Sample records for kanamycin neomycin gentamycin

  1. Synthetic neomycin-kanamycin phosphotransferase, type II coding sequence for gene targeting in mammalian cells.


    Jin, Seung-Gi; Mann, Jeffrey R


    The bacterial neomycin-kanamycin phosphotransferase, type II enzyme is encoded by the neo gene and confers resistance to aminoglycoside drugs such as neomycin and kanamycin-bacterial selection and G418-eukaryotic cell selection. Although widely used in gene targeting in mouse embryonic stem cells, the neo coding sequence contains numerous cryptic splice sites and has a high CpG content. At least the former can cause unwanted effects in cis at the targeted locus. We describe a synthetic sequence, sneo, which encodes the same protein as that encoded by neo. This synthetic sequence has no predicted splice sites in either strand, low CpG content, and increased mammalian codon usage. In mouse embryonic stem cells sneo expressability is similar to neo. The use of sneo in gene targeting experiments should substantially reduce the probability of unwanted effects in cis due to splicing, and perhaps CpG methylation, within the coding sequence of the selectable marker.

  2. Tuning the regioselectivity of the Staudinger reaction for the facile synthesis of kanamycin and neomycin class antibiotics with N-1 modification.


    Li, Jie; Chen, Hsiao-Nung; Chang, Huiwen; Wang, Jinhua; Chang, Cheng-Wei Tom


    [reaction: see text] A novel method for achieving the desired regioselective reduction of the N-1 azido group on a tetraazidoneamine has been developed that leads to the synthesis of both kanamycin and neomycin class antibiotics bearing N-1 modification. Both classes of aminoglycosides are active against aminoglycoside-resistant bacteria carrying APH(3')-I and AAC(6')/APH(2'').

  3. Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.


    Bera, Smritilekha; Zhanel, George G; Schweizer, Frank


    Cationic amphiphiles containing multiple positively charged amino functions define a structurally diverse class of antibacterials with broad-spectrum activity and different modes of action. Oligocationic amphiphiles have been used as antibiotics to treat infections and as antiseptics and disinfectants for decades with little or no occurrence of resistance. We have prepared a novel class of cationic amphiphiles termed aminoglycoside antibiotics-derived amphiphiles in which the polyol scaffold of the aminoglycosides neomycin B, kanamycin A, amikacin, and neamine has been uniformly decorated with hydrophobic residues in the form of polycarbamates and polyethers. Our results show that the nature of the polyol modification as well as the nature of the aminoglycoside antibiotics has a strong effect on the antibacterial potency. The most potent antibacterials are polyol-modified neomycin B-based amphiphiles containing unsubstituted aromatic rings. These analogues exhibit up to 256-fold enhanced antibacterial activity against resistant strains when compared to neomycin B while retaining most of their activity against neomycin B-susceptible strains.

  4. Extremely sensitive sandwich assay of kanamycin using surface-enhanced Raman scattering of 2-mercaptobenzothiazole labeled gold@silver nanoparticles.


    Zengin, Adem; Tamer, Ugur; Caykara, Tuncer


    Herein, we report the development of extremely sensitive sandwich assay of kanamycin using a combination of anti-kanamycin functionalized hybrid magnetic (Fe3O4) nanoparticles (MNPs) and 2-mercaptobenzothiazole labeled Au-core@Ag-shell nanoparticles as the recognition and surface-enhanced Raman scattering (SERS) substrate, respectively. The hybrid MNPs were first prepared via surface-mediated RAFT polymerization of N-acryloyl-L-glutamic acid in the presence of 2-(butylsulfanylcarbonylthiolsulfanyl) propionic acid-modified MNPs as a RAFT agent and then biofunctionalized with anti-kanamycin, which are both specific for kanamycin and can be collected via a simple magnet. After separating kanamycin from the sample matrix, they were sandwiched with the SERS substrate. According to our experimental results, the limit of detection (LOD) was determined to be 2pg mL(-1), this value being about 3-7 times more than sensitive than the LOD of previously reported results, which can be explained by the higher SERS activity of silver coated gold nanoparticles. The analysis time took less than 10min, including washing and optical detection steps. Furthermore, the sandwich assay was evaluated for investigating the kanamycin specificity on neomycin, gentamycin and streptomycin and detecting kanamycin in artificially contaminated milk.

  5. Neomycin inhibits angiogenin-induced angiogenesis.


    Hu, G F


    A class of angiogenesis inhibitor has emerged from our mechanistic study of the action of angiogenin, a potent angiogenic factor. Neomycin, an aminoglycoside antibiotic, inhibits nuclear translocation of human angiogenin in human endothelial cells, an essential step for angiogenin-induced angiogenesis. The phospholipase C-inhibiting activity of neomycin appears to be involved, because U-73122, another phospholipase C inhibitor, has a similar effect. In contrast, genistein, oxophenylarsine, and staurosporine, inhibitors of tyrosine kinase, phosphotyrosine phosphatase, and protein kinase C, respectively, do not inhibit nuclear translocation of angiogenin. Neomycin inhibits angiogenin-induced proliferation of human endothelial cells in a dose-dependent manner. At 50 microM, neomycin abolishes angiogenin-induced proliferation but does not affect the basal level of proliferation and cell viability. Other aminoglycoside antibiotics, including gentamicin, streptomycin, kanamycin, amikacin, and paromomycin, have no effect on angiogenin-induced cell proliferation. Most importantly, neomycin completely inhibits angiogenin-induced angiogenesis in the chicken chorioallantoic membrane at a dose as low as 20 ng per egg. These results suggest that neomycin and its analogs are a class of agents that may be developed for anti-angiogenin therapy.

  6. Neomycin inhibits angiogenin-induced angiogenesis

    PubMed Central

    Hu, Guo-fu


    A class of angiogenesis inhibitor has emerged from our mechanistic study of the action of angiogenin, a potent angiogenic factor. Neomycin, an aminoglycoside antibiotic, inhibits nuclear translocation of human angiogenin in human endothelial cells, an essential step for angiogenin-induced angiogenesis. The phospholipase C-inhibiting activity of neomycin appears to be involved, because U-73122, another phospholipase C inhibitor, has a similar effect. In contrast, genistein, oxophenylarsine, and staurosporine, inhibitors of tyrosine kinase, phosphotyrosine phosphatase, and protein kinase C, respectively, do not inhibit nuclear translocation of angiogenin. Neomycin inhibits angiogenin-induced proliferation of human endothelial cells in a dose-dependent manner. At 50 μM, neomycin abolishes angiogenin-induced proliferation but does not affect the basal level of proliferation and cell viability. Other aminoglycoside antibiotics, including gentamicin, streptomycin, kanamycin, amikacin, and paromomycin, have no effect on angiogenin-induced cell proliferation. Most importantly, neomycin completely inhibits angiogenin-induced angiogenesis in the chicken chorioallantoic membrane at a dose as low as 20 ng per egg. These results suggest that neomycin and its analogs are a class of agents that may be developed for anti-angiogenin therapy. PMID:9707554

  7. Neomycin, Polymyxin, and Bacitracin Ophthalmic


    Neo-polycin® Ophthalmic Ointment (as a combination product containing Bacitracin, Neomycin, Polymyxin B) ... to explain any part you do not understand. Use neomycin, polymyxin, and bacitracin ophthalmic ointment exactly as ...

  8. A rapid immunoprecipitation assay for neomycin phosphotransferase II expression in transformed bacteria and plant tissues.


    Baszczynski, C L


    Anti-kanamycin antibodies produced in rabbits, following coupling of the antibiotic to bovine serum albumin, were used to immunoprecipitate radioactively labelled phosphorylated kanamycin from transformed bacterial or plant extracts in a novel assay system, for the detection of neomycin phosphotransferase II (NPTII) activity. Radioactive counts in the immunoprecipitated pellet give a semiquantitative measure of the kanamycin phosphorylation and hence the amount of NPTII activity. This assay is sensitive, uses very small amounts of radioactivity, and is very rapid, allowing many samples to be processed within a few hours. Immunoprecipitated counts from reactions with bacteria carrying a kanamycin resistance gene or from tobacco and Brassica napus plants transformed with NPTII gene-containing vectors were consistently higher than counts from nontransformed controls. Results obtained with this assay correlate well with those from the previously described gel overlay and dot-blot assays, but can be obtained in an appreciably shorter time frame.

  9. [The antimicrobial activity and acute toxicity of the polymer salts of gentamycin].


    Solovskiĭ, M V; Zaikina, N A; Okulova, N V; Belokhvostova, A T


    By neutralization of copolymers of N-(2-hydroxypropyl) methacrylamide with acrylic acid and copolymers of N-vinylpyrrolidone with crotonic and p-crotonoylaminophenoxyacetic acids in the presence of gentamycin, water-soluble polymer salts containing from 10 to 25 mass% of gentamycin were obtained. These salts regardless of gentamycin content completely retain high level of antimicrobial activity of gentamycin against Staphylococcus spp. and Escherichia coli and are characterized by less (by more than one order of magnitude) acute toxicity.

  10. Label-free detection of kanamycin using aptamer-based cantilever array sensor.


    Bai, Xiaojing; Hou, Hui; Zhang, Bailin; Tang, Jilin


    A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed. The cantilever array was composed of sensing cantilevers and reference cantilevers. This configuration allowed direct detection of individual cantilever deflections and subsequent determination of differential deflection of sensing/reference cantilever pair. The sensing cantilevers were functionalized with kanamycin aptamer, which was used as receptor molecules while the reference cantilevers were modified with 6-mercapto-1-hexanol (MCH) to eliminate the influence of environmental disturbances. The kanamycin-aptamer interaction induced a change in cantilever surface stress, which caused a differential deflection between the sensing and reference cantilever pair. The surface stress change was linear with kanamycin concentration over the range of 100 μM-10mM with a correlation coefficient of 0.995. A detection limit of 50 μM was obtained, at a signal-to-noise ratio of 3. The sensor also showed good selectivity against other antibiotics such as neomycin, ribostamycin and chloramphenicol. The facile method for kanamycin detection may have great potential for investigating more other molecules.

  11. Detection of Tn5-like sequences in kanamycin-resistant stream bacteria and environmental DNA

    SciTech Connect

    Leff, L.G.; McArthur, J.V. ); Dana, J.R.; Shimkets, L.J. )


    This study investigates the occurrence of kanamycin and neomycin resistance in the culturable portion of the bacterial assemblage of a South Carolina stream. The constitutively expressed nptII gene was used to determine resistance. Spartial differences in the relative abundances of nptII taken from different locations and habitats in the stream were investigated. Results suggest that multiple probes will probably be necessary to assess kanamycin resistance potential of stream bacteria. At the largest patial scale there are not significant difference among the sites in abundances of nptII genes, though there were some differences in habitats. The authors conclude DNA hybridization appears to be a useful technique for assessing the abundance of genes in mixtures of nonculturable organisms.

  12. Protein fusions with the kanamycin resistance gene from transposon Tn5.

    PubMed Central

    Reiss, B; Sprengel, R; Schaller, H


    The gene for the neomycin phosphotransferase II (NPT II) from transposon Tn5 was fused at the amino or carboxy terminus to foreign DNA sequences coding for 3-300 amino acids and the properties of the fused proteins were investigated. All amino-terminal fusions examined conferred kanamycin resistance to their host cell, but profound differences in their enzymatic activity and stability were detected. Short additions to the amino terminus of the NPT II resulted in highly enzymatically active fusion proteins whereas long amino-terminal fusions often had to be proteolytically degraded to release active proteins. Fusions at the carboxy-terminal end of the NPT II protein did not always induce kanamycin resistance and their enzymatic activity depended more stringently on the nature of the junction sequence. Images Fig. 4. PMID:6098471

  13. Aptasensors for quantitative detection of kanamycin.


    Robati, Rezvan Yazdian; Arab, Atefeh; Ramezani, Mohammad; Langroodi, Fatemeh Alebooye; Abnous, Khalil; Taghdisi, Seyed Mohammad


    Up till now, various techniques have been developed to detect kanamycin in biological samples. However, due to some problems involved in these methods including time-consuming, expensive equipment and high consumption of reagents, new strategies for detection and quantitative determination of kanamycin are needed. Aptamer-based biosensors with unique recognition capability have attracted more attention of scientists because of its rapid response, high sensitivity and simple fabrication. Hence, we summarized optical and electrochemical kanamycin aptasensors and focuses on recent advances and modern techniques in aptasensor-based kanamycin detection techniques in order to provide readers with an inclusive understanding of its improvement and progress.

  14. 35S Promoter Methylation in Kanamycin-Resistant Kalanchoe (Kalanchoe pinnata L.) Plants Expressing the Antimicrobial Peptide Cecropin P1 Transgene.


    Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I


    Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases.

  15. Effect of geranylgeranylacetone on gentamycin ototoxicity in rat cochlea culture.


    Sano, Hajime; Yoneda, Satoshi; Iwase, Hitoo; Itoh, Akihiko; Hashimoto, Daimon; Okamoto, Makito


    Geranylgeranylacetone (GGA), an anti-ulcer drug, has been reported to induce heat shock proteins (HSPs) in several animal organs. Purpose of this study was to investigate whether GGA has protective effect on gentamycin (GM) ototoxicity and whether it induces HSP70 in rat cochlea. We used cochlea explant culture from postnatal 5-day rat. Explants were pre-incubated with GGA, then incubated with GM and GGA. The number of surviving outer hair cells (OHCs) labeled by phalloidin was counted to evaluate the protective effect of GGA. The expression of HSP70 in whole cochlea tissue was investigated by immunoblot analysis. The number of surviving OHCs was significantly high in GGA 10(-5)M group compared to GM only group and GGA 10(-6)M group. In the immunoblot analysis, HSP70 levels in GGA added groups were slightly high compared to simple culture group, but much lower than those in heat shock group. It was suggested that GGA-induced HSP70, and had partial protective effects on GM ototoxicity in the cochlea. GGA has possibility to be safe and useful treatment drug for cochlea disorder.

  16. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in the...

  17. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c) of...

  18. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in the...

  19. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  20. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  1. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c)...

  2. 21 CFR 524.1204 - Kanamycin, amphomycin, and hydrocortisone ointment.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, amphomycin, and hydrocortisone ointment... ANIMAL DRUGS § 524.1204 Kanamycin, amphomycin, and hydrocortisone ointment. (a) Specifications. Each gram of ointment contains 5 milligrams kanamycin activity as kanamycin sulfate, 5 milligrams of...

  3. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  4. 21 CFR 522.1204 - Kanamycin.

    Code of Federal Regulations, 2014 CFR


    ... dogs and cats—(1) Amount. Administer by subcutaneous or intramuscular injection 5 mg per pound of body... of bacterial infections due to kanamycin sensitive organisms in dogs and cats. (3) Limitations...

  5. The effect of aqueous leaf extract of Telfairia occidentalis (Cucurbitaceae) on gentamycin-induced renal damage.


    Maduka, Stephen O; Ugwu, Chidiebere E; Onwudinjo, Oluchi J


    Despite the acclaimed beneficial effects of Telfaria occidentalis (TO), it is yet to be established that its aqueous extract is safe in the condition of renal impairment. Thus, the study investigated the effects of TO aqueous leaves extract on gentamycin-induced renal damage. The animals were distributed into five groups. Group A (control) was placed on standard rat feed. Groups B and C received 500 mg/kg and 80 mg/kg of TO and gentamicin for 21 days, respectively. Group D received 500 mg/kg of TO 14 days before 7 days administration of 80 mg/kg of gentamycin. Group E received 80 mg/kg of gentamicin for 14 days before 7 days administration of 500 mg/kg TO. Group F received 500 mg/kg of TO and 80mg/kg of gentamycin concurrently for 21 days. Biochemical and histological examinations were analysed by standard methods. The administration of TO for 7 days after 14 days of gentamycin injection and its concomitant administration with gentamicin for 21 days caused significant reduction (p<0.05) on the relative kidney weight, creatinine and uric acid levels compared to groups C and D. There was a significant decrease (p<0.05) in the mean serum potassium level in group C compared to groups A, B, D, and F. The histological reports showed that the combination of the extract and gentamycin (group F) seems to ameliorate the deleterious effect observed when gentamycin was administered alone. The administration of the extract together with and after the administration of gentamycin reverses renal damage caused by gentamycin.

  6. Inhibition of the hammerhead ribozyme by neomycin.

    PubMed Central

    Stage, T K; Hertel, K J; Uhlenbeck, O C


    A series of antibiotics was tested for stimulation or inhibition of the hammerhead ribozyme cleavage reaction. Neomycin was found to be a potent inhibitor of the reaction with a Kl of 13.5 microM. Two hammerheads with well-characterized kinetics were used to determine which steps in the reaction mechanism were inhibited by neomycin. The data suggest that neomycin interacts preferentially with the enzyme-substrate complex and that this interaction leads to a reduction in the cleavage rate by stabilizing the ground state of the complex and destabilizing the transition state of the cleavage step. A comparison of neomycin with other aminoglycosides and inhibitors of hammerhead cleavage implies that the ammonium ions of neomycin are important for the antibiotic-hammerhead interaction. PMID:7489494

  7. HPLC-ELSD determination of kanamycin B in the presence of kanamycin A in fermentation broth.


    Zhang, Yong; He, Hui-Min; Zhang, Jin; Liu, Feng-Jiao; Li, Chao; Wang, Bing-Wu; Qiao, Ren-Zhong


    A novel method for the direct determination of kanamycin B in the presence of kanamycin A in fermentation broth using high performance liquid chromatography with evaporative light scattering detector (HPLC-ELSD) was developed. An Agilent Technologies C18 column was utilized, evaporation temperature of 40°C and nitrogen pressure of 3.5 bar, the optimized mobile phase was water-acetonitrile (65:35, v/v), containing 11.6 mm heptafluorobutyric acid (isocratic elution with flow rate of 0.5 mL/min) with the gain 11. Kanamycin B was eluted at 5.6 min with an asymmetry factor of 1.827. The method showed good linearity over the concentration range of 0.05 to 0.80 mg/mL for the kanamycin B (r(2) = 0.9987). The intra-day and inter-day coefficients of variation obtained from kanamycin B were less than 4.3%. Mean recovery of kanamycin B from spiked fermentation broth was 95%. The developed method was applied to the determination of kanamycin B without any interference from other constituents in the fermentation broth. This method offers simple, rapid and quantitative detection of kanamycin B. Copyright © 2014 John Wiley & Sons, Ltd.

  8. 21 CFR 524.1484i - Neomycin and hydrocortisone ointment.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Neomycin and hydrocortisone ointment. 524.1484i... § 524.1484i Neomycin and hydrocortisone ointment. (a) Specifications. The drug contains 5 milligrams of neomycin sulfate, equivalent to 3.5 milligrams of neomycin base, and 5 milligrams of hydrocortisone acetate...

  9. 21 CFR 522.1484 - Neomycin sulfate sterile solution.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Neomycin sulfate sterile solution. 522.1484... § 522.1484 Neomycin sulfate sterile solution. (a) Specifications. Each milliliter of sterile aqueous solution contains 50 milligrams of neomycin sulfate (equivalent to 35 milligrams of neomycin base).1...

  10. 21 CFR 522.1484 - Neomycin sulfate sterile solution.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Neomycin sulfate sterile solution. 522.1484... § 522.1484 Neomycin sulfate sterile solution. (a) Specifications. Each milliliter of sterile aqueous solution contains 50 milligrams of neomycin sulfate (equivalent to 35 milligrams of neomycin base).1...

  11. 21 CFR 522.1484 - Neomycin sulfate sterile solution.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin sulfate sterile solution. 522.1484... § 522.1484 Neomycin sulfate sterile solution. (a) Specifications. Each milliliter of sterile aqueous solution contains 50 milligrams of neomycin sulfate (equivalent to 35 milligrams of neomycin base).1...

  12. 21 CFR 522.1484 - Neomycin sulfate sterile solution.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Neomycin sulfate sterile solution. 522.1484... § 522.1484 Neomycin sulfate sterile solution. (a) Specifications. Each milliliter of sterile aqueous solution contains 50 milligrams of neomycin sulfate (equivalent to 35 milligrams of neomycin base).1...

  13. Kanamycin ototoxicity in glutamate transporter knockout mice.


    Shimizu, Yoshitaka; Hakuba, Nobuhiro; Hyodo, Jun; Taniguchi, Masafumi; Gyo, Kiyofumi


    Glutamate-aspartate transporter (GLAST), a powerful glutamate uptake system, removes released glutamate from the synaptic cleft and facilitates the re-use of glutamate as a neurotransmitter recycling system. Aminoglycoside-induced hearing loss is mediated via a glutamate excitotoxic process. We investigated the effect of aminoglycoside ototoxicity in GLAST knockout mice using the recorded auditory brainstem response (ABR) and number of hair cells in the cochlea. Kanamycin (100 mg/mL) was injected directly into the posterior semicircular canal of mice. Before the kanamycin treatment, there was no difference in the ABR threshold average between the wild-type and knockout mice. Kanamycin injection aggravated the ABR threshold in the GLAST knockout mice compared with the wild-type mice, and the IHC degeneration was more severe in the GLAST knockout mice. These findings suggest that GLAST plays an important role in preventing the degeneration of inner hair cells in aminoglycoside ototoxicity.

  14. Isolation and characterization of three phosphoamido-neomycins and their conversion into neomycin by Streptomyces fradiae

    PubMed Central

    Majumdar, Mrinal K.; Majumdar, S. K.


    Some amino acids, particularly glycine and serine, favour the accumulation in the fermentation broth of three phosphorylated amino sugar compounds that are intermediates in the pathway of neomycin biosynthesis by Streptomyces fradiae 3535. The compounds were separated and purified further by Amberlite IRC-50 (NH4+ form). The intermediates were characterized by physicochemical methods as neomycin B pyrophosphate (C23H48N6O19P2,3H2O), neomycin C pyrophosphate (C23H48N6O19P2,3H2O) and neomycin C dipyrophosphate complex (C24H66N8O33P4). PMID:4321893

  15. Preparation and in vitro characterization of gentamycin-impregnated biodegradable beads suitable for treatment of osteomyelitis.


    Meyer, J D; Falk, R F; Kelly, R M; Shively, J E; Withrow, S J; Dernell, W S; Kroll, D J; Randolph, T W; Manning, M C


    A new method for preparing poly(L-lactide) (PLA) biodegradable beads impregnated with an ionic aminoglycoside, gentamycin, is described. The process employs hydrophobic ion pairing to solubilize gentamycin in a solvent compatible with PLA, followed by precipitation with a compressed antisolvent (supercritical carbon dioxide). The resulting precipitate is a homogeneous dispersion of the ion-paired drug in PLA microspheres. The microspheres are approximately 1 microm in diameter and can be compressed into beads (3-6 mm in diameter) strung on surgical sutures for implantation. The bead strings exhibit no significant change in release kinetics upon sterilization with a hydrogen peroxide plasma (Ster-Rad). The kinetics of gentamycin release from the PLA beads are consistent with a matrix-controlled diffusion mechanism. While nonbiodegradable poly(methyl methacrylate) (PMMA) beads initially release gentamycin in a similar manner, the drug release from PMMA ceases after 8 or 9 weeks, while the PLA beads continue to release drug for over 4 months. Moreover, only 10% of the gentamycin is released from the PMMA beads, while PLA beads release more than 60% of their load, if serum is present in the release medium. The PLA system displays improved release kinetics relative to PMMA, is biodegradable, is unaltered by gas sterilization, can be used for a range of antibiotics, and can be manipulated without disintegration. These are all desirable properties for an implantable drug delivery system for the prevention or treatment of osteomyelitis.

  16. Glycodiversification for the optimization of the kanamycin class aminoglycosides.


    Wang, Jinhua; Li, Jie; Chen, Hsiao-Nung; Chang, Huiwen; Tanifum, Christabel Tomla; Liu, Hsiu-Hsiang; Czyryca, Przemyslaw G; Chang, Cheng-Wei Tom


    In an effort to optimize the antibacterial activity of kanamycin class aminoglycoside antibiotics, we have accomplished the synthesis and antibacterial assay of new kanamycin B analogues. A rationale-based glycodiversification strategy was employed. The activity of the lead is comparable to that of commercially available kanamycin. These new members, however, were found to be inactive against aminoglycoside resistant bacteria. Molecular modeling was used to provide the explanation. Thus, a new strategy for structural modifications of kanamycin class aminoglycosides is suggested.

  17. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  18. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  19. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  20. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  1. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  2. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  3. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  4. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  5. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  6. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  7. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  8. Comparative analysis of combination kanamycin-furosemide versus kanamycin alone in the mouse cochlea.


    Hirose, Keiko; Sato, Eisuke


    Combinations of aminoglycosides and loop diuretics have been known to have a synergistic effect in ototoxic injury. Because murine hair cells are relatively resistant to ototoxicity compared to those of other mammals, investigators have turned to combination therapies to create ototoxic lesions in the mouse inner ear. In this paper, we perform a systematic comparison of hearing thresholds, hair cell damage and monocyte migration into the mouse cochlea after kanamycin versus combined kanamycin/furosemide and explore the pathophysiology of enhanced hair cell loss in aminoglycoside ototoxicity in the presence of loop diuretic. Combined kanamycin-furosemide resulted in elevation of threshold not only in the high frequencies, but across all frequencies with more extensive loss of outer hair cells when compared to kanamycin alone. The stria vascularis was severely atrophied and stellate cells in the spiral limbus were missing in kanamycin-furosemide exposed mice while these changes were not observed in mice receiving kanamycin alone. Monocytes and macrophages were recruited in large numbers to the spiral ligament and spiral ganglion in these mice. Combination therapy resulted in a greater number of macrophages in total, and many more macrophages were present further apically when compared to mice given kanamycin alone. Combined kanamycin-furosemide provides an effective method of addressing the relative resistance to ototoxicity that is observed in most mouse strains. As the mouse becomes increasingly more common in studies of hearing loss, and combination therapies gain popularity, recognition of the overall effects of combined aminoglycoside-loop diuretic therapy will be critical to interpretation of the interventions that follow.

  9. Stable Agrobacterium-mediated transformation of maritime pine based on kanamycin selection.


    Alvarez, José M; Ordás, Ricardo J


    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β -glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL(-1) kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD(600 nm)) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth.

  10. Stable Agrobacterium-Mediated Transformation of Maritime Pine Based on Kanamycin Selection

    PubMed Central

    Alvarez, José M.; Ordás, Ricardo J.


    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β-glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL−1 kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD600 nm) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth. PMID:24376383

  11. The aminoglycoside antibiotic kanamycin damages DNA bases in Escherichia coli: caffeine potentiates the DNA-damaging effects of kanamycin while suppressing cell killing by ciprofloxacin in Escherichia coli and Bacillus anthracis.


    Kang, Tina Manzhu; Yuan, Jessica; Nguyen, Angelyn; Becket, Elinne; Yang, Hanjing; Miller, Jeffrey H


    The distribution of mutants in the Keio collection of Escherichia coli gene knockout mutants that display increased sensitivity to the aminoglycosides kanamycin and neomycin indicates that damaged bases resulting from antibiotic action can lead to cell death. Strains lacking one of a number of glycosylases (e.g., AlkA, YzaB, Ogt, KsgA) or other specific repair proteins (AlkB, PhrB, SmbC) are more sensitive to these antibiotics. Mutants lacking AlkB display the strongest sensitivity among the glycosylase- or direct lesion removal-deficient strains. This perhaps suggests the involvement of ethenoadenine adducts, resulting from reactive oxygen species and lipid peroxidation, since AlkB removes this lesion. Other sensitivities displayed by mutants lacking UvrA, polymerase V (Pol V), or components of double-strand break repair indicate that kanamycin results in damaged base pairs that need to be removed or replicated past in order to avoid double-strand breaks that saturate the cellular repair capacity. Caffeine enhances the sensitivities of these repair-deficient strains to kanamycin and neomycin. The gene knockout mutants that display increased sensitivity to caffeine (dnaQ, holC, holD, and priA knockout mutants) indicate that caffeine blocks DNA replication, ultimately leading to double-strand breaks that require recombinational repair by functions encoded by recA, recB, and recC, among others. Additionally, caffeine partially protects cells of both Escherichia coli and Bacillus anthracis from killing by the widely used fluoroquinolone antibiotic ciprofloxacin.

  12. Kanamycin activates caspase-1 in NC/Nga mice.


    Han, Na-Ra; Kim, Hyung-Min; Jeong, Hyun-Ja


    Abuse of antibiotics to treat children has been associated with an increased risk of the development of inflammatory diseases. The underlying mechanism behind this association still remains to be clarified. Here, we examined the mechanisms behind kanamycin-induced skin inflammation in NC/Nga mice. NC/Nga mice were orally administered kanamycin for 7 days consecutively. Blood, spleen and dorsal skin were taken 18 weeks after kanamycin treatment was stopped. Kanamycin significantly increased the allergic reaction. We also observed significant increases in caspase-1 mRNA and protein expression in the dorsal skin of the kanamycin-administered mice compared to the control mice. The increased enzymatic activity of caspase-1 in the dorsal skin of the kanamycin-administered mice increased the mRNA expressions of IL-1β and IL-18. The productions of IL-1β and IL-18 were also increased in the splenocytes obtained from kanamycin-administered mice. Kanamycin upregulated the TNF-α mRNA expression in the dorsal skin and the TNF-α production in stimulated splenocytes. The activation of nuclear factor-κB and degradation of IκBα were increased by kanamycin administration. Our findings suggest that the use of kanamycin during infancy may increase the potential for skin inflammatory reactions through the upregulation of caspase-1.

  13. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2013 CFR


    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR USE IN ANIMAL FEEDS Specific New Animal Drugs for Use in Animal Feeds § 558.364 Neomycin sulfate. (a) Approvals. Type A medicated article: 325 grams...

  14. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2012 CFR


    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR USE IN ANIMAL FEEDS Specific New Animal Drugs for Use in Animal Feeds § 558.364 Neomycin sulfate. (a) Approvals. Type A medicated article: 325 grams...

  15. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2014 CFR


    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR USE IN ANIMAL FEEDS Specific New Animal Drugs for Use in Animal Feeds § 558.364 Neomycin sulfate. (a) Approvals. Type A medicated article: 325 grams...

  16. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2011 CFR


    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR USE IN ANIMAL FEEDS Specific New Animal Drugs for Use in Animal Feeds § 558.364 Neomycin sulfate. (a) Approvals. Type A medicated article: 325 grams...

  17. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2012 CFR


    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product described...

  18. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2014 CFR


    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product described...

  19. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2013 CFR


    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product described...

  20. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2010 CFR


    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product described...

  1. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2011 CFR


    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product described...

  2. Rv3168 phosphotransferase activity mediates kanamycin resistance in Mycobacterium tuberculosis.


    Ahn, Jae-Woo; Kim, Kyung-Jin


    Tuberculosis is a worldwide epidemic disease caused by Mycobacterium tuberculosis, with an estimated one-third of the human population currently affected. Treatment of this disease with aminoglycoside antibiotics has become less effective owing to antibiotic resistance. Recent determination of the crystal structure of the M. tuberculosis Rv3168 protein suggests a structure similar to that of Enterococcus faecalis APH(3')-IIIa, and that this protein may be an aminoglycoside phosphotransferase. To determine whether Rv3168 confers antibiotic resistance against kanamycin, we performed dose-response antibiotic resistance experiments using kanamycin. Expression of the Rv3168 protein in Escherichia coli conferred antibiotic resistance against 100 μM kanamycin, a concentration that effected cell growth arrest in the parental E. coli strain and an E. coli strain expressing the Rv3168(D249A) mutant, in which the catalytic Asp249 residue was mutated to alanine. Furthermore, we detected phosphotransferase activity of Rv3168 against kanamycin as a substrate. Moreover, docking simulation of kanamycin into the Rv3168 structure suggests that kanamycin fits well into the substrate binding pocket of the protein, and that the phosphorylation-hydroxyl-group of kanamycin was located at a position similar to that in E. faecalis APH(3')-IIIa. On the basis of these results, we suggest that the Rv3168 mediates kanamycin resistance in M. tuberculosis, likely through phosphotransferase targeting of kanamycin.

  3. Treatment of chronic osteomyelitis secondary to hydatid disease of bone using gentamycin beads.


    Obeidat, Moutasem M; Mustafa, Ziad


    Hydatid disease of bone is rare. It remains asymptomatic over a long period. It is usually detected after a pathological fracture or secondary infection or following the onset of compressive myelopathy in cases of vertebral lesions. Secondary infection of hydatid disease of bone could be difficult to treat. The authors present a case of chronic osteomyelitis of the proximal aspect of the left femur in a 37-year-old male patient secondary to hydatid disease of bone. It was treated by aggressive debridement, gentamycin beads, and bone graft to fill the defect. No recurrence of the hydatid lesion or infection was detected after 2 years. This case showed that in addition to aggressive debridement, gentamycin beads may be valuable in eradicating the infection in such a case.

  4. International standards and international reference preparations: amphotericin B, vancomycin, capreomycin, cefalotin, demethylchlortetracycline, gentamycin, gramicidin S, kanamycin and kanamycin B, lincomycin, lymecycline, methacycline, paromomycin, rifamycin SV, ristocetin and ristocetin B, spiramycin, and triacetyloleandomycin.


    Lightbown, J W; De Rossi, P; Isaacson, P


    Each of the preparations described here was obtained and evaluated at the request of a WHO Expert Committee on Biological Standardization. Unless otherwise stated, a standard procedure was used to distribute the material into individual ampoules. The procedure was as follows. Upon receipt by the National Institute for Medical Research (NIMR), London, materials were stored temporarily in the dark at a temperature of -10 degrees C or lower, and protected from moisture. At a convenient time they were brought back to room temperature, mixed, and distributed into individual neutral glass ampoules so that each ampoule contained 50-100 mg of powder. If it was known that the material was light-sensitive non-actinic glass ampoules were used. After exhaustive drying in vacuum over phosphorus(V) oxide, the ampoules were either constricted (up to 1963) or fitted with capillary leak plugs, dried for a further period under the same conditions, filled with dry nitrogen, and sealed by fusion of the glass. The total drying period varied from 8 to 38 days according to the nature of the material. After they had been tested for leaks, the ampoules were stored in the dark at -20 degrees C.

  5. FGF22 protects hearing function from gentamycin ototoxicity by maintaining ribbon synapse number.


    Li, Shuna; Hang, Lihua; Ma, Yongming


    Inner hair cell (IHC) ribbon synapses of cochlea play important role in transmitting sound signal into auditory nerve and are sensitive to ototoxicity. However, ototoxic damage of ribbon synapses is not understood clearly. Roles of fibroblast growth factor 22 (FGF22) on synapse formation were explored under gentamycin ototoxicity. 6-week-old mice were injected intraperitoneally once daily with 50-150 mg/kg gentamicin for 10 days. Immunostaining with anti- GluR2&3/CtBP2 was used to estimate the number of ribbon synapses in the cochlea. Expression of FGF22 and myocyte enhancer factor 2D (MEF2D) was assayed with RT-PCR. Expression and localization of FGF22 protein were visualized with anti-FGF22 immunostaining. Hearing thresholds were assessed using auditory brainstem responses. Gentamicin administration caused reduction in ribbon synapse number and hearing impairment without effect on hair cells in CBA/J mouse model. Immunohistochemistry showed that FGF22 protein was expressed in IHCs, but not OHCs of cochlea. Gentamycin attenuated expression of FGF22 but enhanced expression of MEF2D. Cochlear infusion of recombinant FGF22 inhibited expression of MEF2D, preserved ribbon synapses, and restored hearing function impaired by gentamycin. FGF22 restores hearing loss through maintaining ribbon synapse number, likely via inhibition of MEF2D. Activating FGF22 might provide the conceptual basis for the therapeutic strategies. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2011 CFR


    ... milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite (aluminum magnesium silicate). (2) Each tablet contains 100 mg kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite. (b) Sponsor....

  7. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2010 CFR


    ... milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite (aluminum magnesium silicate). (2) Each tablet contains 100 mg kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite. (b) Sponsor....

  8. Modulatory effects of dietary inclusion of garlic (Allium sativum) on gentamycin-induced hepatotoxicity and oxidative stress in rats.


    Ademiluyi, Adedayo O; Oboh, Ganiyu; Owoloye, Tosin R; Agbebi, Oluwaseun J


    To investigate the ameliorative effect of dietary inclusion of garlic (Allium sativum) on gentamycin-induced hepatotoxicity in rats. Adult male rats were randomly divided into four groups with six animals in each group. Groups 1 and 2 were fed basal diet while Groups 3 and 4 were fed diets containing 2% and 4% garlic respectively for 27 d prior to gentamycin administration. Hepatotoxicity was induced by the intraperitoneal administration of gentamycin (100 mg/kg body weight) for 3 d. The liver and plasma were studied for hepatotoxicity and antioxidant indices. Gentamycin induces hepatic damage as revealed by significant (P<0.05) elevation of liver damage marker enzymes (aspartate transaminase and alanine aminotransferase) and reduction in plasma albumin level. Gentamycin also caused a significant (P<0.05) alteration in plasma and liver enzymatic (catalase, glutathione and super oxygen dehydrogenises) and non-enzymatic (glutathione and vitamin C) antioxidant indices with concomitant increase in the malondialdehyde content; however, there was a significant (P<0.05) restoration of the antioxidant status coupled with significant (P<0.05) decrease in the tissues' malondialdehyde content, following consumption of diets containing garlic. These results suggest that dietary inclusion of garlic powder could protect against gentamycin-induced hepatotoxicity, improve antioxidant status and modulate oxidative stress; a function attributed to their phenolic constituents.





    A study was made on the mineral requirements of Streptomyces fradiae strain 3535 for neomycin production. It was observed that optimal levels of the elements Ca, Fe, and Zn per milliliter of a synthetic medium for neomycin production were 10.8, 1.0, and 0.115 mug, respectively. K(2)HPO(4) was required at a concentration of 0.1% for maximal yield of neomycin, whereas NaCl and the metals Mn and Cu were without any effect. High doses of Zn (0.23 mug/ml or above) caused destruction of neomycin after the fifth day of fermentation.

  10. Development of a novel bead-based 96-well filtration plate competitive immunoassay for the detection of Gentamycin.


    Ho, Tien Yu Jessica; Chan, Chia-Chung; Chan, KinGho; Wang, Yu Chieh; Lin, Jing-Tang; Chang, Cheng-Ming; Chen, Chien-Sheng


    We developed a sensitive, simple, inexpensive and rapid bead-based immunoassay platform, composed of liposomal nanovesicle amplification system, Gentamycin sulfate beads and 96-well filtration plates. In the beginning of the assay, Gentamycin sulfate beads, Gentamycin sulfate and Gentamycin specific antibody were incubated in a bottom-sealed 96-well filtration plate. After incubation, washing was done by running washing buffer through the unsealed filtration plate with only gravity and the antibody-Gentamycin bead complexes were retained in the plate. Fluorescent dye-loaded protein G-liposomal nanovesicles were then added to specifically bind to antibodies on the retained beads. After washing unbound nanovesicles, millions of fluorescent dye molecules were released by adding a detergent solution to lyse liposomal nanovesicles. The limit of detection (LOD) of this novel detection platform in TBS and in skim milk were 52.65 ng/mL and 14.16 ng/mL, which are both sufficient for detecting the 200 ng/mL Codex maximum residual level (MRL). The dynamic ranges were both from each of their LODs to 100 μg/mL. The 50% inhibition concentrations (IC50) in TBS and skim milk were 199.66 ng/mL and 360.81 ng/mL, respectively. We also demonstrated the good specificity of this platform by comparing detection results between pure Gentamycin solution and a mixture solution of 6 different antibiotics including Gentamycin in skim milk. The entire assay with 60 samples was conducted within 2h. In sum, this novel biosensing platform not only fulfilled most benefits of magnetic bead-based assays, but also was inexpensive and convenient by replacing the magnetic separation with filtration plate separation.

  11. Mineral Nutrition of Streptomyces kanamyceticus for Kanamycin Formation

    PubMed Central

    Basak, Ketaki; Majumdar, S. K.


    Kanamycin production by Streptomyces kanamyceticus ATCC 12853 requires magnesium sulfate and potassium phosphate at concentrations of 0.4 and 1.0 g per liter, respectively. The optimal concentrations of Fe and Zn for production of kanamycin are 0.25 and 0.575 μg/ml, respectively, whereas Mo at 0.04 μg/ml allows maximal cellular growth and antibiotic synthesis. Mn and Ca are without any effect. Cu, Co, Ni, and V have inhibitory effect on growth of the organism as well as kanamycin formation. PMID:1190749

  12. Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants.


    Mentewab, Ayalew; Stewart, C Neal


    Selectable markers of bacterial origin such as the neomycin phosphotransferase type II gene, which can confer kanamycin resistance to transgenic plants, represent an invaluable tool for plant engineering. However, since all currently used antibiotic-resistance genes are of bacterial origin, there have been concerns about horizontal gene transfer from transgenic plants back to bacteria, which may result in antibiotic resistance. Here we characterize a plant gene, Atwbc19, the gene that encodes an Arabidopsis thaliana ATP binding cassette (ABC) transporter and confers antibiotic resistance to transgenic plants. The mechanism of resistance is novel, and the levels of resistance achieved are comparable to those attained through expression of bacterial antibiotic-resistance genes in transgenic tobacco using the CaMV 35S promoter. Because ABC transporters are endogenous to plants, the use of Atwbc19 as a selectable marker in transgenic plants may provide a practical alternative to current bacterial marker genes in terms of the risk for horizontal transfer of resistance genes.

  13. Limitation of the antibiotic-eluting bone graft substitute: An example of gentamycin-impregnated calcium sulfate.


    Wu, Chang-Chin; Huang, Yang-Kai; Chang, Wei-Jen; Wu, Yun-Ching; Wang, Chen-Chie; Yang, Kai-Chiang


    Patients with inadequate volume of alveolar processes or bone defects commonly require graft substitutes in oral, maxillofacial or orthopedic surgery. Ridge augmentation and reconstruction of facial bony defects with bone graft materials achieve better outcomes in functional and aesthetic rehabilitation. The injectable calcium sulfate filler is used widely in intra-operative applications. Calcium sulfate bone filler has been shown to upregulate bone formation-related mRNA genes in vitro and improve osseointegration in vivo. In addition, the bone graft substitute can be used as a drug delivery system for antibiotics to treat or prevent infections based on the clinical experiences. However, the influences of antibiotics addition on the calcium sulfate are not fully understood. In this study, calcium sulfate impregnated with gentamycin in different weight ratios was characterized. The results showed that gentamycin prolonged the hydration process and extended initial/final setting times of calcium sulfate. The addition of gentamycin slowed the conversion from calcium sulfate hemihydrate to dihydrate and changed the crystalline phase and microstructure. Higher amounts of gentamycin added resulted in faster degradation and lower mechanical strength of calcium sulfate. This study reveals that the extended setting time, decreased compressive strength, and the accelerated degradation of the gentamycin-impregnated calcium sulfate bone graft substitutes should be considered during intra-operative applications. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 2016. © 2016 Wiley Periodicals, Inc.

