latest diagenetic cements include saddle dolomite, pervasive microcrystalline illite and chlorite, and quartz. A K-Ar and {sup 18}O/{sup 16}O study of the fine-grained authigenic illite in 25 samples from 16 wells covering a large area within the basin yields K-Ar ages ranging from 367 to 322 Ma and {delta}{sup 18}O values between 12.7 and 16.9% SMOW. The {delta}{sup 18}O values of diagenetic quartz overgrowths range from 15.2 to 18.9%. Fluid inclusion temperatures in the quartz cementmore » range from 70 to 170{degrees}C, reflecting multiple generations of diagenetic quartz and/or precipitation over most of the diagenetic history. Reequilibrated fluid inclusions in the saddle dolomite cement yield temperatures ranging from 90 to 150{degrees}C. A regionally significant episode of illitization occurred during the Late Devonian-Mississipian. Temperatures of illite formation are indirectly estimated to be in the range of 125-170{degrees}C and most paleodepths of illitization are between 2.8 and 3.2 km. These results imply that (1) illite formed from {sup 18}O-rich fluids, and (2) elevated geothermal gradients, i.e., greater than 34% C/km, existed in the Michigan basin in the late Paleozoic. The K-Ar ages and the {delta}{sup 18}O values are not correlated to present depths of the samples or paleodepths of illitization. Illites with young ages and low {delta}{sup 18}O values tend to be geographically distributed along the north-south branch of the buried Precambrian rift. The {delta}{sup 18}O values of the diagenetic quartz follow a similar trend. The spread of illite K-Ar ages and {delta}{sup 19}O values, and their geographic distribution, are best explained as reflecting abnormally high thermal regimes in the part of the basin located above the presumably highly fractured basement along the rift.« less
NASA Astrophysics Data System (ADS)
Farley, K. A.; Hurowitz, J. A.; Asimow, P. D.; Jacobson, N. S.; Cartwright, J. A.
2013-06-01
A new method for K-Ar dating using a double isotope dilution technique is proposed and demonstrated. The method is designed to eliminate known difficulties facing in situ dating on planetary surfaces, especially instrument complexity and power availability. It may also have applicability in some terrestrial dating applications. Key to the method is the use of a solid tracer spike enriched in both 39Ar and 41K. When mixed with lithium borate flux in a Knudsen effusion cell, this tracer spike and a sample to be dated can be successfully fused and degassed of Ar at <1000 °C. The evolved 40Ar∗/39Ar ratio can be measured to high precision using noble gas mass spectrometry. After argon measurement the sample melt is heated to a slightly higher temperature (˜1030 °C) to volatilize potassium, and the evolved 39K/41K ratio measured by Knudsen effusion mass spectrometry. Combined with the known composition of the tracer spike, these two ratios define the K-Ar age using a single sample aliquot and without the need for extreme temperature or a mass determination. In principle the method can be implemented using a single mass spectrometer. Experiments indicate that quantitative extraction of argon from a basalt sample occurs at a sufficiently low temperature that potassium loss in this step is unimportant. Similarly, potassium isotope ratios measured in the Knudsen apparatus indicate good sample-spike equilibration and acceptably small isotopic fractionation. When applied to a flood basalt from the Viluy Traps, Siberia, a K-Ar age of 351 ± 19 Ma was obtained, a result within 1% of the independently known age. For practical reasons this measurement was made on two separate mass spectrometers, but a scheme for combining the measurements in a single analytical instrument is described. Because both parent and daughter are determined by isotope dilution, the precision on K-Ar ages obtained by the double isotope dilution method should routinely approach that of a pair of
Omodaka, Kazuko; Nishiguchi, Koji M; Yasuda, Masayuki; Tanaka, Yuji; Sato, Kota; Nakamura, Orie; Maruyama, Kazuichi; Nakazawa, Toru
2014-10-24
Apolipoprotein E (ApoE) plays important roles in the body, including a carrier of cholesterols, an anti-oxidant, and a ligand for the low-density lipoprotein receptors. In the nervous system, the presence of ApoE4 isoforms is associated with Alzheimer's disease. ApoE gene polymorphisms are also associated with glaucoma, but the function of ApoE in the retina remains unclear. In this study, we investigated the role of ApoE in axonal damage-induced RGC death. ApoE was detected in the astrocytes and Müller cells in the wild-type (WT) retina. RGC damage was induced in adult ApoE-deficient mice (male, 10-12 weeks old) through ocular hypertension (OH), optic nerve crush (NC), or by administering kainic acid (KA) intravitreally. The WT mice were treated with a glutamate receptor antagonist (MK801 or CNQX) 30 min before performing NC or left untreated. Seven days later, the retinas were flat mounted and Fluorogold-labeled RGCs were counted. We found that the RGCs in the ApoE-deficient mice were resistant to OH-induced RGC death and optic nerve degeneration 4 weeks after induction. In WT mice, NC effectively induced RGC death (control: 4085±331 cells/mm(2), NC: 1728±170 cells/mm(2)). CNQX, an inhibitor of KA receptors, suppressed this RGC death (3031±246 cells/mm(2)), but MK801, an inhibitor of NMDA receptors, did not (1769±212 cells/mm(2)). This indicated the involvement of KA receptor signaling in NC-induced RGC death. We found that NC- or KA-induced RGC death was significantly less in the ApoE-deficient mice than in the WT mice. These data suggest that the ApoE deficiency had a neuroprotective effect against axonal damage-induced RGC death by suppressing the KA receptor signaling. Copyright © 2014 Elsevier B.V. All rights reserved.
Allosteric potentiation of quisqualate receptors by a nootropic drug aniracetam.
Ito, I; Tanabe, S; Kohda, A; Sugiyama, H
1990-01-01
1. Allosteric potentiation of the ionotropic quisqualate (iQA) receptor by a nootropic drug aniracetam (1-p-anisoyl-2-pyrrolidinone) was investigated using Xenopus oocytes injected with rat brain mRNA and rat hippocampal slices. 2. Aniracetam potentiates the iQA responses induced in Xenopus oocytes by rat brain mRNA in a reversible manner. This effect was observed above the concentrations of 0.1 mM. Kainate. N-methyl-D-aspartate and gamma-aminobutyric acid responses induced in the same oocytes were not affected. 3. The specific potentiation of iQA responses was accompanied by an increase in the conductance change of iQA and alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) responses, but the affinity of receptors for agonist and the ion-selectivity of the channels (reversal potentials) were not changed. 4. Aniracetam reversibly potentiated the iQA responses recorded intracellularly from the pyramidal cells in the CA1 region of rat hippocampal slices. The excitatory postsynaptic potentials (EPSPs) in Schaffer collateral-commissural-CA1 synapses were also potentiated by aniracetam. 5. Population EPSPs recorded in the mossy fibre-CA3 synapses as well as Schaffer-commissural synapses were also potentiated by aniracetam. The amplitudes of the potentiation were not changed by the formation of long-term potentiation. PMID:1975272
K-Ar chronology of the Luohe iron district, Anhui Province, China
McKee, E.H.
1988-01-01
Twelve samples of rock from the four mapped units or cycles and one of the major intrusive bodies were collected and evaluated for K-Ar age determination. These include specimens from outcrop and from drill core. Biotite from two outcrop and two core samples and hornblende from one outcrop sample were separated from the sample and dated; a sixth sample was dated using crushed, sieved, and acid-treated whole rock. The ages and analytical data to support them are compatible with the observed relationships in the field or from the drill holes. The percent of K2O in all samples is typical of fresh unaltered mineral phases and the percent of radiogenetic 40Ar relative to total 40Ar is high (88.8 to 63.8%) yielding relatively low analytical errors. -from Authors
NASA Astrophysics Data System (ADS)
Wemmer, Klaus; Steenken, André; Müller, Stefan; de Luchi, Mónica G. López; Siegesmund, Siegfried
2011-04-01
The Sierra de San Luis forms the southern tip of the Eastern Sierras Pampeanas in central Argentina. Two narrow belts of low-grade phyllites and quartz arenites, i.e. the San Luis Formation, have accommodated part of the strain-related differential exhumation of the medium- to high-grade metamorphic domains that constitute to the basement complex of the sierra. Eleven phyllite samples were subjected to the K/Ar fine-fraction dating technique. Results are interpreted in relation to the Kübler index of the illites, which indicate epimetamorphic conditions for the majority of the samples. Obtained ages between 330 and 290 Ma cover a period of compressional tectonics in the late Mississippian (Visean/Serpukhovian boundary) followed by the subsidence during the formation of the Paganzo Basin in the provinces of La Rioja and San Luis. These tectonic movements are coincident with the Toco orogeny in northern Chile and southern Bolivia. This suggests that the older K/Ar ages document the compressional stage and that younger ages record the cooling of the basement during the subsequent extensional uplift of the basement.
NASA Astrophysics Data System (ADS)
Fukui, Shiro; Tsujimori, Tatsuki; Watanabe, Teruo; Itaya, Tetsumaru
2012-10-01
The Tia Complex in the southern New England Fold Belt is a poly-metamorphosed Late Paleozoic accretionary complex. It consists mainly of high-P/low-T type pumpellyite-actinolite facies (rare blueschist facies) schists, phyllite and serpentinite (T = 300 °C and P = 5 kbar), and low-P/high-T type amphibolite facies schist and gneiss (T = 600 °C and P < 5 kbar) associated with granodioritic plutons (Tia granodiorite). White mica and biotite K-Ar ages distinguish Carboniferous subduction zone metamorphism and Permian granitic intrusions, respectively. The systematic K-Ar age mapping along a N-S traverse of the Tia Complex exhibits a gradual change. The white mica ages become younger from the lowest-grade zone (339 Ma) to the highest-grade zone (259 Ma). In contrast, Si content of muscovite changes drastically only in the highest-grade zone. The regional changes of white mica K-Ar ages and chemical compositions of micas indicate argon depletion from precursor high-P/low-T type phengitic white mica during the thermal overprinting and recrystallization by granitoids intrusions. Our new K-Ar ages and available geological data postulate a model of the eastward rollback of a subduction zone in Early Permian. The eastward shift of a subduction zone system and subsequent magmatic activities of high-Mg andesite and adakite might explain formation of S-type granitoids (Hillgrove suite) and coeval low-P/high-T type metamorphism in the Tia Complex.
Aniracetam and DNQX affect the acquisition of rapid tolerance to ethanol in mice.
Rial, Daniel; Takahashi, Reinaldo Naoto; Morato, Gina Struffaldi
2009-03-01
Several studies have emphasized the role of learning in the development of rapid tolerance and have shown that glutamate-mediated neurotransmission plays an important role in this phenomenon. Since the AMPA/kainate receptor system is directly involved in plasticity mechanisms, the influence of this receptor system on rapid tolerance induced by ethanol was studied using the rotarod. In the first experiment, mice were pretreated with aniracetam, an agonist of AMPA/kainate receptors, 30 min before ethanol (2.75 g/kg; IP) treatment, and tested on the rotarod. After 24 h, the groups were tested on the rotarod under ethanol treatment. Aniracetam facilitated the acquisition of rapid tolerance to ethanol. In the second experiment, mice received DNQX, a competitive antagonist of the AMPA receptor, 30 min before ethanol treatment (3 g/kg) and submitted to the rotarod. This dose of ethanol produced tolerance per se. Groups were tested under ethanol treatment (1.75 g/kg) after 24 h. DNQX blocked rapid tolerance to ethanol. Using a similar protocol, the third experiment showed that DNQX blocked the aniracetam-induced facilitation of rapid tolerance to ethanol. Our results show that aniracetam facilitates whereas DNQX blocks ethanol tolerance, suggesting that the non-NMDA receptors are involved in this phenomenon.
Karim, M R; Atoji, Y
2016-02-01
Glutamate is a principal excitatory neurotransmitter in the auditory system. Our previous studies revealed localization of glutamate receptor mRNAs in the pigeon cochlear nuclei, suggesting the existence of glutamatergic input from the auditory nerve to the brainstem. This study demonstrated localization of mRNAs for vesicular glutamate transporter 2 (vGluT2) and ionotropic glutamate receptors (AMPA, kainate and NMDA) in the auditory ganglion (AG) and cochlear nuclei (magnocellular, angular and laminar nuclei). VGluT2 mRNA was intensely expressed in AG and intensely or moderately in the cochlear nuclei. The AG and cochlear nuclei showed intense-to-moderate mRNA signals for GluA2, GluA3, GluA4, GluK4 and GluN1. These results suggest that the pigeon AG neurons receives glutamatergic input from hair cells and in turn projects to the magnocellular and angular nuclei. Glutamate may play a pivotal role in the excitatory synapse transmission in the peripheral auditory pathway of birds. © 2015 Blackwell Verlag GmbH.
Rorick-Kehn, Linda M; Hart, John C; McKinzie, David L
2005-12-01
Accumulating evidence suggests that drugs acting on the glutamatergic system may represent promising novel therapeutic targets for the treatment of anxiety disorders. The stress-induced hyperthermia paradigm has been used widely to model some of the physiological symptoms associated with anxiety disorders and has produced results that are predictive of clinical efficacy. We have modified this paradigm to measure the autonomic consequences of stress induced by the fear of predation in mice. To evaluate the efficacy of several classes of metabotropic and ionotropic glutamate receptor ligands, as well as known anxiolytics and psychotropic comparators, in attenuating predatory-stress-induced hyperthermia. Male DBA/2 mice were implanted with radiotelemetric transmitters in the peritoneal cavity to measure stress-related increases in core body temperature, following placement in a novel cage containing soiled rat shavings. Clinically active compounds such as chlordiazepoxide (5-10 mg/kg), alprazolam (0.3-3 mg/kg), and buspirone (10-30 mg/kg) exhibited an anxiolytic profile. Assessment of glutamatergic agents indicated that the mGlu1 receptor antagonist LY456236 (10-30 mg/kg), mGlu5 receptor antagonist MPEP (10-30 mg/kg), mGlu2/3 receptor agonist LY354740 (3-10 mg/kg), mGlu2 receptor potentiator LY566332 (30 and 100 mg/kg), mGlu8 receptor agonist (S)-3,4-dicarboxyphenylglycine (30-60 mg/kg), competitive NMDA receptor antagonist LY235959 (1 mg/kg), AMPA receptor antagonist GYKI-52466 (10-20 mg/kg), and glycine transporter-1 (GlyT-1) inhibitor ALX-5407 (3-10 mg/kg) dose-dependently attenuated stress-induced hyperthermia. The AMPA receptor potentiator LY451646, iGlu5 kainate receptor antagonist LY382884, glycine(B) receptor partial agonist D: -cycloserine, and GlyT-1 inhibitor ORG-24461 were ineffective in this model. Select metabotropic and ionotropic glutamate receptor ligands exhibited an anxiolytic profile, as measured by the attenuation of stress-induced hyperthermia
Excitatory Amino Acids as Transmitters in the Brain
1989-04-30
Amino Acids as Transmitters in the Brain 12 PERSONAL AUTHOR(S) Cotman, C.W. 13a TYPE OF REPORT 1i3b TIME OYERED 14. DATE OF REPORT (Ye, Month, Day) 5s...necenearia i dentf by block number) FIEL.D GROUP SBGOP Excitatory receptors, excitatory amino acids , excitotoxicit N-methyl-D-aspartate, kainate...mediated by excitatory amino acids and their receptors. These receptors participate in both standard synaptic transmission as well as higher order
Nootropic agents enhance the recruitment of fast GABAA inhibition in rat neocortex.
Ling, Douglas S F; Benardo, Larry S
2005-07-01
It is widely believed that nootropic (cognition-enhancing) agents produce their therapeutic effects by augmenting excitatory synaptic transmission in cortical circuits, primarily through positive modulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionate receptors (AMPARs). However, GABA-mediated inhibition is also critical for cognition, and enhanced GABA function may be likewise therapeutic for cognitive disorders. Could nootropics act through such a mechanism as well? To address this question, we examined the effects of nootropic agents on excitatory and inhibitory postsynaptic currents (EPSCs and IPSCs) recorded from layer V pyramidal cells in acute slices of somatosensory cortex. Aniracetam, a positive modulator of AMPA/kainate receptors, increased the peak amplitude of evoked EPSCs and the amplitude and duration of polysynaptic fast IPSCs, manifested as a greater total charge carried by IPSCs. As a result, the EPSC/IPSC ratio of total charge was decreased, representing a shift in the excitation-inhibition balance that favors inhibition. Aniracetam did not affect the magnitude of either monosynaptic IPSCs (mono-IPSCs) recorded in the presence of excitatory amino acid receptor antagonists, or miniature IPSCs (mIPSCs) recorded in the presence of tetrodotoxin. However, the duration of both mono-IPSCs and mIPSCs was prolonged, suggesting that aniracetam also directly modulates GABAergic transmission. Cyclothiazide, a preferential modulator of AMPAR function, enhanced the magnitude and duration of polysynaptic IPSCs, similar to aniracetam, but did not affect mono-IPSCs. Concanavalin A, a kainate receptor modulator, had little effect on EPSCs or IPSCs, suggesting there was no contribution from kainate receptor activity. These findings indicate that AMPAR modulators strengthen inhibition in neocortical pyramidal cells, most likely by altering the kinetics of AMPARs on synaptically connected interneurons and possibly by modulating GABA(A) receptor responses
NASA Astrophysics Data System (ADS)
Gouzu, Chitaro; Yagi, Koshi; Thanh, Ngo Xuan; Itaya, Tetsumaru; Compagnoni, Roberto
2016-04-01
High-pressure and ultra-high pressure (HP-UHP) blueschist- and eclogite-facies metabasaltic and metasedimentary rocks occur in four different tectonic units near Lago di Cignana, western Alps. We have determined K-Ar ages for white micas (matrix phengite and paragonite) from the Lago di Cignana UHP unit (LCU; 39-41 Ma); the lower and upper units of the Zermatt-Saas meta-ophiolite (LU and UU; 37-38 Ma and 38-41 Ma respectively), and the Combin unit (CU; 36-40 Ma). These K-Ar ages overlap with single-grain Ar-Ar plateau ages (36-42 Ma) previously determined for phengites from LCU metasediments. Matrix white micas have been severely deformed during exhumation, and their chemistries differ from those of micas included in garnet. Although individual mica grains in the matrix could have experienced different degrees of deformation which have reset their K-Ar systems, "bulk" white mica separates provide the average age of all the individual grains in the separate. The similarity of ages determined for white micas from the LCU, LU, UU and CU units, regardless of rock type and mineral species, suggests that these four units were metamorphosed together as part of a single metamorphic sequence in the Piemonte-Liguria paleosubduction zone and were subsequently exhumed together. However, present-day structural relationship among those units and the limited occurrence of UHP minerals in LCU suggests that the exhumation of LCU was more rapid than that for LU, UU and CU. The age gaps between the youngest value of white mica K-Ar ages in each unit and the inferred timing of the metamorphic peak (U-Pb age: 44 Ma) is 5, 7, 6 and 8 Myr for LCU, LU, UU and CU, respectively. These intervals are considerably shorter than that determined for the Sanbagawa HP metamorphic belt of Southwest Japan (> 31 Myr). The short interval observed for the Lago di Cignana units that we have studied is consistent with the model of rapid exhumation of the UHP-bearing metamorphic domain, suggesting the
Back, Franklin P; Carobrez, Antonio P
2018-06-01
Stimulation of the midbrain periaqueductal gray matter (PAG) in humans elicits sensations of fear and impending terror, and mediates predator defensive responses in rodents. In rats, pharmacological stimulation of the dorsolateral portion of the PAG (dlPAG) with N-Methyl-d-Aspartate (NMDA) induces aversive conditioning that acts as an unconditioned stimulus (US). In the present work, we investigated the interplay between the vanilloid TRPV1 and cannabinoid CB1 receptors in the NMDA-dlPAG defensive response and in subsequent aversive learning. Rats were subjected to dlPAG NMDA infusion in an olfactory conditioned stimulus (CS) task allowing the evaluation of immediate and long-term defensive behavioral responses during CS presentation. The results indicated that an intermediate dose of NMDA (50 pmol) induced both immediate and long-term effects. A sub-effective dose of NMDA (25 pmol) was potentiated by the TRPV1 receptor agonist capsaicin (CAP, 1 nmol) and the CB1 receptor antagonist, AM251 (200 pmol). CAP (10 nmol) or the combination of CAP (1 nmol) and AM251 (200 pmol) induced long-term effects without increasing immediate defensive responses. The glutamate release inhibitor riluzole (2 or 4 nmol) and the AMPA/kainate receptor antagonist DNQX (2 or 4 nmol) potentiated the immediate effects but blocked the long-term effects. The results showed that immediate defensive responses rely on NMDA receptors, and aversive learning on the fine-tuning of TRPV1, CB1, metabotropic glutamate and AMPA receptors located in pre- and postsynaptic membranes. In conclusion, the activity of the dlPAG determines core affective aspects of aversive memory formation controlled by local TRPV1/CB1 balance. Copyright © 2018 Elsevier Ltd. All rights reserved.
Haggerty, D C; Glykos, V; Adams, N E; Lebeau, F E N
2013-12-03
Noradrenaline (NA) in the hippocampus plays an important role in memory function and has been shown to modulate different forms of synaptic plasticity. Oscillations in the gamma frequency (20-80 Hz) band in the hippocampus have also been proposed to play an important role in memory functions and, evidence from both in vitro and in vivo studies, has suggested this activity can be modulated by NA. However, the role of different NA receptor subtypes in the modulation of gamma frequency activity has not been fully elucidated. We have found that NA (30 μM) exerts a bidirectional control on the magnitude of kainate-evoked (50-200 nM) gamma frequency oscillations in the cornu Ammonis (CA3) region of the rat hippocampus in vitro via activation of different receptor subtypes. Activation of alpha-adrenergic receptors (α-AR) reduced the power of the gamma frequency oscillation. In contrast, activation of beta-adrenergic receptors (β-AR) caused an increase in the power of the gamma frequency oscillations. Using specific agonists and antagonists of AR receptor subtypes we demonstrated that these effects are mediated specifically via α1A-AR and β1-AR subtypes. NA activated both receptor subtypes, but the α1A-AR-mediated effect predominated, resulting in a reversible suppression of gamma frequency activity. These results suggest that NA is able to differentially modulate on-going gamma frequency oscillatory activity that could result in either increased or decreased information flow through the hippocampus. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
Akinshola, B Emmanuel
2001-01-01
The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388
Gene expression of ionotropic glutamate receptor subunits in the tectofugal pathway of the pigeon.
Atoji, Y
2016-03-01
The tectofugal pathway in birds consists of four stations, the retina, optic tectum, rotundal nucleus, and entopallium, and it conveys visual information via three ascending pathways. These pathways consist of retino-tectal, tecto-rotundal and rotundo-entopallial cells, all of which are glutamatergic. The present study examined the localization of ionotropic glutamate receptors (iGluRs) to identify the target areas of glutamatergic projections in the tectofugal pathway in pigeons. Nine subunits of iGluRs were analyzed using in situ hybridization as follows: AMPA receptors (GluA1, GluA2, GluA3, and GluA4), kainate receptors (GluK1, GluK2, and GluK4), and NMDA receptors (GluN1 and GluN2A). Hybridization signals of subunits showed various intensities in different cells. In the optic tectum, a strong to moderate expression was observed in layer 10 (GluA2, GluA3, GluK4, and GluN1) and layer 13 (GluA2, GluK4, GluN1, and GluN2A). The rotundal nucleus intensely expressed GluA3, GluA4, GluK1, and GluK4. In the entopallium, an intense to moderate expression of GluK1 and GluK4, and a moderate to weak expression of AMPA and NMDA receptors were observed. Furthermore, the parvocellular and magnocellular parts of the isthmic nuclei showed a strong expression of GluA2, GluA3, GluK4, and GluN1. The present findings demonstrate the expression of iGluRs in glutamatergic projection targets of the tectofugal pathway in birds and suggest a diversity of iGluRs in the transmission of visual information. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Chan, K Y; Gupta, S; de Vries, R; Danser, A H J; Villalón, C M; Muñoz-Islas, E; Maassenvandenbrink, A
2010-07-01
During migraine, trigeminal nerves may release calcitonin gene-related peptide (CGRP), inducing cranial vasodilatation and central nociception; hence, trigeminal inhibition or blockade of craniovascular CGRP receptors may prevent this vasodilatation and abort migraine headache. Several preclinical studies have shown that glutamate receptor antagonists affect the pathophysiology of migraine. This study investigated whether antagonists of NMDA (ketamine and MK801), AMPA (GYKI52466) and kainate (LY466195) glutamate receptors affected dural vasodilatation induced by alpha-CGRP, capsaicin and periarterial electrical stimulation in rats, using intravital microscopy. Male Sprague-Dawley rats were anaesthetized and the overlying bone was thinned to visualize the dural artery. Then, vasodilator responses to exogenous (i.v. alpha-CGRP) and endogenous (released by i.v. capsaicin and periarterial electrical stimulation) CGRP were elicited in the absence or presence of the above antagonists. alpha-CGRP, capsaicin and periarterial electrical stimulation increased dural artery diameter. Ketamine and MK801 inhibited the vasodilator responses to capsaicin and electrical stimulation, while only ketamine attenuated those to alpha-CGRP. In contrast, GYKI52466 only attenuated the vasodilatation to exogenous alpha-CGRP, while LY466195 did not affect the vasodilator responses to endogenous or exogenous CGRP. Although GYKI52466 has not been tested clinically, our data suggest that it would not inhibit migraine via vascular mechanisms. Similarly, the antimigraine efficacy of LY466195 seems unrelated to vascular CGRP-mediated pathways and/or receptors. In contrast, the cranial vascular effects of ketamine and MK801 may represent a therapeutic mechanism, although the same mechanism might contribute, peripherally, to cardiovascular side effects.
Arancio, O; Yoshimura, M; Murase, K; MacDermott, A B
1993-01-01
Excitatory amino acid receptor distribution was mapped on acutely dissociated neurons from postnatal rat spinal cord dorsal horn. N-methyl D-aspartate, quisqualate and kainate were applied to multiple locations along the somal and dendritic surfaces of voltage-clamped neurons by means of a pressure application system. To partially compensate for the decrement of response amplitude due to current loss between the site of activation on the dendrite and the recording electrode at the soma, a solution containing 0.15 M KCl was applied on the cell bodies and dendrites of some cells to estimate an empirical length constant. In the majority of the cells tested, the dendritic membrane had regions of higher sensitivity to excitatory amino acid agonists than the somatic membrane, with dendritic response amplitudes reaching more than seven times those at the cell body. A comparison of the relative changes in sensitivity between each combination of two of the three excitatory amino acid agonists along the same dendrite showed different patterns of agonist sensitivity along the dendrite in the majority of the cells. These data were obtained from dorsal horn neurons that had developed and formed synaptic connections in vivo. They demonstrate that in contrast to observations made on ventral horn neurons, receptor density for all the excitatory amino acid receptors on dorsal horn neurons, including the N-methyl-D-aspartate receptor, are generally higher on the dendrites than on the soma. Further, these results are similar to those obtained from dorsal horn neurons grown in culture.
Trovero, F; Gobbi, M; Weil-Fuggaza, J; Besson, M J; Brochet, D; Pirot, S
2000-09-29
Chronic treatment of rats by sulbutiamine induced no change in density of N-methyl-D-aspartate (NMDA) and (+/-)-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors in the cingular cortex, but a significant decrease of the kainate binding sites, as measured by quantitative autoradiography. In the same treated animals, an increase of D1 dopaminergic (DA) binding sites was measured both in the prefrontal and the cingular cortex, while no modification of the D2 binding sites was detected. Furthermore, an acute sulbutiamine administration induced a decrease of kainate binding sites but no change of the density of D1 and D2 DA receptors. Acute sulbutiamine injection led to a decrease of the DA levels in the prefrontal cortex and 3,4-dihydroxyphenylacetic acid levels in both the cingular and the prefrontal cortex. These observations are discussed in terms of a modulatory effect of sulbutiamine on both dopaminergic and glutamatergic cortical transmissions.
Changes in calcium and iron levels in the brains of rats during kainate induced epilepsy
NASA Astrophysics Data System (ADS)
Ren, Min-Qin; Ong, Wei-Yi; Makjanic, Jagoda; Watt, Frank
1999-10-01
Epilepsy is a recurrent disorder of cerebral function characterised by sudden brief attacks of altered consciousness, motor activity or sensory phenomena, and affects approximately 1% of the population. Kainic acid injection induces neuronal degeneration in rats, is associated with glial hypertrophy and proliferation in the CA3-CA4 fields of hippocampal complex, and is a model for temporal lobe epilepsy. In this study we have applied Nuclear Microscopy to the investigation of the elemental changes within the hippocampus and the cortex areas of the rat brain following kainate injection. Analyses of unstained freeze dried tissue sections taken at 1 day and 1, 2, 3 and 4 weeks following injection were carried out using the Nuclear Microscopy facility at the Research Centre for Nuclear Microscopy, National University of Singapore. Quantitative analysis and elemental mapping indicates that there are significant changes in the calcium levels and distributions in the hippocampus as early as 1 day following injection. Preliminary results indicate a rapid increase in cellular calcium. High levels of calcium can activate calcium dependent proteins and phospholipases. Activation of phospholipase A 2 can be harmful to surrounding neurons through free radical damage. In addition to observed increases in calcium, there was evidence of increases in iron levels. This is consistent with measurements in other degenerative brain disorders, and may signal a late surge in free radical production.
Cannabidiol and (−)Δ9-tetrahydrocannabinol are neuroprotective antioxidants
Hampson, A. J.; Grimaldi, M.; Axelrod, J.; Wink, D.
1998-01-01
The neuroprotective actions of cannabidiol and other cannabinoids were examined in rat cortical neuron cultures exposed to toxic levels of the excitatory neurotransmitter glutamate. Glutamate toxicity was reduced by both cannabidiol, a nonpsychoactive constituent of marijuana, and the psychotropic cannabinoid (−)Δ9-tetrahydrocannabinol (THC). Cannabinoids protected equally well against neurotoxicity mediated by N-methyl-d-aspartate receptors, 2-amino-3-(4-butyl-3-hydroxyisoxazol-5-yl)propionic acid receptors, or kainate receptors. N-methyl-d-aspartate receptor-induced toxicity has been shown to be calcium dependent; this study demonstrates that 2-amino-3-(4-butyl-3-hydroxyisoxazol-5-yl)propionic acid/kainate receptor-type neurotoxicity is also calcium-dependent, partly mediated by voltage sensitive calcium channels. The neuroprotection observed with cannabidiol and THC was unaffected by cannabinoid receptor antagonist, indicating it to be cannabinoid receptor independent. Previous studies have shown that glutamate toxicity may be prevented by antioxidants. Cannabidiol, THC and several synthetic cannabinoids all were demonstrated to be antioxidants by cyclic voltametry. Cannabidiol and THC also were shown to prevent hydroperoxide-induced oxidative damage as well as or better than other antioxidants in a chemical (Fenton reaction) system and neuronal cultures. Cannabidiol was more protective against glutamate neurotoxicity than either ascorbate or α-tocopherol, indicating it to be a potent antioxidant. These data also suggest that the naturally occurring, nonpsychotropic cannabinoid, cannabidiol, may be a potentially useful therapeutic agent for the treatment of oxidative neurological disorders such as cerebral ischemia. PMID:9653176
Urstadt, Kevin R; Kally, Peter; Zaidi, Sana F; Stanley, B Glenn
2013-04-01
The nucleus accumbens shell (AcbSh) and the lateral hypothalamus (LH) are both involved in the control of food intake. Activation of GABA(A) receptors or blockade of AMPA and kainate receptors within the AcbSh induces feeding, as does blockade of GABA(A) receptors or activation of NMDA receptors in the LH. Further, evidence suggests that feeding induced via the AcbSh can be suppressed by LH inhibition. However, it is unclear if this suppression is specific to feeding. Adult male Sprague-Dawley rats with 3 intracranial guide cannulas, one unilaterally into the AcbSh and two bilaterally into the LH, were used to explore this issue. DNQX (1.25 μg) or muscimol (100 ng) infused into the AcbSh unilaterally elicited feeding, and this elicited intake was suppressed by bilateral LH injection of d-AP5 (2 μg) or muscimol (25 ng). The effectiveness of d-AP5 or muscimol infusion into either the LH site ipsilateral or contralateral to the AcbSh injection was compared. Ipsilateral LH injection of d-AP5 or muscimol was significantly more effective than contralateral injection in suppressing food intake initiated by AcbSh injection of DNQX or muscimol. These results add to the prior evidence that inhibition of the LH through pharmacological modulation of NMDA or GABA(A) receptors specifically suppresses feeding initiated by AcbSh inhibition, and that these two regions communicate via an ipsilateral circuit to specifically regulate feeding. Copyright © 2012 Elsevier Ltd. All rights reserved.
Koeneman, Lisa L.; Wilson, Frederic H.
2018-04-06
Sample descriptions and analytical data for more than 200 K/Ar and 40Ar/39Ar analyses from rocks of the Alaska-Aleutian Range batholith of south-central Alaska are reported here. Samples were collected over a period of 20 years by Bruce R. Reed and Marvin A. Lanphere (both U.S. Geological Survey) as part of their studies of the batholith.
Von Bergen, Nicholas H; Subieta, Alberto; Brennan, Timothy J
2002-07-01
Excitatory amino acid receptors are important for both sensory and motor function in the spinal cord. We studied the effects of intrathecal LY293558, a competitive non-N-methyl-D-aspartate excitatory amino acid receptor antagonist, on motor and sensory function in rats to determine whether drugs blocking these receptors could potentially be used as alternative agents to local anesthetics for spinal anesthesia. Rats were tested before and 15-240 min after intrathecal injection of 5 nmol (in 10 microl) LY293558. Sensory function was tested at the hind paw using withdrawal response to pin prick and withdrawal to pinch with sharp forceps. Motor performance (ambulation, placing reflex, and Rotorod time), blood pressure, and heart rate were also evaluated. Some tests were repeated the next day. Responses after LY293558 were compared to injection of 40 microl bupivacaine, 0.75%. Pin-prick responses at the forepaw, chest, abdomen, hind leg, and hind paw were also examined after intrathecal LY293558. Intrathecal LY293558 blocked both sensory and motor responses through 180 min; complete recovery was present the following day. No change in blood pressure or heart rate occurred. The effects of LY293558 were more pronounced and sustained than those of bupivacaine. Segmental blockade of the response to pin prick was present after LY293558. Drugs like LY293558 that block alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA)/kainate receptors may be an alternative to local anesthetics for spinal anesthesia in humans.
K-Ar dating of lunar fines - Apollo 12, Apollo 14, and Luna 16.
NASA Technical Reports Server (NTRS)
Pepin, R. O.; Bradley, J. G.; Dragon, J. C.; Nyquist, L. E.
1972-01-01
K-Ar ages were determined on a 6-in. double-focus mass spectrometer in fines of less than 1 mm from Apollo 14 and 16, and Luna 16 lunar soil samples. Age estimates of about 2.8 AE and about 4.0 AE are suggested for the two low-K components whose presence in the samples must be assumed to accommodate the age data. An average value of 0.1849 plus or minus 0.0008 was obtained for the Ar-18/Ar-36 ratio in the solar wind from ordinate intercept correlations for the Apollo 14 and Luna 16 samples. Cosmic ray exposure ages were close to 440 m.y. for both Apollo 14 samples and close to 840 m.y. for both Luna 16 samples.
Molecular modeling of the effects of 40Ar recoil in illite particles on their K-Ar isotope dating
NASA Astrophysics Data System (ADS)
Szczerba, Marek; Derkowski, Arkadiusz; Kalinichev, Andrey G.; Środoń, Jan
2015-06-01
The radioactive decay of 40K to 40Ar is the basis of isotope age determination of micaceous clay minerals formed during diagenesis. The difference in K-Ar ages between fine and coarse grained illite particles has been interpreted using detrital-authigenic components system, its crystallization history or post-crystallization diffusion. Yet another mechanism should also be considered: natural 40Ar recoil. Whether this recoil mechanism can result in a significant enough loss of 40Ar to provide observable decrease of K-Ar age of the finest illite crystallites at diagenetic temperatures - is the primary objective of this study which is based on molecular dynamics (MD) computer simulations. All the simulations were performed for the same kinetic energy (initial velocity) of the 40Ar atom, but for varying recoil angles that cover the entire range of their possible values. The results show that 40Ar recoil can lead to various deformations of the illite structure, often accompanied by the displacement of OH groups or breaking of the Si-O bonds. Depending on the recoil angle, there are four possible final positions of the 40Ar atom with respect to the 2:1 layer at the end of the simulation: it can remain in the interlayer space or end up in the closest tetrahedral, octahedral or the opposite tetrahedral sheet. No simulation angles were found for which the 40Ar atom after recoil passes completely through the 2:1 layer. The energy barrier for 40Ar passing through the hexagonal cavity from the tetrahedral sheet into the interlayer was calculated to be 17 kcal/mol. This reaction is strongly exothermic, therefore there is almost no possibility for 40Ar to remain in the tetrahedral sheet of the 2:1 layer over geological time periods. It will either leave the crystal, if close enough to the edge, or return to the interlayer space. On the other hand, if 40Ar ends up in the octahedral sheet after recoil, a substantially higher energy barrier of 55 kcal/mol prevents it from leaving
Pina, Melanie M; Cunningham, Christopher L
2016-10-15
The ventral tegmental area (VTA) is a well-established neural substrate of reward-related processes. Activity within this structure is increased by the primary and conditioned rewarding effects of abused drugs and its engagement is heavily reliant on excitatory input from structures upstream. In the case of drug seeking, it is thought that exposure to drug-associated cues engages glutamatergic VTA afferents that signal directly to dopamine cells, thereby triggering this behavior. It is unclear, however, whether glutamate input to VTA is directly involved in ethanol-associated cue seeking. Here, the role of intra-VTA ionotropic glutamate receptor (iGluR) signaling in ethanol-cue seeking was evaluated in DBA/2J mice using an ethanol conditioned place preference (CPP) procedure. Intra-VTA iGluRs α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPAR)/kainate and N-methyl-d-aspartate (NMDAR) were blocked during ethanol CPP expression by co-infusion of antagonist drugs 6,7-dinitroquinoxaline-2,3-dione (DNQX; AMPA/kainate) and d-(-)-2-Amino-5-phosphonopentanoic acid (AP5; NMDA). Compared to aCSF, bilateral infusion of low (1 DNQX+100 AP5ng/side) and high (5 DNQX+500 AP5ng/side) doses of the AMPAR and NMDAR antagonist cocktail into VTA blocked ethanol CPP expression. This effect was site specific, as DNQX/AP5 infusion proximal to VTA did not significantly impact CPP expression. An increase in activity was found at the high but not low dose of DNQX/AP5. These findings demonstrate that activation of iGluRs within the VTA is necessary for ethanol-associated cue seeking, as measured by CPP. Copyright © 2016 Elsevier B.V. All rights reserved.
Glutamate modulation of GABA transport in retinal horizontal cells of the skate
Kreitzer, Matthew A; Andersen, Kristen A; Malchow, Robert Paul
2003-01-01
Transport of the amino acid GABA into neurons and glia plays a key role in regulating the effects of GABA in the vertebrate retina. We have examined the modulation of GABA-elicited transport currents of retinal horizontal cells by glutamate, the likely neurotransmitter of vertebrate photoreceptors. Enzymatically isolated external horizontal cells of skate were examined using whole-cell voltage-clamp techniques. GABA (1 mm) elicited an inward current that was completely suppressed by the GABA transport inhibitors tiagabine (10 μm) and SKF89976-A (100 μm), but was unaffected by 100 μm picrotoxin. Prior application of 100 μm glutamate significantly reduced the GABA-elicited current. Glutamate depressed the GABA dose-response curve without shifting the curve laterally or altering the voltage dependence of the current. The ionotropic glutamate receptor agonists kainate and AMPA also reduced the GABA-elicited current, and the effects of glutamate and kainate were abolished by the ionotropic glutamate receptor antagonist 6-cyano-7-nitroquinoxaline. NMDA neither elicited a current nor modified the GABA-induced current, and metabotropic glutamate analogues were also without effect. Inhibition of the GABA-elicited current by glutamate and kainate was reduced when extracellular calcium was removed and when recording pipettes contained high concentrations of the calcium chelator BAPTA. Caffeine (5 mm) and thapsigargin (2 nm), agents known to alter intracellular calcium levels, also reduced the GABA-elicited current, but increases in calcium induced by depolarization alone did not. Our data suggest that glutamate regulates GABA transport in retinal horizontal cells through a calcium-dependent process, and imply a close physical relationship between calcium-permeable glutamate receptors and GABA transporters in these cells. PMID:12562999
Kistler, R.W.; McKee, E.H.; Futa, K.; Peterman, Z.E.; Zartman, R.E.
1985-01-01
The Copley Greenstone, Balaklala Rhyolite, and Mule Mountain stock in the West Shasta Cu-Zn district, California, have Rb-Sr, Sm-Nd, U-Pb, and K-Ar systematics that indicate they are a cogenetic suite of ensimatic island-arc rocks about 400 Ma. Pervasive alteration and mineralization of these rocks, for the most part, was syngenetic and the major component of the mineralizing fluid was Devonian seawater. K-Ar ages of quarz-sericite concentrates from ore horizons and Rb-Sr systematics of a few rock and ore specimens record a later thermal and mineralizing event in the district of about 260 Ma. Contamination of some rocks with pelagic sediments is indicated by the Sm-Nd data. -Authors
Herold, Christina; Paulitschek, Christina; Palomero-Gallagher, Nicola; Güntürkün, Onur; Zilles, Karl
2018-02-15
At the beginning of the 20th century it was suggested that a complex group of nuclei in the avian posterior ventral telencephalon is comparable to the mammalian amygdala. Subsequent findings, however, revealed that most of these structures share premotor characteristics, while some indeed constitute the avian amygdala. These developments resulted in 2004 in a change of nomenclature of these nuclei, which from then on were named arcopallial or amygdala nuclei and referred to as the arcopallium/amygdala complex. The structural basis for the similarities between avian and mammalian arcopallial and amygdala subregions is poorly understood. Therefore, we analyzed binding site densities for glutamatergic AMPA, NMDA and kainate, GABAergic GABA A , muscarinic M 1 , M 2 and nicotinic acetylcholine (nACh; α 4 β 2 subtype), noradrenergic α 1 and α 2 , serotonergic 5-HT 1A and dopaminergic D 1/5 receptors using quantitative in vitro receptor autoradiography combined with a detailed analysis of the cyto- and myelo-architecture. Our approach supports a segregation of the pigeon's arcopallium/amygdala complex into the following subregions: the arcopallium anterius (AA), the arcopallium ventrale (AV), the arcopallium dorsale (AD), the arcopallium intermedium (AI), the arcopallium mediale (AM), the arcopallium posterius (AP), the nucleus posterioris amygdalopallii pars basalis (PoAb) and pars compacta (PoAc), the nucleus taeniae amgygdalae (TnA) and the area subpallialis amygdalae (SpA). Some of these subregions showed further subnuclei and each region of the arcopallium/amygdala complex are characterized by a distinct multi-receptor density expression. Here we provide a new detailed map of the pigeon's arcopallium/amygdala complex and compare the receptor architecture of the subregions to their possible mammalian counterparts. © 2017 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Clauer, N.; Lewan, M. D.; Dolan, M. P.; Chaudhuri, S.; Curtis, J. B.