  14. Attenuation of gentamycin-induced nephrotoxicity in rats by dietary inclusion of ginger (Zingiber officinale) and turmeric (Curcuma longa) rhizomes.


    Ademiluyi, Adedayo O; Oboh, Ganiyu; Ogunsuyi, Opeyemi B; Akinyemi, Ayodele J


    This study sought to investigate the modulatory effects of dietary inclusion of ginger (Zingiber officinale) and turmeric (Curcuma longa) rhizomes on antioxidant status and renal damage induced by gentamycin in rats. Renal damage was induced in albino rats pretreated with dietary inclusion of ginger and turmeric (2% and 4%) by intraperitoneal (i.p.) administration of gentamycin (100 mg/kg body weight) for three days. Assays for renal damage biomarkers (plasma creatinine, plasma urea, blood urea nitrogen and plasma uric acid), malondialdehyde (MDA) content and reduced glutathione (GSH) content as well as renal antioxidant enzymes (catalase, glutathione-S-transferase (GST), glutathione peroxidase (GPx) and superoxide dismutase (SOD)) were carried out. The study revealed significant (p < 0.05) increases in renal damage biomarkers following gentamycin administration with severe alteration in kidney antioxidant status. However, pretreatment with ginger and turmeric rhizome (2% and 4%) prior to gentamycin administration significantly (p < 0.05) protected the kidney and attenuated oxidative stress by modulating renal damage and antioxidant indices. This finding therefore suggests that dietary inclusion of ginger and turmeric rhizomes may protect against gentamycin-induced nephrotoxicity and oxidative stress.

  15. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2011 CFR


    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly at...

  16. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2012 CFR


    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly at...

  17. Radioenzymatic assays for aminoglycosides with kanamycin 6'- acetyltransferase

    SciTech Connect

    Weber, A.; Smith, A.L.; Opheim, K.E.


    To facilitate the rapid and accurate quantitation of parenterally administered aminoglycosides, the optimum conditions (pH, duration of incubation, and cofactor concentrations) were defined to permit radioenzymatic assays with kanamycin acetyltransferase. The accuracy in quantitating tobramycin, netilmicin, kanamycin, and amikacin at concentrations in the therapeutic range was greater than 90%, with a mean recovery of 102.8%. The mean of the interassay coefficient of variation was 7.8%. Typical standard curves at six different concentrations resulted in a correlation coefficient (r value) of greater than 0.99 for each aminoglycoside. The radioenzymatic assay correlates well with the bioassay (tobramycin and netilmicin) and radioimmunoassay (amikacin and kanamycin); the correlation coefficient is greater than 0.90 for all. The authors conclude that the radioenzymatic assay utilizing kanamycin 6'-acetyltransferase is feasible for all commercially available parenterally administered aminoglycosides.

  18. [Electrooptical parameters of kanamycin-treated E. coli cell suspensions].


    Guliĭ, O I; Markina, L N; Bunin, V D; Ignatov, V V; Ignatov, O V


    The effect of kanamycin on the electrophysical parameters of cell suspensions of Escherichia coli K-12 and pMMB33 was investigated. Incubation of the sensitive K-12 strain with kanamycin resulted in significant changes in the orientation spectra (OS) of the cell suspensions; these changes were not revealed in the case of the resistant pMMB33 strain. In the case of the sensitive K-12 strain incubated with different kanamycin concentrations, changes in the OS of the cell suspensions occurred within the 10-1000 kHz frequency range of the orienting electrical field. The most pronounced change in the electrooptical signal was observed at 10 microg/ml of kanamycin. Control experiments were carried out by standard plating on nutrient media. Thus, the OS changes of suspensions in the presence of antibiotics may be used as a test for microbial resistance to such antibiotics.

  19. Thermosensitive replication of a kanamycin resistance factor.


    Terawaki, Y; Takayasu, H; Akiba, T


    A strain of Proteus vulgaris isolated from the urinary tract of a patient with postoperative pyelonephritis and resistant to sulfonamide, streptomycin, tetracycline, and kanamycin (KM) was found to transfer only KM resistance by cell-to-cell conjugation. The genetic determinant controlling the transferable KM resistance was considered to be an R factor and was designated R (KM). Successive transfer of KM resistance was demonstrated also from Escherichia coli 20S0, which received the R (KM) factor, to other substrains of E. coli K-12 or Salmonella typhimurium LT-2. The transfer of the R (KM) factor was strongly affected by the temperature at which the mating culture was kept. The transfer frequency of R (KM) at 25 C was about 10(5) times higher than at 37 C. The R (KM) factor was spontaneously eliminated from the host bacterial cells when P. vulgaris was cultured at 42 C, but no elimination occurred at 25 C. This elimination of the R (KM) factor at elevated temperature was also observed when the R (KM) factor infected E. coli and S. typhimurium. On the other hand, a normal R factor could not be eliminated from the same E. coli host strain by cultivation at the higher temperature. We consider the thermosensitive transfer and the spontaneous elimination of the R (KM) factor at higher temperature to depend upon thermosensitive replication of the R (KM) factor.

  20. Immunoassay Analysis of Kanamycin in Serum Using the Tobramycin Kit

    PubMed Central

    Dijkstra, J. A.; Voerman, A. J.; Greijdanus, B.; Touw, D. J.


    Kanamycin is one of the aminoglycosides used in the treatment of multidrug-resistant tuberculosis. Blood concentrations of kanamycin are predictive for the treatment efficacy and the occurrence of side effects, and dose adjustments can be needed to optimize therapy. However, an immunoassay method for the quantification of kanamycin is not commercially available. We modified the existing tobramycin immunoassay to analyze kanamycin. This modified method was tested in a concentration range of 0.3 to 80.0 mg/liter for inaccuracy and imprecision. In addition, the analytical results of the immunoassay method were compared to those obtained by a liquid chromatography-tandem mass spectrometry (LC-MS/MS) analytical method using Passing and Bablok regression. Within-day imprecision varied from 2.3 to 13.3%, and between-day imprecision ranged from 0.0 to 11.3%. The inaccuracy ranged from −5.2 to 7.6%. No significant cross-reactivity with other antimicrobials and antiviral agents was observed. The results of the modified immunoassay method were comparable with the LC-MS/MS analytical outcome. This new immunoassay method enables laboratories to perform therapeutic drug monitoring of kanamycin without the need for complex and expensive LC-MS/MS equipment. PMID:27185806

  1. [Comparison of pharmacological renal preconditioning with dalargin and lithium ions in the model of gentamycin-induced acute renal failure].


    Cherpakov, R A; Grebenchikov, O A; Plotnikov, E Ju; Likhvantsev, V V


    To examine the efficacy of renal preconditioning effect of dalargin and lithium ions by observing the model of gentamycin-induced acute renalfailure. The experiments were performed on white rats, male. The influence of dalargin and lithium ions on the development of gentamycin-induced acute renalfailure was studied in vivo. On the first 24 hours after dalargin injections were terminated, the rats were euthanized humanly. After this we took the blood for a biochemistry study and a renal culture for biochemical test and also for the test of gsk-3β activity. Concentrations of creatinine and urea were studied in serum. The culture samples of renal tubular epithelium before insertion of gentamycin were incubated in dalargin or lithium ions in different concentrations. After that the substratum was immediately changed to gentamycin in different concentrations also and the incubated for 24 hours. After all the standards MTT-test was performed (based on the ability of living cells to reduce the unpainted form by 3-4,5-dimethylthiazol-2-yl-2,5-difenilterarazola to blue crystalline farmazan). Lithium precondition leads to the 250% increase of gsk-3β concentration (p = 0.035). The same results were observed after injection of dalargin in 50 mcg/kg concentration. Concentration of creatinine was 44% lower in the dalargin group than in the control group (p = 0.022). Concentration of creatinine was 32% lower in the lithium group than in the control group (p = 0.030). Concentration of urea was 27% lower in the lithium group than in the control group (p = 0.049). Morphological inflammatory changes in the control group were more significant also. In vitro studies showed the maximum efficacy in the lithium group. The most effective dalargin concentration was 5 mg/ml. Lithium and dalargine preconditioning lowers the signs of gentamycine induced acute renal failure and damage rate of renal parenchyma in vivo and in vitro.

  2. Discovery of parallel pathways of kanamycin biosynthesis allows antibiotic manipulation.


    Park, Je Won; Park, Sung Ryeol; Nepal, Keshav Kumar; Han, Ah Reum; Ban, Yeon Hee; Yoo, Young Ji; Kim, Eun Ji; Kim, Eui Min; Kim, Dooil; Sohng, Jae Kyung; Yoon, Yeo Joon


    Kanamycin is one of the most widely used antibiotics, yet its biosynthetic pathway remains unclear. Current proposals suggest that the kanamycin biosynthetic products are linearly related via single enzymatic transformations. To explore this system, we have reconstructed the entire biosynthetic pathway through the heterologous expression of combinations of putative biosynthetic genes from Streptomyces kanamyceticus in the non-aminoglycoside-producing Streptomyces venezuelae. Unexpectedly, we discovered that the biosynthetic pathway contains an early branch point, governed by the substrate promiscuity of a glycosyltransferase, that leads to the formation of two parallel pathways in which early intermediates are further modified. Glycosyltransferase exchange can alter flux through these two parallel pathways, and the addition of other biosynthetic enzymes can be used to synthesize known and new highly active antibiotics. These results complete our understanding of kanamycin biosynthesis and demonstrate the potential of pathway engineering for direct in vivo production of clinically useful antibiotics and more robust aminoglycosides.

  3. Reversible neurotoxicity of kanamycin on dorsal cochlear nucleus.


    Fan, Guo-Run; Yin, Ze-Deng; Sun, Yu; Chen, Sen; Zhang, Wen-Juan; Huang, Xiang; Kong, Wei-Jia; Zhang, Hong-Lian


    The time course of aminoglycoside neurotoxic effect on cochlear nucleus is still obscure. We examined dynamic pathological changes of dorsal cochlear nucleus (DCN) and investigated whether apoptosis or autophagy was upregulated in the neurotoxic course of kanamycin on DCN after kanamycin treatment. Rats were treated with kanamycin sulfate/kg/day at a dose of 500mg by subcutaneous injection for 10 days. Dynamic pathological changes, neuron density and neuron apoptosis of the DCN were examined at 1, 7, 14, 28, 56, 70 and 140 days after kanamycin treatment. The expressions of JNK1, DAPK2, Bcl-2, p-Bcl-2, Caspase-3, LC3B and Beclin-1 were also detected. Under transmission electron microscopy, the mitochondrial swelling and focal vacuoles as well as endoplasmic reticulum dilation were progressively aggravated from 1 day to 14 days, and gradually recovered from 28 days to 140 days. Meanwhile, both autophagosomes and autolysosomes were increased from 1 day to 56 days. Only few neurons were positive to the TUNEL staining. Moreover, neither the expressions of caspase-3 and DAPK2 nor neurons density of DCN changed significantly. LC3-II was drastically increased at 7 days. Beclin-1 was upgraded at 1 and 7 days. P-Bcl-2 increased at 1, 7, 14 and 28 days. JNK1 increased at 7 days, and Bcl-2 was downgraded at 140 days. LC3-B positive neurons were increased at 1, 7 and 14 days. These data demonstrated that the neurons damage of the DCN caused by kanamycin was reversible and autophagy was upregulated in the neurotoxic course of kanamycin on DCN through JNK1-mediated phosphorylation of Bcl-2 pathway.

  4. Label-free gold nanoparticles for the determination of neomycin

    NASA Astrophysics Data System (ADS)

    Apyari, Vladimir V.; Dmitrienko, Stanislava G.; Arkhipova, Viktoriya V.; Atnagulov, Aydar G.; Gorbunova, Mariya V.; Zolotov, Yury A.


    A new spectrophotometric method for the determination of neomycin has been developed. The method is based on aggregation of label-free gold nanoparticles leading to change in absorption spectra and color of the solution. Influence of different factors (the concentration of ethylenediaminetetraacetate (EDTA), pH, the concentrations of neomycin and the nanoparticles) on the aggregation and analytical performance of the method was investigated. EDTA plays an important role not only as a masking agent to eliminate interferences of metal cations but strongly affects the sensitivity of the nanoparticles relative to neomycin. The method allows to determine neomycin with detection limit of 28 ng mL-1. It was applied to analysis of eye- and ear-drops. The sample pretreatment is simply done by diluting the formulation with water.

  5. Label-free gold nanoparticles for the determination of neomycin.


    Apyari, Vladimir V; Dmitrienko, Stanislava G; Arkhipova, Viktoriya V; Atnagulov, Aydar G; Gorbunova, Mariya V; Zolotov, Yury A


    A new spectrophotometric method for the determination of neomycin has been developed. The method is based on aggregation of label-free gold nanoparticles leading to change in absorption spectra and color of the solution. Influence of different factors (the concentration of ethylenediaminetetraacetate (EDTA), pH, the concentrations of neomycin and the nanoparticles) on the aggregation and analytical performance of the method was investigated. EDTA plays an important role not only as a masking agent to eliminate interferences of metal cations but strongly affects the sensitivity of the nanoparticles relative to neomycin. The method allows to determine neomycin with detection limit of 28ngmL(-1). It was applied to analysis of eye- and ear-drops. The sample pretreatment is simply done by diluting the formulation with water. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Furazolidone toxicity in neomycin-treated turkey poults.


    Czarnecki, C M


    Furazolidone (FZ) toxicity was evaluated in turkey poults treated with neomycin at a dose of 20 mg/kg body weight for 5, 10, or 26 days. Neomycin treatment had no effect on FZ-induced anorexia, delayed the onset of altered electrocardiographic patterns by approximately 1 week, and did not significantly affect the development of FZ-induced cardiomyopathy. Data indicated that FZ toxicity is not significantly altered by the gut microflora.

  7. Application of glycodiversification: expedient synthesis and antibacterial evaluation of a library of kanamycin B analogues.


    Li, Jie; Wang, Jinhua; Czyryca, Przemyslaw Greg; Chang, Huiwen; Orsak, Thomas W; Evanson, Richard; Chang, Cheng-Wei Tom


    [reaction: see text] The expedient synthesis of a library of kanamycin B analogues is reported. The revealed SAR will guide future designs in developing kanamycin-type aminoglycoside antibiotics against drug-resistant bacteria.

  8. Regeneration of Medicago truncatula from protoplasts isolated from kanamycin-sensitive and kanamycin-resistant plants.


    Rose, R J; Nolan, K E


    Medicago truncatula (barrel medic) is an annual legume of agricultural and biological interest. In this report regeneration from isolated mesophyll protoplasts is described. A specifically developed, highly regenerable seed line is essential for regeneration. Other critical requirements for regeneration are the starting plant material, the use of agarose droplets incubated in a shallow layer of liquid medium, and protoplast density. Plants are grown in controlled environment conditions. Protoplasts are purified using a Percoll-based flotation procedure, then embedded in 100 μl agarose droplets containing a basal medium plus 25 μM NAA and 4 μM BAP (the same medium as in the surrounding shallow liquid layer) to induce protoplast division. A protoplast density of 6-8×10(5) ml(-1) is required for maximum colony formation. M. truncatula plants previously transformed for kanamycin resistance yielded embryogenic callus and also regenerated plants. Protoplasts from other annual Medicago (M.intertexta and M.scutellata) species readily form calli by the procedure we have described.

  9. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  10. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  11. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  12. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.


    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill


    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

  13. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin B, and hydrocortisone suspension.

    Code of Federal Regulations, 2014 CFR


    ..., atopic dermatitis, interdigital eczema, and otitis externa caused by bacteria susceptible to neomycin... caused by bacteria susceptible to neomycin, penicillin, and polymyxin B. (3) Limitations. For use in dogs...

  14. Factors Which Influence Synergism by Neomycin and Oxytetracycline

    PubMed Central

    Williams, B. J.


    Six strains of enteropathogenic gram-negative bacteria were tested for susceptibility to neomycin or oxytetracycline alone and combined in fixed ratios. The minimal inhibitory concentration for the combination was less than one-half of that expected if the antibiotic activities were simply additive. Neomycin alone was more effective against bacteria multiplying in the presence of abundant oxygen, whereas oxytetracycline alone was more effective against bacteria multiplying in relatively anaerobic environments; when combined, the antibiotics complemented each other by their opposing optima for activity. Oxygen concentration, pH, and neomycin activity are related, and the depression of acid production by oxytetracycline is believed to be partially responsible for the synergistic activity of this pair of antibiotics. Images PMID:4930276

  15. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.


    Li, Yuebin; Ruby, John; Wu, Hui


    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  16. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2013 CFR


    ... ointment. 524.1484i Section 524.1484i Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... NEW ANIMAL DRUGS § 524.1484i Neomycin sulfate, hydrocortisone acetate, sterile ointment. (a) Specifications. The drug contains 5 milligrams of neomycin sulfate, equivalent to 3.5 milligrams of neomycin base...

  17. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2012 CFR


    ... ointment. 524.1484i Section 524.1484i Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... NEW ANIMAL DRUGS § 524.1484i Neomycin sulfate, hydrocortisone acetate, sterile ointment. (a) Specifications. The drug contains 5 milligrams of neomycin sulfate, equivalent to 3.5 milligrams of neomycin base...

  18. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Neomycin, penicillin, polymyxin, hydrocortisone... NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin, hydrocortisone suspension. (a... milligrams of neomycin, 10,000 international units of penicillin G procaine, 5,000 international units of...

  19. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin, penicillin, polymyxin, hydrocortisone... NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin, hydrocortisone suspension. (a... milligrams of neomycin, 10,000 international units of penicillin G procaine, 5,000 international units of...

  20. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Neomycin, penicillin, polymyxin, hydrocortisone... NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin, hydrocortisone suspension. (a... milligrams of neomycin, 10,000 international units of penicillin G procaine, 5,000 international units of...

  1. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Neomycin, penicillin, polymyxin, hydrocortisone... NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin, hydrocortisone suspension. (a... milligrams of neomycin, 10,000 international units of penicillin G procaine, 5,000 international units of...

  2. 21 CFR 524.1883 - Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Prednisolone sodium phosphate-neomycin sulfate... DOSAGE FORM NEW ANIMAL DRUGS § 524.1883 Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment. (a) Specifications. Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment contains...

  3. 21 CFR 524.1883 - Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Prednisolone sodium phosphate-neomycin sulfate... DOSAGE FORM NEW ANIMAL DRUGS § 524.1883 Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment. (a) Specifications. Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment contains...

  4. 21 CFR 524.1883 - Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Prednisolone sodium phosphate-neomycin sulfate... DOSAGE FORM NEW ANIMAL DRUGS § 524.1883 Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment. (a) Specifications. Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment contains...

  5. 21 CFR 524.1883 - Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Prednisolone sodium phosphate-neomycin sulfate... DOSAGE FORM NEW ANIMAL DRUGS § 524.1883 Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment. (a) Specifications. Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment contains...

  6. Construction and uses of a new transposable element whose insertion is able to produce gene fusions with the neomycin-phosphotransferase-coding region of Tn903.


    Ratet, P; Richaud, F


    We describe the construction of a transposable element derived from the Mu phage that upon insertion is able to create a gene fusion between the region of Tn903 coding for neomycin phosphotransferase (NPT I), which confers resistance to aminoglycosides including kanamycin (KmR), neomycin and G418, and the control elements of the gene where the insertion occurs. A chloramphenicol (Cm) transacetylase gene (cat) that confers resistance to Cm is present in the transposon so that transposition events can be monitored even when no active fusions with the nptI coding region occur. The transposase gene is deleted and, therefore, this transposon is perfectly stable upon insertion. The properties of this new transposable element were studied by obtaining gene fusions between the Escherichia coli L-arabinose operon and 'nptI gene. In some of them the KmR phenotype is induced by arabinose. Insertions of this element in cloned fragments of the T-DNA region of Agrobacterium rhizogenes were also isolated. Some of them confer a KmR phenotype upon its E. coli carriers, which indicates that portions of the T-DNA are expressed in these cells.

  7. 21 CFR 524.1484a - Neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR


    ... for use in dogs and cats for the treatment of superficial ocular bacterial infections limited to the...) Severe infections should be supplemented by systemic therapy. (5) Prolonged administration of the drug may permit overgrowth of organisms that are not susceptible to neomycin. If new infections due...

  8. 21 CFR 524.1484a - Neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR


    ... for use in dogs and cats for the treatment of superficial ocular bacterial infections limited to the...) Severe infections should be supplemented by systemic therapy. (5) Prolonged administration of the drug may permit overgrowth of organisms that are not susceptible to neomycin. If new infections due...

  9. Producing a Mammalian GFP Expression Vector Containing Neomycin Resistance Gene.


    Izadi, Manizheh; Abiri, Maryam; Keramatipour, Mohammad


    The green fluorescent protein (GFP) was originally isolated from the Jellyfish Aequorea Victoria that fluoresces green when exposed to blue light. GFP protein is composed of 238 amino acids with the molecular mass of 26.9 kD. The GFP gene is frequently used in cellular and molecular biology as a reporter gene. To date, many bacterial, yeast, fungal, plants, fly and mammalian cells, including human, have been created which express GFP. Martin Chalfie, Osamu Shimomura, and Roger Tsien were awarded the 2008 noble prize in chemistry for their discovery and development of GFP. In many studies on mammalian cells, GFP gene is introduced into cells using vector-based systems or a recombinant virus to track the location of a target protein or to study the expression level of the gene of interest, but in these studies there is no selection marker to normalize transfection. According to the importance of neomycin gene as a selection marker in mammalian cells, we aimed to produce a GFP expression vector that contains neomycin gene. GFP gene was separated from pEGFP-N1 vector and was inserted in the back-bone of pCDNA3.1/His/LacZ vector that contained the neomycin gene. The resulted vector contained GFP beside neomycin gene.

  10. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2010 CFR


    .... Cattle feeds shall bear the following warning statement: “Use of more than one product containing neomycin or failure to follow withdrawal times may result in illegal drug residues.” (e) Indications for... veal. A milk discard time has not been established for use in lactating dairy cattle. Do not use...

  11. An aminoglycoside antibiotic gentamycin induces oxidative stress, reduces antioxidant reserve and impairs spermatogenesis in rats.


    Narayana, Kilarkaje


    Gentamycin (GS) is an aminoglycoside antibiotic used to treat infections of various Gram-negative organisms. The present study was designed to investigate the effects of GS on oxidative stress, antioxidant levels, testicular structure and sperm parameters in the rat. Adult Wistar rats (12 week old; N=7/group) were treated (i. p.) with 0 mg/kg, 3 mg/kg and 5 mg/kg for 10 days at an interval of 24 hr between subsequent treatments. Animals were sacrificed on days 1 and 35 after the last treatment, and the reproductive organs were removed and weights of testis and seminal vesicle were recorded. The right testis was processed for light microscopic analysis. The left testis was homogenized and step 19 spermatids were counted to determine the daily sperm production (DSP) and daily abnormal sperm production (DASP). The sperm count, sperm motility and incidence of abnormal sperms were estimated in the epididymis. In testicular sections, along with the evaluation of qualitative changes, the seminiferous tubule diameter (STD) and the epithelial height (SE) were measured. The incidence of stage XIV tubules in testicular sections, meiotic figures and step 14 spermatids/stage XIV tubule, and step 19 spermatids/stage VII tubule were estimated. Intra-testicular levels of superoxide anion, lipid peroxidation and antioxidants-superoxide dismutase (SOD), catalase, glutathione peroxidase (GPx) and ascorbic acid were measured. GS did not affect the body weight, but the testis weight and DSP were decreased at 5 mg/kg dose-level on both days (p<0.05), and the weight of seminal vesicle decreased on day 35 at both dose-levels. The DASP was increased in a dose-dependent manner (p<0.05) on days 1 and 35 at both dose-levels. The sperm count was decreased at both dose-levels on day 35, whereas the sperm motility was decreased and sperm abnormality was increased on day 1 at 5 mg/kg and on day 35 at both dose-levels. GS induced structural changes such as sloughing of seminiferous epithelium

  12. Kanamycin-resistant alfalfa has a point mutation in the 16S plastid rRNA.


    Rosellini, D; LaFayette, P R; Barone, P; Veronesi, F; Parrott, W A


    Genes conferring resistance to kanamycin are frequently used to obtain transgenic plants as spontaneous resistance to kanamycin is not known to exist in higher plants. Nevertheless, mutations conferring kanamycin resistance have been identified in Chlamydomonas reinhardtii, raising the question as to why kanamycin-resistant mutants have not been found in higher plants. While attempting plastid transformation of alfalfa, we obtained non-transgenic but kanamycin-resistant somatic embryos following 2 months of culture in the presence of 50 mg l(-1) kanamycin. Sequencing of the plastid DNA region corresponding to the decoding site of the 16S rRNA in ten independent resistant events revealed an A to C transversion at position 1357 of the 16S plastid rDNA, the same site at which an A to G conversion confers kanamycin resistance to C. reinhardtii by reducing the ability of the antibiotic to bind to its target site. All plants derived from the resistant embryos through additional cycles of somatic embryogenesis in the absence of kanamycin retained the mutant phenotype, suggesting that the mutation was homoplastomic. Resistant plants produced 85% less biomass than controls; their leaves were chlorotic during early development and over time slowly turned green. The absence of kanamycin- resistant mutants in higher plants might be explained by the requirement for a regeneration system capable of resulting in homoplastomic individuals, or it may be the result of the detrimental effect of the mutation on the phenotype.

  13. Neomycin resistance as a selectable marker in Methanococcus maripaludis

    SciTech Connect

    Argyle, J.L.; Leigh, J.A.; Tumbula, D.L.


    The authors cloned the aminoglycoside phosphotransferase genes APH3{prime}I and APH3{prime}II between the Methanococcus voltae methyl reductase promoter and terminator in a plasmid containing a fragment of Methanococcus maripaludis chromosomal DNA. The resulting plasmids encoding neomycin resistance transformed M. maripaludis at frequencies similar to those observed for pKAS102 encoding puromycin resistance. The antibiotic geneticin was not inhibitory to M. maripaludis. 22 refs., 3 figs., 3 tabs.

  14. Minocycline Protection of Neomycin Induced Hearing Loss in Gerbils

    PubMed Central

    Robinson, Alan M.; Vujanovic, Irena; Richter, Claus-Peter


    This animal study was designed to determine if minocycline ameliorates cochlear damage is caused by intratympanic injection of the ototoxic aminoglycoside antibiotic neomycin. Baseline auditory-evoked brainstem responses were measured in gerbils that received 40 mM intratympanic neomycin either with 0, 1.2, or 1.5 mg/kg intraperitoneal minocycline. Four weeks later auditory-evoked brainstem responses were measured and compared to the baseline measurements. Minocycline treatments of 1.2 mg/kg and 1.5 mg/kg resulted in significantly lower threshold increases compared to 0 mg/kg, indicating protection of hearing loss between 6 kHz and 19 kHz. Cochleae were processed for histology and sectioned to allow quantification of the spiral ganglion neurons and histological evaluation of organ of Corti. Significant reduction of spiral ganglion neuron density was demonstrated in animals that did not receive minocycline, indicating that those receiving minocycline demonstrated enhanced survival of spiral ganglion neurons, enhanced survival of sensory hairs cells and spiral ganglion neurons, and reduced hearing threshold elevation correlates with minocycline treatment demonstrating that neomycin induced hearing loss can be reduced by the simultaneous application of minocycline. PMID:25950003

  15. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms. ...

  16. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms. ...

  17. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  18. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  19. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  20. Development of immunoassays for the detection of kanamycin in veterinary fields

    PubMed Central

    Jin, Yong; Jang, Jin-Wook; Han, Chang-Hoon


    Monoclonal antibody against kanamycin was prepared, and competitive direct ELISA and immunochromatographic assay were developed using the antibody to detect kanamycin in animal plasma and milk. The monoclonal antibody produced was identified to be IgG1, which has a kappa light chain. No cross-reactivity of the antibody was detected with other aminoglycosides, indicating that the monoclonal antibody was highly specific for kanamycin. Based on competitive direct ELISA, the detection limits of kanamycin were determined to be 1.1 ng/ml in PBS, 1.4 ng/ml in plasma, and 1.0 ng/ml in milk. The concentration of intramuscularly injected kanamycin was successfully monitored in rabbit plasma with competitive direct ELISA. Based on the colloidal gold-based immunochromatographic assay, the detection limits of kanamycin were estimated to be about 6-8 ng/ml in PBS, plasma, and milk. The immunochromatographic assay would be suitable for rapid and simple screening of kanamycin residues in veterinary medicine. Screened positives can be confirmed using a more sensitive laboratory method such as competitive direct ELISA. Therefore, the assays developed in this study could be used to complement each other as well as other laboratory findings. Moreover, instead of slaughtering the animals to obtain test samples, these methods could be applied to determine kanamycin concentration in the plasma of live animals. PMID:16645333

  1. Development of immunoassays for the detection of kanamycin in veterinary fields.


    Jin, Yong; Jang, Jin-Wook; Han, Chang-Hoon; Lee, Mun-Han


    Monoclonal antibody against kanamycin was prepared, and competitive direct ELISA and immunochromatographic assay were developed using the antibody to detect kanamycin in animal plasma and milk. The monoclonal antibody produced was identified to be IgG1, which has a kappa light chain. No cross-reactivity of the antibody was detected with other aminoglycosides, indicating that the monoclonal antibody was highly specific for kanamycin. Based on competitive direct ELISA, the detection limits of kanamycin were determined to be 1.1 ng/ml in PBS, 1.4 ng/ml in plasma, and 1.0 ng/ml in milk. The concentration of intramuscularly injected kanamycin was successfully monitored in rabbit plasma with competitive direct ELISA. Based on the colloidal gold-based immunochromatographic assay, the detection limits of kanamycin were estimated to be about 6-8 ng/ml in PBS, plasma, and milk. The immunochromatographic assay would be suitable for rapid and simple screening of kanamycin residues in veterinary medicine. Screened positives can be confirmed using a more sensitive laboratory method such as competitive direct ELISA. Therefore, the assays developed in this study could be used to complement each other as well as other laboratory findings. Moreover, instead of slaughtering the animals to obtain test samples, these methods could be applied to determine kanamycin concentration in the plasma of live animals.

  2. Discordant resistance to kanamycin and amikacin in drug-resistant Mycobacterium tuberculosis.


    Krüüner, Annika; Jureen, Pontus; Levina, Klavdia; Ghebremichael, Solomon; Hoffner, Sven


    It is generally thought that there is full cross-resistance in Mycobacterium tuberculosis between the aminoglycoside drugs kanamycin and amikacin. However, kanamycin resistance and amikacin susceptibility were seen in 43 of 79 (54%) multidrug-resistant Estonian isolates, indicating that there might be a need to test the resistance of M. tuberculosis isolates to both drugs.

  3. Deletion formation mutations in plasmid expression vectors are unfavored by runaway amplification conditions and differentially selected under kanamycin stress.


    Oliveira, Pedro H; Prazeres, Duarte M F; Monteiro, Gabriel A


    Plasmid pCIneo is a ColE1-like mammalian expression vector also used as backbone for DNA vaccine development. We have recently shown that pCIneo spontaneously recombines due to the presence of two 28bp direct repeats. The persistence of low-frequency recombinants led us to evaluate the impact of environmental stresses typically found during plasmid production on plasmid copy number and recombination frequency. We observed an increase in pCIneo amplification (2.6-4.3-fold) in Escherichia coli cultures grown at 42 degrees C and also in minimal medium (at both 37 degrees C and 42 degrees C). These conditions fit to the smallest ratio between recombinant molecules and total plasmids. Conversely, increasing the dissolved oxygen tension from 20% to 40% in rich media did not have a significant impact on both plasmid copy number and recombination frequency, independently of the temperature used. We have also shown recently that the neomycin resistance (neo(r)) gene of pCIneo becomes actively transcribed as a result of recombination between the repeats. This prompted us to gain some insight into plasmid adaptation and competition by evaluating the impact of distinct concentrations of kanamycin on the differential selection of plasmid recombinant forms: monomer and heterodimers (1+2 and 1+3). We found the monomeric form to be predominantly recovered at lower concentrations of antibiotic whilst higher concentrations led to an increase in the percentage of the 1+2 form. The 1+3 heterodimeric form was invariably found at low percentages, independently of the concentration used.

  4. Fructose restores susceptibility of multidrug-resistant Edwardsiella tarda to kanamycin.


    Su, Yu-bin; Peng, Bo; Han, Yi; Li, Hui; Peng, Xuan-xian


    Edwardsiella tarda, the causative agent of Edwardsiellosis, imposes medical challenges in both the clinic and aquaculture. The emergence of multidrug resistant strains makes antibiotic treatment impractical. The identification of molecules that facilitate or promote antibiotic efficacy is in high demand. In the present study, we aimed to identify small molecules whose abundance is correlated with kanamycin resistance in E. tarda by gas chromatography-mass spectrometry. We found that the abundance of fructose was greatly suppressed in kanamycin-resistant strains. The incubation of kanamycin-resistant bacteria with exogenous fructose sensitized the bacteria to kanamycin. Moreover, the fructose also functioned in bacteria persisters and biofilm. The synergistic effects of fructose and kanamycin were validated in a mouse model. Furthermore, the mechanism relies on fructose in activating TCA cycle to produce NADH, which generates proton motive force to increase the uptake of the antibiotics. Therefore, we present a novel approach in fighting against multidrug resistant bacteria through exploration of antibiotic-suppressed molecules.

  5. Multiple antibiotic resistance among gram negative bacteria isolated from poultry.


    Ansari, F A; Khatoon, H


    Gram negative bacteria, including species of Salmonella, Escherichia, Pseudomonas and Klebsiella, isolated from poultry, were screened for their resistance to the commonly used antibiotics: ampicillin, chloramphenicol, gentamycin, kanamycin, neomycin, polymyxin B, streptomycin and tetracycline. Of the 500 bacteria screened, 351 were found to be resistant to one or more antibiotics at the level of 50 micrograms/ml. Various patterns of antibiotic resistance observed during these studies have been reported.

  6. Kanamycin detection based on the catalytic ability enhancement of gold nanoparticles.


    Wang, Chengke; Chen, Dan; Wang, Qingqing; Tan, Rong


    In this paper, we demonstrated that kanamycin could enhance the peroxidase-like activity of citrate-capped gold nanoparticles (AuNPs) through two steps: the attachment of kanamycin onto AuNPs through -NH2 (on kanamycin) and -COOH (on AuNPs) interactions; and the specifically interaction between glucoside on kanamycin and AuNPs which changes the surface property of AuNPs, and produced •OH radicals and Au(3+) in the solution, and catalyzed the chromogenic reactions between 3, 3', 5, 5'-tetramethylbenzidine (TMB) and H2O2. Based on this principle, a novel method for kanamycin detection has been developed. This method exhibited high sensitivity and selectivity, as low as 0.1nM kanamycin could be detected with a linear range from 0.1nM to 20nM and 20nM to 300nM, respectively. This method was also successfully applied for the detection of kanamycin content in milk and meat samples.

  7. Audiological Evaluation of Patients Taking Kanamycin for Multidrug Resistant Tuberculosis

    PubMed Central

    Sharma, Vishal; Bhagat, Sanjeev; Verma, Bhimsain; Singh, Ravinder; Singh, Surinderpal


    Introduction: The incidence of multidrug resistant tuberculosis is increasing in developing countries. Aminoglycosides are an integral part of second-line drugs, however ototoxicity is a major limitation for their use. This study aims to determine the extent of hearing loss in patients taking one of the commonly prescribed drugs for Multidrug resistant tuberculosis (MDR-TB), Kanamycin, at a Government Medical College, Patiala, Punjab, India, which is a 1200 bed tertiary care hospital. Materials and Methods: A total of 100 patients (68 males and 32 females) with confirmed diagnosis of MDR-TB were included in this study conducted between January 2012 and February 2014. Subjects were between 15 to 60 years of age, with a mean age of 37.46 ± 10.1. Pure tone audiometry (PTA) was performed before the start of the therapy, as a baseline, and was repeated after 1 week and 6 weeks of Kanamycin use to assess hearing loss as an effect of therapy. Results: Of the 100 patients examined, ototoxicity was found in 18 subjects post therapy. Incidence of high frequency hearing loss was 2% at week 1, and 12% after 6 weeks of follow up. However, 4% of the cases developed flat loss at week 6. The hearing loss was bilateral in 13 patients and unilateral in 5 patients. Ototoxicity was more common in males (66.67%) compared to females (33.3%). Maximum cases were found in the age group of 36 to 45 years (36.8%), the majority being from a rural background (83.3%). The association with socioeconomic status (P=0.024) and co-morbid conditions like diabetes and hypertension (P=0.001) reached statistical significance. Conclusion: Lack of specific guidelines to monitor patients taking aminoglycosides makes ototoxicity a major adverse effect of their use in MDR-TB. More studies are mandated to study the risk factors associated with the development of ototoxicity and for the development of alternate drugs for the treatment of MDR-TB. PMID:27429949

  8. From GUIDON to NEOMYCIN and HERACLES in Twenty Short Lessons. Final Report. ONR Technical Report #20.

    ERIC Educational Resources Information Center

    Clancey, William J.

    This paper reviews the research leading from the GUIDON rule-based tutoring system, including the reconfiguration of MYCIN into NEOMYCIN and NEOMYCIN's generalization into the heuristic classification shell, HERACLES. The presentation is organized chronologically around pictures and dialogues that represent turning points and crystallize the basic…

  9. 21 CFR 524.1484f - Neomycin, prednisolone, and tetracaine otic suspension.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Neomycin, prednisolone, and tetracaine otic suspension. 524.1484f Section 524.1484f Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... neomycin-susceptible organisms and/or allergy. (3) Limitations. Federal law restricts this drug to use...

  10. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2013 CFR


    ... chapter. (c) Conditions of use. (1) The drug is used in dogs to control bacterial diarrhea caused by... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each...

  11. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2011 CFR


    ... chapter. (c) Conditions of use. (1) The drug is used in dogs to control bacterial diarrhea caused by... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each...

  12. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2012 CFR


    ... chapter. (c) Conditions of use. (1) The drug is used in dogs to control bacterial diarrhea caused by... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each...

  13. 21 CFR 524.155 - Bacitracin, neomycin, polymyxin B, and hydrocortisone ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR


    ... ophthalmic ointment. (a) Specifications. Each gram of ointment contains 400 units of bacitracin zinc, 5 milligrams (mg) of neomycin sulfate (equivalent to 3.5 mg of neomycin sulfate), 10,000 units of polymyxin B sulfate, and10 mg of hydrocortisone. (b) Sponsors. See Nos. 000061 and 043264 in § 510.600(c) of this...

  14. 21 CFR 524.1484e - Neomycin and polymyxin B ophthalmic solution.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Neomycin and polymyxin B ophthalmic solution. 524.1484e Section 524.1484e Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1484e Neomycin and polymyxin B ophthalmic solution. (a) Specifications....

  15. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2014 CFR


    ... contains both aminopropazine fumarate equivalent to 25 milligrams of aminopropazine base and neomycin sulfate equivalent to 50 milligrams of neomycin base. (b) Sponsor. See No. 000061 in § 510.600(c) of this... administered at a dosage level of one to two tablets per 10 pounds of body weight twice daily for 3 days.1 (3...

  16. Effect of neomycin on the bioavailability of spironolactone: a single-dose study.


    Bartle, W R; Coates, P E; Fisher, M M; Louman, F J


    The effect of oral neomycin sulfate on the bioavailability of oral spironolactone in humans was studied. A 100-mg spironolactone tablet was administered alone or with two 500-mg neomycin sulfate tablets to 12 healthy, fasting men in a randomized crossover fashion. Levels of canrenone (an active spironolactone metabolite) in plasma and urine samples collected for 32 and 48 hours after dosing, respectively, were measured fluorimetrically. Neomycin significantly decreased the peak plasma canrenone concentration, significantly increased the time to reach peak concentration of canrenone, and significantly decreased the urinary excretion of canrenone over the first four hours (p less than 0.05). There were no significant differences between treatment groups in elimination half-life, area under the plasma curves or 48-hour urinary excretion of canrenone. Single doses of neomycin appear to delay the rate but not reduce the extent of spironolactone absorption. Thus, neomycin may not interfere with the clinical efficacy of spironolactone.

  17. Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles.


    Fosso, Marina Y; Shrestha, Sanjib K; Green, Keith D; Garneau-Tsodikova, Sylvie


    Cationic amphiphiles derived from aminoglycosides (AGs) have been shown to exhibit enhanced antimicrobial activity. Through the attachment of hydrophobic residues such as linear alkyl chains on the AG backbone, interesting antibacterial and antifungal agents with a novel mechanism of action have been developed. Herein, we report the design and synthesis of seven kanamycin B (KANB) derivatives. Their antibacterial and antifungal activities, along with resistance/enzymatic, hemolytic, and cytotoxicity assays were also studied. Two of these compounds, with a C12 and C14 aliphatic chain attached at the 6″-position of KANB through a thioether linkage, exhibited good antibacterial and antifungal activity, were poorer substrates than KANB for several AG-modifying enzymes, and could delay the development of resistance in bacteria and fungi. Also, they were both relatively less hemolytic than the known membrane targeting antibiotic gramicidin and the known antifungal agent amphotericin B and were not toxic at their antifungal MIC values. Their oxidation to sulfones was also demonstrated to have no effect on their activities. Moreover, they both acted synergistically with posaconazole, an azole currently used in the treatment of human fungal infections.

  18. Aggregation of Kanamycin A: dimer formation with physiological cations.


    Dieterich, Johannes M; Gerstel, Ulrich; Schröder, Jens-Michael; Hartke, Bernd


    Global cluster geometry optimization has focused so far on clusters of atoms or of compact molecules. We are demonstrating here that present-day techniques also allow to globally optimize clusters of extended, flexible molecules, and that such studies have immediate relevance to experiment. For example, recent experimental findings point to production of larger clusters of an aminoglycoside closely related to Kanamycin A (KA), together with certain preferred physiological cations, by Pseudomonas aeruginosa. The present study provides first theoretical support for KA clustering, with a close examination of the monomer, the bare dimer, and dimers with sodium and potassium cations, employing global cluster structure optimization, in conjunction with force fields, semiempirical methods, DFT and ab-initio approaches. Interestingly, already at this stage the theoretical findings support the experimental observation that sodium cations are preferred over potassium cations in KA clusters, due to fundamentally different cationic embedding. Theoretically predicted NMR and IR spectra for these species indicate that it should be possible to experimentally detect the aggregation state and even the cationic embedding mode in such clusters.

  19. Effect of the Antibiotic Neomycin on the Toxicity of the Glycoside Vicine in Rats

    PubMed Central

    Arbid, Mahmoud S.; Koriem, Khaled M. M.; Asaad, Gihan F.; Megahed, Hoda A.