2014-04-01
Progressive maturation of the Eocene Kreyenhagen Shale from the San Joaquin Basin of California was studied by combining mineralogical and chemical analyses with K-Ar dating of whole rocks and <2 μm clay fractions from naturally buried samples and laboratory induced maturation by hydrous pyrolysis of an immature outcrop sample. The K-Ar age decreases from 89.9 ± 3.9 and 72.4 ± 4.2 Ma for the outcrop whole rock and its <2 μm fraction, respectively, to 29.7 ± 1.5 and 21.0 ± 0.7 Ma for the equivalent materials buried to 5167 m. The natural maturation does not produce K-Ar ages in the historical sense, but rather K/Ar ratios of relative K and radiogenic 40Ar amounts resulting from a combined crystallization of authigenic and alteration of initial detrital K-bearing minerals of the rocks. The Al/K ratio of the naturally matured rocks is essentially constant for the entire depth sequence, indicating that there is no detectable variation in the crystallo-chemical organization of the K-bearing alumino-silicates with depth. No supply of K from outside of the rock volumes occurred, which indicates a closed-system behavior for it. Conversely, the content of the total organic carbon (TOC) content decreases significantly with burial, based on the progressive increasing Al/TOC ratio of the whole rocks. The initial varied mineralogy and chemistry of the rocks and their <2 μm fractions resulting from differences in detrital sources and depositional settings give scattered results that homogenize progressively during burial due to increased authigenesis, and concomitant increased alteration of the detrital material. Hydrous pyrolysis was intended to alleviate the problem of mineral and chemical variations in initially deposited rocks of naturally matured sequences. However, experiments on aliquots from thermally immature Kreyenhagen Shale outcrop sample did not mimic the results from naturally buried samples. Experiments conducted for 72 h at temperatures from 270 to 365
Martin, Pamela Moore; Ola, Mohammad S.; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B.
2013-01-01
Recent studies demonstrated that the excitotoxic amino acid homocysteine induces apoptotic death of retinal ganglion cells in vivo. In the present study, an in vitro rat retinal ganglion cell (RGC-5) culture system was used to analyze the toxicity of acute exposure to high levels of homocysteine, the mechanism of homocysteine-induced toxicity and the usefulness of σR1 ligands as neuroprotectants. When cultured RGC-5 cells were subjected to treatment with 1 mM D, L- homocysteine, a significant increase in cell death was detected by TUNEL analysis and analysis of activated caspase. When cells were treated with homocysteine- or glutamate in the presence of MK-801, an antagonist of the NMDA receptor, the cell death was inhibited significantly. In contrast, NBQX, an antagonist of the AMPA/Kainate receptor, and nifedipine, a calcium channel blocker, did not prevent the homocysteine- or glutamate-induced cell death. Semi-quantitative RT-PCR and immunocytochemical analysis demonstrated that RGC-5 cells exposed to homocysteine or glutamate express type 1 sigma receptor at levels similar to control cells. Treatment of RGC-5 cells with 3 µM or 10 µM concentrations of the σR1-specific ligand (+)-pentazocine inhibited significantly the apoptotic cell death induced by homocysteine or glutamate. The results suggest that homocysteine is toxic to ganglion cells in vitro, that the toxicity is mediated via NMDA receptor activation, and that the σR1-specific ligand (+)-pentazocine can block the RGC-5 cell death induced by homocysteine and glutamate. PMID:15046867
Sámano, C; Nasrabady, S E; Nistri, A
2012-10-11
Excitotoxicity triggered by over-stimulation of glutamatergic receptors is considered to be a major component of damage following acute spinal cord injury (SCI). Using an in vitro model of neonatal rat SCI caused by transient application (1h) of the glutamate agonist kainate (0.05-0.1 mM) to produce limited excitotoxicity, the present study investigated whether riluzole, a drug inhibiting glutamate release and neuronal excitability, could prevent neuronal loss and protect locomotor patterns 24 h later. Immunohistochemical analysis of neuronal and motoneuronal populations was associated with recording of fictive locomotion induced by neurochemicals or dorsal root stimuli. Riluzole (5 μM; 24 h application) per se exerted strong and persistent neurodepressant effects on network synaptic transmission from which recovery was very slow. When continuously applied after kainate, riluzole partially reduced the number of pyknotic cells in the gray matter, although motoneurons remained vulnerable and no fictive locomotion was present. In further experiments, riluzole per se was applied for 3 h (expected to coincide with kainate peak excitotoxicity) and washed out for 24 h with full return of fictive locomotion. When this protocol was implemented after kainate, no efficient histological or functional recovery was observed. No additional benefit was detected even when riluzole was co-applied with kainate and continued for the following 3 h. These results show that modest neuronal losses evoked by excitotoxicity have a severe impact on locomotor network function, and that they cannot be satisfactorily blocked by strong neurodepression with riluzole, suggesting the need for more effective pharmacological approaches. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.
Mutual enhancement of central neurotoxicity induced by ketamine followed by methamphetamine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ke, J.-J.; Chen, H.-I.; Jen, C.J.
2008-03-01
We hereby report that repeated administration of ketamine (350 mg/kg in total) and methamphetamine (30 mg/kg in total) causes specific glutamatergic and dopaminergic neuron deficits, respectively, in adult mouse brain. Acute ketamine did not affect basal body temperature or the later methamphetamine-induced hyperthermia. However, pretreatment with repeated doses of ketamine aggravated methamphetamine-induced dopaminergic terminal loss as evidenced by a drastic decrease in the levels of dopamine, 3,4-dihydroxyphenylacetic acid, and dopamine transporter density as well as poor gait balance performance. In contrast, methamphetamine-induced serotonergic depletion was not altered by ketamine pretreatment. Likewise, the subsequent treatment with methamphetamine exacerbated the ketamine-induced glutamatergicmore » damage as indicated by reduced levels of the vesicular glutamate transporter in hippocampus and striatum and poor memory performance in the Morris water maze. Finally, since activation of the D1 and AMPA/kainate receptors has been known to be involved in the release of glutamate and dopamine, we examined the effects of co-administration of SCH23390, a D1 antagonist, and CNQX, an AMPA/kainate antagonist. Intraventricular CNQX infusion abolished ketamine's potentiation of methamphetamine-induced dopamine neurotoxicity, while systemic SCH23390 mitigated methamphetamine's potentiation of ketamine-induced glutamatergic toxicity. We conclude that repeated doses of ketamine potentiate methamphetamine-induced dopamine neurotoxicity via AMPA/kainate activation and that conjunctive use of methamphetamine aggravates ketamine-induced glutamatergic neurotoxicity possibly via D1 receptor activation.« less
Study of inelastic processes in Li+-Ar, K+-Ar, and Na+-He collisions in the energy range 0.5-10 keV
NASA Astrophysics Data System (ADS)
Lomsadze, Ramaz A.; Gochitashvili, Malkhaz R.; Kezerashvili, Roman Ya; Schulz, Michael
2017-11-01
Absolute cross sections are measured for charge-exchange, ionization, and excitation processes within the same experimental setup for the Li{}+-Ar, K{}+-Ar, and Na{}+-He collisions in the ion energy range of 0.5-10 keV. The results of the measurements and schematic correlation diagrams are used to analyze and determine the mechanisms for these processes. The experimental results show that the charge-exchange processes occur with high probabilities and electrons are predominantly captured in ground states. The contributions of various partial inelastic channels to the total ionization cross section are estimated, and a primary mechanism for the process is identified. In addition, the energy-loss spectrum is applied in order to estimate the relative contribution of different inelastic channels, and to determine the mechanisms for the ionization and for some excitation processes of Ar resonance lines for the {{{K}}}+-Ar collision system. The excitation cross sections for the helium and for the sodium doublet lines for the Na{}+-He collision system both reveal some unexpected features. A mechanism to explain this observation is suggested.
Lawrence, J Josh; Brenowitz, Stephan; Trussell, Laurence O
2003-08-01
The mechanism of action of aniracetam on alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors was examined in outside-out patches and at glutamatergic synapses in neurons of the chick cochlear nucleus. A combination of rapid-flow analysis, using glutamate as an agonist, and kinetic modeling indicated that aniracetam slows both the rate of channel closing, and the microscopic rates of desensitization, even for partially liganded receptors. Little effect was observed on the rate of recovery from desensitization or on the response to the weakly desensitizing agonist kainate. Aniracetam's effects on receptor deactivation saturated at lower concentrations than its effects on desensitization, suggesting that cooperativity between homologous binding sites was required to regulate desensitization. Analysis of responses to paired pulses of agonist also indicated that AMPA receptors must desensitize partially even after agonist exposures too brief to permit rebinding. In the presence of aniracetam, evoked excitatory synaptic currents (EPSCs) and miniature EPSCs in low quantal-content conditions had decay times similar to the time course of receptor deactivation. Under these conditions, the time course of both transmitter release and clearance must be <1 to 2 ms. However, in high quantal-content conditions, the evoked EPSC in aniracetam decayed with a time course intermediate between deactivation and desensitization, suggesting that the time course of transmitter clearance is prolonged because of pooling of transmitter in the synaptic cleft. Moreover, by comparing the amounts of paired-pulse synaptic depression and patch desensitization prevented by aniracetam, we conclude that significant desensitization occurs in response to rebinding of transmitter to the AMPA receptors.
In-situ Geochronology on the Mars 2020 Rover with KArLE (The Potassium-Argon Laser Experiment)
NASA Technical Reports Server (NTRS)
Cohen, Barbara A.; Li, Z. -H.; Miller, J. S.; Devismes, D.; Swindle, T. D.; Schwenzer, S. P.; Kelley, S. P.; Zacny, K. A.; Roark, S. E.; Hardaway, L. R.;
2014-01-01
A successful Mars exploration program has revealed chapters of Mars history, but in this book, the pages are ripped out of the binding and scattered across the surface. An examination of each page reveals interesting information, but there is no way to read the book in a logical order. Geochronology is the tool that puts page number onto the individual pages, and allows the book of Martian history to be read in its proper order. The KArLE experiment performs the first dedicated in situ geochronology investigation on Mars, bringing clarity to Mars 2020 samples and context to its landing site.
Johnston, April; McBain, Chris J; Fisahn, André
2014-01-01
Rhythmic cortical neuronal oscillations in the gamma frequency band (30–80 Hz, gamma oscillations) have been associated with cognitive processes such as sensory perception and integration, attention, learning, and memory. Gamma oscillations are disrupted in disorders for which cognitive deficits are hallmark symptoms such as schizophrenia and Alzheimer's disease. In vitro, various neurotransmitters have been found to modulate gamma oscillations. Serotonin (5-HT) has long been known to be important for both behavioural and cognitive functions such as learning and memory. Multiple 5-HT receptor subtypes are expressed in the CA3 region of the hippocampus and high doses of 5-HT reduce the power of induced gamma oscillations. Hypothesizing that 5-HT may have cell- and receptor subtype-specific modulatory effects, we investigated the receptor subtypes, cell types and cellular mechanisms engaged by 5-HT in the modulation of gamma oscillations in mice and rats. We found that 5-HT decreases the power of kainate-induced hippocampal gamma oscillations in both species via the 5-HT1A receptor subtype. Whole-cell patch clamp recordings demonstrated that this decrease was caused by a hyperpolarization of CA3 pyramidal cells and a reduction of their firing frequency, but not by alteration of inhibitory neurotransmission. Finally, our results show that the effect on pyramidal cells is mediated via the G protein-coupled receptor inwardly rectifying potassium channel Kir3. Our findings suggest this novel cellular mechanism as a potential target for therapies that are aimed at alleviating cognitive decline by helping the brain to maintain or re-establish normal gamma oscillation levels in neuropsychiatric and neurodegenerative disorders. PMID:25107925
Inhibition of non-NMDA ionotropic glutamate receptors delays the retinal degeneration in rd10 mouse.
Xiang, Zongqin; Bao, Yiqin; Zhang, Jia; Liu, Chao; Xu, Di; Liu, Feng; Chen, Hui; He, Liumin; Ramakrishna, Seeram; Zhang, Zaijun; Vardi, Noga; Xu, Ying
2018-06-22
Retinitis pigmentosa (RP) is a hereditary blinding disease characterized by neurodegeneration of photoreceptors. Retinal ganglion cells (RGCs) in animal models of RP exhibit an abnormally high spontaneous activity that interferes with signal processing. Blocking AMPA/Kainate receptors by bath application of CNQX decreases the spontaneous firing, suggesting that inhibiting these receptors in vivo may help maintain the function of inner retinal neurons in rd10 mice experiencing photoreceptor degeneration. To test this, rd10 mice were i.p. injected with CNQX or GYKI 52466 (an AMPA receptor antagonist) for 1-2 weeks, and examined for their retinal morphology (by immunocytochemistry), function (by MEA recordings) and visual behaviors (using a black/white box). Our data show that iGluRs were up-regulated in the inner plexiform layer (IPL) of rd10 retinas. Application of CNQX at low doses both in vitro and in vivo, attenuated the abnormal spontaneous spiking in RGCs, and increased the light-evoked response of ON RGCs, whereas GYKI 52466 had little effect. CNQX application also improved the behavioral performance. Interestingly, in vivo administration of CNQX delayed photoreceptor degeneration, evidenced by the increased cell number and restored structure. CNQX also improved the structure of bipolar cells. Together, we demonstrated that during photoreceptor degeneration, blockade of the non-NMDA iGluRs decelerates the progression of RGCs dysfunction, possibly by dual mechanisms including slowing photoreceptor degeneration and modulating signal processing within the IPL. Accordingly, this strategy may effectively extend the time window for treating RP. Copyright © 2018. Published by Elsevier Ltd.
Timofeeva, Olga; Nadler, J Victor
2006-03-17
Recurrent mossy fiber synapses in the dentate gyrus of epileptic brain facilitate the synchronous firing of granule cells and may promote seizure propagation. Mossy fiber terminals contain and release zinc. Released zinc inhibits the activation of NMDA receptors and may therefore oppose the development of granule cell epileptiform activity. Hippocampal slices from rats that had experienced pilocarpine-induced status epilepticus and developed a recurrent mossy fiber pathway were used to investigate this possibility. Actions of released zinc were inferred from the effects of chelation with 1 mM calcium disodium EDTA (CaEDTA). When granule cell population bursts were evoked by mossy fiber stimulation in the presence of 6 mM K(+) and 30 microM bicuculline, CaEDTA slowed the rate at which evoked bursting developed, but did not change the magnitude of the bursts once they had developed fully. The effects of CaEDTA were then studied on the pharmacologically isolated NMDA receptor- and AMPA/kainate receptor-mediated components of the fully developed bursts. CaEDTA increased the magnitude of NMDA receptor-mediated bursts and reduced the magnitude of AMPA/kainate receptor-mediated bursts. CaEDTA did not affect the granule cell bursts evoked in slices from untreated rats by stimulating the perforant path in the presence of bicuculline and 6 mM K(+). These results suggest that zinc released from the recurrent mossy fibers serves mainly to facilitate the recruitment of dentate granule cells into population bursts.
Multireceptor fingerprints in progressive supranuclear palsy.
Chiu, Wang Zheng; Donker Kaat, Laura; Boon, Agnita J W; Kamphorst, Wouter; Schleicher, Axel; Zilles, Karl; van Swieten, John C; Palomero-Gallagher, Nicola
2017-04-17
Progressive supranuclear palsy (PSP) with a frontal presentation, characterized by cognitive deficits and behavioral changes, has been recognized as an early clinical picture, distinct from the classical so-called Richardson and parkinsonism presentations. The midcingulate cortex is associated with executive and attention tasks and has consistently been found to be impaired in imaging studies of patients with PSP. The aim of the present study was to determine alterations in neurotransmission underlying the pathophysiology of PSP, as well as their significance for clinically identifiable PSP subgroups. In vitro receptor autoradiography was used to quantify densities of 20 different receptors in the caudate nucleus and midcingulate area 24' of patients with PSP (n = 16) and age- and sex-matched control subjects (n = 14). Densities of γ-aminobutyric acid type B, peripheral benzodiazepine, serotonin receptor type 2, and N-methyl-D-aspartate receptors were significantly higher in area 24' of patients with PSP, where tau impairment was stronger than in the caudate nucleus. Kainate and nicotinic cholinergic receptor densities were significantly lower, and adenosine receptor type 1 (A 1 ) receptors significantly higher, in the caudate nucleus of patients with PSP. Receptor fingerprints also segregated PSP subgroups when clinical parameters such as occurrence of frontal presentation and tau pathology severity were taken into consideration. We demonstrate, for the first time to our knowledge, that kainate and A 1 receptors are altered in PSP and that clinically identifiable PSP subgroups differ at the neurochemical level. Numerous receptors were altered in the midcingulate cortex, further suggesting that it may prove to be a key region in PSP. Finally, we add to the evidence that nondopaminergic systems play a role in the pathophysiology of PSP, thus highlighting potential novel treatment strategies.
Assaf, Zeinab; Larsen, Anja P; Venskutonytė, Raminta; Han, Liwei; Abrahamsen, Bjarke; Nielsen, Birgitte; Gajhede, Michael; Kastrup, Jette S; Jensen, Anders A; Pickering, Darryl S; Frydenvang, Karla; Gefflaut, Thierry; Bunch, Lennart
2013-02-28
In the mammalian central nervous system, (S)-glutamate (Glu) is released from the presynaptic neuron where it activates a plethora of pre- and postsynaptic Glu receptors. The fast acting ionotropic Glu receptors (iGluRs) are ligand gated ion channels and are believed to be involved in a vast number of neurological functions such as memory and learning, synaptic plasticity, and motor function. The synthesis of 14 enantiopure 2,4-syn-Glu analogues 2b-p is accessed by a short and efficient chemoenzymatic approach starting from readily available cyclohexanone 3. Pharmacological characterization at the iGluRs and EAAT1-3 subtypes revealed analogue 2i as a selective GluK1 ligand with low nanomolar affinity. Two X-ray crystal structures of the key analogue 2i in the ligand-binding domain (LBD) of GluA2 and GluK3 were determined. Partial domain closure was seen in the GluA2-LBD complex with 2i comparable to that induced by kainate. In contrast, full domain closure was observed in the GluK3-LBD complex with 2i, similar to that of GluK3-LBD with glutamate bound.
NASA Astrophysics Data System (ADS)
Bablon, Mathilde; Quidelleur, Xavier; Samaniego, Pablo; Le Pennec, Jean-Luc; Lahitte, Pierre; Liorzou, Céline; Bustillos, Jorge Eduardo; Hidalgo, Silvana
2018-05-01
This study focuses on the evolution through time of Tungurahua volcano (Ecuador), and provides new information regarding its history. Eighteen new K-Ar ages constrain its construction and the activity of its three successive edifices. We show that the volcano is much younger than expected. Indeed, the older edifice activity only began around 293 ± 10 ka, and ended at 79 ± 3 ka. After 50 ka of quiescence, the second edifice started growing at 29 ± 2 ka after a major sector collapse, and itself collapsed at 3 ka. Since then, the third edifice filled the amphitheatre and is still active. Together with numerical reconstructions of the morphology of the three edifices flanks before erosion, these new ages allow us to quantify the magmatic productivity rates during their construction, from 0.6 ± 0.3 and 0.9 ± 0.2 km3/ka for the two older edifices to 2.5 ± 1.0 km3/ka for the youngest, as well as an erosion rate of 0.2 ± 0.1 km3/ka, occurring since the end of Tungurahua I construction. Major and trace element contents of lavas from the three edifices display rather similar trends. Combined with our new ages, the magmatic signature through time does not seem to have been significantly affected either by the sector collapses experienced by the volcano, or by changes of the deep magmatic source. Finally, our results show that the K-Ar dating method by the unspiked Cassignol-Gillot technique performed on groundmass can be successfully applied to lava flows older than the Holocene, while the uncertainties related to younger units can prevent an accurate age determination. Particularly, this method can be applied to Quaternary volcanoes from the Ecuadorian arc, with many of them remaining without knowledge of the timing of their past activity.
NASA Astrophysics Data System (ADS)
Nóbile, Julieta C.; Collo, Gilda; Dávila, Federico M.; Martina, Federico; Wemmer, Klaus
2015-12-01
The Argentine broken foreland has been the subject of continuous research to determine the uplift and exhumation history of the region. High-elevation mountains are the result of N-S reverse faults that disrupted a W-E Miocene Andean foreland basin. In the Sierra de Ambato (northern Argentine broken foreland) the reverse faults offset Neogene sedimentary rocks (Aconquija Fm., ˜9 Ma) and affect the basement comprising Paleozoic metamorphic rocks that have been dated at ˜477-470 Ma. In order to establish a chronology of these faults affecting the previous continuous basin we date the formation age of clay minerals associated with fault gouge using the K-Ar dating technique. Clay mineral formation is a fundamental process in the evolution of faults under the brittle regime (<<300 °C). K-Ar ages (9 fractions from 3 samples collected along a transect in the Sierra de Ambato) vary from Late Devonian to Late Triassic (˜360-220 Ma). This age distribution can be explained by a long lasting brittle deformation history with a minimum age of ˜360 Ma and a last clay minerals forming event at ˜220 Ma. Moreover, given the progression of apparent ages decreasing from coarse to fine size fractions (˜360-311 Ma for 2-1 μm grain size fraction, ˜326-286 Ma for 1-0.2 μm and ˜291-219 Ma of <0.2 μm), we modeled discrete deformation events at ˜417 Ma (ending of the Famatinian cycle), ˜317-326 Ma (end of Gondwanic orogeny), and ˜194-279 Ma (Early Permian - Jurassic deformation). According to our data, the Neogene reactivation would not have affected the K-Ar system neither generated a significant clay minerals crystallization in the fault gouge, although an exhumation of more than 2 Km is recorded in this period from stratigraphic data.
Saitoh, Akiyoshi; Ohashi, Masanori; Suzuki, Satoshi; Tsukagoshi, Mai; Sugiyama, Azusa; Yamada, Misa; Oka, Jun-Ichiro; Inagaki, Masatoshi; Yamada, Mitsuhiko
2014-08-01
We investigated the possible roles of the prelimbic medial prefrontal cortex (PL) in the regulation of anxiety-like behaviors by pharmacologically activating the terminals of neuronal inputs or postsynaptic efferent neurons with a sodium channel activator veratrine. The extracellular glutamate levels were measured by in vivo microdialysis, and the behaviors were assessed with the open field (OF) test in mice simultaneously. The samples were collected every 10 min for 60 min, as basal levels of glutamate. The medium containing drugs were perfused for 30 min. The OF test was performed in the last 10 min of drug perfusion. After the drug treatments, the perfusion medium containing drugs was switched back to perfusion medium without drugs, and then samples were collected for another 90 min. The extracellular glutamate levels were significantly elevated after local perfusion of veratrine in the PL. At the same time, perfusion of veratrine in the PL produced anxiety-like behaviors in mice. Local coperfusion of a sodium channel blocker, lamotrigine, completely diminished the veratrine-induced elevated extracellular glutamate levels and the behavioral changes. Local coperfusion of an NMDA receptor antagonist, MK-801, but not a non-NMDA (AMPA/kainate) receptor antagonist, CNQX, completely diminished the behavioral changes without any effects on the veratrine-induced elevated extracellular glutamate levels. This study demonstrates that the activation of the PL with veratrine induces anxiety-like behaviors via NMDA receptor-mediated glutamatergic neurotransmission in mice. © 2014 Wiley Periodicals, Inc.
2015-01-01
NMDA receptors are tetrameric complexes composed of GluN1 and GluN2A–D subunits that mediate a slow Ca2+-permeable component of excitatory synaptic transmission. NMDA receptors have been implicated in a wide range of neurological diseases and thus represent an important therapeutic target. We herein describe a novel series of pyrrolidinones that selectively potentiate only NMDA receptors that contain the GluN2C subunit. The most active analogues tested were over 100-fold selective for recombinant GluN2C-containing receptors over GluN2A/B/D-containing NMDA receptors as well as AMPA and kainate receptors. This series represents the first class of allosteric potentiators that are selective for diheteromeric GluN2C-containing NMDA receptors. PMID:24512267
Girotra, Priti; Thakur, Aman; Kumar, Ajay; Singh, Shailendra Kumar
2017-03-01
The complex pathophysiology involved in migraine necessitates the drug treatment to act on several receptors simultaneously. The present investigation was an attempt to discover the unidentified anti-migraine activity of the already marketed drugs. Shared featured pharmacophore modeling was employed for this purpose on six target receptors (β 2 adrenoceptor, Dopamine D 3 , 5HT 1B , TRPV1, iGluR5 kainate and CGRP), resulting in the generation of five shared featured pharmacophores, which were further subjected to virtual screening of the ligands obtained from Drugbank database. Molecular docking, performed on the obtained hit compounds from virtual screening, indicated nystatin to be the only active lead against the receptors iGluR5 kainate receptor (1VSO), CGRP (3N7R), β 2 adrenoceptor (3NYA) and Dopamine D 3 (3PBL) with a high binding energy of -11.1, -10.9, -10.2 and -12kcal/mole respectively. The anti-migraine activity of nystatin was then adjudged by fabricating its brain targeted chitosan nanoparticles. Its brain targeting efficacy, analyzed qualitatively by confocal laser scanning microscopy, demonstrated a significant amount of drug reaching the brain. The pharmacodynamic models on Swiss male albino mice revealed significant anti-migraine activity of the nanoformulation. The present study reports for the first time the therapeutic potential of nystatin in migraine management, hence opening avenues for its future exploration. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
2012-05-01
WE RECOMMEND Scientific American—The Amateur Scientist 3.0 Article collection spans the decades DynaKar DynaKar drives dynamics experiments The Fundamentals of Imaging Author covers whole imaging spectrum Teaching Secondary Physics Effective teaching is all in the approach Novel Materials and Smart Applications/Novel materials sample pack Resources kit samples smart materials WORTH A LOOK Cryptic disk Metal disk spins life into discussions about energy, surfaces and kinetics HANDLE WITH CARE The New Resourceful Physics Teacher Book brings creativity to physics WEB WATCH Apps for tablets and smartphones can aid physics teaching
Piracetam induces plasma membrane depolarization in rat brain synaptosomes.
Fedorovich, Sergei V
2013-10-11
Piracetam is a cyclic derivative of γ-aminobutyric acid (GABA). It was the first nootropic drug approved for clinical use. However, mechanism of its action is still not clear. In present paper, I investigated effects of piracetam on neurotransmitter release, plasma membrane potential monitored by fluorescent dye DiSC3(5) and chloride transport monitored by fluorescent dye SPQ in rat brain synaptosomes. It was shown that piracetam (1 mM) induces slow weak plasma membrane depolarization. This effect was decreased on 43% and 58% by both AMPA/kainate receptor blockers NBQX (10 μM) and CNQX (100 μM), respectively, on 84% by GABA ionotropic receptor blocker picrotoxin (50 μM) and on 91% upon withdrawal of HCO(3-) ions from incubation medium. GABA (1 mM) and kainate (100 μM) were found not to produce changes of plasma membrane potential. Also, it was found that piracetam induces chloride efflux which seems to be the reason of depolarization. Thereby, piracetam induces depolarization of plasma membrane of isolated neuronal presynaptic endings by picrotoxin-sensitive way. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Cho, Yuichiro; Horiuchi, Misa; Shibasaki, Kazuo; Kameda, Shingo; Sugita, Seiji
2017-08-01
In situ radiogenic isotope measurements to obtain the absolute age of geologic events on planets are of great scientific value. In particular, K-Ar isochrons are useful because of their relatively high technical readiness and high accuracy. Because this isochron method involves spot-by-spot K measurements using laser-induced breakdown spectroscopy (LIBS) and simultaneous Ar measurements with mass spectrometry, LIBS measurements are conducted under a high vacuum condition in which emission intensity decreases significantly. Furthermore, using a laser power used in previous planetary missions is preferable to examine the technical feasibility of this approach. However, there have been few LIBS measurements for K under such conditions. In this study, we measured K contents in rock samples using 30 mJ and 15 mJ energy lasers under a vacuum condition (10 -3 Pa) to assess the feasibility of in situ K-Ar dating with lasers comparable to those used in NASA's Curiosity and Mars 2020 missions. We obtained various calibration curves for K using internal normalization with the oxygen line at 777 nm and continuum emission from the laser-induced plasma. Experimental results indicate that when K 2 O < 1.1 wt%, a calibration curve using the intensity of the K emission line at 769 nm normalized with that of the oxygen line yields the best results for the 30 mJ laser energy, with a detection limit of 88 ppm and 20% of error at 2400 ppm of K 2 O. Futhermore, the calibration curve based on the K 769 nm line intensity normalized with continuum emission yielded the best result for the 15 mJ laser, giving a detection limit of 140 ppm and 20% error at 3400 ppm K 2 O. Error assessments using obtained calibration models indicate that a 4 Ga rock with 3000 ppm K 2 O would be measured with 8% (30 mJ) and 10% (15 mJ) of precision in age when combined with mass spectrometry of 40 Ar with 10% of uncertainty. These results strongly suggest that high precision
Anticonvulsant effect of AMP by direct activation of adenosine A1 receptor.
Muzzi, Mirko; Coppi, Elisabetta; Pugliese, Anna Maria; Chiarugi, Alberto
2013-12-01
Purinergic neurotransmission mediated by adenosine (Ado) type 1 receptors (A1Rs) plays pivotal roles in negative modulation of epileptic seizures, and Ado is thought to be a key endogenous anticonvulsant. Recent evidence, however, indicates that AMP, the metabolic precursor of Ado, also activate A1Rs. Here, we evaluated the antiepileptic effects of AMP adopting in vitro and in vivo models of epilepsy. We report that AMP reversed the increase in population spike (PS) amplitude and the decrease in PS latency induced by a Mg(2+)-free extracellular solution in CA1 neurons of mouse hippocampal slices. The AMP effects were inhibited by the A1R antagonist DPCPX, but not prevented by inhibiting conversion of AMP into Ado, indicating that AMP inhibited per se sustained hippocampal excitatory neurotransmission by directly activating A1Rs. AMP also reduced seizure severity and mortality in a model of audiogenic convulsion. Of note, the anticonvulsant effects of AMP were potentiated by preventing its conversion into Ado and inhibited by DPCPX. When tested in a model of kainate-induced seizure, AMP prolonged latency of convulsions but had no effects on seizure severity and mortality. Data provide the first evidence that AMP is an endogenous anticonvulsant acting at A1Rs. © 2013.
Crystal structure and association behaviour of the GluR2 amino-terminal domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan
2009-09-02
Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less
The Brain Tourniquet: Physiological Isolation of Brain Regions Damaged by Traumatic Head Injury
2008-06-19
brain slices were treated after injury with either a nootropic agent ( aniracetam , cyclothiazide, IDRA 21, or 1-BCP) or the antiepileptic drug...tourniquet approach. Four well-known nootropic agents were evaluated: aniracetam , a pyrrolidione analog that slows non-NMDA (AMPA/kainate) receptor...to improve cognition in rats [Stdubli et al., 1994], and has more potent effects than aniracetam in rat brain slices [Arai et al., 1994]. In
A conserved mechanism for gating in an ionotropic glutamate receptor.
Moore, Bryn S; Mirshahi, Uyenlinh L; Ebersole, Tonya L; Mirshahi, Tooraj
2013-06-28
Ionotropic glutamate receptor (iGluR) channels control synaptic activity. The crystallographic structure of GluA2, the prototypical iGluR, reveals a clamshell-like ligand-binding domain (LBD) that closes in the presence of glutamate to open a gate on the pore lining α-helix. How LBD closure leads to gate opening remains unclear. Here, we show that bending the pore helix at a highly conserved alanine residue (Ala-621) below the gate is responsible for channel opening. Substituting Ala-621 with the smaller more flexible glycine resulted in a basally active, nondesensitizing channel with ∼39-fold increase in glutamate potency without affecting surface expression or binding. On GluA2(A621G), the partial agonist kainate showed efficacy similar to a full agonist, and competitive antagonists CNQX and DNQX acted as a partial agonists. Met-629 in GluA2 sits above the gate and is critical in transmitting LBD closure to the gate. Substituting Met-629 with the flexible glycine resulted in reduced channel activity and glutamate potency. The pore regions in potassium channels are structurally similar to iGluRs. Whereas potassium channels typically use glycines as a hinge for gating, iGluRs use the less flexible alanine as a hinge at a similar position to maintain low basal activity allowing for ligand-mediated gating.
Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis
Guo, Yongxia; Zheng, Zuyu; La Clair, James J.; Chory, Joanne; Noel, Joseph P.
2013-01-01
Genetic studies in Arabidopsis implicate an α/β-hydrolase, KARRIKIN-INSENSITIVE 2 (KAI2) as a receptor for karrikins, germination-promoting butenolide small molecules found in the smoke of burned plants. However, direct biochemical evidence for the interaction between KAI2 and karrikin and for the mechanism of downstream signaling by a KAI2–karrikin complex remain elusive. We report crystallographic analyses and ligand-binding experiments for KAI2 recognition of karrikins. The karrikin-1 (KAR1) ligand sits in the opening to the active site abutting a helical domain insert but distal from the canonical catalytic triad (Ser95-His246-Asp217) of α/β-hydrolases, consistent with the lack of detectable hydrolytic activity by purified KAI2. The closest approach of KAR1 to Ser95-His246-Asp217 is 3.8 Å from His246. Six aromatic side chains, including His246, encapsulate KAR1 through geometrically defined aromatic–aromatic interactions. KAR1 binding induces a conformational change in KAI2 at the active site entrance. A crevice of hydrophobic residues linking the polar edge of KAR1 and the helical domain insert suggests that KAI2–KAR1 creates a contiguous interface for binding signaling partners in a ligand-dependent manner. PMID:23613584
Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis.
Guo, Yongxia; Zheng, Zuyu; La Clair, James J; Chory, Joanne; Noel, Joseph P
2013-05-14
Genetic studies in Arabidopsis implicate an α/β-hydrolase, KARRIKIN-INSENSITIVE 2 (KAI2) as a receptor for karrikins, germination-promoting butenolide small molecules found in the smoke of burned plants. However, direct biochemical evidence for the interaction between KAI2 and karrikin and for the mechanism of downstream signaling by a KAI2-karrikin complex remain elusive. We report crystallographic analyses and ligand-binding experiments for KAI2 recognition of karrikins. The karrikin-1 (KAR1) ligand sits in the opening to the active site abutting a helical domain insert but distal from the canonical catalytic triad (Ser95-His246-Asp217) of α/β-hydrolases, consistent with the lack of detectable hydrolytic activity by purified KAI2. The closest approach of KAR1 to Ser95-His246-Asp217 is 3.8 Å from His246. Six aromatic side chains, including His246, encapsulate KAR1 through geometrically defined aromatic-aromatic interactions. KAR1 binding induces a conformational change in KAI2 at the active site entrance. A crevice of hydrophobic residues linking the polar edge of KAR1 and the helical domain insert suggests that KAI2-KAR1 creates a contiguous interface for binding signaling partners in a ligand-dependent manner.
Differential Expression of Glutamate Receptors in Avian Neural Pathways for Learned Vocalization
WADA, KAZUHIRO; SAKAGUCHI, HIRONOBU; JARVIS, ERICH D.; HAGIWARA, MASATOSHI
2008-01-01
Learned vocalization, the substrate for human language, is a rare trait. It is found in three distantly related groups of birds—parrots, hummingbirds, and songbirds. These three groups contain cerebral vocal nuclei for learned vocalization not found in their more closely related vocal nonlearning relatives. Here, we cloned 21 receptor subunits/subtypes of all four glutamate receptor families (AMPA, kainate, NMDA, and metabotropic) and examined their expression in vocal nuclei of songbirds. We also examined expression of a subset of these receptors in vocal nuclei of hummingbirds and parrots, as well as in the brains of dove species as examples of close vocal nonlearning relatives. Among the 21 subunits/subtypes, 19 showed higher and/or lower prominent differential expression in songbird vocal nuclei relative to the surrounding brain subdivisions in which the vocal nuclei are located. This included relatively lower levels of all four AMPA subunits in lMAN, strikingly higher levels of the kainite subunit GluR5 in the robust nucleus of the arcopallium (RA), higher and lower levels respectively of the NMDA subunits NR2A and NR2B in most vocal nuclei and lower levels of the metabotropic group I subtypes (mGluR1 and -5) in most vocal nuclei and the group II subtype (mGluR2), showing a unique expression pattern of very low levels in RA and very high levels in HVC. The splice variants of AMPA subunits showed further differential expression in vocal nuclei. Some of the receptor subunits/subtypes also showed differential expression in hummingbird and parrot vocal nuclei. The magnitude of differential expression in vocal nuclei of all three vocal learners was unique compared with the smaller magnitude of differences found for nonvocal areas of vocal learners and vocal nonlearners. Our results suggest that evolution of vocal learning was accompanied by differential expression of a conserved gene family for synaptic transmission and plasticity in vocal nuclei. They also
Chatterjee, Koushik; Bhaumik, Gautam; Chattopadhyay, Bhargab
2018-01-01
There is a paucity of any significant data on the estrogen receptor (ER) and progesterone receptor (PR) status of breast cancer patients from the eastern part of India. This study aims to document the ER and PR status of breast cancer patients in the eastern Indian population, as catered by two premier tertiary care hospitals in Kolkata. All breast cancer patients registered between January 1, 2013 and December 31, 2015, in the Departments of Oncology, of IPGMER and SSKM Hospitals and R. G. Kar Medical College and Hospital, Kolkata, who had at least undergone a core biopsy or surgery, were analyzed retrospectively for documentation of their ER and PR status, using the 2010 American Society of Clinical Oncology/College of American Pathologists (ASCO/CAP) interpretation guidelines. Over a period of 3 years, a total of 927 patients were included for the study. A total of 825 (89%) patients had their ER and PR data available for evaluation. ER and PR positive was seen in 312 (37.82%) patients, ER and PR negative in 399 (48.36%) patients, ER positive and PR negative in 71 (8.6%) patients, and ER negative and PR positive results was found in 43 (5.21%) patients. This is the first multi-institutional documentation of ER and PR status from eastern India, having a modest number of patients and one of the earliest documentations using the latest ASCO/CAP interpretation guidelines. These findings resemble the data from the south and also reiterate the fact that majority of the Indian breast cancer patients are still ER and PR negative in spite of the changes in the interpretation guidelines.
Glutamate as a neurotransmitter in the brain: review of physiology and pathology.
Meldrum, B S
2000-04-01
Glutamate is the principal excitatory neurotransmitter in brain. Our knowledge of the glutamatergic synapse has advanced enormously in the last 10 years, primarily through application of molecular biological techniques to the study of glutamate receptors and transporters. There are three families of ionotropic receptors with intrinsic cation permeable channels [N-methyl-D-aspartate (NMDA), alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate]. There are three groups of metabotropic, G protein-coupled glutamate receptors (mGluR) that modify neuronal and glial excitability through G protein subunits acting on membrane ion channels and second messengers such as diacylglycerol and cAMP. There are also two glial glutamate transporters and three neuronal transporters in the brain. Glutamate is the most abundant amino acid in the diet. There is no evidence for brain damage in humans resulting from dietary glutamate. A kainate analog, domoate, is sometimes ingested accidentally in blue mussels; this potent toxin causes limbic seizures, which can lead to hippocampal and related pathology and amnesia. Endogenous glutamate, by activating NMDA, AMPA or mGluR1 receptors, may contribute to the brain damage occurring acutely after status epilepticus, cerebral ischemia or traumatic brain injury. It may also contribute to chronic neurodegeneration in such disorders as amyotrophic lateral sclerosis and Huntington's chorea. In animal models of cerebral ischemia and traumatic brain injury, NMDA and AMPA receptor antagonists protect against acute brain damage and delayed behavioral deficits. Such compounds are undergoing testing in humans, but therapeutic efficacy has yet to be established. Other clinical conditions that may respond to drugs acting on glutamatergic transmission include epilepsy, amnesia, anxiety, hyperalgesia and psychosis.
Vidal, Lucía; Durán, Rafael; Faro, Lilian F; Campos, Francisco; Cervantes, Rosa C; Alfonso, Miguel
2007-09-05
The possible role of ionotropics glutamate receptors on the HgCl(2)-induced dopamine (DA) release from rat striatum was investigated by using in vivo brain microdialysis technique after administration of selective NMDA and AMPA/Kainate receptors antagonists dizocilpine (MK-801), D (-)-2-amino-5-phoshonopentanoic acid (AP5), and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Moreover, we have also studied the effects of nitric oxide synthase (NOS) inhibitors L-nitro-arginine methyl ester (L-NAME) and 7-nitro-indazol (7-NI) on HgCl(2)-induced DA release. Intraestriatal infusion of 1mM HgCl(2) increased striatal DA to 1717.2+/-375.4% respect to basal levels. Infusion of 1mM HgCl(2) in 400 microM MK-801 pre-treated animals produced an increase on striatal DA levels 61% smaller than that induced in non-pre-treated animals. In the case of AP5, this treatment reduced 92% the increase produced by HgCl(2) as compared to non-pre-treated rats. Nevertheless, the administration of CNQX did not produce any effect on HgCl(2)-induced dopamine release. Intrastriatal infusion of 1mM HgCl(2) in 100 microM L-NAME pre-treated animals produced an increase on extracellular DA levels 82% smaller than produced by HgCl(2) alone. In addition, the pre-treatment with 7-NI reduced 90% the increase produced by infusion of HgCl(2) alone in rats. Thus, HgCl(2)-induced DA release could be produced at last in part, by overstimulation of NMDA receptors with NO production, since administration of NMDA receptor antagonists and NOS inhibitors protected against HgCl(2) effects on DA release.
NASA Technical Reports Server (NTRS)
Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)
1995-01-01
Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.
Molina, Anthony J A; Verzi, Michael P; Birnbaum, Andrea D; Yamoah, Ebenezer N; Hammar, Katherine; Smith, Peter J S; Malchow, Robert Paul
2004-01-01
Self-referencing H+-selective microelectrodes were used to measure extracellular H+ fluxes from horizontal cells isolated from the skate retina. A standing H+ flux was detected from quiescent cells, indicating a higher concentration of free hydrogen ions near the extracellular surface of the cell as compared to the surrounding solution. The standing H+ flux was reduced by removal of extracellular sodium or application of 5-(N-ethyl-N-isopropyl) amiloride (EIPA), suggesting activity of a Na+–H+ exchanger. Glutamate decreased H+ flux, lowering the concentration of free hydrogen ions around the cell. AMPA/kainate receptor agonists mimicked the response, and the AMPA/kainate receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) eliminated the effects of glutamate and kainate. Metabotropic glutamate agonists were without effect. Glutamate-induced alterations in H+ flux required extracellular calcium, and were abolished when cells were bathed in an alkaline Ringer solution. Increasing intracellular calcium by photolysis of the caged calcium compound NP-EGTA also altered extracellular H+ flux. Immunocytochemical localization of the plasmalemma Ca2+–H+-ATPase (PMCA pump) revealed intense labelling within the outer plexiform layer and on isolated horizontal cells. Our results suggest that glutamate modulation of H+ flux arises from calcium entry into cells with subsequent activation of the plasmalemma Ca2+–H+-ATPase. These neurotransmitter-induced changes in extracellular pH have the potential to play a modulatory role in synaptic processing in the outer retina. However, our findings argue against the hypothesis that hydrogen ions released by horizontal cells normally act as the inhibitory feedback neurotransmitter onto photoreceptor synaptic terminals to create the surround portion of the centre-surround receptive fields of retinal neurones. PMID:15272044
Synthesis and biological evaluation of cyclopropyl analogues of 2-amino-5-phosphonopentanoic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dappen, M.S.; Pellicciari, R.; Natalini, B.
1991-01-01
A series of cyclopropyl analogues related to 2-amino-5-phosphonopentanoic acid (AP5) were synthesized and their biological activity was assessed as competitive antagonists for the N-methyl-D-aspartate (NMDA) receptor. In vitro receptor binding using (3H)-L-glutamate as the radioligand provided affinity data, while modulation of (3H)MK-801 binding was used as a functional assay. The analogues were also evaluated in (3H)kainate binding to assess selectivity over non-NMDA glutamate receptors. Of the compounds tested, 4,5-methano-AP5 analogue 26 was the most potent selective NMDA antagonist; however, potency was lower than that for (((+/-)-2-carboxypiperidin-4-yl)methyl)phosphonic acid (CGS 19755, 5).
Basu, A.R.; Rubury, E.; Mehnert, H.; Tatsumoto, M.
1984-01-01
We provide new data on Sm-Nd systematics, K-Ar dating and the major element chemistry of kimberlites from the eastern United States (mostly from central New York State) and their constituent mineral phases of olivine, clinopyroxene, garnet, phlogopite and perovskite. In addition, we report Nd-isotopes in a few kimberlites from South Africa, Lesotho and from the eastern part of China. The major element compositions of the New York dike rocks and of their constituent minerals including a xenolith of eclogite are comparable with those from the Kimberley area in South Africa. The K-Ar age of emplacement of the New York dikes is further established to be 143 Ma. We have analyzed the Nd-isotopic composition of the following kimberlites and related rocks: Nine kimberlite pipes from South Africa and Lesotho, two from southern India; one from the U.S.S.R., fifteen kimberlite pipes and related dike rocks from eastern and central U.S. and two pipes from the Shandong Province of eastern China. The age of emplacement of these kimberlites ranges from 1300 million years to 90 million years. The initial Nd-isotopic compositions of these kimberlitic rocks expressed as e{open}NdIwith respect to a chondritic bulk-earth growth-curve show a range between 0 and +4, with the majority of the kimberlites being in the range 0 to +2. This range is not matched by any other suite of mantle-derived igneous rocks. This result strengthens our earlier conclusion that kimberlitic liquids are derived from a relatively primeval and unique mantle reservoir with a nearly chondritic Sm/Nd ratio. ?? 1984 Springer-Verlag.
Tchekalarova, Jana; Loyens, Ellen; Smolders, Ilse
2015-05-01
In the management of epilepsy, AT1 receptor antagonists have been suggested as an additional treatment strategy. A hyperactive brain angiotensin (Ang) II system and upregulated AT1 receptors are implicated in the cerebrovascular alterations in a genetic form of hypertension. Uncontrolled hypertension could also, in turn, be a risk factor for a seizure threshold decrease and development of epileptogenesis. The present study aimed to assess the effects of the selective AT1 receptor antagonist ZD7155 on kainic acid (KA)-induced status epilepticus (SE) development and accompanying changes in the hippocampal extracellular (EC) neurotransmitter levels of noradrenaline (NAD), serotonin (5-HT), and dopamine (DA) in spontaneously hypertensive rats (SHRs) and their parent strain Wistar-Kyoto (WKY) rats, since monoamines are well-known neurotransmitters involved in mechanisms of both epilepsy and hypertension. Status epilepticus was evoked in freely moving rats by a repetitive intraperitoneal (i.p.) administration of KA in subconvulsant doses. In the treatment group, ZD7155 (5mg/kg i.p.) was coadministered with the first KA injection. Spontaneously hypertensive rats exhibited higher susceptibility to SE than WKY rats, but the AT1 receptor antagonist did not alter the development of SE in SHRs or in WKY rats. In vivo microdialysis demonstrated significant KA-induced increases of the hippocampal NAD and DA levels in SHRs and of NAD, 5-HT, and DA in WKY rats. Although SHRs developed more severe seizures while receiving a lower dose of KA compared to WKY rats, AT1 receptor antagonism completely prevented all KA-induced increases of hippocampal monoamine levels in both rat strains without affecting seizure development per se. These results suggest a lack of direct relationship between KA-induced seizure susceptibility and adaptive changes of hippocampal NAD, 5-HT, and DA levels in the effects of ZD7155 in WKY rats and SHRs. Copyright © 2015 Elsevier Inc. All rights reserved.
Lanphere, M.A.; Baadsgaard, H.
2001-01-01
The accuracy of ages measured using the 40Ar/39Ar technique is affected by uncertainties in the age of radiation fluence-monitor minerals. At present, there is lack of agreement about the ages of certain minerals used as fluence monitors. The accuracy of the age of a standard may be improved if the age can be measured using different decay schemes. This has been done by measuring ages on minerals from the Oligocene Fish Canyon Tuff (FCT) using the K-Ar, 40Ar/39Ar. Rb-Sr and U/Pb methods. K-Ar and 40Ar/39Ar total fusion ages of sanidine, biotite and hornblende yielded a mean age of 27.57 ?? 0.36 Ma. The weighted mean 40Ar/39Ar plateau age of sanidine and biotite is 27.57 ?? 0.18 Ma. A biotite-feldspar Rb-Sr isochron yielded an age of 27.44 ?? 0.16 Ma. The U-Pb data for zircon are complex because of the presence of Precambrian zircons and inheritance of radiogenic Pb. Zircons with 207Pb/235U < 0.4 yielded a discordia line with a lower concordia intercept of 27.52 ?? 0.09 Ma. Evaluation of the combined data suggests that the best age for FCT is 27.51 Ma. Published by Elsevier Science B.V.
Fukushima, Kazuyuki; Tabata, Yoshikuni; Imaizumi, Yoichi; Kohmura, Naohiro; Sugawara, Michiko; Sawada, Kohei; Yamazaki, Kazuto; Ito, Masashi
2014-09-01
The hippocampus is an important brain region that is involved in neurological disorders such as Alzheimer disease, schizophrenia, and epilepsy. Ionotropic glutamate receptors-namely,N-methyl-D-aspartate (NMDA) receptors (NMDARs), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptors (AMPARs), and kainic acid (KA) receptors (KARs)-are well known to be involved in these diseases by mediating long-term potentiation, excitotoxicity, or both. To predict the therapeutic efficacy and neuronal toxicity of drug candidates acting on these receptors, physiologically relevant systems for assaying brain region-specific human neural cells are necessary. Here, we characterized the functional differentiation of human fetal hippocampus-derived neural stem/progenitor cells-namely, HIP-009 cells. Calcium rise assay demonstrated that, after a 4-week differentiation, the cells responded to NMDA (EC50= 7.5 ± 0.4 µM; n= 4), AMPA (EC50= 2.5 ± 0.1 µM; n= 3), or KA (EC50= 33.5 ± 1.1 µM; n= 3) in a concentration-dependent manner. An AMPA-evoked calcium rise was observed in the absence of the desensitization inhibitor cyclothiazide. In addition, the calcium rise induced by these agonists was inhibited by antagonists for each receptor-namely, MK-801 for NMDA stimulation (IC50= 0.6 ± 0.1 µM; n= 4) and NBQX for AMPA and KA stimulation (IC50= 0.7 ± 0.1 and 0.7 ± 0.03 µM, respectively; n= 3). The gene expression profile of differentiated HIP-009 cells was distinct from that of undifferentiated cells and closely resembled that of the human adult hippocampus. Our results show that HIP-009 cells are a unique tool for obtaining human hippocampal neural cells and are applicable to systems for assay of ionotropic glutamate receptors as a physiologically relevant in vitro model. © 2014 Society for Laboratory Automation and Screening.
K/Ar dating of lunar soils. IV - Orange glass from 74220 and agglutinates from 14259 and 14163
NASA Technical Reports Server (NTRS)
Alexander, E. C., Jr.; Coscio, M. R., Jr.; Dragon, J. C.; Saito, K.
1980-01-01
Total fusion Ar-40 - A-39 analyses of orange glass from lunar soil 74220 combined with the sums of earlier stepwise heating data by other workers have yielded a precise K/Ar isochron with a slope corresponding to an age of 3.66 + or - 0.03 G.y. for the orange glass. The result is in marginal agreement with Huneke's (1978) age of 3.60 + or - 0.04 G.y. for 74220 glass. The Ar systematics in the agglutinates from 14259 and 14163 are dominated by volume correlated argon. Step-wise heating analyses yield data which define experimentally reproducible linear arrays in Ar-40/Ar-36 vs. K-40/Ar-36 diagrams. The slopes of these arrays correspond formally to very old ages, but it is not clear, however, that such ages have any physical significance.
NASA Astrophysics Data System (ADS)
Jang, Yirang; Kwon, Sanghoon; Song, Yungoo; Kim, Sung Won; Kwon, Yi Kyun; Yi, Keewook
2018-05-01
We present the SHRIMP U-Pb detrital zircon and K-Ar illite 1Md/1M and 2M1 ages, suggesting new insight into the Phanerozoic polyphase orogenies preserved in the northeastern Okcheon Belt, Korea since the initial basin formation during Neoproterozoic rifting through several successive contractional orogens. The U-Pb detrital zircon ages from the Early Paleozoic strata of the Taebaeksan Zone suggest a Cambrian maximum deposition age, and are supported by trilobite and conodont biostratigraphy. Although the age spectra from two sedimentary groups, the Yeongwol and Taebaek Groups, show similar continuous distributions from the Late Paleoproterozoic to Early Paleozoic ages, a Grenville-age hiatus (1.3-0.9 Ga) in the continuous stratigraphic sequence from the Taebaek Group suggests the existence of different peripheral clastic sources along rifted continental margin(s). In addition, we present the K-Ar illite 1Md/1M ages of the fault gouges, which confirm fault formation/reactivation during the Late Cretaceous to Early Paleogene (ca. 82-62 Ma) and the Early Miocene (ca. 20-18 Ma). The 2M1 illite ages, at least those younger than the host rock ages, provide episodes of deformation, metamorphism and hydrothermal effects related to the tectonic events during the Devonian (ca.410 Ma) and Permo-Triassic (ca. 285-240 Ma). These results indicate that the northeastern Okcheon Belt experienced polyphase orogenic events, namely the Okcheon (Middle Paleozoic), Songrim (Late Paleozoic to Early Mesozoic), Daebo (Middle Mesozoic) and Bulguksa (Late Mesozoic to Early Cenozoic) Orogenies, reflecting the Phanerozoic tectonic evolution of the Korean Peninsula along the East Asian continental margin.
Gong, Kerui; Bhargava, Aditi; Jasmin, Luc
2016-01-01
The contribution of the peripheral nervous system to opiate-induced hyperalgesia (OIH) is not well understood. In this study, we determined the changes in excitability of primary sensory neurons after sustained morphine administration for 7 days. Changes in the expression of glutamate receptors and glutamate transporters after morphine administration were ascertained in dorsal root ganglions. Patch clamp recordings from intact dorsal root ganglions (ex vivo preparation) of morphine-treated rats showed increased excitability of small diameter (≤30 μm) neurons with respect to rheobase and membrane threshold, whereas the excitability of large diameter (>30 μm) neurons remained unchanged. Small diameter neurons also displayed increased responses to glutamate, which were mediated mainly by GluN2B containing N-methyl-D-aspartate (NMDA) receptors, and to a lesser degree by the neuronal excitatory amino acid transporter 3/excitatory amino acid carrier 1. Coadministration in vivo of the GluN2B selective antagonist Ro 25-6981 with morphine for 7 days prevented the appearance of OIH and increased morphine-induced analgesia. Administration of morphine for 7 days led to an increased expression of GluN2B and excitatory amino acid transporter 3/excitatory amino acid carrier 1, but not of the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate, kainate, or group I metabotropic glutamate receptors, or of the vesicular glutamate transporter 2. These results suggest that peripheral glutamatergic neurotransmission contributes to OIH and that GluN2B subunit of NMDA receptors in the periphery may be a target for therapy.
Siahposht-Khachaki, Ali; Fatahi, Zahra; Yans, Asal; Khodagholi, Fariba; Haghparast, Abbas
2017-03-01
Glutamate receptors in mesolimbic areas such as the nucleus accumbens, ventral tegmental area, prefrontal cortex (PFC), and hippocampus (HIP) are a component of the mechanisms of drug-induced reward and can modulate the firing pattern of dopaminergic neurons in the reward system. In addition, several lines of study have indicated that cAMP response element-binding protein (CREB) and c-fos have important role in morphine-induced conditioned place preference (CPP) induced by drugs of abuse, such as morphine, cocaine, nicotine, and alcohol. Therefore, in the present study, we investigated the changes in phosphorylated CREB (p-CREB) and c-fos induction within the nucleus accumbens (NAc), HIP, and PFC after intracerebroventricular (ICV) administration of different doses of CNQX or vehicle during extinction period or reinstatement of morphine-induced CPP. In all groups, the CPP procedure was done; afterward, the conditioning scores were recorded by Ethovision software. After behavioral test recording, we dissected out the NAc, HIP, and PFC regions and measured the p-CREB/CREB ratio and c-fos level by Western blot analysis. Our results showed that administration of CNQX significantly shortened the extinction of morphine CPP. Besides, ICV microinjection of CNQX following extinction period decreased the reinstatement of morphine CPP in extinguished rats. In molecular section, in treatment group, all mentioned factors were dose-dependently decreased in comparison with vehicle group (DMSO) after ICV microinjection of different doses of CNQX but not in pre-extinction microinjection. These findings suggested that antagonism of AMPA receptor decreased p-CREB/CREB ratio and c-fos level in the PFC, NAc, and HIP. Modulation of the drug memory reconsolidation may be useful for faster extinction of drug-induced reward and attenuation of drug-seeking behavior.
Signalling and responses to strigolactones and karrikins.
Smith, Steven M; Li, Jiayang
2014-10-01
Strigolactone (SL) and karrikin (KAR) signalling control many aspects of plant growth and development through similar mechanisms employing related α/β-fold hydrolase-receptors and a common F-box protein named MORE AXILARY GROWTH2 (MAX2) in Arabidopsis or DWARF3 (D3) in rice. D3 mediates SL-dependent ubiquitination and proteolysis of DWARF53 (D53) protein, thought to be involved in the control of gene expression, while a related protein SUPPRESSOR OF MAX2-1 (SMAX1) is implicated in the response to KAR in Arabidopsis. Different members of the D53/SMAX1 multigene family likely mediate different responses in plant growth and development. Analysis of responses to SL or KAR has identified many genes regulated by these compounds. Crosstalk with other signalling systems including light, hormones and abiotic stress has also been identified. Here we critically analyse how to progress towards a clearer understanding of the targets and functions of the SL and KAR signalling systems. Copyright © 2014 Elsevier Ltd. All rights reserved.
Dean, Benjamin John Floyd; Snelling, Sarah J B; Dakin, Stephanie G; Murphy, Richard J; Javaid, Muhammad Kassim; Carr, Andrew Jonathan
2015-07-10
The relationship between peripheral tissue characteristics and pain symptoms in soft tissue inflammation is poorly understood. The primary aim of this study was to determine immunohistochemical differences in tissue obtained from patients with persistent pain and patients who had become pain-free after surgical treatment for rotator cuff tendinopathy. The secondary aim was to investigate whether there would be differences in glutaminergic and inflammatory gene expression between disease-derived and healthy control cells in vitro. Supraspinatus tendon biopsies were obtained from nine patients with tendon pain before shoulder surgery and from nine further patients whose pain had resolved completely following shoulder surgery. Histological markers relating to the basic tendon characteristics, inflammation and glutaminergic signalling were quantified by immunohistochemical analysis. Gene expression of glutaminergic and inflammatory markers was determined in tenocyte explants derived from painful rotator cuff tendon tears in a separate cohort of patients and compared to that of explants from healthy control tendons. Dual labelling was performed to identify cell types expressing nociceptive neuromodulators. Tendon samples from patients with persistent pain demonstrated increased levels of metabotropic glutamate receptor 2 (mGluR2), kainate receptor 1 (KA1), protein gene product 9.5 (PGP9.5), CD206 (macrophage marker) and CD45 (pan-leucocyte marker) versus pain-free controls (p <0.05). NMDAR1 co-localised with CD206-positive cells, whereas PGP9.5 and glutamate were predominantly expressed by resident tendon cells. These results were validated by in vitro increases in the expression of mGluR2, N-methyl-D-aspartate receptor (NMDAR1), KA1, CD45, CD206 and tumour necrosis factor alpha (TNF-α) genes (p <0.05) in disease-derived versus control cells. We conclude that differences in glutamate receptors and inflammatory cell numbers are associated with the resolution of shoulder
NASA Astrophysics Data System (ADS)
Cho, Yuichiro; Kameda, Shingo; Okuno, Mamoru; Horiuchi, Misa; Shibasaki, Kazuo; Wagatsuma, Ryo; Aida, Yusuke; Miura, Yayoi N.; Yoshioka, Kazuo; Okazaki, Ryuji; Sugita, Seiji
2017-10-01
Mass spectrometry has been widely used in lander missions to characterize the volatiles in rocks and soils on planetary surfaces. A good vacuum seal is very important for introducing such solid samples to a vacuum chamber and ejecting them. However, multiple measurements require many metal gaskets, leading to extra weight and complexity for the instruments. In this study, we investigate the capability of three kinds of elastomeric O-rings (Viton, Nexus-SLT, and Nexus-FV) as vacuum seals for mass spectrometric measurements, particularly for in situ K-Ar dating on Mars. First, thermal cycle tests revealed that low-temperature-resistant O-rings can maintain pressure <10-5 Pa at -60 °C under 1 bar ambient pressure, whereas Viton O-rings leaked at -25 °C. Then, the amount of 40Ar due to outgassing from the O-rings and permeation under the ambient pressure of 650 Pa or 3 Pa was measured and compared with the amounts of 40Ar that a flight-equivalent laser would liberate from potential target Martian rocks. The measured amounts were <1% of that a target rock with 5000 ppm K2O and an age of 4.2 Ga would yield. These results suggest that a Viton O-ring can maintain the Ar blank low under the Mars atmospheric pressure when temperatures are higher than -25 °C. A double O-ring seal using the low-temperature-resistant elastomers would be an alternative approach at lower temperatures. The elastomeric O-rings would be useful for constructing a small and light-weighted mass spectrometric instrument for in situ K-Ar dating on Mars.
Stanga, John P.; Smith, Steven M.; Briggs, Winslow R.; Nelson, David C.
2013-01-01
Abiotic chemical signals discovered in smoke that are known as karrikins (KARs) and the endogenous hormone strigolactone (SL) control plant growth through a shared MORE AXILLARY GROWTH2 (MAX2)-dependent pathway. A SL biosynthetic pathway and candidate KAR/SL receptors have been characterized, but signaling downstream of MAX2 is poorly defined. A screen for genetic suppressors of the enhanced seed dormancy phenotype of max2 in Arabidopsis (Arabidopsis thaliana) led to identification of a suppressor of max2 1 (smax1) mutant. smax1 restores the seed germination and seedling photomorphogenesis phenotypes of max2 but does not affect the lateral root formation, axillary shoot growth, or senescence phenotypes of max2. Expression of three transcriptional markers of KAR/SL signaling, D14-LIKE2, KAR-UP F-BOX1, and INDOLE-3-ACETIC ACID INDUCIBLE1, is rescued in smax1 max2 seedlings. SMAX1 is a member of an eight-gene family in Arabidopsis that has weak similarity to HEAT SHOCK PROTEIN 101, which encodes a caseinolytic peptidase B chaperonin required for thermotolerance. SMAX1 and the SMAX1-like (SMXL) homologs are differentially expressed in Arabidopsis tissues. SMAX1 transcripts are most abundant in dry seed, consistent with its function in seed germination control. Several SMXL genes are up-regulated in seedlings treated with the synthetic SL GR24. SMAX1 and SMXL2 transcripts are reduced in max2 seedlings, which could indicate negative feedback regulation by KAR/SL signaling. smax1 seed and seedling growth mimics the wild type treated with KAR/SL, but smax1 seedlings are still responsive to 2H-furo[2,3-c]pyran-2-one (KAR2) or GR24. We conclude that SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth but is not necessary for all MAX2-dependent responses. We hypothesize that one or more SMXL proteins may also act downstream of MAX2 to control the diverse developmental responses to KARs and SLs. PMID:23893171
ERIC Educational Resources Information Center
Hernandez, Pepe J.; Andrzejewski, Matthew E.; Sadeghian, Kenneth; Panksepp, Jules B.; Kelley, Ann E.
2005-01-01
Neural integration of glutamate- and dopamine-coded signals within the nucleus accumbens (NAc) is a fundamental process governing cellular plasticity underlying reward-related learning. Intra-NAc core blockade of NMDA or D1 receptors in rats impairs instrumental learning (lever-pressing for sugar pellets), but it is not known during which phase of…
The karrikin receptor KAI2 promotes drought resistance in Arabidopsis thaliana
Li, Weiqiang; Nguyen, Kien Huu; Ha, Chien Van; Watanabe, Yasuko; Osakabe, Yuriko; Leyva-González, Marco Antonio; Sato, Mayuko; Tanaka, Maho; Mostofa, Mohammad Golam; Seki, Motoaki; Seo, Mitsunori; Yamaguchi, Shinjiro; Nelson, David C.; Herrera-Estrella, Luis
2017-01-01
Drought causes substantial reductions in crop yields worldwide. Therefore, we set out to identify new chemical and genetic factors that regulate drought resistance in Arabidopsis thaliana. Karrikins (KARs) are a class of butenolide compounds found in smoke that promote seed germination, and have been reported to improve seedling vigor under stressful growth conditions. Here, we discovered that mutations in KARRIKIN INSENSITIVE2 (KAI2), encoding the proposed karrikin receptor, result in hypersensitivity to water deprivation. We performed transcriptomic, physiological and biochemical analyses of kai2 plants to understand the basis for KAI2-regulated drought resistance. We found that kai2 mutants have increased rates of water loss and drought-induced cell membrane damage, enlarged stomatal apertures, and higher cuticular permeability. In addition, kai2 plants have reduced anthocyanin biosynthesis during drought, and are hyposensitive to abscisic acid (ABA) in stomatal closure and cotyledon opening assays. We identified genes that are likely associated with the observed physiological and biochemical changes through a genome-wide transcriptome analysis of kai2 under both well-watered and dehydration conditions. These data provide evidence for crosstalk between ABA- and KAI2-dependent signaling pathways in regulating plant responses to drought. A comparison of the strigolactone receptor mutant d14 (DWARF14) to kai2 indicated that strigolactones also contributes to plant drought adaptation, although not by affecting cuticle development. Our findings suggest that chemical or genetic manipulation of KAI2 and D14 signaling may provide novel ways to improve drought resistance. PMID:29131815
The karrikin receptor KAI2 promotes drought resistance in Arabidopsis thaliana.
Li, Weiqiang; Nguyen, Kien Huu; Chu, Ha Duc; Ha, Chien Van; Watanabe, Yasuko; Osakabe, Yuriko; Leyva-González, Marco Antonio; Sato, Mayuko; Toyooka, Kiminori; Voges, Laura; Tanaka, Maho; Mostofa, Mohammad Golam; Seki, Motoaki; Seo, Mitsunori; Yamaguchi, Shinjiro; Nelson, David C; Tian, Chunjie; Herrera-Estrella, Luis; Tran, Lam-Son Phan
2017-11-01
Drought causes substantial reductions in crop yields worldwide. Therefore, we set out to identify new chemical and genetic factors that regulate drought resistance in Arabidopsis thaliana. Karrikins (KARs) are a class of butenolide compounds found in smoke that promote seed germination, and have been reported to improve seedling vigor under stressful growth conditions. Here, we discovered that mutations in KARRIKIN INSENSITIVE2 (KAI2), encoding the proposed karrikin receptor, result in hypersensitivity to water deprivation. We performed transcriptomic, physiological and biochemical analyses of kai2 plants to understand the basis for KAI2-regulated drought resistance. We found that kai2 mutants have increased rates of water loss and drought-induced cell membrane damage, enlarged stomatal apertures, and higher cuticular permeability. In addition, kai2 plants have reduced anthocyanin biosynthesis during drought, and are hyposensitive to abscisic acid (ABA) in stomatal closure and cotyledon opening assays. We identified genes that are likely associated with the observed physiological and biochemical changes through a genome-wide transcriptome analysis of kai2 under both well-watered and dehydration conditions. These data provide evidence for crosstalk between ABA- and KAI2-dependent signaling pathways in regulating plant responses to drought. A comparison of the strigolactone receptor mutant d14 (DWARF14) to kai2 indicated that strigolactones also contributes to plant drought adaptation, although not by affecting cuticle development. Our findings suggest that chemical or genetic manipulation of KAI2 and D14 signaling may provide novel ways to improve drought resistance.
NASA Technical Reports Server (NTRS)
Reynolds, J. H.; Alexander, E. C., Jr.; Davis, P. K.; Srinivasan, B.
1974-01-01
The lunar breccia 14318 is one of three Apollo-14 breccias containing substantial amounts of parentless xenon from the spontaneous fission of extinct Pu-244. The argon and xenon contained in this breccia were studied by stepwise heating of pristine and neutron-irradiated samples. The isotopic composition of xenon from fission, determined by an improved method, is shown to be from Pu-244. Concentrations of this fissiogenic xenon are in substantial excess (15-fold) of what could be produced by spontaneous fission of U-238. The breccia is found to contain abundant trapped argon with an Ar-40/Ar-36 ratio of roughly 14. Otherwise, the argon is radiogenic and gives a convincing K-Ar age of 3.69 plus or minus 0.09 b.y. by the stepwise Ar-40/Ar-39 method, nearly in agreement with ages for other Apollo-14 breccias.
In situ dating on Mars: A new approach to the K-Ar method utilizing cosmogenic argon
NASA Astrophysics Data System (ADS)
Cassata, William S.
2014-01-01
Cosmogenic argon isotopes are produced in feldspars via nuclear reactions between cosmic rays and Ca and K atoms within the lattice. These cosmogenic isotopes can be used as proxies for K and Ca, much like nuclear reactor-derived 39Ar and 37Ar are used as proxies for K and Ca, respectively, in 40Ar/39Ar geochronology. If Ca and K are uniformly distributed, then the ratio of radiogenic 40Ar (40Ar*) to cosmogenic 38Ar or 36Ar (38Arcos or 36Arcos) is proportional to the difference between the radioisotopic and exposure ages, as well as the K/Ca ratio of the degassing phase. Thus cosmogenic, radiogenic, and trapped Ar isotopes, all of which can be measured remotely and are stable over geologic time, are sufficient to generate an isochron-like diagram from which the isotopic composition of the trapped component may be inferred. Such data also provide a means to assess the extent to which the system has remained closed with respect to 40Ar*, thereby mitigating otherwise unquantifiable uncertainties that complicate the conventional K-Ar dating method.
Nathan, Pradeep J; Lu, Kristy; Gray, M; Oliver, C
2006-01-01
L-theanine (N-ethyl-L-glutamine) or theanine is a major amino acid uniquely found in green tea. L-theanine has been historically reported as a relaxing agent, prompting scientific research on its pharmacology. Animal neurochemistry studies suggest that L-theanine increases brain serotonin, dopamine, GABA levels and has micromolar affinities for AMPA, Kainate and NMDA receptors. In addition has been shown to exert neuroprotective effects in animal models possibly through its antagonistic effects on group 1 metabotrophic glutamate receptors. Behavioural studies in animals suggest improvement in learning and memory. Overall, L-theanine displays a neuropharmacology suggestive of a possible neuroprotective and cognitive enhancing agent and warrants further investigation in animals and humans.
Neuroprotective Effects of Glutamate Antagonists and Extracellular Acidity
NASA Astrophysics Data System (ADS)
Kaku, David A.; Giffard, Rona G.; Choi, Dennis W.
1993-06-01
Glutamate antagonists protect neurons from hypoxic injury both in vivo and in vitro, but in vitro studies have not been done under the acidic conditions typical of hypoxia-ischemia in vivo. Consistent with glutamate receptor antagonism, extracellular acidity reduced neuronal death in murine cortical cultures that were deprived of oxygen and glucose. Under these acid conditions, N-methyl-D-aspartate and α-amino-3-hydroxy-5-methyl-4-isox-azolepropionate-kainate antagonists further reduced neuronal death, such that some neurons tolerated prolonged oxygen and glucose deprivation almost as well as did astrocytes. Neuroprotection induced by this combination exceeded that induced by glutamate antagonists alone, suggesting that extracellular acidity has beneficial effects beyond the attenuation of ionotropic glutamate receptor activation.
Tagami, Takahiro; Nishimitsu, Yoshitomo; Sherrod, D.R.
2003-01-01
West Maui's rejuvenated-stage Lahaina Volcanics were erupted from four discrete sites. New KAr ages indicate two pulses of volcanism, the older about 0.6 Ma and the younger about 0.4 Ma. Compositionally the lava flows are entirely basanitic, but each pulse is diverse. The underlying postshield-stage Honolua Volcanics were emplaced by about 1.2 Ma on the basis of previously published ages. Therefore the duration of volcanic quiescence prior to rejuvenation is about 0.6 m.y. at West Maui, much longer than estimated previously. ?? 2002 Elsevier Science B.V. All rights reserved.
Nguyen, David; Deng, Ping; Matthews, Elizabeth A; Kim, Doo-Sik; Feng, Guoping; Dickenson, Anthony H; Xu, Zao C; Luo, Z David
2009-01-01
Nerve injury-induced expression of the spinal calcium channel alpha-2-delta-1 subunit (Cavα2δ1) has been shown to mediate behavioral hypersensitivity through a yet identified mechanism. We examined if this neuroplasticity modulates behavioral hypersensitivity by regulating spinal glutamatergic neurotransmission in injury-free transgenic mice overexpressing the Cavα2δ1 proteins in neuronal tissues. The transgenic mice exhibited hypersensitivity to mechanical stimulation (allodynia) similar to the spinal nerve ligation injury model. Intrathecally delivered antagonists for N-methyl-D-aspartate (NMDA) and α-amino-3-hydroxyl-5-methylisoxazole-4-propionic acid (AMPA)/kainate receptors, but not for the metabotropic glutamate receptors, caused a dose-dependent allodynia reversal in the transgenic mice without changing the behavioral sensitivity in wild-type mice. This suggests that elevated spinal Cavα2δ1 mediates allodynia through a pathway involving activation of selective glutamate receptors. To determine if this is mediated by enhanced spinal neuronal excitability or pre-synaptic glutamate release in deep-dorsal horn, we examined wide-dynamic-range (WDR) neuron excitability with extracellular recording and glutamate-mediated excitatory postsynaptic currents with whole-cell patch recording in deep-dorsal horn of the Cavα2δ1 transgenic mice. Our data indicated that overexpression of Cavα2δ1 in neuronal tissues led to increased frequency, but not amplitude, of miniature excitatory post synaptic currents mediated mainly by AMPA/kainate receptors at physiological membrane potentials, and also by NMDA receptors upon depolarization, without changing the excitability of WDR neurons to high intensity stimulation. Together, these findings support a mechanism of Cavα2δ1-mediated spinal sensitization in which elevated Cavα2δ1 causes increased pre-synaptic glutamate release that leads to reduced excitation thresholds of post-synaptic dorsal horn neurons to innocuous
Lyddon, Rebecca; Navarrett, Scott; Dracheva, Stella
2012-07-01
Dysfunction of glutamate neurotransmission has been implicated in the pathology of schizophrenia and bipolar disorder, and one mechanism by which glutamate signalling can be altered is through RNA editing of ionotropic glutamate receptors (iGluRs). The objectives of the present study were to evaluate the editing status of iGluRs in the human prefrontal cortex, determine whether iGluR editing is associated with psychiatric disease or suicide and evaluate a potential association between editing and alternative splicing in the α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA) iGluR subunits' pre-mRNA. We studied specimens derived from patients with antemortem diagnoses of bipolar disorder (n = 31) or schizophrenia (n = 34) who died by suicide or other causes, and from psychiatrically healthy controls (n = 34) who died from causes other than suicide. The RNA editing at all 8 editing sites within AMPA (GluA2-4 subunits) and kainate (GluK1-2 subunits) iGluRs was analyzed using a novel real-time quantitative polymerase chain reaction assay. No differences in editing were detected among schizophrenia, bipolar or control groups or between suicide completers and patients who died from causes other than suicide. The editing efficiency was significantly higher in the flop than in the flip splicoforms of GluA3-4 AMPA subunits (all p < 0.001). The study is limited by the near absence of specimens from medicationnaive psychiatric patients and considerable variation in medication regimens among individuals, both of which introduce considerable uncertainty into the analysis of potential medication effects. We found that iGluR RNA editing status was not associated with bipolar disorder, schizophrenia or suicide. Differences in editing between flip and flop splicoforms suggest that glutamate sensitivity of receptors containing GluA3 and/or GluA4 flop subunits is moderated as a result of increased editing.
Gareeva, A E; Khusnutdinova, E K
2014-01-01
Schizophrenia is a severe mental disorder that affects about 1% of the world population, leading to disability and social exclusion. Glutamatergic neurotransmission is a violation of one of the main hypotheses put forward to explain the neurobiological mechanisms of schizophrenia. Post mortem studies have found changes in the degree of affinity glutamate receptors, their transcription, and altered expression of their subunits in the prefrontal cortex, hippocampus, and thalamus in patients with schizophrenia. As a result of genetic studies of gene family encoding ionotropic AMPA and kainate glutamate receptors in schizophrenia, ambiguous results were received. The association of polymorphic variants of genes GRIA2 and GRIK2 with paranoid schizophrenia and response to therapy with haloperidol in Russian and Tatar of the Republic of Bashkortostan was conducted in the present study. DNA samples of 257 patients with paranoid schizophrenia and of 349 healthy controls of Russian and Tatar ethnic group living in the Republic of Bashkortostan were involved into the present study. In the result of the present study: (1) high risk genetic markers of paranoid schizophrenia (PSZ) were obtained: in Russians-GR4IA2*CCC (OR = 9.60) and in Tatars-GRIK2*ATG (OR = 3.5), GRIK2*TGG (OR = 3.12) (2) The following low risk genetic markers of PSZ were revealed: in Tatars-GRIA2*T/T (rs43025506) of GRIA2 gene (OR = 0.34); in Russians.- GRIA2*CCT (OR = 0.481). (3) Genetic markers of low haloperido! treatment efficacy in respect of negative and positive symptoms GRIK2*T/T (rs2227281) of GRIK2 gene and GRAL42*C/C in Russians, GRIK2*A/A (rs995640) of GRIK2 gene in Tatars. (4) Genetic markers of low haloperidol treatment efficacy in respect of positive symptoms GRL42*C/C in Russians. The results of the present study support the hypothesis of the involvement of glutamate receptor genes in schizophrenia pathway. Considerable inter-ethnic'diversity of genetic risk factors for this disease was
Influence of GRIK4 genetic variants on the electroconvulsive therapy response.
Minelli, Alessandra; Congiu, Chiara; Ventriglia, Mariacarla; Bortolomasi, Marco; Bonvicini, Cristian; Abate, Maria; Sartori, Riccardo; Gainelli, Giulio; Gennarelli, Massimo
2016-07-28
Several lines of evidence have shown the involvement of the glutamatergic system in the function of electroconvulsive therapy (ECT). In particular, patients with treatment resistant depression (TRD) and chronic depression have lower levels of glutamate/glutamine than controls, and ECT can reverse this deficit. Genetic factors might contribute to modulating the mechanisms underlying ECT. This study aimed to evaluate the relationship between three polymorphisms (rs1954787, rs4936554 and rs11218030) of the glutamate receptor ionotropic kainate 4 (GRIK4) gene and responsiveness to ECT treatment in a sample of one hundred individuals, TRD or depressive Bipolar Disorder patients resistant to pharmacological treatments. The results revealed that GRIK4 variants were significantly associated with the response to ECT. In particular, we found that patients carrying the G allele of the GRIK4 rs11218030 had a significantly poorer response to ECT (p=2.71×10(-4)), showing five times the risk of relapse after ECT compared to the AA homozygotes. Analogously, patients carrying the GG rs1954787 genotype and rs4936554A allele carriers presented a double risk of lack of response after ECT (p=0.013 and p=0.040, respectively). In conclusion, the current study provides new evidence, indicating that some GRIK4 variants modulate the response to ECT in patients with depression resistant to treatment, suggesting a role for kainate receptor modulation. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Rangel, Alejandra; Madroñal, Noelia; Massó, Agnès Gruart i.; Gavín, Rosalina; Llorens, Franc; Sumoy, Lauro; Torres, Juan María; Delgado-García, José María; Río, José Antonio Del
2009-01-01
Background Prionopathies are characterized by spongiform brain degeneration, myoclonia, dementia, and periodic electroencephalographic (EEG) disturbances. The hallmark of prioniopathies is the presence of an abnormal conformational isoform (PrPsc) of the natural cellular prion protein (PrPc) encoded by the Prnp gene. Although several roles have been attributed to PrPc, its putative functions in neuronal excitability are unknown. Although early studies of the behavior of Prnp knockout mice described minor changes, later studies report altered behavior. To date, most functional PrPc studies on synaptic plasticity have been performed in vitro. To our knowledge, only one electrophysiological study has been performed in vivo in anesthetized mice, by Curtis and coworkers. They reported no significant differences in paired-pulse facilitation or LTP in the CA1 region after Schaffer collateral/commissural pathway stimulation. Methodology/Principal Findings Here we explore the role of PrPc expression in neurotransmission and neural excitability using wild-type, Prnp −/− and PrPc-overexpressing mice (Tg20 strain). By correlating histopathology with electrophysiology in living behaving mice, we demonstrate that both Prnp −/− mice but, more relevantly Tg20 mice show increased susceptibility to KA, leading to significant cell death in the hippocampus. This finding correlates with enhanced synaptic facilitation in paired-pulse experiments and hippocampal LTP in living behaving mutant mice. Gene expression profiling using Illumina™ microarrays and Ingenuity pathways analysis showed that 129 genes involved in canonical pathways such as Ubiquitination or Neurotransmission were co-regulated in Prnp −/− and Tg20 mice. Lastly, RT-qPCR of neurotransmission-related genes indicated that subunits of GABAA and AMPA-kainate receptors are co-regulated in both Prnp −/− and Tg20 mice. Conclusions/Significance Present results demonstrate that PrPc is necessary for the proper
NASA Technical Reports Server (NTRS)
Devismes, Damien; Cohen, Barbara
2016-01-01
Since these techniques are very new and as they have never been used or this purpose. they will need to be replicated by several independent studies. These techniques may be very important if the optical imaging encounters difficulties, for example, if a sample is made of very dark or monochromatic material and in the case of very deep pits (>500 microns) Based on the preliminary results, the LIBS continuum technique is more appropriate to the large pits produced by long ablations The relationship may work best homogeneous samples, but the continuum is collected with every LIBS analysis so does not require any addition to the experimental suite of techniques. The integration of a QCMB in the ablation chamber may be a very interesting solution to determine the ablated mass. Even if it only measures a fraction of the total mass, its sensitivity should be able to weigh hundreds of nanograms accumulated on the crystal during ablation and relate it to the actual ablated mass. In the future. these options may help in situ K-Ar dating to give the age of the rock with the best accuracy and precision.
Gleason, Scott D; Kato, Akihiko; Bui, Hai H; Thompson, Linda K; Valli, Sabrina N; Stutz, Patrick V; Kuo, Ming-Shang; Falcone, Julie F; Anderson, Wesley H; Li, Xia; Witkin, Jeffrey M
2015-01-01
affected by deletion of the γ-8 protein. Of a large panel of plasma lipids, only two monoacylglycerols (1OG and 2OG) were marginally but nonsignificantly altered in WT vs KO mice. Overall, the data suggest genetic inactivation of this specific population of AMPA receptors results in modest changes in behavior characterized by a mild hyperactivity which is condition dependent and a marked reduction in digging and burying behaviors. Despite deletion of TARP γ-8, chemoconvulsants were still active. Consistent with their predicted pharmacological actions, the convulsant effects of kainate and the antidepressant-like effects of an AMPA receptor potentiator (both acting upon AMPA receptors) were reduced or absent in KO mice.
Krogsgaard-Larsen, Niels; Storgaard, Morten; Møller, Charlotte; Demmer, Charles S; Hansen, Jeanette; Han, Liwei; Monrad, Rune N; Nielsen, Birgitte; Tapken, Daniel; Pickering, Darryl S; Kastrup, Jette S; Frydenvang, Karla; Bunch, Lennart
2015-08-13
Herein we describe the first structure-activity relationship study of the broad-range iGluR antagonist (2S,3R)-3-(3-carboxyphenyl)pyrrolidine-2-carboxylic acid (1) by exploring the pharmacological effect of substituents in the 4, 4', or 5' positions and the bioisosteric substitution of the distal carboxylic acid for a phosphonic acid moiety. Of particular interest is a hydroxyl group in the 4' position 2a which induced a preference in binding affinity for homomeric GluK3 over GluK1 (Ki = 0.87 and 4.8 μM, respectively). Two X-ray structures of ligand binding domains were obtained: 2e in GluA2-LBD and 2f in GluK1-LBD, both at 1.9 Å resolution. Compound 2e induces a D1-D2 domain opening in GluA2-LBD of 17.3-18.8° and 2f a domain opening in GluK1-LBD of 17.0-17.5° relative to the structures with glutamate. The pyrrolidine-2-carboxylate moiety of 2e and 2f shows a similar binding mode as kainate. The 3-carboxyphenyl ring of 2e and 2f forms contacts comparable to those of the distal carboxylate in kainate.
Transient protective effect of B-vitamins in experimental epilepsy in the mouse brain.
Rabie, Tamer; Mühlhofer, Wolfgang; Bruckner, Thomas; Schwab, Anna; Bauer, Alexander T; Zimmermann, Manfred; Bonke, Dieter; Marti, Hugo H; Schenkel, Johannes
2010-05-01
The regulation of programmed cell death in the nervous system of vertebrates is a complex mechanism aimed to remove superfluous or damaged cells. Epileptic seizures can lead to an activation of pathways resulting in neuronal cell death. B-vitamins might have a neuroprotective potential reducing cell death following appropriate stimulation. Here, the role of the B-vitamins B(1) (thiamine), B(6) (pyridoxine), and B(12) (cobalamine) was investigated in a mouse model of experimental epilepsy induced by kainate. B-vitamin pre-treated animals showed a significantly reduced epileptic score during the first 15 min after kainate injection. The molecular response to kainate showed a bi-phased time course with early induction of Bcl-2 expression within 12 h and a second induction after 7 days of kainate exposure. B-vitamin pre-treatment resulted in significant higher Bcl-2 expression in control animals (no kainate) and at 12 h within the early phase. Bcl-2 expression was not affected by B-vitamins within the second phase. BAX expression was not significantly influenced during the whole experiment. Three days after kainate stimulation, the number of TdT-mediated dUTP-biotin nick end labeling-positive cells in the hippocampal region was lower in B-vitamin-treated animals. Therefore, B-vitamin pre-treatment may attenuate the response to epileptic stimulation.
Nishizaki, Tomoyuki; Matsumura, Takuro
2002-01-31
The present study was conducted to assess the effect of aniracetam and its metabolites, such as 2-pyrrolidinone, p-anisic acid, and anisamide butyrate, on the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, heteromerically formed of GluR1,2 (GluR1 and GluR2), GluR1,3 (GluR1 and GluR3), and GluR1,2,3 (GluR1, GluR2, and GluR3), expressed in Xenopus oocytes. 2-Pyrrolidinone potentiated kainate-evoked currents through GluR1,2,3 channels in a bell-shaped dose-dependent manner at concentrations ranged from 1 nM to 300 microM, with a maximal effect at 100 microM. The potentiation was long-lasting, reaching approximately 180% of basal levels 60 min after 5-min treatment with 2-pyrrolidinone at 100 microM. 2-Pyrrolidinone (100 microM) potentiated GluR1,3 channel currents as observed in GluR1,2,3, but instead it depressed GluR1,2 currents. Aniracetam and p-anisic acid potentiated GluR1,2,3 channel currents, but to a lesser extent, each about 130 and 103% of basal levels 60 min after treatment at 100 microM. In contrast, anisamide butyrate had no potentiating effect on the currents. Potentiation of GluR1,2,3 channel currents obtained with 2-pyrrolidinone was inhibited by KN-93, a selective inhibitor of calcium/calmodulin-dependent protein kinase (CaMKII), while it was not affected by GF109203X, a selective inhibitor of protein kinase C or H-89, a selective inhibitor of cAMP-dependent protein kinase. The results of the present study suggest that 2-pyrrolidinone persistently enhances activity of the Ca2+-permeable AMPA receptors, GluR1,3 and GluR1,2,3, by interacting with CaMKII.