    Vicine is hydrolyzed by microflora to highly reactive free radical generating compound divicine which causes mortality and other adverse effects. This study in the rats established the effect of a broad spectrum and poorly absorbed antibiotic, neomycin sulfate on the toxicity of vicine. The results showed extremely decrease in mortality rate in the group pretreated with neomycin. Hemoglobin (Hb) concentration, hematocrit (Hct) value, and red blood cells (RBCs) count were significantly decreased after injection of vicine and the improvement of these values in the group pretreated with neomycin. The same results were observed in white blood cells (WBCs). The results showed a significant decrease in glucose level and returned to normal in group pretreated with neomycin. Glutathione (GSH) was significantly decreased in the vicine group and returned to normal value in the group pretreated with neomycin. Lipid peroxide (TBARs) was significantly increased in the group treated with vicine and neomycin pretreated group decreased to the normal level. Glucose-6-phosphate dehydrogenase (G6-PD) activity was significantly decreased and returned to normal level in rats pretreated with neomycin. Serum protein and globulin were significantly decreased but serum albumin showed insignificant decrease in vicine and neomycin groups compared to control. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly decreased in the vicine group. The group pretreated with neomycin showed significantly increased activities of AST and ALT compared with vicine group. In conclusion, neomycin pretreatment of rats injected with glycoside vicine decreased to a great extent of its toxic and mortality effects and is useful in favism and hemolytic anemia. PMID:23840205

  20. Risk factors associated with kanamycin-resistant tuberculosis in a Beijing tuberculosis referral hospital.


    Yu, Hao Tian; Wang, Qi; Yang, Nan; Li, Hong Min; Liang, Jian Qin; Liu, Cui Hua


    The rapidly increasing number of multidrug-resistant tuberculosis (MDR-TB) cases worldwide underlines the necessity for the rational use of key second-line drugs such as kanamycin. In this study, we determined the prevalence of, and risk factors associated with, kanamycin-resistant tuberculosis (TB) in 309 Hospital, Beijing, China, with the aim of providing information for better case management in order to minimize further development of extensively drug-resistant TB (XDR-TB). Drug susceptibility testing results and clinical data were retrospectively analysed for hospitalized TB patients for whom such data were available in 309 Hospital for the period 1997-2009. Univariate and multivariate analyses were used to determine the risk factors associated with kanamycin-resistant TB. During 1997-2009, 553 (14.4 %) of 3843 tested Mycobacterium tuberculosis isolates from hospitalized TB patients were kanamycin-resistant. The increasing trend of resistance to kanamycin was reversed since 2000. The independent risk factors associated with kanamycin-resistant TB included living in urban areas [adjusted odds ratio (OR) = 1.89], being retreated for repeat cases (adjusted OR = 1.60), being smear-positive for acid-fast bacilli at admission to the hospital (adjusted OR = 1.39), having ofloxacin-resistant (adjusted OR = 1.61) or para-aminosalicylic acid-resistant TB (adjusted OR = 1.47), having MDR-TB (adjusted OR = 5.10), having MDR-TB plus ofloxacin resistance (adjusted OR = 4.27) and having poly-resistant TB (adjusted OR = 3.94). The remaining rate of kanamycin resistance is still high despite the reversal of the increasing trend during the past decade. Surveillance of kanamycin resistance, especially among high-risk populations, should be continued to closely monitor trends so that appropriate action can be taken.

  1. Impact of kanamycin on melanogenesis and antioxidant enzymes activity in melanocytes--an in vitro study.


    Wrześniok, Dorota; Otręba, Michał; Beberok, Artur; Buszman, Ewa


    Aminoglycosides, broad spectrum aminoglycoside antibiotics, are used in various infections therapy due to their good antimicrobial characteristics. However, their adverse effects such as nephrotoxicity and auditory ototoxicity, as well as some toxic effects directed to pigmented tissues, complicate the use of these agents. This study was undertaken to investigate the effect of aminoglycoside antibiotic-kanamycin on viability, melanogenesis and antioxidant enzymes activity in cultured human normal melanocytes (HEMa-LP). It has been demonstrated that kanamycin induces concentration-dependent loss in melanocytes viability. The value of EC50 was found to be ~6.0 mM. Kanamycin suppressed melanin biosynthesis: antibiotic was shown to inhibit cellular tyrosinase activity and to reduce melanin content in normal human melanocytes. Significant changes in the cellular antioxidant enzymes: SOD, CAT and GPx were stated in melanocytes exposed to kanamycin. Moreover, it was observed that kanamycin caused depletion of antioxidant defense sytem. It is concluded that the inhibitory effect of kanamycin on melanogenesis and not sufficient antioxidant defense mechanism in melanocytes in vitro may explain the potential mechanisms of undesirable side effects of this drug directed to pigmented tissues in vivo.

  2. Polyethylene oxide (PEO)-hyaluronic acid (HA) nanofibers with kanamycin inhibits the growth of Listeria monocytogenes.


    Ahire, J J; Robertson, D D; van Reenen, A J; Dicks, L M T


    Listeria monocytogenes is well known to cause prosthetic joint infections in immunocompromised patients. In this study, polyethylene oxide (PEO) nanofibers, containing kanamycin and hyaluronic acid (HA), were prepared by electrospinning at a constant electric field of 10kV. PEO nanofibers spun with 0.2% (w/v) HA and 1% (w/v) kanamycin had a smooth, bead-free structure at 30-35% relative humidity. The average diameter of the nanofibers was 83±20nm. Attenuated total reflectance (ATR)-Fourier transform infrared (FTIR) spectroscopy indicated that kanamycin was successfully incorporated into PEO/HA matrix. The presence of kanamycin affects the thermal properties of PEO/HA nanofibers, as shown by differential scanning calorimetry (DSC) and thermogravimetric analyses (TGA). The kanamycin-PEO-HA nanofibers (1mg; 47±3μg kanamycin) inhibited the growth of L. monocytogenes EDGe by 62%, as compared with PEO-HA nanofibers, suggesting that it may be used to coat prosthetic implants to prevent secondary infections.

  3. Overexpression of the chromosomally encoded aminoglycoside acetyltransferase eis confers kanamycin resistance in Mycobacterium tuberculosis.


    Zaunbrecher, M Analise; Sikes, R David; Metchock, Beverly; Shinnick, Thomas M; Posey, James E


    The emergence of multidrug-resistant (MDR) tuberculosis (TB) highlights the urgent need to understand the mechanisms of resistance to the drugs used to treat this disease. The aminoglycosides kanamycin and amikacin are important bactericidal drugs used to treat MDR TB, and resistance to one or both of these drugs is a defining characteristic of extensively drug-resistant TB. We identified mutations in the -10 and -35 promoter region of the eis gene, which encodes a previously uncharacterized aminoglycoside acetyltransferase. These mutations led to a 20-180-fold increase in the amount of eis leaderless mRNA transcript, with a corresponding increase in protein expression. Importantly, these promoter mutations conferred resistance to kanamycin [5 microg/mL < minimum inhibitory concentration (MIC) kanamycin resistance harbored eis promoter mutations. These results have important clinical implications in that clinical isolates determined to be resistant to kanamycin may not be cross-resistant to amikacin, as is often assumed. Molecular detection of eis mutations should distinguish strains resistant to kanamycin and those resistant to kanamycin and amikacin. This may help avoid excluding a potentially effective drug from a treatment regimen for drug-resistant TB.

  4. Design, synthesis, and antibacterial activities of conformationally constrained kanamycin A derivatives.


    Zhang, Wenxuan; Chen, Ying; Liang, Qingzhao; Li, Hui; Jin, Hongwei; Zhang, Liangren; Meng, Xiangbao; Li, Zhongjun


    A series of conformationally constrained kanamycin A derivatives with a 2'-hydroxyl group in ring I and a 5-hydroxyl group in ring II tethered by carbon chains were designed and synthesized. Pivotal 5,2'-hydroxyl groups were exposed, and the kanamycin A intermediate was synthesized from 5, 2', 4″, 6″-di-O-benzylidene-protected tetraazidokanamycin A. Cyclic kanamycin A derivatives with intramolecular 8-, 9-, 10-, and 11-membered ethers were then prepared by cesium carbonate mediated Williamson ether synthesis or a ring-closing metathesis reaction. The kanamycin A derivatives were assayed against both susceptible and resistant bacterial strains. Although no derivative showed better antibacterial activities than kanamycin A, the antibacterial activities of these cyclic kanamycin A derivatives indeed varied with the length of the bridge. Moreover, different variations of activities were observed between the susceptible and resistant bacterial strains. More tightly constrained derivative 2 with a one-carbon bridge showed better activity than the others against susceptible strains, but it was much less effective for resistant bacterial strains than derivative 3 with a two-carbon bridge and derivative 6 with an unsaturated four-carbon bridge.

  5. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    PubMed Central

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young


    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety. PMID:28054670

  6. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor.


    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young


    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kd(app) values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety.

  7. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    NASA Astrophysics Data System (ADS)

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young


    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety.

  8. Determination of neomycin residues in eggs and stability of residues after cooking.


    Katz, S E; Levine, P R


    The procedure for neomycin residues used a surfactant to improve extraction, a centrifuge step to eliminate solids that interfere with the diffusion of the antibiotic, and a heat treatment to destroy interfering lysozyme activity. The use of Bcillus stearothermophilus and a 65 degree C incubation yielded a rapid assay with a sensitivity of 0.2 microgram neomycin activity/g egg. Frying eggs caused little or no loss of activity, poaching resulted in 25% loss, and soft boiling and hard boiling caused little or no loss of applied activity. Neomycin residues in eggs were quite stable to normal egg preparation procedures.

  9. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay.


    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang


    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  10. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    NASA Astrophysics Data System (ADS)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang


    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  11. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity

    PubMed Central

    Payne, Jason N.; Waghwani, Hitesh K.; Connor, Michael G.; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B.; Dakshinamurthy, Rajalingam


    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents. PMID:27330535

  12. 17-DMAG induces Hsp70 and protects the auditory hair cells from kanamycin ototoxicity in vitro.


    Liu, Yun; Yu, Yang; Chu, Hanqi; Bing, Dan; Wang, Shaoli; Zhou, Liangqiang; Chen, Jin; Chen, Qingguo; Pan, Chunchen; Sun, Yanbo; Cui, Yonghua


    Heat shock protein 70 (Hsp70) has been known to be able to play a protective role in the cochlea. The aim of this study was to investigate whether geldanamycin hydrosoluble derivative 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (17-DMAG) has the ability to induce Hsp70 up-regulation to protect hair cells from kanamycin-induced ototoxicity in vitro. The organ of Corti (OC) explants were isolated from mice at postnatal day 3-5. Then, the explants were exposed to kanamycin with or without pre-incubation with 17-DMAG. The expression of Hsp70 was assessed by reverse transcription-quantitative polymerase chain reaction, ELISA, and immunofluorescent staining. The surviving hair cells were examined by phalloidin labeling and were counted. We found that Hsp70 expression in the explants after pre-incubation with 17-DMAG was significantly increased at both mRNA and protein levels. Immunofluorescent staining showed that Hsp70 was mainly located in the auditory hair cells. Compared with kanamycin group, the loss of hair cells was inhibited significantly in 17-DMAG+kanamycin group. Our study demonstrated that 17-DMAG induces Hsp70 in the hair cells, and has a significant protective effect against kanamycin ototoxicity in vitro. 17-DMAG has the possibility to be a safe and effective anti-ototoxic drug.

  13. Sustained Fos expression is observed in the developing brainstem auditory circuits of kanamycin-treated rats.


    Lee, Jae Ho; Kim, Hee Jung; Suh, Myung-Whan; Ahn, Seung Cheol


    It has been demonstrated that kanamycin treatment during early developmental period induces partial cochlear destruction and enhanced glutamatergic transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses in the superior olivary complex (SOC). As c-fos was expected to be expressed in the SOC by kanamycin-induced cochlear damage, the expression of c-fos protein (Fos) was investigated using immunohistochemistry in kanamycin-treated rat pups. In the control rat pups less than postnatal (P) day 9 in age, Fos-like immunoreactivity (Fos-IR) was transiently observed in the MNTB and LSO on P6, but disappeared on P9, which reflects a physiologic process. In contrast, in kanamycin-treated rats, Fos-IR was consistently observed through P9. Because a significant increase in terminal uridine deoxynucleotidyl transferase-mediated 2'-deoxyuridine 5'-triphosphate-biotin nick-end labeling (TUNEL) and glial fibrillary acidic protein (GFAP) IR was not demonstrated in the MNTB and LSO of kanamycin-treated rats, the increased Fos-IR does not appear to indicate an ongoing pathologic process, but may be related to the increased activity caused by the disturbance in excitatory and inhibitory balance between brainstem auditory circuits.

  14. Structure-activity relationships for antibacterial to antifungal conversion of kanamycin to amphiphilic analogues.


    Fosso, Marina; AlFindee, Madher N; Zhang, Qian; Nziko, Vincent de Paul Nzuwah; Kawasaki, Yukie; Shrestha, Sanjib K; Bearss, Jeremiah; Gregory, Rylee; Takemoto, Jon Y; Chang, Cheng-Wei Tom


    Novel fungicides are urgently needed. It was recently reported that the attachment of an octyl group at the O-4″ position of kanamycin B converts this antibacterial aminoglycoside into a novel antifungal agent. To elucidate the structure-activity relationship (SAR) for this phenomenon, a lead compound FG03 with a hydroxyl group replacing the 3″-NH2 group of kanamycin B was synthesized. FG03's antifungal activity and synthetic scheme inspired the synthesis of a library of kanamycin B analogues alkylated at various hydroxyl groups. SAR studies of the library revealed that for antifungal activity the O-4″ position is the optimal site for attaching a linear alkyl chain and that the 3″-NH2 and 6″-OH groups of the kanamycin B parent molecule are not essential for antifungal activity. The discovery of lead compound, FG03, is an example of reviving clinically obsolete drugs like kanamycin by simple chemical modification and an alternative strategy for discovering novel antimicrobials.

  15. Structure-activity relationships among the kanamycin aminoglycosides: role of ring I hydroxyl and amino groups.


    Salian, Sumantha; Matt, Tanja; Akbergenov, Rashid; Harish, Shinde; Meyer, Martin; Duscha, Stefan; Shcherbakov, Dmitri; Bernet, Bruno B; Vasella, Andrea; Westhof, Eric; Böttger, Erik C


    The kanamycins form an important subgroup of the 4,6-disubstituted 2-deoxystreptamine aminoglycoside antibiotics, comprising kanamycin A, kanamycin B, tobramycin, and dibekacin. These compounds interfere with protein synthesis by targeting the ribosomal decoding A site, and they differ in the numbers and locations of amino and hydroxy groups of the glucopyranosyl moiety (ring I). We synthesized kanamycin analogues characterized by subtle variations of the 2' and 6' substituents of ring I. The functional activities of the kanamycins and the synthesized analogues were investigated (i) in cell-free translation assays on wild-type and mutant bacterial ribosomes to study drug-target interaction, (ii) in MIC assays to assess antibacterial activity, and (iii) in rabbit reticulocyte translation assays to determine activity on eukaryotic ribosomes. Position 2' forms an intramolecular H bond with O5 of ring II, helping the relative orientations of the two rings with respect to each other. This bond becomes critical for drug activity when a 6'-OH substituent is present.

  16. An ultrasensitive homogeneous aptasensor for kanamycin based on upconversion fluorescence resonance energy transfer.


    Li, Hui; Sun, De-en; Liu, Yajie; Liu, Zhihong


    We developed an ultrasensitive fluorescence resonance energy transfer (FRET) aptasensor for kanamycin detection, using upconversion nanoparticles (UCNPs) as the energy donor and graphene as the energy acceptor. Oleic acid modified upconversion nanoparticles were synthesized through a hydrothermal process followed by a ligand exchange with hexanedioic acid. The kanamycin aptamer (5'-NH2-AGATGGGGGTTGAGGCTAAGCCGA-3') was tagged to UCNPs through an EDC-NHS protocol. The π-π stacking interaction between the aptamer and graphene brought UCNPs and graphene in close proximity and hence initiated the FRET process resulting in quenching of UCNPs fluorescence. The addition of kanamycin to the UCNPs-aptamer-graphene complex caused the fluorescence recovery because of the blocking of the energy transfer, which was induced by the conformation change of aptamer into a hairpin structure. A linear calibration was obtained between the fluorescence intensity and the logarithm of kanamycin concentration in the range from 0.01 nM to 3 nM in aqueous buffer solution, with a detection limit of 9 pM. The aptasensor was also applicable in diluted human serum sample with a linear range from 0.03 nM to 3 nM and a detection limit of 18 pM. The aptasensor showed good specificity towards kanamycin without being disturbed by other antibiotics. The ultrahigh sensitivity and pronounced robustness in complicated sample matrix suggested promising prospect of the aptasensor in practical applications.

  17. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity.


    Payne, Jason N; Waghwani, Hitesh K; Connor, Michael G; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B; Dakshinamurthy, Rajalingam


    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents.

  18. Effect of dried oregano leaves versus neomycin in treating newborn calves with colibacillosis.


    Bampidis, V A; Christodoulou, V; Florou-Paneri, P; Christaki, E


    Treatment with neomycin (as a positive control) and dried oregano leaves on mortality, number of days scouring and severity of scours due to Escherichia coli were examined in 30 Holstein calves. Calves were assigned to one of the treatments following clinical signs of diarrhoea (i.e. faecal score >2), and treated either with an oral solution of neomycin sulphate, to provide 10 mg neomycin sulphate per kg calf body weight per 24 h, or dried oregano leaves, to provide 10 mg oregano essential oil per kg calf body weight per 24 h. The number of scouring days, severity of scouring and mortality rates were similar between the treatments. This study indicates that dried oregano leaves administered as an oral solution to calves with diarrhoea may be as effective in the treatment of colibacillosis as neomycin.

  19. 21 CFR 524.1484b - Neomycin, isoflupredone, tetracaine, and myristyl-gamma-picolinium powder.

    Code of Federal Regulations, 2014 CFR


    ... with neomycin-susceptible organisms and/or allergy; as a superficial dressing applied to minor cuts, wounds, lacerations, abrasions, and for postsurgical application where reduction of pain and...

  20. Oral administration of neomycin to chickens experimentally infected with Salmonella typhimurium.


    Smith, H W; Tucker, J F


    Groups of healthy chickens with a light experimental Salmonella typhimurium infection were fed on a diet containing 225 g per ton (1016 kg) of neomycin for two days. This brought about only a slight reduction in the incidence of chickens that were excreting S typhimurium in their faeces. Examination of caecal contents two days after the cessation of treatment revealed the neomycin had not had any effect in eliminating infection. In one experiment, the neomycin administration resulted in the emergence of enormous populations of Escherichia coli in the alimentary tract of treated chickens that possessed multiple antibiotic resistance of the transmissible type. For these reasons the practice of feeding broiler chickens on diets containing neomycin immediately before slaughter should be actively discouraged.

  1. Protective Role of Trimetazidine Against Neomycin-induced Hair Cell Damage in Zebrafish.


    Chang, Jiwon; Im, Gi Jung; Chae, Sung Won; Lee, Seung Hoon; Kwon, Soon-Young; Jung, Hak Hyun; Chung, Ah-Young; Park, Hae-Chul; Choi, June


    Trimetazidine (TMZ) is known to reduce the generation of oxygen-derived free radicals. The objective of the present study was to evaluate the effects of TMZ on neomycin-induced ototoxicity in transgenic zebrafish (Brn3C: EGFP). Five-day, postfertilization zebrafish larvae were exposed to 125 µM neomycin and one of the following TMZ concentrations for 1 hour: 10 µM, 100 µM, 500 µM, 1,000 µM, 1,500 µM, or 2,000 µM. Hair cells within the neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed using fluorescence microscopy and confocal microscopy (n=10). Hair cell survival was calculated as a percentage of hair cells in the control group that were not exposed to neomycin. Ultrastructural changes were evaluated using scanning electron microscopy. TMZ protected against neomycin-induced hair cell loss in the neuromasts (TMZ 1,000 µM, 11.2±0.4 cells; 125 µM neomycin only, 4.2±0.5 cells; n=10; P<0.05) and decreased the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) reaction. In the ultrastructural analysis, structures of mitochondria and hair cells within the neuromasts were preserved in zebrafish exposed to 125 µM neomycin and 1,000 µM TMZ. TMZ attenuated neomycin-induced hair cell loss in zebrafish. The results of this study suggest that neomycin induces apoptosis, and that apoptotic cell death can be prevented by treatment with tremetazidine.

  2. Intestinal Protective Effects of Herbal-Based Formulations in Rats against Neomycin Insult

    PubMed Central

    Bose, Shambhunath; Han, Kyung-Wan; Lee, Myeong-Jong


    Disturbance in the gut microbial niche by antibiotics like neomycin produces gastrointestinal (GI) disorders. Here, we evaluated the impact of a mixture of extracts of three herbs (Atractylodis Rhizoma Macrocephalae, Massa Medicata Fermentata, and Dolichoris Semen) with known GI protective activities, either laboratory unfermented (herbal formulation-1 (HF-1)) or fermented/re-fermented (herbal formulation-2 (HF-2)) on neomycin-treated rats using a commercial Lactobacillus probiotic as a reference. Treatment with neomycin augmented stool water content, decreased fecal population of Lactobacillus spp., changed the histology of intestine without inducing inflammation, reduced the colonic expression of zonula occludens-1 (ZO-1) and claudin-1, and elevated the serum C-reactive protein (CRP) and interferon-gamma (IFN-γ) levels. Coadministration of either HF-2 or probiotic, but not HF-1, restored the fecal content of Lactobacillus spp., normalized the serum CRP level, and significantly increased the colonic expression of ZO-1 and claudin-1 in neomycin-treated rats. The combined treatment with any of the above agents ameliorated the histological changes of cecum and colon in neomycin-treated rats, and the magnitude of this effect was probiotic > HF-2 > HF-1. Our study revealed the intestinal protective effect of a mixture of three herbs against neomycin insult, which is mediated through multiple mechanisms and is potentiated upon prior fermentation/refermentation of the herbs. PMID:23690835

  3. [Research progress of acute kanamycin sulfate-induced deafness in guinea pig].


    Yin, Zedeng; Kng, Weijia


    To present a summary of current knowledge regarding acute kanamycin sulfate-induced deafness in guinea pig, by reviewing the published literature. Animal model of acute deafness induced by a single dose of kanamycin sulfate in combination with ethacrynic acid or furosemide in guinea pig was usually used to investigate the mechanism of cochlear cell degeneration. There were different time sequences of cell degeneration of spiral ganglion cell and hair cell in different studies. The findings may result from different doses, order of two drugs administration or time point chosen. There remains scope for further research in chronic kanamycin-induced deafness, which more replicates the type of exposure to people than acute deafness.

  4. Novel mutations conferring resistance to kanamycin in Mycobacterium tuberculosis clinical isolates from Northern India.


    Kaur, Simerpreet; Rana, Vibhuti; Singh, Pooja; Trivedi, Garima; Anand, Shashi; Kaur, Amanpreet; Gupta, Pawan; Jain, Amita; Sharma, Charu


    Twenty-nine Kanamycin resistant clinical isolates of Mycobacterium tuberculosis from Northern India were screened to evaluate genetic mutations in rrs gene, eis gene with its promoter, and whiB7 gene along with its 5'UTR. 14 strains (~48.0%) collectively exhibited mutations in rrs, eis or whiB7 target regions. While the highest frequency of mutations was found in rrs gene, eis and whiB7 loci displayed novel mutations. The novel mutations displayed by eis and whiB7 loci were found to be associated specifically with the Kanamycin resistance as none of the twenty nine Kanamycin sensitive strains harbor them. The inclusion of novel mutations of eis and whiB7 loci will be useful in improving the specificity of future diagnostics.

  5. Engineering of a functional thermostable kanamycin resistance marker for use in Moorella thermoacetica ATCC39073.


    Iwasaki, Yuki; Kita, Akihisa; Sakai, Shinsuke; Takaoka, Kazue; Yano, Shinichi; Tajima, Takahisa; Kato, Junichi; Nishio, Naomichi; Murakami, Katsuji; Nakashimada, Yutaka


    A transformation system for Moorella thermoacetica ATCC39073 was developed using thermostable kanamycin resistant gene (kanR) derived from the plasmid pJH1 that Streptococcus faecalis harbored. When kanR with its native promoter was introduced into uracil auxotrophic mutant of M. thermoacetica ATCC39073 together with a gene to complement the uracil auxotrophy as a selection marker, it did not give kanamycin resistance due to poor transcription level of kanR. However, the use of glyceraldehyde-3-phosphate dehydrogenase promoter cloned from M. thermoacetica ATCC39073 significantly improved transcription level of kanR and resulted in the cell growth in the presence of more than 150 μg mL(-1) kanamycin. It was also demonstrated that kanR with G3PD promoter can be used as a selection marker for transformation of wild-type strain of M. thermoacetica ATCC39073.

  6. Construction of kanamycin B overproducing strain by genetic engineering of Streptomyces tenebrarius.


    Ni, Xianpu; Li, Dan; Yang, Lihua; Huang, Tingjiao; Li, Hao; Xia, Huanzhang


    Genetic engineering as an important approach to strain optimization has received wide recognition. Recent advances in the studies on the biosynthetic pathways and gene clusters of Streptomyces make stain optimization by genetic alteration possible. Kanamycin B is a key intermediate in the manufacture of the important medicines dibekacin and arbekacin, which belong to a class of antibiotics known as the aminoglycosides. Kanamycin could be prepared by carbamoylkanamycin B hydrolysis. However, carbamoylkanamycin B production in Streptomyces tenebrarius H6 is very low. Therefore, we tried to obtain high kanamycin B-producing strains that produced kanamycin B as a main component. In our work, aprD3 and aprD4 were clarified to be responsible for deoxygenation in apramycin and tobramycin biosynthesis. Based on this information, genes aprD3, aprQ (deduced apramycin biosynthetic gene), and aprD4 were disrupted to optimize the production of carbamoylkanamycin B. Compared with wild-type strain, mutant strain SPU313 (ΔaprD3, ΔaprQ, and ΔaprD4) produced carbamoylkanamycin B as a single antibiotic, whose production increased approximately fivefold. To construct a strain producing kanamycin B instead of carbamoylkanamycin B, the carbamoyl-transfer gene tacA was inactivated in strain SPU313. Mutant strain SPU314 (ΔaprD3, ΔaprQ, ΔaprD4, and ΔtacA) specifically produced kanamycin B, which was proven by LC-MS. This work demonstrated careful genetic engineering could significantly improve production and eliminate undesired products.

  7. Macrophage-specific Mycobacterium tuberculosis genes: identification by green fluorescent protein and kanamycin resistance selection.


    Srivastava, Vikas; Rouanet, Carine; Srivastava, Ranjana; Ramalingam, B; Locht, Camille; Srivastava, Brahm S


    Mycobacterium tuberculosis survives and multiplies inside macrophages of its host by modulating the expression of several genes essential for in vivo survival. An in vivo expression system has been developed, based on green fluorescent protein and kanamycin resistance, to identify M. tuberculosis genes which appear to be up-regulated in infected macrophages. A promoter-trap shuttle vector, pLL192, was constructed, containing a streptomycin resistance gene as selection marker and an artificial bicistronic operon composed of the promoterless green fluorescent protein (gfp) gene, followed by the kanamycin resistance gene. A unique BamHI site upstream of the gfp gene allowed for insertion of promoter libraries. The vector was validated by the use of known regulated or constitutive M. tuberculosis promoters. In addition, an M. tuberculosis genomic DNA library was inserted into pLL192 and then introduced into Mycobacterium bovis BCG. The recombinant BCG cells were then used to infect the J774A.1 murine macrophage-like cell line in the presence of kanamycin. Several recombinant BCG cells were thereby selected that were resistant to kanamycin within infected macrophages, but were sensitive to kanamycin when grown in vitro. The kanamycin resistance phenotype was paralleled by the fluorescence phenotype. After nucleotide sequencing, the corresponding genes were identified as mce1A, PE_PGRS63(RV3097c), Rv2232, Rv1026, Rv1635c, viuB, Rv2231(cobC) and Rv0997. Real-time PCR analysis using RNA isolated at various time points from M. tuberculosis and M. bovis BCG grown in vitro and within macrophages, confirmed the up-regulation of these genes. The level of up-regulation varied from 2- to 40-fold in macrophages compared to growth in vitro.

  8. Probing the recognition surface of a DNA triplex: Binding studies with intercalator-neomycin conjugates

    PubMed Central

    Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skirba, Michael; Arya, Dev P.


    Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA)•2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalenedimide-neomycin (3) and anthraquinone-neomycin (4) were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2), in our investigations. A combination of experiments including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC) revealed that all four conjugates (1–4) stabilized poly(dA)•2poly(dT) much greater than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (Tm3→2) at which poly(dA)•2poly(dT) dissociated into poly(dA)•poly(dT) and poly(dT) increased dramatically (> 12 °C) in the presence of intercalator-neomycin (1–4) even at a very low concentration (2 µM). In contrast to intercalator-neomycin conjugates, the increment of Tm3→2 of poly(dA)•2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin (1–4) to poly(dA)•2poly(dT) was also confirmed by competition dialysis and fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compound 1–4 had slightly larger binding site size (~7–7.5) with poly(dA)•2poly(dT) as compared to neomycin (~6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA)•2poly(dT) were derived from an integrated van’t Hoff equation using the Tm3→2 values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA)•2poly(dT) increased in the order neomycin < 1 < 3 < 4 < 2. Amongst them, the binding constant [(2.7 ± 0.3) × 108 M−1] of 2 with poly(dA)•2poly(dT) was the highest, almost 1000 fold more

  9. Probing the recognition surface of a DNA triplex: binding studies with intercalator-neomycin conjugates.


    Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skriba, Michael; Arya, Dev P


    Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA).2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalene diimide-neomycin (3) and anthraquinone-neomycin (4) conjugates were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2) conjugates, in our investigations. A combination of experiments, including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC), revealed that all four conjugates (1-4) stabilized poly(dA).2poly(dT) much more than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (T(m3-->2)) at which poly(dA).2poly(dT) dissociated into poly(dA).poly(dT) and poly(dT) increased dramatically (>12 degrees C) in the presence of intercalator-neomycin conjugates (1-4) even at a very low concentration (2 muM). In contrast to intercalator-neomycin conjugates, the increment of T(m3-->2) of poly(dA).2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin conjugates (1-4) to poly(dA).2poly(dT) was also confirmed by competition dialysis and a fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compounds 1-4 had slightly larger binding site size ( approximately 7-7.5) with poly(dA).2poly(dT) as compared to neomycin ( approximately 6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA).2poly(dT) were derived from an integrated van't Hoff equation using the T(m3-->2) values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA).2poly(dT) increased in the following order: neomycin < 1 < 3 < 4 < 2. Among them, the binding constant [(2.7 +/- 0.3) x 10(8) M(-1)] of

  10. A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii

    PubMed Central

    Lipscomb, Gina L.; Conway, Jonathan M.; Blumer-Schuette, Sara E.; Kelly, Robert M.


    ABSTRACT Caldicellulosiruptor bescii, an anaerobic Gram-positive bacterium with an optimal growth temperature of 78°C, is the most thermophilic cellulose degrader known. It is of great biotechnological interest, as it efficiently deconstructs nonpretreated lignocellulosic plant biomass. Currently, its genetic manipulation relies on a mutant uracil auxotrophic background strain that contains a random deletion in the pyrF genome region. The pyrF gene serves as a genetic marker to select for uracil prototrophy, and it can also be counterselected for loss via resistance to the compound 5-fluoroorotic acid (5-FOA). To expand the C. bescii genetic tool kit, kanamycin resistance was developed as a selection for genetic manipulation. A codon-optimized version of the highly thermostable kanamycin resistance gene (named Cbhtk) allowed the use of kanamycin selection to obtain transformants of either replicating or integrating vector constructs in C. bescii. These strains showed resistance to kanamycin at concentrations >50 μg · ml−1, whereas wild-type C. bescii was sensitive to kanamycin at 10 μg · ml−1. In addition, placement of the Cbhtk marker between homologous recombination regions in an integrating vector allowed direct selection of a chromosomal mutation using both kanamycin and 5-FOA. Furthermore, the use of kanamycin selection enabled the targeted deletion of the pyrE gene in wild-type C. bescii, generating a uracil auxotrophic genetic background strain resistant to 5-FOA. The pyrE gene functioned as a counterselectable marker, like pyrF, and was used together with Cbhtk in the ΔpyrE background strain to delete genes encoding lactate dehydrogenase and the CbeI restriction enzyme. IMPORTANCE Caldicellulosiruptor bescii is a thermophilic anaerobic bacterium with an optimal growth temperature of 78°C, and it has the ability to efficiently deconstruct nonpretreated lignocellulosic plant biomass. It is, therefore, of biotechnological interest for genetic

  11. A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii.


    Lipscomb, Gina L; Conway, Jonathan M; Blumer-Schuette, Sara E; Kelly, Robert M; Adams, Michael W W


    Caldicellulosiruptor bescii, an anaerobic Gram-positive bacterium with an optimal growth temperature of 78°C, is the most thermophilic cellulose degrader known. It is of great biotechnological interest, as it efficiently deconstructs nonpretreated lignocellulosic plant biomass. Currently, its genetic manipulation relies on a mutant uracil auxotrophic background strain that contains a random deletion in the pyrF genome region. The pyrF gene serves as a genetic marker to select for uracil prototrophy, and it can also be counterselected for loss via resistance to the compound 5-fluoroorotic acid (5-FOA). To expand the C. bescii genetic tool kit, kanamycin resistance was developed as a selection for genetic manipulation. A codon-optimized version of the highly thermostable kanamycin resistance gene (named Cbhtk) allowed the use of kanamycin selection to obtain transformants of either replicating or integrating vector constructs in C. bescii These strains showed resistance to kanamycin at concentrations >50 μg · ml(-1), whereas wild-type C. bescii was sensitive to kanamycin at 10 μg · ml(-1) In addition, placement of the Cbhtk marker between homologous recombination regions in an integrating vector allowed direct selection of a chromosomal mutation using both kanamycin and 5-FOA. Furthermore, the use of kanamycin selection enabled the targeted deletion of the pyrE gene in wild-type C. bescii, generating a uracil auxotrophic genetic background strain resistant to 5-FOA. The pyrE gene functioned as a counterselectable marker, like pyrF, and was used together with Cbhtk in the ΔpyrE background strain to delete genes encoding lactate dehydrogenase and the CbeI restriction enzyme. Caldicellulosiruptor bescii is a thermophilic anaerobic bacterium with an optimal growth temperature of 78°C, and it has the ability to efficiently deconstruct nonpretreated lignocellulosic plant biomass. It is, therefore, of biotechnological interest for genetic engineering applications

  12. Kanamycin resistance in plants: an unexpected trait controlled by a potentially multifaceted gene.


    Rommens, Caius M


    Ayalew Mentewab and C. Neal Stewart Jr recently showed that an Arabidopsis kanamycin resistance gene encodes an ATP binding cassette (ABC) transporter. This Atwbc19 protein is hypothesized to prevent ribosome inactivation by translocating kanamycin into the vacuole. Because ABC transporters often recognize multiple exogenous substrates, overexpression of Atwbc19 can result in the accumulation of unexpected compounds in transgenic plants. Another potential safety issue associated with this gene is horizontal gene transfer. Thus, commercial applications are likely to be limited to methods that allow removal of the selectable marker from the transgenic plant genome.

  13. Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes.


    Kumar, Sunil; Xue, Liang; Arya, Dev P


    A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ∼10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT


    PubMed Central

    Broitman, Selwyn A.; Gottlieb, Leonard S.; Zamcheck, Norman


    Two groups of adult rats fed a choline-deficient diet supplemented with neomycin in their drinking water for 250 or 350 days were protected against the development of liver fibrosis and cirrhosis. At the termination of the study these animals weighed more than others not receiving neomycin. This difference in weight did not appear to be caused by a growth-promoting effect of neomycin but rather reflected the increased severity of liver disease and a resultant weight loss in animals not receiving neomycin. Protection by neomycin was cancelled when Salmonella typhosa endotoxin was added to the drinking water. It was concluded that the protective effect of neomycin was mediated by an alteration in the intestinal microflora resulting in a reduction in the numbers of organisms contributing to intraluminal endotoxin. In the presence of choline deficiency, absorption of intraluminal endotoxin may contribute to the development of fibrosis and cirrhosis. PMID:14151103

  15. Determination of neomycin in animal tissues by liquid chromatography.


    Reid, J A; MacNeil, J D


    Tissue samples are digested under hot alkaline conditions after initial conditioning at room temperature with phosphate-buffered saline. The cooled digest is deproteinated with concentrated perchloric acid. After centrifugation and pH adjustment, the clear supernatant is applied to an ion-exchange cartridge, and after the cartridge is washed, the neomycin is eluted with dilute perchloric acid. This eluate is derivatized with 9-fluorenylmethyl chloroformate prior to liquid chromatography using a wide-pore spherical silica C4 column and fluorescence detection. Recovery and repeatability are calculated from tissue extract standard calibration curves produced from the same assay. Recoveries ranged from 80 to 120% for fortifications of 0.25-1.00 mg/kg for muscle tissue and from 80 to 100% for fortifications of 0.50-10.0 mg/kg for kidney tissue. Limits of quantitation were 0.25 and 0.50 mg/kg, respectively, for muscle and kidney tissues. Limits of detection were 0.125 and 0.20 mg/kg, respectively, for muscle and kidney tissues.

  16. Photoelectrochemical aptasensing of kanamycin using visible light-activated carbon nitride and graphene oxide nanocomposites.


    Li, Ruizhen; Liu, Yong; Cheng, Ling; Yang, Changzhu; Zhang, Jingdong


    Photoactive material and recognition element are two crucial factors which determine the sensitivity and selectivity of the photoelectrochemical (PEC) sensor. Herein we developed a novel PEC aptamer sensor for the specific detection of kanamycin using water-dispersible graphite-like carbon nitride (w-g-C3N4) as visible light-active material and aptamer as the biorecognition element. While a suitable amount of graphene oxide (GO) was doped in w-g-C3N4, the visible light photocurrent response was enhanced, which was beneficial to the construction of PEC sensor. On the other hand, the large specific surface area and π-conjugated structure of GO/w-g-C3N4 provided an excellent platform for immobilizing the kanamycin-binding DNA aptamer on the surface of the sensor via π-π stacking interaction. On such a sensor, the capture of kanamycin molecules by aptamer resulted in increased photocurrent. The PEC response of the sensor was found to be linearly proportional to the concentration of kanamycin in the range from 1 nM to 230 nM with a detection limit (3S/N) of 0.2 nM. Moreover, the proposed sensor displayed high selectivity, good reproducibility, and high stability, demonstrating the successful combination of GO/w-g-C3N4 with aptamer in fabricating high performance PEC sensors.

  17. Susceptibility of coagulase-negative staphylococci to a kanamycin and cefalexin combination.


    Silley, P; Goby, L; Pillar, C M


    A combination of kanamycin and cefalexin was licensed in Europe in 2008 to treat bovine clinical mastitis. Preliminary broth and disk clinical breakpoints for this antibiotic combination have been proposed for Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus uberis, and Escherichia coli. This study indicates that these proposed breakpoints also hold for coagulase-negative staphylococci (CNS), a group of bacteria frequently isolated in milk samples from cows with clinical mastitis. The data show that clinical bovine mastitis isolates of CNS from Europe have a high degree of susceptibility to the kanamycin/cefalexin combination, with minimal resistance to either agent alone. The use of the available kanamycin and cefalexin combination disk for testing the susceptibility of bovine mastitis isolates of Staph. aureus, Strep. uberis, Strep. dysgalactiae, and E. coli is also reliable for use in the testing of CNS, as disk results correlated with broth minimum inhibitory concentrations. The study reports, for the first time, the approved Clinical Laboratory Standards Institute quality control ranges for the kanamycin/cefalexin combination and wild-type cutoff values for major bacterial pathogens implicated in bovine mastitis.

  18. Combined treatment with the antibiotics kanamycin and streptomycin promotes the conjugation of Escherichia coli.


    Zhang, Peng-Yi; Xu, Pei-Pei; Xia, Zhi-Jie; Wang, Jing; Xiong, Juan; Li, Yue-Zhong


    It is widely accepted that antibiotics provide a critical selective pressure for the horizontal transfer of antibiotic resistance between bacterial species. This study demonstrated that a combination of low doses of kanamycin and streptomycin, which inhibited the growth of recipient and donor cells, respectively, had positive effects on the transmission of the conjugation plasmids pRK2013, pSU2007, and RP4 from Escherichia coli DH5α to HB101 at their minimum inhibitory concentrations (MICs). Administration of either antibiotic alone as well as other antibiotics in combination or alone did not have this effect. Two-dimensional electrophoresis revealed that 60 proteins were downregulated and 14 proteins were upregulated in the conjugation of E. coli DH5α (pRK2013) and HB101 in the presence of kanamycin and streptomycin. Of these proteins, 64 were subsequently identified by mass spectrometry. Two antibiotic-induced genes encoding oligopeptide-binding protein (OppA) and ribose-binding protein (RbsB) were further confirmed by quantitative real-time PCR. When these genes were deleted, the number of transconjugants decreased in the same fashion as when the cells were treated with kanamycin and streptomycin. These results indicate that the process of E. coli conjugation may be promoted by combination treatment with kanamycin and streptomycin and that two proteins potentially participated in this process.

  19. Aptamer-mediated 'turn-off/turn-on' nanozyme activity of gold nanoparticles for kanamycin detection.


    Sharma, Tarun Kumar; Ramanathan, Rajesh; Weerathunge, Pabudi; Mohammadtaheri, Mahsa; Daima, Hemant Kumar; Shukla, Ravi; Bansal, Vipul


    A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines the intrinsic peroxidase-like activity of gold nanoparticles (GNPs) with the high affinity and specificity of a ssDNA aptamer is presented for the efficient detection of a model small molecule kanamycin.

  20. [Antitoxic properties of pantothenic acid derivatives, precursors of coenzyme A biosynthesis, with regard to kanamycin].


    Moĭseenok, A G; Dorofeev, B F; Sheĭbak, V M; Khomich, T I


    The effect of calcium pantothenate (CPN)B 4'-phospho-CPN (PCP), pantetheine (PT) and calcium S-sulfopantetheine (SPN) on acute toxicity of kanamycin sulfate was studied on albino mice. The above derivatives of pantothenic acid except PT lowered the antibiotic toxicity. The coefficient of the antitoxic effect (LD50/ED50) of SPN and PCP was 1.3-1.4 times higher than that of CPN. The combined use of kanamycin (1/5 of the LD50) with CPN, PCP or PT (30 mg/kg bw was equivalent to CPN) for 15 days prevented the increase in the total content of CoA and in the content of the fraction of free CoA and the precursors of its biosynthesis participating in the reaction of N-acetylation in the liver and brain. The contents of these substances were within the normal during the whole experiment. A certain increase in the activity of pantothenate kinase in the liver cytosol due to the use of kanamycin was eliminated by the simultaneous use of PCP and PT. The vitamin-containing compounds PCP and SPN were recommended for the clinical trials as agents preventing complications of kanamycin therapy.