Burgdorf, Jeffrey; Zhang, Xiao-lei; Nicholson, Katherine L; Balster, Robert L; David Leander, J; Stanton, Patric K; Gross, Amanda L; Kroes, Roger A; Moskal, Joseph R
2013-01-01
Recent human clinical studies with the NMDA receptor (NMDAR) antagonist ketamine have revealed profound and long-lasting antidepressant effects with rapid onset in several clinical trials, but antidepressant effects were preceded by dissociative side effects. Here we show that GLYX-13, a novel NMDAR glycine-site functional partial agonist, produces an antidepressant-like effect in the Porsolt, novelty induced hypophagia, and learned helplessness tests in rats without exhibiting substance abuse-related, gating, and sedative side effects of ketamine in the drug discrimination, conditioned place preference, pre-pulse inhibition and open-field tests. Like ketamine, the GLYX-13-induced antidepressant-like effects required AMPA/kainate receptor activation, as evidenced by the ability of NBQX to abolish the antidepressant-like effect. Both GLYX-13 and ketamine persistently (24 h) enhanced the induction of long-term potentiation of synaptic transmission and the magnitude of NMDAR-NR2B conductance at rat Schaffer collateral-CA1 synapses in vitro. Cell surface biotinylation studies showed that both GLYX-13 and ketamine led to increases in both NR2B and GluR1 protein levels, as measured by Western analysis, whereas no changes were seen in mRNA expression (microarray and qRT-PCR). GLYX-13, unlike ketamine, produced its antidepressant-like effect when injected directly into the medial prefrontal cortex (MPFC). These results suggest that GLYX-13 produces an antidepressant-like effect without the side effects seen with ketamine at least in part by directly modulating NR2B-containing NMDARs in the MPFC. Furthermore, the enhancement of ‘metaplasticity' by both GLYX-13 and ketamine may help explain the long-lasting antidepressant effects of these NMDAR modulators. GLYX-13 is currently in a Phase II clinical development program for treatment-resistant depression. PMID:23303054
Gating characteristics control glutamate receptor distribution and trafficking in vivo.
Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J
2014-09-08
Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.
Alhadeff, Amber L; Holland, Ruby A; Nelson, Alexandra; Grill, Harvey J; De Jonghe, Bart C
2015-08-05
Cisplatin chemotherapy is used commonly to treat a variety of cancers despite severe side effects such as nausea, vomiting, and anorexia that compromise quality of life and limit treatment adherence. The neural mechanisms mediating these side effects remain elusive despite decades of clinical use. Recent data highlight the dorsal vagal complex (DVC), lateral parabrachial nucleus (lPBN), and central nucleus of the amygdala (CeA) as potential sites of action in mediating the side effects of cisplatin. Here, results from immunohistochemical studies in rats identified a population of cisplatin-activated DVC neurons that project to the lPBN and a population of cisplatin-activated lPBN calcitonin gene-related peptide (CGRP, a marker for glutamatergic neurons in the lPBN) neurons that project to the CeA, outlining a neuroanatomical circuit that is activated by cisplatin. CeA gene expressions of AMPA and NMDA glutamate receptor subunits were markedly increased after cisplatin treatment, suggesting that CeA glutamate receptor signaling plays a role in mediating cisplatin side effects. Consistent with gene expression results, behavioral/pharmacological data showed that CeA AMPA/kainate receptor blockade attenuates cisplatin-induced pica (a proxy for nausea/behavioral malaise in nonvomiting laboratory rodents) and that CeA NMDA receptor blockade attenuates cisplatin-induced anorexia and body weight loss in addition to pica, demonstrating that glutamate receptor signaling in the CeA is critical for the energy balance dysregulation caused by cisplatin treatment. Together, these data highlight a novel circuit and CGRP/glutamatergic mechanism through which cisplatin-induced malaise and energy balance dysregulation are mediated. To treat cancer effectively, patients must follow prescribed chemotherapy treatments without interruption, yet most cancer treatments produce side effects that devastate quality of life (e.g., nausea, vomiting, anorexia, weight loss). Although hundreds of
Alhadeff, Amber L.; Holland, Ruby A.; Nelson, Alexandra; Grill, Harvey J.
2015-01-01
Cisplatin chemotherapy is used commonly to treat a variety of cancers despite severe side effects such as nausea, vomiting, and anorexia that compromise quality of life and limit treatment adherence. The neural mechanisms mediating these side effects remain elusive despite decades of clinical use. Recent data highlight the dorsal vagal complex (DVC), lateral parabrachial nucleus (lPBN), and central nucleus of the amygdala (CeA) as potential sites of action in mediating the side effects of cisplatin. Here, results from immunohistochemical studies in rats identified a population of cisplatin-activated DVC neurons that project to the lPBN and a population of cisplatin-activated lPBN calcitonin gene-related peptide (CGRP, a marker for glutamatergic neurons in the lPBN) neurons that project to the CeA, outlining a neuroanatomical circuit that is activated by cisplatin. CeA gene expressions of AMPA and NMDA glutamate receptor subunits were markedly increased after cisplatin treatment, suggesting that CeA glutamate receptor signaling plays a role in mediating cisplatin side effects. Consistent with gene expression results, behavioral/pharmacological data showed that CeA AMPA/kainate receptor blockade attenuates cisplatin-induced pica (a proxy for nausea/behavioral malaise in nonvomiting laboratory rodents) and that CeA NMDA receptor blockade attenuates cisplatin-induced anorexia and body weight loss in addition to pica, demonstrating that glutamate receptor signaling in the CeA is critical for the energy balance dysregulation caused by cisplatin treatment. Together, these data highlight a novel circuit and CGRP/glutamatergic mechanism through which cisplatin-induced malaise and energy balance dysregulation are mediated. SIGNIFICANCE STATEMENT To treat cancer effectively, patients must follow prescribed chemotherapy treatments without interruption, yet most cancer treatments produce side effects that devastate quality of life (e.g., nausea, vomiting, anorexia, weight loss
Petrology and K-Ar ages of rift-related basaltic rocks, offshore northern Brazil, 3/sup 0/N
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fodor, R.V.; McKee, E.H.
1986-07-01
Tholeiitic basaltic rock in three cores from Petrobras drill site APS-21, 1960-2480 m depths, Amapa basin, offshore Brazil is compositionally similar to rift-related basaltic rock associated with the opening of both the North and South Atlantic Oceans (SiO/sub 2/ 52-54 wt %; K/sub 2/O 0.7-1.3%; TiO/sub 2/ 1.3-2%). Whole-rock K-Ar ages are 185.4, 183.2, and 126.5 m.y. If these represent crystallization ages, then the older samples correspond to North Atlantic tectonism (as represented by the Liberian dike system) and the younger correlates with South Atlantic rift-related magmatism (of which Serra Geral flood basalts are the best example). Trace- and REE-elementsmore » identify T-type mantle source-areas (La/Sm/sub (n)/ approx. 2; Zr/Nb 8-11) that feasibly were mixes of N-type and P-type components (metasomatized or veined upper mantle). These Amapa basin mafic rocks document the southernmost magmatism related to North Atlantic rifting, as well as early Mesozoic mantle source-areas and processes beneath Gondwanaland such as those identified with basalts in the South Atlantic basin.« less
NASA Astrophysics Data System (ADS)
Jaya, Asri; Nishikawa, Osamu; Hayasaka, Yasutaka
2017-11-01
The zircon U-Pb and muscovite K-Ar age from the Bantimala, Barru and Biru basement complexes in the South Arm of Sulawesi, Indonesia provide new information regarding the timing of magmatism, metamorphism and sedimentation in this region and have implications for the origin and evolution of the study area. The study area is at the juncture between the southeast margin of Sundaland and Bird's Head-Australia. The age of both the zircon U-Pb of detrital materials in the Bantimala Complex and the muscovite K-Ar of amphibolite in the Biru Complex fall in the Late Early Cretaceous (between 109 and 115 Ma), which is a similar age range to previous data for both the sedimentary and metamorphic rocks. The youngest detrital zircon in the schist samples from the Barru Complex fall into the Triassic in age (between 243 and 247 Ma). These age data indicate that the protolith of all three basement complexes were involved in the subduction system and metamorphosed in the late Early Cretaceous, but there are several differences in their deposition environment under and out of the influence of the late Early Cretaceous magmatism in the Bantimala and Barru Complexes, respectively. Felsic igneous activities are confirmed in the Late Cretaceous and the Eocene by the zircon U-Pb age of igneous rocks intruding or included as detrital fragments in three basement complexes. These dates are similar to those reported from the Meratus Complex of South Kalimantan. The detrital zircon age distributions of the basement rocks in the South Arm of Sulawesi display predominant Mesozoic (Cretaceous and Triassic) and Paleozoic populations with a small population of Proterozoic ages supporting the hypothesis that the West Sulawesi block originated from the region of the circum Bird's Head-Australian, namely the Inner Banda block. The absence of Jurassic zircon age population in the South Arm of Sulawesi suggests the division of the South Arm of Sulawesi from the Inner Banda block in early stage of
Foster, A C; Kemp, J A; Leeson, P D; Grimwood, S; Donald, A E; Marshall, G R; Priestley, T; Smith, J D; Carling, R W
1992-05-01
The glycine site on the N-methyl-D-aspartate (NMDA) subtype of receptors for the excitatory neurotransmitter glutamate is a potential target for the development of neuroprotective drugs. We report here two chemical series of glycine site antagonists derived from kynurenic acid (KYNA), with greatly improved potency and selectivity. Disubstitution with chlorine or bromine in the 5- and 7-positions of KYNA increased affinity for [3H]glycine binding sites in rat cortex/hippocampus P2 membranes, with a parallel increase of potency for antagonism of NMDA-evoked responses in the rat cortical wedge preparation. The optimal compound was 5-I,7-Cl-KYNA, with an IC50 for [3H]glycine binding of 29 nM and an apparent Kb in the cortical wedge preparation of 0.41 microM. Reduction of the right-hand ring of 5,7-diCl-KYNA reduced affinity by 10-fold, but this was restored by substitution in the 4-position with the trans-phenylamide and further improved in the trans-benzylamide. The optimal compound was the transphenylurea (L-689,560), with an IC50 of 7.4 nM and an apparent Kb of 0.13 microM. Both series of compounds displayed a high degree of selectivity for the glycine site, having IC50 values of greater than 10 microM versus radioligand binding to the glutamate recognition sites of NMDA, alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA), and kainate receptors and the strychnine-sensitive glycine receptor. Selectivity versus AMPA receptor-mediated responses was also apparent in the rat cortical wedge and in patch-clamp recordings of cortical neurons in culture. Experiments using [3H]dizocilpine (MK-801) binding indicated that 5,7-diBr-KYNA, 5,7-diCl-KYNA, 5-I,7-Cl-KYNA, and L-689,560 all behaved as full antagonists and were competitive with glycine. Patch-clamp recordings of cortical neurons in culture also indicated that NMDA-induced currents were antagonized by competition for the glycine site, and gave no evidence for partial agonist activity. pKi values for 5,7-di
Tchekalarova, J; Shishmanova, M; Atanasova, D; Stefanova, M; Alova, L; Lazarov, N; Georgieva, K
2015-11-02
The therapeutic efficacy of regular physical exercises in an animal model of epilepsy and depression comorbidity has been confirmed previously. In the present study, we examined the effects of endurance training on susceptibility to kainate (KA)-induced status epilepticus (SE), behavioral changes and neuronal damage in spontaneously hypertensive rats (SHRs). Male SHRs were randomly divided into two groups. One group was exercised on a treadmill with submaximal loading for four weeks and the other group was sedentary. Immediately after the training period, SE was evoked in half of the sedentary and trained rats by KA, while the other half of the two groups received saline. Basal systolic (SP), diastolic (DP) and mean arterial pressure (MAP) of all rats were measured at the beginning and at the end of the training period. Anxiety, memory and depression-like behaviour were evaluated a month after SE. The release of 5-HT in the hippocampus was measured using a liquid scintillation method and neuronal damage was analyzed by hematoxylin and eosin staining. SP and MAP of exercised SHRs decreased in comparison with the initial values. The increased resistance of SHRs to KA-induced SE was accompanied by an elongated latent seizure-free period, improved object recognition memory and antidepressant effect after the training program. While the anticonvulsant and positive behavioral effects of endurance training were accompanied by an increase of 5-HT release in the hippocampus, it did not exert neuroprotective activity. Our results indicate that prior exercise is an effective means to attenuate KA-induced seizures and comorbid behavioral changes in a model of hypertension and epilepsy suggesting a potential influence of hippocampal 5-HT on a comorbid depression. However, this beneficial impact does not prevent the development of epilepsy and concomitant brain damage. Copyright © 2015 Elsevier B.V. All rights reserved.
Kriebel, Anita; Dörr, Claudia; Bandt, Susanne; Rist, Manuela; Roth, Alexander; Hummel, Eva; Kulling, Sabine; Hoffmann, Ingrid; Watzl, Bernhard
2016-01-01
Background The human metabolome is influenced by various intrinsic and extrinsic factors. A precondition to identify such biomarkers is the comprehensive understanding of the composition and variability of the metabolome of healthy humans. Sample handling aspects have an important impact on the composition of the metabolome; therefore, it is crucial for any metabolomics study to standardize protocols on sample collection, preanalytical sample handling, storage, and analytics to keep the nonbiological variability as low as possible. Objective The main objective of the KarMeN study is to analyze the human metabolome in blood and urine by targeted and untargeted metabolite profiling (gas chromatography-mass spectrometry [GC-MS], GC×GC-MS, liquid chromatography-mass spectrometry [LC-MS/MS], and1H nuclear magnetic resonance [NMR] spectroscopy) and to determine the impact of sex, age, body composition, diet, and physical activity on metabolite profiles of healthy women and men. Here, we report the outline of the study protocol with special regard to all aspects that should be considered in studies applying metabolomics. Methods Healthy men and women, aged 18 years or older, were recruited. In addition to a number of anthropometric (height, weight, body mass index, waist circumference, body composition), clinical (blood pressure, electrocardiogram, blood and urine clinical chemistry) and functional parameters (lung function, arterial stiffness), resting metabolic rate, physical activity, fitness, and dietary intake were assessed, and 24-hour urine, fasting spot urine, and plasma samples were collected. Standard operating procedures were established for all steps of the study design. Using different analytical techniques (LC-MS, GC×GC-MS,1H NMR spectroscopy), metabolite profiles of urine and plasma were determined. Data will be analyzed using univariate and multivariate as well as predictive modeling methods. Results The project was funded in 2011 and enrollment was
NASA Technical Reports Server (NTRS)
Devismes, D.; Cohen, B. A.; Li, Z.-H.; Miller, J. S.
2014-01-01
In planetary exploration, in situ absolute geochronology is one of the main important measurements that needs to be accomplished. Until now, on Mars, the age of the surface is only determined by crater density counting, which gives relative ages. These ages can have a lot of uncertainty as they depend on many parameters. More than that, the curves must be ties to absolute ages. Thus far, only the lost lander Beagle 2 was designed to conduct absolute geochronology measurements, though some recent attempts using MSL Curiosity show that this investigation is feasible and should be strongly encouraged for future flight. Experimental: The Potassium (K)-Argon Laser Experiment (KArLE) is being developed at MSFC through the NASA Planetary Instrument Definition and Development Program (PIDDP). The goal of this experiment is to provide in situ geochronology based on the K-Ar method. A laser ablates a rock under high vacuum, creating a plasma which is sensed by an optical spectrometer to do Laser Induced Breakdown Spectroscopy (LIBS). The ablated material frees gases, including radiogenic 40Ar,which is measured by a mass spectrometer (MS). As the potassium is a content and the 40Ar is a quantity, the ablated mass needed in order to relate them. The mass is given by the product of the ablated volume by the density of this material. So we determine the mineralogy of the ablated material with the LIBS spectra and images and calculate its density. The volume of the pit is measured by using microscopy. LIBS measurement of K under high vacuum: Three independant projects [1, 2, 3] including KArLE, are developing geochronological instruments based on this LA-LIBS-MS method. Despite several differences in their setup, all of them have validated the methods with analyses and ages. However, they all described difficulties with the LIBS measurements of K [3,4]. At ambient pressure, the quantification of K by LIBS on geological materials can be accurate [5]. However the protocol of the LA
NASA Technical Reports Server (NTRS)
Park, J.; Ming, D. W.; Garrison, D. H.; Jones, J. H.; Bogard, D. D.; Nagao, K.
2009-01-01
The purpose of this noble gas investigation was to evaluate the possibility of measuring noble gases in martian rocks and air by future robotic missions such as the Mars Science Laboratory (MSL). The MSL mission has, as part of its payload, the Sample Analysis at Mars (SAM) instrument, which consists of a pyrolysis oven integrated with a GCMS. The MSL SAM instrument has the capability to measure noble gas compositions of martian rocks and atmosphere. Here we suggest the possibility of K-Ar age dating based on noble gas release of martian rocks by conducting laboratory simulation experiments on terrestrial basalts and martian meteorites. We provide requirements for the SAM instrument to obtain adequate noble gas abundances and compositions within the current SAM instrumental operating conditions, especially, a power limit that prevents heating the furnace above approx.1100 C. In addition, Martian meteorite analyses from NASA-JSC will be used as ground truth to evaluate the feasibility of robotic experiments to constrain the ages of martian surface rocks.
Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi
2015-01-01
In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into
Gana, Paulina; Tosdal, Richard M.
1996-01-01
The U-Pb and K-Ar geochronology applied to intrusive rocks from the Coastal Batholith of Central Chile, demonstrates the existence of a basement block of the Mirasol Unit, with a crystallization age of 299??10 Ma, exposed in the northern block of the Melipilla Fault. The age of 214??1 Ma obtained in the 'Dioritas Gne??isicas de Cartagena Unit', indicates that a Late Triassic magmatism took place in this region; it coincides with the end of an extensive crustal melting period, proposed for northern Chile. The ages of the Jurassic plutonic units (Laguna Verde, Sauce, Pen??uelas and Limache) are restricted to the 156-161 Ma interval, showing in certain cases, inherited zircons from an unknown source. The difference between ages obtained using both chronological methods is a few million years, indicating that a short time passed between the crystallization and the cooling of the plutonic bodies, as well as a fast magmatic differentiation process. The Laguna Verde and Sauce Units, experienced a fast uplift, probably as a result of an extensional tectonic process in the magmatic arc, or induced by the magmatic pressure through fracture zones during Middle Jurassic.
Sharp, W.D.; Turrin, B.D.; Renne, P.R.; Lanphere, M.A.
1996-01-01
Mauna Kea lava flows cored in the HilIo hole range in age from <200 ka to about 400 ka based on 40Ar/39Ar incremental heating and K-Ar analyses of 16 groundmass samples and one coexisting plagioclase. The lavas, all subaerially deposited, include a lower section consisting only of tholeiitic basalts and an upper section of interbedded alkalic, transitional tholeiitic, and tholeiitic basalts. The lower section has yielded predominantly complex, discordant 40Ar/39Ar age spectra that result from mobility of 40Ar and perhaps K, the presence of excess 40Ar, and redistribution of 39Ar by recoil. Comparison of K-Ar ages with 40Ar/39Ar integrated ages indicates that some of these samples have also lost 39Ar. Nevertheless, two plateau ages of 391 ?? 40 and 400 ?? 26 ka from deep in the hole, combined with data from the upper section, show that the tholeiitic section accumulated at an average rate of about 7 to 8 m/kyr and has an mean recurrence interval of 0.5 kyr/flow unit. Samples from the upper section yield relatively precise 40Ar/39Ar plateau and isotope correlation ages of 326 ?? 23, 241 ?? 5, 232 ?? 4, and 199 ?? 9 ka for depths of -415.7 m to -299.2 m. Within their uncertainty, these ages define a linear relationship with depth, with an average accumulation rate of 0.9 m/kyr and an average recurrence interval of 4.8 kyr/flow unit. The top of the Mauna Kea sequence at -280 m must be older than the plateau age of 132 ?? 32 ka, obtained for the basal Mauna Loa flow in the corehole. The upward decrease in lava accumulation rate is a consequence of the decreasing magma supply available to Mauna Kea as it rode the Pacific plate away from its magma source, the Hawaiian mantle plume. The age-depth relation in the core hole may be used to test and refine models that relate the growth of Mauna Kea to the thermal and compositional structure of the mantle plume.
NASA Astrophysics Data System (ADS)
Imaoka, T.; Kiminami, K.; Nishida, K.; Takemoto, M.; Ikawa, T.; Itaya, T.; Kagami, H.; Iizumi, S.
2011-01-01
Systematic K-Ar dating and geochemical analyses of Paleogene cauldrons in the Sanin Belt of SW Japan have been made to explore the relationship between the timing of their formation and the Paleogene subduction history of SW Japan documented in the Shimanto accretionary complex. We also examine the magma sources and tectonics beneath the backarc region of SW Japan at the eastern plate boundary of Eurasia. Fifty-eight new K-Ar ages and 19 previously reported radiometric age data show that the cauldrons formed during Middle Eocene to Early Oligocene time (43-30 Ma), following a period of magmatic hiatus from 52 to 43 Ma. The hiatus coincides with absence of an accretionary prism in the Shimanto Belt. Resumption of the magmatism that formed the cauldron cluster in the backarc was concurrent with voluminous influx of terrigenous detritus to the trench, as a common tectono-thermal event within a subduction system. The cauldrons are composed of medium-K calc-alkaline basalts to rhyolites and their plutonic equivalents. These rocks are characterized by lower concentrations of large ion lithophile elements (LILE) including K 2O, Ba, Rb, Th, U and Li, lower (La/Yb) n ratios, lower initial Sr isotopic ratios (0.7037-0.7052) and higher ɛNd( T) values (-0.5 to +3.5) relative to Late Cretaceous to Early Paleogene equivalents. There are clear trends from enriched to depleted signatures with decreasing age, from the Late Cretaceous to the Paleogene. The same isotopic shift is also confirmed in lower crust-derived xenoliths, and is interpreted as mobilization of pre-existing enriched lithospheric mantle by upwelling depleted asthenosphere. Relatively elevated geothermal gradients are presumed to have prevailed over wide areas of the backarc and forearc of the SW Japan arc-trench system during the Eocene to Oligocene. Newly identified Late Eocene low silica adakites and high-Mg andesites in the Sanin Belt and Early Eocene A-type granites in the SW Korea Peninsula probably formed
Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir
2014-01-01
We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605
Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir
2014-01-01
We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.
Beamer, Edward; Sills, Graeme J.; Thippeswamy, Thimmasettappa
2014-01-01
A refined kainate (KA) C57BL/6J mouse model of status epilepticus (SE) using a repeated low dose (RLD) of KA (5 mg/kg, intraperitoneal; at 30 min intervals) was compared with the established single high dose (SHD) of KA (20 mg/kg, intraperitoneal) model. In the RLD group, increased duration of convulsive motor seizures (CMS, Racine scale stage ≥3) with a significant reduction in mortality from 21% to 6% and decreased variability in seizure severity between animals/batches were observed when compared to the SHD group. There was a significant increase in the percentage of animals that reached stage-5 seizures (65% versus 96%) in the RLD group. Integrated real-time video-EEG analysis of both groups, using NeuroScore software, revealed stage-specific spikes and power spectral density characteristics. When the seizures progressed from non-convulsive seizures (NCS, stage 1–2) to CMS (stage 3–5), the delta power decreased which was followed by an increase in gamma and beta power. A transient increase in alpha and sigma power marked the transition from NCS to CMS with characteristic ‘high frequency trigger’ spikes on the EEG, which had no behavioral expression. During SE the spike rate was higher in the RLD group than in the SHD group. Overall these results confirm that RLD of KA is a more robust and consistent mouse model of SE than the SHD of KA mouse model. PMID:24802808
Neuroprotective antioxidants from marijuana.
Hampson, A J; Grimaldi, M; Lolic, M; Wink, D; Rosenthal, R; Axelrod, J
2000-01-01
Cannabidiol and other cannabinoids were examined as neuroprotectants in rat cortical neuron cultures exposed to toxic levels of the neurotransmitter, glutamate. The psychotropic cannabinoid receptor agonist delta 9-tetrahydrocannabinol (THC) and cannabidiol, (a non-psychoactive constituent of marijuana), both reduced NMDA, AMPA and kainate receptor mediated neurotoxicities. Neuroprotection was not affected by cannabinoid receptor antagonist, indicating a (cannabinoid) receptor-independent mechanism of action. Glutamate toxicity can be reduced by antioxidants. Using cyclic voltametry and a fenton reaction based system, it was demonstrated that Cannabidiol, THC and other cannabinoids are potent antioxidants. As evidence that cannabinoids can act as an antioxidants in neuronal cultures, cannabidiol was demonstrated to reduce hydroperoxide toxicity in neurons. In a head to head trial of the abilities of various antioxidants to prevent glutamate toxicity, cannabidiol was superior to both alpha-tocopherol and ascorbate in protective capacity. Recent preliminary studies in a rat model of focal cerebral ischemia suggest that cannabidiol may be at least as effective in vivo as seen in these in vitro studies.
Portugal, Camila Cabral; Miya, Vivian Sayuri; Calaza, Karin da Costa; Santos, Rochelle Alberto Martins; Paes-de-Carvalho, Roberto
2009-01-01
Vitamin C is transported in the brain by sodium vitamin C co-transporter 2 (SVCT-2) for ascorbate and glucose transporters for dehydroascorbate. Here we have studied the expression of SVCT-2 and the uptake and release of [(14)C] ascorbate in chick retinal cells. SVCT-2 immunoreactivity was detected in rat and chick retina, specially in amacrine cells and in cells in the ganglion cell layer. Accordingly, SVCT-2 was expressed in cultured retinal neurons, but not in glial cells. [(14)C] ascorbate uptake was saturable and inhibited by sulfinpyrazone or sodium-free medium, but not by treatments that inhibit dehydroascorbate transport. Glutamate-stimulated vitamin C release was not inhibited by the glutamate transport inhibitor l-beta-threo-benzylaspartate, indicating that vitamin C release was not mediated by glutamate uptake. Also, ascorbate had no effect on [(3)H] D-aspartate release, ruling out a glutamate/ascorbate exchange mechanism. 2-Carboxy-3-carboxymethyl-4-isopropenylpyrrolidine (Kainate) or NMDA stimulated the release, effects blocked by their respective antagonists 6,7-initroquinoxaline-2,3-dione (DNQX) or (5R,2S)-(1)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine hydrogen maleate (MK-801). However, DNQX, but not MK-801 or 2-amino-5-phosphonopentanoic acid (APV), blocked the stimulation by glutamate. Interestingly, DNQX prevented the stimulation by NMDA, suggesting that the effect of NMDA was mediated by glutamate release and stimulation of non-NMDA receptors. The effect of glutamate was neither dependent on external calcium nor inhibited by 1,2-bis (2-aminophenoxy) ethane-N',N',N',N',-tetraacetic acid tetrakis (acetoxy-methyl ester) (BAPTA-AM), an internal calcium chelator, but was inhibited by sulfinpyrazone or by the absence of sodium. In conclusion, retinal cells take up and release vitamin C, probably through SVCT-2, and the release can be stimulated by NMDA or non-NMDA glutamate receptors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
40Ar/39Ar and K-Ar data bearing on the metamorphic and tectonic history of western New England.
Sutter, J.F.; Ratcliffe, N.M.; Mukasa, S.B.
1985-01-01
40Ar/39Ar ages of coexisting biotite and hornblende from Proterozoic Y gneisses of the Berkshire and Green Mt massifs, as well as 40Ar/39Ar and K/Ar mineral and whole-rock ages from Palaeozoic metamorphic rocks, suggest that the thermal peaks for the dominant metamorphic recrystallization in western New England occurred 465 + or - 5 m.y. (Taconian). 40Ar/39Ar age data from a poorly-defined terrain along the eastern strip of the area suggests that the area has been retrograded during a metamorphism that peaked at least 376 + or - 5 m.y. (Acadian). Available age and petrological data from western New England indicate the presence of at least three separate metamorphic-structure domains of Taconic age: 1) a small area of relict high-P and low-T metamorphism, 2) a broad area of normal Barrovian metamorphism from chlorite to garnet grade characterized by a gentle metamorphic gradient and, 3) a rather narrow belt of steep-gradient, Barrovian series metamorphic rocks. Areas of maximum metamorphic intensity within the last domain coincide with areas of maximum crustal thickening in the later stage of Taconic orogeny. -L.di H
High preservation of DNA standards diluted in 50% glycerol.
Schaudien, Dirk; Baumgärtner, Wolfgang; Herden, Christiane
2007-09-01
Standard curves are important tools in real-time quantitative polymerase chain reaction (PCR) to precisely analyze gene expression patterns under physiologic and pathologic conditions. Handling of DNA standards often implies multiple cycles of freezing and thawing that might affect DNA stability and integrity. This in turn might influence the reliability and reproducibility of quantitative measurements in real-time PCR assays. In this study, 3 DNA standards such as murine tumor necrosis factor (TNF) alpha, interferon (IFN) gamma, and kainat-1 receptor were diluted in 50% glycerol or water after 1, 4, and 16 cycles of freezing and thawing and amplified copy numbers after real-time PCR were compared. The standards diluted in water showed a reduction to 83%, 55%, and 50% after 4 cycles, to 24%, 5%, and 4% after 16 cycles for kainat-1 receptor, TNFalpha, and IFNgamma standards, respectively, when compared with a single cycle of freezing and thawing. Interestingly, all cDNA samples diluted in 50% glycerol were amplified in comparable copy numbers even after 16 cycles of freezing and thawing. The effect of the standards undergoing different cycles of freezing and thawing on sample values was demonstrated by amplifying cDNA obtained from Borna disease virus infected and noninfected TNF-transgenic mice brain. This revealed significant differences of measured cDNA copy numbers using water-diluted DNA standards. In contrast, sample values did not vary using glycerol-diluted standards that were frozen and thawed for 16 times. In conclusion, glycerol storage of DNA standards represents a suitable tool for the accurate and reproducible quantification of cDNA samples in real-time PCR analysis.
Sherrod, D.R.; Murai, T.; Tagami, Takahiro
2007-01-01
Thirty-seven new K-Ar ages from West Maui volcano, Hawai'i, are used to define the waning stages of shield growth and a brief episode of postshield volcanism. All but two samples from shield-stage strata have reversed polarity magnetization, so conceivably the exposed shield is not much older than the Olduvai Normal-Polarity subchron, or about 1.8 Ma. The oldest ages obtained are in the range 1.9-2.1 Ma but have large analytical error. Shield volcanism ended about 1.35 Ma, and postshield volcanism followed soon thereafter, persisting until about 1.2 Ma. Exposed shield-stage strata were emplaced at a rate of about 0.001 km3 per year, a rate smaller than historic Hawaiian magmatic rates by a factor of 100. Stratigraphic accumulation rates are similar to those measured previously at Wai'anae volcano (O'ahu) or the upper part of the Mauna Kea shield sequence (Hilo drill core, Hawai'i). These rates diminish sharply during the final 0.3-0.5 m.y. of the shield stage. Hawaiian shield volcanoes begin waning well before their last 0.5 m.y. of life, then end quickly, geologically speaking, if West Maui is representative. ?? Springer-Verlag 2006.
Rye, Robert O.; Bethke, Philip M.; Lanphere, Marvin A.; Steven, Thomas A.
2000-01-01
K/Ar age determinations or supergene alunite and jarosite, formed during Neogene weathering of the epithermal silver and base-metal ores of the Creede mining district, have been combined with geologic evidence to estimate the timing of regional uplift of the southern Rocky Mountains and related canyon cutting. In addition, oxygen and hydrogen isotopic studies suggest climate changes in the central San Juan Mountains during the past 5 m.y. Alunite [ideally (K,Na)Al3(SO4)2(OH)6] and jarosite [ideally KFe3(SO4)2(OH)6] can be dated by K/Ar or 40Ar/39Ar techniques and both contain OH and SO4 sites that enable four stable isotope analyses (δD, δ18OOH, and δ34S) to be made. This supergene alunite and jarosite formed by weathering of sulfide-rich ore bodies may record the evolution of the chemical and hydrologic processes affecting ancient oxidized acid ground water, as well as details of climate history and geomorphic evolution. Fine-grained (1-10 μm) supergene alunite and jarosite occur in minor fractures in the upper, oxidized parts of the 25 Ma sulfide-bearing veins of the Creede mining district, and jarosite also occurs in adjacent oxidized Ag-bearing clastic sediments. K/Ar ages for alunite range from 4.8 to 3.1 Ma, and for jarosite range from 2.6 to 0.9 Ma. The δD values for alunite and jarosite show opposite correlations with elevation, and values for jarosite correlate with age. Calculated δDH2O values of alunite fluids approach but are larger than those of present-day meteoric water. Calculated δDH2O values for jarosite fluids are more variable; the values of the youngest jarosites are lowest and are similar to those of present-day meteoric water in the district. The narrow δD-δ18OSO4 values of alunites reflects oxidation of sulfide below the water table. The greater range in these values for jarosites reflects oxidation of sulfide under vadose conditions. The ages of alunite mark the position of the paleo-water table at the end of a period of moderate
NASA Astrophysics Data System (ADS)
Duchesne, A. E.; Pierce, E. L.; Williams, T.; Hemming, S. R.; Johnson, D. L.; May, T.; Gombiner, J.; Torfstein, A.
2012-12-01
¶ The Middle Miocene Climate Transition (MMCT) (~14 Ma) represents a time of major East Antarctic Ice-Sheet (EAIS) expansion, with research suggesting major global sea level fall on the order of ~60 meters (John et al., 2011, EPSL). Ocean Drilling Program (ODP) core data from Site 1165B near Prydz Bay shows an influx of cobbles deposited ~13.8-13.5 Ma, representing a sudden burst of ice-rafted detritus (IRD) during the MMCT. Based on 40Ar/39Ar dating of hornblendes and/or biotite grains, 5 of 6 dated pebbles from a companion study show Wilkes Land origins, indicating transport from over 1500 kilometers away. However, samples throughout this time interval have an anomalously low abundance of sand, thus we seek to understand the sedimentary processes that led to the deposition of these isolated dropstones in a fine matrix through provenance studies of the core's terrigenous fine fraction. Geochemical provenance studies of the terrigenous fraction of marine sediments can aid in identifying past dynamic EAIS behavior; the few outcrops available on the continent provide specific rock characterizations and age constraints from which cored marine sediments can then be matched to using established radiogenic isotope techniques. Here we apply the K/Ar dating method as a provenance tool for identifying the source area(s) of fine-grained terrigenous sediments (<63 μm) deposited during the MMCT. ¶ After source area characterization, we find that the fine-grained sediments from the mid-Miocene show a mixture of both local Prydz Bay sourcing (~400 Ma signature) and Wilkes Land provenance (~900 Ma signature). While locally-derived Prydz Bay sediments are likely to have been delivered via meltwater from ice and deposited as hemipelagic sediments (with some possible bottom current modification, as this is a drift site), sediments sourced from Wilkes Land required transport via large icebergs. Future work will involve further provenance determination on both the fine
Receptor-receptor interactions within receptor mosaics. Impact on neuropsychopharmacology.
Fuxe, K; Marcellino, D; Rivera, A; Diaz-Cabiale, Z; Filip, M; Gago, B; Roberts, D C S; Langel, U; Genedani, S; Ferraro, L; de la Calle, A; Narvaez, J; Tanganelli, S; Woods, A; Agnati, L F
2008-08-01
Future therapies for diseases associated with altered dopaminergic signaling, including Parkinson's disease, schizophrenia and drug addiction or drug dependence may substantially build on the existence of intramembrane receptor-receptor interactions within dopamine receptor containing receptor mosaics (RM; dimeric or high-order receptor oligomers) where it is believed that the dopamine D(2) receptor may operate as the 'hub receptor' within these complexes. The constitutive adenosine A(2A)/dopamine D(2) RM, located in the dorsal striato-pallidal GABA neurons, are of particular interest in view of the demonstrated antagonistic A(2A)/D(2) interaction within these heteromers; an interaction that led to the suggestion and later demonstration that A(2A) antagonists could be used as novel anti-Parkinsonian drugs. Based on the likely existence of A(2A)/D(2)/mGluR5 RM located both extrasynaptically on striato-pallidal GABA neurons and on cortico-striatal glutamate terminals, multiple receptor-receptor interactions within this RM involving synergism between A(2A)/mGluR5 to counteract D(2) signaling, has led to the proposal of using combined mGluR5 and A(2A) antagonists as a future anti-Parkinsonian treatment. Based on the same RM in the ventral striato-pallidal GABA pathways, novel strategies for the treatment of schizophrenia, building on the idea that A(2A) agonists and/or mGluR5 agonists will help reduce the increased dopaminergic signaling associated with this disease, have been suggested. Such treatment may ensure the proper glutamatergic drive from the mediodorsal thalamic nucleus to the prefrontal cortex, one which is believed to be reduced in schizophrenia due to a dominance of D(2)-like signaling in the ventral striatum. Recently, A(2A) receptors also have been shown to counteract the locomotor and sensitizing actions of cocaine and increases in A(2A) receptors have also been observed in the nucleus accumbens after extended cocaine self-administration, probably
NASA Astrophysics Data System (ADS)
Duru, Olgun; Keskin, Mehmet
2017-04-01
Between the towns of Sarıkamış and Kaǧızman, NE Turkey, a medium-sized strato-volcano with satellite cones and domes on its slopes unconformably overlies the Erzurum-Kars Volcanic Plateau (EKVP) with a subhorizontal contact. It is called the Aladaǧ volcanic system (AVS). Dating results indicate that the AVS is Pliocene in age. The EKVP is known to be formed by a widespread volcanism between Middle Miocene to Pliocene. The young volcanism in E Turkey including the study area is linked to a collision between the Eurasia and Arabian continents, started almost 15 Ma ago. The EKVP lies over 2000 m above the sea level, and is deeply cut by the river Aras. On the slopes of the valley, one of the best volcano-stratigraphic transects of Eastern Anatolia, almost half a km thick, is exposed. That transect is composed of aphyric andesites-dacites, ignimbrites, tuffs, perlite and obsidian bands. Pyroclastic fall and surge-related pumice deposits are also widespread. Top of the plateau is composed of the andesitic to basaltic andesitic lavas containing plagioclase (Plg) and ortho/clino pyroxene (Opx/Cpx) phenocrysts set in glassy groundmass. In the northwest of the study area, an eroded stratovolcano, probably coeval with the plateau sequence is situated. It also consists of high-silica rhyolites and pyroclastic equivalents. The AVS is composed basically of intermediate lavas. The largest volcanic edifice of the Aladaǧ volcanic system, namely the Greater Aladaǧ stratovolcano reaches up to 3000 m height and includes a horseshoe shaped crater open to the North. Small volcanic cones and domes sit on the flanks of the Greater Aladaǧ volcano. The Aladaǧ lavas are divided into four sub-groups on the basis of their stratigraphic positions, mineral assemblages and textural properties. (1) The oldest products of the Greater Aladaǧ stratovolcano are andesitic and dasitic lavas. They directly sit on the EKVP. These are Plg and Opx/Cpx bearing lavas with porphric, vitrophyric
Turrin, Brent D.; Champion, Duane E.; ,
1991-01-01
K-Ar and 40Ar/39Ar ages from the Lathrop Wells volcanic center, Nevada, and from the Cima volcanic field, California, indicate that the recently reported 20-ka age estimate for the Lathrop Wells volcanic center is incorrect. Instead an age of 119??11 to 141??10 ka is indicated for the Lathrop Wells volcanic center. This age corrected is concordant with the ages determined by two independent isotopic geochronometric techniques and with the stratigraphy of surficial deposits in the Yucca Mountain region. In addition, paleomagnetic data and radiometric age data indicate only two volcanic events at the Lathrop Wells volcanic center that are probably closely linked in time, not as many as five as recently reported.
Postconditioning and anticonditioning: possibilities to interfere to evoked apoptosis.
Burda, Jozef; Danielisová, Viera; Némethová, Miroslava; Gottlieb, Miroslav; Kravcuková, Petra; Domoráková, Iveta; Mechírová, Eva; Burda, Rastislav
2009-09-01
The aim of this study was to validate the ability of postconditioning, used 2 days after kainate intoxication, to protect selectively vulnerable hippocampal CA1 neurons against delayed neuronal death. Kainic acid (8 mg/kg, i.p.) was used to induce neurodegeneration of pyramidal CA1 neurons in rat hippocampus. Fluoro Jade B, the specific marker of neurodegeneration, and NeuN, a specific neuronal marker were used for visualization of changes 7 days after intoxication without and with delayed postconditioning (norepinephrine, 3.1 mumol/kg i.p., 2 days after kainate administration) and anticonditioning (Extract of Ginkgo biloba, 40 mg/kg p.o used simultaneously with kainate). Morris water maze was used on 6th and 7th day after kainate to test learning and memory capabilities of animals. Our results confirm that postconditioning if used at right time and with optimal intensity is able to prevent delayed neuronal death initiated not only by ischemia but kainate intoxication, too. The protective effect of repeated stress-postconditioning was suppressed if extract of Ginkgo biloba (EGb 761, 40 mg/kg p.o.) has been administered together with kainic acid. It seems that combination of lethal stress and antioxidant treatment blocks the activation of endogenous protecting mechanism known as ischemic tolerance, aggravates neurodegeneration and, after repeated stress is able to cause cumulative damage. This observation could be very valuable in situation when the aim of treatment is elimination of unwanted cell population from the organism.
Fuxe, Kjell; Marcellino, Daniel; Borroto-Escuela, Dasiel Oscar; Frankowska, Malgorzata; Ferraro, Luca; Guidolin, Diego; Ciruela, Francisco; Agnati, Luigi F
2010-10-01
Based on indications of direct physical interactions between neuropeptide and monoamine receptors in the early 1980s, the term receptor-receptor interactions was introduced and later on the term receptor heteromerization in the early 1990s. Allosteric mechanisms allow an integrative activity to emerge either intramolecularly in G protein-coupled receptor (GPCR) monomers or intermolecularly via receptor-receptor interactions in GPCR homodimers, heterodimers, and receptor mosaics. Stable heteromers of Class A receptors may be formed that involve strong high energy arginine-phosphate electrostatic interactions. These receptor-receptor interactions markedly increase the repertoire of GPCR recognition, signaling and trafficking in which the minimal signaling unit in the GPCR homomers appears to be one receptor and one G protein. GPCR homomers and GPCR assemblies are not isolated but also directly interact with other proteins to form horizontal molecular networks at the plasma membrane.
Dong, Lu; Li, Baoman; Verkhratsky, Alexei; Peng, Liang
2015-08-01
Previously, we reported that chronic treatment with fluoxetine increased gene expression of 5-hydroxytryptamine receptor 2B (5-HT2BR), cytosolic phospholipase 2α (cPLA2α), glutamate receptor, ionotropic kainate 2 (GluK2) and adenosine deaminase acting on RNA 2 (ADAR2), in cultured astrocytes and astrocytes freshly isolated from transgenic mice tagged with an astrocyte-specific marker. In contrast, neurones isolated from transgenic mice tagged with a neurone-specific marker and exposed to fluoxetine showed an increase in gene expression of glutamate receptor, ionotropic kainate 4 (GluK4) and 5-hydroxytryptamine receptor 2C (5-HT2CR). In a mouse model of anhedonia, the downregulation of 5-HT2BR, cPLA2α, ADAR2 and GluK4 but not GluK2 and 5-HT2CR was detected. To investigate the effects of chronic mild stress (CMS) and/or fluoxetine treatment on gene expression of 5-HT2BR, 5-HT2CR, cPLA2α, ADAR2, GluK2 and GluK4 specifically in astrocytes and neurones. Transgenic mice tagged with either astrocyte- or neurone-specific markers were exposed to the CMS. Real-time PCR was applied to determine expression of messenger RNA (mRNA). We found that (i) mRNAs of the 5-HT2BR and cPLA2α in astrocytes and GluK4 in neurones were significantly reduced in mice that became anhedonic; the mRNA levels were restored by fluoxetine treatment; (ii) ADAR2 in astrocytes was decreased by the CMS but showed no response to fluoxetine in anhedonic animals; (iii) neither GluK2 expression in astrocytes nor 5-HT2CR expression in neurones were affected in anhedonic animals, although expression of 5-HT2CR mRNA was upregulated by fluoxetine. Our results indicate that the effects of chronic treatment with fluoxetine are not only dependent on the cell type studied but also on the development of anhedonia. This suggests that fluoxetine may affect major depression (MD) patients and healthy people in a different manner.
Protective Effect of Resveratrol on the Brain in a Rat Model of Epilepsy.
Li, Zhen; You, Zhuyan; Li, Min; Pang, Liang; Cheng, Juan; Wang, Liecheng
2017-06-01
Accumulating evidence has suggested resveratrol as a promising drug candidate for the treatment of epilepsy. To validate this, we tested the protective effect of resveratrol on a kainic acid (KA)-induced epilepsy model in rats and investigated the underlying mechanism. We found that acute resveratrol application partially inhibited evoked epileptiform discharges in the hippocampal CA1 region. During acute, silent and chronic phases of epilepsy, the expression of hippocampal kainate glutamate receptor (GluK2) and the GABA A receptor alpha1 subunit (GABA A R-alpha1) was up-regulated and down-regulated, respectively. Resveratrol reversed these effects and induced an antiepileptic effect. Furthermore, in the chronic phase, resveratrol treatment inhibited the KA-induced increased glutamate/GABA ratio in the hippocampus. The antiepileptic effects of resveratrol may be partially attributed to the reduction of glutamate-induced excitotoxicity and the enhancement in GABAergic inhibition.
Dietary Pattern and Plasma BCAA-Variations in Healthy Men and Women-Results from the KarMeN Study.
Merz, Benedikt; Frommherz, Lara; Rist, Manuela J; Kulling, Sabine E; Bub, Achim; Watzl, Bernhard
2018-05-15
Branched-chain amino acids (BCAA) in plasma are discussed as risk factors for the onset of several diseases. Information about the contribution of the overall diet to plasma BCAA concentrations is controversial. Our objective was to investigate which dietary pattern is associated with plasma BCAA concentrations and whether other additional nutrients besides BCAA further characterize this dietary pattern. Based on the cross-sectional KarMeN study, fasting plasma amino acid (AA) concentrations, as well as current and habitual dietary intake were assessed in 298 healthy individuals. Using reduced rank regression, we derived a habitual dietary pattern that explained 32.5% of plasma BCAA variation. This pattern was high in meat, sausages, sauces, eggs, and ice cream but low in nuts, cereals, mushrooms, and pulses. The age, sex, and energy intake adjusted dietary pattern score was associated with an increase in animal-based protein together with a decrease in plant-based protein, dietary fiber, and an unfavorable fatty acid composition. Besides BCAA, alanine, lysine and the aromatic AA were positively associated with the dietary pattern score as well. All of these factors were reported to be associated with risk of type 2 diabetes and cardiovascular diseases before. Our data suggest that rather than the dietary intake of BCAA, the overall dietary pattern that contributes to high BCAA plasma concentrations may modulate chronic diseases risk.
Dietary Pattern and Plasma BCAA-Variations in Healthy Men and Women—Results from the KarMeN Study
Frommherz, Lara; Kulling, Sabine E.
2018-01-01
Branched-chain amino acids (BCAA) in plasma are discussed as risk factors for the onset of several diseases. Information about the contribution of the overall diet to plasma BCAA concentrations is controversial. Our objective was to investigate which dietary pattern is associated with plasma BCAA concentrations and whether other additional nutrients besides BCAA further characterize this dietary pattern. Based on the cross-sectional KarMeN study, fasting plasma amino acid (AA) concentrations, as well as current and habitual dietary intake were assessed in 298 healthy individuals. Using reduced rank regression, we derived a habitual dietary pattern that explained 32.5% of plasma BCAA variation. This pattern was high in meat, sausages, sauces, eggs, and ice cream but low in nuts, cereals, mushrooms, and pulses. The age, sex, and energy intake adjusted dietary pattern score was associated with an increase in animal-based protein together with a decrease in plant-based protein, dietary fiber, and an unfavorable fatty acid composition. Besides BCAA, alanine, lysine and the aromatic AA were positively associated with the dietary pattern score as well. All of these factors were reported to be associated with risk of type 2 diabetes and cardiovascular diseases before. Our data suggest that rather than the dietary intake of BCAA, the overall dietary pattern that contributes to high BCAA plasma concentrations may modulate chronic diseases risk. PMID:29762522
Isobolographic analysis of the mechanisms of action of anticonvulsants from a combination effect.
Matsumura, Nobuko; Nakaki, Toshio
2014-10-15
The nature of the pharmacodynamic interactions of drugs is influenced by the drugs׳ mechanisms of action. It has been hypothesized that drugs with different mechanisms are likely to interact synergistically, whereas those with similar mechanisms seem to produce additive interactions. In this review, we describe an extensive investigation of the published literature on drug combinations of anticonvulsants, the nature of the interaction of which has been evaluated by type I and II isobolographic analyses and the subthreshold method. The molecular targets of antiepileptic drugs (AEDs) include Na(+) and Ca(2+) channels, GABA type-A receptor, and glutamate receptors such as NMDA and AMPA/kainate receptors. The results of this review indicate that the nature of interactions evaluated by type I isobolographic analyses but not by the two other methods seems to be consistent with the above hypothesis. Type I isobolographic analyses may be used not only for evaluating drug combinations but also for predicting the targets of new drugs. Copyright © 2014 Elsevier B.V. All rights reserved.
Distinct roles for key karyogamy proteins during yeast nuclear fusion.
Melloy, Patricia; Shen, Shu; White, Erin; Rose, Mark D
2009-09-01
During yeast mating, cell fusion is followed by the congression and fusion of the two nuclei. Proteins required for nuclear fusion are found at the surface (Prm3p) and within the lumen (Kar2p, Kar5p, and Kar8p) of the nuclear envelope (NE). Electron tomography (ET) of zygotes revealed that mutations in these proteins block nuclear fusion with different morphologies, suggesting that they act in different steps of fusion. Specifically, prm3 zygotes were blocked before formation of membrane bridges, whereas kar2, kar5, and kar8 zygotes frequently contained them. Membrane bridges were significantly larger and occurred more frequently in kar2 and kar8, than in kar5 mutant zygotes. The kinetics of NE fusion in prm3, kar5, and kar8 mutants, measured by live-cell fluorescence microscopy, were well correlated with the size and frequency of bridges observed by ET. However the kar2 mutant was defective for transfer of NE lumenal GFP, but not diffusion within the lumen, suggesting that transfer was blocked at the NE fusion junction. These observations suggest that Prm3p acts before initiation of outer NE fusion, Kar5p may help dilation of the initial fusion pore, and Kar2p and Kar8p act after outer NE fusion, during inner NE fusion.
NASA Astrophysics Data System (ADS)
Audin, L.; Quidelleur, X.; Coulié, E.; Courtillot, V.; Gilder, S.; Manighetti, I.; Gillot, P.-Y.; Tapponnier, P.; Kidane, T.
2004-07-01
A new detailed palaeomagnetic study of Tertiary volcanics, including extensive K-Ar and 40Ar/39Ar dating, helps constrain the deformation mechanisms related to the opening processes of the Afar depression (Ethiopia and Djibouti). Much of the Afar depression is bounded by 30 Myr old flood basalts and floored by the ca 2 Myr old Stratoid basalts, and evidence for pre-2 Ma deformation processes is accessible only on its borders. K-Ar and 40Ar/39Ar dating of several mineral phases from rhyolitic samples from the Ali Sabieh block shows indistinguishable ages around 20 Myr. These ages can be linked to separation of this block in relation to continental breakup. Different amounts of rotation are found to the north and south of the Holhol fault zone, which cuts across the northern part of the Ali Sabieh block. The southern domain did not record any rotation for the last 8 Myr, whereas the northern domain experienced approximately 12 +/- 9° of clockwise rotation. We propose to link this rotation to the counter-clockwise rotation observed in the Danakil block since 7 Ma. This provides new constraints on the early phases of rifting and opening of the southern Afar depression in connection with the propagation of the Aden ridge. A kinematic model of propagation and transfer of extension within southern Afar is proposed, with particular emphasis on the previously poorly-known period from 10 to 4 Ma.
Daiyasu, Hiromi; Nemoto, Wataru; Toh, Hiroyuki
2012-01-01
Chemokine receptors (CKRs) function in the inflammatory response and in vertebrate homeostasis. Decoy and viral receptors are two types of CKR homologs with modified functions from those of the typical CKRs. The decoy receptors are able to bind ligands without signaling. On the other hand, the viral receptors show constitutive signaling without ligands. We examined the sites related to the functional difference. At first, the decoy and viral receptors were each classified into five groups, based on the molecular phylogenetic analysis. A multiple amino acid sequence alignment between each group and the CKRs was then constructed. The difference in the amino acid composition between the group and the CKRs was evaluated as the Kullback–Leibler (KL) information value at each alignment site. The KL information value is considered to reflect the difference in the functional constraints at the site. The sites with the top 5% of KL information values were selected and mapped on the structure of a CKR. The comparisons with decoy receptor groups revealed that the detected sites were biased on the intracellular side. In contrast, the sites detected from the comparisons with viral receptor groups were found on both the extracellular and intracellular sides. More sites were found in the ligand binding pocket in the analyses of the viral receptor groups, as compared to the decoy receptor groups. Some of the detected sites were located in the GPCR motifs. For example, the DRY motif of the decoy receptors was often degraded, although the motif of the viral receptors was basically conserved. The observations for the viral receptor groups suggested that the constraints in the pocket region are loose and that the sites on the intracellular side are different from those for the decoy receptors, which may be related to the constitutive signaling activity of the viral receptors. PMID:22855685
Daiyasu, Hiromi; Nemoto, Wataru; Toh, Hiroyuki
2012-01-01
Chemokine receptors (CKRs) function in the inflammatory response and in vertebrate homeostasis. Decoy and viral receptors are two types of CKR homologs with modified functions from those of the typical CKRs. The decoy receptors are able to bind ligands without signaling. On the other hand, the viral receptors show constitutive signaling without ligands. We examined the sites related to the functional difference. At first, the decoy and viral receptors were each classified into five groups, based on the molecular phylogenetic analysis. A multiple amino acid sequence alignment between each group and the CKRs was then constructed. The difference in the amino acid composition between the group and the CKRs was evaluated as the Kullback-Leibler (KL) information value at each alignment site. The KL information value is considered to reflect the difference in the functional constraints at the site. The sites with the top 5% of KL information values were selected and mapped on the structure of a CKR. The comparisons with decoy receptor groups revealed that the detected sites were biased on the intracellular side. In contrast, the sites detected from the comparisons with viral receptor groups were found on both the extracellular and intracellular sides. More sites were found in the ligand binding pocket in the analyses of the viral receptor groups, as compared to the decoy receptor groups. Some of the detected sites were located in the GPCR motifs. For example, the DRY motif of the decoy receptors was often degraded, although the motif of the viral receptors was basically conserved. The observations for the viral receptor groups suggested that the constraints in the pocket region are loose and that the sites on the intracellular side are different from those for the decoy receptors, which may be related to the constitutive signaling activity of the viral receptors.
Lulli, Matteo; Witort, Ewa; Papucci, Laura; Torre, Eugenio; Schipani, Christian; Bergamini, Christian; Dal Monte, Massimo; Capaccioli, Sergio
2012-12-17
To evaluate if coenzyme Q10 (CoQ10) can protect retinal ganglion cells (RGCs) from apoptosis and, when instilled as eye drops on the cornea, if it can reach the retina and exert its antiapoptotic activity in this area in a mouse model of kainate (KA)-induced retinal damage. Rat primary or cultured RGCs were subjected to glutamate (50 μM) or chemical hypoxia (Antimycin A, 200 μM) or serum withdrawal (FBS, 0.5%) in the presence or absence of CoQ10 (10 μM). Cell viability was evaluated by light microscopy and fluorescence-activated cell sorting analyses. Apoptosis was evaluated by caspase 3/7 activity and mitochondrion depolarization tetramethylrhodamine ethyl ester analysis. CoQ10 transfer to the retina following its instillation as eye drops on the cornea was quantified by HPLC. Retinal protection by CoQ10 (10 μM) eye drops instilled on the cornea was then evaluated in a mouse model of KA-induced excitotoxic retinal cell apoptosis by cleaved caspase 3 immunohistofluorescence, caspase 3/7 activity assays, and quantification of inhibition of RGC loss. CoQ10 significantly increased viable cells by preventing RGC apoptosis. Furthermore, when topically applied as eye drops to the cornea, it reached the retina, thus substantially increasing local CoQ10 concentration and protecting retinal layers from apoptosis. The ability of CoQ10 eye drops to protect retinal cells from apoptosis in the mouse model of KA-induced retinal damage suggests that topical CoQ10 may be evaluated in designing therapies for treating apoptosis-driven retinopathies.
Kumamoto, E
1996-12-01
Excitatory amino-acid currents in rodent central neurones are mediated by the activation of glutamate receptors. Ionotropic types of the receptors are divided into alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA), kainate and N-methyl-D-aspartate (NMDA) receptors, and the former two are collectively called non-NMDA receptors. The NMDA receptor is modulated by a number of endogenous neuromodulators including Mg2+, polyamines, glycine and protons in extracellular solutions. Although it has been generally thought that each of the neuromodulators acts on a distinct site in the NMDA receptor, recent studies have revealed that these actions may be not necessarily independent of each other. The NMDA receptor response is not only inhibited but also potentiated by Mg2+, and the latter action is due to an interaction of a Mg2+ site with either glycine- or proton-binding site. In the presence of polyamines, a tonic inhibition by protons of the NMDA receptor response is relieved, resulting in a potentiation of the response. Alternatively, it has been recently revealed that there are some subtypes of non-NMDA receptors which are negatively modulated by polyamines in either extra- or intra cellular solutions. The difference in polyamine sensitivity among non-NMDA receptors is attributed to a distinction in their constituted subunits. The inhibition of non-NMDA receptor by intracellular polyamines results in inward rectification of the current-voltage relation which is not seen for polyamine-insensitive ones. This polyamine action is not mimicked by intracellular Mg2+.
2013-01-01
Proteinase-activated receptors (PARs) are a subfamily of G protein-coupled receptors (GPCRs) with four members, PAR1, PAR2, PAR3 and PAR4, playing critical functions in hemostasis, thrombosis, embryonic development, wound healing, inflammation and cancer progression. PARs are characterized by a unique activation mechanism involving receptor cleavage by different proteinases at specific sites within the extracellular amino-terminus and the exposure of amino-terminal “tethered ligand“ domains that bind to and activate the cleaved receptors. After activation, the PAR family members are able to stimulate complex intracellular signalling networks via classical G protein-mediated pathways and beta-arrestin signalling. In addition, different receptor crosstalk mechanisms critically contribute to a high diversity of PAR signal transduction and receptor-trafficking processes that result in multiple physiological effects. In this review, we summarize current information about PAR-initiated physical and functional receptor interactions and their physiological and pathological roles. We focus especially on PAR homo- and heterodimerization, transactivation of receptor tyrosine kinases (RTKs) and receptor serine/threonine kinases (RSTKs), communication with other GPCRs, toll-like receptors and NOD-like receptors, ion channel receptors, and on PAR association with cargo receptors. In addition, we discuss the suitability of these receptor interaction mechanisms as targets for modulating PAR signalling in disease. PMID:24215724
Liu, H; Cao, Y; Basbaum, A I; Mazarati, A M; Sankar, R; Wasterlain, C G
1999-10-12
Epileptic seizures are associated with increases in hippocampal excitability, but the mechanisms that render the hippocampus hyperexcitable chronically (in epilepsy) or acutely (in status epilepticus) are poorly understood. Recent evidence suggests that substance P (SP), a peptide that has been implicated in cardiovascular function, inflammatory responses, and nociception, also contributes to hippocampal excitability and status epilepticus, in part by enhancing glutamate release. Here we report that mice with disruption of the preprotachykinin A gene, which encodes SP and neurokinin A, are resistant to kainate excitoxicity. The mice show a reduction in the duration and severity of seizures induced by kainate or pentylenetetrazole, and both necrosis and apoptosis of hippocampal neurons are prevented. Although kainate induced the expression of bax and caspase 3 in the hippocampus of wild-type mice, these critical intracellular mediators of cell death pathways were not altered by kainate injection in the mutant mice. These results indicate that the reduction of seizure activity and the neuroprotection observed in preprotachykinin A null mice are caused by the extinction of a SP/neurokinin A-mediated signaling pathway that is activated by seizures. They suggest that these neurokinins are critical to the control of hippocampal excitability, hippocampal seizures, and hippocampal vulnerability.
Scaffidi, Adrian; Waters, Mark T; Sun, Yueming K; Skelton, Brian W; Dixon, Kingsley W; Ghisalberti, Emilio L; Flematti, Gavin R; Smith, Steven M
2014-07-01
Two α/β-fold hydrolases, KARRIKIN INSENSITIVE2 (KAI2) and Arabidopsis thaliana DWARF14 (AtD14), are necessary for responses to karrikins (KARs) and strigolactones (SLs) in Arabidopsis (Arabidopsis thaliana). Although KAI2 mediates responses to KARs and some SL analogs, AtD14 mediates SL but not KAR responses. To further determine the specificity of these proteins, we assessed the ability of naturally occurring deoxystrigolactones to inhibit Arabidopsis hypocotyl elongation, regulate seedling gene expression, suppress outgrowth of secondary inflorescences, and promote seed germination. Neither 5-deoxystrigol nor 4-deoxyorobanchol was active in KAI2-dependent seed germination or hypocotyl elongation, but both were active in AtD14-dependent hypocotyl elongation and secondary shoot growth. However, the nonnatural enantiomer of 5-deoxystrigol was active through KAI2 in growth and gene expression assays. We found that the four stereoisomers of the SL analog GR24 had similar activities to their deoxystrigolactone counterparts. The results suggest that AtD14 and KAI2 exhibit selectivity to the butenolide D ring in the 2'R and 2'S configurations, respectively. However, we found, for nitrile-debranone (CN-debranone, a simple SL analog), that the 2'R configuration is inactive but that the 2'S configuration is active through both AtD14 and KAI2. Our results support the conclusion that KAI2-dependent signaling does not respond to canonical SLs. Furthermore, racemic mixtures of chemically synthesized SLs and their analogs, such as GR24, should be used with caution because they can activate responses that are not specific to naturally occurring SLs. In contrast, the use of specific stereoisomers might provide valuable information about the specific perception systems operating in different plant tissues, parasitic weed seeds, and arbuscular mycorrhizae. © 2014 American Society of Plant Biologists. All Rights Reserved.
Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena
2013-06-01
In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.
Estrogen-related receptor β (ERRβ) – renaissance receptor or receptor renaissance?
Divekar, Shailaja D.; Tiek, Deanna M.; Fernandez, Aileen; Riggins, Rebecca B.
2016-01-01
Estrogen-related receptors (ERRs) are founding members of the orphan nuclear receptor (ONR) subgroup of the nuclear receptor superfamily. Twenty-seven years of study have yet to identify cognate ligands for the ERRs, though they have firmly placed ERRα and ERRγ at the intersection of cellular metabolism and oncogenesis. The pace of discovery for novel functions of ERRβ, however, has until recently been somewhat slower than that of its family members. ERRβ has also been largely ignored in summaries and perspectives of the ONR literature. Here, we provide an overview of established and emerging knowledge of ERRβ in mouse, man, and other species, highlighting unique aspects of ERRβ biology that set it apart from the other two estrogen-related receptors, with a focus on the impact of alternative splicing on the structure and function of this receptor. PMID:27507929
CGRP Receptor Biology: Is There More Than One Receptor?
Hay, Debbie L
2018-05-25
Calcitonin gene-related peptide (CGRP) has many reported pharmacological actions. Can a single receptor explain all of these? This chapter outlines the molecular nature of reported CGRP binding proteins and their pharmacology. Consideration of whether CGRP has only one or has more receptors is important because of the key role that this peptide plays in migraine. It is widely thought that the calcitonin receptor-like receptor together with receptor activity-modifying protein 1 (RAMP1) is the only relevant receptor for CGRP. However, some closely related receptors also have high affinity for CGRP and it is still plausible that these play a role in CGRP biology, and in migraine. The calcitonin receptor/RAMP1 complex, which is currently called the AMY 1 receptor, seems to be the most likely candidate but more investigation is needed to determine its role.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kahn, C.R.; Harrison, L.C.
1988-01-01
This book contains the procedure in insulin receptors. Part B: Clinical assessment, biological responses, and comparison to the IGF-1 receptor. Topics covered include: Insulin and IGF-1 receptors, Clinical assessment of receptor functions, and Biological responses.
Effect of lanthanum on rooting of in vitro regenerated shoots of Saussurea involucrata Kar. et Kir.
Guo, Bin; Xu, Ling-Ling; Guan, Zhen-Jun; Wei, Ya-Hui
2012-06-01
In present study, the effect of lanthanum (La) on the rooting of regenerated shoots of Saussurea involucrata Kar. et Kir was analyzed. Rooting occurred from regenerated shoots inoculated on a medium supplemented with La, the plant rooting hormone indole-3-acetic acid (IAA), or both La and IAA together. The highest rooting efficiency (96%), root number/shoot (8.5), and root length (63 mm) were recorded in shoots cultured on medium containing 2.5 μM IAA combined with 100 μM La(3+). In order to elucidate the mechanism of rooting enhancement by La, we examined dynamic changes in antioxidant enzyme activities in plant tissue over time in culture. We found that the activities of peroxidase (POX) and superoxide dismutase (SOD) were significantly higher in plant tissue cultured in IAA plus La than in La or IAA alone. At the same time, the highest H(2)O(2) content was detected in plant tissue in the presence of 2.5 μM IAA plus 100 μM La(3+). In light of these data and previous results, we speculate that La enhanced IAA-induced rooting by acting as a mild abiotic stress to stimulate POX and SOD activities in plant cells. Then, IAA reacted with oxygen and POX to form the ternary complex enzyme-IAA-O(2) that dissociated into IAA radicals and O(2)(-). Subsequently, IAA-induced O(2)(-) readily converted to hydroxyl radical (HO·) via SOD-catalyzed dismutation. Finally, cell wall loosening and cell elongation occurred as a consequence of HO-dependent scission of wall components, leading to root growth. The treatment of IAA combined with La resulted in the highest plantlet survival (80%) compared to single treatments with IAA or La alone. These data suggest that rare earth elements enhance root morphogenesis and the growth of S. involucrata.
Veeraraghavan, Priyadharishini; Dekanic, Ana; Nistri, Andrea
2016-10-01
Endocannabinoids acting on cannabinoid-1 receptors (CB1Rs) are proposed to protect brain and spinal neurons from excitotoxic damage. The ability to recover from spinal cord injury (SCI), in which excitotoxicity is a major player, is usually investigated at late times after modulation of CB1Rs whose role in the early phases of SCI remains unclear. Using the rat spinal cord in vitro as a model for studying SCI initial pathophysiology, we investigated if agonists or antagonists of CB1Rs might affect SCI induced by the excitotoxic agent kainate (KA) within 24h from a transient (1h) application of this glutamate agonist. The CB1 agonist anandamide (AEA or pharmacological block of its degradation) did not limit excitotoxic depolarization of spinal networks: cyclic adenosine monophosphate (cAMP) assay demonstrated that CB1Rs remained functional 24h later and similarly expressed among dead or survived cells. Locomotor-like network activity recorded from ventral roots could not recover with such treatments and was associated with persistent depression of synaptic transmission. Motoneurons, that are particularly vulnerable to KA, were not protected by AEA. Application of 2-arachidonoylglycerol also did not attenuate the electrophysiological and histological damage. The intensification of damage by the CB1 antagonist AM251 suggested that endocannabinoids were operative after excitotoxic stimulation, yet insufficient to contrast it efficiently. The present data indicate that the early phases of excitotoxic SCI could not be arrested by pharmacologically exploiting the endocannabinoid system, consistent with the notion that AEA and its derivatives are more useful to treat late SCI phases. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Baggio, Cristiane Hatsuko; Freitas, Cristina Setim; Martins, Daniel Fernandes; Mazzardo, Leidiane; Smiderle, Fhernanda Ribeiro; Sassaki, Guilherme Lanzi; Iacomini, Marcello; Marques, Maria Consuelo Andrade; Santos, Adair Roberto Soares
2010-10-01
The present study evaluated the antinociceptive effect of (1→3),(1→6)-linked β-glucan (GL) isolated from Pleurotus pulmonarius (Fr.) Quel. in mice and its possible mechanism of action. Intraperitoneal administration of GL inhibited glutamate-induced licking with an ID(50) of 0.34 mg/kg and inhibition of 96% ± 3%. The treatment of animals with GL (1 mg/kg i.p.) inhibited nociception induced by intrathecal injection of N-methyl-D-aspartic acid, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate and interleukin -1β in 67% ± 13%, 89% ± 11%, 74% ± 9%, and 75% ± 7%, respectively, but not the nociceptive response induced by (±)-1-aminocyclopentane-trans-1,3-dicarboxylic acid, substance P, and tumor necrosis factor-α. Moreover, GL (30 mg/kg i.p.) also reduced mechanical allodynia caused by partial sciatic nerve ligation for 2 hours, with inhibition of 47% ± 10% observed 0.5 hours after treatment. When given chronically (twice a day) over 7 days, GL reversed the mechanical allodynia caused by partial sciatic nerve ligation (inhibition of 45% ± 13% to 60% ± 8%). Interestingly, GL did not affect the locomotor activity of mice in an open field test with doses that produce antinociceptive effects. Our findings show that GL inhibits acute and neuropathic pain in mice through mechanisms that involve the inhibition of ionotropic glutamate receptors and the interleukin -1β pathway. This article presents the antinociceptive activity of GL in acute and neuropathic pain with participation of ionotropic glutamate receptors and pro-inflammatory cytokines (interleukin-1β). After further experiments, this compound may represent a new pharmacological agent for the treatment of clinical pain. Copyright © 2010 American Pain Society. Published by Elsevier Inc. All rights reserved.
Long, Rowena L.; Stevens, Jason C.; Griffiths, Erin M.; Adamek, Markus; Gorecki, Marta J.; Powles, Stephen B.; Merritt, David J.
2011-01-01
Background and Aims Karrikinolide (KAR1) is a smoke-derived chemical that can trigger seeds to germinate. A potential application for KAR1 is for synchronizing the germination of weed seeds, thereby enhancing the efficiency of weed control efforts. Yet not all species germinate readily with KAR1, and it is not known whether seemingly non-responsive species can be induced to respond. Here a major agronomic weed family, the Brassicaceae, is used to test the hypothesis that a stimulatory response to KAR1 may be present in physiologically dormant seeds but may not be expressed under all circumstances. Methods Seeds of eight Brassicaceae weed species (Brassica tournefortii, Raphanus raphanistrum, Sisymbrium orientale, S. erysimoides, Rapistrum rugosum, Lepidium africanum, Heliophila pusilla and Carrichtera annua) were tested for their response to 1 µm KAR1 when freshly collected and following simulated and natural dormancy alleviation, which included wet–dry cycling, dry after-ripening, cold and warm stratification and a 2 year seed burial trial. Key Results Seven of the eight Brassicaceae species tested were stimulated to germinate with KAR1 when the seeds were fresh, and the remaining species became responsive to KAR1 following wet–dry cycling and dry after-ripening. Light influenced the germination response of seeds to KAR1, with the majority of species germinating better in darkness. Germination with and without KAR1 fluctuated seasonally throughout the seed burial trial. Conclusions KAR1 responses are more complex than simply stating whether a species is responsive or non-responsive; light and temperature conditions, dormancy state and seed lot all influence the sensitivity of seeds to KAR1, and a response to KAR1 can be induced. Three response types for generalizing KAR1 responses are proposed, namely inherent, inducible and undetected. Given that responses to KAR1 were either inherent or inducible in all 15 seed lots included in this study, the Brassicaceae
Long, Rowena L; Stevens, Jason C; Griffiths, Erin M; Adamek, Markus; Gorecki, Marta J; Powles, Stephen B; Merritt, David J
2011-10-01
Karrikinolide (KAR(1)) is a smoke-derived chemical that can trigger seeds to germinate. A potential application for KAR(1) is for synchronizing the germination of weed seeds, thereby enhancing the efficiency of weed control efforts. Yet not all species germinate readily with KAR(1), and it is not known whether seemingly non-responsive species can be induced to respond. Here a major agronomic weed family, the Brassicaceae, is used to test the hypothesis that a stimulatory response to KAR(1) may be present in physiologically dormant seeds but may not be expressed under all circumstances. Seeds of eight Brassicaceae weed species (Brassica tournefortii, Raphanus raphanistrum, Sisymbrium orientale, S. erysimoides, Rapistrum rugosum, Lepidium africanum, Heliophila pusilla and Carrichtera annua) were tested for their response to 1 µm KAR(1) when freshly collected and following simulated and natural dormancy alleviation, which included wet-dry cycling, dry after-ripening, cold and warm stratification and a 2 year seed burial trial. Seven of the eight Brassicaceae species tested were stimulated to germinate with KAR(1) when the seeds were fresh, and the remaining species became responsive to KAR(1) following wet-dry cycling and dry after-ripening. Light influenced the germination response of seeds to KAR(1), with the majority of species germinating better in darkness. Germination with and without KAR(1) fluctuated seasonally throughout the seed burial trial. KAR(1) responses are more complex than simply stating whether a species is responsive or non-responsive; light and temperature conditions, dormancy state and seed lot all influence the sensitivity of seeds to KAR(1), and a response to KAR(1) can be induced. Three response types for generalizing KAR(1) responses are proposed, namely inherent, inducible and undetected. Given that responses to KAR(1) were either inherent or inducible in all 15 seed lots included in this study, the Brassicaceae may be an ideal target for
Immunocytochemical localization of the NMDA-R2A receptor subunit in the cat retina.
Goebel, D J; Aurelia, J L; Tai, Q; Jojich, L; Poosch, M S
1998-10-19
+, Brain Res. 664 (1994) 252-256; G.D. Zeevalk, W.J. Nicklas, Action of the anti-ischemic agent ifenprodil on N-methyl-d-aspartate and kainate-mediated excitotoxicity, Brain Res. 522 (1990) 135-139; R. Huba, H.D. Hofmann, Transmitter-gated currents of GABAergic amacrine-like cells in chick retinal cultures, Vis. Neurosci. 6 (1991) 303-314; M. Yamashita, R. Huba, H.D. Hofmann, Early in vitro development of voltage- and transmitter-gated currents in GABAergic amacrine cells, Dev. Brain Res. 82 (1994) 95-102; R. Ientile, S. Pedale, V. Picciurro, V. Macaione, C. Fabiano, S. Macaione, Nitric oxide mediates NMDA-evoked [3H]GABA release from chick retina cells, FEBS Lett. 417 (1997) 345-348; R.C. Kubrusly, M.C. deMello, F.G. deMello, Aspartate as a selective NMDA agonist in cultured cells from the avian retina, Neurochem. Intl. 32 (1998) 47-52] or reduction of GABA in vivo [N.N. Osborn, A.J. Herrera, The effect of experimental ischaemia and excitatory amino acid agonist on the GABA and serotonin immunoreactivities in the rabbit retina, Neurosci. 59 (1994) 1071-1081]. Since the majority of GABAergic synapses in the inner retina are onto both rod and cone bipolar axon terminals [R.G. Pourcho, M.T. Owzcarzak, Distribution of GABA immunoreactivity in the cat retina: A light and electron-microscopic study, Vis. Neurosci. 2 (1989) 425-435], we hypothesize that the NMDA-receptor plays a crucial role in providing feedback inhibition onto rod and cone bipolar cells. Copyright 1998 Elsevier Science B.V.
Scaffidi, Adrian; Waters, Mark T.; Sun, Yueming K.; Skelton, Brian W.; Dixon, Kingsley W.; Ghisalberti, Emilio L.; Flematti, Gavin R.; Smith, Steven M.
2014-01-01
Two α/β-fold hydrolases, KARRIKIN INSENSITIVE2 (KAI2) and Arabidopsis thaliana DWARF14 (AtD14), are necessary for responses to karrikins (KARs) and strigolactones (SLs) in Arabidopsis (Arabidopsis thaliana). Although KAI2 mediates responses to KARs and some SL analogs, AtD14 mediates SL but not KAR responses. To further determine the specificity of these proteins, we assessed the ability of naturally occurring deoxystrigolactones to inhibit Arabidopsis hypocotyl elongation, regulate seedling gene expression, suppress outgrowth of secondary inflorescences, and promote seed germination. Neither 5-deoxystrigol nor 4-deoxyorobanchol was active in KAI2-dependent seed germination or hypocotyl elongation, but both were active in AtD14-dependent hypocotyl elongation and secondary shoot growth. However, the nonnatural enantiomer of 5-deoxystrigol was active through KAI2 in growth and gene expression assays. We found that the four stereoisomers of the SL analog GR24 had similar activities to their deoxystrigolactone counterparts. The results suggest that AtD14 and KAI2 exhibit selectivity to the butenolide D ring in the 2′R and 2′S configurations, respectively. However, we found, for nitrile-debranone (CN-debranone, a simple SL analog), that the 2′R configuration is inactive but that the 2′S configuration is active through both AtD14 and KAI2. Our results support the conclusion that KAI2-dependent signaling does not respond to canonical SLs. Furthermore, racemic mixtures of chemically synthesized SLs and their analogs, such as GR24, should be used with caution because they can activate responses that are not specific to naturally occurring SLs. In contrast, the use of specific stereoisomers might provide valuable information about the specific perception systems operating in different plant tissues, parasitic weed seeds, and arbuscular mycorrhizae. PMID:24808100
Baude, A; Nusser, Z; Molnár, E; McIlhinney, R A; Somogyi, P
1995-12-01
The cellular and subcellular localization of the GluRA, GluRB/C and GluRD subunits of the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) type glutamate receptor was determined in the rat hippocampus using polyclonal antipeptide antibodies in immunoperoxidase and immunogold procedures. For the localization of the GluRD subunit a new polyclonal antiserum was developed using the C-terminal sequence of the protein (residues 869-881), conjugated to carrier protein and absorbed to colloidal gold for immunization. The purified antibodies immunoprecipitated about 25% of 3[H]AMPA binding activity from the hippocampus, cerebellum or whole brain, but very little from neocortex. These antibodies did not precipitate a significant amount of 3[H]kainate binding activity. The antibodies also recognize the GluRD subunit, but not the other AMPA receptor subunits, when expressed in transfected COS-7 cells and only when permeabilized with detergent, indicating an intracellular epitope. All subunits were enriched in the neuropil of the dendritic layers of the hippocampus and in the molecular layer of the dentate gyrus. The cellular distribution of the GluRD subunit was studied more extensively. The strata radiatum, oriens and the dentate molecular layer were more strongly immunoreactive than the stratum lacunosum moleculare, the stratum lucidum and the hilus. However, in the stratum lucidum of the CA3 area and in the hilus the weakly reacting dendrites were surrounded by immunopositive rosettes, shown in subsequent electron microscopic studies to correspond to complex dendritic spines. In the stratum radiatum, the weakly reacting apical dendrites contrasted with the surrounding intensely stained neuropil. The cell bodies of pyramidal and granule cells were moderately reactive. Some non-principal cells and their dendrites in the pyramidal cell layer and in the alveus also reacted very strongly for the GluRD subunit. At the subcellular level, silver intensified immunogold
Probing receptor structure/function with chimeric G-protein-coupled receptors.
Yin, Dezhong; Gavi, Shai; Wang, Hsien-yu; Malbon, Craig C
2004-06-01
Owing its name to an image borrowed from Greek mythology, a chimera is seen to represent a new entity created as a composite from existing creatures or, in this case, molecules. Making use of various combinations of three basic domains of the receptors (i.e., exofacial, transmembrane, and cytoplasmic segments) that couple agonist binding into activation of effectors through heterotrimeric G-proteins, molecular pharmacology has probed the basic organization, structure/function relationships of this superfamily of heptahelical receptors. Chimeric G-protein-coupled receptors obviate the need for a particular agonist ligand when the ligand is resistant to purification or, in the case of orphan receptors, is not known. Chimeric receptors created from distant members of the heptahelical receptors enable new strategies in understanding how these receptors transduce agonist binding into receptor activation and may be able to offer insights into the evolution of G-protein-coupled receptors from yeast to humans.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arney, B.; Goff, F.; Eddy, A.C.
1985-04-01
As part of a reconnaissance mapping project, 40 chemical analyses and 13 potassium-argon age dates were obtained for Tertiary volcanic and Precambrian granitic rocks between Kingman and Bill Williams Mountain, Arizona. The dated volcanic rocks range in age from 5.5 +- 0.2 Myr for basalt in the East Juniper Mountains to about 25 Myr for a biotite-pyroxene andesite. The date for Picacho Butte, a rhyodacite in the Mt. Floyd volcanic field, was 9.8 +- 0.07 Myr, making it the oldest rhyodacite dome in that volcanic field. Dated rocks in the Fort Rock area range from 20.7 to 24.3 Myr. Nomore » ages were obtained on the Precambrian rocks. Compositionally, the volcanic rocks analyzed range from alkali basalt to rhyolite, but many rocks on the western side of the map area are unusually potassic. The granites chosen for analysis include syenogranite from the Hualapai Mountains, a muscovite granite from the Picacho Butte area, and two other granites. The chemical and K-Ar age data and petrographic descriptions included in this report accompany the reconnaissance geologic strip map published as LA-9202-MAP by Goff, Eddy, and Arney. 9 refs., 4 figs., 2 tabs.« less
Strigolactones Inhibit Caulonema Elongation and Cell Division in the Moss Physcomitrella patens
Hoffmann, Beate; Proust, Hélène; Belcram, Katia; Labrune, Cécile; Boyer, François-Didier; Rameau, Catherine; Bonhomme, Sandrine
2014-01-01
In vascular plants, strigolactones (SLs) are known for their hormonal role and for their role as signal molecules in the rhizosphere. SLs are also produced by the moss Physcomitrella patens, in which they act as signaling factors for controlling filament extension and possibly interaction with neighboring individuals. To gain a better understanding of SL action at the cellular level, we investigated the effect of exogenously added molecules (SLs or analogs) in moss growth media. We used the previously characterized Ppccd8 mutant that is deficient in SL synthesis and showed that SLs affect moss protonema extension by reducing caulonema cell elongation and mainly cell division rate, both in light and dark conditions. Based on this effect, we set up bioassays to examine chemical structure requirements for SL activity in moss. The results suggest that compounds GR24, GR5, and 5-deoxystrigol are active in moss (as in pea), while other analogs that are highly active in the control of pea branching show little activity in moss. Interestingly, the karrikinolide KAR1, which shares molecular features with SLs, did not have any effect on filament growth, even though the moss genome contains several genes homologous to KAI2 (encoding the KAR1 receptor) and no canonical homologue to D14 (encoding the SL receptor). Further studies should investigate whether SL signaling pathways have been conserved during land plant evolution. PMID:24911649
The interleukin-4 receptor: signal transduction by a hematopoietin receptor.
Keegan, A D; Pierce, J H
1994-02-01
Over the last several years, the receptors for numerous cytokines have been molecularly characterized. Analysis of their amino acid sequences shows that some of these receptors bear certain motifs in their extracellular domains that define a family of receptors called the Hematopoietin receptor superfamily. Significant advances in characterizing the structure, function, and mechanisms of signal transduction have been made for several members of this family. The purpose of this review is to discuss the recent advances made for one of the family members, the interleukin (IL) 4 receptor. Other receptor systems have recently been reviewed elsewhere. The IL-4 receptor consists of, at the minimum, the cloned 140 kDa IL-4-binding chain with the potential for associating with other chains. The IL-4 receptor transduces its signal by activating a tyrosine kinase that phosphorylates cellular substrates, including the receptor itself, and the 170 kDa substrate called 4PS. Phosphorylated 4PS interacts with the SH2 domain of the enzyme PI-3'-kinase and increases its enzymatic activity. These early events in the IL-4 receptor initiated signaling pathway may trigger a series of signals that will ultimately lead to an IL-4 specific biologic outcome.
Meng, Yongjie; Shuai, Haiwei; Luo, Xiaofeng; Chen, Feng; Zhou, Wenguan; Yang, Wenyu; Shu, Kai
2017-01-01
Seed germination and early seedling establishment are critical stages during a plant’s life cycle. These stages are precisely regulated by multiple internal factors, including phytohormones and environmental cues such as light. As a family of small molecules discovered in wildfire smoke, karrikins (KARs) play a key role in various biological processes, including seed dormancy release, germination regulation, and seedling establishment. KARs show a high similarity with strigolactone (SL) in both chemical structure and signaling transduction pathways. Current evidence shows that KARs may regulate seed germination by mediating the biosynthesis and/or signaling transduction of abscisic acid (ABA), gibberellin (GA) and auxin [indoleacetic acid (IAA)]. Interestingly, KARs regulate seed germination differently in different species. Furthermore, the promotion effect on seedling establishment implies that KARs have a great potential application in alleviating shade avoidance response, which attracts more and more attention in plant molecular biology. In these processes, KARs may have complicated interactions with phytohormones, especially with IAA. In this updated review, we summarize the current understanding of the relationship between KARs and SL in the chemical structure, signaling pathway and the regulation of plant growth and development. Further, the crosstalk between KARs and phytohormones in regulating seed germination and seedling development and that between KARs and IAA during shade responses are discussed. Finally, future challenges and research directions for the KAR research field are suggested. PMID:28174573
Goldstein, Joseph L; Brown, Michael S
2009-04-01
In this article, the history of the LDL receptor is recounted by its codiscoverers. Their early work on the LDL receptor explained a genetic cause of heart attacks and led to new ways of thinking about cholesterol metabolism. The LDL receptor discovery also introduced three general concepts to cell biology: receptor-mediated endocytosis, receptor recycling, and feedback regulation of receptors. The latter concept provides the mechanism by which statins selectively lower plasma LDL, reducing heart attacks and prolonging life.
Thussagunpanit, Jutiporn; Nagai, Yuko; Nagae, Miyu; Mashiguchi, Kiyoshi; Mitsuda, Nobutaka; Ohme-Takagi, Masaru; Nakano, Takeshi; Nakamura, Hidemitsu; Asami, Tadao
2017-02-01
Strigolactones (SLs) and karrikins (KARs) regulate photomorphogenesis. GR24, a synthetic SL and KAR 1 , a KAR, inhibit the hypocotyl elongation of Arabidopsis thaliana in a weak light. GR24 and KAR 1 up-regulate the expression of STH7, encoding a transcription factor belonging to the double B-box zinc finger subfamily. In this study, we used STH7-overexpressing (STH7ox) lines and functionally defective STH7 (STH7-SRDX) mutants to investigate roles of SLs and KARs in photomorphogenesis of Arabidopsis. Hypocotyl elongation of STH7-SRDX mutants was less sensitive to both GR24 and KAR 1 treatment than that of wild-type Arabidopsis under weak light conditions. Furthermore, the chlorophyll and anthocyanin content was increased in STH7ox lines when de-etiolated with light and GR24-treated plants had enhanced anthocyanin production. GR24 and KAR 1 treatment significantly increased the expression level of photosynthesis-related genes LHCB1 and rbcS. The results strongly suggest that SL and KAR induce photomorphogenesis of Arabidopsis in an STH7-dependent manner.
Donnelly-Roberts, Diana; McGaraughty, Steve; Shieh, Char-Chang; Honore, Prisca; Jarvis, Michael F
2008-02-01
Multiple P2 receptor-mediated mechanisms exist by which ATP can alter nociceptive sensitivity following tissue injury. Evidence from a variety of experimental strategies, including genetic disruption studies and the development of selective antagonists, has indicated that the activation of P2X receptor subtypes, including P2X(3), P2X(2/3), P2X(4) and P2X(7), and P2Y (e.g., P2Y(2)) receptors, can modulate pain. For example, administration of a selective P2X(3) antagonist, A-317491, has been shown to effectively block both hyperalgesia and allodynia in different animal models of pathological pain. Intrathecally delivered antisense oligonucleotides targeting P2X(4) receptors decrease tactile allodynia following nerve injury. Selective antagonists for the P2X(7) receptor also reduce sensitization in animal models of inflammatory and neuropathic pain, providing evidence that purinergic glial-neural interactions are important modulators of noxious sensory neurotransmission. Furthermore, activation of P2Y(2) receptors leads to sensitization of polymodal transient receptor potential-1 receptors. Thus, ATP acting at multiple purinergic receptors, either directly on neurons (e.g., P2X(3), P2X(2/3), and P2Y receptors) or indirectly through neural-glial cell interactions (P2X(4) and P2X(7) receptors), alters nociceptive sensitivity. The development of selective antagonists for some of these P2 receptors has greatly aided investigations into the nociceptive role of ATP. This perspective highlights some of the recent advances to identify selective P2 receptor ligands, which has enhanced the investigation of ATP-related modulation of pain sensitivity.