  1. Novel plasmid conferring kanamycin and tetracycline resistance in turkey-derived Campylobacter jejuni strain 11601MD

    USDA-ARS?s Scientific Manuscript database

    In Campylobacter spp., resistance to the antibiotics kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095 bp.) harboring tet(O) was identified in...

  2. Specificity of neomycin analogues bound to the packaging region of human immunodeficiency virus type 1 RNA.


    McPike, Mark P; Goodisman, Jerry; Dabrowiak, James C


    The packaging region of HIV-1 RNA contains a number of structural features which are important in the life cycle of the virus, making this segment of RNA a potential target for new types of AIDS-directed drugs. We studied the binding of three neomycin analogues (neo-guanidino, neo-acridine, and neo-neo) to a 171-mer RNA molecule from the packaging region of HIV-1 using quantitative footprinting and circular dichroism. Neo-guanidino produced footprinting patterns and effects on the CD similar to those observed for neomycin and paromomycin, indicating that all three compounds bind to the same regions of the 171-mer. Neo-guanidino binds to SL 1 where it joins the large internal loop, near a bulge in the stem of SL 1, and on SL 2. Neo-acridine, which has an acridine attached to neomycin, and neo-neo, which has two neomycins linked by a flexible tether, bind bivalently, and give very different footprinting and CD results from the other compounds. The neomycin portion of neo-acridine binds to the same sites as neomycin, while the attached acridine group appears to bind to a duplex region in the main stem of the folded 171-mer. Since the footprinting data for this analogue show few enhancements, bivalent binding of neo-acridine appears to stabilize the folded structure of RNA by effectively 'stapling' parts of the structure together. Neo-neo induces significant structural changes in RNA where neomycin binds. This may be related to the inability of both neomycins of neo-neo it find optimal binding sites adjacent to one another without changing RNA structure. The intensity of a strong negative CD band in the spectrum of psi-RNA at 208 nm is sensitive to drug-induced changes in RNA structure. Neo-guanidino and neo-neo (also neomycin and paromomycin), which change RNA structure, cause an increase in intensity while neo-acridine, which induces little distortion to RNA, causes a decrease in intensity. Molecular modeling analysis shows that C-5' of ribose of neo-acridine and neo

  3. Protonation of kanamycin A: detailing of thermodynamics and protonation sites assignment.


    Fuentes-Martínez, Yanet; Godoy-Alcántar, Carolina; Medrano, Felipe; Dikiy, Alexander; Yatsimirsky, Anatoly K


    Protonation of an aminoglycoside antibiotic kanamycin A sulfate was studied by potentiometric titrations at variable ionic strength, sulfate concentration and temperature. From these results the association constants of differently protonated forms of kanamycin A with sulfate and enthalpy changes for protonation of each amino group were determined. The protonation of all amino groups of kanamycin A is exothermic, but the protonation enthalpy does not correlate with basicity as in a case of simple polyamines. The sites of stepwise protonation of kanamycin A have been assigned by analysis of (1)H-(13)C-HSQC spectra at variable pH in D(2)O. Plots of chemical shifts for each H and C atom of kanamycin A vs. pH were fitted to the theoretical equation relating them to pK(a) values of ionogenic groups and it was observed that changes in chemical shifts of all atoms in ring C were controlled by ionization of a single amino group with pK(a) 7.98, in ring B by ionization of two amino groups with pK(a) 6.61 and 8.54, but in ring A all atoms felt ionization of one group with pK(a) 9.19 and some atoms felt ionization of a second group with pK(a) 6.51, which therefore should belong to amino group at C3 in ring B positioned closer to the ring A while higher pK(a) 8.54 can be assigned to the group at C1. This resolves the previously existed uncertainty in assignment of protonation sites in rings B and C.

  4. Bicarbonate enhances the in vitro antibiotic activity of kanamycin in Escherichia coli.


    Gutiérrez-Huante, M; Martínez, H; Bustamante, V H; Puente, J L; Sánchez, J


    Growth of enteropathogenic Escherichia coli E2348/69 was inhibited by bicarbonate in a dose-dependent manner, showing approximately 5% growth reduction at 5 mmol l(-1) while kanamycin at 3·12 μg ml(-1) inhibited growth by 15%, yet when kanamycin and bicarbonate were combined at these concentrations, inhibition increased to 80%. Unexpectedly, at bicarbonate concentrations >20 mmol l(-1) enhancement of the antibiotic activity virtually disappeared, i.e. there was a paradoxical Eagle-like effect. How bicarbonate acts is unclear, but neutral or alkaline pH also enhanced the activity of kanamycin. However, several differences indicated a separate effect of bicarbonate. First, bicarbonate inhibited growth more than the corresponding increments in pH. Second, at low concentration, the antibiotic enhancing effect of bicarbonate was stronger than the effect of pH alone. Third, 5 mmol l(-1) bicarbonate significantly enhanced the activity of kanamycin while the corresponding pH had no effect. Fourth, the Eagle-like effect was exclusive of bicarbonate because changes in pH did not induce an analogous behaviour. Notwithstanding the mechanism, the enhancing effect of bicarbonate was indubitable. Consequently, it seems worthwhile to explore further its potential to improve the efficacy of aminoglycosides and maybe even other antibiotics. Bicarbonate at a low concentration enhanced the in vitro antibiotic activity of kanamycin and gentamicin. Even though the action mechanism of bicarbonate is hitherto unknown, it seems worthwhile to explore further its capacity to improve the efficacy of aminoglycosides. Clearly, the well-known harmful side-effects of aminoglycosides are a concern. However, it has recently been shown in a fish model that bicarbonate may protect ciliary cells against the damage caused by aminoglycosides. So, it seems possible that bicarbonate could help reduce aminoglycoside dosage at the same time that it might help lessen the damage to auditory ciliary cells in

  5. Characterization of plasmid-mediated aphA-3 kanamycin resistance in Campylobacter jejuni.


    Gibreel, Amera; Sköld, Ola; Taylor, Diane E


    A total of 254 isolates of Campylobacter jejuni and three isolates of Campylobacter coli, isolated from Sweden, Canada, and Egypt, were screened for kanamycin resistance. Eight strains of C. jejuni contained large plasmids that carried the aphA-3 kanamycin-resistance marker. In six plasmids, the aphA-3 gene was located downstream of an apparent insertion sequence, designated IS607*, which showed a considerable similarity to IS607, characterized on the chromosome of some Helicobacter pylori strains. In contrast, the other plasmids carried the aphA-3 gene as a part of a resistance cluster. This included three resistance markers encoding 6'-adenylyltransferase (aadE), streptothricin acetyltransferase (sat), and 3'-aminoglycoside phosphotransferase type III (aphA-3). The genetic organization of this resistance cluster suggests that it has been acquired by C. jejuni from a Gram-positive organism. The IS607* element was also observed in kanamycin-susceptible strains of C. jejuni on plasmids mediating tetracycline resistance. The kanamycin-resistance phenotype transferred along with tetracycline resistance by conjugation from four representative C. jejuni strains to a recipient strain of C. jejuni. The kanamycin-resistance determinant (aphA-3) was stably transferred from one of the four C. jejuni strains to a recipient strain of Escherichia coli. However, the C. jejuni plasmid, which also carries the tetO gene, was not maintained in E. coli. Pulsed-field gel electrophoresis revealed the integration of approximately 50 kb of the plasmid into the chromosome of the E. coli recipient.

  6. Loss of enzyme-sensitive antigens due to the presence of leukocytes, neomycin sulfate, and LISS.


    Velliquette, R W; Howard, P; Malyska, H; Reid, M E


    Previous studies have shown that RBCs with residual WBCs stored in LISS and neomycin sulfate develop characteristics associated with enzyme-treated RBCs. During a mass screening program to antigen type donor RBCs, we observed that the Fya antigens on a RBC sample from an in-house panel became non-detectable with anti-Fya after incubation overnight in Diluent 2 from Micro Typing Systems, Inc. (MTS, Pompano Beach, FL). In response to this observation, we initiated an investigation to determine the cause. Tests were performed according to the manfacturer's instructions in MTS neutral gel cards or gel cards containing anti-IgG. We found that a reduction or loss of the Fya, Fyb, and M antigens occurs when RBCs were prepared from samples containing residual WBCs (as a source of enzymes) and subsequently incubated in media containing neomycin sulfate and LISS. We showed that the effect did not occur in the absence of neomycin sulfate. RBC antigens can be altered in LISS if they have first been exposed to neomycin. We recommend restricting the use of RBCs suspended in MTS Diluent 2 to the day of dilution (as indicated in the package insert) if preparing reagent RBCs from sources that were not leukoreduced and were stored in the presence of neomycin.

  7. Correlation of neomycin, faecal neutral and acid sterols with colon carcinogenesis in rats

    PubMed Central

    Panda, S K; Chattoraj, S C; Broitman, S A


    High fat diets have been implicated in incidence of colon cancer both in epidemiological and animal studies. Present investigation deals with the incidence, location and numbers of large and small bowel tumours induced by 1,2-dimethyl hydrazine (DMH) in rats fed high fat diets and neomycin. Neomycin was used to modify the faecal sterol metabolism and the relationship of the high fat diet and faecal neutral and acid sterols to the large bowel tumorigenesis was evaluated. DMH administered rats were fed with (a) 20% safflower oil; (b) 20% safflower oil and neomycin; (c) 20% safflower oil, cholesterol and cholic acid; and (d) 20% safflower oil, cholesterol, cholic acid and neomycin. Neomycin was found to be associated with both increase and decrease of tumour numbers. The faecal sterols lithocholic and deoxycholic acids were found to have no participation, while cholesterol and cholic acid were found to decrease with increase in tumour numbers. However, faecal coprostanol has been found to have a significant positive correlation with tumorigenesis in all dietary groups. Therefore coprostanol might possibly be associated with colon carcinogenesis in DMH-fed rats and cholesterol metabolism in gut appears to be related to the development of tumours. © 1999 Cancer Research Campaign PMID:10376962

  8. Correlation of neomycin, faecal neutral and acid sterols with colon carcinogenesis in rats.


    Panda, S K; Chattoraj, S C; Broitman, S A


    High fat diets have been implicated in incidence of colon cancer both in epidemiological and animal studies. Present investigation deals with the incidence, location and numbers of large and small bowel tumours induced by 1,2-dimethyl hydrazine (DMH) in rats fed high fat diets and neomycin. Neomycin was used to modify the faecal sterol metabolism and the relationship of the high fat diet and faecal neutral and acid sterols to the large bowel tumorigenesis was evaluated. DMH administered rats were fed with (a) 20% safflower oil; (b) 20% safflower oil and neomycin; (c) 20% safflower oil, cholesterol and cholic acid; and (d) 20% safflower oil, cholesterol, cholic acid and neomycin. Neomycin was found to be associated with both increase and decrease of tumour numbers. The faecal sterols lithocholic and deoxycholic acids were found to have no participation, while cholesterol and cholic acid were found to decrease with increase in tumour numbers. However, faecal coprostanol has been found to have a significant positive correlation with tumorigenesis in all dietary groups. Therefore coprostanol might possibly be associated with colon carcinogenesis in DMH-fed rats and cholesterol metabolism in gut appears to be related to the development of tumours.

  9. Interaction of weakly bound antibiotics neomycin and lincomycin with bovine and human serum albumin: biophysical approach.


    Keswani, Neelam; Choudhary, Sinjan; Kishore, Nand


    The thermodynamics of interaction of neomycin and lincomycin with bovine serum albumin (BSA) and human serum albumin (HSA) has been studied using isothermal titration calorimetry (ITC), in combination with UV-visible, steady state and time resolved fluorescence spectroscopic measurements. Neomycin is observed to bind weakly to BSA and HSA whereas lincomycin did not show any evidence for binding with the native state of these proteins, rather it interacts in the presence of surfactants. The ITC results suggest 1 : 1 binding stoichiometry for neomycin in the studied temperature range. The values of the van't Hoff enthalpy do not agree with the calorimetric enthalpy in the case of neomycin, suggesting conformational changes in the protein upon ligand binding, as well as with the rise in the temperature. Experiments at different ionic strengths, and in the presence of tetrabutyl ammonium bromide and surfactants suggest the predominant involvement of electrostatic interactions in the complexation process of neomycin with BSA and HSA, and non-specific interaction behaviour of lincomycin with these proteins.

  10. Time sequence of auditory nerve and spiral ganglion cell degeneration following chronic kanamycin-induced deafness in the guinea pig.


    Kong, W J; Yin, Z D; Fan, G R; Li, D; Huang, X


    We investigated the time sequence of morphological changes of the spiral ganglion cell (SGC) and auditory nerve (AN) following chronic kanamycin-induced deafness. Guinea pigs were treated with kanamycin by subcutaneous injection at 500 mg/kg per day for 7 days. Histological changes in hair cells, SGCs, Schwann cells and the area of the cross-sectional of the AN with vestibular ganglion (VG) in the internal acoustic meatus were quantified at 1, 7, 14, 28, 56 and 70 days after kanamycin treatment. Outer hair cells decreased at 7 and 14 days. Loss of inner hair cells occurred at 14 and 28 days. The cross-sectional area of the AN with VG increased at 1 day and decreased shortly following loss of SGCs and Schwann cells at 7, 14 and 28 days after deafening. There was a similar time course of morphological changes in the overall cochlea and the basal turn. Thus, the effects of kanamycin on hair cells, spiral ganglion and Schwann cells are progressive. Early degeneration of SGC and Schwann cell mainly results from the direct toxic effect of kanamycin. However, multiple factors such as loss of hair cell, degeneration of Schwann cell and the progressive damage of kanamycin, may participate in the late degeneration process of SGCs. The molecular mechanism of the degeneration of SGC and Schwann cell should be investigated in the future. Moreover, there is a different time sequence of cell degeneration between acute and chronic deafness by kanamycin.

  11. Surprising Alteration of Antibacterial Activity of 5″-Modified Neomycin against Resistant Bacteria

    PubMed Central

    Zhang, Jianjun; Chiang, Fang-I; Wu, Long; Czyryca, Przemyslaw Greg; Li, Ding; Chang, Cheng-Wei Tom


    A facile synthetic protocol for the production of neomycin B derivatives with various modifications at the 5″ position has been developed. Structural activity relationship (SAR) against aminoglycoside resistant bacteria equipped with various aminoglycoside-modifying enzymes (AME's) was investigated. Enzymatic and molecular modeling studies reveal that the superb substrate promiscuity of AME's allows the resistant bacteria to cope with diverse structural modifications despite the observation that several derivatives show enhanced antibacterial activity than the parent neomycin. Surprisingly, when testing synthetic neomycin derivatives against other human pathogens, two leads exhibit prominent activity against both Methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE) that are known to exert high level of resistance against clinically used aminoglycosides. These findings can be extremely useful in developing new aminoglycoside antibiotics against resistant bacteria. Our result also suggests that new biological and antimicrobial activities can be obtained by chemical modifications of old drugs. PMID:19012394

  12. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5 milligrams...

  13. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Bacitracin or bacitracin zinc-neomycin sulfate... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.154 Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B... units of polymyxin B. (2) To 000061 and 043264; each gram contains 400 units of bacitracin zinc, 3.5...

  14. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Bacitracin or bacitracin zinc-neomycin sulfate... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.154 Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B... units of polymyxin B. (2) To 000061 and 025463; each gram contains 400 units of bacitracin zinc, 3.5...

  15. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin or bacitracin zinc-neomycin sulfate... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.154 Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B... units of polymyxin B. (2) To 000061 and 025463; each gram contains 400 units of bacitracin zinc, 3.5...

  16. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5 milligrams...

  17. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Bacitracin or bacitracin zinc-neomycin sulfate... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.154 Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B... units of polymyxin B. (2) To 000061 and 025463; each gram contains 400 units of bacitracin zinc, 3.5...

  18. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5 milligrams...

  19. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5 milligrams...

  20. Global Epigenetic Changes Induced by SWI2/SNF2 Inhibitors Characterize Neomycin-Resistant Mammalian Cells

    PubMed Central

    Goswami, Shyamal K.; Komath, Sneha Sudha; Mayo, Marty W.; Hockensmith, Joel W.; Muthuswami, Rohini


    Background Previously, we showed that aminoglycoside phosphotransferases catalyze the formation of a specific inhibitor of the SWI2/SNF2 proteins. Aminoglycoside phosphotransferases, for example neomycin-resistant genes, are used extensively as selection markers in mammalian transfections as well as in transgenic studies. However, introduction of the neomycin-resistant gene is fraught with variability in gene expression. We hypothesized that the introduction of neomycin-resistant genes into mammalian cells results in inactivation of SWI2/SNF2 proteins thereby leading to global epigenetic changes. Methodology Using fluorescence spectroscopy we have shown that the inhibitor, known as Active DNA-dependent ATPase A Domain inhibitor (ADAADi), binds to the SWI2/SNF2 proteins in the absence as well as presence of ATP and DNA. This binding occurs via a specific region known as Motif Ia leading to a conformational change in the SWI2/SNF2 proteins that precludes ATP hydrolysis. ADAADi is produced from a plethora of aminoglycosides including G418 and Streptomycin, two commonly used antibiotics in mammalian cell cultures. Mammalian cells are sensitive to ADAADi; however, cells stably transfected with neomycin-resistant genes are refractory to ADAADi. In resistant cells, endogenous SWI2/SNF2 proteins are inactivated which results in altered histone modifications. Microarray data shows that the changes in the epigenome are reflected in altered gene expression. The microarray data was validated using real-time PCR. Finally, we show that the epigenetic changes are quantized. Significance The use of neomycin-resistant genes revolutionized mammalian transfections even though questions linger about efficacy. In this study, we have demonstrated that selection of neomycin-resistant cells results in survival of only those cells that have undergone epigenetic changes, and therefore, data obtained using these resistant genes as selection markers need to be cautiously evaluated. PMID

  1. Protective role of NecroX-5 against neomycin-induced hair cell damage in zebrafish.


    Song, Jae-Jun; Chang, Jiwon; Choi, Jungim; Im, Gi Jung; Chae, Sung Won; Lee, Seung Hoon; Kwon, Soon-Young; Jung, Hak Hyun; Chung, Ah-Young; Park, Hae-Chul; Choi, June


    NecroX-5, one of the derivatives of NecroX series compounds, is a mitochondrial reactive oxygen species and reactive nitrogen species scavenger that inhibits cell death against various kinds of oxidative stresses. The objective of the present study was to evaluate the effects of NecroX-5 on neomycin-induced ototoxicity in transgenic zebrafish (Brn3C: EGFP). Five days post-fertilization, zebrafish larvae were exposed to 125 μM neomycin and one of the following NecroX-5 concentrations for 1 h: 10, 25, 50, and 75 μM. Hair cells within the neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed using fluorescence microscopy (n = 10). The terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridiniumiodide (DASPEI) assay were performed for evaluation of apoptosis and mitochondrial damage. Ultrastructural changes were evaluated using scanning electron microscopy. NecroX-5 decreased neomycin-induced hair cell loss in the neuromasts (NecroX-5 50 μM: 13.4 ± 2.0 cells, 125 μM neomycin only: 8.1 ± 1.2 cells; n = 10, P < 0.05) and decreased the TUNEL reaction. The ultrastructural analysis showed that the structures of mitochondria and hair cells within the neuromasts were preserved in zebrafish exposed to 125 μM neomycin and 50 μM NecroX-5. NecroX-5 decreased apoptosis and mitochondrial damage. In conclusion, NecroX-5 attenuated neomycin-induced hair cell loss in zebrafish.

  2. eis Promoter C14G and C15G Mutations Do Not Confer Kanamycin Resistance in Mycobacterium tuberculosis.


    Pholwat, Suporn; Stroup, Suzanne; Heysell, Scott; Ogarkov, Oleg; Zhdanova, Svetlana; Ramakrishnan, Girija; Houpt, Eric


    We studied the significance of particular eis mutations on Mycobacterium tuberculosis drug resistance using a specialized transduction strategy. Recombinant strains harboring eis promoter mutations C14T, C12T, and G10A exhibited kanamycin resistance with MICs of 40, 10, and 20 μg/ml, respectively, while recombinant strains harboring C14G and C15G mutations were kanamycin susceptible (MIC, 2.5 to 5 μg/ml). Each of the eis mutants tested remained amikacin susceptible (MIC, 0.5 to 4 μg/ml). The identification of specific eis mutations is needed for accurate genotypic susceptibility testing for kanamycin.

  3. Heterologous expression of the kanamycin biosynthetic gene cluster (pSKC2) in Streptomyces venezuelae YJ003.


    Thapa, Laxmi Prasad; Oh, Tae-Jin; Lee, Hei Chan; Liou, Kwangkyoung; Park, Je Won; Yoon, Yeo Joon; Sohng, Jae Kyung


    The pSKC2 cosmid, which has 32 kb and 28 open-reading frames, was isolated from Streptomyces kanamyceticus ATCC12853 as the gene cluster of kanamycin. This gene cluster includes the minimal biosynthetic genes of kanamycin with the resistance and regulatory genes. It was heterologously expressed in Streptomyces venezuelae YJ003, which has the advantage of fast growth, good efficiency of the transformation host, and rapid production of the aminoglycosides antibiotic. The isolated compound was analyzed by electrospray ionization-mass spectrometry, liquid chromatography-mass spectrometry, high-performance liquid chromatography, and tandem mass spectrometry and shows a molecular weight of 485 as kanamycin A.

  4. Characterization of a radical S-adenosyl-L-methionine epimerase, NeoN, in the last step of neomycin B biosynthesis.


    Kudo, Fumitaka; Hoshi, Shota; Kawashima, Taiki; Kamachi, Toshiaki; Eguchi, Tadashi


    The last step of neomycin biosynthesis is the epimerization at C-5‴ of neomycin C to give neomycin B. A candidate enzyme responsible for the epimerization was a putative radical S-adenosyl-L-methionine (SAM) enzyme, NeoN, which is uniquely encoded in the neomycin biosynthetic gene cluster and remained an unassigned protein in the neomycin biosynthesis. The reconstituted and reduced NeoN showed the expected epimerization activity in the presence of SAM. In the epimerization, 1 equiv of SAM was consumed to convert neomycin C into neomycin B. The site of neomycin C reactive toward epimerization was clearly confirmed to be C-5‴ by detecting the incorporation of a deuterium atom from the deuterium oxide-based buffer solution. Further, alanine scanning of the NeoN cysteine residues revealed that C249 is a critical amino acid residue that provides a hydrogen atom to complete the epimerization. Furthermore, electron paramagnetic resonance analysis of the C249A variant in the presence of SAM and neomycin C revealed that a radical intermediate is generated at the C-5‴ of neomycin C. Therefore, the present study clearly illustrates that the epimerization of neomycin C to neomycin B is catalyzed by a unique radical SAM epimerase NeoN with a radical reaction mechanism.

  5. MAPLE fabrication of thin films based on kanamycin functionalized magnetite nanoparticles with anti-pathogenic properties

    NASA Astrophysics Data System (ADS)

    Grumezescu, Valentina; Andronescu, Ecaterina; Holban, Alina Maria; Mogoantă, Laurenţiu; Mogoşanu, George Dan; Grumezescu, Alexandru Mihai; Stănculescu, Anca; Socol, Gabriel; Iordache, Florin; Maniu, Horia; Chifiriuc, Mariana Carmen


    In this study we aimed to evaluate the biocompatibility and antimicrobial activity of kanamycin functionalized 5 nm-magnetite (Fe3O4@KAN) nanoparticles thin films deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) technique. A laser deposition regime was established in order to stoichiometrically transfer Fe3O4@KAN thin films on silicone and glass substrates. Morphological and physico-chemical properties of powders and coatings were characterized by XRD, TEM, SEM, AFM and IR microscopy (IRM). Our nanostructured thin films have proved efficiency in the prevention of microbial adhesion and mature biofilms development as a result of antibiotic release in its active form. Furthermore, kanamycin functionalized nanostructures exhibit a good biocompatibility, both in vivo and in vitro, demonstrating their potential for implants application. This is the first study reporting the assessment of the in vivo biocompatibility of a magnetite-antimicrobial thin films produced by MAPLE technique.

  6. Efficient plastid transformation in tobacco using the aphA-6 gene and kanamycin selection.


    Huang, F-C; Klaus, S M J; Herz, S; Zou, Z; Koop, H-U; Golds, T J


    Here we report on the development of a new dominant selection marker for plastid transformation in higher plants using the aminoglycoside phosphotransferase gene aphA-6 from Acinetobacter baumannii. Vectors containing chimeric aphA-6 gene constructs were introduced into the tobacco chloroplast using particle bombardment of alginate-embedded protoplast-derived micro colonies or polyethylene glycol (PEG)-mediated DNA uptake. Targeted insertion into the plastome was achieved via homologous recombination, and plastid transformants were recovered on the basis of their resistance to kanamycin. Variations in kanamycin resistance in transplastomic lines were observed depending on the 5' and 3' regulatory elements associated with the aphA-6 coding region. Transplastomic plants were fertile and showed maternal inheritance of the transplastome in the progeny.

  7. Draft Genome Sequence of Amikacin- and Kanamycin-Resistant Mycobacterium tuberculosis MT433 without rrs and eis Mutations.


    Sowajassatakul, Angkanang; Coker, Olabisi O; Prammananan, Therdsak; Chaiprasert, Angkana; Phunpruch, Saranya


    We announce the draft genome sequence of amikacin- and kanamycin-resistant Mycobacterium tuberculosis MT433, which has been previously described as the strain carrying an unknown resistance mechanism.

  8. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.


    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung


    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer.

  9. Label-free immunosensor for the detection of kanamycin using Ag@Fe₃O₄ nanoparticles and thionine mixed graphene sheet.


    Yu, Shujun; Wei, Qin; Du, Bin; Wu, Dan; Li, He; Yan, Liangguo; Ma, Hongmin; Zhang, Yong


    A highly sensitive label-free immunosensor for the detection of kanamycin had been developed using silver hybridized mesoporous ferroferric oxide nanoparticles (Ag@Fe₃O₄ NPs) and thionine mixed graphene sheet (TH-GS). TH was used as an electron transfer mediator. The electrical signal was greatly improved in the presence of GS due to its good electron-transfer ability. With the advantages of large specific surface area and excellent electrical conductivity, Ag@Fe₃O₄ NPs could immobilize more antibodies of kanamycin and promote the electron transfer. Cyclic voltammetry and square wave voltammetry were used to characterize the recognition of kanamycin. The proposed immunosensor showed good performances such as low detection limit (15 pg mL⁻¹), wide linear range (from 0.050 to 16 ng mL⁻¹), short analysis time (3 min), high stability, and good selectivity in the detection of kanamycin. The immunosensor was evaluated for pork meat sample, receiving satisfactory results.

  10. Management of gonococcal ophthalmia neonatorum with single-dose kanamycin and ocular irrigation with saline.


    Latif, A; Mason, P; Marowa, E; Paraiwa, E; Dhamu, F; Tambo, J; Gwanzura, L; Mapeta, D; Jongeling, G


    Two hundred nineteen neonates with gonococcal ophthalmia neonatorum, including 40 infected with penicillinase-producing strains, were treated as outpatients with a single intramuscular injection of 100 mg of kanamycin and hourly ocular irrigation with saline. Neisseria gonorrhoeae was isolated from three (1.4%) of the 212 babies attending for follow-up, and post-gonococcal conjunctivitis developed in 22 (10.4%) of those who returned for follow-up.

  11. Covalently linked kanamycin - Ciprofloxacin hybrid antibiotics as a tool to fight bacterial resistance.


    Shavit, Michal; Pokrovskaya, Varvara; Belakhov, Valery; Baasov, Timor


    To address the growing problem of antibiotic resistance, a set of 12 hybrid compounds that covalently link fluoroquinolone (ciprofloxacin) and aminoglycoside (kanamycin A) antibiotics were synthesized, and their activity was determined against both Gram-negative and Gram-positive bacteria, including resistant strains. The hybrids were antagonistic relative to the ciprofloxacin, but were substantially more potent than the parent kanamycin against Gram-negative bacteria, and overcame most dominant resistance mechanisms to aminoglycosides. Selected hybrids were 42-640 fold poorer inhibitors of bacterial protein synthesis than the parent kanamycin, while they displayed similar inhibitory activity to that of ciprofloxacin against DNA gyrase and topoisomerase IV enzymes. The hybrids showed significant delay of resistance development in both E. coli and B. subtilis in comparison to that of component drugs alone or their 1:1 mixture. More generally, the data suggest that an antagonistic combination of aminoglycoside-fluoroquinolone hybrids can lead to new compounds that slowdown/prevent the emergence of resistance.

  12. A novel strategy for obtaining kanamycin resistance in Arabidopsis thaliana by silencing an endogenous gene encoding a putative chloroplast transporter.


    Aufsatz, Werner; Nehlin, Lilian; Voronin, Viktor; Schmidt, Agnes; Matzke, Antonius J M; Matzke, Marjori


    The use of bacterial antibiotic resistance markers in transgenic plants raises concerns about horizontal gene transfer to soil bacteria. We report here that kanamycin resistance in Arabidopsis thaliana can be achieved by silencing an endogenous gene encoding a putative chloroplast transporter, which presumably imports kanamycin into chloroplasts to interfere with ribosomal RNA. Homologs of the transporter exist in other plant species, suggesting this strategy may be generally useful for selecting transformed plant cells.

  13. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Prochlorperazine, isopropamide, with neomycin sustained-release capsules. 520.1921 Section 520.1921 Food and Drugs FOOD AND DRUG ADMINISTRATION... desirable to administer a vasoconstrictor, norepinephrine is the drug of choice. Federal law restricts...

  14. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS §...

  15. Neomycin Sulfate Improves the Antimicrobial Activity of Mupirocin-Based Antibacterial Ointments

    PubMed Central

    Blanchard, Catlyn; Brooks, Lauren; Beckley, Andrew; Colquhoun, Jennifer; Dewhurst, Stephen


    In the midst of the current antimicrobial pipeline void, alternative approaches are needed to reduce the incidence of infection and decrease reliance on last-resort antibiotics for the therapeutic intervention of bacterial pathogens. In that regard, mupirocin ointment-based decolonization and wound maintenance practices have proven effective in reducing Staphylococcus aureus transmission and mitigating invasive disease. However, the emergence of mupirocin-resistant strains has compromised the agent's efficacy, necessitating new strategies for the prevention of staphylococcal infections. Herein, we set out to improve the performance of mupirocin-based ointments. A screen of a Food and Drug Administration (FDA)-approved drug library revealed that the antibiotic neomycin sulfate potentiates the antimicrobial activity of mupirocin, whereas other library antibiotics did not. Preliminary mechanism of action studies indicate that neomycin's potentiating activity may be mediated by inhibition of the organism's RNase P function, an enzyme that is believed to participate in the tRNA processing pathway immediately upstream of the primary target of mupirocin. The improved antimicrobial activity of neomycin and mupirocin was maintained in ointment formulations and reduced S. aureus bacterial burden in murine models of nasal colonization and wound site infections. Combination therapy improved upon the effects of either agent alone and was effective in the treatment of contemporary methicillin-susceptible, methicillin-resistant, and high-level mupirocin-resistant S. aureus strains. From these perspectives, combination mupirocin-and-neomycin ointments appear to be superior to that of mupirocin alone and warrant further development. PMID:26596945

  16. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment. 524.1484c Section 524.1484c Food and Drugs FOOD AND DRUG ADMINISTRATION... observe animals being treated for evidence of hypersensitivity or allergy to the drug. If such signs...

  17. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment. 524.1484c Section 524.1484c Food and Drugs FOOD AND DRUG ADMINISTRATION... observe animals being treated for evidence of hypersensitivity or allergy to the drug. If such signs...

  18. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment. 524.1484c Section 524.1484c Food and Drugs FOOD AND DRUG ADMINISTRATION... observe animals being treated for evidence of hypersensitivity or allergy to the drug. If such signs...

  19. 21 CFR 524.1484d - Neomycin, hydrocortisone, and tetracaine otic ointment.

    Code of Federal Regulations, 2014 CFR


    ... ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... NEW ANIMAL DRUGS § 524.1484d Neomycin, hydrocortisone, and tetracaine otic ointment. (a... base, 5 milligrams of hydrocortisone acetate, and 5 milligrams of tetracaine hydrochloride in each gram...

  20. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2010 CFR


    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484i Neomycin sulfate, hydrocortisone acetate, sterile ointment. (a... conjunctival sac. With improvement, frequency may be reduced to two or three times daily. For treatment of ear...

  1. 21 CFR 524.1881b - Prednisolone acetate-neomycin sulfate sterile suspension.

    Code of Federal Regulations, 2011 CFR


    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1881b Prednisolone acetate-neomycin sulfate sterile suspension. (a... externa, 2 to 6 drops may be placed in the external ear canal 2 or 3 times daily. (3) All topical...

  2. 21 CFR 524.1484g - Neomycin sulfate-thiabendazole-dexamethasone solution.

    Code of Federal Regulations, 2011 CFR


    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484g Neomycin sulfate-thiabendazole-dexamethasone solution. (a) Specifications... and otitis externa in dogs and cats. (2) In treating dermatoses affecting areas other than the ear...

  3. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2011 CFR


    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484i Neomycin sulfate, hydrocortisone acetate, sterile ointment. (a... conjunctival sac. With improvement, frequency may be reduced to two or three times daily. For treatment of ear...

  4. Recognition of HIV-TAR RNA using neomycin-benzimidazole conjugates.


    Ranjan, Nihar; Kumar, Sunil; Watkins, Derrick; Wang, Deyun; Appella, Daniel H; Arya, Dev P


    Synthesis of a novel class of compounds and their biophysical studies with TAR-RNA are presented. The synthesis of these compounds was achieved by conjugating neomycin, an aminoglycoside, with benzimidazoles modeled from a B-DNA minor groove binder, Hoechst 33258. The neomycin-benzimidazole conjugates have varying linkers that connect the benzimidazole and neomycin units. The linkers of varying length (5-23 atoms) in these conjugates contain one to three triazole units. The UV thermal denaturation experiments showed that the conjugates resulted in greater stabilization of the TAR-RNA than either neomycin or benzimidazole used in the synthesis of conjugates. These results were corroborated by the FID displacement and tat-TAR inhibition assays. The binding of ligands to the TAR-RNA is affected by the length and composition of the linker. Our results show that increasing the number of triazole groups and the linker length in these compounds have diminishing effect on the binding to TAR-RNA. Compounds that have shorter linker length and fewer triazole units in the linker displayed increased affinity towards the TAR RNA.

  5. 21 CFR 524.154 - Bacitracin, neomycin, and polymyxin B ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR


    ...,000 units of polymyxin B sulfate; or (2) 400 units of bacitracin zinc, 3.5 milligrams of neomycin, and 10,000 units of polymyxin B sulfate. (b) Sponsors. See sponsor numbers in § 510.600(c) of this...

  6. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2010 CFR


    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.960 Flumethasone, neomycin sulfate, and polymyxin B sulfate... which microorganisms are not susceptible to the antibiotics incorporated in the drug. (ii) The drug...

  7. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    Code of Federal Regulations, 2010 CFR


    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484e Neomycin sulfate and polymyxin B sulfate ophthalmic solution. (a... nonsusceptible to the antibiotics incorporated in the drug. (4) Federal law restricts this drug to use by or...

  8. 21 CFR 524.1484f - Neomycin sulfate, prednisolone acetate, tetracaine hydrochloride eardrops.

    Code of Federal Regulations, 2010 CFR


    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484f Neomycin sulfate, prednisolone acetate, tetracaine hydrochloride... lesions may be due to the presence of nonsusceptible organisms or to prolonged use of...

  9. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2012 CFR


    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1921 Prochlorperazine, isopropamide, with neomycin sustained-release... orally twice daily to dogs as follows: Animal weight (pounds) Number of capsules per dose Capsule No. 1...

  10. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2014 CFR


    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1921 Prochlorperazine, isopropamide, with neomycin sustained-release... orally twice daily to dogs as follows: Animal weight (pounds) Number of capsules per dose Capsule No. 1...

  11. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2013 CFR


    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1921 Prochlorperazine, isopropamide, with neomycin sustained-release... orally twice daily to dogs as follows: Animal weight (pounds) Number of capsules per dose Capsule No. 1...

  12. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2011 CFR


    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1921 Prochlorperazine, isopropamide, with neomycin sustained-release... orally twice daily to dogs as follows: Animal weight (pounds) Number of capsules per dose Capsule No. 1...

  13. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2010 CFR


    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  14. Neomycin binding preserves extracellular matrix in bioprosthetic heart valves during in vitro cyclic fatigue and storage

    PubMed Central

    Raghavan, Devanathan; Starcher, Barry C.; Vyavahare, Naren R.


    Bioprosthetic heart valve (BHV) cusps have a complex architecture consisting of an anisotropic arrangement of collagen, glycosaminoglycans (GAGs) and elastin. Glutaraldehyde (GLUT) is used as a fixative for all clinical BHV implants; however, it only stabilizes the collagen component of the tissue, and other components such as GAGs and elastin are lost from the tissue during processing, storage or after implantation. We have shown previously that the effectiveness of the chemical crosslinking can be increased by incorporating neomycin trisulfate, a hyaluronidase inhibitor, to prevent the enzyme-mediated GAG degradation. In the present study, we optimized carbodiimide-based GAG-targeted chemistry to incorporate neomycin into BHV cusps prior to conventional GLUT crosslinking. This crosslinking leads to enhanced preservation of GAGs during in vitro cyclic fatigue and storage. The neomycin group showed greater GAG retention after both 10 and 50 million accelerated-fatigue cycles and after 1 year of storage in GLUT solution. Thus, additional binding of neomycin to the cusps prior to standard GLUT crosslinking could enhance tissue stability and thus heart valve durability. PMID:19091637

  15. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2011 CFR


    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  16. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2012 CFR


    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  17. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2013 CFR


    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  18. Effects of neomycin on the biliary excretion and enterohepatic circulation of mestranol and 17beta-oestradiol.


    Brewster, D; Jones, R S; Symons, A M


    The continued circulation of free steroids depends on their resorption from the gut following the hydrolysis of biliary conjugates. In this study, the bile duct of female Wistar albino rats was cannulated. Animals receiving labeled steroids or labeled bile intraductally also had the duodenum fitted with a cannula connected with a dosing syringe. In neomycin-treated rats, recirculation was impaired up to 50%. The deconjugation of mestranol and estradiol biliary conjugates was shown in vitro uponiincubation with rat caecal microorganisms, and the inhibition of such hydrolysis by neomycin was observed in vitro. Neomycin pretreatment reduced the biliary excretion of mestranol and estradiol after intraductal administration. It was thought that suppression of the gut microflora by neomycin was a major factor in the impairment of the intrahepatic circulation of mestranol and estradiol metabolites. This effect may be important regarding the half-life of estrogenic compounds of the contraceptive pill.

  19. Cross-resistance of Mycobacterium tuberculosis isolates among streptomycin, kanamycin and amikacin.


    Sugawara, I; Zhang, J; Li, C


    Seventy-four streptomycin (SM)-resistant M. tuberculosis clinical isolates were subjected to cross-resistance drug testing against two major aminoglycosides, kanamycin (KM) and amikacin (AMK). Among them, 15 clinical isolates (20.3%) were resistant to both KM and AMK. Fifteen (80%) of 19 KM-resistant isolates were AMK-resistant. Fifteen SM, KM, and AMK resistant isolates harbored rrs mutation, but only two had rrs and rpsL double mutations. Low-level SM resistance was associated with rpsL mutation, whereas high-level SM resistance was linked to rrs mutation.

  20. The ryanodine receptor pore blocker neomycin also inhibits channel activity via a previously undescribed high-affinity Ca(2+) binding site.


    Laver, Derek R; Hamada, Tomoyo; Fessenden, James D; Ikemoto, Noriaki


    In this study, we present evidence for the mechanism of neomycin inhibition of skeletal ryanodine receptors (RyRs). In single-channel recordings, neomycin produced monophasic inhibition of RyR open probability and biphasic inhibition of [(3)H]ryanodine binding. The half-maximal inhibitory concentration (IC(50)) for channel blockade by neomycin was dependent on membrane potential and cytoplasmic [Ca(2+)], suggesting that neomycin acts both as a pore plug and as a competitive antagonist at a cytoplasmic Ca(2+) binding site that causes allosteric inhibition. This novel Ca(2+)/neomycin binding site had a neomycin affinity of 100 nM: and a Ca(2+) affinity of 35 nM,: which is 30-fold higher than that of the well-described cytoplasmic Ca(2+) activation site. Therefore, a new high-affinity class of Ca(2+) binding site(s) on the RyR exists that mediates neomycin inhibition. Neomycin plugging of the channel pore induced brief (1-2 ms) conductance substates at 30% of the fully open conductance, whereas allosteric inhibition caused complete channel closure with durations that depended on the neomycin concentration. We quantitatively account for these results using a dual inhibition model for neomycin that incorporates voltage-dependent pore plugging and Ca(2+)-dependent allosteric inhibition.

  1. Limited sampling strategies for therapeutic drug monitoring of amikacin and kanamycin in patients with multidrug-resistant tuberculosis.


    Dijkstra, J A; van Altena, R; Akkerman, O W; de Lange, W C M; Proost, J H; van der Werf, T S; Kosterink, J G W; Alffenaar, J W C


    Amikacin and kanamycin are considered important and effective drugs in the treatment of multidrug-resistant tuberculosis (MDR-TB). Unfortunately, the incidence of toxicity is high and is related to elevated drug exposure. In order to achieve a balance between efficacy and toxicity, a population pharmacokinetic (PPK) model may help to optimise drug exposure. Patients with MDR-TB who had received amikacin or kanamycin as part of their treatment and who had routinely received therapeutic drug monitoring were evaluated. A PPK model was developed and subsequently validated. Using this model, a limited sampling model was developed. Eleven patients receiving amikacin and nine patients receiving kanamycin were included in this study. The median observed 24-h area under the concentration-time curve (AUC0-24h) was 77.2 mg h/L [interquartile range (IQR) 64.7-96.2 mg h/L] for amikacin and 64.1 mg h/L (IQR 55.6-92.1 mg h/L) for kanamycin. The PPK model was developed and validated using n-1 cross-validation. A robust population model was developed that is suitable for predicting the AUC0-24h of amikacin and kanamycin. This model, in combination with the limited sampling strategy developed, can be used in daily routine to guide dosing but also to assess AUC0-24h in phase 3 studies.