Kaplan, S A
1984-03-01
Cells are endowed with specific cognitive molecules that function as receptors for hormones, neurotransmitters, and other intercellular messengers. The receptor molecules may be present in the plasma membrane, cytoplasm, or nucleus. When occupied by the messenger, the receptor is coupled to the cellular machinery that responds to the message-bearing molecules. For some hormones the events following attachment of the messenger to the receptor are well known. An example is the generation of cAMP after combination of glucagon with its receptor and the series of steps culminating in activation of phosphorylase. In the case of many other messengers, including insulin, the nature of these coupling steps is not known. Receptors are subject to the regulatory processes of synthesis, degradation, and conformational change; alterations in receptor properties may have significant effects on the qualitative and quantitative responses of the cell to the extracellular messenger. The insulin receptor is located in the plasma membrane, is composed of two pairs of subunits, and has a molecular weight of about 350,000. It is located in cells such as adipocytes, hepatocytes, and skeletal muscle cells as well as in cells not considered to be typical target organ cells. Insulin receptors in nonfetal cells are downregulated by exposure of the cells to high concentrations of insulin. Other factors that regulate insulin binding include muscular exercise, diet, thyroid hormones, glucocorticoids, androgens, estrogens, and cyclic nucleotides. The fetus has high concentrations of insulin receptors in several tissues. These begin to appear early in fetal life and may outnumber those found in adult tissues. Fetal insulin receptors are unusual in that they may not undergo downregulation but may experience the opposite when exposed to insulin in high concentrations. Thus the offspring of a mother with poorly controlled diabetes may be placed in double jeopardy by fetal hyperinsulinemia and
Qiao, Xiuli; Ai, Dan; Liang, Honglu; Mu, Dianbin; Guo, Qisen
2017-01-20
Molecular targeted therapy has gradually become an important treatment for lung cancer, the aim of this research is to analyze the clinicopathologic features associated with the gene mutation status of epidermal growth factor receptor (EGFR), echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK), ROS proto-oncogene 1, receptor tyrosine kinase (ROS1) and Kirsten rat sarcoma viral oncogene (KRAS) in non-small cell lung cancer (NSCLC) patients and determine the most likely populations to benefit from molecular target therapy treatment. The mutation status of EGFR, EML4-ALK fusion gene, ROS1 and KARS gene were determined by Real-time PCR, the relationship between clinical pathologic features and concomitant gene were analyzed with χ2 test by SPSS software 19.0. A total of 514 specimens from Shandong tumor hospital were collected from NSCLC patients between January 2014 and May 2016. The total mutation rate of EGFR gene was 36.70%, major occurred in exon 19 (36.61%) and exon 21 (51.36%), respectively, and EGFR mutations usually occurred in female, non-smoking and adenocarcinoma patients (P<0.05). The total rearrangements rate of EML4-ALK fusion gene was 9.37%, EML4-ALK fusion gene usually occurred in younger age (≤60 yr) and non-smoking patients (P<0.05). Mutations were not related to gender and pathological type (P>0.05). ROS1 fusion gene was detected in 136 cases, the positive rate was 3.67%, all patients were 60 years old, and the difference was statistically significant (P<0.05). Only 23 samples were tested KARS gene mutations, two of them were positive and the positive rate was 8.70%. They all occurred in non-smoker and adenocarcinoma patients. No mutation was detected to coexist in EGFR, EML4-ALK and KARS gene mutation. EGFR, EML4-ALK, ROS1 and KRAS defines different molecular subset of NSCLC with distinct characteristic, which provides a new option for the clinical treatment of patients with NSCLC.
2012-01-01
The neurons in neocortex layer I (LI) provide inhibition to the cortical networks. Despite increasing use of mice for the study of brain functions, few studies were reported about mouse LI neurons. In the present study, we characterized intrinsic properties of LI neurons of the anterior cingulate cortex (ACC), a key cortical area for sensory and cognitive functions, by using whole-cell patch clamp recording approach. Seventy one neurons in LI and 12 pyramidal neurons in LII/III were recorded. Although all of the LI neurons expressed continuous adapting firing characteristics, the unsupervised clustering results revealed five groups in the ACC, including: Spontaneous firing neurons; Delay-sAHP neurons, Delay-fAHP neurons, and two groups of neurons with ADP, named ADP1 and ADP2, respectively. Using pharmacological approaches, we found that LI neurons received both excitatory (mediated by AMPA, kainate and NMDA receptors), and inhibitory inputs (which were mediated by GABAA receptors). Our studies provide the first report characterizing the electrophysiological properties of neurons in LI of the ACC from adult mice. PMID:22818293
Metal Toxicity at the Synapse: Presynaptic, Postsynaptic, and Long-Term Effects
Sadiq, Sanah; Ghazala, Zena; Chowdhury, Arnab; Büsselberg, Dietrich
2012-01-01
Metal neurotoxicity is a global health concern. This paper summarizes the evidence for metal interactions with synaptic transmission and synaptic plasticity. Presynaptically metal ions modulate neurotransmitter release through their interaction with synaptic vesicles, ion channels, and the metabolism of neurotransmitters (NT). Many metals (e.g., Pb 2+, Cd 2+, and Hg +) also interact with intracellular signaling pathways. Postsynaptically, processes associated with the binding of NT to their receptors, activation of channels, and degradation of NT are altered by metals. Zn 2+, Pb 2+, Cu 2+, Cd 2+, Ni 2+, Co 2+, Li 3+, Hg +, and methylmercury modulate NMDA, AMPA/kainate, and/or GABA receptors activity. Al 3+, Pb 2+, Cd 2+, and As 2 O 3 also impair synaptic plasticity by targeting molecules such as CaM, PKC, and NOS as well as the transcription machinery involved in the maintenance of synaptic plasticity. The multiple effects of metals might occur simultaneously and are based on the specific metal species, metal concentrations, and the types of neurons involved. PMID:22287959
Neuroprotective properties of epoetin alfa.
Cerami, Anthony; Brines, Michael; Ghezzi, Pietro; Cerami, Carla; Itri, Loretta M
2002-01-01
Erythropoietin and its receptor function as primary mediators of the normal physiological response to hypoxia. Erythropoietin is recognized for its central role in erythropoiesis, but studies in which recombinant human erythropoietin (epoetin alfa) is injected directly into ischaemic rodent brain show that erythropoietin also mediates neuroprotection. Abundant expression of the erythropoietin receptor has been observed at brain capillaries, which could provide a route for circulating erythropoietin to enter the brain. In confirmation of this hypothesis, systemic administration of epoetin alfa before or up to 6 h after focal brain ischaemia reduced injury by 50-75%. Epoetin alfa also limited the extent of concussive brain injury, the immune damage in experimental autoimmune encephalomyelitis and excitotoxicity induced by kainate. Thus, systemically administered epoetin alfa in animal models has neuroprotective effects, demonstrating its potential use after brain injury, trauma and multiple sclerosis. It is evident that erythropoietin has biological activities in addition to increasing red cell mass. Given the excellent safety profile of epoetin alfa, clinical trials evaluating systemically administered epoetin alfa as a general neuroprotective treatment are warranted.
The two-state dimer receptor model: a general model for receptor dimers.
Franco, Rafael; Casadó, Vicent; Mallol, Josefa; Ferrada, Carla; Ferré, Sergi; Fuxe, Kjell; Cortés, Antoni; Ciruela, Francisco; Lluis, Carmen; Canela, Enric I
2006-06-01
Nonlinear Scatchard plots are often found for agonist binding to G-protein-coupled receptors. Because there is clear evidence of receptor dimerization, these nonlinear Scatchard plots can reflect cooperativity on agonist binding to the two binding sites in the dimer. According to this, the "two-state dimer receptor model" has been recently derived. In this article, the performance of the model has been analyzed in fitting data of agonist binding to A(1) adenosine receptors, which are an example of receptor displaying concave downward Scatchard plots. Analysis of agonist/antagonist competition data for dopamine D(1) receptors using the two-state dimer receptor model has also been performed. Although fitting to the two-state dimer receptor model was similar to the fitting to the "two-independent-site receptor model", the former is simpler, and a discrimination test selects the two-state dimer receptor model as the best. This model was also very robust in fitting data of estrogen binding to the estrogen receptor, for which Scatchard plots are concave upward. On the one hand, the model would predict the already demonstrated existence of estrogen receptor dimers. On the other hand, the model would predict that concave upward Scatchard plots reflect positive cooperativity, which can be neither predicted nor explained by assuming the existence of two different affinity states. In summary, the two-state dimer receptor model is good for fitting data of binding to dimeric receptors displaying either linear, concave upward, or concave downward Scatchard plots.
Tan, Uner
2015-02-01
To investigate siblings from Kars (n = 2), Turkey, with diagonal-sequence quadrupedal locomotion (QL), severe mental retardation, and no speech (Uner Tan syndrome, UTS), in relation to the evolutionary emergence of human bipedal locomotion (BL). Video recordings were made to assess gaits. Brain MRI scanning was performed to visualize the cerebro-cerebellar malformations. Genome-wide association analyses were performed in venous blood samples. One of the two men with UTS showed early-onset QL and late-onset BL without infantile hypotonia, the other consistent QL with infantile hypotonia. No homozygosity was found in the genetic analysis. The family lived under extremely poor socioeconomic conditions. Low socioeconomic status may be a triggering factor for the epigenetic emergence of UTS. The neural networks responsible for the ancestral diagonal-sequence QL, evolutionarily preserved since about 400 MYA, may be selected during locomotor development, under the influence of self-organizing processes during pre- and postnatal periods. The diagonal-sequence QL induced ipsilateral limb interference in UTS cases as in nonhuman primates. To overcome this condition, our ancestors would prefer the attractor BL. This novel theory for the evolution of human bipedalism was evaluated in light of dynamical systems theory.
Meng, Yongjie; Chen, Feng; Shuai, Haiwei; Luo, Xiaofeng; Ding, Jun; Tang, Shengwen; Xu, Shuanshuan; Liu, Jianwei; Liu, Weiguo; Du, Junbo; Liu, Jiang; Yang, Feng; Sun, Xin; Yong, Taiwen; Wang, Xiaochun; Feng, Yuqi; Shu, Kai; Yang, Wenyu
2016-01-01
Karrikins (KAR) are a class of signal compounds, discovered in wildfire smoke, which affect seed germination. Currently, numerous studies have focused on the model plant Arabidopsis in the KAR research field, rather than on crops. Thus the regulatory mechanisms underlying KAR regulation of crop seed germination are largely unknown. Here, we report that KAR delayed soybean seed germination through enhancing abscisic acid (ABA) biosynthesis, while impairing gibberellin (GA) biogenesis. Interestingly, KAR only retarded soybean seed germination under shaded conditions, rather than under dark and white light conditions, which differs from in Arabidopsis. Phytohormone quantification showed that KAR enhanced ABA biogenesis while impairing GA biosynthesis during the seed imbibition process, and subsequently, the ratio of active GA4 to ABA was significantly reduced. Further qRT-PCR analysis showed that the transcription pattern of genes involved in ABA and GA metabolic pathways are consistent with the hormonal measurements. Finally, fluridone, an ABA biogenesis inhibitor, remarkably rescued the delayed-germination phenotype of KAR-treatment; and paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Taken together, these evidences suggest that KAR inhibit soybean seed germination by mediating the ratio between GA and ABA biogenesis. PMID:26902640
Meng, Yongjie; Chen, Feng; Shuai, Haiwei; Luo, Xiaofeng; Ding, Jun; Tang, Shengwen; Xu, Shuanshuan; Liu, Jianwei; Liu, Weiguo; Du, Junbo; Liu, Jiang; Yang, Feng; Sun, Xin; Yong, Taiwen; Wang, Xiaochun; Feng, Yuqi; Shu, Kai; Yang, Wenyu
2016-02-23
Karrikins (KAR) are a class of signal compounds, discovered in wildfire smoke, which affect seed germination. Currently, numerous studies have focused on the model plant Arabidopsis in the KAR research field, rather than on crops. Thus the regulatory mechanisms underlying KAR regulation of crop seed germination are largely unknown. Here, we report that KAR delayed soybean seed germination through enhancing abscisic acid (ABA) biosynthesis, while impairing gibberellin (GA) biogenesis. Interestingly, KAR only retarded soybean seed germination under shaded conditions, rather than under dark and white light conditions, which differs from in Arabidopsis. Phytohormone quantification showed that KAR enhanced ABA biogenesis while impairing GA biosynthesis during the seed imbibition process, and subsequently, the ratio of active GA4 to ABA was significantly reduced. Further qRT-PCR analysis showed that the transcription pattern of genes involved in ABA and GA metabolic pathways are consistent with the hormonal measurements. Finally, fluridone, an ABA biogenesis inhibitor, remarkably rescued the delayed-germination phenotype of KAR-treatment; and paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Taken together, these evidences suggest that KAR inhibit soybean seed germination by mediating the ratio between GA and ABA biogenesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farr, K.L.; Montano, C.Y.; Paxton, L.L.
1988-11-01
The effect of prenatal ethanol exposure on the kainate-sensitive subtype of glutamate receptor binding sites was studied using in vitro /sup 3/H-vinylidene kainic acid (VKA) autoradiography. Pregnant Sprague-Dawley rats were fed a liquid diet containing either 3.35% or 6.7% ethanol throughout gestation. Pair-fed dams received isocalorically matched liquid diets and a lab chow ad lib group served as control for paired feeding. At 45 days of age, the offspring were sacrificed and their brains analyzed for specific /sup 3/H-VKA binding. Compared to pair-fed controls, specific /sup 3/H-VKA binding was reduced by 13% to 32% in dorsal and ventral hippocampal CA3more » stratum lucidum, entorhinal cortex and cerebellum of 45-day-old rats whose mothers consumed either 3.35% or 6.7% ethanol diets. The binding site reductions were statistically significant only in the ventral hippocampal formation and entorhinal cortex of the 3.35% ethanol diet group rats. Saturation of binding studies in the ventral hippocampal formation of 3.35% ethanol rats indicated that the decrease in specific /sup 3/H-VKA binding was due to a decrease in the total number of binding sites. Given the excitatory effect of kainic acid on the spontaneous firing rate of hippocampal CA3 pyramidal neurons, the reduction of kainate-sensitive glutamate binding in this region is consistent with the electrophysiological observation of decreased spontaneous activity of CA3 pyramidal neurons in fetal alcohol rats.« less
Zwart, Ruud; Reed, Hannah; Sher, Emanuele
2018-01-01
Muscarinic acetylcholine M1 receptors play an important role in synaptic plasticity in the hippocampus and cortex. Potentiation of NMDA receptors as a consequence of muscarinic acetylcholine M1 receptor activation is a crucial event mediating the cholinergic modulation of synaptic plasticity, which is a cellular mechanism for learning and memory. In Alzheimer's disease, the cholinergic input to the hippocampus and cortex is severely degenerated, and agonists or positive allosteric modulators of M1 receptors are therefore thought to be of potential use to treat the deficits in cognitive functions in Alzheimer's disease. In this study we developed a simple system in which muscarinic modulation of NMDA receptors can be studied in vitro. Human M1 receptors and NR1/2B NMDA receptors were co-expressed in Xenopus oocytes and various muscarinic agonists were assessed for their modulatory effects on NMDA receptor-mediated responses. As expected, NMDA receptor-mediated responses were potentiated by oxotremorine-M, oxotremorine or xanomeline when the drugs were applied between subsequent NMDA responses, an effect which was fully blocked by the muscarinic receptor antagonist atropine. However, in oocytes expressing NR1/2B NMDA receptors but not muscarinic M1 receptors, oxotremorine-M co-applied with NMDA also resulted in a potentiation of NMDA currents and this effect was not blocked by atropine, demonstrating that oxotremorine-M is able to directly potentiate NMDA receptors. Oxotremorine, which is a close analogue of oxotremorine-M, and xanomeline, a chemically distinct muscarinic agonist, did not potentiate NMDA receptors by this direct mechanism. Comparing the chemical structures of the three different muscarinic agonists used in this study suggests that the tri-methyl ammonium moiety present in oxotremorine-M is important for the compound's interaction with NMDA receptors. Copyright © 2017 Elsevier Inc. All rights reserved.
Trošt, Nina; Hevir, Neli; Rižner, Tea Lanišnik; Debeljak, Nataša
2013-03-01
Erythropoietin (EPO) receptor (EPOR) expression in breast cancer has been shown to correlate with the expression of estrogen receptor (ESR) and progesterone receptor (PGR) and to be associated with the response to tamoxifen in ESR+/PGR+ tumors but not in ESR- tumors. In addition, the correlation between EPOR and G protein-coupled estrogen receptor 1 [GPER; also known as G protein-coupled receptor 30 (GPR30)] has been reported, suggesting the prognostic potential of EPOR expression. Moreover, the involvement of colony stimulating factor 2 receptor, β, low‑affinity (CSF2RB) and ephrin type-B receptor 4 (EPHB4) as EPOR potential receptor partners in cancer has been indicated. This study analyzed the correlation between the expression of genes for EPO, EPOR, CSF2RB, EPHB4, ESR, PGR and GPER in the MCF-7, MDA-MB-361, T-47D, MDA-MB-231, Hs578Bst, SKBR3, MCF-10A and Hs578T cell lines. The cell lines were also treated with recombinant human EPO (rHuEPO) in order to determine its ability to activate the Jak/STAT5, MAPK and PI3K signaling pathways and modify cell growth characteristics. Expression analysis stratified the cell lines in 2 main clusters, hormone-dependent cell lines expressing ESR and PGR and a hormone-independent cluster. A significant correlation was observed between the expression levels of ESR and PGR and their expression was also associated with that of GPER. Furthermore, the expression of GPER was associated with that of EPOR, suggesting the connection between this orphan G protein and EPO signaling. A negative correlation between EPOR and CSF2RB expression was observed, questioning the involvement of these two receptors in the hetero-receptor formation. rHuEPO treatment only influenced the hormone-independent cell lines, since only the MDA-MB-231, SKBR3 and Hs578T cells responded to the treatment. The correlation between the expression of the analyzed receptors suggests that the receptors may interact in order to activate signaling pathways
Freeman, Spencer A; Jaumouillé, Valentin; Choi, Kate; Hsu, Brian E; Wong, Harikesh S; Abraham, Libin; Graves, Marcia L; Coombs, Daniel; Roskelley, Calvin D; Das, Raibatak; Grinstein, Sergio; Gold, Michael R
2015-02-03
Integrating signals from multiple receptors allows cells to interpret the physiological context in which a signal is received. Here we describe a mechanism for receptor crosstalk in which receptor-induced increases in actin dynamics lower the threshold for signalling by another receptor. We show that the Toll-like receptor ligands lipopolysaccharide and CpG DNA, which are conserved microbial molecules, enhance signalling by the B-cell antigen receptor (BCR) by activating the actin-severing protein cofilin. Single-particle tracking reveals that increased severing of actin filaments reduces the spatial confinement of the BCR within the plasma membrane and increases BCR mobility. This allows more frequent collisions between BCRs and greater signalling in response to low densities of membrane-bound antigen. These findings implicate actin dynamics as a means of tuning receptor signalling and as a mechanism by which B cells distinguish inert antigens from those that are accompanied by indicators of microbial infection.
Freeman, Spencer A.; Jaumouillé, Valentin; Choi, Kate; Hsu, Brian E.; Wong, Harikesh S.; Abraham, Libin; Graves, Marcia L.; Coombs, Daniel; Roskelley, Calvin D.; Das, Raibatak; Grinstein, Sergio; Gold, Michael R.
2015-01-01
Integrating signals from multiple receptors allows cells to interpret the physiological context in which a signal is received. Here we describe a mechanism for receptor crosstalk in which receptor-induced increases in actin dynamics lower the threshold for signalling by another receptor. We show that the Toll-like receptor ligands lipopolysaccharide and CpG DNA, which are conserved microbial molecules, enhance signalling by the B-cell antigen receptor (BCR) by activating the actin-severing protein cofilin. Single-particle tracking reveals that increased severing of actin filaments reduces the spatial confinement of the BCR within the plasma membrane and increases BCR mobility. This allows more frequent collisions between BCRs and greater signalling in response to low densities of membrane-bound antigen. These findings implicate actin dynamics as a means of tuning receptor signalling and as a mechanism by which B cells distinguish inert antigens from those that are accompanied by indicators of microbial infection. PMID:25644899
A second trigeminal CGRP receptor: function and expression of the AMY1 receptor
Walker, Christopher S; Eftekhari, Sajedeh; Bower, Rebekah L; Wilderman, Andrea; Insel, Paul A; Edvinsson, Lars; Waldvogel, Henry J; Jamaluddin, Muhammad A; Russo, Andrew F; Hay, Debbie L
2015-01-01
Objective The trigeminovascular system plays a central role in migraine, a condition in need of new treatments. The neuropeptide, calcitonin gene-related peptide (CGRP), is proposed as causative in migraine and is the subject of intensive drug discovery efforts. This study explores the expression and functionality of two CGRP receptor candidates in the sensory trigeminal system. Methods Receptor expression was determined using Taqman G protein-coupled receptor arrays and immunohistochemistry in trigeminal ganglia (TG) and the spinal trigeminal complex of the brainstem in rat and human. Receptor pharmacology was quantified using sensitive signaling assays in primary rat TG neurons. Results mRNA and histological expression analysis in rat and human samples revealed the presence of two CGRP-responsive receptors (AMY1: calcitonin receptor/receptor activity-modifying protein 1 [RAMP1]) and the CGRP receptor (calcitonin receptor-like receptor/RAMP1). In support of this finding, quantification of agonist and antagonist potencies revealed a dual population of functional CGRP-responsive receptors in primary rat TG neurons. Interpretation The unexpected presence of a functional non-canonical CGRP receptor (AMY1) at neural sites important for craniofacial pain has important implications for targeting the CGRP axis in migraine. PMID:26125036
Hypotensive effects of ghrelin receptor agonists mediated through a novel receptor.
Callaghan, Brid; Kosari, Samin; Pustovit, Ruslan V; Sartor, Daniela M; Ferens, Dorota; Ban, Kung; Baell, Jonathan; Nguyen, Trung V; Rivera, Leni R; Brock, James A; Furness, John B
2014-03-01
Some agonists of ghrelin receptors cause rapid decreases in BP. The mechanisms by which they cause hypotension and the pharmacology of the receptors are unknown. The effects of ligands of ghrelin receptors were investigated in rats in vivo, on isolated blood vessels and on cells transfected with the only molecularly defined ghrelin receptor, growth hormone secretagogue receptor 1a (GHSR1a). Three agonists of GHSR1a receptors, ulimorelin, capromorelin and CP464709, caused a rapid decrease in BP in the anaesthetized rat. The effect was not reduced by either of two GHSR1a antagonists, JMV2959 or YIL781, at doses that blocked effects on colorectal motility, in vivo. The rapid hypotension was not mimicked by ghrelin, unacylated ghrelin or the unacylated ghrelin receptor agonist, AZP531. The early hypotension preceded a decrease in sympathetic nerve activity. Early hypotension was not reduced by hexamethonium or by baroreceptor (sino-aortic) denervation. Ulimorelin also relaxed isolated segments of rat mesenteric artery, and, less potently, relaxed aorta segments. The vascular relaxation was not reduced by JMV2959 or YIL781. Ulimorelin, capromorelin and CP464709 activated GHSR1a in transfected HEK293 cells at nanomolar concentrations. JMV2959 and YIL781 both antagonized effects in these cells, with their pA2 values at the GHSR1a receptor being 6.55 and 7.84. Our results indicate a novel vascular receptor or receptors whose activation by ulimorelin, capromorelin and CP464709 lowered BP. This receptor is activated by low MW GHSR1a agonists, but is not activated by ghrelin. © 2013 The British Pharmacological Society.
Hypotensive effects of ghrelin receptor agonists mediated through a novel receptor
Callaghan, Brid; Kosari, Samin; Pustovit, Ruslan V; Sartor, Daniela M; Ferens, Dorota; Ban, Kung; Baell, Jonathan; Nguyen, Trung V; Rivera, Leni R; Brock, James A; Furness, John B
2014-01-01
BACKGROUND AND PURPOSE Some agonists of ghrelin receptors cause rapid decreases in BP. The mechanisms by which they cause hypotension and the pharmacology of the receptors are unknown. EXPERIMENTAL APPROACH The effects of ligands of ghrelin receptors were investigated in rats in vivo, on isolated blood vessels and on cells transfected with the only molecularly defined ghrelin receptor, growth hormone secretagogue receptor 1a (GHSR1a). KEY RESULTS Three agonists of GHSR1a receptors, ulimorelin, capromorelin and CP464709, caused a rapid decrease in BP in the anaesthetized rat. The effect was not reduced by either of two GHSR1a antagonists, JMV2959 or YIL781, at doses that blocked effects on colorectal motility, in vivo. The rapid hypotension was not mimicked by ghrelin, unacylated ghrelin or the unacylated ghrelin receptor agonist, AZP531. The early hypotension preceded a decrease in sympathetic nerve activity. Early hypotension was not reduced by hexamethonium or by baroreceptor (sino-aortic) denervation. Ulimorelin also relaxed isolated segments of rat mesenteric artery, and, less potently, relaxed aorta segments. The vascular relaxation was not reduced by JMV2959 or YIL781. Ulimorelin, capromorelin and CP464709 activated GHSR1a in transfected HEK293 cells at nanomolar concentrations. JMV2959 and YIL781 both antagonized effects in these cells, with their pA2 values at the GHSR1a receptor being 6.55 and 7.84. CONCLUSIONS AND IMPLICATIONS Our results indicate a novel vascular receptor or receptors whose activation by ulimorelin, capromorelin and CP464709 lowered BP. This receptor is activated by low MW GHSR1a agonists, but is not activated by ghrelin. PMID:24670149
Ismael, Amber; Tian, Wei; Waszczak, Nicholas; Wang, Xin; Cao, Youfang; Suchkov, Dmitry; Bar, Eli; Metodiev, Metodi V; Liang, Jie; Arkowitz, Robert A; Stone, David E
2016-04-12
Gradient-directed cell migration (chemotaxis) and growth (chemotropism) are processes that are essential to the development and life cycles of all species. Cells use surface receptors to sense the shallow chemical gradients that elicit chemotaxis and chemotropism. Slight asymmetries in receptor activation are amplified by downstream signaling systems, which ultimately induce dynamic reorganization of the cytoskeleton. During the mating response of budding yeast, a model chemotropic system, the pheromone receptors on the plasma membrane polarize to the side of the cell closest to the stimulus. Although receptor polarization occurs before and independently of actin cable-dependent delivery of vesicles to the plasma membrane (directed secretion), it requires receptor internalization. Phosphorylation of pheromone receptors by yeast casein kinase 1 or 2 (Yck1/2) stimulates their internalization. We showed that the pheromone-responsive Gβγ dimer promotes the polarization of the pheromone receptor by interacting with Yck1/2 and locally inhibiting receptor phosphorylation. We also found that receptor phosphorylation is essential for chemotropism, independently of its role in inducing receptor internalization. A mathematical model supports the idea that the interaction between Gβγ and Yck1/2 results in differential phosphorylation and internalization of the pheromone receptor and accounts for its polarization before the initiation of directed secretion. Copyright © 2016, American Association for the Advancement of Science.
Glucocorticoid receptor modulators.
Meijer, Onno C; Koorneef, Lisa L; Kroon, Jan
2018-06-01
The glucocorticoid hormone cortisol acts throughout the body to support circadian processes and adaptation to stress. The glucocorticoid receptor is the target of cortisol and of synthetic glucocorticoids, which are used widely in the clinic. Both agonism and antagonism of the glucocorticoid receptor may be beneficial in disease, but given the wide expression of the receptor and involvement in various processes, beneficial effects are often accompanied by unwanted side effects. Selective glucocorticoid receptor modulators are ligands that induce a receptor conformation that allows activation of only a subset of downstream signaling pathways. Such molecules thereby combine agonistic and antagonistic properties. Here we discuss the mechanisms underlying selective receptor modulation and their promise in treating diseases in several organ systems where cortisol signaling plays a role. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Laudet, V
1997-12-01
From a database containing the published nuclear hormone receptor (NR) sequences I constructed an alignment of the C, D and E domains of these molecules. Using this alignment, I have performed tree reconstruction using both distance matrix and parsimony analysis. The robustness of each branch was estimated using bootstrap resampling methods. The trees constructed by these two methods gave congruent topologies. From these analyses I defined six NR subfamilies: (i) a large one clustering thyroid hormone receptors (TRs), retinoic acid receptors (RARs), peroxisome proliferator-activated receptors (PPARs), vitamin D receptors (VDRs) and ecdysone receptors (EcRs) as well as numerous orphan receptors such as RORs or Rev-erbs; (ii) one containing retinoid X receptors (RXRs) together with COUP, HNF4, tailless, TR2 and TR4 orphan receptors; (iii) one containing steroid receptors; (iv) one containing the NGFIB orphan receptors; (v) one containing FTZ-F1 orphan receptors; and finally (vi) one containing to date only one gene, the GCNF1 orphan receptor. The relationships between the six subfamilies are not known except for subfamilies I and IV which appear to be related. Interestingly, most of the liganded receptors appear to be derived when compared with orphan receptors. This suggests that the ligand-binding ability of NRs has been gained by orphan receptors during the course of evolution to give rise to the presently known receptors. The distribution into six subfamilies correlates with the known abilities of the various NRs to bind to DNA as homo- or heterodimers. For example, receptors heterodimerizing efficiently with RXR belong to the first or the fourth subfamilies. I suggest that the ability to heterodimerize evolved once, just before the separation of subfamilies I and IV and that the first NR was able to bind to DNA as a homodimer. From the study of NR sequences existing in vertebrates, arthropods and nematodes, I define two major steps of NR diversification: one
Petri, Doris; Schlicker, Eberhard
2016-07-01
The histamine H4 receptor is coupled to Gi/o proteins and expressed on inflammatory cells and lymphoid tissues; it was suggested that this receptor also occurs in the brain or on peripheral neurones. Since many Gi/o protein-coupled receptors, including the H3 receptor, serve as presynaptic inhibitory receptors, we studied whether the sympathetic neurones supplying four peripheral tissues and the cholinergic neurones in the hippocampus from the guinea-pig are equipped with release-modulating H4 and H3 receptors. For this purpose, we preincubated tissue pieces from the aorta, atrium, renal cortex and vas deferens with (3)H-noradrenaline and hippocampal slices with (3)H-choline and determined the electrically evoked tritium overflow. The stimulation-evoked overflow in the five superfused tissues was inhibited by the muscarinic receptor agonist oxotremorine, which served as a positive control, but not affected by the H4 receptor agonist 4-methylhistamine. The H3 receptor agonist R-α-methylhistamine inhibited noradrenaline release in the peripheral tissues without affecting acetylcholine release in the hippocampal slices. Thioperamide shifted the concentration-response curve of histamine in the aorta and the renal cortex to the right, yielding apparent pA2 values of 8.0 and 8.1, respectively, which are close to its affinity at other H3 receptors but higher by one log unit than its pKi at the H4 receptor of the guinea-pig. In conclusion, histamine H4 receptors could not be identified in five experimental models of the guinea-pig that are suited for the detection of presynaptic inhibitory receptors whereas H3 receptors could be shown in the peripheral tissues but not in the hippocampus. This article is part of the Special Issue entitled 'Histamine Receptors'. Copyright © 2015 Elsevier Ltd. All rights reserved.
Thakali, Keshari; Galligan, James J; Fink, Gregory D; Gariepy, Cheryl E; Watts, Stephanie W
2008-07-01
Heterodimerization of G-protein coupled receptors can alter receptor pharmacology. ET A and ET B receptors heterodimerize when co-expressed in heterologous expression lines. We hypothesized that ET A and ET B receptors heterodimerize and pharmacologically interact in vena cava from wild-type (WT) but not ET B receptor deficient (sl/sl) rats. Pharmacological endothelin receptor interaction was assessed by comparing ET-1-induced contraction in rings of rat thoracic aorta and thoracic vena cava from male Sprague Dawley rats under control conditions, ET A receptor blockade (atrasentan, 10 nM), ET B receptor blockade (BQ-788, 100 nM) or ET B receptor desensitization (Sarafotoxin 6c, 100 nM) and ET A plus ET B receptor blockade or ET A receptor blockade plus ET B receptor desensitization. In addition, similar pharmacological ET receptor antagonism experiments were performed in rat thoracic aorta and vena cava from WT and sl/sl rats. ET A but not ET B receptor blockade or ET B receptor desensitization inhibited aortic and venous ET-1-induced contraction. In vena cava but not aorta, when ET B receptors were blocked (BQ-788, 100 nM) or desensitized (S6c, 100 nM), atrasentan caused a greater inhibition of ET-1-induced contraction. Vena cava from WT but not sl/sl rats exhibited similar pharmacological ET receptor interaction. Immunocytochemistry was performed on freshly dissociated aortic and venous vascular smooth muscle cells to determine localization of ET A and ET B receptors. ET A and ET B receptors qualitatively co-localized more strongly to the plasma membrane of aortic compared to venous vascular smooth muscle cells. Our data suggest that pharmacological ET A and ET B receptor interaction may be dependent on the presence of functional ET B receptors and independent of receptor location.
Knock-In Mice with NOP-eGFP Receptors Identify Receptor Cellular and Regional Localization.
Ozawa, Akihiko; Brunori, Gloria; Mercatelli, Daniela; Wu, Jinhua; Cippitelli, Andrea; Zou, Bende; Xie, Xinmin Simon; Williams, Melissa; Zaveri, Nurulain T; Low, Sarah; Scherrer, Grégory; Kieffer, Brigitte L; Toll, Lawrence
2015-08-19
The nociceptin/orphanin FQ (NOP) receptor, the fourth member of the opioid receptor family, is involved in many processes common to the opioid receptors including pain and drug abuse. To better characterize receptor location and trafficking, knock-in mice were created by inserting the gene encoding enhanced green fluorescent protein (eGFP) into the NOP receptor gene (Oprl1) and producing mice expressing a functional NOP-eGFP C-terminal fusion in place of the native NOP receptor. The NOP-eGFP receptor was present in brain of homozygous knock-in animals in concentrations somewhat higher than in wild-type mice and was functional when tested for stimulation of [(35)S]GTPγS binding in vitro and in patch-clamp electrophysiology in dorsal root ganglia (DRG) neurons and hippocampal slices. Inhibition of morphine analgesia was equivalent when tested in knock-in and wild-type mice. Imaging revealed detailed neuroanatomy in brain, spinal cord, and DRG and was generally consistent with in vitro autoradiographic imaging of receptor location. Multicolor immunohistochemistry identified cells coexpressing various spinal cord and DRG cellular markers, as well as coexpression with μ-opioid receptors in DRG and brain regions. Both in tissue slices and primary cultures, the NOP-eGFP receptors appear throughout the cell body and in processes. These knock-in mice have NOP receptors that function both in vitro and in vivo and appear to be an exceptional tool to study receptor neuroanatomy and correlate with NOP receptor function. The NOP receptor, the fourth member of the opioid receptor family, is involved in pain, drug abuse, and a number of other CNS processes. The regional and cellular distribution has been difficult to determine due to lack of validated antibodies for immunohistochemical analysis. To provide a new tool for the investigation of receptor localization, we have produced knock-in mice with a fluorescent-tagged NOP receptor in place of the native NOP receptor. These
Inhibitory Ah Receptor-Androgen Receptor Crosstalk in Prostate Cancer
2005-02-01
Balk,S.P. Selection for androgen receptor mutations in prostate cancers treated with androgen antagonist. Cancer Res. 59:2511-2515, 1999. 5. Ris...expression, 24-hydroxylase activity, and inhibition of growth hydrocarbon receptor modulators ( SARMs ) for treatment of breast by lca,25-dihydroxyvitamin D3...Safe, A. McDougal, M.S. Gupta, K. Ramamoorthy, Selective Ah [20] D.M. Peehl, R.J. Skowronski, G.K. Leung, S.T. Wong, T.A. Stamey, receptor modulators
Aremu, Adeyemi O; Plačková, Lenka; Novák, Ondřej; Stirk, Wendy A; Doležal, Karel; Van Staden, Johannes
2016-01-01
The current evidence of regulatory effect of smoke-water (SW) and karrikinolide (KAR(1)) on the concentrations of endogenous cytokinins in plants partly explain the basis for their growth stimulatory activity. Karrikinolide (KAR1) which is derived from smoke-water (SW) is involved in some physiological aspects in the life-cycle of plants. This suggests a potential influence on the endogenous pool (quantity and quality) of phytohormones such as cytokinins (CKs). In the current study, the effect of SW (1:500; 1:1000; 1:1500 v/v dilutions) and KAR1 (10(-7); 10(-8); 10(-9) M) applied during micropropagation of Eucomis autumnalis subspecies autumnalis on the ex vitro growth and CKs after 4 months post-flask duration was evaluated. The interactions of SW and KAR(1) with benzyladenine (BA), α-naphthaleneacetic acid (NAA) or BA+NAA were also assessed. Plants treated with SW (1:500) and KAR1 (10(-8) M) demonstrated superior growth in terms of the rooting, leaf and bulb sizes and fresh biomass than the control and plants treated with BA and BA+NAA. However, plant growth was generally inhibited with either SW (1:500) or KAR1 (10(-8) M) and BA when compared to BA (alone) treatment. Relative to NAA treatment, the presence of KAR(1) (10(-7) M) with NAA significantly increased the leaf area and fresh biomass. Both SW and KAR1-treated plants accumulated more total CKs, mainly isoprenoid-type than the control and NAA-treated plants. The highest CK content was also accumulated in SW (1:500) with BA+NAA treatments. Similar stimulatory effects were observed with increasing concentrations of KAR(1) and BA. The current findings establish that SW and KAR1 exert significant influence on the endogenous CK pools. However, the better growth of plants treated with SW and KAR1 treatments was not exclusively related to the endogenous CKs.
Increased Accuracy of Ligand Sensing by Receptor Internalization and Lateral Receptor Diffusion
NASA Astrophysics Data System (ADS)
Aquino, Gerardo; Endres, Robert
2010-03-01
Many types of cells can sense external ligand concentrations with cell-surface receptors at extremely high accuracy. Interestingly, ligand-bound receptors are often internalized, a process also known as receptor-mediated endocytosis. While internalization is involved in a vast number of important functions for the life of a cell, it was recently also suggested to increase the accuracy of sensing ligand as overcounting of the same ligand molecules is reduced. A similar role may be played by receptor diffusion om the cell membrane. Fast, lateral receptor diffusion is known to be relevant in neurotransmission initiated by release of neurotransmitter glutamate in the synaptic cleft between neurons. By binding ligand and removal by diffusion from the region of release of the neurotransmitter, diffusing receptors can be reasonably expected to reduce the local overcounting of the same ligand molecules in the region of signaling. By extending simple ligand-receptor models to out-of-equilibrium thermodynamics, we show that both receptor internalization and lateral diffusion increase the accuracy with which cells can measure ligand concentrations in the external environment. We confirm this with our model and give quantitative predictions for experimental parameters values. We give quantitative predictions, which compare favorably to experimental data of real receptors.
Cooperative ethylene receptor signaling
Liu, Qian; Wen, Chi-Kuang
2012-01-01
The gaseous plant hormone ethylene is perceived by a family of five ethylene receptor members in the dicotyledonous model plant Arabidopsis. Genetic and biochemical studies suggest that the ethylene response is suppressed by ethylene receptor complexes, but the biochemical nature of the receptor signal is unknown. Without appropriate biochemical measures to trace the ethylene receptor signal and quantify the signal strength, the biological significance of the modulation of ethylene responses by multiple ethylene receptors has yet to be fully addressed. Nevertheless, the ethylene receptor signal strength can be reflected by degrees in alteration of various ethylene response phenotypes and in expression levels of ethylene-inducible genes. This mini-review highlights studies that have advanced our understanding of cooperative ethylene receptor signaling. PMID:22827938
Calcitonin and calcitonin receptor-like receptors: common themes with family B GPCRs?
Barwell, James; Gingell, Joseph J; Watkins, Harriet A; Archbold, Julia K; Poyner, David R; Hay, Debbie L
2012-05-01
The calcitonin receptor (CTR) and calcitonin receptor-like receptor (CLR) are two of the 15 human family B (or Secretin-like) GPCRs. CTR and CLR are of considerable biological interest as their pharmacology is moulded by interactions with receptor activity-modifying proteins. They also have therapeutic relevance for many conditions, such as osteoporosis, diabetes, obesity, lymphatic insufficiency, migraine and cardiovascular disease. In light of recent advances in understanding ligand docking and receptor activation in both the family as a whole and in CLR and CTR specifically, this review reflects how applicable general family B GPCR themes are to these two idiosyncratic receptors. We review the main functional domains of the receptors; the N-terminal extracellular domain, the juxtamembrane domain and ligand interface, the transmembrane domain and the intracellular C-terminal domain. Structural and functional findings from the CLR and CTR along with other family B GPCRs are critically appraised to gain insight into how these domains may function. The ability for CTR and CLR to interact with receptor activity-modifying proteins adds another level of sophistication to these receptor systems but means careful consideration is needed when trying to apply generic GPCR principles. This review encapsulates current thinking in the realm of family B GPCR research by highlighting both conflicting and recurring themes and how such findings relate to two unusual but important receptors, CTR and CLR. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.
Structures of D14 and D14L in the strigolactone and karrikin signaling pathways.
Kagiyama, Megumi; Hirano, Yoshinori; Mori, Tomoyuki; Kim, Sun-Yong; Kyozuka, Junko; Seto, Yoshiya; Yamaguchi, Shinjiro; Hakoshima, Toshio
2013-02-01
Strigolactones (SLs) are plant hormones that inhibit shoot branching. DWARF14 (D14) inhibits rice tillering and is an SL receptor candidate in the branching inhibition pathway, whereas the close homologue DWARF14-LIKE (D14L) participates in the signaling pathway of karrikins (KARs), which are derived from burnt vegetation as smoke stimulants of seed germination. We provide the first evidence for direct binding of the bioactive SL analogue GR24 to D14. Isothermal titration calorimetry measurements show a D14-GR24 binding affinity in the sub-micromolar range. Similarly, bioactive KAR1 directly binds D14L in the micromolar range. The crystal structure of rice D14 shows a compact α-/β-fold hydrolase domain forming a deep ligand-binding pocket capable of accommodating GR24. Insertion of four α-helices between β6 strand and αD helix forms the helical cap of the pocket, although the pocket is open to the solvent. The pocket contains the conserved catalytic triad Ser-His-Asp aligned with the oxyanion hole, suggesting hydrolase activity. Although these structural characteristics are conserved in D14L, the D14L pocket is smaller than that of D14. The KAR-insensitive mutation kai2-1 is located at the prominent long β6-αD1 loop, which is characteristic in D14 and D14L, but not in related α-/β-fold hydrolases. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
Nuclear receptors in pancreatic tumor cells.
Damaskos, Christos; Garmpis, Nikolaos; Karatzas, Theodore; Kostakis, Ioannis D; Nikolidakis, Lampros; Kostakis, Alkiviadis; Kouraklis, Gregory
2014-12-01
This review focuses on nuclear receptors expressed in pancreatic cancer. An extensive search of articles published up to March 2013 was conducted using the MEDLINE database. The key words used were "pancreatic cancer", "molecular receptors" and "growth factors". A total of 112 articles referred to pancreatic cancer, molecular receptors and/or growth factors were included. Receptors of growth factors, such as the epithelial growth factor receptor, insulin-like growth factor-1 receptor, vascular endothelial growth factor receptor and others, such as integrin α5β1, somatostatin receptors, the death receptor 5, claudin, notch receptors, mesothelin receptors, follicle-stimulating hormone receptors, the MUC1 receptor, the adrenomedullin receptor, the farnesoid X receptor, the transferrin receptor, sigma-2 receptors, the chemokine receptor CXCR4, the urokinase plasminogen activator receptor, the ephrine A2 receptor, the GRIA3 receptor, the RON receptor and the angiotensin II receptor AT-1 are expressed in pancreatic tumor cells. These molecules are implicated in tumor growth, apoptosis, angiogenesis, metastasis etc. After identifying the molecular receptors associated with the pancreatic cancer, many more target molecules playing important roles in tumor pathophysiology and senescence-associated signal transduction in cancer cells will be identified. This may have a significant influence on diagnosis, therapy and prognosis of pancreatic cancer. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Synaptic Neurotransmitter-Gated Receptors
Smart, Trevor G.; Paoletti, Pierre
2012-01-01
Since the discovery of the major excitatory and inhibitory neurotransmitters and their receptors in the brain, many have deliberated over their likely structures and how these may relate to function. This was initially satisfied by the determination of the first amino acid sequences of the Cys-loop receptors that recognized acetylcholine, serotonin, GABA, and glycine, followed later by similar determinations for the glutamate receptors, comprising non-NMDA and NMDA subtypes. The last decade has seen a rapid advance resulting in the first structures of Cys-loop receptors, related bacterial and molluscan homologs, and glutamate receptors, determined down to atomic resolution. This now provides a basis for determining not just the complete structures of these important receptor classes, but also for understanding how various domains and residues interact during agonist binding, receptor activation, and channel opening, including allosteric modulation. This article reviews our current understanding of these mechanisms for the Cys-loop and glutamate receptor families. PMID:22233560
Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C
1987-01-26
Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.
Molecular modeling of ligand-receptor interactions in the OR5 olfactory receptor.
Singer, M S; Shepherd, G M
1994-06-02
Olfactory receptors belong to the superfamily of seven transmembrane domain, G protein-coupled receptors. In order to begin analysis of mechanisms of receptor activation, a computer model of the OR5 olfactory receptor has been constructed and compared with other members of this superfamily. We have tested docking of the odor molecule lyral, which is known to activate the OR5 receptor. The results point to specific ligand-binding residues on helices III through VII that form a binding pocket in the receptor. Some of these residues occupy sequence positions identical to ligand-binding residues conserved among other superfamily members. The results provide new insights into possible molecular mechanisms of odor recognition and suggest hypotheses to guide future experimental studies using site-directed mutagenesis.
30 CFR 916.15 - Approval of Kansas regulatory program amendments.
Code of Federal Regulations, 2012 CFR
2012-07-01
... MLCRA 49-403, 49-405c, 49-406, 49-420; § 10 of House Bill 2182; K.A.R. 47-2-21, 47-8-10, 47-8-11. March 16, 1984 June 8, 1984 MLCRA 49-406; K.A.R. 47-1-10. December 21, 1984 April 11, 1985 K.A.R. 47-15-13. April 4, 1985 November 15, 1985 K.S.A 1984 Supp. 49-406(g); K.A.R. 47-1-11; 47-2-75; 47-3-42, (a)(23...
30 CFR 916.15 - Approval of Kansas regulatory program amendments.
Code of Federal Regulations, 2011 CFR
2011-07-01
... MLCRA 49-403, 49-405c, 49-406, 49-420; § 10 of House Bill 2182; K.A.R. 47-2-21, 47-8-10, 47-8-11. March 16, 1984 June 8, 1984 MLCRA 49-406; K.A.R. 47-1-10. December 21, 1984 April 11, 1985 K.A.R. 47-15-13. April 4, 1985 November 15, 1985 K.S.A 1984 Supp. 49-406(g); K.A.R. 47-1-11; 47-2-75; 47-3-42, (a)(23...
30 CFR 916.15 - Approval of Kansas regulatory program amendments.
Code of Federal Regulations, 2010 CFR
2010-07-01
... MLCRA 49-403, 49-405c, 49-406, 49-420; § 10 of House Bill 2182; K.A.R. 47-2-21, 47-8-10, 47-8-11. March 16, 1984 June 8, 1984 MLCRA 49-406; K.A.R. 47-1-10. December 21, 1984 April 11, 1985 K.A.R. 47-15-13. April 4, 1985 November 15, 1985 K.S.A 1984 Supp. 49-406(g); K.A.R. 47-1-11; 47-2-75; 47-3-42, (a)(23...
30 CFR 916.15 - Approval of Kansas regulatory program amendments.
Code of Federal Regulations, 2014 CFR
2014-07-01
... MLCRA 49-403, 49-405c, 49-406, 49-420; § 10 of House Bill 2182; K.A.R. 47-2-21, 47-8-10, 47-8-11. March 16, 1984 June 8, 1984 MLCRA 49-406; K.A.R. 47-1-10. December 21, 1984 April 11, 1985 K.A.R. 47-15-13. April 4, 1985 November 15, 1985 K.S.A 1984 Supp. 49-406(g); K.A.R. 47-1-11; 47-2-75; 47-3-42, (a)(23...
30 CFR 916.15 - Approval of Kansas regulatory program amendments.
Code of Federal Regulations, 2013 CFR
2013-07-01
... MLCRA 49-403, 49-405c, 49-406, 49-420; § 10 of House Bill 2182; K.A.R. 47-2-21, 47-8-10, 47-8-11. March 16, 1984 June 8, 1984 MLCRA 49-406; K.A.R. 47-1-10. December 21, 1984 April 11, 1985 K.A.R. 47-15-13. April 4, 1985 November 15, 1985 K.S.A 1984 Supp. 49-406(g); K.A.R. 47-1-11; 47-2-75; 47-3-42, (a)(23...
Ionotropic receptors (IRs): chemosensory ionotropic glutamate receptors in Drosophila and beyond.
Rytz, Raphael; Croset, Vincent; Benton, Richard
2013-09-01
Ionotropic Receptors (IRs) are a recently characterized family of olfactory receptors in the fruit fly, Drosophila melanogaster. IRs are not related to insect Odorant Receptors (ORs), but rather have evolved from ionotropic glutamate receptors (iGluRs), a conserved family of synaptic ligand-gated ion channels. Here, we review the expression and function of IRs in Drosophila, highlighting similarities and differences with iGluRs. We also briefly describe the organization of the neuronal circuits in which IRs function, comparing and contrasting them with the sensory pathways expressing ORs. Finally, we summarize the bioinformatic identification and initial characterization of IRs in other species, which imply an evolutionarily conserved role for these receptors in chemosensation in insects and other protostomes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Purification of PRL receptors from toad kidney: Comparisons with rabbit mammary PRL receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dunand, M.; Kraehenbuhl, J.P.; Rossier, B.C.
1988-03-01
The binding characteristics of the prolactin (PRL) receptors present in toad (Bufo marinus) kidneys were investigated and compared to those of PRL receptors present in rabbit mammary glands. The molecular characteristics of the Triton X-100 solubilized renal and mammary PRL receptors were assessed by gel filtration and by migration analysis on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) after affinity labeling of the binding sites with {sup 125}I-human growth hormone. Similar results were obtained for both receptors. Partial purification of the toad PRL receptor could be achieved by affinity chromatography. The molecular weight of this purified receptor could be determined bymore » analysis of SDS-PAGE. With the use of a polyclonal antiserum raised against a purified preparation of rabbit mammary PRL receptor, one or several antigenic epitope(s) could be identified on the core of the toad renal PRL receptor. In conclusion, although the structure and the biological role(s) of PRL have substantially changed during evolution, the receptor for this hormone has retained many of its structural features as could be assessed between an amphibian and a mammalian species on functionally different target tissues.« less
Karrikins force a rethink of strigolactone mode of action
Waters, Mark T.; Scaffidi, Adrian; Flematti, Gavin R.; Smith, Steven M.
2012-01-01
Strigolactones (SL) and karrikins (KAR) both contain essential butenolide moieties, and both require the F-box protein MAX2 to control seed germination and photomorphogenesis in Arabidopsis thaliana. A new discovery that SL and KAR also require related α/β-hydrolase proteins for such activity suggests that they operate through a similar molecular mechanism. Based on structural similarity, a previously proposed mode of action for SL was also considered for KAR, but recent structure-activity studies suggest that this mechanism may not apply. Here we rationalise these observations into a hypothesis whereby different α/β-hydrolases distinguish SL and KAR by virtue of their non-butenolide moieties and catalyze nucleophilic attack on the butenolide. The products would be different for SL and KAR, and in the case of SL they have no biological activity. The inference is that nucleophilic attack on SL and KAR by α/β-hydrolases is required for their bioactivity, but the hydrolysis products are not. PMID:22827937
Cocaine Inhibits Dopamine D2 Receptor Signaling via Sigma-1-D2 Receptor Heteromers
Navarro, Gemma; Moreno, Estefania; Bonaventura, Jordi; Brugarolas, Marc; Farré, Daniel; Aguinaga, David; Mallol, Josefa; Cortés, Antoni; Casadó, Vicent; Lluís, Carmen; Ferre, Sergi
2013-01-01
Under normal conditions the brain maintains a delicate balance between inputs of reward seeking controlled by neurons containing the D1-like family of dopamine receptors and inputs of aversion coming from neurons containing the D2-like family of dopamine receptors. Cocaine is able to subvert these balanced inputs by altering the cell signaling of these two pathways such that D1 reward seeking pathway dominates. Here, we provide an explanation at the cellular and biochemical level how cocaine may achieve this. Exploring the effect of cocaine on dopamine D2 receptors function, we present evidence of σ1 receptor molecular and functional interaction with dopamine D2 receptors. Using biophysical, biochemical, and cell biology approaches, we discovered that D2 receptors (the long isoform of the D2 receptor) can complex with σ1 receptors, a result that is specific to D2 receptors, as D3 and D4 receptors did not form heteromers. We demonstrate that the σ1-D2 receptor heteromers consist of higher order oligomers, are found in mouse striatum and that cocaine, by binding to σ1 -D2 receptor heteromers, inhibits downstream signaling in both cultured cells and in mouse striatum. In contrast, in striatum from σ1 knockout animals these complexes are not found and this inhibition is not seen. Taken together, these data illuminate the mechanism by which the initial exposure to cocaine can inhibit signaling via D2 receptor containing neurons, destabilizing the delicate signaling balance influencing drug seeking that emanates from the D1 and D2 receptor containing neurons in the brain. PMID:23637801
Molecular Perspectives for mu/delta Opioid Receptor Heteromers as Distinct, Functional Receptors
Ong, Edmund W.; Cahill, Catherine M.
2014-01-01
Opioid receptors are the sites of action for morphine and the other opioid drugs. Abundant evidence now demonstrates that different opioid receptor types can physically associate to form heteromers. Understandings of the nature, behavior, and role of these opioid receptor heteromers are developing. Owing to their constituent monomers’ involvement in analgesia, mu/delta opioid receptor (M/DOR) heteromers have been a particular focus of attention. There is now considerable evidence demonstrating M/DOR to be an extant and physiologically relevant receptor species. Participating in the cellular environment as a distinct receptor type, M/DOR availability is complexly regulated and M/DOR exhibits unique pharmacology from that of other opioid receptors (ORs), including its constituents. M/DOR appears to have a range of actions that vary in a ligand- (or ligands-) dependent manner. These actions can meaningfully affect the clinical effects of opioid drugs: strategies targeting M/DOR may be therapeutically useful. This review presents and discusses developments in these understandings with a focus on the molecular nature and activity of M/DOR in the context of therapeutic potentials. PMID:24709907
Tchekalarova, Jana D; Ivanova, Natasha; Atanasova, Dimitrina; Pechlivanova, Daniela M; Lazarov, Nikolai; Kortenska, Lidia; Mitreva, Rumiana; Lozanov, Valentin; Stoynev, Alexander
2016-08-01
Over the last 10 years, accumulated experimental and clinical evidence has supported the idea that AT1 receptor subtype is involved in epilepsy. Recently, we have shown that the selective AT1 receptor antagonist losartan attenuates epileptogenesis and exerts neuroprotection in the CA1 area of the hippocampus in epileptic Wistar rats. This study aimed to verify the efficacy of long-term treatment with losartan (10 mg/kg) after kainate-induced status epilepticus (SE) on seizure activity, behavioral and biochemical changes, and neuronal damage in a model of co-morbid hypertension and epilepsy. Spontaneous seizures were video- and EEG-monitored in spontaneously hypertensive rats (SHRs) for a 16-week period after SE. The behavior was analyzed by open field, elevated plus maze, sugar preference test, and forced swim test. The levels of serotonin in the hippocampus and neuronal loss were estimated by HPLC and hematoxylin and eosin staining, respectively. The AT1 receptor antagonism delayed the onset of seizures and alleviated their frequency and duration during and after discontinuation of treatment. Losartan showed neuroprotection mostly in the CA3 area of the hippocampus and the septo-temporal hilus of the dentate gyrus in SHRs. However, the AT1 receptor antagonist did not exert a substantial influence on concomitant with epilepsy behavioral changes and decreased 5-HT levels in the hippocampus. Our results suggest that the antihypertensive therapy with an AT1 receptor blocker might be effective against seizure activity and neuronal damage in a co-morbid hypertension and epilepsy.
CONTAMINANT INTERACTIONS WITH STEROID RECEPTORS: EVIDENCE FOR RECEPTOR BINDING.
Steroid receptors are important determinants of endocrine disrupter consequences. As the most frequently proposed mechanism of endocrine-disrupting contaminant (EDC) action, steroid receptors are not only targets of natural steroids but are also commonly sites of nonsteroidal com...
Amsler, K; Kuwada, S K
1999-01-01
Signal transduction from receptors is mediated by the interaction of activated receptors with proximate downstream signaling proteins. In polarized epithelial cells, the membrane is divided into subdomains: the apical and basolateral membranes. Membrane receptors may be present in one or both subdomains. Using a combination of immunoprecipitation and Western blot analyses, we tested the hypothesis that a tyrosine kinase growth factor receptor, epidermal growth factor receptor (EGFR), interacts with distinct signaling proteins when present at the apical vs. basolateral membrane of a polarized renal epithelial cell. We report here that tyrosine phosphorylation of phospholipase C-gamma (PLC-gamma) was induced only when basolateral EGFR was activated. In contrast, tyrosine phosphorylation of several other signaling proteins was increased by activation of receptor at either surface. All signaling proteins were distributed diffusely throughout the cytoplasm; however, PLC-gamma protein also displayed a concentration at lateral cell borders. These results demonstrate that in polarized epithelial cells the array of signaling pathways initiated by activation of a membrane receptor is defined, at least in part, by the membrane location of the receptor.
Cervetto, Chiara; Venturini, Arianna; Passalacqua, Mario; Guidolin, Diego; Genedani, Susanna; Fuxe, Kjell; Borroto-Esquela, Dasiel O; Cortelli, Pietro; Woods, Amina; Maura, Guido; Marcoli, Manuela; Agnati, Luigi F
2017-01-01
Evidence for striatal A2A-D2 heterodimers has led to a new perspective on molecular mechanisms involved in schizophrenia and Parkinson's disease. Despite the increasing recognition of astrocytes' participation in neuropsychiatric disease vulnerability, involvement of striatal astrocytes in A2A and D2 receptor signal transmission has never been explored. Here, we investigated the presence of D2 and A2A receptors in isolated astrocyte processes prepared from adult rat striatum by confocal imaging; the effects of receptor activation were measured on the 4-aminopyridine-evoked release of glutamate from the processes. Confocal analysis showed that A2A and D2 receptors were co-expressed on the same astrocyte processes. Evidence for A2A-D2 receptor-receptor interactions was obtained by measuring the release of the gliotransmitter glutamate: D2 receptors inhibited the glutamate release, while activation of A2A receptors, per se ineffective, abolished the effect of D2 receptor activation. The synthetic D2 peptide VLRRRRKRVN corresponding to the receptor region involved in electrostatic interaction underlying A2A-D2 heteromerization abolished the ability of the A2A receptor to antagonize the D2 receptor-mediated effect. Together, the findings are consistent with heteromerization of native striatal astrocytic A2A-D2 receptors that via allosteric receptor-receptor interactions could play a role in the control of striatal glutamatergic transmission. These new findings suggest possible new pathogenic mechanisms and/or therapeutic approaches to neuropsychiatric disorders. © 2016 International Society for Neurochemistry.
Töllner, Kathrin; Brandt, Claudia; Erker, Thomas; Löscher, Wolfgang
2015-01-05
In about 20-40% of patients, status epilepticus (SE) is refractory to standard treatment with benzodiazepines, necessitating second- and third-line treatments that are not always successful, resulting in increased mortality. Rat models of refractory SE are instrumental in studying the changes underlying refractoriness and to develop more effective treatments for this severe medical emergency. Failure of GABAergic inhibition is a likely cause of the development of benzodiazepine resistance during SE. In addition to changes in GABAA receptor expression, trafficking, and function, alterations in Cl(-) homeostasis with increased intraneuronal Cl(-) levels may be involved. Bumetanide, which reduces intraneuronal Cl(-) by inhibiting the Cl(-) intruding Na(+), K(+), Cl(-) cotransporter NKCC1, has been reported to interrupt SE induced by kainate in urethane-anesthetized rats, indicating that this diuretic drug may be an interesting candidate for treatment of refractory SE. In this study, we evaluated the effects of bumetanide in the kainate and lithium-pilocarpine models of SE as well as a model in which SE is induced by sustained electrical stimulation of the basolateral amygdala. Unexpectedly, bumetanide alone was ineffective to terminate SE in both conscious and anesthetized adult rats. However, it potentiated the anticonvulsant effect of low doses of phenobarbital, although this was only seen in part of the animals; higher doses of phenobarbital, particularly in combination with diazepam, were more effective to terminate SE than bumetanide/phenobarbital combinations. These data do not suggest that bumetanide, alone or in combination with phenobarbital, is a valuable option in the treatment of refractory SE in adult patients. Copyright © 2014 Elsevier B.V. All rights reserved.
Clauer, Norbert; Fallick, Anthony E.; Eberl, Dennis D.; Honty, Miroslav; Huff, Warren D.; Auberti, Amelie
2013-01-01
Nanometric (2 diagram that illitization occurred in all fractions by simultaneous nucleation and crystal growth, except for one sample. In that sample, a period of growth without nucleation was detected on top of the nucleation and growth episode. The K-Ar ages organize into two isochrons, the first at 319.9 ± 2.0 Ma with an initial 40Ar/36Ar ratio of 271 ± 66 Ma, and the second at 284.9 ± 1.2 Ma with an initial 40Ar/36Ar ratio of 310 ± 44. One data point above the older isochron and three between the two isochrons suggest a detrital contamination for the former separate and a possible further generation of nanoparticles for the three others. The samples with the older crystallization age consist of illite and illite-rich mixed-layers, and those with the younger age contain smectite-rich mixed-layers without illite, or illite-enriched illite-smectite mixed-layers. The K-Ar ages fit the age trends published previously for similar K-bentonites with regional age patterns between 240 and 270 Ma in the southwestern region, between 270 and 300 Ma in the central zone and the southern Appalachians, and between 315 and 370 Ma in the northernmost. Each of the two generations of illite crystals yields very consistent δ18O (V-SMOW) values at 17 ± 1‰ for the older and at 21 ± 1‰ for the younger. If crystallization temperatures of the nanometric illite were between 100 and 200 °C, as suggested by microthermometric determinations, the hydrothermal fluids had δ18O values of 4 ± 1‰ in the Dalton district and of 8 ± 1‰ in the Lafayette, Trenton, and Dirtseller districts at 100 °C, and of 11 ± 1 and 15 ± 1‰ in the same locations at 200 °C, probably because the water-rock isotope exchanges at elevated temperature occurred in rock-dominated systems. The δ18O of the fluids remained unchanged during local crystal growth, but varied depending on the geographic location of the samples and timing of illitization. The δD (V-SMOW) values of the different size
Li, Xiaona; Zhou, Mang; Huang, Wei; Yang, Huaiyu
2017-07-01
N-glycosylation is a common post-translational modification of G-protein-coupled receptors (GPCRs). However, it remains unknown how N-glycosylation affects GPCR signaling. β 2 adrenergic receptor (β 2 AR) has three N-glycosylation sites: Asn6, Asn15 at the N-terminus, and Asn187 at the second extracellular loop (ECL2). Here, we show that deletion of the N-glycan did not affect receptor expression and ligand binding. Deletion of the N-glycan at the N-terminus rather than Asn187 showed decreased effects on isoproterenol-promoted G-protein-dependent signaling, β-arrestin2 recruitment, and receptor internalization. Both N6Q and N15Q showed decreased receptor dimerization, while N187Q did not influence receptor dimerization. As decreased β 2 AR homodimer accompanied with reduced efficiency for receptor function, we proposed that the N-glycosylation of β 2 AR regulated receptor function by influencing receptor dimerization. To verify this hypothesis, we further paid attention to the residues at the dimerization interface. Studies of Lys60 and Glu338, two residues at the receptor dimerization interface, exhibited that the K60A/E338A showed decreased β 2 AR dimerization and its effects on receptor signaling were similar to N6Q and N15Q, which further supported the importance of receptor dimerization for receptor function. This work provides new insights into the relationship among glycosylation, dimerization, and function of GPCRs. Peptide-N-glycosidase F (PNGase F, EC 3.2.2.11); endo-β-N-acetylglucosaminidase A (Endo-A, EC 3.2.1.96). © 2017 Federation of European Biochemical Societies.
Functional Implications of Limited Leptin Receptor and Ghrelin Receptor Coexpression in the Brain
Perello, Mario; Scott, Michael M.; Sakata, Ichiro; Lee, Charlotte E.; Chuang, Jen-Chieh; Osborne-Lawrence, Sherri; Rovinsky, Sherry A.; Elmquist, Joel K.; Zigman, Jeffrey M.
2012-01-01
The hormones leptin and ghrelin act in apposition to one another in the regulation of body weight homeostasis. Interestingly, both leptin receptor expression and ghrelin receptor expression have been observed within many of the same nuclei of the central nervous system (CNS), suggesting that these hormones may act on a common population of neurons to produce changes in food intake and energy expenditure. In the present study we explored the extent of this putative direct leptin and ghrelin interaction in the CNS and addressed the question of whether a loss of ghrelin signaling would affect sensitivity to leptin. Using histological mapping of leptin receptor and ghrelin receptor expression, we found that cells containing both leptin receptors and ghrelin receptors are mainly located in the medial part of the hypothalamic arcuate nucleus. In contrast, coexpression was much less extensive elsewhere in the brain. To assess the functional consequences of this observed receptor distribution, we explored the effect of ghrelin receptor deletion on leptin sensitivity. In particular, the responses of ad libitum-fed, diet-induced obese and fasted mice to the anorectic actions of leptin were examined. Surprisingly, we found that deletion of the ghrelin receptor did not affect the sensitivity to exogenously administrated leptin. Thus, we conclude that ghrelin and leptin act largely on distinct neuronal populations and that ghrelin receptor deficiency does not affect sensitivity to the anorexigenic and body weight-lowering actions of leptin. PMID:21674492
Functional implications of limited leptin receptor and ghrelin receptor coexpression in the brain.
Perello, Mario; Scott, Michael M; Sakata, Ichiro; Lee, Charlotte E; Chuang, Jen-Chieh; Osborne-Lawrence, Sherri; Rovinsky, Sherry A; Elmquist, Joel K; Zigman, Jeffrey M
2012-02-01
The hormones leptin and ghrelin act in apposition to one another in the regulation of body weight homeostasis. Interestingly, both leptin receptor expression and ghrelin receptor expression have been observed within many of the same nuclei of the central nervous system (CNS), suggesting that these hormones may act on a common population of neurons to produce changes in food intake and energy expenditure. In the present study we explored the extent of this putative direct leptin and ghrelin interaction in the CNS and addressed the question of whether a loss of ghrelin signaling would affect sensitivity to leptin. Using histological mapping of leptin receptor and ghrelin receptor expression, we found that cells containing both leptin receptors and ghrelin receptors are mainly located in the medial part of the hypothalamic arcuate nucleus. In contrast, coexpression was much less extensive elsewhere in the brain. To assess the functional consequences of this observed receptor distribution, we explored the effect of ghrelin receptor deletion on leptin sensitivity. In particular, the responses of ad libitum-fed, diet-induced obese and fasted mice to the anorectic actions of leptin were examined. Surprisingly, we found that deletion of the ghrelin receptor did not affect the sensitivity to exogenously administrated leptin. Thus, we conclude that ghrelin and leptin act largely on distinct neuronal populations and that ghrelin receptor deficiency does not affect sensitivity to the anorexigenic and body weight-lowering actions of leptin. Copyright © 2011 Wiley-Liss, Inc.
Type-7 metabotropic glutamate receptors negatively regulate α1-adrenergic receptor signalling.
Iacovelli, Luisa; Di Menna, Luisa; Peterlik, Daniel; Stangl, Christina; Orlando, Rosamaria; Molinaro, Gemma; De Blasi, Antonio; Bruno, Valeria; Battaglia, Giuseppe; Flor, Peter J; Uschold-Schmidt, Nicole; Nicoletti, Ferdinando
2017-02-01
We studied the interaction between mGlu7 and α 1 -adrenergic receptors in heterologous expression systems, brain slices, and living animals. L-2-Amino-4-phosphonobutanoate (L-AP4), and l-serine-O-phosphate (L-SOP), which activate group III mGlu receptors, restrained the stimulation of polyphosphoinositide (PI) hydrolysis induced by the α 1 -adrenergic receptor agonist, phenylephrine, in HEK 293 cells co-expressing α 1 -adrenergic and mGlu7 receptors. The inibitory action of L-AP4 was abrogated by (i) the mGlu7 receptor antagonist, XAP044; (ii) the C-terminal portion of type-2 G protein coupled receptor kinase; and (iii) the MAP kinase inhibitors, UO126 and PD98059. This suggests that the functional interaction between mGlu7 and α 1 -adrenergic receptors was mediated by the βγ-subunits of the G i protein and required the activation of the MAP kinase pathway. Remarkably, activation of neither mGlu2 nor mGlu4 receptors reduced α 1 -adrenergic receptor-mediated PI hydrolysis. In mouse cortical slices, both L-AP4 and L-SOP were able to attenuate norepinephrine- and phenylephrine-stimulated PI hydrolysis at concentrations consistent with the activation of mGlu7 receptors. L-AP4 failed to affect norepinephrine-stimulated PI hydrolysis in cortical slices from mGlu7 -/- mice, but retained its inhibitory activity in slices from mGlu4 -/- mice. At behavioural level, i.c.v. injection of phenylephrine produced antidepressant-like effects in the forced swim test. The action of phenylephrine was attenuated by L-SOP, which was inactive per se. Finally, both phenylephrine and L-SOP increased corticosterone levels in mice, but the increase was halved when the two drugs were administered in combination. Our data demonstrate that α 1 -adrenergic and mGlu7 receptors functionally interact and suggest that this interaction might be targeted in the treatment of stress-related disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuwasako, Kenji, E-mail: kuwasako@fc.miyazaki-u.ac.jp; Kitamura, Kazuo; Nagata, Sayaka
2010-02-12
Receptor activity-modifying protein 2 (RAMP2) enables calcitonin receptor-like receptor (CRLR) to form an adrenomedullin (AM)-specific receptor. Here we investigated the function of the cytoplasmic C-terminal tail (C-tail) of human (h)CRLR by co-transfecting its C-terminal mutants into HEK-293 cells stably expressing hRAMP2. Deleting the C-tail from CRLR disrupted AM-evoked cAMP production or receptor internalization, but did not affect [{sup 125}I]AM binding. We found that CRLR residues 428-439 are required for AM-evoked cAMP production, though deleting this region had little effect on receptor internalization. Moreover, pretreatment with pertussis toxin (100 ng/mL) led to significant increases in AM-induced cAMP production via wild-type CRLR/RAMP2more » complexes. This effect was canceled by deleting CRLR residues 454-457, suggesting Gi couples to this region. Flow cytometric analysis revealed that CRLR truncation mutants lacking residues in the Ser/Thr-rich region extending from Ser{sup 449} to Ser{sup 467} were unable to undergo AM-induced receptor internalization and, in contrast to the effect on wild-type CRLR, overexpression of GPCR kinases-2, -3 and -4 failed to promote internalization of CRLR mutants lacking residues 449-467. Thus, the hCRLR C-tail is crucial for AM-evoked cAMP production and internalization of the CRLR/RAMP2, while the receptor internalization is dependent on the aforementioned GPCR kinases, but not Gs coupling.« less
Monteiro, Renato C; Van De Winkel, Jan G J
2003-01-01
The IgA receptor family comprises a number of surface receptors including the polymeric Ig receptor involved in epithelial transport of IgA/IgM, the myeloid specific IgA Fc receptor (FcalphaRI or CD89), the Fcalpha/muR, and at least two alternative IgA receptors. These are the asialoglycoprotein receptor and the transferrin receptor, which have been implicated in IgA catabolism, and tissue IgA deposition. In this review we focus on the biology of FcalphaRI (CD89). FcalphaRI is expressed on neutrophils, eosinophils, monocytes/macrophages, dendritic cells, and Kupffer cells. This receptor represents a heterogeneously glycosylated transmembrane protein that binds both IgA subclasses with low affinity. A single gene encoding FcalphaRI has been isolated, which is located within the leukocyte receptor cluster on chromosome 19. The FcalphaRI alpha chain lacks canonical signal transduction domains but can associate with the FcR gamma-chain that bears an activation motif (ITAM) in the cytoplasmic domain, allowing activatory functions. FcalphaRI expressed alone mediates endocytosis and recyling of IgA. No FcalphaRI homologue has been defined in the mouse, and progress in defining the in vivo role of FcalphaRI has been made using human FcalphaRI transgenic (Tg) mice. FcalphaRI-Tg mice demonstrated FcalphaRI expression on Kupffer cells and so defined a key role for the receptor in mucosal defense. The receptor functions as a second line of antibacterial defense involving serum IgA rather than secretory IgA. Studies in FcalphaRI-Tg mice, furthermore, defined an essential role for soluble FcalphaRI in the development of IgA nephropathy by formation of circulating IgA-FcalphaRI complexes. Finally, recent work points out a role for human IgA in treatment of infectious and neoplastic diseases.
Monine, Michael I.; Posner, Richard G.; Savage, Paul B.; Faeder, James R.; Hlavacek, William S.
2010-01-01
Abstract We use flow cytometry to characterize equilibrium binding of a fluorophore-labeled trivalent model antigen to bivalent IgE-FcεRI complexes on RBL cells. We find that flow cytometric measurements are consistent with an equilibrium model for ligand-receptor binding in which binding sites are assumed to be equivalent and ligand-induced receptor aggregates are assumed to be acyclic. However, this model predicts extensive receptor aggregation at antigen concentrations that yield strong cellular secretory responses, which is inconsistent with the expectation that large receptor aggregates should inhibit such responses. To investigate possible explanations for this discrepancy, we evaluate four rule-based models for interaction of a trivalent ligand with a bivalent cell-surface receptor that relax simplifying assumptions of the equilibrium model. These models are simulated using a rule-based kinetic Monte Carlo approach to investigate the kinetics of ligand-induced receptor aggregation and to study how the kinetics and equilibria of ligand-receptor interaction are affected by steric constraints on receptor aggregate configurations and by the formation of cyclic receptor aggregates. The results suggest that formation of linear chains of cyclic receptor dimers may be important for generating secretory signals. Steric effects that limit receptor aggregation and transient formation of small receptor aggregates may also be important. PMID:20085718
Kawano, Susumu; Ito, Risa; Nishiyama, Miharu; Kubo, Mai; Matsushima, Tomoko; Minamisawa, Motoko; Ambo, Akihiro; Sasaki, Yusuke
2007-07-01
Receptor binding properties and antinociceptive activities of chimeric peptides linked by spacers were investigated. The peptides consisted of the micro-opioid receptor ligand dermorphin (Tyr-D-Ala-Phe-Gly-Tyr-Pro-Ser-NH(2)) or its analog YRFB (Tyr-D-Arg-Phe-betaAla-NH(2)) linked to the ORL1 receptor ligand Ac-Arg-Tyr-Tyr-Arg-Ile-Lys-NH(2) (Ac-RYYRIK-NH(2)). All chimeric peptides were found to possess high receptor binding affinities for both micro-opioid and ORL1 receptors in mouse brain membranes although their binding affinities for both receptors in spinal membranes were significantly lower. Among them, chimeric peptide 2, which consists of dermorphin and Ac-RYYRIK-NH(2) connected by a long spacer, had the highest binding affinity towards both receptors. In the tail-flick test following intrathecal (i.t.) administration to mice, all chimeric peptides showed potent and dose-dependent antinociceptive activities with an ED(50) of 1.34-4.51 (pmol/mouse), nearly comparable to dermorphin alone (ED(50); 1.08 pmol/mouse). In contrast to their micro-opioid receptor binding profiles, intracerebroventricular (i.c.v.) administration of the chimeric peptides resulted in much less potent antinociceptive activity (ED(50) 5.55-100< pmol/mouse) than when administered i.t. (ED(50): 1.34-4.51 pmol/mouse). These results suggest the involvement of nociceptin-like agonistic effects of the Ac-RYYRIK pharmacophore in the peptides, and the regulation of mu-opioid receptor-mediated antinociception in brain. The present chimeric peptides may be useful as pharmacological tools for studies on micro-opioid receptor/ORL1 receptor heterodimers.
Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.
Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S
1994-01-01
The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.
Vinpocetine regulates cation channel permeability of inner retinal neurons in the ischaemic retina.
Nivison-Smith, Lisa; Acosta, Monica L; Misra, Stuti; O'Brien, Brendan J; Kalloniatis, Michael
2014-01-01
Vinpocetine is a natural drug which exerts neuroprotective effects in ischaemia of the brain through actions on cation channels, glutamate receptors and other pathways. This study investigated the effect of vinpocetine on cation channel permeability of inner retinal neurons after acute retinal metabolic insult. We focused on amacrine and ganglion cells immunoreactive for calretinin or parvalbumin due to their previously documented susceptibility to ischaemia. Using the probe, 1-amino-4-guanidobutane (AGB), we observed increased cation channel permeability across amacrine and ganglion cells under ischaemia and hypoglycaemia but not anoxia. Calretinin and parvalbumin immunoreactivity was also reduced during ischaemia and hypoglyacemia but not anoxia. Vinpocetine decreased AGB entry into ischaemic and hypoglycaemic ganglion cells indicating that the drug can modulate unregulated cation entry. In addition, vinpocetine prevented the loss of calretinin and parvalbumin immunoreactivity following ischaemia suggesting it may indirectly regulate intracellular calcium. Vinpocetine also reduced AGB permeability in selected amacrine and ganglion cell populations following N-methyl-D-aspartate (NMDA) but not kainate activation suggesting that vinpocetine's regulation of cation channel permeability may partly involve NMDA sensitive glutamate receptors. Copyright © 2014 Elsevier Ltd. All rights reserved.
Cottrell, Graeme S.; Alemi, Farzad; Kirkland, Jacob G.; Grady, Eileen F.; Corvera, Carlos U.; Bhargava, Aditi
2012-01-01
Calcitonin gene-related peptide (CGRP) exerts its diverse effects on vasodilation, nociception, secretion, and motor function through a heterodimeric receptor comprising of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). Despite the importance of CLR•RAMP1 in human disease, little is known about its distribution in the human gastrointestinal (GI) tract, where it participates in inflammation and pain. In this study, we determined that CLR and RAMP1 mRNAs are expressed in normal human stomach, ileum and colon by RT-PCR. We next characterized antibodies that we generated to rat CLR and RAMP1 in transfected HEK cells. Having characterized these antibodies in vitro, we then localized CLR-, RAMP1-, CGRP- and intermedin-immunoreactivity (IMD-IR) in various human GI segments. In the stomach, nerve bundles in the myenteric plexus and nerve fibers throughout the circular and longitudinal muscle had prominent CLR-IR. In the proximal colon and ileum, CLR was found in nerve varicosities of the myenteric plexus and surrounding submucosal neurons. Interestingly, CGRP expressing fibers did not co-localize, but were in close proximity to CLR. However, CLR and RAMP1, the two subunits of a functional CGRP receptor were clearly localized in myenteric plexus, where they may form functional cell-surface receptors. IMD, another member of calcitonin peptide family was also found in close proximity to CLR, and like CGRP, did not co-localize with either CLR or RAMP1 receptors. Thus, CGRP and IMD appear to be released locally, where they can mediate their effect on their receptors regulating diverse functions such as inflammation, pain and motility. PMID:22484227
Evolution of olfactory receptors.
Hoover, Kara C
2013-01-01
Olfactory receptors are a specialized set of receptor cells responsible for the detection of odors. These cells are G protein-coupled receptors and expressed in the cell membranes of olfactory sensory neurons. Once a cell is activated by a ligand, it initiates a signal transduction cascade that produces a nerve impulse to the brain where odor perception is processed. Vertebrate olfactory evolution is characterized by birth-and-death events, a special case of the stochastic continuous time Markov process. Vertebrate fish have three general types of receptor cells (two dedicated to pheromones). Terrestrial animals have different epithelial biology due to the specialized adaptation to detecting airborne odors. Two general classes of olfactory receptor gene reflect the vertebrate marine heritage (Class I) and the derived amphibian, reptile, and mammal terrestrial heritage (Class II). While we know much about olfactory receptor cells, there are still areas where our knowledge is insufficient, such as intra-individual diversity throughout the life time, epigenetic processes acting on olfactory receptors, and association of ligands to specific cells.
NASA Technical Reports Server (NTRS)
Barr, B. G.; Martinko, E. A. (Principal Investigator)
1983-01-01
The activities of the Kansas Applied Remote Sensing (KARS) Program during the period April 1, 1982 through Marsh 31, 1983 are described. The most important work revolved around the Kansas Interagency Task Force on Applied Remote Sensing and its efforts to establish an operational service oriented remote sensing program in Kansas state government. Concomitant with this work was the upgrading of KARS capabilities to process data for state agencies through the vehicle of a low cost digital data processing system. The KARS Program continued to take an active role in irrigation mapping. KARS is now integrating data acquired through analysis of LANDSAT into geographic information systems designed for evaluating groundwater resources. KARS also continues to work at the national level on the national inventory of state natural resources information systems.
2004-09-07
receptors for the three Aedes kinins. Keywords: insect GPCR (G protein-coupled receptor ) (myo)kinin receptor ... receptor 57 © 2005 The Royal Entomological Society, Insect Molecular Biology , 14 , 55–67 58 P. V. Pietrantonio et al. © 2005 The... receptor 59 © 2005 The Royal Entomological Society, Insect Molecular Biology , 14 , 55–67 further support to the role of this receptor
Li, Li-Jun; Hu, Rong; Lujan, Brendan; Chen, Juan; Zhang, Jian-Jian; Nakano, Yasuko; Cui, Tian-Yuan; Liao, Ming-Xia; Chen, Jin-Cao; Man, Heng-Ye; Feng, Hua; Wan, Qi
2016-01-01
NMDA receptors are Ca2+-permeable ion channels. The activation of NMDA receptors requires agonist glutamate and co-agonist glycine. Recent evidence indicates that NMDA receptor also has metabotropic function. Here we report that in cultured mouse hippocampal neurons, glycine increases AMPA receptor-mediated currents independent of the channel activity of NMDA receptors and the activation of glycine receptors. The potentiation of AMPA receptor function by glycine is antagonized by the inhibition of ERK1/2. In the hippocampal neurons and in the HEK293 cells transfected with different combinations of NMDA receptors, glycine preferentially acts on GluN2A-containing NMDA receptors (GluN2ARs), but not GluN2B-containing NMDA receptors (GluN2BRs), to enhance ERK1/2 phosphorylation independent of the channel activity of GluN2ARs. Without requiring the channel activity of GluN2ARs, glycine increases AMPA receptor-mediated currents through GluN2ARs. Thus, these results reveal a metabotropic function of GluN2ARs in mediating glycine-induced potentiation of AMPA receptor function via ERK1/2 activation. PMID:27807405
Dissecting the signaling mechanisms underlying recognition and preference of food odors.
Harris, Gareth; Shen, Yu; Ha, Heonick; Donato, Alessandra; Wallis, Samuel; Zhang, Xiaodong; Zhang, Yun
2014-07-09
Food is critical for survival. Many animals, including the nematode Caenorhabditis elegans, use sensorimotor systems to detect and locate preferred food sources. However, the signaling mechanisms underlying food-choice behaviors are poorly understood. Here, we characterize the molecular signaling that regulates recognition and preference between different food odors in C. elegans. We show that the major olfactory sensory neurons, AWB and AWC, play essential roles in this behavior. A canonical Gα-protein, together with guanylate cyclases and cGMP-gated channels, is needed for the recognition of food odors. The food-odor-evoked signal is transmitted via glutamatergic neurotransmission from AWC and through AMPA and kainate-like glutamate receptor subunits. In contrast, peptidergic signaling is required to generate preference between different food odors while being dispensable for the recognition of the odors. We show that this regulation is achieved by the neuropeptide NLP-9 produced in AWB, which acts with its putative receptor NPR-18, and by the neuropeptide NLP-1 produced in AWC. In addition, another set of sensory neurons inhibits food-odor preference. These mechanistic logics, together with a previously mapped neural circuit underlying food-odor preference, provide a functional network linking sensory response, transduction, and downstream receptors to process complex olfactory information and generate the appropriate behavioral decision essential for survival. Copyright © 2014 the authors 0270-6474/14/339389-15$15.00/0.
Dissecting the Signaling Mechanisms Underlying Recognition and Preference of Food Odors
Harris, Gareth; Shen, Yu; Ha, Heonick; Donato, Alessandra; Wallis, Samuel; Zhang, Xiaodong
2014-01-01
Food is critical for survival. Many animals, including the nematode Caenorhabditis elegans, use sensorimotor systems to detect and locate preferred food sources. However, the signaling mechanisms underlying food-choice behaviors are poorly understood. Here, we characterize the molecular signaling that regulates recognition and preference between different food odors in C. elegans. We show that the major olfactory sensory neurons, AWB and AWC, play essential roles in this behavior. A canonical Gα-protein, together with guanylate cyclases and cGMP-gated channels, is needed for the recognition of food odors. The food-odor-evoked signal is transmitted via glutamatergic neurotransmission from AWC and through AMPA and kainate-like glutamate receptor subunits. In contrast, peptidergic signaling is required to generate preference between different food odors while being dispensable for the recognition of the odors. We show that this regulation is achieved by the neuropeptide NLP-9 produced in AWB, which acts with its putative receptor NPR-18, and by the neuropeptide NLP-1 produced in AWC. In addition, another set of sensory neurons inhibits food-odor preference. These mechanistic logics, together with a previously mapped neural circuit underlying food-odor preference, provide a functional network linking sensory response, transduction, and downstream receptors to process complex olfactory information and generate the appropriate behavioral decision essential for survival. PMID:25009271
The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong
2015-11-30
Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibitsmore » constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.« less
40 CFR 52.875 - Original identification of plan section.
Code of Federal Regulations, 2014 CFR
2014-07-01
... applicable to stationary sources subject to prevention of significant deterioration (PSD) permit requirements... interim stack height policy for each PSD permit issued until such time as EPA revises its general stack... submitted rule revisions to K.A.R. 28-19-17, the PSD rule; to K.A.R. 28-19-19, the CEM rule; and to K.A.R...
40 CFR 52.875 - Original identification of plan section.
Code of Federal Regulations, 2012 CFR
2012-07-01
... applicable to stationary sources subject to prevention of significant deterioration (PSD) permit requirements... interim stack height policy for each PSD permit issued until such time as EPA revises its general stack... submitted rule revisions to K.A.R. 28-19-17, the PSD rule; to K.A.R. 28-19-19, the CEM rule; and to K.A.R...
40 CFR 52.875 - Original identification of plan section.
Code of Federal Regulations, 2013 CFR
2013-07-01
... applicable to stationary sources subject to prevention of significant deterioration (PSD) permit requirements... interim stack height policy for each PSD permit issued until such time as EPA revises its general stack... submitted rule revisions to K.A.R. 28-19-17, the PSD rule; to K.A.R. 28-19-19, the CEM rule; and to K.A.R...
40 CFR 52.875 - Original identification of plan section.
Code of Federal Regulations, 2011 CFR
2011-07-01
... applicable to stationary sources subject to prevention of significant deterioration (PSD) permit requirements... interim stack height policy for each PSD permit issued until such time as EPA revises its general stack... submitted rule revisions to K.A.R. 28-19-17, the PSD rule; to K.A.R. 28-19-19, the CEM rule; and to K.A.R...