  2. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite.


    Zhu, Ye; Chandra, Pranjal; Song, Kyung-Mi; Ban, Changill; Shim, Yoon-Bo


    Highly sensitive label-free detection of kanamycin is achieved with an aptamer sensor based on a conducting polymer/gold self-assembled nanocomposite. The sensor probe is fabricated by covalently immobilizing an in vitro selected DNA aptamer for kanamycin onto gold nanoparticle (AuNP)-comprised conducting polymer, poly-[2, 5-di-(2-thienyl)-1H-pyrrole-1-(p-benzoic acid)] (poly-DPB). The self-assembling of DPB on AuNP is investigated by TEM and UV-vis spectroscopy and the modification of the aptamer sensor is characterized using XPS and electrochemical impedance spectroscopy. The probe is applied to detect kanamycin by using voltammetric techniques. The sensor shows a pair of redox peaks around 0.26/ 0.08 V (vs. Ag/AgCl) for kanamycin captured by the aptamer-immobilized probe. The parameters that can affect the response, such as aptamer concentration, incubation time, temperature, and pH are optimized. The calibration plot shows a linear range from 0.05 μM to 9.0 μM kanamycin with a detection limit of 9.4±0.4 nM. The proposed aptamer sensor is examined with a real sample.

  3. An Arabidopsis thaliana ABC transporter that confers kanamycin resistance in transgenic plants does not endow resistance to Escherichia coli.


    Burris, Kellie; Mentewab, Ayalew; Ripp, Steven; Stewart, C Neal


    Concerns have been raised about potential horizontal gene transfer (HGT) of antibiotic resistance markers (ARMs) from transgenic plants to bacteria of medical and environmental importance. All ARMs used in transgenic plants have been bacterial in origin, but it has been recently shown that an Arabidopsis thaliana ABC transporter, Atwbc19, confers kanamycin resistance when overexpressed in transgenic plants. Atwbc19 was evaluated for its ability to transfer kanamycin resistance to Escherichia coli, a kanamycin-sensitive model bacterium, under simulated HGT, staged by subcloning Atwbc19 under the control of a bacterial promoter, genetically transforming to kanamycin-sensitive bacteria, and assessing if resistance was conferred as compared with bacteria harbouring nptII, the standard kanamycin resistance gene used to produce transgenic plants. NptII provided much greater resistance than Atwbc19 and was significantly different from the no-plasmid control at low concentrations. Atwbc19 was not significantly different from the no-plasmid control at higher concentrations. Even though HGT risks are considered low with nptII, Atwbc19 should have even lower risks, as its encoded protein is possibly mistargeted in bacteria.

  4. The penetration of gentamicin and neomycin into perilymph across the round window membrane.


    Smith, B M; Myers, M G


    Many commonly employed otic drops contain aminoglycoside antibiotics that may be toxic to the inner ear. A variety of chemicals such as ionic solutions, certain anesthetics, and epinephrine have been shown to diffuse across the round window membrane into the perilymph. Twelve adult cats were studied in this experiment. The auditory bulla was exposed and solutions containing gentamicin or neomycin concentrations similar to that commonly used in otic drops were applied to the round window niche for 15 minutes and washed with saline solution. The gentamicin and neomycin concentrations in the round window niche wash and the perilymph were then assayed by a radioenzymatic method. Concentrations of both antibiotics were observed in the perilymph. Thus, the round window membrane is a route through which these ototoxins may gain access to the inner ear.

  5. Neomycin inhibits the phosphatidylinositol monophosphate and phosphatidylinositol bisphosphate stimulation of plasma membrane ATPase activity

    SciTech Connect

    Chen, Qiuyun; Boss, W.F. )


    The inositol phospholipids, phosphatidylinositol monophosphate (PIP) and phosphatidylinositol bisphosphate (PIP{sub 2}), have been shown to increase the vanadate-sensitive ATPase activity of plant plasma membranes. In this paper, the authors show the effect of various concentrations of phosphatidyinositol, PIP, and PIP{sub 2} on the plasma membrane vanadate-sensitive ATPase activity. PIP and PIP{sub 2} at concentrations at 10 nanomoles per 30 microgram membrane protein per milliliter of reaction mixture caused a twofold and 1.8-fold increase in the ATPase activity, respectively. The effect of these negatively charged phospholipids on the ATPase activity was inhibited by adding the positively charged aminoglycoside, neomycin. Neomycin did not affect the endogenous plasma membrane ATPase activity in the absence of exogenous lipids.

  6. Neomycin Sulfate Improves the Antimicrobial Activity of Mupirocin-Based Antibacterial Ointments.


    Blanchard, Catlyn; Brooks, Lauren; Beckley, Andrew; Colquhoun, Jennifer; Dewhurst, Stephen; Dunman, Paul M


    In the midst of the current antimicrobial pipeline void, alternative approaches are needed to reduce the incidence of infection and decrease reliance on last-resort antibiotics for the therapeutic intervention of bacterial pathogens. In that regard, mupirocin ointment-based decolonization and wound maintenance practices have proven effective in reducing Staphylococcus aureus transmission and mitigating invasive disease. However, the emergence of mupirocin-resistant strains has compromised the agent's efficacy, necessitating new strategies for the prevention of staphylococcal infections. Herein, we set out to improve the performance of mupirocin-based ointments. A screen of a Food and Drug Administration (FDA)-approved drug library revealed that the antibiotic neomycin sulfate potentiates the antimicrobial activity of mupirocin, whereas other library antibiotics did not. Preliminary mechanism of action studies indicate that neomycin's potentiating activity may be mediated by inhibition of the organism's RNase P function, an enzyme that is believed to participate in the tRNA processing pathway immediately upstream of the primary target of mupirocin. The improved antimicrobial activity of neomycin and mupirocin was maintained in ointment formulations and reduced S. aureus bacterial burden in murine models of nasal colonization and wound site infections. Combination therapy improved upon the effects of either agent alone and was effective in the treatment of contemporary methicillin-susceptible, methicillin-resistant, and high-level mupirocin-resistant S. aureus strains. From these perspectives, combination mupirocin-and-neomycin ointments appear to be superior to that of mupirocin alone and warrant further development. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. [Integration of modern technologies in therapy of sarcomas of the pelvis. Computer-assisted hemipelvectomy and implantation of a "custom-made" Bonit gentamycin coated partial pelvic prosthesis].


    Bastian, L; Hüfner, T; Mössinger, E; Geerling, J; Goesling, T; Busche, M; Kendoff, D; Bading, S; Rosenthal, H; Krettek, C


    The resection of primary malignancies in the pelvis is technically demanding as organs and structures are to be preserved and reconstruction of the defect as well as the postoperative function and rehabilitation are dependent on an optimal prosthesis. We present two patients with a sarcoma of the pelvis where for the first time a structured concept of technology integration led to a press-fit implantation of a hemipelvic prosthesis. This concept includes the design and production of a "custom-made" prosthesis as a hemipelvic substitute and the coating of this prosthesis with Bonit, a second-generation calcium phosphate, and gentamycin in watery solution. The tumor resection was done with computer-assisted surgery based on computed tomographies (CT) of the pelvis model done by rapid prototyping rather than on the CT of the patients' pelvis. With this procedure the presurgically simulated resection could be executed precisely with complete resection of the tumors and an accuracy which allowed an exact implantation of the prosthesis. The course was uneventful with primary healing and no sign of an infection or loosening after 6 months.

  8. Follicular contact dermatitis revisited: A review emphasizing neomycin-associated follicular contact dermatitis

    PubMed Central

    Cohen, Philip R


    Follicular contact dermatitis clinically presents as individual papules that include a central hair follicle. Pathologic features involve the follicle and the surrounding dermis: spongiosis and vesicle formation of the follicular epithelium associated with perifollicular and perivascular lymphocytic inflammation. Using the PubMed database, an extensive literature search was performed on follicular contact dermatitis and neomycin. Relevant papers were reviewed and the clinical and pathologic features, the associated chemicals (including a more detailed description of neomycin), the hypothesized pathogenesis, and the management of follicular contact dermatitis were described. Several agents-either as allergens or irritants-have been reported to elicit follicular contact dermatitis. Several hypotheses have been suggested for the selective involvement of the follicles in follicular contact dermatitis: patient allergenicity, characteristics of the agent, vehicle containing the agent, application of the agent, and external factors. The differential diagnosis of follicular contact dermatitis includes not only recurrent infundibulofolliculitis, but also drug eruption, mite infestation, viral infection, and dermatoses that affect hair follicles. The primary therapeutic intervention for follicular contact dermatitis is withdrawal of the causative agent; treatment with a topical corticosteroid preparation may also promote resolution of the dermatitis. In conclusion, follicular contact dermatitis may be secondary to allergens or irritants; topical antibiotics, including neomycin, may cause this condition. Several factors may account for the selective involvement of the hair follicle in this condition. Treatment of the dermatitis requires withdrawal of the associated topical agent; in addition, topical corticosteroids may be helpful to promote resolution of lesions. PMID:25516854

  9. [Drug resistance of Escherichia coli strains isolated from poultry].


    Giurov, B; Korudzhiĭski, N; Bineva, I


    Studied was the sensitivity of a total of 143 strains of Escherichia coli, isolated from young birds and broilers died from coli septicaemia, to antibiotics and chemotherapeutics. The following descending order was established: gentamycin, carbenicillin, ampicillin, furazolidon, borgal, kanamycin, strep tomycin, chloramphenicol, neomycin sulphathiazole, and tetracycline. Markers of resistance were established with all strains with regard to the therapeutic agents in current and prospective use in industrial poultry farming. It is stated that a preliminary antibiogram is indispensable in order to obtain dependable results in the treatment of animals affected with colibacteriosis. An alternative is to apply directly those drugs to which the strains have shown highest sensitivity.

  10. Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance

    SciTech Connect

    Mai, V.; Lorenz, W.W.; Wiegel, J.


    The industrial application of thermophilic (eu)bacteria is hampered by the lack of genetic systems for these bacteria. We report here the first unequivocal transformation of a Gram-positive, thermophilic, anaerobic microorganism, Thermoanaerobacterium, with the kanamycin resistance-mediating plasmid pIKM1. The construct pIKM1 is based on the Escherichia coli-Clostridium acetobutylicum shuttle vector pIMP1 and contains the thermostable kanamycin cassette from S. faecalis plasmid pKD102. Using electrotransformation, plasmid pIKM1 mediated kanamycin resistance in Thermoanaerobacterium sp. strain JW/SL-YS485 up to 400 {mu}g ml{sup -1} at 48{degrees}C and 200 {mu}g ml{sup -1} at 60{degrees}C.

  11. Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.


    Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian


    Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Adaptive gene profiling of Mycobacterium tuberculosis during sub-lethal kanamycin exposure.


    Habib, Zeshan; Xu, Weize; Jamal, Muhammad; Rehman, Khaista; Chen, Xi; Dai, Jinxia; Fu, Zhen Fang; Cao, Gang


    Resistance to anti-tuberculosis drugs is a formidable obstacle to effective tuberculosis (TB) treatment and prevention globally. New forms of multidrug, extensive drug and total drug resistance Mycobacterium tuberculosis (Mtb) causing a serious threat to human as well as animal's population. Mtb shows diverse adaptability under stress conditions especially antibiotic treatment, however underlying physiological mechanism remained elusive. In present study, we investigated Mtb's response and adaptation with reference to gene expression during sub-lethal kanamycin exposure. Mtb were cultured under sub-lethal drug and control conditions, where half were sub-cultured every 3-days to observe serial adaptation under same conditions and the remaining were subjected to RNA-seq. We identified 98 up-regulated and 198 down-regulated responsive genes compared to control through differential analysis, of which Ra1750 and Ra3160 were the most responsive genes. In adaptive analysis, we found Ra1750, Ra3160, Ra3161, Ra3893 and Ra2492 up-regulation at early stage and gradually showed low expression levels at the later stages of drug exposure. The adaptive expression of Ra1750, Ra3160 and Ra3161 were further confirmed by real time qPCR. These results suggested that these genes contributed in Mtb's physiological adaptation during sub-lethal kanamycin exposure. Our findings may aid to edify these potential targets for drug development against drug resistance tuberculosis. Copyright © 2017. Published by Elsevier Ltd.

  13. Time course of neuronal and synaptic plasticity in dorsal cochlear nucleus of guinea pig following chronic kanamycin-induced deafness.


    Kong, W J; Yin, Z D; Fan, G R; Yang, Y; Huang, X


    We investigated the time course of the plasticity in fusiform cell (FC) and at auditory nerve (AN) synapse on FC (AN/FC synapse) following chronic kanamycin-induced deafness. Guinea pigs were treated with kanamycin sulfate by subcutaneous injection at dose of 500 mg/kg/day for 7 days. Ultrastructural changes in FC and AN/FC synapse were observed, and local insulin-like growth factor 1 (IGF-1) mRNA was quantified using quantitative real time PCR at 1, 7, 14, 28, 70 and 140 days after kanamycin treatment. The average threshold was 46.46+/-3.45, 80.63+/-5.95 and 103.95+/-6.59 dB SPL respectively at 1, 7 and 14 days, and the threshold was statistically unchanged at 28, 70 and 140 days in comparison with the 14 day group. Mitochondrial swelling in FC and at AN/FC synapse was progressive at 7, 14 and 28 days. Moreover, the thickness of the postsynaptic densities increased at 1, 7 and 14 days. Finally, there was a persistent upregulation in local IGF-1 mRNA at 7, 14, 28 and 70 days. These changes in the ultrastructure of AN/FC synapse and FC, and upregulation of local IGF-1 mRNA were no longer present at 140 days. Our results indicate that the effects of kanamycin on the ultrastructure of FC and AN/FC synapse are progressive. However, FC and AN/FC synapse are capable of reviving and remodeling after kanamycin-induced lesion and incomplete deafferentation. Additionally, local IGF-1 might play a role in the lesion- and deafness-induced plasticity in FC and at AN/FC synapse following chronic kanamycin-induced deafness.

  14. Modification of kanamycin-esculin-azide agar to improve selectivity in the enumeration of fecal streptococci from water samples.

    PubMed Central

    Audicana, A; Perales, I; Borrego, J J


    Kanamycin-esculin-azide agar was modified by increasing the concentration of sodium azide to 0.4 g liter-1 and replacing kanamycin sulfate with 5 mg of oxolinic acid liter-1. The modification, named oxolinic acid-esculin-azide (OAA) agar, was compared with Slanetz-Bartley and KF agars by using drinking water and seawater samples. The OAA agar showed higher specificity, selectivity, and recovery efficiencies than those obtained by using the other media. In addition, no confirmation of typical colonies was needed when OAA agar was used, which significantly shortens the time of sample processing and increases the accuracy of the method. PMID:8534085

  15. Glutamate co-transmission from developing medial nucleus of the trapezoid body - Lateral superior olive synapses is cochlear dependent in kanamycin-treated rats

    SciTech Connect

    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol


    Research highlights: {yields} Glutamate co-transmission is enhanced in kanamycin-treated rats. {yields} VGLUT3 expression is increased in kanamycin-treated rats. {yields} GlyR expression is decreased in kanamycin-treated rats. {yields} GlyR, VGLUT3 expression patterns are asymmetric in unilaterally cochlear ablated rat. -- Abstract: Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  16. Protective effects of caffeic acid phenethyl ester (CAPE) against neomycin-induced hair cell damage in zebrafish.


    Park, Moo Kyun; Im, Gi Jung; Chang, Jiwon; Chae, Sung Won; Yoo, Jun; Han, Won-gue; Hwang, Gyu Ho; Jung, Jong Yoon; Choi, Jungim; Jung, Hak Hyun; Chung, Ah-Young; Park, Hae-Chul; Choi, June


    Caffeic acid phenethyl ester (CAPE) is known to reduce the generation of oxygen-derived free radicals, which is a major mechanism of aminoglycoside-induced ototoxicity. The objective of the present study was to evaluate the effects of CAPE on neomycin-induced ototoxicity in zebrafish (Brn3c: EGFP). Five-day post-fertilization zebrafish larvae (n=10) were exposed to 125 μM neomycin and one of the following CAPE concentrations for 1h: 50, 100, 250, 500, or 1000 μM. Ultrastructural changes were evaluated using scanning electron microscopy (SEM). The terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick-end labeling (TUNEL) assay and 2-[4-(dimethylamino)styryl]-N-ethylpyridiniumiodide (DASPEI) assay were performed for evaluation of apoptosis and mitochondrial damage. CAPE decreased neomycin-induced hair cell loss in the neuromasts (500 μM CAPE: 12.7 ± 1.1 cells, 125 μM neomycin only: 6.3 ± 1.1 cells; n = 10, P < 0.05). In the ultrastructural analysis, structures of mitochondria and hair cells were preserved when exposed to 125 μM neomycin and 500 μM CAPE. CAPE decreased apoptosis and mitochondrial damage. In the present study, CAPE attenuated neomycin-induced hair cell damage in zebrafish. The results of the current study suggest that neomycin induces apoptosis, and the apoptotic cell death can be prevented by treatment with CAPE in zebrafish. Copyright © 2014. Published by Elsevier Ireland Ltd.

  17. Surface plasmon resonance and molecular docking studies of bovine serum albumin interaction with neomycin: kinetic and thermodynamic analysis

    PubMed Central

    Sharifi, Maryam; Ezzati Nazhad Dolatabadi, Jafar; Fathi, Farzaneh; Zakariazadeh, Mostafa; Barzegar, Abolfazl; Rashidi, Mohammad; Tajalli, Habib; Rashidi, Mohammad-Reza


    Introduction: The interactions between biomacromolecules such as serum albumin (SA) and various drugs have attracted increasing research attention in recent years. However, the study of SA with those drugs that have relatively high hydrophilicity and a lower affinity for SA could be a challenging issue. At the present study, the interaction of bovine SA (BSA) with neomycin as a hydrophilic drug has been investigated using surface plasmon resonance (SPR) and molecular docking methods. Methods: BSA was immobilized on the carboxymethyl dextran hydrogel sensor chip after activation of carboxylic groups through NHS/EDC and, then, the neomycin interaction with BSA at different concentrations (1-128 µM) was investigated. Results: Dose-response sensorgrams of BSA upon increasing concentration of neomycin has been shown through SPR analysis. The small KD value (4.96 e-7 at 40°C) demonstrated high affinity of neomycin to BSA. Thermodynamic parameters were calculated through van’t Hoff equation at 4 different temperatures. The results showed that neomycin interacts with BSA via Van der Waals interactions and hydrogen bonds and increase of KD with temperature rising indicated that the binding process was entropy driven. Molecular docking study confirmed that hydrogen bond was the major intermolecular force stabilizing neomycin-BSA complex. Conclusion: The attained results showed that neomycin molecules can efficiently distribute within the body after interaction with BSA in spite of having hydrophilic properties. Besides, SPR can be considered as a useful instrument for study of the interaction of hydrophilic drugs with SA. PMID:28752073

  18. Glutamate co-transmission from developing medial nucleus of the trapezoid body--lateral superior olive synapses is cochlear dependent in kanamycin-treated rats.


    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol


    Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB)--the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  19. Comparative study on usefulness of gentamycin-containing collagen implants in the treatment of patients with osteitis and osteomyelitis of the craniofacial skeleton.


    Zawadzki, Paweł J; Perkowski, Konrad; Kotlarski, Michał; Pietruczuk-Padzik, Anna; Chomicz, Lidia


    Introduction and objective. A reduction in incidences of peri-surgical complications due to infections is achieved by antibiotic prophylaxis The objective of the study was to assess the usefulness of gentamycin-containing collagen implants (GCCI) in the treatment of patients with osteitis and osteomyelitis of the craniofacial skeleton. Materials and method. The retrospective study included 103 patients with osteitis and osteomyelitis. 54 patients were treated intra-operatively with GCCI (Garamycin, EusaPharma, Europe). 49 patients were treated according to standard procedures. Light microscopy and in vitro culture techniques were applied for bacteria specific identification, and to investigate the resistance of detected microbiota to antibiotics. Patients received one dose of antibiotic pre-operatively. Post-operative antibiotic treatment was administered individually, according to clinical course and microbiological tests. The patients were followed-up on days 3, 7 and 14 after discharge for local complications; radiographic follow-up was performed 3, 6 and 12 months after surgery. Results. The course of post-operative antibiotic therapy was shorter in GCCI patients than in the control group (median 1 vs. 7 days); they also required shorter hospitalization (median 3 vs. 4 days). Implantation of GCCI significantly reduced the incidence of local complications (OR 0.30, 95%CI 0.11-0.83, p<0.0001), independently of the use of postoperative antibiotic therapy. On follow-up after 3-12 months, all patients presented with good soft tissue and bone healing. Conclusions. The results of this comparative study advocate the use of GCCI in osteomyelitis of various origin in oral and maxillofacial surgery, as they seemed to reduce the incidence of local complications, shorten antibiotic administration time and hospital stay.

  20. Pseudothrombocytopenia observed with ethylene diamine tetra acetate and citrate anticoagulants, resolved using 37°C incubation and Kanamycin.


    Kamath, Vandana; Sarda, Parimal; Chacko, Mary Purna; Sitaram, Usha


    Pseudothrombocytopenia (PTP) is defined by falsely low platelet counts on automated analyzers caused by in vitro phenomena including large platelet aggregates in blood samples. Diagnosis and resolution of PTP is crucial as it can lead to unwarranted interventions. We discuss a case of PTP in a pre-surgical setting, which was resolved using 37°C incubation and Kanamycin.

  1. Mobilization properties of small ColE1-like plasmids carrying kanamycin resistance gene isolated from Salmonella enterica serotypes

    USDA-ARS?s Scientific Manuscript database

    Background: Previously we isolated and characterized various groups of small kanamycin resistance (KanR) ColE1-like plasmids from different serotypes of Salmonella enterica isolates. These plasmids all carried the aph(3)-I gene encoding the aminoglycoside phosphotransferase responsible for the kanam...

  2. The effect of some boron derivatives on kanamycin resistance and survival of E. coli and P. aeruginosa in lake water.


    Darcan, Cihan; Kahyaoğlu, Mustafa


    To study MIC value of 7 boron derivatives namely [Boric acid (H(3)BO(3)), Anhydrous Borax (Na(2)B(4)O(7)), Sodium Borate (NaBO(2)), Diammonium Tetraborate (NH(4))(2)B(4)O(7), Sodium Perborate (NaBO(3)), Boron Trioxide (B(2)O(3)), Potassium Tetraborate (K(2)B(4)O(7))] on E. coli and P. aeruginosa and their effects on survival of bacteria in lake water and resistance against kanamycin antibiotic. MIC values of Boron derivatives and antibiotic were studied by broth microdilution method. The effect of boron derivatives on survival of bacteria in lake water were also determined with plate count. Sodium perborate was determined as the most effective substance among the studied substances. Effectiveness increased as temperature increased. E. coli was more affected from P. aeruginosa in 8 mg/mL sodium perborate concentration in lake water. Moreover, it was determined that MIC value of kanamycin antibiotic decreased 200 times by especially treating P. aeruginosa with sodium perborate in lake water. However, it can be stated that this change in resistance did not arise from microorganisms. Sodium perborate solution can be used supportedly in kanamycin antibiotic applications for P. aeruginosa. Future studies are necessary to explore the relation between sodium perborate and kanamycin which is effective on P. aeruginosa in lake water. Copyright © 2012 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

  3. In Vitro Activity of Netilmicin Compared with Gentamicin, Tobramycin, Amikacin, and Kanamycin

    PubMed Central

    Eickhoff, Theodore C.; Ehret, Josephine M.


    The in vitro activity of netilmicin was compared with that of gentamicin, tobramycin, amikacin, and kanamycin against 636 strains of bacteria recently isolated from clinical sources. Gentamicin was the most active antibiotic, but netilmicin and tobramycin closely paralleled it. Netilmicin was generally four-to eightfold less active than gentamicin against Serratia and group A streptococci, and was twofold less active against Pseudomonas aeruginosa. When effects of inoculum size and concentration of divalent cations in the media were evaluated, netilmicin was shown to be similar to gentamicin in vitro. Minimum inhibitory concentrations for P. aeruginosa were increased as much as 18-fold when the Mg2+ and Ca2+ concentrations were increased to physiological levels in Mueller-Hinton broth. PMID:879733

  4. Sulfonamide-Based Inhibitors of Aminoglycoside Acetyltransferase Eis Abolish Resistance to Kanamycin in Mycobacterium tuberculosis.


    Garzan, Atefeh; Willby, Melisa J; Green, Keith D; Gajadeera, Chathurada S; Hou, Caixia; Tsodikov, Oleg V; Posey, James E; Garneau-Tsodikova, Sylvie


    A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28-37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.

  5. Julian Davies and the discovery of kanamycin resistance transposon Tn5.


    Berg, Douglas E


    This paper recounts some of my fond memories of a collaboration between Julian Davies and myself that started in 1974 in Geneva and that led to our serendipitous discovery of the bacterial kanamycin resistance transposon Tn5, and aspects of the lasting positive impact of our interaction and discovery on me and the community. Tn5 was one of the first antibiotic resistance transposons to be found. Its analysis over the ensuing decades provided valuable insights into mechanisms and control of transposition, and led to its use as a much-valued tool in diverse areas of molecular genetics, as also will be discussed here.The Journal of Antibiotics advance online publication, 12 October 2016; doi:10.1038/ja.2016.120.

  6. Potent Inhibitors of Acetyltransferase Eis Overcome Kanamycin Resistance in Mycobacterium tuberculosis.


    Willby, Melisa J; Green, Keith D; Gajadeera, Chathurada S; Hou, Caixia; Tsodikov, Oleg V; Posey, James E; Garneau-Tsodikova, Sylvie


    A major cause of tuberculosis (TB) resistance to the aminoglycoside kanamycin (KAN) is the Mycobacterium tuberculosis (Mtb) acetyltransferase Eis. Upregulation of this enzyme is responsible for inactivation of KAN through acetylation of its amino groups. A 123 000-compound high-throughput screen (HTS) yielded several small-molecule Eis inhibitors that share an isothiazole S,S-dioxide heterocyclic core. These were investigated for their structure-activity relationships. Crystal structures of Eis in complex with two potent inhibitors show that these molecules are bound in the conformationally adaptable aminoglycoside binding site of the enzyme, thereby obstructing binding of KAN for acetylation. Importantly, we demonstrate that several Eis inhibitors, when used in combination with KAN against resistant Mtb, efficiently overcome KAN resistance. This approach paves the way toward development of novel combination therapies against aminoglycoside-resistant TB.

  7. Nestin expression and reactive phenomena in the mouse cochlea after kanamycin ototoxicity.


    Martone, Tiziana; Giordano, Pamela; Dagna, Federico; Carulli, Daniela; Albera, Roberto; Rossi, Ferdinando


    Following injury to the adult mammalian cochlea, hair cells cannot be spontaneously replaced. Nonetheless, the postnatal cochlea contains progenitor cells, distinguished by the expression of nestin, which are able to proliferate and form neurospheres in vitro. Such resident progenitors might be endowed with reparative potential. However, to date little is known about their behaviour in situ following hair cell injury. Using adult mice and ex vivo cochlear cultures, we sought to determine whether: (i) resident cochlear progenitors respond to kanamycin ototoxicity and compensate for it; and (ii) the reparative potential of cochlear progenitors can be stimulated by the addition of growth factors. Morphological changes of cochlear tissue, expression of nestin mRNA and protein and cell proliferation were investigated in these models. Our observations show that ototoxic injury has modest effects on nestin expression and cell proliferation. On the other hand, the addition of growth factors to the injured cochlear explants induced the appearance of nestin-positive cells in the supporting cell area of the organ of Corti. The vast majority of nestin-expressing cells, however, were not proliferating. Growth factors also had a robust stimulatory effect on axonal sprouting and the proliferative response, which was more pronounced in injured cochleae. On the whole, our findings indicate that nestin expression after kanamycin ototoxicity is related to tissue reactivity rather than activation of resident progenitors attempting to replace the lost receptors. In addition, administration of growth factors significantly enhances tissue remodelling, suggesting that cochlear repair may be promoted by the exogenous application of regeneration-promoting substances.

  8. Synergy of Penicillin-Netilmicin Combinations Against Enterococci Including Strains Highly Resistant to Streptomycin or Kanamycin

    PubMed Central

    Sanders, Christine C.


    The in vitro activity of combinations of penicillin and netilimicin was determined against 20 clinical isolates of enterococci and compared with that obtained in simultaneous tests with penicillin/sisomicin, penicillin/streptomycin, and penicillin/kanamycin. Synergy between the two drugs in each combination was determined by the use of quantitative kill curves and was defined as a killing by the combination at least 100-fold greater than that produced by the most effective drug alone. Penicillin/netilmicin and penicillin/sisomicin combinations were found to be synergistic against the majority of isolates tested, including strains resistant to penicillin/streptomycin or penicillin/kanamycin combinations. This synergy with penicillin could be demonstrated at a concentration of ≤7 μg/ml for either netilmicin or sisomicin. Studies on the kinetics of killing produced by these combinations showed the rate and extent of killing to be directly dependent upon the organism's relative susceptibility to the aminoglycoside alone and the aminoglycoside concentration in the combination. Results also indicated that the interaction between penicillin and netilmicin was true synergy; i.e., rapid and complete killing was produced by combinations containing each drug at concentrations insufficient to produce any killing alone, and the killing observed could not be produced by either drug alone at a concentration equivalent to the total drug concentration in the combination. The potential clinical application of this synergistic interaction should be investigated further, especially in view of recent reports showing netilmicin to be considerably less toxic than gentamicin in experimental animals. PMID:242509

  9. Molecular detection of drug resistance to ofloxacin and kanamycin in Mycobacterium tuberculosis by using multiplex allele-specific PCR.


    Kumari, Richa; Banerjee, Tuhina; Anupurba, Shampa


    Drug resistance in tuberculosis (TB) is the biggest global health challenge as it hinders the tuberculosis control program and makes the disease more worsen. Molecular methods interrupt the spread of drug resistance by facilitating the appropriate anti- tuberculosis therapy at correct time through rapid diagnosis of multi drug resistant (MDR) and extensively drug resistant tuberculosis (XDR-TB). In this study we standardized and evaluated the diagnostic utility of multiplex allele specific PCR (MAS-PCR) targeting gyrA D94G and rrs A1401G mutations for detection of resistance against two key drugs (ofloxacin and kanamycin) of second line anti tuberculosis treatment. MAS-PCR assays targeting gyrA D94G and rrs A1401G for ofloxacin (OFL) and kanamycin (KAN) resistance respectively were carried out on 150 multidrug resistant isolates of Mycobacterium tuberculosis. The results were compared with phenotypic drug susceptibility test against ofloxacin and kanamycin by using proportion method on MGIT 960. Of 150 MDR isolates 50 were resistant to both ofloxacin and kanamycin, 36 were resistant to ofloxacin only, 8 were resistant to kanamycin only and 56 were susceptible to both the drugs. MAS-PCR correctly identified gyrA D94G and rrs A1401G mutations in phenotypically resistant isolates with a specificity of 100%. The sensitivity of MAS-PCR was 88.66%, 93.55% and 86% for OFL, KAN and XDR-TB respectively. There was no mutation detected at gyrA D94G region of 12.86% (11 of 86) OFL resistant isolates while 6.89% (4 of 58) of KAN resistant isolates did not carry rrs A1401G substitution. MAS-PCR proves to be a rapid tool for detection of drug resistance which could also be used as an initial marker for screening of XDR-TB. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Targeting biofilms and persisters of ESKAPE pathogens with P14KanS, a kanamycin peptide conjugate.


    Mohamed, Mohamed F; Brezden, Anna; Mohammad, Haroon; Chmielewski, Jean; Seleem, Mohamed N


    The worldwide emergence of antibiotic resistance represents a serious medical threat. The ability of these resistant pathogens to form biofilms that are highly tolerant to antibiotics further aggravates the situation and leads to recurring infections. Thus, new therapeutic approaches that adopt novel mechanisms of action are urgently needed. To address this significant problem, we conjugated the antibiotic kanamycin with a novel antimicrobial peptide (P14LRR) to develop a kanamycin peptide conjugate (P14KanS). Antibacterial activities were evaluated in vitro and in vivo using a Caenorhabditis elegans model. Additionally, the mechanism of action, antibiofilm activity and anti-inflammatory effect of P14KanS were investigated. P14KanS exhibited potent antimicrobial activity against ESKAPE pathogens. P14KanS demonstrated a ≥128-fold improvement in MIC relative to kanamycin against kanamycin-resistant strains. Mechanistic studies confirmed that P14KanS exerts its antibacterial effect by selectively disrupting the bacterial cell membrane. Unlike many antibiotics, P14KanS demonstrated rapid bactericidal activity against stationary phases of both Gram-positive and Gram-negative pathogens. Moreover, P14KanS was superior in disrupting adherent bacterial biofilms and in killing intracellular pathogens as compared to conventional antibiotics. Furthermore, P14KanS demonstrated potent anti-inflammatory activity via the suppression of LPS-induced proinflammatory cytokines. Finally, P14KanS protected C. elegans from lethal infections of both Gram-positive and Gram-negative pathogens. The potent in vitro and in vivo activity of P14KanS warrants further investigation as a potential therapeutic agent for bacterial infections. This study demonstrates that equipping kanamycin with an antimicrobial peptide is a promising method to tackle bacterial biofilms and address bacterial resistance to aminoglycosides. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Synthesis and spectroscopic studies of the aminoglycoside (neomycin)--perylene conjugate binding to human telomeric DNA.


    Xue, Liang; Ranjan, Nihar; Arya, Dev P


    Synthesis of a novel perylene-neomycin conjugate (3) and the properties of its binding to human telomeric G-quadruplex DNA, 5'-d[AG3(T2AG3)3] (4), are reported. Various spectroscopic techniques were employed to characterize the binding of conjugate 3 to 4. A competition dialysis assay revealed that 3 preferentially binds to 4, in the presence of other nucleic acids, including DNA, RNA, DNA-RNA hybrids, and other higher-order structures (single strands, duplexes, triplexes, other G-quadruplexes, and the i-motif). UV thermal denaturation studies showed that thermal stabilization of 4 increases as a function of the increasing concentration of 3. The fluorescence intercalator displacement (FID) assay displayed a significantly tighter binding of 3 with 4 as compared to its parent constituents [220-fold stronger than neomycin (1) and 4.5-fold stronger than perylene diamine (2), respectively]. The binding of 3 with 4 resulted in pronounced changes in the molar ellipticity of the DNA absorption region as confirmed by circular dichroism. The UV-vis absorption studies of the binding of 3 to 4 resulted in a red shift in the spectrum of 3 as well as a marked hypochromic change in the perylene absorption region, suggesting that the ligand-quadruplex interaction involves stacking of the perylene moiety. Docking studies suggest that the perylene moiety serves as a bridge that end stacks on 4, making contacts with two thymine bases in the loop, while the two neomycin moieties branch into the grooves of 4.

  12. Influence of subtherapeutic levels of a combination of neomycin and oxytetracycline on Salmonella typhimurium in swine, calves, and chickens.


    Girard, A E; English, A R; Evangelisti, D G; Lynch, J E; Solomons, I A


    Subtherapeutic levels of oxytetracycline plus neomycin in animal feeds did not bring about increases in the quantity, prevalence, or shedding of Salmonella typhimurium in swine, calves, or chickens. In fact, the medication generally reduced the proportion of animals carrying S. typhimurium. The medicated groups were fed rations containing oxytetracycline plus neomycin commencing 5 days prior to oral inoculation with S. typhimurium and continuing through a 28-day postinoculation period. Colonization of S. typhimurium occurred in all three animal species, as evidenced by clinical signs of infection and/or colony counts in feces. Only from swine and on only one occasion was a single resistant colony isolated. It is concluded that no evidence has been obtained which would implicate the continuous low-level feeding of oxytetracycline and neomycin for a 4-week period to a potential increased incidence of disease in animals or as a hazard to humans.

  13. Influence of Subtherapeutic Levels of a Combination of Neomycin and Oxytetracycline on Salmonella typhimurium in Swine, Calves, and Chickens

    PubMed Central

    Girard, A. E.; English, A. R.; Evangelisti, D. G.; Lynch, J. E.; Solomons, I. A.


    Subtherapeutic levels of oxytetracycline plus neomycin in animal feeds did not bring about increases in the quantity, prevalence, or shedding of Salmonella typhimurium in swine, calves, or chickens. In fact, the medication generally reduced the proportion of animals carrying S. typhimurium. The medicated groups were fed rations containing oxytetracycline plus neomycin commencing 5 days prior to oral inoculation with S. typhimurium and continuing through a 28-day postinoculation period. Colonization of S. typhimurium occurred in all three animal species, as evidenced by clinical signs of infection and/or colony counts in feces. Only from swine and on only one occasion was a single resistant colony isolated. It is concluded that no evidence has been obtained which would implicate the continuous low-level feeding of oxytetracycline and neomycin for a 4-week period to a potential increased incidence of disease in animals or as a hazard to humans. PMID:791090

  14. Sodium Selenite Acts as an Otoprotectant against Neomycin-Induced Hair Cell Damage in a Zebrafish Model

    PubMed Central

    Chang, Jiwon; Choi, June; Rah, Yoon Chan; Yoo, Myung Hoon; Oh, Kyoung Ho; Im, Gi Jung; Lee, Seung Hoon; Kwon, Soon Young; Park, Hae-Chul; Chae, Sung Won; Jung, Hak Hyun


    Sodium selenite is a trace element essential for many physiological functions in the body. It is involved in various biological processes; it acts as a cofactor for antioxidant enzymes that protect against free radicals and is reported to limit metal-mediated oxidative DNA damage. In the present study, we investigated the effect of sodium selenite on neomycin ototoxicity in wild-type and transgenic zebrafish (Brn3C: EGFP). Five or six days post-fertilization, zebrafish larvae were co-exposed to 125 μM neomycin and various concentrations (10 μM, 100 μM, 250 μM, and 500 μM) of sodium selenite for 1 h. Hair cells within neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed by fluorescence microscopy (n = 10 fish per treatment). Hair cell survival was estimated as the ratio of the hair cell numbers in each group compared to those of the control group that were not exposed to neomycin. Apoptosis and hair cell damage of neuromasts were evaluated using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridinium iodide (DASPEI) assay, respectively. Ultrastructural changes were evaluated using scanning electron microscopy and transmission electron microscopy. Neuromast hair cells were preserved in zebrafish exposed to 125 μM neomycin and 500 μM sodium selenite for 1 h. Sodium selenite protected against neomycin-induced hair cell loss of neuromasts, reduced apoptosis, and prevented zebrafish ultrastructural changes. We propose that sodium selenite protects against neomycin-induced hair cell damage by inhibiting apoptosis, decreasing the disarray of stereocilia, and preventing ultrastructural changes in the neuromast hair cells of the zebrafish. PMID:26974429

  15. Sodium Selenite Acts as an Otoprotectant against Neomycin-Induced Hair Cell Damage in a Zebrafish Model.


    Chang, Jiwon; Choi, June; Rah, Yoon Chan; Yoo, Myung Hoon; Oh, Kyoung Ho; Im, Gi Jung; Lee, Seung Hoon; Kwon, Soon Young; Park, Hae-Chul; Chae, Sung Won; Jung, Hak Hyun


    Sodium selenite is a trace element essential for many physiological functions in the body. It is involved in various biological processes; it acts as a cofactor for antioxidant enzymes that protect against free radicals and is reported to limit metal-mediated oxidative DNA damage. In the present study, we investigated the effect of sodium selenite on neomycin ototoxicity in wild-type and transgenic zebrafish (Brn3C: EGFP). Five or six days post-fertilization, zebrafish larvae were co-exposed to 125 μM neomycin and various concentrations (10 μM, 100 μM, 250 μM, and 500 μM) of sodium selenite for 1 h. Hair cells within neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed by fluorescence microscopy (n = 10 fish per treatment). Hair cell survival was estimated as the ratio of the hair cell numbers in each group compared to those of the control group that were not exposed to neomycin. Apoptosis and hair cell damage of neuromasts were evaluated using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridinium iodide (DASPEI) assay, respectively. Ultrastructural changes were evaluated using scanning electron microscopy and transmission electron microscopy. Neuromast hair cells were preserved in zebrafish exposed to 125 μM neomycin and 500 μM sodium selenite for 1 h. Sodium selenite protected against neomycin-induced hair cell loss of neuromasts, reduced apoptosis, and prevented zebrafish ultrastructural changes. We propose that sodium selenite protects against neomycin-induced hair cell damage by inhibiting apoptosis, decreasing the disarray of stereocilia, and preventing ultrastructural changes in the neuromast hair cells of the zebrafish.

  16. Development and characterization of a transdermal patch and an emulgel containing kanamycin intended to be used in the treatment of mycetoma caused by Actinomadura madurae.


    López-Cervantes, Miriam; Escobar-Chávez, José Juan; Casas-Alancaster, Norma; Quintanar-Guerrero, David; Ganem-Quintanar, Adriana


    Mycetoma is a chronic, degenerative, and incapacitating infection of the skin and subcutaneous tissue. This study focuses on developing a kanamycin-based auxiliary system intended to be used in the treatment of mycetoma caused by Actinomadura madurae. Transdermal patches (with two different formulations: one with free kanamycin [K] and the other one with kanamycin adsorbed in silica [K-SG]) and an emulgel were developed. Both patches were prepared by the casting-evaporation technique. To characterize them, differential scanning calorimetry, bioadhesion, post-moisture detachment, strength and rupture distance, gas exchange, water uptake, and dissolution studies were carried out. The emulgel (containing 0.57% of kanamycin) was prepared from an oil-in-water emulsion, which was then incorporated to a gel. the patches with the best characteristics contained 22.9% of silica and 14.6% of kanamycin. Dissolution studies indicated that 8.8% of kanamycin released from K and 3.2% from K-SG at 24h. The emulgel containing 0.57% of kanamycin showed good technological characteristics for its application to the skin (viscosity, 44.9 +/- 1.4 poises; pH, 6.9 +/- 0.4; and penetrability, 52.7 +/- 5.1). The optimal patches were those containing 15.9% of freely dispersed kanamycin (K) and 14.6% of kanamycin adsorbed in silica (K-SG), which corresponds to the batch 2-0.8. The assessments performed to both pharmaceutical forms (patches and emulgel) show that they have the adequate technological characteristics for being used as an auxiliary in the treatment of actinomycetoma caused by A. madurae.

  17. The effects of neomycin and oxytetracycline alone or combined upon the incidence of salmonellosis in broiler chickens.


    Williams, B J


    Chickens were orally inoculated with Salmonella typhimurium and fed rations medicated with either 200 g/ton neomycin sulfate, 200 g/ton oxytetracycline, or a combination of 200 g/ton neomycin sulfate plus 200 g/ton oxytetracycline for 16 days. The incidence of salmonellosis was lower in chickens fed the combined antibiotics, and the numbers of viable S. typhimurium in feces were significantly fewer than in chickens receiving only one antibiotic. Chickens fed the combination also gained significantly more weight on less feed than those fed only one antibiotic.

  18. Growth of soil bacteria, on penicillin and neomycin, not previously exposed to these antibiotics.


    Zhang, Qichun; Dick, Warren A


    There is growing evidence that bacteria, in the natural environment (e.g. the soil), can exhibit naturally occurring resistance/degradation against synthetic antibiotics. Our aim was to assess whether soils, not previously exposed to synthetic antibiotics, contained bacterial strains that were not only antibiotic resistant, but could actually utilize the antibiotics for energy and nutrients. We isolated 19 bacteria from four diverse soils that had the capability of growing on penicillin and neomycin as sole carbon sources up to concentrations of 1000 mg L(-1). The 19 bacterial isolates represent a diverse set of species in the phyla Proteobacteria (84%) and Bacteroidetes (16%). Nine antibiotic resistant genes were detected in the four soils but some of these genes (i.e. tetM, ermB, and sulI) were not detected in the soil isolates indicating the presence of unculturable antibiotic resistant bacteria. Most isolates that could subsist on penicillin or neomycin as sole carbon sources were also resistant to the presence of these two antibiotics and six other antibiotics at concentrations of either 20 or 1000 mg L(-1). The potentially large and diverse pool of antibiotic resistant and degradation genes implies ecological and health impacts yet to be explored and fully understood. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Neomycin Topical


    ... not swallow it. Do not apply dressings, bandages, cosmetics, lotions, or other skin medications to the area ... as well as any products such as vitamins, minerals, or other dietary supplements. You should bring this ...

  20. Amikacin, kanamycin and tobramycin binding to melanin in the presence of Ca(2+) and Mg(2+) ions.


    Wrześniok, Dorota; Buszman, Ewa; Miernik-Biela, Ewa


    The aim of the presented work was to examine the interaction of amikacin, kanamycin and tobramycin with melanin in the presence of Ca(2+ )and Mg(2+) ions. It has been demonstrated that the analyzed aminoglycosides form complexes with melanin in the presence of metal ions and the amount of drugs bound to the polymer increases with increasing initial antibiotics concentration. It has been also shown that two classes of binding sites participate in the formation of amikacin, kanamycin and tobramycin complexes with melanin containing Ca(2+) or Mg(2+) ions: high affinity binding sites (n1) with the association constant K1 approximately 10(4)-10(5)M(-1) and low affinity binding sites (n2) with K2 approximately 10(3)M(-1). It has been demonstrated that calcium and magnesium significantly decrease the number of total binding sites (ntot) as compared with aminoglycoside-melanin complexes obtained in the absence of metal ions.

  1. Successful treatment of recurrent Helicobacter fennelliae bacteraemia by selective digestive decontamination with kanamycin in a lung cancer patient receiving chemotherapy

    PubMed Central

    Nagamatsu, Maki; Tomida, Junko; Kawamura, Yoshiaki; Yamamoto, Kei; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Hayakawa, Kayoko; Kanagawa, Shuzo; Mezaki, Kazuhisa; Hashimoto, Masao; Ishii, Satoru; Ohmagari, Norio


    Introduction: Helicobacter fennelliae is an enterohepatic Helicobacter species causing bacteraemia in immunocompromised hosts. Only a few cases of recurrent H. fennelliae bacteraemia have been reported in Japan and there are no guidelines regarding antimicrobial treatment for H. fennelliae infection. Case presentation: H. fennelliae bacteraemia was observed in a patient receiving platinum-based chemotherapy for lung cancer. To prevent recurrence, the patient received antibiotic therapy with cefepime, amoxicillin and doxycycline for 6 weeks, which is similar to the therapy for Helicobacter cinaedi bacteraemia. Bacteraemia recurred despite the long-term antibiotic therapy. We hypothesized that the H. fennelliae bacteraemia originated from endogenous infection in the intestinal tract due to the long-term damage of the enteric mucosa by platinum-based drugs and performed selective digestive decontamination (SDD) with kanamycin. Bacteraemia did not recur after SDD. Conclusion: Our observations indicate that clinicians should be aware of possible recurrent H. fennelliae bacteraemia, which could be effectively prevented by SDD with kanamycin. PMID:28348791

  2. A novel kanamycin/G418 resistance marker for direct selection of transformants in Escherichia coli and different yeast species.


    Agaphonov, Michael; Romanova, Nina; Choi, Eui-Sung; Ter-Avanesyan, Michael


    We have developed a set of cloning vectors possessing a modified Tn903 kanamycin resistance gene that enables the selection of both kanamycin-resistant transformants in Escherichia coli and G418-resistant transformants in the yeasts Saccharomyces cerevisiae, Hansenula polymorpha and Pichia pastoris. Expression of this gene in yeast is controlled by the H. polymorpha glyceraldehyde-3-phosphate dehydrogenase promoter, while expression in E. coli is governed by an upstream E. coli lacZ promoter. Applicability of the vectors for gene disruption in H. polymorpha and S. cerevisiae was demonstrated by inactivation of the HpMAL1 and URA3 genes, respectively. One of the vectors possesses a H. polymorpha ARS allowing plasmid maintenance in an episomal state. The small size of the vectors (2-2.5 kb) makes them convenient for routine DNA cloning. In addition, we report a novel approach for construction of gene disruption cassettes.

  3. Novel plasmid conferring kanamycin and tetracycline resistance in the turkey-derived Campylobacter jejuni strain 11601MD.


    Crespo, M D; Altermann, E; Olson, J; Miller, W G; Chandrashekhar, K; Kathariou, S


    In Campylobacter spp., resistance to the antimicrobials kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095nt) harboring tet(O) was identified in C. jejuni strain 11601MD, which was isolated from the jejunum of a turkey produced conventionally in North Carolina. Analysis of the p11601MD sequence revealed the presence of a high-GC content cassette with four genes that included tet(O) and a putative aminoglycoside transferase gene (aphA-3) highly similar to kanamycin resistance determinants. Several genes putatively involved in conjugative transfer were also identified on the plasmid. These findings will contribute to a better understanding of the distribution of potentially self-mobilizing plasmids harboring antibiotic resistance determinants in Campylobacter spp. from turkeys and other sources. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Frequency of Resistance to Kanamycin, Tobramycin, Netilmicin, and Amikacin in Gentamicin-Resistant Gram-Negative Bacteria

    PubMed Central

    Seligman, Stephen J.


    In vitro evaluation of 66 epidemiologically distinct, gentamicin-resistant, gram-negative isolates from four hospitals revealed that 92% were kanamycin resistant, 44% were netilmicin resistant, 41% were tobramycin resistant, and 6% were amikacin resistant. Combined resistance to gentamicin, tobramycin, and netilmicin occurred in 30% of the strains. Although the resistance percentage to amikacin was the lowest of the three newer agents, two strains were resistant to all of the aminoglycosides tested. PMID:626492

  5. Development of plasmid cloning vectors for Thermus thermophilus HB8: Expression of a heterologous, plasmid-borne kanamycin nucleotidyltransferase gene

    SciTech Connect

    Mather, M.W.; Fee, J.A. )


    While several thermus genes have been cloned and T. thermophilus has been shown to be transformable, molecular genetic studies of these thermophiles have been hampered by the absence of selectable cloning vectors. The authors have constructed a selectable plasmid by random insertion of a heterologous gene encoding a thermostable kanamycin nucleotidyltransferase activity into a cryptic, multicopy plasmid from T. thermophilus HB8. This plasmid should serve as a suitable starting point for the development of a gene expression system for T. thermophilus.

  6. The Effect of Kanamycin and Tetracycline on Growth and Photosynthetic Activity of Two Chlorophyte Algae.


    Bashir, Khawaja Muhammad Imran; Cho, Man-Gi


    Antibiotics are routinely used in microalgae culture screening, stock culture maintenance, and genetic transformation. By studying the effect of antibiotics on microalgae growth, we can estimate the least value to inhibit growth of undesired pathogens in algal culture. We studied the effect of kanamycin and tetracycline on the growth and photosynthetic activity of two chlorophyte microalgae, Dictyosphaerium pulchellum and Micractinium pusillum. We measured CFU mL(-1) on agar plates, optical density, fluorescence yields, and photosynthetic inhibition. Our results showed a significant effect of kan and tet on the tested microalgae species except tet, which showed a minor effect on M. pusillum. Both antibiotics are believed to interact with the protein synthesis machinery; hence, the inhibitory effect of the tested antibiotics was further confirmed by isolation and quantification of the whole cell protein. A significant reduction in protein quantity was observed at concentrations more than 5 mg L(-1), except M. pusillum, which showed only a slight reduction in protein quantity even at the maximum tested concentration of tet (30 mg L(-1)). This study can further aid in aquaculture industry, for the maintenance of the microalgae stock cultures and it can also help the microalgae genetic engineers in the construction of molecular markers.

  7. Systemic lipopolysaccharide induces cochlear inflammation and exacerbates the synergistic ototoxicity of kanamycin and furosemide.


    Hirose, Keiko; Li, Song-Zhe; Ohlemiller, Kevin K; Ransohoff, Richard M


    Aminoglycoside antibiotics are highly effective agents against gram-negative bacterial infections, but they cause adverse effects on hearing and balance dysfunction as a result of toxicity to hair cells of the cochlea and vestibular organs. While ototoxicity has been comprehensively studied, the contributions of the immune system, which controls the host response to infection, have not been studied in antibiotic ototoxicity. Recently, it has been shown that an inflammatory response is induced by hair cell injury. In this study, we found that lipopolysaccharide (LPS), an important component of bacterial endotoxin, when given in combination with kanamycin and furosemide, augmented the inflammatory response to hair cell injury and exacerbated hearing loss and hair cell injury. LPS injected into the peritoneum of experimental mice induced a brisk cochlear inflammatory response with recruitment of mononuclear phagocytes into the spiral ligament, even in the absence of ototoxic agents. While LPS alone did not affect hearing, animals that received LPS prior to ototoxic agents had worse hearing loss compared to those that did not receive LPS pretreatment. The poorer hearing outcome in LPS-treated mice did not correlate to changes in endocochlear potential. However, LPS-treated mice demonstrated an increased number of CCR2(+) inflammatory monocytes in the inner ear when compared with mice treated with ototoxic agents alone. We conclude that LPS and its associated inflammatory response are harmful to the inner ear when coupled with ototoxic medications and that the immune system may contribute to the final hearing outcome in subjects treated with ototoxic agents.

  8. Subinhibitory concentration of kanamycin induces the Pseudomonas aeruginosa type VI secretion system.


    Jones, Cerith; Allsopp, Luke; Horlick, Jack; Kulasekara, Hemantha; Filloux, Alain


    Pseudomonas aeruginosa is a Gram-negative bacterium found in natural environments including plants, soils and warm moist surfaces. This organism is also in the top ten of nosocomial pathogens, and prevalent in cystic fibrosis (CF) lung infections. The ability of P. aeruginosa to colonize a wide variety of environments in a lasting manner is associated with the formation of a resistant biofilm and the capacity to efficiently outcompete other microorganisms. Here we demonstrate that sub-inhibitory concentration of kanamycin not only induces biofilm formation but also induces expression of the type VI secretion genes in the H1-T6SS cluster. The H1-T6SS is known for its role in toxin production and bacterial competition. We show that the antibiotic induction of the H1-T6SS only occurs when a functional Gac/Rsm pathway is present. These observations may contribute to understand how P. aeruginosa responds to antibiotic producing competitors. It also suggests that improper antibiotic therapy may enhance P. aeruginosa colonization, including in the airways of CF patients.

  9. Subinhibitory Concentration of Kanamycin Induces the Pseudomonas aeruginosa type VI Secretion System

    PubMed Central

    Jones, Cerith; Allsopp, Luke; Horlick, Jack; Kulasekara, Hemantha; Filloux, Alain


    Pseudomonas aeruginosa is a Gram-negative bacterium found in natural environments including plants, soils and warm moist surfaces. This organism is also in the top ten of nosocomial pathogens, and prevalent in cystic fibrosis (CF) lung infections. The ability of P. aeruginosa to colonize a wide variety of environments in a lasting manner is associated with the formation of a resistant biofilm and the capacity to efficiently outcompete other microorganisms. Here we demonstrate that sub-inhibitory concentration of kanamycin not only induces biofilm formation but also induces expression of the type VI secretion genes in the H1-T6SS cluster. The H1-T6SS is known for its role in toxin production and bacterial competition. We show that the antibiotic induction of the H1-T6SS only occurs when a functional Gac/Rsm pathway is present. These observations may contribute to understand how P. aeruginosa responds to antibiotic producing competitors. It also suggests that improper antibiotic therapy may enhance P. aeruginosa colonization, including in the airways of CF patients. PMID:24260549

  10. M. tuberculosis ferritin (Rv3841): Potential involvement in Amikacin (AK) & Kanamycin (KM) resistance.


    Sharma, Divakar; Lata, Manju; Faheem, Mohammad; Khan, Asad Ullah; Joshi, Beenu; Venkatesan, Krishnamurthy; Shukla, Sangeeta; Bisht, Deepa


    Tuberculosis is an infectious disease, caused by one of the most successful human pathogen, Mycobacterium tuberculosis. Aminoglycosides, Amikacin (AK) & Kanamycin (KM) are commonly used to treat drug resistant tuberculosis. They target the protein synthesis machinery by interacting with several steps of translation. Several explanations have been proposed to explain the mechanism of aminoglycoside resistance but still our information is inadequate. Iron storing/interacting proteins were found to be overexpressed in aminoglycosides resistant isolates. Iron assimilation and utilization in M. tuberculosis plays a crucial role in growth, virulence and latency. To establish the relationship of ferritin with AK & KM resistance ferritin (Rv3841/bfrB) was cloned, expressed and antimicrobial drug susceptibility testing (DST) was carried out. Rv3841/bfrB gene was cloned and expressed in E. coli BL21 using pQE2 expression vector. Etest results for DST against AK & KM showed that the minimum inhibitory concentration (MIC) of ferritin recombinant cells was changed. Recombinants showed two fold changes in MIC with AK and three fold with KM E-strips. Overexpression of ferritin reflect the MIC shift which might be playing a critical role in the survival of mycobacteria by inhibiting/modulating the effects of AK & KM. String analysis also suggests that ferritin interacted with few proteins which are directly and indirectly involved in M. tuberculosis growth, Iron assimilation, virulence, resistance, stresses and latency.

  11. Prevalence of ColE1-like plasmids and kanamycin resistance genes in Salmonella enterica serovars.


    Chen, Chin-Yi; Lindsey, Rebecca L; Strobaugh, Terence P; Frye, Jonathan G; Meinersmann, Richard J


    Multi-antimicrobial-resistant Salmonella enterica strains frequently carry resistance genes on plasmids. Recent studies focus heavily on large conjugative plasmids, and the role that small plasmids play in resistance gene transfer is largely unknown. To expand our previous studies in assessing the prevalence of the isolates harboring ColE1-like plasmids carrying the aph gene responsible for kanamycin resistance (Kan(r)) phenotypes, 102 Kan(r) Salmonella isolates collected through the National Antimicrobial Resistance Monitoring System (NARMS) in 2005 were screened by PCR using ColE1 primer sets. Thirty isolates were found to be positive for ColE1-like replicon. Plasmids from 23 isolates were able to propagate in Escherichia coli and were subjected to further characterization. Restriction mapping revealed three major plasmid groups found in three or more isolates, with each group consisting of two to three subtypes. The aph genes from the Kan(r) Salmonella isolates were amplified by PCR, sequenced, and showed four different aph(3')-I genes. The distribution of the ColE1 plasmid groups in association with the aph gene, Salmonella serovar, and isolate source demonstrated a strong linkage of the plasmid with S. enterica serovar Typhimurium DT104. Due to their high copy number and mobility, the ColE1-like plasmids may play a critical role in transmission of antibiotic resistance genes among enteric pathogens, and these findings warrant a close monitoring of this plasmid incompatibility group.

  12. Optimization of Medium Composition for the Production of Neomycin by Streptomyces fradiae NCIM 2418 in Solid State Fermentation

    PubMed Central

    Vastrad, B. M.; Neelagund, S. E.


    Neomycin production of Streptomyces fradiae NCIM 2418 was optimized by using response surface methodology (RSM), which is powerful mathematical approach comprehensively applied in the optimization of solid state fermentation processes. In the first step of optimization, with Placket-Burman design, ammonium chloride, sodium nitrate, L-histidine, and ammonium nitrate were established to be the crucial nutritional factors affecting neomycin production significantly. In the second step, a 24 full factorial central composite design and RSM were applied to determine the optimal concentration of significant variable. A second-order polynomial was determined by the multiple regression analysis of the experimental data. The optimum values for the important nutrients for the maximum were obtained as follows: ammonium chloride 2.00%, sodium nitrate 1.50%, L-histidine 0.250%, and ammonium nitrate 0.250% with a predicted value of maximum neomycin production of 20,000 g kg−1 dry coconut oil cake. Under the optimal condition, the practical neomycin production was 19,642 g kg−1 dry coconut oil cake. The determination coefficient (R2) was 0.9232, which ensures an acceptable admissibility of the model. PMID:25009746

  13. Optimization of Medium Composition for the Production of Neomycin by Streptomyces fradiae NCIM 2418 in Solid State Fermentation.


    Vastrad, B M; Neelagund, S E


    Neomycin production of Streptomyces fradiae NCIM 2418 was optimized by using response surface methodology (RSM), which is powerful mathematical approach comprehensively applied in the optimization of solid state fermentation processes. In the first step of optimization, with Placket-Burman design, ammonium chloride, sodium nitrate, L-histidine, and ammonium nitrate were established to be the crucial nutritional factors affecting neomycin production significantly. In the second step, a 2(4) full factorial central composite design and RSM were applied to determine the optimal concentration of significant variable. A second-order polynomial was determined by the multiple regression analysis of the experimental data. The optimum values for the important nutrients for the maximum were obtained as follows: ammonium chloride 2.00%, sodium nitrate 1.50%, L-histidine 0.250%, and ammonium nitrate 0.250% with a predicted value of maximum neomycin production of 20,000 g kg(-1) dry coconut oil cake. Under the optimal condition, the practical neomycin production was 19,642 g kg(-1) dry coconut oil cake. The determination coefficient (R (2)) was 0.9232, which ensures an acceptable admissibility of the model.

  14. Fecal excretion pattern of bile acids in rats fed high fat diets and neomycin in induced colon tumorigenesis.


    Panda, S K; Broitman, S A


    Neomycin augments colon tumorigenesis in 1,2 - dimethylhydrazine treated rats fed polyunsaturated fat diet and decreases fecal cholic acid excretion, while it inhibits tumorigenesis with increased cholic acid and decreased deoxycholic acid excretions in rats fed high cholesterol diet. Participation of other fecal bile acids seems to be insignificant in relation to colon carcinogenesis.

  15. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2012 CFR


    ..., tetracaine hydrochloride, and myristyl-gamma-picolinium chloride, topical powder. 524.1484b Section 524.1484b... Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium chloride... hydrochloride and .2 milligram of myristyl-gamma-picolinium chloride in each gram of the product in a...

  16. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2013 CFR


    ..., tetracaine hydrochloride, and myristyl-gamma-picolinium chloride, topical powder. 524.1484b Section 524.1484b... Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium chloride... hydrochloride and .2 milligram of myristyl-gamma-picolinium chloride in each gram of the product in a...

  17. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2011 CFR


    ..., tetracaine hydrochloride, and myristyl-gamma-picolinium chloride, topical powder. 524.1484b Section 524.1484b... Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium chloride... hydrochloride and .2 milligram of myristyl-gamma-picolinium chloride in each gram of the product in a...

  18. Novel neomycin sulfate-loaded hydrogel dressing with enhanced physical dressing properties and wound-curing effect.


    Choi, Jong Seo; Kim, Dong Wuk; Kim, Dong Shik; Kim, Jong Oh; Yong, Chul Soon; Cho, Kwan Hyung; Youn, Yu Seok; Jin, Sung Giu; Choi, Han-Gon


    To develop a novel neomycin sulfate-loaded hydrogel dressing (HD), numerous neomycin sulfate-loaded HDs were prepared with various amounts of polyvinyl alcohol (PVA), polyvinyl pyrrolidone (PVP) and sodium alginate (SA) using freeze-thawing technique, and their physical dressing properties, drug release, in vivo wound curing and histopathology in diabetic-induced rats were assessed. SA had a positive effect on a swelling capacity, but a negative effect on the physical dressing properties and drug release of HD. However, PVP did the opposite. In particular, the neomycin sulfate-loaded HD composed of drug, PVA, PVP and SA at the weight ratio of 1/10/0.8/0.8 had excellent swelling and bioadhesive capacity, good elasticity and fast drug release. Moreover, this HD gave more improved wound curing effect compared to the commercial product, ensured the disappearance of granulation tissue and recovered the wound tissue to normal. Therefore, this novel neomycin sulfate-loaded HD could be an effective pharmaceutical product for the treatment of wounds.

  19. Amikacin in Newborn Infants: Comparative Pharmacology with Kanamycin and Clinical Efficacy in 45 Neonates with Bacterial Diseases

    PubMed Central

    Howard, Jorge B.; McCracken, George H.; Trujillo, Hugo; Mohs, Edgar


    The pharmacokinetic properties of amikacin (BBK8) were similar to those of kanamycin in newborn infants. Peak serum concentrations of both drugs were in the range of 15 to 25 μg/ml with the exception of kanamycin in babies weighing greater than 2,000 g at birth where peak levels were 12.5 to 15 μg/ml. Volumes of distribution, plasma clearances, and serum half-life values were comparable for the two drugs. The clinical and bacteriological responses to amikacin therapy were assessed in 45 neonates with bacterial diseases. A case fatality rate of 26% was observed in infants with septicemia and/or meningitis, whereas no deaths occurred among 22 infants with urinary tract and mucocutaneous infections. Cultures from infected sites were sterile within 72 h of initiating amikacin therapy in 47% of the infants, continued positive for greater than 72 h in 31%, and were not reevaluated during therapy in 22%. The clinical response was judged to be satisfactory in 92% of the surviving infants. The efficacy of amikacin was comparable to that of kanamycin or gentamicin in neonatal bacterial diseases. PMID:984762

  20. Production of monoclonal antibody and development of enzyme-linked immunosorbent assay for kanamycin in biological matrices.


    Watanabe, H; Satake, A; Kido, Y; Tsuji, A


    Monoclonal antibodies (MAbs) against kanamycin were prepared by using a kanamycin-bovine gamma-globulin conjugate for the immunization of mice. Splenocytes from BALB/c immunized mice were fused with P3X63Ag8U.1 myeloma cells. This resulted in two hybridoma cell lines. Fifty per cent inhibition concentrations (IC50) for the MAbs were 2 and 5 ng ml-1. One MAb (IC50 = 2 ng ml-1) was named #22 and was used to develop quantitative assays for kanamycin by means of an enzyme-linked immunosorbent assay (ELISA). The detection limit was 0.2 ng ml-1 and the standard deviations were 0.2-4.4% for intra-assay and 0.6-4.7% for inter-assay, respectively. The detection limits using peroxidase were 4 ppb in cattle milk, cattle plasma, cattle urine, swine plasma, swine urine and chicken plasma. Using the MAb #22 produced, a rapid test kit based on an immunochromatographic method was developed. The detection limits using the kit were 50 ppb in cattle milk, cattle plasma, cattle urine and chicken plasma.

  1. Infrared Spectroscopy Coupled with a Dispersion Model for Quantifying the Real-Time Dynamics of Kanamycin Resistance in Artificial Microbiota.


    Jin, Naifu; Paraskevaidi, Maria; Semple, Kirk T; Martin, Francis L; Zhang, Dayi


    Overusage of antibiotics leads to the widespread induction of antibiotic-resistance genes (ARGs). Developing an approach to allow real-time monitoring and fast prediction of ARGs dynamics in clinical or environmental samples has become an urgent matter. Vibrational spectroscopy is potentially an ideal technique toward the characterization of the microbial composition of microbiota as it is nondestructive, high-throughput, and label-free. Herein, we employed attenuated total reflection Fourier transform infrared (ATR-FT-IR) spectroscopy and developed a spectrochemical tool to quantify the static and dynamic composition of kanamycin resistance in artificial microbiota to evaluate microbial antibiotic resistance. Second-order differentiation was introduced in identifying the spectral biomarkers, and principal component analysis followed by linear discriminant analysis (PCA-LDA) was used for the multivariate analysis of the entire spectral features employed. The calculated results of the mathematical dispersion model coupled with PCA-LDA showed high similarity to the designed microbiota structure, with no significant difference (P > 0.05) in the static treatments. Moreover, our model successfully predicted the dynamics of kanamycin resistance within artificial microbiota under kanamycin pressures. This work lends new insights into the potential role of spectrochemical analyses in investigating the existence and trends of antibiotic resistance in microbiota.

  2. Physicochemical and microbiological properties as well as stability of ointments containing aloe extract (Aloe arborescens Mill.) or aloe extract associated to neomycin sulphate.


    Kodym, A; Bujak, T


    The aim of the study was to work out methods of quality assessment of ointments containing dry extract from fresh leaves of Aloe arborescens Mill. (Lilliaceae) and also of ointments containing both of dry extract and neomycin sulphate. The stability of the ointments, stored at 20 degrees C, was studied and the following criteria were considered: chromatographic analysis (TLC), pH of the ointments, the content of the substances in the dry extract converted to aloenin, the content of aloenin and aloin, anti-microbial activity of neomycin in the ointments, the size of the particles of the dry extract and of neomycin sulphate in the ointment suspension and the sterility of the ointments. After two years of storage at 20 degrees C, the ointments prepared with the anhydrous lipophilic base, did not change their physicochemical characteristics and neomycin in those ointments retained almost 100% of starting anti-microbial activity. Water or propylene glycol significantly decreased the stability of the biologically active substances of the dry extract in the ointments. Besides, in the ointments containing the dry extract and neomycin sulphate, the presence of water or propylene glycol induced degradation of the biologically active substances of the dry extract and a decrease in the anti-microbial activity of neomycin in the ointments. Considering the physicochemical and microbiological stability, the most advisable base for the ointments with aloe and neomycin sulphate was composed of white vaseline, liquid paraffin, solid paraffin, cholesterol.

  3. Effects of neomycin on high-threshold Ca(2+) currents and tetrodotoxin-resistant Na(+) currents in rat dorsal root ganglion neuron.


    Zhou, Yu; Zhao, Zhi-Qi


    High-threshold Ca(2+) channels and tetrodotoxin-resistant Na(+) channels are highly expressed in small dorsal root ganglion neurons. In acutely isolated rat dorsal root ganglion neurons, the effects of neomycin, one of the aminoglycoside antibiotics, on high-threshold Ca(2+) currents and tetrodotoxin-resistant Na(+) currents were examined using whole-cell patch recording. We showed for the first time that neomycin dose-dependently inhibited peak high-threshold Ca(2+) currents and peak tetrodotoxin-resistant Na(+) currents with half-maximal inhibitory concentrations at 3.69 microM (n=20) and 1213.44 microM (n=25), respectively. Inactivation properties of high-threshold Ca(2+) currents and activation properties of tetrodotoxin-resistant Na(+) currents were also affected by neomycin with reduction of excitability of small dorsal root ganglion neurons. Half-maximal inactivation voltage of high-threshold Ca(2+) currents was -45.56 mV before and -50.46 mV after application of neomycin (n=10). Half-maximal activation voltage of tetrodotoxin-resistant Na(+) currents was -19.93 mV before and -11.19 mV after administration of neomycin (n=15). These results suggest that neomycin can inhibit high-threshold Ca(2+) currents and tetrodotoxin-resistant Na(+) currents in small dorsal root ganglion neurons, which may contribute to neomycin-induced peripheral and central analgesia.

  4. Protective role of L-ascorbic acid, N-acetylcysteine and apocynin on neomycin-induced hair cell loss in zebrafish.


    Wu, Chia-Yen; Lee, Han-Jung; Liu, Chi-Fang; Korivi, Mallikarjuna; Chen, Hwei-Hsien; Chan, Ming-Huan


    Hair cells are highly sensitive to environmental insults and other therapeutic drugs. The adverse effects of drugs such as aminoglycosides can cause hair cell death and lead to hearing loss and imbalance. The objective of the present study was to evaluate the protective activity of L-ascorbic acid, N-acetylcysteine (NAC) and apocynin on neomycin-induced hair cell damage in zebrafish (Danio rerio) larvae at 5 days post fertilization (dpf). Results showed that the loss of hair cells within the neuromasts of the lateral lines after neomycin exposure was evidenced by a significantly lower number of neuromasts labeled with fluorescent dye FM1-43FX observed under a microscope. Co-administration with L-ascorbic acid, NAC and apocynin protected neomycin-induced hair cell loss within the neuromasts. Moreover, these three compounds reduced the production of reactive oxygen species (ROS) in neuromasts exposed to neomycin, indicating that their antioxidant action is involved. In contrast, the neuromasts were labeled with specific fluorescent dye Texas-red conjugated with neomycin to detect neomycin uptake. Interestingly, the uptake of neomycin into hair cells was not influenced by these three antioxidant compounds. These data imply that prevention of hair cell damage against neomycin by L-ascorbic acid, NAC and apocynin might be associated with inhibition of excessive ROS production, but not related to modulating neomycin uptake. Our findings conclude that L-ascorbic acid, NAC and apocynin could be used as therapeutic drugs to protect aminoglycoside-induced listening impairment after further confirmatory studies.

  5. Stable production of mutant mice from double gene converted ES cells with puromycin and neomycin.


    Watanabe, S; Kai, N; Yasuda, M; Kohmura, N; Sanbo, M; Mishina, M; Yagi, T


    The antibiotic puromycin is an effective inhibitor of protein synthesis and puromycin N-acetyl transferase gene could be used as a dominant selection marker. We report the effective production of mutant mice from double gene-converted ES cells by selection with G418 and puromycin. We confirmed that (i) puromycin efficiently inhibited the growth of ES cells at a low-dose (0.1 microgram/ml) and for a short time (2 days), independent of G418 selection; (ii) when these selected ES cells were injected into eight-cell stage embryos, the cells produced chimeras with high levels of chimerism; (iii) these chimeric males were fertile and exclusively yielded ES cell-derived offspring; and (iv) each offspring contained both neomycin transferase and puromycin N-acetyl transferase genes.

  6. Ototoxic destruction by co-administration of kanamycin and ethacrynic acid in rats.


    Liu, Hong; Ding, Da-lian; Jiang, Hai-yan; Wu, Xue-wen; Salvi, Richard; Sun, Hong


    It is well known that ethacrynic acid (EA) can potentiate the ototoxicity of aminoglycoside antibiotics (AmAn) such as kanamycin (KM), if they were applied at the same time. Currently, to create the model of EA-KM-induced cochlear lesion in rats, adult rats received a single injection of EA (75 mg/kg, intravenous injection), or followed immediately by KM (500 mg/kg, intramuscular injection). The hearing function was assessed by auditory brainstem response (ABR) measurement in response to click and/or tone bursts at 4, 8, 12, 16, 20, 24, and 32 kHz. The static microcirculation status in the stria vascularis after a single EA injection was evaluated with eosin staining. The pathological changes in cochlear and vestibular hair cells were also quantified after co-administration of EA and KM. After a single EA injection, blood flow in vessels supplying the stria vascularis rapidly diminished. However, the blood supply to the cochlear lateral wall partially recovered 5 h after EA treatment. Threshold changes in ABR were basically parallel to the microcirculation changes in stria vascularis after single EA treatment. Importantly, disposable co-administration of EA and KM resulted in a permanent hearing loss and severe damage to the cochlear hair cells, but spared the vestibular hair cells. Since the cochlear lateral wall is the important part of the blood-cochlea barrier, EA-induced anoxic damage to the epithelium of stria vascularis may enhance the entry of KM to the cochlea. Thus, experimental animal model of selective cochlear damage with normal vestibular systems can be reliably created through co-administration of EA and KM.

  7. Ototoxic destruction by co-administration of kanamycin and ethacrynic acid in rats*

    PubMed Central

    Liu, Hong; Ding, Da-lian; Jiang, Hai-yan; Wu, Xue-wen; Salvi, Richard; Sun, Hong


    It is well known that ethacrynic acid (EA) can potentiate the ototoxicity of aminoglycoside antibiotics (AmAn) such as kanamycin (KM), if they were applied at the same time. Currently, to create the model of EA-KM-induced cochlear lesion in rats, adult rats received a single injection of EA (75 mg/kg, intravenous injection), or followed immediately by KM (500 mg/kg, intramuscular injection). The hearing function was assessed by auditory brainstem response (ABR) measurement in response to click and/or tone bursts at 4, 8, 12, 16, 20, 24, and 32 kHz. The static microcirculation status in the stria vascularis after a single EA injection was evaluated with eosin staining. The pathological changes in cochlear and vestibular hair cells were also quantified after co-administration of EA and KM. After a single EA injection, blood flow in vessels supplying the stria vascularis rapidly diminished. However, the blood supply to the cochlear lateral wall partially recovered 5 h after EA treatment. Threshold changes in ABR were basically parallel to the microcirculation changes in stria vascularis after single EA treatment. Importantly, disposable co-administration of EA and KM resulted in a permanent hearing loss and severe damage to the cochlear hair cells, but spared the vestibular hair cells. Since the cochlear lateral wall is the important part of the blood-cochlea barrier, EA-induced anoxic damage to the epithelium of stria vascularis may enhance the entry of KM to the cochlea. Thus, experimental animal model of selective cochlear damage with normal vestibular systems can be reliably created through co-administration of EA and KM. PMID:21960349

  8. Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis.


    Maus, Courtney E; Plikaytis, Bonnie B; Shinnick, Thomas M


    Capreomycin, kanamycin, amikacin, and viomycin are drugs that are used to treat multidrug-resistant tuberculosis. Each inhibits translation, and cross-resistance to them is a concern during therapy. A recent study revealed that mutation of the tlyA gene, encoding a putative rRNA methyltransferase, confers capreomycin and viomycin resistance in Mycobacterium tuberculosis bacteria. Mutations in the 16S rRNA gene (rrs) have been associated with resistance to each of the drugs; however, reports of cross-resistance to the drugs have been variable. We investigated the role of rrs mutations in capreomycin resistance and examined the molecular basis of cross-resistance to the four drugs in M. tuberculosis laboratory-generated mutants and clinical isolates. Spontaneous mutants were generated to the drugs singularly and in combination by plating on medium containing one or two drugs. The frequencies of recovery of the mutants on single- and dual-drug plates were consistent with single-step mutations. The rrs genes of all mutants were sequenced, and the tlyA genes were sequenced for mutants selected on capreomycin, viomycin, or both; MICs of all four drugs were determined. Three rrs mutations (A1401G, C1402T, and G1484T) were found, and each was associated with a particular cross-resistance pattern. Similar mutations and cross-resistance patterns were found in drug-resistant clinical isolates. Overall, the data implicate rrs mutations as a molecular basis for resistance to each of the four drugs. Furthermore, the genotypic and phenotypic differences seen in the development of cross-resistance when M. tuberculosis bacteria were exposed to one or two drugs have implications for selection of treatment regimens.

  9. Technology of eye drops containing aloe (Aloe arborescens Mill.--Liliaceae) and eye drops containing both aloe and neomycin sulphate.


    Kodym, A; Marcinkowski, A; Kukuła, H


    Eye drops made of aloe are a sterile, aqueous extract of fresh leaves of Aloe arborescens Mill., containing necessary additives and neomycin sulphate. The aim of the studies was to establish the technology of eye drops containing biologically active aloe substances and those containing both chemical constituents of aloe and neomycin sulphate. Within the studies, the formulary content and the way of preparing eye drops were determined, criteria were defined and methods of qualitative assessment of drops were proposed. On the basis of the proposed analytical methods, the physicochemical and microbiological stability of the eye drops stored at a temperature of 20-25 degrees C was studied. As the criteria of qualitative assessment of the eye drops, the following analyses were considered: sterility, appearance of the eye drops (clarity), pH, osmotic pressure, density, viscosity, TLC analysis, content of aloenin and aloin, studies of anti-microbial activity of neomycin in the drops, and preservative efficiency of thiomersal in the eye drops. The studies showed that the additives such as: sodium chloride, benzalkonium chloride, chlorhexidine diacetate and digluconate, phenylmercuric borate and Nipagins M and P could not be used to prepare the eye drops because they were involved in pharmaceutical interactions with chemical constituents of aloe in the eye drops. The eye drops containing: aqueous extract of fresh leaves of aloe, boric acid, thiomersal, sodium pyrosulphite, disodium EDTA, beta-phenylethyl alcohol and neomycin sulphate, both freshly prepared and after two years of storage, met the requirements of the Polish Pharmacopoeia (PPh V) mentioned in the monograph Guttae ophthalmicae. They were sterile, clear, their osmotic pressure approximated the osmotic pressure of lacrimal fluid and they were characterized by appropriate pH. Aloenin in the drops was much more stable than aloin. Neomycin after two years of storage retained almost 98% of its starting antimicrobial

  10. Combined administration of kanamycin and furosemide does not result in loss of vestibular function in Guinea pigs.


    Bremer, Hendrik G; de Groot, John C M J; Versnel, Huib; Klis, Sjaak F L


    Aminoglycoside antibiotics are known to damage the vestibular and auditory sensory epithelia. Although loop diuretics enhance the cochleotoxic effect of aminoglycosides, it is not known whether concomitant administration of an aminoglycoside and a loop diuretic affects the vestibular system. The aim of our study was to investigate the effect of co-administration of kanamycin and furosemide upon the otolith organs and to compare it to the known vestibulotoxic effect of gentamicin. Five guinea pigs were injected with a single dose of both kanamycin (400 mg/kg, s.c.) and furosemide (100 mg/kg, i.v.), 5 animals received gentamicin (100 mg/kg, i.p.) for 10 days, and 5 untreated animals served as controls. After 7 days, vestibular function was assessed by measuring vestibular short-latency evoked potentials (VsEPs) to linear acceleration stimuli and cochlear function by auditory brainstem responses (ABRs) to clicks. Hair cell densities were determined in phalloidin-stained whole mounts of the utricles and saccules, and in midmodiolar sections of resin-embedded cochleae. Co-administration of kanamycin and furosemide had no significant effect on VsEPs and hair cell densities in the utricles and saccules were not reduced. ABR thresholds were increased to a great extent (by ∼60 dB), and histologically a severe loss of cochlear hair cells was observed. The effect of gentamicin, both on vestibular and cochlear function, was just the opposite. VsEP thresholds to horizontal stimulation were elevated and suprathreshold amplitudes showed a decrease, whereas cochlear function was not reduced. With this protocol, we have a tool to selectively induce cochlear or vestibular damage, which may be of interest to researchers and clinicians alike.

  11. Diagnosis of Drug Resistance to Fluoroquinolones, Amikacin, Capreomycin, Kanamycin and Ethambutol with Genotype MTBDRsl Assay: a Meta-Analysis.


    Mao, Xiaolu; Ke, Zunqiong; Shi, Xiaoyan; Liu, Shuiyi; Tang, Beibei; Wang, Jin; Huang, Hao


    The Genotype MTBDRsl is a new-generation PCR-based line-probe assay for rapid identification of the resistance to the second-line antituberculosis drugs with a single strip. The aim of this meta-analysis was to evaluate the performance of Genotype MTBDRsl in detecting drug resistance to fluoroquinolones, amikacin, capreomycin, kanamycin and ethambutol in comparison with the phenotypic drug susceptibility test. We searched Pubmed, Embase and the Cochrane Library and calculated the sensitivity, the specificity, the positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR), corresponding 95% confidence interval (CI), and the area under the summary receiver operating characteristic (SROC) curves (AUC), and tested heterogeneity in accuracy estimates with the Spearman correlation coefficient and Chi-square. The summarized sensitivity (95% CI), specificity (95% CI), and AUC (standard error) were 0.869 (0.847-0.890), 0.973 (0.965-0.979) and 0.9690 (0.0188) for fluoroquinolones, 0.868 (0.829-0.900), 0.998 (0.994-0.999) and 0.9944 (0.0050) for amikacin, 0.879 (0.838-0.914), 0.970 (0.958-0.978) and 0.9791 (0.0120) for capreomycin, 0.501 (0.461-0.541), 0.991 (0.983-0.996) and 0.9814 (0.0114) for kanamycin and 0.686 (0.663-0.709), 0.871 (0.852-0.888) and 0.7349 (0.0639) for ethambutol, respectively. The genotype MTBDRsl demonstrate excellent accuracy for detecting drug resistance to fluoroquinolones, amikacin, and capreomycin, but it may not be an appropriate choice for detection of kanamycin and ethambutol. © 2015 by the Association of Clinical Scientists, Inc.

  12. Synergy with rifampin and kanamycin enhances potency, kill kinetics, and selectivity of de novo-designed antimicrobial peptides.