Molecular properties of muscarinic acetylcholine receptors
HAGA, Tatsuya
2013-01-01
Muscarinic acetylcholine receptors, which comprise five subtypes (M1-M5 receptors), are expressed in both the CNS and PNS (particularly the target organs of parasympathetic neurons). M1-M5 receptors are integral membrane proteins with seven transmembrane segments, bind with acetylcholine (ACh) in the extracellular phase, and thereafter interact with and activate GTP-binding regulatory proteins (G proteins) in the intracellular phase: M1, M3, and M5 receptors interact with Gq-type G proteins, and M2 and M4 receptors with Gi/Go-type G proteins. Activated G proteins initiate a number of intracellular signal transduction systems. Agonist-bound muscarinic receptors are phosphorylated by G protein-coupled receptor kinases, which initiate their desensitization through uncoupling from G proteins, receptor internalization, and receptor breakdown (down regulation). Recently the crystal structures of M2 and M3 receptors were determined and are expected to contribute to the development of drugs targeted to muscarinic receptors. This paper summarizes the molecular properties of muscarinic receptors with reference to the historical background and bias to studies performed in our laboratories. PMID:23759942
Fischer, J A; Muff, R; Born, W
2002-08-01
The calcitonin (CT) receptor (CTR) and the CTR-like receptor (CRLR) are close relatives within the type II family of G-protein-coupled receptors, demonstrating sequence identity of 50%. Unlike the interaction between CT and CTR, receptors for the related hormones and neuropeptides amylin, CT-gene-related peptide (CGRP) and adrenomedullin (AM) require one of three accessory receptor-activity-modifying proteins (RAMPs) for ligand recognition. An amylin/CGRP receptor is revealed when CTR is co-expressed with RAMP1. When complexed with RAMP3, CTR interacts with amylin alone. CRLR, initially classed as an orphan receptor, is a CGRP receptor when co-expressed with RAMP1. The same receptor is specific for AM in the presence of RAMP2. Together with human RAMP3, CRLR defines an AM receptor, and with mouse RAMP3 it is a low-affinity CGRP/AM receptor. CTR-RAMP1, antagonized preferentially by salmon CT-(8-32) and not by CGRP-(8-37), and CRLR-RAMP1, antagonized by CGRP-(8-37), are two CGRP receptor isotypes. Thus amylin and CGRP interact specifically with heterodimeric complexes between CTR and RAMP1 or RAMP3, and CGRP and AM interact with complexes between CRLR and RAMP1, RAMP2 or RAMP3.
Pathophysiological consequences of receptor mistraffic: Tales from the platelet P2Y12 receptor.
Cunningham, Margaret R; Aungraheeta, Riyaad; Mundell, Stuart J
2017-07-05
Genetic variations in G protein-coupled receptor (GPCR) genes can disrupt receptor function in a wide variety of human genetic diseases, including platelet bleeding disorders. Platelets are critical for haemostasis with inappropriate platelet activation leading to the development of arterial thrombosis, which can result in heart attack and stroke whilst decreased platelet activity is associated with an increased risk of bleeding. GPCRs expressed on the surface of platelets play key roles in regulating platelet activity and therefore function. Receptors include purinergic receptors (P2Y 1 and P2Y 12 ), proteinase-activated receptor (PAR1 and PAR4) and thromboxane receptors (TPα), among others. Pharmacological blockade of these receptors forms a powerful therapeutic tool in the treatment and prevention of arterial thrombosis. With the advance of genomic technologies, there has been a substantial increase in the identification of naturally occurring rare and common GPCR variants. These variants include single-nucleotide polymorphisms (SNPs) and insertion or deletions that have the potential to alter GPCR expression or function. A number of defects in platelet GPCRs that disrupt receptor function have now been characterized in patients with mild bleeding disorders. This review will focus on rare, function-disrupting variants of platelet GPCRs with particular emphasis upon mutations in the P2Y 12 receptor gene that affect receptor traffic to modulate platelet function. Further this review will outline how the identification and characterization of function-disrupting GPCR mutations provides an essential link in translating our detailed understanding of receptor traffic and function in cell line studies into relevant human biological systems. Copyright © 2017. Published by Elsevier B.V.
Tachykinin receptors and the airways.
Frossard, N; Advenier, C
1991-01-01
The tachykinins, substance P, neurokinin A and neurokinin B, belong to a structural family of peptides. In mammalian airways, substance P and neurokinin A are colocalized to afferent C-fibres. Substance P-containing fibres are close to bronchial epithelium, smooth muscle, mucus glands and blood vessels. Sensory neuropeptides may be released locally, possibly as a result of a local reflex, and produce bronchial obstruction through activation of specific receptors on these various tissues. Three types of tachykinin receptors, namely NK-1, NK-2 and NK-3 receptors, have been characterized by preferential activation by substance P, neurokinin A and neurokinin B respectively. NK-1 and NK-2 receptors were recently cloned. The determination of receptor types involved in the effects of tachykinins in the airways has been done with synthetic agonists and antagonists binding specifically to NK-1, NK-2 and NK-3 receptors. Although the existence of species differences, the conclusion that bronchial smooth muscle contraction is mainly related to activation of NK-2 receptors on bronchial smooth muscle cell has been drawn. The hypothesis of a NK-2 receptor subclassification has been proposed with NK-2A receptor subtype in the guinea-pig airways. Other effects in the airways are related to stimulation of NK-1 receptors on mucus cells, vessels, epithelium and inflammatory cells. A non-receptor-mediated mechanism is also involved in the effect of substance P on inflammatory cells and mast cells.
Marini, Pietro; Cascio, Maria-Grazia; King, Angela; Pertwee, Roger G; Ross, Ruth A
2013-01-01
Background and Purpose Although cannabinoid CB2 receptor ligands have been widely characterized in recombinant systems in vitro, little pharmacological characterization has been performed in tissues natively expressing CB2 receptors. The aim of this study was to compare the pharmacology of CB2 receptor ligands in tissue natively expressing CB2 receptors (human, rat and mouse spleen) and hCB2-transfected CHO cells. Experimental Approach We tested the ability of well-known cannabinoid CB2 receptor ligands to stimulate or inhibit [35S]GTPγS binding to mouse, rat and human spleen membranes and to hCB2-transfected CHO cell membranes. cAMP assays were also performed in hCB2-CHO cells. Key Results The data presented demonstrate that: (i) CP 55,940, WIN 55,212-2 and JWH 133 behave as CB2 receptor full agonists both in spleen and hCB2-CHO cells, in both [35S]GTPγS and cAMP assays; (ii) JWH 015 behaves as a low-efficacy agonist in spleen as well as in hCB2-CHO cells when tested in the [35S]GTPγS assay, while it displays full agonism when tested in the cAMP assay using hCB2-CHO cells; (iii) (R)-AM 1241 and GW 405833 behave as agonists in the [35S]GTPγS assay using spleen, instead it behaves as a low-efficacy inverse agonist in hCB2-CHO cells; and (iv) SR 144528, AM 630 and JTE 907 behave as CB2 receptor inverse agonists in all the tissues. Conclusion and Implications Our results demonstrate that CB2 receptor ligands can display differential pharmacology when assays are conducted in tissues that natively express CB2 receptors and imply that conclusions from recombinant CB2 receptors should be treated with caution. PMID:23711022
Selective Glucocorticoid Receptor modulators.
De Bosscher, Karolien
2010-05-31
The ancient two-faced Roman god Janus is often used as a metaphor to describe the characteristics of the Glucocorticoid Receptor (NR3C1), which exhibits both a beneficial side, that serves to halt inflammation, and a detrimental side responsible for undesirable effects. However, recent developments suggest that the Glucocorticoid Receptor has many more faces with the potential to express a range of different functionalities, depending on factors that include the tissue type, ligand type, receptor variants, cofactor surroundings and target gene promoters. This behavior of the receptor has made the development of safer ligands, that trigger the expression program of only a desirable subset of genes, a real challenge. Thus more knowledge-based fundamental research is needed to ensure the design and development of selective Glucocorticoid Receptor modulators capable of reaching the clinic. Recent advances in the characterization of novel selective Glucocorticoid Receptor modulators, specifically in the context of anti-inflammatory strategies, will be described in this review. 2010 Elsevier Ltd. All rights reserved.
Lane-Serff, Harriet; MacGregor, Paula; Peacock, Lori; Macleod, Olivia Js; Kay, Christopher; Gibson, Wendy; Higgins, Matthew K; Carrington, Mark
2016-04-15
The haptoglobin-haemoglobin receptor of the African trypanosome species, Trypanosoma brucei, is expressed when the parasite is in the bloodstream of the mammalian host, allowing it to acquire haem through the uptake of haptoglobin-haemoglobin complexes. Here we show that in Trypanosoma congolense this receptor is instead expressed in the epimastigote developmental stage that occurs in the tsetse fly, where it acts as a haemoglobin receptor. We also present the structure of the T. congolense receptor in complex with haemoglobin. This allows us to propose an evolutionary history for this receptor, charting the structural and cellular changes that took place as it adapted from a role in the insect to a new role in the mammalian host.
Klotho converts canonical FGF receptor into a specific receptor for FGF23.
Urakawa, Itaru; Yamazaki, Yuji; Shimada, Takashi; Iijima, Kousuke; Hasegawa, Hisashi; Okawa, Katsuya; Fujita, Toshiro; Fukumoto, Seiji; Yamashita, Takeyoshi
2006-12-07
FGF23 is a unique member of the fibroblast growth factor (FGF) family because it acts as a hormone that derives from bone and regulates kidney functions, whereas most other family members are thought to regulate various cell functions at a local level. The renotropic activity of circulating FGF23 indicates the possible presence of an FGF23-specific receptor in the kidney. Here we show that a previously undescribed receptor conversion by Klotho, a senescence-related molecule, generates the FGF23 receptor. Using a renal homogenate, we found that Klotho binds to FGF23. Forced expression of Klotho enabled the high-affinity binding of FGF23 to the cell surface and restored the ability of a renal cell line to respond to FGF23 treatment. Moreover, FGF23 incompetence was induced by injecting wild-type mice with an anti-Klotho monoclonal antibody. Thus, Klotho is essential for endogenous FGF23 function. Because Klotho alone seemed to be incapable of intracellular signalling, we searched for other components of the FGF23 receptor and found FGFR1(IIIc), which was directly converted by Klotho into the FGF23 receptor. Thus, the concerted action of Klotho and FGFR1(IIIc) reconstitutes the FGF23 receptor. These findings provide insights into the diversity and specificity of interactions between FGF and FGF receptors.
Neurotrophin receptor structure and interactions.
Yano, H; Chao, M V
2000-03-01
Although ligand-induced dimerization or oligomerization of receptors is a well established mechanism of growth factor signaling, increasing evidence indicates that biological responses are often mediated by receptor trans-signaling mechanisms involving two or more receptor systems. These include G protein-coupled receptors, cytokine, growth factor and trophic factor receptors. Greater flexibility is provided when different signaling pathways are merged through multiple receptor signaling systems. Trophic factors exemplified by NGF and its family members, ciliary neurotrophic factor (CNTF) and glial derived neurotrophic factor (GDNF) all utilize increased tyrosine phosphorylation of cellular substrates to mediate neuronal cell survival. Actions of the NGF family of neurotrophins are not only dictated by ras activation through the Trk family of receptor tyrosine kinases, but also a survival pathway defined by phosphatidylinositol-3-kinase activity (Yao and Cooper, 1995), which gives rise to phosphoinositide intermediates that activate the serine/threonine kinase Akt/PKB (Dudek et al., 1997). Induction of the serine-threonine kinase activity is critical for cell survival, as well as cell proliferation. Hence, for many trophic factors, multiple proteins constitute a functional multisubunit receptor complex that activates ras-dependent and ras-independent intracellular signaling. The NGF receptors provide an example of bidirectional crosstalk. In the presence of TrkA receptors, p75 can participate in the formation of high affinity binding sites and enhanced neurotrophin responsiveness leading to a survival or differentiation signal. In the absence of TrkA receptors, p75 can generate, in only specific cell populations, a death signal. These activities include the induction of NF kappa B (Carter et al., 1996); the hydrolysis of sphingomyelin to ceramide (Dobrowsky et al., 1995); and the pro-apoptotic functions attributed to p75. Receptors are generally drawn and viewed as
L-glutamate Receptor In Paramecium
NASA Astrophysics Data System (ADS)
Bernal-Martínez, Juan; Ortega-Soto, Arturo
2004-09-01
Behavioral, electrophysiological and biochemical experiments were performed in order to establish the presence of a glutamate receptor in the ciliate Paramecium. It was found that an AMPA/KA receptor is functionally expressed in Paramecium and that this receptor is immunologically and fillogenetically related to the AMPA/KA receptor present in vertebrates.
Do receptors get pregnant too? Adrenergic receptor alterations in human pregnancy.
Smiley, R M; Finster, M
1996-01-01
In this review we discuss adrenergic receptor number and function during pregnancy, with emphasis on evidence that pregnancy results in specific receptor alterations from the nonpregnant state. Changes in adrenergic receptor function or distribution in vascular smooth muscle may be in part responsible for the decreased vascular responsiveness seen in human pregnancy, and the lack of the normal alterations may be a part of the syndromes of gestational hypertension, including preeclampsia-eclampsia. The onset of labor may be influenced by adrenergic modulation, and receptor or postreceptor level molecular alterations may trigger or facilitate normal or preterm labor. Human studies are emphasized when possible to assess the role of adrenergic signal transduction regulation in the physiology and pathophysiology of normal and complicated human pregnancy.
Receptor recruitment: A mechanism for interactions between G protein-coupled receptors
Holtbäck, Ulla; Brismar, Hjalmar; DiBona, Gerald F.; Fu, Michael; Greengard, Paul; Aperia, Anita
1999-01-01
There is a great deal of evidence for synergistic interactions between G protein-coupled signal transduction pathways in various tissues. As two specific examples, the potent effects of the biogenic amines norepinephrine and dopamine on sodium transporters and natriuresis can be modulated by neuropeptide Y and atrial natriuretic peptide, respectively. Here, we report, using a renal epithelial cell line, that both types of modulation involve recruitment of receptors from the interior of the cell to the plasma membrane. The results indicate that recruitment of G protein-coupled receptors may be a ubiquitous mechanism for receptor sensitization and may play a role in the modulation of signal transduction comparable to that of the well established phenomenon of receptor endocytosis and desensitization. PMID:10377404
Translating 5-HT receptor pharmacology.
Sanger, G J
2009-12-01
Since metoclopramide was first described (in 1964) there have been several attempts to develop compounds which retained gastrointestinal prokinetic activity (via 5-HT(4) receptor activation) but without the limiting side effects associated with dopamine D(2) receptor antagonism. Early compounds (mosapride, cisapride, renzapride, tegaserod) were identified before several of the 5-HT receptors were even described (including 5-HT(4) and 5-HT(2B)), whereas prucalopride came later. Several compounds were hampered by non-selectivity, introducing cardiac liability (cisapride: activity at human Ether-a-go-go Related Gene) or potentially, a reduced intestinal prokinetic activity caused by activity at a second 5-HT receptor (renzapride: antagonism at the 5-HT(3) receptor; tegaserod: antagonism at the 5-HT(2B) receptor). Poor intrinsic activity at gastrointestinal 5-HT(4) receptors has also been an issue (mosapride, tegaserod). Perhaps prucalopride has now achieved the profile of good selectivity of action and high intrinsic activity at intestinal 5-HT(4) receptors, without clinically-meaningful actions on 5-HT(4) receptors in the heart. The progress of this compound for treatment of chronic constipation, as well as competitor molecules such as ATI-7505 and TD-5108, will now be followed with interest as each attempts to differentiate themselves from each other. Perhaps at last, 5-HT(4) receptor agonists are being given the chance to show what they can do.
Emergence of the pre-Bötzinger respiratory rhythm generator in the mouse embryo.
Thoby-Brisson, Muriel; Trinh, Jean-Baptiste; Champagnat, Jean; Fortin, Gilles
2005-04-27
To obtain insights into the emergence of rhythmogenic circuits supporting respiration, we monitored spontaneous activities in isolated brainstem and medullary transverse slice preparations of mouse embryos, combining electrophysiological and calcium imaging techniques. At embryonic day 15 (E15), in a restricted region ventral to the nucleus ambiguus, we observed the onset of a sustained high-frequency (HF) respiratory-like activity in addition to a preexisting low-frequency activity having a distinct initiation site, spatial extension, and susceptibility to gap junction blockers. At the time of its onset, the HF generator starts to express the neurokinin 1 receptor, is connected bilaterally, requires active AMPA/kainate glutamatergic synapses, and is modulated by substance P and the mu-opioid agonist D-Ala2-N-Me-Phe4-Glycol5-enkephalin. We conclude that a rhythm generator sharing the properties of the neonatal pre-Bötzinger complex becomes active during E15 in mice.
Ecke, Denise; Hanck, Theodor; Tulapurkar, Mohan E; Schäfer, Rainer; Kassack, Matthias; Stricker, Rolf; Reiser, Georg
2008-01-01
Nucleotides signal through purinergic receptors such as the P2 receptors, which are subdivided into the ionotropic P2X receptors and the metabotropic P2Y receptors. The diversity of functions within the purinergic receptor family is required for the tissue-specificity of nucleotide signalling. In the present study, hetero-oligomerization between two metabotropic P2Y receptor subtypes is established. These receptors, P2Y1 and P2Y11, were found to associate together when co-expressed in HEK293 cells. This association was detected by co-pull-down, immunoprecipitation and FRET (fluorescence resonance energy transfer) experiments. We found a striking functional consequence of the interaction between the P2Y11 receptor and the P2Y1 receptor where this interaction promotes agonist-induced internalization of the P2Y11 receptor. This is remarkable because the P2Y11 receptor by itself is not able to undergo endocytosis. Co-internalization of these receptors was also seen in 1321N1 astrocytoma cells co-expressing both P2Y11 and P2Y1 receptors, upon stimulation with ATP or the P2Y1 receptor-specific agonist 2-MeS-ADP. 1321N1 astrocytoma cells do not express endogenous P2Y receptors. Moreover, in HEK293 cells, the P2Y11 receptor was found to functionally associate with endogenous P2Y1 receptors. Treatment of HEK293 cells with siRNA (small interfering RNA) directed against the P2Y1 receptor diminished the agonist-induced endocytosis of the heterologously expressed GFP-P2Y11 receptor. Pharmacological characteristics of the P2Y11 receptor expressed in HEK293 cells were determined by recording Ca2+ responses after nucleotide stimulation. This analysis revealed a ligand specificity which was different from the agonist profile established in cells expressing the P2Y11 receptor as the only metabotropic nucleotide receptor. Thus the hetero-oligomerization of the P2Y1 and P2Y11 receptors allows novel functions of the P2Y11 receptor in response to extracellular nucleotides.
How theories evolved concerning the mechanism of action of barbiturates.
Löscher, Wolfgang; Rogawski, Michael A
2012-12-01
The barbiturate phenobarbital has been in use in the treatment of epilepsy for 100 years. It has long been recognized that barbiturates act by prolonging and potentiating the action of γ-aminobutyric acid (GABA) on GABA(A) receptors and at higher concentrations directly activating the receptors. A large body of data supports the concept that GABA(A) receptors are the primary central nervous system target for barbiturates, including the finding that transgenic mice with a point mutation in the β3 GABA(A) -receptor subunit exhibit diminished sensitivity to the sedative and immobilizing actions of the anesthetic barbiturate pentobarbital. Although phenobarbital is only modestly less potent as a GABA(A) -receptor modulator than pentobarbital, phenobarbital is minimally sedating at effective anticonvulsant doses. Possible explanations for the reduced sedative effect of phenobarbital include more regionally restricted action; partial agonist activity; reduced propensity to directly activate GABA(A) receptors (possibly including extrasynaptic receptors containing δ subunits); and reduced activity at other ion channel targets, including voltage-gated calcium channels. In recent years, substantial progress has been made in defining the structural features of GABA(A) receptors responsible for gating and allosteric modulation by drugs. Although the precise sites of action of barbiturates have not yet been defined, the second and third transmembrane domains of the β subunit appear to be critical; binding may involve a pocket formed by β-subunit methionine 286 as well as α-subunit methionine 236. In addition to effects on GABA(A) receptors, barbiturates block AMPA/kainate receptors, and they inhibit glutamate release through an effect on P/Q-type high-voltage activated calcium channels. The combination of these various actions likely accounts for their diverse clinical activities. Despite the remarkable progress of the last century, there is still much to learn about the
Hypothyroidism Affects D2 Receptor-mediated Breathing without altering D2 Receptor Expression
Schlenker, Evelyn H.; Rio, Rodrigo Del; Schultz, Harold D.
2015-01-01
Bromocriptine depressed ventilation in air and D2 receptor expression in the nucleus tractus solitaries (NTS) in male hypothyroid hamsters. Here we postulated that in age- matched hypothyroid female hamsters, the pattern of D2 receptor modulation of breathing and D2 receptor expression would differ from those reported in hypothyroid males. In females hypothyroidism did not affect D2 receptor protein levels in the NTS, carotid bodies or striatum. Bromocriptine, but not carmoxirole (a peripheral D2 receptor agonist), increased oxygen consumption and body temperature in awake air-exposed hypothyroid female hamsters and stimulated their ventilation before and following exposure to hypoxia. Carmoxirole depressed frequency of breathing in euthyroid hamsters prior to, during and following hypoxia exposures and stimulated it in the hypothyroid hamsters following hypoxia. Although hypothyroidism did not affect expression of D2 receptors, it influenced central D2 modulation of breathing in a disparate manner relative to euthyroid hamsters. PMID:24434437
Hypothyroidism affects D2 receptor-mediated breathing without altering D2 receptor expression.
Schlenker, Evelyn H; Del Rio, Rodrigo; Schultz, Harold D
2014-03-01
Bromocriptine depressed ventilation in air and D2 receptor expression in the nucleus tractus solitaries (NTS) in male hypothyroid hamsters. Here we postulated that in age-matched hypothyroid female hamsters, the pattern of D2 receptor modulation of breathing and D2 receptor expression would differ from those reported in hypothyroid males. In females hypothyroidism did not affect D2 receptor protein levels in the NTS, carotid bodies or striatum. Bromocriptine, but not carmoxirole (a peripheral D2 receptor agonist), increased oxygen consumption and body temperature in awake air-exposed hypothyroid female hamsters and stimulated their ventilation before and following exposure to hypoxia. Carmoxirole depressed frequency of breathing in euthyroid hamsters prior to, during and following hypoxia exposures and stimulated it in the hypothyroid hamsters following hypoxia. Although hypothyroidism did not affect expression of D2 receptors, it influenced central D2 modulation of breathing in a disparate manner relative to euthyroid hamsters. Copyright © 2014 Elsevier B.V. All rights reserved.
Iglarz, Marc; Steiner, Pauline; Wanner, Daniel; Rey, Markus; Hess, Patrick; Clozel, Martine
2015-10-01
The goal of this study was to characterize the role of Endothelin (ET) type B receptors (ETB) on vascular function in healthy and diseased conditions and demonstrate how it affects the pharmacological activity of ET receptor antagonists (ERAs). The contribution of the ETB receptor to vascular relaxation or constriction was characterized in isolated arteries from healthy and diseased rats with systemic (Dahl-S) or pulmonary hypertension (monocrotaline). Because the role of ETB receptors is different in pathological vis-à-vis normal conditions, we compared the efficacy of ETA-selective and dual ETA/ETB ERAs on blood pressure in hypertensive rats equipped with telemetry. In healthy vessels, ETB receptors stimulation with sarafotoxin S6c induced vasorelaxation and no vasoconstriction. In contrast, in arteries of rats with systemic or pulmonary hypertension, endothelial ETB-mediated relaxation was lost while vasoconstriction on stimulation by sarafotoxin S6c was observed. In hypertensive rats, administration of the dual ETA/ETB ERA macitentan on top of a maximal effective dose of the ETA-selective ERA ambrisentan further reduced blood pressure, indicating that ETB receptors blockade provides additional benefit. Taken together, these data suggest that in pathology, dual ETA/ETB receptor antagonism can provide superior vascular effects compared with ETA-selective receptor blockade.
40 CFR 52.920 - Identification of plan.
Code of Federal Regulations, 2011 CFR
2011-07-01
... for non-major sources 01/15/01 09/06/06, 71 FR 52464 401 KAR 52:090 Prohibitory rule for hot mix... paper surface coating operations 06/24/92 06/23/94, 59 FR 32343. 401 KAR 59:212 New graphic arts.../24/92 06/23/94, 59 FR 32343. 401 KAR 61:120 Existing fabric, vinyl and paper surface coating...
40 CFR 52.920 - Identification of plan.
Code of Federal Regulations, 2012 CFR
2012-07-01
... for non-major sources 01/15/01 09/06/06, 71 FR 52464 401 KAR 52:090 Prohibitory rule for hot mix... paper surface coating operations 06/24/92 06/23/94, 59 FR 32343. 401 KAR 59:212 New graphic arts.../24/92 06/23/94, 59 FR 32343. 401 KAR 61:120 Existing fabric, vinyl and paper surface coating...
Kuo, Chao-Lin; Agrawal, Dinesh-Chandra; Chang, Hung-Chi; Chiu, Ya-Ting; Huang, Chu-Peng; Chen, Yi-Lin; Huang, Shih-Hung; Tsay, Hsin-Sheng
2015-12-01
Saussurea involucrata (Kar. et Kir.) commonly known as 'snow lotus' or 'Xue Lian' is an important plant in the traditional Chinese system of medicine. The plant contains flavonoids such as syringin and rutin. These compounds have been reported to be anti-rheumatic, anti-inflammatory and dilate blood vessels, lower blood pressure, prevent cardiovascular diseases, enhance immunity, and act as anti-aging, anti-cancer, and anti-fatigue agents. The species has become endangered due to the excessive collection of S. involucrata plants in the wild, slower plant growth and ecological destruction of natural habitats. There is a severe shortage of plant material, while the market demand is ever increasing. Hence, it is very important to apply tissue culture technique for plant propagation and production of the bioactive compounds of this species. Multiple shoot induction and proliferation in shoot base explants derived from in vitro raised seedlings of S. involucrata was achieved on 3/4 strength of Murashige and Skoog's (MS) basal medium (MSBM) supplemented with 1.0 mg/L -1 BA and 1.5 mg/L -1 NAA. Rooting was induced in 100 % shoots cultured on 1/2X MSBM supplemented with 1.0 mg/L -1 IBA for one week and then transfer to auxin free medium. The plantlets could be acclimatized successfully by sachet technique and established in the greenhouse. Maximum callus induction and proliferation in leaf segments was achieved on 1/2X MSBM supplemented with 0.5 mg/L -1 BA, 0.5 mg/L -1 NAA, 0.4 % gelrite and on incubation at 20 °C. Container closures had an influence on the quality and quantity of callus and production of the active compounds. The HPLC analysis showed much higher syringin content in in vitro shoots and callus as compared to commercially available market crude drug. The present study describes an in vitro culture protocol of Saussurea involucrata. The bioactive compounds, syringin and rutin could be produced through tissue culture technique without sacrificing the
Adenosine receptor desensitization and trafficking.
Mundell, Stuart; Kelly, Eamonn
2011-05-01
As with the majority of G-protein-coupled receptors, all four of the adenosine receptor subtypes are known to undergo agonist-induced regulation in the form of desensitization and trafficking. These processes can limit the ability of adenosine receptors to couple to intracellular signalling pathways and thus reduce the ability of adenosine receptor agonists as well as endogenous adenosine to produce cellular responses. In addition, since adenosine receptors couple to multiple signalling pathways, these pathways may desensitize differentially, while the desensitization of one pathway could even trigger signalling via another. Thus, the overall picture of adenosine receptor regulation can be complex. For all adenosine receptor subtypes, there is evidence to implicate arrestins in agonist-induced desensitization and trafficking, but there is also evidence for other possible forms of regulation, including second messenger-dependent kinase regulation, heterologous effects involving G proteins, and the involvement of non-clathrin trafficking pathways such as caveolae. In this review, the evidence implicating these mechanisms is summarized for each adenosine receptor subtype, and we also discuss those issues of adenosine receptor regulation that remain to be resolved as well as likely directions for future research in this field. Copyright © 2010 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koide, T.; Matsushita, H.
1981-03-09
The chronic effects of antidepressant treatment on striatal dopaminergic (DA) and muscarinic cholinergic (mACh) receptors of the rat brain have been examined comparatively in this study using /sup 3/H-spiroperidol (/sup 3/H-SPD) and /sup 3/H-quinuclidinyl benzilate (/sup 3/H-QNB) as the respective radioactive ligands. Imipramine and desipramine were used as prototype antidepressants. Although a single administration of imipramine or desipramine did not affect each receptor sensitivity, chronic treatment with each drug caused a supersensitivity of mACh receptor subsequent to DA receptor subsensitivity. Furthermore, it has been suggested that anti-mACh properties of imipramine or desipramine may not necessarily be related to the manifestationmore » of mACh receptor supersensitivity and that sustained DA receptor subsensitivity may play some role in the alterations of mACh receptor sensitivity.« less
Moreno, Estefanía; Moreno-Delgado, David; Navarro, Gemma; Hoffmann, Hanne M.; Fuentes, Silvia; Rosell-Vilar, Santi; Gasperini, Paola; Rodríguez-Ruiz, Mar; Medrano, Mireia; Mallol, Josefa; Cortés, Antoni; Casadó, Vicent; Lluís, Carme; Ferré, Sergi; Ortiz, Jordi; Canela, Enric
2014-01-01
The general effects of cocaine are not well understood at the molecular level. What is known is that the dopamine D1 receptor plays an important role. Here we show that a key mechanism may be cocaine's blockade of the histamine H3 receptor-mediated inhibition of D1 receptor function. This blockade requires the σ1 receptor and occurs upon cocaine binding to σ1-D1-H3 receptor complexes. The cocaine-mediated disruption leaves an uninhibited D1 receptor that activates Gs, freely recruits β-arrestin, increases p-ERK 1/2 levels, and induces cell death when over activated. Using in vitro assays with transfected cells and in ex vivo experiments using both rats acutely treated or self-administered with cocaine along with mice depleted of σ1 receptor, we show that blockade of σ1 receptor by an antagonist restores the protective H3 receptor-mediated brake on D1 receptor signaling and prevents the cell death from elevated D1 receptor signaling. These findings suggest that a combination therapy of σ1R antagonists with H3 receptor agonists could serve to reduce some effects of cocaine. PMID:24599455
Bachmanov, Alexander A.; Bosak, Natalia P.; Lin, Cailu; Matsumoto, Ichiro; Ohmoto, Makoto; Reed, Danielle R.; Nelson, Theodore M.
2016-01-01
Taste receptors function as one of the interfaces between internal and external milieus. Taste receptors for sweet and umami (T1R [taste receptor, type 1]), bitter (T2R [taste receptor, type 2]), and salty (ENaC [epithelial sodium channel]) have been discovered in the recent years, but transduction mechanisms of sour taste and ENaC-independent salt taste are still poorly understood. In addition to these five main taste qualities, the taste system detects such noncanonical “tastes” as water, fat, and complex carbohydrates, but their reception mechanisms require further research. Variations in taste receptor genes between and within vertebrate species contribute to individual and species differences in taste-related behaviors. These variations are shaped by evolutionary forces and reflect species adaptations to their chemical environments and feeding ecology. Principles of drug discovery can be applied to taste receptors as targets in order to develop novel taste compounds to satisfy demand in better artificial sweeteners, enhancers of sugar and sodium taste, and blockers of bitterness of food ingredients and oral medications. PMID:23886383
Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H
2012-01-01
BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512
Lee, Sangho; Privalsky, Martin L.
2009-01-01
Nuclear receptors are ligand-regulated transcription factors that regulate key aspects of metazoan development, differentiation, and homeostasis. Nuclear receptors recognize target genes by binding to specific DNA recognition sequences, denoted hormone response elements (HREs). Many nuclear receptors can recognize HREs as either homodimers or heterodimers. Retinoid X receptors (RXRs), in particular, serve as important heterodimer partners for many other nuclear receptors, including thyroid hormone receptors (TRs), and RXR/TR heterodimers have been proposed to be the primary mediators of target gene regulation by T3 hormone. Here, we report that the retinoic acid receptors (RARs), a distinct class of nuclear receptors, are also efficient heterodimer partners for TRs. These RAR/TR heterodimers form with similar affinities as RXR/TR heterodimers on an assortment of consensus and natural HREs, and preferentially assemble with the RAR partner 5′ of the TR moiety. The corepressor and coactivator recruitment properties of these RAR/TR heterodimers and their transcriptional activities in vivo are distinct from those observed with the corresponding RXR heterodimers. Our studies indicate that RXRs are not unique in their ability to partner with TRs, and that RARs can also serve as robust heterodimer partners and combinatorial regulators of T3-modulated gene expression. PMID:15650024
Dupré, Clémence; Bruno, Olivier; Bonnaud, Anne; Giganti, Adeline; Nosjean, Olivier; Legros, Céline; Boutin, Jean A
2018-01-05
Melatonin receptors belong to the family of G-protein coupled receptors. Agonist-induced receptor activation is terminated with the recruitment of β-arrestin, which leads to receptor internalization. Furthermore, agonist binding induces a shift in cellular shape that translates into a change in the electric impedance of the cell. In the present study, we employed engineered cells to study these internalization-related processes in the context of the two melatonin receptors, MT 1 and MT 2 . To assess these three receptor internalization-related functions and validate the results, we employed four classical ligands of melatonin receptors: the natural agonist melatonin; the super-agonist 2-iodo-melatonin and the two antagonists luzindole and 4-phenyl-2-propionamidotetralin. The assessments confirmed the nature of the agonistic ligands but showed that 4-phenyl-2-propionamidotetralin, a described antagonist, is a biased partial agonist at MT 2 with poorer affinity for MT 1 . The methods are now available to be applied to any receptor system for which multiple signaling pathways must be evaluated for new molecules. Copyright © 2017 Elsevier B.V. All rights reserved.
Arrestin Scaffolds NHERF1 to the P2Y12 Receptor to Regulate Receptor Internalization*
Nisar, Shaista P.; Cunningham, Margaret; Saxena, Kunal; Pope, Robert J.; Kelly, Eamonn; Mundell, Stuart J.
2012-01-01
We have recently shown in a patient with mild bleeding that the PDZ-binding motif of the platelet G protein-coupled P2Y12 receptor (P2Y12R) is required for effective receptor traffic in human platelets. In this study we show for the first time that the PDZ motif-binding protein NHERF1 exerts a major role in potentiating G protein-coupled receptor (GPCR) internalization. NHERF1 interacts with the C-tail of the P2Y12R and unlike many other GPCRs, NHERF1 interaction is required for effective P2Y12R internalization. In vitro and prior to agonist stimulation P2Y12R/NHERF1 interaction requires the intact PDZ binding motif of this receptor. Interestingly on receptor stimulation NHERF1 no longer interacts directly with the receptor but instead binds to the receptor via the endocytic scaffolding protein arrestin. These findings suggest a novel model by which arrestin can serve as an adaptor to promote NHERF1 interaction with a GPCR to facilitate effective NHERF1-dependent receptor internalization. PMID:22610101
Arrestin scaffolds NHERF1 to the P2Y12 receptor to regulate receptor internalization.
Nisar, Shaista P; Cunningham, Margaret; Saxena, Kunal; Pope, Robert J; Kelly, Eamonn; Mundell, Stuart J
2012-07-13
We have recently shown in a patient with mild bleeding that the PDZ-binding motif of the platelet G protein-coupled P2Y(12) receptor (P2Y(12)R) is required for effective receptor traffic in human platelets. In this study we show for the first time that the PDZ motif-binding protein NHERF1 exerts a major role in potentiating G protein-coupled receptor (GPCR) internalization. NHERF1 interacts with the C-tail of the P2Y(12)R and unlike many other GPCRs, NHERF1 interaction is required for effective P2Y(12)R internalization. In vitro and prior to agonist stimulation P2Y(12)R/NHERF1 interaction requires the intact PDZ binding motif of this receptor. Interestingly on receptor stimulation NHERF1 no longer interacts directly with the receptor but instead binds to the receptor via the endocytic scaffolding protein arrestin. These findings suggest a novel model by which arrestin can serve as an adaptor to promote NHERF1 interaction with a GPCR to facilitate effective NHERF1-dependent receptor internalization.
Hovius, Ruud
2013-01-01
The application of fluorescent receptor ligands has become widespread, incited by two important reasons. "Seeing is believing"-it is possible to visualize in real time in live cells ligand-receptor interactions, and to locate the receptors with subcellular precision allowing one to follow, e.g., internalization of the ligand-receptor complex. The high sensitivity of photon detection permits observation of on the one hand receptor-ligand interactions on cells with low, native receptor abundance, and on the other of individual fluorophores unveiling the stochastic properties of single ligand-receptor complexes.The major bottlenecks that impede extensive use of fluorescent ligands are due to possible dramatic changes of the pharmacological properties of a ligand upon chemical modification and fluorophore conjugation, aggravated by the observation that different fluorophores can provoke very dissimilar effects. This makes it virtually impossible to predict beforehand which labelling strategy to use to produce a fluorescent ligand with the desired qualities.Here, we focus on the design, synthesis, and evaluation of a high-affinity fluorescent antagonist for the ionotropic serotonin type-3 receptor.
A candidate pheromone receptor and two odorant receptors of the hawkmoth Manduca sexta.
Patch, Harland M; Velarde, Rodrigo A; Walden, Kimberly K O; Robertson, Hugh M
2009-05-01
In this study, we cloned and characterized three Manduca sexta odorant receptors (ORs). One receptor is a putative pheromone receptor expressed exclusively in a cell associated with male-specific type-I trichoid sensilla. We describe the results of real-time PCR (RT-PCR) and quantitative real-time PCR (qRT-PCR) experiments that show MsextaOR1 is expressed only in male antennae. In situ hybridization labels a single cell associated with type-1 trichoid sensilla, which houses two neurons that have been previously determined to respond to the major components of the pheromone blend. The second receptor, MsextaOR2, was discovered using degenerate primers designed to conserved motifs of a unique group ORs that share as much as 88% identity. Comparison of RT-PCR, qRT-PCR, and in situ hybridization results with those of ORs in the Drosophila melanogaster Or83b subfamily shows a strong sequence and expression pattern similarity. The third receptor, MsextaOR3, was found by 5'-end sequencing of a normalized and subtracted cDNA library from male M. sexta antennae. RT-PCR and qRT-PCR show that this receptor is expressed only in male and female antennae. These are the first ORs, including a putative pheromone receptor, to be described from M. sexta.
A compilation of K-Ar-ages for southern California
Miller, Fred K.; Morton, Douglas M.; Morton, Janet L.; Miller, David M.
2014-01-01
The purpose of this report is to make available a large body of conventional K-Ar ages for granitic, volcanic, and metamorphic rocks collected in southern California. Although one interpretive map is included, the report consists primarily of a systematic listing, without discussion or interpretation, of published and unpublished ages that may be of value in future regional and other geologic studies. From 1973 to 1979, 468 rock samples from southern California were collected for conventional K-Ar dating under a regional geologic mapping project of Southern California (predecessor of the Southern California Areal Mapping Project). Most samples were collected and dated between 1974 and 1977. For 61 samples (13 percent of those collected), either they were discarded for varying reasons, or the original collection data were lost. For the remaining samples, 518 conventional K-Ar ages are reported here; coexisting mineral pairs were dated from many samples. Of these K-Ar ages, 225 are previously unpublished, and identified as such in table 1. All K-Ar ages are by conventional K-Ar analysis; no 40Ar/39Ar dating was done. Subsequent to the rock samples collected in the 1970s and reported here, 33 samples were collected and 38 conventional K-Ar ages determined under projects directed at (1) characterization of the Mesozoic and Cenozoic igneous rocks in and on both sides of the Transverse Ranges and (2) clarifying the Mesozoic and Cenozoic tectonics of the eastern Mojave Desert. Although previously published (Beckerman et al., 1982), another eight samples and 11 conventional K-Ar ages are included here, because they augment those completed under the previous two projects.
NASA Astrophysics Data System (ADS)
Aka, Festus Tongwa; Hasegawa, Takeshi; Nche, Linus Anye; Asaah, Asobo Nkengmatia Elvis; Mimba, Mumbfu Ernestine; Teitchou, Isidore; Ngwa, Caroline; Miyabuchi, Yasuo; Kobayashi, Tetsuo; Kankeu, Boniface; Yokoyama, Tetsuya; Tanyileke, Gregory; Ohba, Takeshi; Hell, Joseph Victor; Kusakabe, Minoru
2018-05-01
The hydrodynamic fragmentation that formed Lake Nyos in northwest Cameroon did not only make it the most unpopular lake in the world from a gas disaster perspective, it also opened a rare and formidable window through which much of the geology of Cameroon can be studied in a single locality. The Cambrian quartz monzonite cliff excavated by the maar-forming explosion and exposed in its northeastern shore is intruded by mafic dykes, two of which we dated. Even though close to one another, the dykes are different in composition. The alkaline dyke yields a slightly older (Carnian) K-Ar fedspar age of 231.1 ± 4.8 Ma, while the sub alkaline dyke yields an age of 224.8 ± 4.7 Ma (Norian). Based on radioisotopic age data available over the last 48 years (347 data) for the Cameroon Line magmatism comprising eruptives and volcano-plutonic complexes, the Nyos dykes are way older than the Cameroon Line, and even pre-date the Lower Cretaceous initiation of west Gondwana fragmentation in Equatorial Atlantic domain. They would therefore not have been directly linked to the formation of the Cameroon Line. Alternatively, they might be associated with the development of intra-continental rift systems in West Central Africa that pre-dated west Gondwana breakup to form the Atlantic Ocean.
Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V
1999-01-01
The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965
Armour, S L; Foord, S; Kenakin, T; Chen, W J
1999-12-01
Receptor-activity-modifying proteins (RAMPs) are a family of single transmembrane domain proteins shown to be important for the transport and ligand specificity of the calcitonin gene-related peptide (CGRP) receptor. In this report, we describe the analysis of pharmacological properties of the human calcitonin receptor (hCTR) coexpressed with different RAMPs with the use of the Xenopus laevis melanophore expression system. We show that coexpression of RAMP3 with human calcitonin receptor changed the relative potency of hCTR to human calcitonin (hCAL) and rat amylin. RAMP1 and RAMP2, in contrast, had little effect on the change of hCTR potency to hCAL or rat amylin. When coexpressed with RAMP3, hCTR reversed the relative potency by a 3.5-fold loss in sensitivity to hCAL and a 19-fold increase in sensitivity to rat amylin. AC66, an inverse agonist, produced apparent simple competitive antagonism of hCAL and rat amylin, as indicated by linear Schild regressions. The potency of AC66 was changed in the blockade of rat amylin but not hCAL responses with RAMP3 coexpression. The mean pK(B) for AC66 to hCAL was 9.4 +/- 0.3 without RAMP3 and 9.45 +/- 0.07 with RAMP3. For the antagonism of AC66 to rat amylin, the pK(B) was 9.25 +/- 0.15 without RAMP3 and 8.2 +/- 0.35 with RAMP3. The finding suggests that RAMP3 might modify the active states of calcitonin receptor in such a way as to create a new receptor phenotype that is "amylin-like." Irrespective of the physiological association of the new receptor species, the finding that a coexpressed membrane protein can completely change agonist and antagonist affinities for a receptor raises implications for screening in recombinant receptor systems.
Tsuji, Motonori; Shudo, Koichi; Kagechika, Hiroyuki
2017-03-01
Understanding and identifying the receptor subtype selectivity of a ligand is an important issue in the field of drug discovery. Using a combination of classical molecular mechanics and quantum mechanical calculations, this report assesses the receptor subtype selectivity for the human retinoid X receptor (hRXR) and retinoic acid receptor (hRAR) ligand-binding domains (LBDs) complexed with retinoid ligands. The calculated energies show good correlation with the experimentally reported binding affinities. The technique proposed here is a promising method as it reveals the origin of the receptor subtype selectivity of selective ligands.