    Anantharaman, Aparna; Rizvi, Meryam Sardar; Sahal, Dinkar


    By choosing membranes as targets of action, antibacterial peptides offer the promise of providing antibiotics to which bacteria would not become resistant. However, there is a need to increase their potency against bacteria along with achieving a reduction in toxicity to host cells. Here, we report that three de novo-designed antibacterial peptides (DeltaFm, DeltaFmscr, and Ud) with poor to moderate antibacterial potencies and kill kinetics improved significantly in all of these aspects when synergized with rifampin and kanamycin against Escherichia coli. (DeltaFm and DeltaFmscr [a scrambled-sequence version of DeltaFm] are isomeric, monomeric decapeptides containing the nonproteinogenic amino acid alpha,beta-didehydrophenylalanine [DeltaF] in their sequences. Ud is a lysine-branched dimeric peptide containing the helicogenic amino acid alpha-aminoisobutyric acid [Aib].) In synergy with rifampin, the MIC of DeltaFmscr showed a 34-fold decrease (67.9 microg/ml alone, compared to 2 microg/ml in combination). A 20-fold improvement in the minimum bactericidal concentration of Ud was observed when the peptide was used in combination with rifampin (369.9 microg/ml alone, compared to 18.5 microg/ml in combination). Synergy with kanamycin resulted in an enhancement in kill kinetics for DeltaFmscr (no killing until 60 min for DeltaFmscr alone, versus 50% and 90% killing within 20 min and 60 min, respectively, in combination with kanamycin). Combination of the dendrimeric peptide DeltaFq (a K-K2 dendrimer for which the sequence of DeltaFm constitutes each of the four branches) (MIC, 21.3 microg/ml) with kanamycin (MIC, 2.1 microg/ml) not only lowered the MIC of each by 4-fold but also improved the therapeutic potential of this highly hemolytic (37% hemolysis alone, compared to 4% hemolysis in combination) and cytotoxic (70% toxicity at 10x MIC alone, versus 30% toxicity in combination) peptide. Thus, synergy between peptide and nonpeptide antibiotics has the potential to

  13. Inhibition of ARC decreases the survival of HEI-OC-1 cells after neomycin damage in vitro

    PubMed Central

    Guan, Ming; Fang, Qiaojun; He, Zuhong; Li, Yong; Qian, Fuping; Qian, Xiaoyun; Lu, Ling; Zhang, Xiaoli; Liu, Dingding; Qi, Jieyu; Zhang, Shasha; Tang, Mingliang; Gao, Xia; Chai, Renjie


    Hearing loss is a common sensory disorder mainly caused by the loss of hair cells (HCs). Noise, aging, and ototoxic drugs can all induce apoptosis in HCs. Apoptosis repressor with caspase recruitment domain(ARC) is a key factor in apoptosis that inhibits both intrinsic and extrinsic apoptosis pathways; however, there have been no reports on the role of ARC in HC loss in the inner ear. In this study, we used House Ear Institute Organ of Corti 1 (HEI-OC-1) cells, which is a cochlear hair-cell-like cell line, to investigate the role of ARC in aminoglycoside-induced HC loss. ARC was expressed in the cochlear HCs as well as in the HEI-OC-1 cells, but not in the supporting cells, and the expression level of ARC in HCs was decreased after neomycin injury in both cochlear HCs and HEI-OC-1 cells, suggesting that reduced levels of ARC might correlate with neomycin-induced HC loss. We inhibited ARC expression using siRNA and found that this significantly increased the sensitivity of HEI-OC-1 cells to neomycin toxicity. Finally, we found that ARC inhibition increased the expression of pro-apoptotic factors, decreased the mitochondrial membrane potential, and increased the level of reactive oxygen species (ROS) after neomycin injury, suggesting that ARC inhibits cell death and apoptosis in HEI-OC-1 cells by controlling mitochondrial function and ROS accumulation. Thus the endogenous anti-apoptotic factor ARC might be a new therapeutic target for the prevention of aminoglycoside-induced HC loss. PMID:27556499

  14. Efficacy of neomycin sulfate water medication on the control of mortality associated with colibacillosis in growing turkeys.


    Marrett, L E; Robb, E J; Frank, R K


    The objective of this investigation was to evaluate the efficacy, safety, and toxicity of neomycin sulfate (Neomix 325) water medication to control mortality associated with colibacillosis (Escherichia coli) in growing turkeys. One efficacy trial was conducted at five locations; each location included 2,880 sexed 21-d-old turkey poults that were naturally challenged with litter from turkey flocks that had colibacillosis. Between 5 and 7 d after challenge, and when mortality had reached 0.5%, poults were randomized within sex into three treatment groups of 0, 11, or 22 mg neomycin sulfate/kg body weight. In each location, each treatment was replicated 12 times with 40 poults per sex per replicate. All treatments were administered in the drinking water for 5 d. The pivotal decision criterion was mortality. Mortality was defined as 1) supported mortality (SM): positive microbial culture for E. coli and gross lesions, 2) diagnosed mortality (DM): diagnosed as associated with E. coli but not supported by lesions or positive microbiological cultures, 3) overall mortality (OM): mortality associated with E. coli or other microorganisms and miscellaneous reasons such as accidents (trampling or suffocations). Performance data (growth and feed utilization) also were measured and are reported without statistical analysis. Results from this efficacy study clearly demonstrated the effectiveness of neomycin sulfate against E. coli as measured by a reduction in mortality. In the target animal safety and toxicity study (done in conjunction with the efficacy study), neomycin sulfate in the drinking water at 66, 110, or 220 mg/kg per d for 15 d had no observable adverse effects on poult performance, as measured by feed or water consumption, body weight, gross pathology, or mortality.

  15. Decreased Immunoreactivities of the Chloride Transporters, KCC2 and NKCC1, in the Lateral Superior Olive Neurons of Kanamycin-treated Rats

    PubMed Central

    Suh, Myung-Whan


    Objectives From our previous study about the weak expressions of potassium-chloride (KCC2) and sodium-potassium-2 chloride (NKCC1) co-transporters in the lateral superior olive (LSO) in circling mice, we hypothesized that partially damaged cochlea of circling mice might be a cause of the weak expressions of KCC2 or NKCC1. To test this possibility, we reproduced the altered expressions of KCC2 and NKCC1 in the LSO of rats, whose cochleae were partially destroyed with kanamycin. Methods Rat pups were treated with kanamycin from postnatal (P)3 to P8 (700 mg/kg, subcutaneous injection, twice a day) and sacrificed for immunohistochemical analysis, scanning electron microscope (SEM) and auditory brain stem response. Results The SEM study revealed partially missing hair cells in P9 rats treated with kanamycin, and the hearing threshold was elevated to 63.8±2.5 dB SPL (4 ears) at P16. Both KCC2 and NKCC1 immunoreactivities were more prominent in control rats on P16. On 9 paired slices, the mean densities of NKCC1 immunoreactivities were 118.0±1.0 (control) and 112.2±1.2 (kanamycin treated), whereas those of KCC2 were 115.7±1.5 (control) and 112.0±0.8 (kanamycin treated). Conclusion We concluded that weak expressions of KCC2 and NKCC1 in circling mice were due to partial destruction of cochleae. PMID:22977707

  16. Improved methods in Agrobacterium-mediated transformation of almond using positive (mannose/pmi) or negative (kanamycin resistance) selection-based protocols.


    Ramesh, Sunita A; Kaiser, Brent N; Franks, Tricia; Collins, Graham; Sedgley, Margaret


    A protocol for Agrobacterium-mediated transformation with either kanamycin or mannose selection was developed for leaf explants of the cultivar Prunus dulcis cv. Ne Plus Ultra. Regenerating shoots were selected on medium containing 15 muM kanamycin (negative selection), while in the positive selection strategy, shoots were selected on 2.5 g/l mannose supplemented with 15 g/l sucrose. Transformation efficiencies based on PCR analysis of individual putative transformed shoots from independent lines relative to the initial numbers of leaf explants tested were 5.6% for kanamycin/nptII and 6.8% for mannose/pmi selection, respectively. Southern blot analysis on six randomly chosen PCR-positive shoots confirmed the presence of the nptII transgene in each, and five randomly chosen lines identified to contain the pmi transgene by PCR showed positive hybridisation to a pmi DNA probe. The positive (mannose/pmi) and the negative (kanamycin) selection protocols used in this study have greatly improved transformation efficiency in almond, which were confirmed with PCR and Southern blot. This study also demonstrates that in almond the mannose/pmi selection protocol is appropriate and can result in higher transformation efficiencies over that of kanamycin/nptII selection protocols.

  17. Neomycin and pentagalloyl glucose enhanced cross-linking for elastin and glycosaminoglycans preservation in bioprosthetic heart valves.


    Tripi, Daniel R; Vyavahare, Naren R


    Glutaraldehyde cross-linked bioprosthetic heart valves fail within 12-15 years of implantation due to limited durability. Glutaraldehyde does not adequately stabilize extracellular matrix components such as glycosaminoglycans and elastin, and loss of these components could be a major cause of degeneration of valve after implantation. We have shown earlier that neomycin-based cross-linking stabilizes glycosaminoglycans in the tissue but fails to stabilize elastin component. Here, we report a new treatment where neomycin and pentagalloyl glucose (PGG) were incorporated into glutaraldehyde cross-linking neomycin-PGG-Glutaraldehyde (NPG) to stabilize both glycosaminoglycans and elastin in porcine aortic valves. In vitro studies demonstrated a marked increase in extracellular matrix stability against enzymatic degradation after cross-linking and 10 month storage in NPG group when compared to glutaraldehyde controls. Tensile properties showed increased lower elastic modulus in both radial and circumferential directions in NPG group as compared to glutaraldehyde, probably due to increased elastin stabilization with no changes in upper elastic modulus and extensibility. The enhanced extracellular matrix stability was further maintained in NPG-treated tissues after rat subdermal implantation for three weeks. NPG group also showed reduced calcification when compared to glutaraldehyde controls. We conclude that NPG cross-linking would be an excellent alternative to glutaraldehyde cross-linking of bioprosthetic heart valves to improve its durability.


    PubMed Central

    Khoury, Kenneth A.; Floch, Martin H.; Herskovic, Teodoro


    The effects of an oral neomycin and penicillin regimen on intestinal bacteriology and on morphology and function of the small intestine of mice were investigated. Quantitative and qualitative stool cultures on selective media of the treated animals revealed only growth of yeast organisms. The treated animals developed enlargement of the ceca with fluid contents and watery stools, resembling characteristics of germfree animals. Radioautography with tritiated thymidine revealed an increased epithelial cell migration rate in the mice treated with the antibiotics for 3 to 5 wk. A slight increase in villus height was also noted. The treated male mice showed greater variance than the treated females in epithelial cell migration rates. Histochemical staining reactions showed a decrease in nonspecific esterase and in NADH dehydrogenase activity in the proximal gut of the antibiotic animals. Stains of distal gut and those for acid and alkaline phosphatase, NADPH dehydrogenase, lactic dehydrogenase, and succinic dehydrogenase were similar to the controls. A slight increase in sucrase activity and a slight decrease in lactase activity in the antibiotic animals was observed in contrast to control animals. Germfree mice, however, had greater sucrase and lactase activity. Transport of L-methionine was slightly reduced in the distal segment of the treated animals. Since the direction of these changes is away from the intestinal state observed in germfree animals, they are probably the result of the direct action of the antibiotics on the gut. PMID:4388518

  19. Rapid analytical procedure for neomycin determination in ointments by CE with direct UV detection.


    Huidobro, A L; García, A; Barbas, C


    The purpose of this study was the development of an analytical methodology for the determination of neomycin in a complex pharmaceutical preparation. The simplified methodology consisted of a primary liquid-liquid extraction, employing a mixture of chloroform and water (1.25:1, v/v) and subsequent analysis by CE applying a capillary zone electrophoresis method with a 30 cm (effective length), 50 microm (internal diameter) polyacrylamide-coated silica capillary. The background electrolyte consisted of 35 mM phosphate and 15 mM acetate buffer set at pH 4.7, under normal polarity mode and direct UV detection at 200 nm. The separation of the target analyte from the complex matrix was accomplished in less than 3 min. The analytical method was successfully validated in order to verify its proper selectivity, linearity, accuracy and precision for the goal intended and its further implementation for the quantification of the active compound in the pharmaceutical speciality for quality control.

  20. Influence of Linker Length and Composition on Enzymatic Activity and Ribosomal Binding of Neomycin Dimers

    PubMed Central

    Watkins, Derrick; Kumar, Sunil; Green, Keith D.


    The human and bacterial A site rRNA binding as well as the aminoglycoside-modifying enzyme (AME) activity against a series of neomycin B (NEO) dimers is presented. The data indicate that by simple modifications of linker length and composition, substantial differences in rRNA selectivity and AME activity can be obtained. We tested five different AMEs with dimeric NEO dimers that were tethered via triazole, urea, and thiourea linkages. We show that triazole-linked dimers were the worst substrates for most AMEs, with those containing the longer linkers showing the largest decrease in activity. Thiourea-linked dimers that showed a decrease in activity by AMEs also showed increased bacterial A site binding, with one compound (compound 14) even showing substantially reduced human A site binding. The urea-linked dimers showed a substantial decrease in activity by AMEs when a conformationally restrictive phenyl linker was introduced. The information learned herein advances our understanding of the importance of the linker length and composition for the generation of dimeric aminoglycoside antibiotics capable of avoiding the action of AMEs and selective binding to the bacterial rRNA over binding to the human rRNA. PMID:25896697

  1. A kanamycin sensor based on an electrosynthesized molecularly imprinted poly-o-phenylenediamine film on a single-walled carbon nanohorn modified glassy carbon electrode.


    Han, Shuang; Li, Bingqian; Song, Ze; Pan, Sihao; Zhang, Zhichao; Yao, Hui; Zhu, Shuyun; Xu, Guobao


    A single-walled carbon nanohorn (SWCNH) has been used to construct a molecularly imprinted electrochemical sensor for the first time. Kanamycin, a widely used aminoglycoside antibiotic, is used as a representative analyte to test the detection strategy. The kanamycin sensor was constructed by the electropolymerization of a molecularly imprinted poly-o-phenylenediamine film on a SWCNH modified glassy carbon electrode. The sensor was investigated in the presence or absence of kanamycin by cyclic voltammetry to verify the changes in the redox peak currents of K3Fe(CN)6. The sensor exhibits a linear range of 0.1-50 μM with a detection limit of 0.1 μM. It also shows high recognition ability, indicating that the SWCNH-based molecularly imprinted sensor is promising.

  2. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.


    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean


    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  3. Crystallization and preliminary X-ray diffraction analysis of kanamycin-binding β-lactamase in complex with its ligand.


    Van de Water, Karen; Soror, Sameh H; Wohlkonig, Alexandre; van Nuland, Nico A J; Volkov, Alexander N


    TEM-1 β-lactamase is a highly efficient enzyme that is involved in bacterial resistance against β-lactam antibiotics such as penicillin. It is also a robust scaffold protein which can be engineered by molecular-evolution techniques to bind a variety of targets. One such β-lactamase variant (BlaKr) has been constructed to bind kanamycin (kan) and other aminoglycoside antibiotics, which are neither substrates nor ligands of native β-lactamases. In addition to recognizing kan, BlaKr activity is up-regulated by its binding via an activation mechanism which is not yet understood at the molecular level. In order to fill this gap, determination of the structure of the BlaKr-kan complex was embarked upon. A crystallization condition for BlaKr-kan was identified using high-throughput screening, and crystal growth was further optimized using streak-seeding and hanging-drop methods. The crystals belonged to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 47.01, b = 72.33, c = 74.62 Å, and diffracted to 1.67 Å resolution using synchrotron radiation. The X-ray structure of BlaKr with its ligand kanamycin should provide the molecular-level details necessary for understanding the activation mechanism of the engineered enzyme.

  4. Involvement of calpain-I and microRNA34 in kanamycin-induced apoptosis of inner ear cells.


    Yu, Li; Tang, Hao; Jiang, Xiao Hua; Tsang, Lai Ling; Chung, Yiu Wa; Chan, Hsiao Chang


    Inner ear cells, including hair cells, spiral ganglion cells, stria vascularis cells and supporting cells on the basilar membrane, play a major role in transducing hearing signals and regulating inner ear homoeostasis. However, their functions are often damaged by antibiotic-induced ototoxicity. Apoptosis is probably involved in inner ear cell injury following aminoglycoside treatment. Calpain, a calcium-dependent protease, is essential for mediating and promoting cell death. We have therefore investigated the involvement of calpain in the molecular mechanism underlying ototoxicity induced by the antibiotic kanamycin in mice. Kanamycin (750 mg/kg) mainly induced cell death of cochlear cells, including stria vascularis cells, supporting cells and spiral ganglion cells, but not hair cells within the organ of Corti. Cell death due to apoptosis occurred in a time-dependent manner with concomitant up-regulation of calpain expression. Furthermore, the expression levels of two microRNAs, mir34a and mir34c, were altered in a dose-dependent manner in cochlear cells. These novel findings demonstrated the involvement of both calpain and microRNAs in antibiotic-induced ototoxicity.

  5. Effect of Mutations on the Binding of Kanamycin-B to RNA Hairpins Derived from the Mycobacterium tuberculosis Ribosomal A-Site.


    Truitt, Amber R; Choi, Bok-Eum; Li, Jenny; Soto, Ana Maria


    Kanamycin is an aminoglycoside antibiotic used in the treatment of drug-resistant tuberculosis. Mutations at the rRNA A-site have been associated with kanamycin resistance in Mycobacterium tuberculosis clinical isolates. Understanding the effect of these mutations on the conformation of the M. tuberculosis A-site is critical for understanding the mechanisms of antibiotic resistance in M. tuberculosis. In this work, we have studied RNA hairpins derived from the M. tuberculosis A-site, the wild type and three mutants at the following positions (M. tuberculosis/Escherichia coli numbering): A1400/1408 → G, C1401/1409 → U, and the double mutant G1483/1491 C1401/1409 → UA. Specifically, we used circular dichroism, ultraviolet spectroscopy, and fluorescence spectroscopy to characterize the conformation, stability, and binding affinity of kanamycin-B and other aminoglycoside antibiotics for these RNA hairpins. Our results show that the mutations affect the conformation of the decoding site, with the mutations at position 1401/1409 resulting in significant destabilizations. Interestingly, the mutants bind paromomycin with weaker affinity than the wild type, but they bind kanamycin-B with similar affinity than the wild type. The results suggest that the presence of mutations does not prevent kanamycin-B from binding. Instead, kanamycin may promote different interactions with a third partner in the mutants compared to the wild type. Furthermore, our results with longer and shorter hairpins suggest that the region of the A-site that varies among organisms may have modulating effects on the binding and interactions of the A-site.

  6. High level of cross-resistance between kanamycin, amikacin, and capreomycin among Mycobacterium tuberculosis isolates from Georgia and a close relation with mutations in the rrs gene.


    Jugheli, Levan; Bzekalava, Nino; de Rijk, Pim; Fissette, Krista; Portaels, Françoise; Rigouts, Leen


    The aminoglycosides kanamycin and amikacin and the macrocyclic peptide capreomycin are key drugs for the treatment of multidrug-resistant tuberculosis (MDR-TB). The increasing rates of resistance to these drugs and the possible cross-resistance between them are concerns for MDR-TB therapy. Mutations in the 16S rRNA gene (rrs) have been associated with resistance to each of the drugs, and mutations of the tlyA gene, which encodes a putative rRNA methyltransferase, are thought to confer capreomycin resistance in Mycobacterium tuberculosis bacteria. Studies of possible cross-resistance have shown variable results. In this study, the MICs of these drugs for 145 clinical isolates from Georgia and the sequences of the rrs and tlyA genes of the isolates were determined. Of 78 kanamycin-resistant strains, 9 (11.5%) were susceptible to amikacin and 16 (20.5%) were susceptible to capreomycin. Four strains were resistant to capreomycin but were susceptible to the other drugs, whereas all amikacin-resistant isolates were resistant to kanamycin. Sequencing revealed six types of mutations in the rrs gene (A514C, C517T, A1401G, C1402T, C1443G, T1521C) but no mutations in the tlyA gene. The A514C, C517T, C1443G, and T1521C mutations showed no association with resistance to any of the drugs. The A1401G and C1402T mutations were observed in 65 kanamycin-resistant isolates and the 4 capreomycin-resistant isolates, respectively, whereas none of the susceptible isolates showed either of those mutations. The four mutants with the C1402T mutations showed high levels of resistance to capreomycin but no resistance to kanamycin and amikacin. Detection of the A1401G mutation appeared to be 100% specific for the detection of resistance to kanamycin and amikacin, while the sensitivities reached 85.9% and 94.2%, respectively.

  7. Caprolactam-silica network, a strong potentiator of the antimicrobial activity of kanamycin against gram-positive and gram-negative bacterial strains.


    Voicu, Georgeta; Grumezescu, Valentina; Andronescu, Ecaterina; Grumezescu, Alexandru Mihai; Ficai, Anton; Ficai, Denisa; Ghitulica, Cristina Daniela; Gheorghe, Irina; Chifiriuc, Mariana Carmen


    Here, we report the fabrication of a novel ε-caprolactam-silica (ε-SiO2) network and assessed its biocompatibility and ability to improve the antimicrobial activity of kanamycin. The results of the quantitative antimicrobial assay demonstrate that the obtained ε-SiO2 network has efficiently improved the kanamycin activity on Staphylococcus aureus ATCC 25923 and Escherichia coli ATCC 25922 strains, with a significant decrease of the minimum inhibitory concentration. The ε-SiO2 network could be feasibly obtained and represents an alternative for the design of new antibiotic drug carriers or delivery systems to control bacterial infections.

  8. The last step of kanamycin biosynthesis: unique deamination reaction catalyzed by the α-ketoglutarate-dependent nonheme iron dioxygenase KanJ and the NADPH-dependent reductase KanK.


    Sucipto, Hilda; Kudo, Fumitaka; Eguchi, Tadashi


    Mystery solved: using heterologous expression, the activities of two enzymes exclusively belonging to the kanamycin biosynthetic pathway have been identified in vitro. A distinctive reaction mechanism to produce kanamycin is proposed and the previously unknown catalytic deamination activity of KanJ dioxygenase is uncovered.

  9. Characterization of Small ColE1-Like Plasmids Conferring Kanamycin Resistance in Salmonella enterica subsp. enterica serovars Typhimurium and Newport

    USDA-ARS?s Scientific Manuscript database

    Multi-antibiotic resistant (MR) Salmonella enterica serovars Typhimurium and Newport are an increasing concern in human and animal health. Many strains are known to carry antibiotic resistance determinants on multiple plasmids, yet detailed information is scarce. Three plasmids conferring kanamycin...

  10. Capacitively coupled contactless conductivity detection as an alternative detection mode in CE for the analysis of kanamycin sulphate and its related substances.


    El-Attug, Mohamed N; Adams, Erwin; Hoogmartens, Jos; Van Schepdael, Ann


    A method was developed to determine simultaneously kanamycin, its related substances and sulphate in kanamycin sulphate using capacitively coupled contactless conductivity detection. Kanamycin is an aminoglycoside antibiotic that lacks a strong UV-absorbing chromophore. Due to its physicochemical properties, CE in combination with capacitively coupled contactless conductivity detection was chosen. The separation method uses a BGE composed of 40 mM 2-(N-morpholino)ethanesulphonic acid monohydrate and 40 mM L-histidine, pH 6.35. A 0.6 mM N-cetyltrimethyl ammonium bromide (CTAB) solution was added as electroosmotic flow modifier in a concentration below the critical micellar concentration (CMC). Ammonium acetate 50 mg/L was used as internal standard. In total, 30 kV was applied in reverse polarity on a fused-silica capillary (65/41 cm; 75 μm id). The optimized separation was obtained in less than 6 min with good linearity (R(2)=0.9999) for kanamycin. It shows a good precision expressed as RSD on the relative peak areas equal to 0.3 and 1.1% for intra-day and inter-day precision, respectively. The LOD and LOQ are 0.7 and 2.3 mg/L, respectively. Similarly, for sulphate, a good linearity (R(2)=0.9996) and precision (RSD 0.4 and 0.6% for intra-day and inter-day, respectively) were obtained.

  11. RNA-seq analysis of the effect of kanamycin and the ABC transporter AtWBC19 on Arabidopsis thaliana seedlings reveals changes in metal content.


    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna


    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake.

  12. Photoelectrochemical aptasensor for the sensitive and selective detection of kanamycin based on Au nanoparticle functionalized self-doped TiO2 nanotube arrays.


    Xin, Yanmei; Li, Zhenzhen; Zhang, Zhonghai


    In this communication, a new photoelectrochemical aptasensor with Au nanoparticle functionalized self-doped TiO2 nanotube arrays (Au/SD-TiO2 NTs) as the core sensing unit and aptamers as the recognition unit was set up to accomplish the sensitive and selective detection of kanamycin with the lowest detection limit of 0.1 nM.

  13. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.


    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian


    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance.

  14. An aptamer-based signal-on bio-assay for sensitive and selective detection of Kanamycin A by using gold nanoparticles.


    Chen, Jing; Li, Zhaohui; Ge, Jia; Yang, Ran; Zhang, Lin; Qu, Ling-Bo; Wang, Hong-Qi; Zhang, Ling


    In this study, a simple and sensitive aptamer-based fluorescence method for the detection of Kanamycin A by using gold nanoparticles (AuNPs) has been developed. In this assay, AuNPs were utilized as DNA nanocarrier as well as efficient fluorescence quencher. In the absence of Kanamycin A, dye-labeled aptamer could be adsorbed onto the surface of AuNPs and the fluorescence signal was quenched. In the presence of Kanamycin A, the specific binding between dye-labeled aptamer and its target induced the formation of rigid structure, which led to dye-labeled aptamer releasing from the surface of AuNPs and the fluorescence intensity was recovered consequently. Under optimum conditions, calibration modeling showed that the analytical linear range covered from 0.8nM to 350nM and the detection limit of 0.3nM was realized successfully. This proposed bio-assay also showed high selectivity over other antibiotics. Meanwhile, this strategy was further used to determine the concentrations of Kanamycin A in milk sample with satisfying results.

  15. Influence of tra genes of IncP and F plasmids on the mobilization of small Kanamycin resistance ColE1-Like plasmids in bacterial biofilms

    USDA-ARS?s Scientific Manuscript database

    Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...

  16. RNA-Seq Analysis of the Effect of Kanamycin and the ABC Transporter AtWBC19 on Arabidopsis thaliana Seedlings Reveals Changes in Metal Content

    PubMed Central

    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna


    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake. PMID:25310285

  17. Pre-XDR & XDR in MDR and Ofloxacin and Kanamycin resistance in non-MDR Mycobacterium tuberculosis isolates.


    Jain, Amita; Dixit, Pratima; Prasad, Rajendra


    Resistance to second line anti tubercular drugs is a cause of serious concern. The present study reports the prevalence of Ofloxacin (OFX) and Kanamycin (KM) resistance in Mycobacterium tuberculosis isolates from cases of pulmonary tuberculosis, who received anti tubercular treatment for >4 weeks in past. Of total 438 enrolled patients, 361 were culture positive for M. tuberculosis, of which, 95 (26.3%) were OFX resistant & 49 (13.5%) were KM resistant. Total 130 isolates were Multidrug resistant, of which, 55 (42.3%) were resistant to either OFX or KM (Pre-XDR) & 11 (8.5%) were resistant to both KM & OFX (XDR). Resistance to quinolones & aminoglycosides should be routinely assessed in areas endemic for tuberculosis.

  18. Selective modification of the 3''-amino group of kanamycin prevents significant loss of activity in resistant bacterial strains.


    Santana, Andrés G; Zárate, Sandra G; Asensio, Juan Luis; Revuelta, Julia; Bastida, Agatha


    Aminoglycosides are highly potent, wide-spectrum bactericidals. N-1 modification of aminoglycosides has thus far been the best approach to regain bactericidal efficiency of this class of antibiotics against resistant bacterial strains. In the present study we have evaluated the effect that both, the number of modifications and their distribution on the aminoglycoside amino groups (N-1, N-3, N-6' and N-3''), have on the antibiotic activity. The modification of N-3'' in the antibiotic kanamycin A is the key towards the design of new aminoglycoside antibiotics. This derivative maintains the antibiotic activity against aminoglycoside acetyl-transferase- and nucleotidyl-transferase-expressing strains, which are two of the most prevalent modifying enzymes found in aminoglycoside resistant bacteria.

  19. Colorimetric detection of kanamycin based on analyte-protected silver nanoparticles and aptamer-selective sensing mechanism.


    Xu, Yuanyuan; Han, Tian; Li, Xiaqing; Sun, Linghao; Zhang, Yujuan; Zhang, Yuanshu


    In this work, a novel colorimetric detection method for kanamycin (Kana), a widely used aminoglycoside antibiotic, has been developed using unmodified silver nanoparticles (AgNPs) as sensing probe. The method is designed based on the finding that the analyte (Kana) can protect AgNPs against salt-induced aggregation, and nucleic acid aptamers can decrease the risk of false positives through an aptamer-selective sensing mechanism. By use of the proposed method, selective quantification of Kana can be achieved over the concentration range from 0.05 to 0.6 μg mL(-1) within 20 min. The detection limit is estimated to be 2.6 ng mL(-1), which is much lower than the allowed maximum residue limit. Further studies also demonstrate the applicability of the proposed method in milk samples, revealing that the method may possess enormous potential for practical detection of Kana in the future.

  20. Sulfonamide-Based Inhibitors of Aminoglycoside Acetyltransferase Eis Abolish Resistance to Kanamycin in Mycobacterium tuberculosis

    SciTech Connect

    Garzan, Atefeh; Willby, Melisa J.; Green, Keith D.; Gajadeera, Chathurada S.; Hou, Caixia; Tsodikov, Oleg V.; Posey, James E.; Garneau-Tsodikova, Sylvie


    A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28–37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.

  1. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Pseudomonas aeruginosa responding to ampicilin, kanamycin, and tetracycline resistance.


    Peng, Xuanxian; Xu, Changxin; Ren, Haixia; Lin, Xiangmin; Wu, Lina; Wang, Sanying


    Nosocomial wound infections by antibiotic-resistant Pseudomonas aeruginosa strains have increasing importance in hospitals. Outer membrane proteins of the bacterium have strong influence on its resistance to antibiotics. In the current study, a parallel proteomic approach was applied to analysis of sarcosine-insoluble outer membrane fraction of P. aeruginosa responding to ampicilin, kanamycin and tetracycline resistances. Eleven differential proteins with 15 spots were determined and then identified by MALDI-TOF/MS, in which four with increased OprF, MexA, OmpH, and decreased hypothetical protein (NCBI No. 15599856), six with increased OprF, OmpH, hypothetical protein (NCBI No. 15599183) and decreased OprG, MexA, conserved hypothetical protein (NCBI No. 15600371), and eight with increased OprF, MexA, OprL, probable Omp (NCBI No. 15599856), probable secretion protein (NCBI No. 15600167), OprD and decreased OprG, conserved hypothetical protein (NCBI No. 15600371) responded to ampicilin, kanamycin, and tetracycline resistances, respectively. With the exception of OprF, the other differential proteins did not show the same behaviors against the three antibiotic resistances. Compared with our previous report on E. coli Omps responding to ampicilin and tetracycline resistances, which was only a protein difference in quality between the two antibiotics, P. aeruginosa showed significant diversity against the three antibiotics. Our findings might provide valuable data for an understanding of antibiotic-resistant difference between different species of bacteria. Meanwhile, these proteins shared by different bacteria or a bacterium against different antibiotics may provide universal targets for the development of new drugs that control antibiotic-resistant bacteria.

  2. Evaluating the in vitro susceptibility of bovine mastitis pathogens to a combination of kanamycin and cefalexin: Recommendations for a disk diffusion test.


    Pillar, C M; Goby, L; Draghi, D; Grover, P; Thornsberry, C


    Cows suffering from bovine mastitis have markedly reduced milk production because of inflammation within the udder subsequent to infection and damage from bacterial toxins. Antibiotic treatment is commonly used as a preventative and therapeutic measure for bovine mastitis. The most common pathogens include Staphylococcus aureus, various streptococci (Streptococcus dysgalactiae, Streptococcus uberis), and coliforms (Escherichia coli), which can be contracted from other infected cows or from the environment. A combination of kanamycin and cefalexin (1:1.5 wt/wt) is currently used therapeutically in Europe for the treatment of bovine mastitis, although standardized methods for the in vitro determination of the susceptibility of target pathogens have not been developed. This study evaluates the appropriate broth microdilution testing criteria for kanamycin and cefalexin administered in combination and reports the development of a disk diffusion test. At a ratio of kanamycin:cefalexin relevant to that observed in milk postadministration (10:1 wt/wt), the minimum inhibitory concentrations were determined against 307 isolates of target mastitis pathogens (staphylococci, streptococci, and E. coli). Based on achievable concentrations in milk and the resulting distribution of minimum inhibitory concentrations, preliminary broth breakpoints for kanamycin/cefalexin (10:1 fixed ratio) of or=32/3.2 microg/mL resistant were applied to evaluated staphylococci, streptococci, and E. coli. Parallel testing by disk diffusion and resulting error-rate bounded analysis using a combined disk concentration of 30 microg of kanamycin and 15 microg of cefalexin resulted in the establishment of preliminary disk interpretive breakpoints of >or=20 mm susceptible, 18 to 19 mm intermediate, and

  3. Cloning and over expression of non-coding RNA rprA in E.coli and its resistance to Kanamycin without osmotic shock.


    Sahni, Azita; Hajjari, Mohammadreza; Raheb, Jamshid; Foroughmand, Ali Mohammad; Asgari, Morteza


    Recent reports have indicated that small RNAs have key roles in the response of the E.coli to stress and also in the regulating of virulence factors. It seems that some small non-coding RNAs are involved in multidrug resistance. Previous studies have indicated that rprA can increase the tolerance to Kanamycin in RcsB-deficient Escherichia coli K-12 following osmotic shock. The current study aims to clone and over-express the non-coding RNA rprA in E.coli and investigate its effect on the bacterial resistance to Kanamycin without any osmotic shock. For this purpose, rprA gene was amplified by the PCR and then cloned into the PET-28a (+) vector. The recombinant plasmid was transformed into wild type E.coli BL21 (DE3). The over expression was induced by IPTG and confirmed by qRT-PCR. The resistance to the kanamycin was then measured in different times by spectrophotometry. The statistical analysis showed that the rprA can increase the resistance to Kanamycin in Ecoli K12. The interaction between rprA and rpoS was reviewed and analyzed by in silico methods. The results showed that the bacteria with over-expressed rprA were more resistant to Kanamycin. The present study is an important step to prove the role of non-coding RNA rprA in bacterial resistance. The data can be the basis for future works and can also help to develop and deliver next-generation antibiotics.

  4. Cloning and over expression of non-coding RNA rprA in E.coli and its resistance to Kanamycin without osmotic shock

    PubMed Central

    Sahni, Azita; Hajjari, Mohammadreza; Raheb, Jamshid; Foroughmand, Ali Mohammad; Asgari, Morteza


    Recent reports have indicated that small RNAs have key roles in the response of the E.coli to stress and also in the regulating of virulence factors. It seems that some small non-coding RNAs are involved in multidrug resistance. Previous studies have indicated that rprA can increase the tolerance to Kanamycin in RcsB-deficient Escherichia coli K-12 following osmotic shock. The current study aims to clone and over-express the non-coding RNA rprA in E.coli and investigate its effect on the bacterial resistance to Kanamycin without any osmotic shock. For this purpose, rprA gene was amplified by the PCR and then cloned into the PET-28a (+) vector. The recombinant plasmid was transformed into wild type E.coli BL21 (DE3). The over expression was induced by IPTG and confirmed by qRT-PCR. The resistance to the kanamycin was then measured in different times by spectrophotometry. The statistical analysis showed that the rprA can increase the resistance to Kanamycin in Ecoli K12. The interaction between rprA and rpoS was reviewed and analyzed by in silico methods. The results showed that the bacteria with over-expressed rprA were more resistant to Kanamycin. The present study is an important step to prove the role of non-coding RNA rprA in bacterial resistance. The data can be the basis for future works and can also help to develop and deliver next-generation antibiotics. PMID:28479746

  5. Comparative study of the effects of gentamicin, neomycin, streptomycin and ofloxacin antibiotics on sperm parameters and testis apoptosis in rats.


    Khaki, Arash; Novin, Marefat Ghaffari; Khaki, Amir Afshin; Nouri, Mohammad; Sanati, Ehsan; Nikmanesh, Mahdad


    The aim of this study was to investigate the comparative effects of aminoglycosides and fluoroquinolones on testis apoptosis and sperm parameters in rats. Fifty male Wistar rats were randomly divided into control (n = 10) and experimental (n = 40) groups. The experimental groups subdivided into four groups often. Each received 5 mg kg(-1) (IP) gentamicin, 50 mg kg(-1) (IP) neomycin, 40 mg kg(-1) (IP) streptomycin and 72 mg kg(-1) (IP) ofloxacin daily for 14 days, respectively; however, the control group just received vehicle (IP). In the fourteenth day, rats were killed and sperm analyzed for sperm parameters. Testis tissues were also prepared for TUNEL assay for detection of apoptosis. There was a significant decrease in sperm count, viability and motility in all of experimental groups when compared with control group. Although in streptomycin group these parameters were less decreased than in the other experimental groups. The apoptotic cells were significantly increased in all experimental groups when compared with those seen in the controlled group. Gentamicin, neomycin and streptomycin and ofloxacin have negative effects on sperm parameters and testis apoptosis in rats. However, these side effects are less seen in the streptomycin group. Therefore, it is recommended that usage of this drug have fewer side effects on male fertility.

  6. [Liver hemostasis using a dry electrocautery or greased with lidocaine or neomycin or glycerin or vaseline, in rabbit].


    de Matos Filho, Argos Soares; Petroianu, Andy; Alberti, Luiz Ronaldo; Vidigal, Paula Vieira Teixeira; dos Reis, Daniel Cruz Ferreira; de Souza, Davi Machado


    To assess the hemostasis and healing of the hepatic parenchyma after segmental hepatectomy, using a dry electrocautery or an electrocautery greased with lidocaine gel, neomycin pomade, glycerin lotion, or a vaseline pomade. Rabbits were submitted to partial hepatectomy and divided into six groups of 10 animals each: Group 1: untreated; Group 2: treated with a dry electrocautery; Group 3: treated with an electrocautery greased with lidocaine gel; Group 4: with neomycin pomade; Group 5: with glycerine lotion; Group 6: with vaseline pomade. Resected liver weight, bleeding volume and time spent to achieve hemostasis were determined. Five rabbits from each group were re-operated upon after 24 hours and five after 7 days in order to obtain a biopsy of the hepatic wound and to explore he abdominal cavity. Red blood cell levels and markers of hepatic function and injury were determined before surgery and before re-operation. Lidocaine gel and glycerine lotion reduced the bleeding volume and the time to achieve hemostasis and conducted the thermal energy of the electrocautery, causing hydropic cell degeneration after 24 hours and deeper necrosis of hepatic tissue after 7 days. All substances increased the aminotransferase concentrations. These values returned to normal after a maximum of seven days. The electrocautery coated with lidocaine gel and glycerine lotion were the most effective methods for the hemostasis of hepatic parenchyma.

  7. N6', N6''', and O4' Modifications to Neomycin Affect Ribosomal Selectivity without Compromising Antibacterial Activity.


    Sati, Girish C; Shcherbakov, Dimitri; Hobbie, Sven N; Vasella, Andrea; Böttger, Erik C; Crich, David


    The synthesis of a series of neomycin derivatives carrying the 2-hydroxyethyl substituent on N6' and/or N6‴ both alone and in combination with a 4'-O-ethyl group is described. By means of cell-free translation assays with wild-type bacterial ribosomes and their hybrids with eukaryotic decoding A sites, we investigate how individual substituents and their combinations affect activity and selectivity at the target level. In principle, and as shown by cell-free translation assays, modifications of the N6' and N6‴ positions allow enhancement of target selectivity without compromising antibacterial activity. As with the 6'OH aminoglycoside paromomycin, the 4'-O-ethyl modification affects the ribosomal activity, selectivity, and antibacterial profile of neomycin and its 6'-N-(2-hydroxyethyl) derivatives. The modified aminoglycosides show good antibacterial activity against model Gram-positive and Gram-negative microbes including the ESKAPE pathogens Staphylococcus aureus, Klebsiella pneumoniae, Enterobacter cloacae, and Acinetobacter baumannii.

  8. The efficacy and safety of topical polymyxin B, neomycin and gramicidin for treatment of presumed bacterial corneal ulceration

    PubMed Central

    Bosscha, M I; van Dissel, J T; Kuijper, E J; Swart, W; Jager, M J


    Aim: To evaluate the clinical efficacy and safety of topical polymyxin B, neomycin, and gramicidin for the treatment of suspected bacterial corneal ulceration at the Leiden University Medical Center. Methods: Patients with a diagnosis of a suspected bacterial corneal ulcer between April 1995 and February 2002 were retrospectively identified and reviewed; clinical and microbiological features and response to therapy were analysed. All patients were treated with Polyspectran eye drops. Results: In total, 91 patients were included in this analysis. Bacteriological cultures of 46 patients (51%) were positive and revealed 51 microorganisms. Staphylococcus aureus (29.4%) and Pseudomonas aeruginosa (23.5%) were the most frequently encountered bacteria. Eighteen patients switched therapy before complete healing of the corneal ulceration, four patients were lost to follow up. Of the 69 patients who completed Polyspectran treatment, re-epithelialisation occurred in 68 patients (99%) and on average took 12.6 (median 8) days. Among 91 patients, there were four perforations and one evisceration. Seven toxic or allergic reactions were reported. Conclusion: This study shows that the combination of polymyxin B, neomycin, and gramicidin is an effective and safe treatment of suspected corneal ulceration. PMID:14693766

  9. Hydrophilic interaction chromatography for the analysis of aminoglycosides.


    Kumar, Praveen; Rubies, Antoni; Companyó, Ramon; Centrich, Francesc


    The effect of mobile-phase constituents (pH and ionic strength) and chromatographic behaviour of ten aminoglycosides (streptomycin, dihydrostreptomycin, spectinomycin, apramycin, paramomycin, kanamycin A, gentamycin C1, gentamycin C2/C2a, gentamycin C1a and neomycin) in the bare silica, amino, amide and zwitterionic phases of hydrophilic interaction chromatography (HILIC) were studied systematically. Among the stationary phases studied, the zwitterionic phase provided the best separation of aminoglycosides. The effect of pH, ionic concentration and column temperature on retention time, peak shape and sensitivity was studied using a central composite design. pH affected sensitivity of the detection of analytes but not the retention time. High ionic strength in the mobile phase was necessary to control the ionic interactions between ionised aminoglycosides and the hydrophilic phase, thereby influencing peak shape and retention time. Column temperature affected sensitivity of the detection but not the retention time. During method development, crosstalk between the MS/MS channels of the analytes was observed and resolved.

  10. Determination of aminoglycoside residues in kidney and honey samples by hydrophilic interaction chromatography-tandem mass spectrometry.


    Kumar, Praveen; Rúbies, Antoni; Companyó, Ramon; Centrich, Francesc


    Two methods based on liquid chromatography-tandem mass spectrometry were developed for the determination of ten aminoglycosides (streptomycin, dihydrostreptomycin, spectinomycin, apramycin, paromomycin, kanamycin A, gentamycin C1, gentamycin C2/C2a, gentamycin C1a, and neomycin B) in kidney samples from food-producing animals and in honey samples. The methods involved extraction with an aqueous solution (for the kidney samples) or sample dissolution in water (for the honey samples), solid-phase extraction with a weak cation exchange cartridge and injection of the eluate into a liquid chromatography-tandem mass spectrometry system. A zwitterionic hydrophilic interaction chromatography column was used for separation of aminoglycosides and a triple quadrupole mass analyzer was used for detection. The methods were validated according to Decision 2002/657/EC. The limits of quantitation ranged from 2 to 125 μg/kg in honey and 25 to 264 μg/kg in the kidney samples. Interday precision (RSD%) ranged from 6 to 26% in honey and 2 to 21% in kidney. Trueness, expressed as the percentage of error, ranged from 7 to 20% in honey and 1 to 11% in kidney.

  11. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    PubMed Central

    Merritt, Kristen K; Bradley, Kevin M; Hutter, Daniel; Matsuura, Mariko F; Rowold, Diane J


    Summary Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA) constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C) and weak (A:T) nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so. Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS) that adds nucleotides to the four (G, A, C, and T) found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B), at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes with

  12. Electrochemical sensor using neomycin-imprinted film as recognition element based on chitosan-silver nanoparticles/graphene-multiwalled carbon nanotubes composites modified electrode.


    Lian, Wenjing; Liu, Su; Yu, Jinghua; Li, Jie; Cui, Min; Xu, Wei; Huang, Jiadong


    A novel imprinted electrochemical sensor for neomycin recognition was developed based on chitosan-silver nanoparticles (CS-SNP)/graphene-multiwalled carbon nanotubes (GR-MWCNTs) composites decorated gold electrode. Molecularly imprinted polymers (MIPs) were synthesized by electropolymerization using neomycin as the template, and pyrrole as the monomer. The mechanism of the fabrication process and a number of factors affecting the activity of the imprinted sensor have been discussed and optimized. The characterization of imprinted sensor has been carried out by scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FTIR). The performance of the proposed imprinted sensor has been investigated using cyclic voltammetry (CV) and amperometry. Under the optimized conditions, the linear range of the sensor was from 9×10(-9)mol/L to 7×10(-6)mol/L, with the limit of detection (LOD) of 7.63×10(-9)mol/L (S/N=3). The film exhibited high binding affinity and selectivity towards the template neomycin, as well as good reproducibility and stability. Furthermore, the proposed sensor was applied to determine the neomycin in milk and honey samples based on its good reproducibility and stability, and the acceptable recovery implied its feasibility for practical application.

  13. Activation of Dormant Secondary Metabolite Production by Introducing Neomycin Resistance into the Deep-Sea Fungus, Aspergillus versicolor ZBY-3

    PubMed Central

    Dong, Yuan; Cui, Cheng-Bin; Li, Chang-Wei; Hua, Wei; Wu, Chang-Jing; Zhu, Tian-Jiao; Gu, Qian-Qun


    A new ultrasound-mediated approach has been developed to introduce neomycin-resistance to activate silent pathways for secondary metabolite production in a bio-inactive, deep-sea fungus, Aspergillus versicolor ZBY-3. Upon treatment of the ZBY-3 spores with a high concentration of neomycin by proper ultrasound irradiation, a total of 30 mutants were obtained by single colony isolation. The acquired resistance of the mutants to neomycin was confirmed by a resistance test. In contrast to the ZBY-3 strain, the EtOAc extracts of 22 of the 30 mutants inhibited the human cancer K562 cells, indicating that these mutants acquired a capability to produce antitumor metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses of the EtOAc extracts of seven bioactive mutants and the ZBY-3 strain indicated that diverse secondary metabolites have been newly produced in the mutant extracts in contrast to the ZBY-3 extract. The followed isolation and characterization demonstrated that six metabolites, cyclo(d-Pro-d-Phe) (1), cyclo(d-Tyr-d-Pro) (2), phenethyl 5-oxo-l-prolinate (3), cyclo(l-Ile-l-Pro) (4), cyclo(l-Leu-l-Pro) (5) and 3β,5α,9α-trihydroxy-(22E,24R)-ergosta-7,22-dien-6-one (6), were newly produced by the mutant u2n2h3-3 compared to the parent ZBY-3 strain. Compound 3 was a new compound; 2 was isolated from a natural source for the first time, and all of these compounds were also not yet found in the metabolites of other A. versicolor strains. Compounds 1–6 inhibited the K562 cells, with inhibition rates of 54.6% (1), 72.9% (2), 23.5% (3), 29.6% (4), 30.9% (5) and 51.1% (6) at 100 μg/mL, and inhibited also other human cancer HL-60, BGC-823 and HeLa cells, to some extent. The present study demonstrated the effectiveness of the ultrasound-mediated approach to activate silent metabolite production in fungi by introducing acquired resistance to aminoglycosides and its potential for discovering new compounds from silent

  14. Activation of dormant secondary metabolite production by introducing neomycin resistance into the deep-sea fungus, Aspergillus versicolor ZBY-3.


    Dong, Yuan; Cui, Cheng-Bin; Li, Chang-Wei; Hua, Wei; Wu, Chang-Jing; Zhu, Tian-Jiao; Gu, Qian-Qun


    A new ultrasound-mediated approach has been developed to introduce neomycin-resistance to activate silent pathways for secondary metabolite production in a bio-inactive, deep-sea fungus, Aspergillus versicolor ZBY-3. Upon treatment of the ZBY-3 spores with a high concentration of neomycin by proper ultrasound irradiation, a total of 30 mutants were obtained by single colony isolation. The acquired resistance of the mutants to neomycin was confirmed by a resistance test. In contrast to the ZBY-3 strain, the EtOAc extracts of 22 of the 30 mutants inhibited the human cancer K562 cells, indicating that these mutants acquired a capability to produce antitumor metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses of the EtOAc extracts of seven bioactive mutants and the ZBY-3 strain indicated that diverse secondary metabolites have been newly produced in the mutant extracts in contrast to the ZBY-3 extract. The followed isolation and characterization demonstrated that six metabolites, cyclo(D-Pro-D-Phe) (1), cyclo(D-Tyr-D-Pro) (2), phenethyl 5-oxo-L-prolinate (3), cyclo(L-Ile-L-Pro) (4), cyclo(L-Leu-L-Pro) (5) and 3β,5α,9α-trihydroxy-(22E,24R)-ergosta-7,22-dien-6-one (6), were newly produced by the mutant u2n2h3-3 compared to the parent ZBY-3 strain. Compound 3 was a new compound; 2 was isolated from a natural source for the first time, and all of these compounds were also not yet found in the metabolites of other A. versicolor strains. Compounds 1-6 inhibited the K562 cells, with inhibition rates of 54.6% (1), 72.9% (2), 23.5% (3), 29.6% (4), 30.9% (5) and 51.1% (6) at 100 μg/mL, and inhibited also other human cancer HL-60, BGC-823 and HeLa cells, to some extent. The present study demonstrated the effectiveness of the ultrasound-mediated approach to activate silent metabolite production in fungi by introducing acquired resistance to aminoglycosides and its potential for discovering new compounds from silent fungal

  15. Complete dissociation and reassembly behavior as studied by using poly(ethylene glycol)-block-poly(glutamate sodium) and kanamycin A.


    Wen, Hao; Pan, Wei; Zhou, Jihan; Li, Zhibo; Liang, Dehai


    Kanamycin A, an amino modified sugar, can interact with poly(ethylene glycol)-block-poly(glutamate sodium) (PEG114-PGlu64) via electrostatic interactions (with PGlu) and hydrogen bonding (with PEG). The interplay of these two forces determines the assembly process and the resulting structure. In deionized water, kanamycin A and PEG114-PGlu64 form a spherical structure at [+]/[-] = 3.5. This structure dissociates instantly and completely in the presence of 30 mM NaCl. However, a new structure is reassembled in about 2 hours. A similar phenomenon is observed when the buffer pH is increased from 7.8 to 8.3. We attribute the distinct dissociation/reassembly process to the reestablishment of the balance between electrostatic interactions and hydrogen bonding. The dissociation/reassembly process in response to environmental changes offers a novel approach to release the loaded cargo in a controlled manner.

  16. Transformation of Acinetobacter sp. Strain BD413(pFG4ΔnptII) with Transgenic Plant DNA in Soil Microcosms and Effects of Kanamycin on Selection of Transformants

    PubMed Central

    Nielsen, Kaare M.; van Elsas, Jan D.; Smalla, Kornelia


    Here we show that horizontal transfer of DNA, extracted from transgenic sugar beets, to bacteria, based on homologous recombination, can occur in soil. Restoration of a 317-bp-deleted nptII gene in Acinetobacter sp. strain BD413(pFG4) cells incubated in sterile soil microcosms was detected after addition of nutrients and transgenic plant DNA encoding a functional nptII gene conferring bacterial kanamycin resistance. Selective effects of the addition of kanamycin on the population dynamics of Acinetobacter sp. cells in soil were found, and high concentrations of kanamycin reduced the CFU of Acinetobacter sp. cells from 109 CFU/g of soil to below detection. In contrast to a chromosomal nptII-encoded kanamycin resistance, the pFG4-generated resistance was found to be unstable over a 31-day incubation period in vitro. PMID:10698801

  17. Synthesis, characterization and in vitro evaluation of amphiphilic ion pairs of erythromycin and kanamycin antibiotics with liposaccharides.


    Pignatello, Rosario; Simerska, Pavla; Leonardi, Antonio; Abdelrahim, Adel S; Petronio, Giulio Petronio; Fuochi, Virginia; Furneri, Pio Maria; Ruozi, Barbara; Toth, Istvan


    The hydrophilic ion paring strategy (HIP) is a method explored to improve the cell/tissue uptake of poorly adsorbed drugs and to optimize their physico-chemical characteristics. In this context, we here describe the synthesis of some ion pairs of two model cationic antibiotics, erythromycin (ERY) and kanamycin A (KAN), with liposaccharides having different levels of lipophilicity and charge. The formation of drug-liposaccharide complexes was confirmed by Fourier transform infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD) analysis. The effect of the amphiphilic liposaccharide moieties on the antimicrobial activity of ERY and KAN was assessed by measuring the minimal inhibitory concentration (MIC) of the compounds against a panel of bacterial strains that were susceptible or resistant to the parent antibiotics. The ion pairing did not depress the in vitro antibiotic activity, although no lowering of MIC values was registered. The experimental findings would motivate the future investigation of this ion pairing strategy in drug design, for instance allowing improvement of the encapsulation efficiency of hydrophilic antibiotics in lipid-based nanocarriers, or changing their in vivo biodistribution and pharmacokinetic profile.

  18. Immunosensor based on magnetic relaxation switch and biotin-streptavidin system for the detection of Kanamycin in milk.


    Chen, Yi Ping; Zou, Ming qiang; Qi, Cai; Xie, Meng-Xia; Wang, Da-Ning; Wang, Yan-Fei; Xue, Qiang; Li, Jin-Feng; Chen, Yan


    A rapid, sensitive, and simple immunosensor was developed for the detection of Kanamycin (KM) in milk. This immunosensor is based on magnetic relaxation switch (MRS) assay and biotin-streptavidin system (B-SA system). The target analyte (KM) competed with those on the surface of the superparamagnetic iron oxide (SPIO) nanoparticles and hence affected the formation of SPIO aggregates. The dispersed and aggregated states of SPIO can modulate the spin-spin relaxation time (T(2)) of the neighboring water molecule. T(2) was then changed as an effect of the target analyte. The B-SA system was used to amplify the SPIO binding, thus enhance the sensitivity. The detection working was 1.5 to 25.2ng mL(-1) and limit of detection (LOD) was determined to be 0.1ng mL(-1). The LOD of the immunosensor decreased tenfold, and its analysis time (45min) was much shorter than that of enzyme-linked immunosorbent assay (6h to 8h). The average recoveries of the KM at various spiking levels ranged from 80.2% to 85.6% with a relative standard deviation (RSD) below 4.0%. The results showed that the MRS immunosensor was a promising platform for the determination of small molecular residues because of its high sensitivity, specificity, homogeneity, and speed.

  19. Comparative study of kanamycin sulphate microparticles and nanoparticles for intramuscular administration: preparation in vitro release and preliminary in vivo evaluation.


    Mustafa, Sanaul; Devi, V Kusum; Pai, Roopa S


    Kanamycin sulphate (KS) is a Mycobacterium tuberculosis protein synthesis inhibitor. KS is polycationic, a property responsible for KS poor oral absorption half-life (2.5 h) and rapid renal clearance, which results in serious nephrotoxicity/ototoxicity. The current study aimed to develop KS-loaded PLGA vitamin-E-TPGS microparticles (MPs) and nanoparticles (NPs) to reduce the dosing frequency and dose-related adverse effect. In vitro release was sustained up to 10 days for KS PLGA-TPGS MPs and 13 days for KS PLGA-TPGS NPs in phosphate-buffered saline (PBS) pH 7.4. The in vivo pharmacokinetic test in Wistar rats showed that the AUC0-∞ of KS PLGA-TPGS NPs (280.58 μg/mL*min) was about 1.62-fold higher than that of KS PLGA-TPGS MPs (172.30 μg/mL*min). Further, in vivo protein-binding assay ascribed 1.20-fold increase in the uptake of KS PLGA-TPGS NPs through the alveolar macrophage (AM). The studies, therefore, could provide another useful tool for successful development of KS MPs and NPs.

  20. The combination effect of Korean red ginseng saponins with kanamycin and cefotaxime against methicillin-resistant Staphylococcus aureus.


    Sung, Woo Sang; Lee, Dong Gun


    Korean red ginseng saponins (ginsenosides) have been reported as having various biological properties, but the combinational effects with commercial antibiotics and the mode of action of ginsenosides remain mostly unknown. In this study, saponins were isolated from Korean red ginseng, and the antibacterial effects of ginsenosides were investigated. Ginsenosides showed antibacterial activities toward pathogenic Gram-positive and Gram-negative bacteria. To elucidate the antibacterial mode of action of ginsenosides, we measured the release of the fluorescent marker calcein from negatively charged PC/PG (1 : 1, w/w) liposomes, which mimic bacterial membranes. The results suggest that ginsenosides may exert antibacterial activity by disrupting the cell membrane. To estimate the general combination effects of ginsenosides and commercial antibiotics, such as kanamycin and cefotaxime, on antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA) strains that were clinically isolated from an infected patient, the fraction inhibitory concentration (FIC) indexes were determined by a checkerboard study. The FIC indexes showed synergistic or additive effects between the ginsenosides and antibiotics tested.

  1. Molecular recognition of 6'-N-5-hexynoate kanamycin A and RNA 1x1 internal loops containing CA mismatches.


    Tran, Tuan; Disney, Matthew D


    In our previous study to identify the RNA internal loops that bind an aminoglycoside derivative, we determined that 6'-N-5-hexynoate kanamycin A prefers to bind 1x1 nucleotide internal loops containing C·A mismatches. In this present study, the molecular recognition between a variety of RNAs that are mutated around the C·A loop and the ligand was investigated. Studies show that both loop nucleotides and loop closing pairs affect binding affinity. Most interestingly, it was shown that there is a correlation between the thermodynamic stability of the C·A internal loops and ligand affinity. Specifically, C·A loops that had relatively high or low stability bound the ligand most weakly whereas loops with intermediate stability bound the ligand most tightly. In contrast, there is no correlation between the likelihood that a loop forms a C-A(+) pair at lower pH and ligand affinity. It was also found that a 1x1 nucleotide C·A loop that bound to the ligand with the highest affinity is identical to the consensus site in RNAs that are edited by adenosine deaminases acting on RNA type 2 (ADAR2). These studies provide a detailed investigation of factors affecting small molecule recognition of internal loops containing C·A mismatches, which are present in a variety of RNAs that cause disease.

  2. Conformational Response of 30S-bound IF3 to A-Site Binders Streptomycin and Kanamycin.


    Chulluncuy, Roberto; Espiche, Carlos; Nakamoto, Jose Alberto; Fabbretti, Attilio; Milón, Pohl


    Aminoglycoside antibiotics are widely used to treat infectious diseases. Among them, streptomycin and kanamycin (and derivatives) are of importance to battle multidrug-resistant (MDR) Mycobacterium tuberculosis. Both drugs bind the small ribosomal subunit (30S) and inhibit protein synthesis. Genetic, structural, and biochemical studies indicate that local and long-range conformational rearrangements of the 30S subunit account for this inhibition. Here, we use intramolecular FRET between the C- and N-terminus domains of the flexible IF3 to monitor real-time perturbations of their binding sites on the 30S platform. Steady and pre-steady state binding experiments show that both aminoglycosides bring IF3 domains apart, promoting an elongated state of the factor. Binding of Initiation Factor IF1 triggers closure of IF3 bound to the 30S complex, while both aminoglycosides revert the IF1-dependent conformation. Our results uncover dynamic perturbations across the 30S subunit, from the A-site to the platform, and suggest that both aminoglycosides could interfere with prokaryotic translation initiation by modulating the interaction between IF3 domains with the 30S platform.

  3. Conformational Response of 30S-bound IF3 to A-Site Binders Streptomycin and Kanamycin

    PubMed Central

    Chulluncuy, Roberto; Espiche, Carlos; Nakamoto, Jose Alberto; Fabbretti, Attilio; Milón, Pohl


    Aminoglycoside antibiotics are widely used to treat infectious diseases. Among them, streptomycin and kanamycin (and derivatives) are of importance to battle multidrug-resistant (MDR) Mycobacterium tuberculosis. Both drugs bind the small ribosomal subunit (30S) and inhibit protein synthesis. Genetic, structural, and biochemical studies indicate that local and long-range conformational rearrangements of the 30S subunit account for this inhibition. Here, we use intramolecular FRET between the C- and N-terminus domains of the flexible IF3 to monitor real-time perturbations of their binding sites on the 30S platform. Steady and pre-steady state binding experiments show that both aminoglycosides bring IF3 domains apart, promoting an elongated state of the factor. Binding of Initiation Factor IF1 triggers closure of IF3 bound to the 30S complex, while both aminoglycosides revert the IF1-dependent conformation. Our results uncover dynamic perturbations across the 30S subunit, from the A-site to the platform, and suggest that both aminoglycosides could interfere with prokaryotic translation initiation by modulating the interaction between IF3 domains with the 30S platform. PMID:27983590

  4. A novel signal amplification strategy of an electrochemical aptasensor for kanamycin, based on thionine functionalized graphene and hierarchical nanoporous PtCu.


    Qin, Xiaoli; Yin, Yan; Yu, Huijing; Guo, Wenjuan; Pei, Meishan


    An ultrasensitive electrochemical aptasensor for the quantitative detection of kanamycin antibiotic was fabricated based on a novel signal amplification strategy. This aptasensor was developed using thionine functionalized graphene (GR-TH) and hierarchical nanoporous (HNP) PtCu alloy as biosensing substrates for the first time. HNP-PtCu alloy with controllable bimodal ligament/pore distributions was successfully prepared by two-step dealloying of a well-designed PtCuAl precursor alloy combined with an annealing operation. GR-TH composite was synthesized by one-step reduction of graphene oxide (GO) in TH solution. Greatly amplified sensitivity was achieved by using GR-TH/HNP-PtCu composite owing to its large specific surface and good electron-transfer ability. Under the optimized conditions, the proposed aptasensor exhibited a high sensitivity and a wider linearity to kanamycin in the range 5 × 10(-7)-5 × 10(-2) μgmL(-1) with a low detection limit of 0.42 pgmL(-1). This aptasensor also displayed a satisfying electrochemical performance with good stability, selectivity and reproducibility. The as-prepared aptasensor was successfully used for the determination of kanamycin in animal derived food.

  5. Gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAu(rod)) nanocapsules for drug delivery and photothermal therapy on bacteria.


    Hu, Bo; Zhang, Li-Pei; Chen, Xu-Wei; Wang, Jian-Hua


    A hybrid bactericidal material, gold nanorod-covered kanamycin-loaded hollow SiO(2) (HSKAu(rod)) nanocapsules, is constructed. The hybrid material combines the features of a chemical drug with photothermal physical sterilization which decreases the dosage of broad-spectrum antibiotic and the physical damage of biological systems. Hollow SiO(2) nanocapsules are used as carriers for drug delivery. The nanocapsules load a model drug, kanamycin, and are covered with gold nanorods to avoid drug leakage and realize photothermal treatment. The sterilizing effect on the bacterial strain is investigated by incubating E. coli BL21 with the hybrid nanocapsules and irradiating under near-infrared light (NIR) for 20 min. A bactericidal effect, i.e., a sterilizing rate of 53.47%, is achieved for the HSKAu(rod) nanocapsules under NIR irradiation, with respect to a net sum sterilizing rate of 34.49% for the individual components of the HSKAu(rod) nanocapsules, e.g., carrier nanocapsules, chemical sterilization of kanamycin and physical sterilization due to the gold nanorods under NIR irradiation. It is demonstrated that the combination of chemical drug and physical sterilization results in an obvious synergistic effect and makes the sterilization more effective. This novel hybrid has great potential as an adjuvant therapeutic alternative material for sterilization or even for the control of disease.

  6. Gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAurod) nanocapsules for drug delivery and photothermal therapy on bacteria

    NASA Astrophysics Data System (ADS)

    Hu, Bo; Zhang, Li-Pei; Chen, Xu-Wei; Wang, Jian-Hua


    A hybrid bactericidal material, gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAurod) nanocapsules, is constructed. The hybrid material combines the features of a chemical drug with photothermal physical sterilization which decreases the dosage of broad-spectrum antibiotic and the physical damage of biological systems. Hollow SiO2 nanocapsules are used as carriers for drug delivery. The nanocapsules load a model drug, kanamycin, and are covered with gold nanorods to avoid drug leakage and realize photothermal treatment. The sterilizing effect on the bacterial strain is investigated by incubating E. coli BL21 with the hybrid nanocapsules and irradiating under near-infrared light (NIR) for 20 min. A bactericidal effect, i.e., a sterilizing rate of 53.47%, is achieved for the HSKAurod nanocapsules under NIR irradiation, with respect to a net sum sterilizing rate of 34.49% for the individual components of the HSKAurod nanocapsules, e.g., carrier nanocapsules, chemical sterilization of kanamycin and physical sterilization due to the gold nanorods under NIR irradiation. It is demonstrated that the combination of chemical drug and physical sterilization results in an obvious synergistic effect and makes the sterilization more effective. This novel hybrid has great potential as an adjuvant therapeutic alternative material for sterilization or even for the control of disease.

  7. Antibiotic resistance of lactic acid bacteria isolated from Chinese yogurts.


    Zhou, N; Zhang, J X; Fan, M T; Wang, J; Guo, G; Wei, X Y


    The aim of this study was to evaluate the susceptibility of 43 strains of lactic acid bacteria, isolated from Chinese yogurts made in different geographical areas, to 11 antibiotics (ampicillin, penicillin G, roxithromycin, chloramphenicol, tetracycline, chlortetracycline, lincomycin, kanamycin, streptomycin, neomycin, and gentamycin). The 43 isolates (18 Lactobacillus bulgaricus and 25 Streptococcus thermophilus) were identified at species level and were typed by random amplified polymorphic DNA analysis. Thirty-five genotypically different strains were detected and their antimicrobial resistance to 11 antibiotics was determined using the agar dilution method. Widespread resistance to ampicillin, chloramphenicol, chlortetracycline, tetracyclines, lincomycin, streptomycin, neomycin, and gentamycin was found among the 35 strains tested. All of the Strep. thermophilus strains tested were susceptible to penicillin G and roxithromycin, whereas 23.5 and 64.7% of Lb. bulgaricus strains, respectively, were resistant. All of the Strep. thermophilus and Lb. bulgaricus strains were found to be resistant to kanamycin. The presence of the corresponding resistance genes in the resistant isolates was investigated through PCR, with the following genes detected: tet(M) in 1 Lb. bulgaricus and 2 Strep. thermophilus isolates, ant(6) in 2 Lb. bulgaricus and 2 Strep. thermophilus isolates, and aph(3')-IIIa in 5 Lb. bulgaricus and 2 Strep. thermophilus isolates. The main threat associated with these bacteria is that they may transfer resistance genes to pathogenic bacteria, which has been a major cause of concern to human and animal health. To our knowledge, the aph(3')-IIIa and ant(6) genes were found in Lb. bulgaricus and Strep. thermophilus for the first time. Further investigations are required to analyze whether the genes identified in Lb. bulgaricus and Strep. thermophilus isolates might be horizontally transferred to other species. Copyright © 2012 American Dairy Science

  8. Molecular and phenotypic characterization of multidrug-resistant Mycobacterium tuberculosis isolates resistant to kanamycin, amikacin, and capreomycin in China.


    Zhang, Z; Liu, M; Wang, Y; Pang, Y; Kam, K M; Zhao, Y


    Although second-line anti-tuberculosis (TB) injectable drugs have been widely used to improve treatment outcomes of multidrug-resistant TB (MDR-TB), little is known about the prevalence and mechanism of second-line injectable drug resistance among MDR Mycobacterium tuberculosis isolates in China. Here, we found that 12.7 % (20/158) of isolates showed resistance to at least one second-line injectable drug among 158 MDR isolates. At the same time, there were 16 (10.1 %) strains resistant to kanamycin (KAN), 9 (5.7 %) to amikacin (AMK), and 12 (7.6 %) to capreomycin (CAP). In addition, our data revealed no significant difference in the drug resistance patterns for Beijing versus non-Beijing genotype strains (p > 0.05). The most frequently observed mutation was A-to-G substitution at position 1401 of the rrs gene, conferring high-level resistance to KAN and AMK, but had varying minimum inhibitory concentrations (MICs) for CAP. The mutations in the eis promoter and tlyA gene were responsible for low-level resistance to CAP. 83.3 % of A1401G substitutions in the rrs gene was observed in Beijing genotype strains, while the difference was not significant (p = 0.157). Our data demonstrated that the hot-spot regions localized in the rrs gene serve as excellent markers for AMK, but is not a sensitive marker for KAN and CAP. In addition, the cross-resistance patterns and MICs differed among different genetic mutation types, which challenge the practice in China of generalizing resistance to AMK and CAP based on the resistance to KAN alone. Our findings suggested that the individualized drug susceptibility to three major second-line injectable drugs is essential in order to generate more effective treatment regimens for MDR patients.

  9. Successful treatment of a LifeSite Hemodialysis Access System pocket infection with large-volume kanamycin solution irrigation.


    Ross, John R


    Bridge devices-dialysis catheters and subcutaneous access devices-play a critical role in increasing the placement of arteriovenous (AV) fistulas by providing hemodialysis vascular access while AV fistulas mature. The LifeSite Hemodialysis Access System (Vasca Inc, Tewskburg, MA), a fully implantable, subcutaneous dual valve access system, has been shown to have lower complication rates, higher blood flow rates, and better long-term device survival than conventional tunneled hemodialysis catheters, indicating it may better meet the requirements for optimally bridging to a fistula. This case study of a 48-year-old black man undergoing chronic hemodialysis for renal failure because of insulin-dependent diabetes describes a simple approach for resolving localized pocket infections associated with the LifeSite System by drip irrigation of the valves and tissue pockets with an antibiotic solution. Eight weeks after implantation of the LifeSite System, the patient exhibited symptoms of infection of the lateral LifeSite valve tissue pocket, which on culture was shown to be caused by Staphylococcus aureus. Flushing the LifeSite valve and tissue pocket with a large volume of kanamycin solution, in conjunction with intravenous vancomycin and routine irrigation of the valve with isopropyl alcohol, resolved the infection after 1 treatment. The LifeSite System successfully bridged the patient to a transposed basilic vein fistula created through a 2-stage surgical procedure. The LifeSite System provided uninterrupted access for hemodialysis over a period of 6 months while the fistula matured. The LifeSite System should allow surgeons to attempt fistula construction in more patients, including diabetics, access-challenged patients, and patients with small vessels, who may benefit from a nontraditional surgical approach toward fistula creation.

  10. Synthesis of C-5, C-2' and C-4'-neomycin-conjugated triplex forming oligonucleotides and their affinity to DNA-duplexes.


    Tähtinen, Ville; Granqvist, Lotta; Virta, Pasi


    Neomycin-conjugated homopyrimidine oligo 2'-deoxyribonucleotides have been synthesized on a solid phase and their potential as triplex forming oligonucleotides (TFOs) with DNA-duplexes has been studied. For the synthesis of the conjugates, C-5, C-2' and C-4'-tethered alkyne-modified nucleoside derivatives were used as an integral part of the standard automated oligonucleotide chain elongation. An azide-derived neomycin was then conjugated to the incorporated terminal alkynes by Cu(I)-catalyzed 1,3-dipolar cycloaddition (the click chemistry). Concentrated ammonia released the desired conjugates in acceptable purity and yields. The site of conjugation was expectedly important for the Hoogsteen-face recognition: C-5-conjugation showed a notable positive effect, whereas the influence of the C-2' and C-4'-modification remained marginal. In addition to conventional characterization methods (UV- and CD-spectroscopy), (19)F NMR spectroscopy was applied for the monitoring of triplex/duplex/single strand-conversions.

  11. Activation of the silent secondary metabolite production by introducing neomycin-resistance in a marine-derived Penicillium purpurogenum G59.


    Wu, Chang-Jing; Yi, Le; Cui, Cheng-Bin; Li, Chang-Wei; Wang, Nan; Han, Xiao


    Introduction of neomycin-resistance into a marine-derived, wild-type Penicillium purpurogenum G59 resulted in activation of silent biosynthetic pathways for the secondary metabolite production. Upon treatment of G59 spores with neomycin and dimethyl sulfoxide (DMSO), a total of 56 mutants were obtained by single colony isolation. The acquired resistance of mutants to neomycin was testified by the resistance test. In contrast to the G59 strain, the EtOAc extracts of 28 mutants inhibited the human cancer K562 cells, indicating that the 28 mutants have acquired the capability to produce bioactive metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses further indicated that diverse secondary metabolites have been newly produced in the bioactive mutant extracts. Followed isolation and characterization demonstrated that five bioactive secondary metabolites, curvularin (1), citrinin (2), penicitrinone A (3), erythro-23-O-methylneocyclocitrinol (4) and 22E-7α-methoxy-5α, 6α-epoxyergosta-8(14),22-dien-3β-ol (5), were newly produced by a mutant, 4-30, compared to the G59 strain. All 1-5 were also not yet found in the secondary metabolites of other wild type P. purpurogenum strains. Compounds 1-5 inhibited human cancer K562, HL-60, HeLa and BGC-823 cells to varying extents. Both present bioassays and chemical investigations demonstrated that the introduction of neomycin-resistance into the marine-derived fungal G59 strain could activate silent secondary metabolite production. The present work not only extended the previous DMSO-mediated method for introducing drug-resistance in fungi both in DMSO concentrations and antibiotics, but also additionally exemplified effectiveness of this method for activating silent fungal secondary metabolites. This method could be applied to other fungal isolates to elicit their metabolic potentials to investigate secondary metabolites from silent biosynthetic pathways.

  12. Neuropharmacological characterization of voltage-sensitive calcium channels: possible existence of neomycin-sensitive, omega-conotoxin GVIA- and dihydropyridines-resistant calcium channels in the rat brain.


    Yamada, K; Teraoka, T; Morita, S; Hasegawa, T; Nabeshima, T


    We attempted to characterize the functional roles of subtypes of voltage-sensitive calcium channels in the brain. The maximal number of [125I]omega-conotoxin GVIA (omega-CTX) binding sites in rat brain associated with N-type calcium channels (N-channels) was approximately 10 times more than that of [3H]-PN200-110 associated with L-type calcium channels (L-channels). [125I]omega-CTX binding was inhibited by aminoglycoside antibiotics, neomycin and dynorphin A(1-13), but not by various classes of L-channel antagonists. A 6-hydroxydopamine-induced lesion of the striatum resulted in a marked reduction of both [125I]-omega-CTX and [3H]PN200-110 binding. Kainic acid-induced lesion of the striatum reduced [3H]PN200-110 binding by 57%, but did not reduce [125I]omega-CTX binding. Omega-CTX produced a small (18%) but significant reduction of potassium-stimulated Ca2+ influx into rat brain synaptosomes, although it produced a concentration-dependent inhibition in chick brain synaptosomes. Neomycin inhibited Ca2+ influx in both preparations in a concentration-dependent manner. Both omega-CTX and neomycin inhibited potassium-stimulated [3H]dopamine (DA) release from rat striatal slices. The L-channel antagonists had no effect on either Ca2+ influx or [3H]DA release. These results suggest that DA release in the striatum is regulated by Ca2+ influx through N-channels located in presynaptic nerve terminals, and that the most of the Ca2+ influx in rat brain appears to be governed by neomycin-sensitive, omega-CTX- and DHP-resistant calcium channels.

  13. Comparing amikacin and kanamycin-induced hearing loss in multidrug-resistant tuberculosis treatment under programmatic conditions in a Namibian retrospective cohort.


    Sagwa, Evans L; Ruswa, Nunurai; Mavhunga, Farai; Rennie, Timothy; Leufkens, Hubert G M; Mantel-Teeuwisse, Aukje K


    Amikacin and kanamycin are mainly used for treating multidrug-resistant tuberculosis (MDR-TB), especially in developing countries where the burden of MDR-TB is highest. Their protracted use in MDR-TB treatment is known to cause dose-dependent irreversible hearing loss, requiring hearing aids, cochlear implants or rehabilitation. Therapeutic drug monitoring and regular audiological assessments may help to prevent or detect the onset of hearing loss, but these services are not always available or affordable in many developing countries. We aimed to compare the cumulative incidence of hearing loss among patients treated for MDR-TB with amikacin or kanamycin-based regimens, and to identify the most-at-risk patients, based on the real-life clinical practice experiences in Namibia. We conducted a retrospective cohort study of patients treated with amikacin or kanamycin-based regimens in four public sector MDR-TB treatment sites in Namibia between June 2004 and March 2014. Patients were audiologically assessed as part of clinical care. The study outcome was the occurrence of any hearing loss. Data were manually extracted from patients' treatment records. We compared proportions using the Chi-square test; applied stratified analysis and logistic regression to study the risk of hearing loss and to identify the most-at-risk patients through effect-modification analysis. A P-value < 0.05 was statistically significant. All 353 patients had normal baseline hearing, 46 % were HIV co-infected. Cumulative incidence of any hearing loss was 58 %, which was mostly bilateral (83 %), and mild (32 %), moderate (23 %), moderate-severe (16 %), severe (10 %), or profound (15 %). Patients using amikacin had a greater risk of developing the more severe forms of hearing loss than those using kanamycin (adjusted odds ratio (OR) = 4.0, 95 % CI: 1.5-10.8). Patients co-infected with HIV (OR = 3.4, 95 % CI: 1.1-10.6), males (OR = 4.5, 95 %1.5-13.4) and those with lower

  14. Reduced TRMU expression increases the sensitivity of hair-cell-like HEI-OC-1 cells to neomycin damage in vitro

    PubMed Central

    He, Zuhong; Sun, Shan; Waqas, Muhammad; Zhang, Xiaoli; Qian, Fuping; Cheng, Cheng; Zhang, Mingshu; Zhang, Shasha; Wang, Yongming; Tang, Mingliang; Li, Huawei; Chai, Renjie


    Aminoglycosides are ototoxic to the cochlear hair cells, and mitochondrial dysfunction is one of the major mechanisms behind ototoxic drug-induced hair cell death. TRMU (tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase) is a mitochondrial protein that participates in mitochondrial tRNA modifications, but the role of TRMU in aminoglycoside-induced ototoxicity remains to be elucidated. In this study, we took advantage of the HEI-OC-1 cell line to investigate the role of TRMU in aminoglycoside-induced cell death. We found that TRMU is expressed in both hair cells and HEI-OC-1 cells, and its expression is significantly decreased after 24 h neomycin treatment. We then downregulated TRMU expression with siRNA and found that cell death and apoptosis were significantly increased after neomycin injury. Furthermore, when we down-regulated TRMU expression, we observed significantly increased mitochondrial dysfunction and increased levels of reactive oxygen species (ROS) after neomycin injury, suggesting that TRMU regulates mitochondrial function and ROS levels. Lastly, the antioxidant N-acetylcysteine rescued the mitochondrial dysfunction and cell apoptosis that was induced by TRMU downregulation, suggesting that ROS accumulation contributed to the increased aminoglycosides sensitivity of HEI-OC-1 cells after TRMU downregulation. This study provides evidence that TRMU might be a new therapeutic target for the prevention of aminoglycoside-induced hair cell death. PMID:27405449

  15. Determination of neomycin and oxytetracycline in the presence of their impurities in veterinary dosage forms by high-performance liquid chromatography/tandem mass spectrometry.


    Vucićević-Prcetić, Katarina; Cservenák, Robert; Radulović, Niko


    Two HPLC/MS/MS methods, one for determination of neomycin sulfate and the other for determination of oxytetracycline hydrochloride in the presence of their impurities, were developed and validated. Separations were achieved with gradient elution on a C18 column. All components were ionized by positive-ion electrospray and detected by multiple reaction monitoring. Calibration curves were linear, with correlation coefficients >0.99. Precision of the methods was confirmed by RSD values of 0.34 and 0.71% for neomycin and oxytetracycline, respectively. Recovery values of 101.5 and 101.0%, respectively, indicated adequate accuracy. Analysis time for neomycin was 24 min, with the retention time of the main compound at 10.1 min; for oxytetracycline, the analysis time was 18 min, with the main peak at 9.95 min. Longer retention times than expected were a consequence of the necessity of chromatographic separation of isomers with the same ion transition. All impurities defined in the pharmacopoeias were determined and their identities confirmed. The methods were tested for QC of veterinary dosage forms (commercial powders and injections containing these antibiotics).

  16. Treatment of familial staphylococcal infection--comparison of mupirocin nasal ointment and chlorhexidine/neomycin (Naseptin) cream in eradication of nasal carriage.


    Leigh, D A; Joy, G


    Twenty-six families with recurrent staphylococcal infections were treated with either mupirocin nasal ointment (group M) or chlorhexidine neomycin (Naseptin) cream (group N) to the anterior nares, each combined with chlorhexidine soap for washing and chlorhexidine powder applied to other possible carriage sites. Patients receiving mupirocin following failure with chlorhexidine/neomycin (group M/N) were also treated. Treatment was given for seven days to 99 patients, 32 index (infected) patients and 67 family members. Follow-up swabs were collected by a study nurse 8, 14, 28, and 91 days after starting treatment. The carriage of Staphylococcus aureus in the anterior nares was 67%, in the axillae 22%, in the groin 23%, and perianal 19%. The carriage rates in the index patients was higher than family members, in all sites. The eradication of S. aureus from the nasal carriage site after therapy at 8 days was 95% in group M, 85% in group M/N and 61% in group N. Recolonization during the follow-up period was much less in those treated with mupirocin: 57% of patients in group M and 42% in group M/N were not carriers at 91 days, whereas 89% of patients group N were again colonized. Assessment clinically and in terms of prevention of further infective lesions showed that there was a higher response to mupirocin than to chlorhexidine/neomycin. Mupirocin nasal is a successful therapy for removing nasal carriage of S. aureus and has a prolonged effect on recolonization.

  17. c-Myb knockdown increases the neomycin-induced damage to hair-cell-like HEI-OC1 cells in vitro

    PubMed Central

    Yu, Xiaoyu; Liu, Wenwen; Fan, Zhaomin; Qian, Fuping; Zhang, Daogong; Han, Yuechen; Xu, Lei; Sun, Gaoying; Qi, Jieyu; Zhang, Shasha; Tang, Mingliang; Li, Jianfeng; Chai, Renjie; Wang, Haibo


    c-Myb is a transcription factor that plays a key role in cell proliferation, differentiation, and apoptosis. It has been reported that c-Myb is expressed within the chicken otic placode, but whether c-Myb exists in the mammalian cochlea, and how it exerts its effects, has not been explored yet. Here, we investigated the expression of c-Myb in the postnatal mouse cochlea and HEI-OC1 cells and found that c-Myb was expressed in the hair cells (HCs) of mouse cochlea as well as in cultured HEI-OC1 cells. Next, we demonstrated that c-Myb expression was decreased in response to neomycin treatment in both cochlear HCs and HEI-OC1 cells, suggesting an otoprotective role for c-Myb. We then knocked down c-Myb expression with shRNA transfection in HEI-OC1 cells and found that c-Myb knockdown decreased cell viability, increased expression of pro-apoptotic factors, and enhanced cell apoptosis after neomycin insult. Mechanistic studies revealed that c-Myb knockdown increased cellular levels of reactive oxygen species and decreased Bcl-2 expression, both of which are likely to be responsible for the increased sensitivity of c-Myb knockdown cells to neomycin. This study provides evidence that c-Myb might serve as a new target for the prevention of aminoglycoside-induced HC loss. PMID:28112219

  18. The expression of NLRX1 in C57BL/6 mice cochlear hair cells: Possible relation to aging- and neomycin-induced deafness.


    Yang, Qianqian; Sun, Gaoying; Cao, Zhixin; Yin, Haiyan; Qi, Qi; Wang, Jinghan; Liu, Wenwen; Bai, Xiaohui; Wang, Haibo; Li, Jianfeng


    Nucleotide-binding domain and leucine-rich-repeat-containing family member X1 (NLRX1) is a cytoplasmic pattern recognition receptor that is predominantly located in mitochondria, which is tightly related to mitochondrial damage, reactive oxygen species (ROS) production, inflammation and apoptosis. The present study was designed to explore whether NLRX1 expresses in C57BL/6 mice cochlear hair cells and, if so, to investigate the possible correlations between NLRX1 and hearing. The location and dynamic expression of NLRX1 were investigated by immunofluorescence, real-time PCR and Western blotting. Hearing thresholds of C57BL/6 mice were measured by auditory brainstem response (ABR). Moreover, the downstream inflammatory and apoptotic pathways regulated by NLRX1 were examined in age-related and neomycin-induced hair cell damage. Data showed that NLRX1 expressed in cytoplasm of C57BL/6 cochlear hair cells, especially in the cilia, which were essential for sound sensation. The expression of NLRX1 in hair cells increased as the mice grew up, and, decreased as they aged. Additionally, the activated apoptotic JNK pathway was detected in 9-month old mice with worse-hearing and 3-month old mice treated with neomycin. Overall, results indicate that NLRX1 may relate to hair cell maturity, hearing formation and maintenance, and promote hair cell apoptosis through JNK pathway induced by aging and neomycin.

  19. c-Myb knockdown increases the neomycin-induced damage to hair-cell-like HEI-OC1 cells in vitro.


    Yu, Xiaoyu; Liu, Wenwen; Fan, Zhaomin; Qian, Fuping; Zhang, Daogong; Han, Yuechen; Xu, Lei; Sun, Gaoying; Qi, Jieyu; Zhang, Shasha; Tang, Mingliang; Li, Jianfeng; Chai, Renjie; Wang, Haibo


    c-Myb is a transcription factor that plays a key role in cell proliferation, differentiation, and apoptosis. It has been reported that c-Myb is expressed within the chicken otic placode, but whether c-Myb exists in the mammalian cochlea, and how it exerts its effects, has not been explored yet. Here, we investigated the expression of c-Myb in the postnatal mouse cochlea and HEI-OC1 cells and found that c-Myb was expressed in the hair cells (HCs) of mouse cochlea as well as in cultured HEI-OC1 cells. Next, we demonstrated that c-Myb expression was decreased in response to neomycin treatment in both cochlear HCs and HEI-OC1 cells, suggesting an otoprotective role for c-Myb. We then knocked down c-Myb expression with shRNA transfection in HEI-OC1 cells and found that c-Myb knockdown decreased cell viability, increased expression of pro-apoptotic factors, and enhanced cell apoptosis after neomycin insult. Mechanistic studies revealed that c-Myb knockdown increased cellular levels of reactive oxygen species and decreased Bcl-2 expression, both of which are likely to be responsible for the increased sensitivity of c-Myb knockdown cells to neomycin. This study provides evidence that c-Myb might serve as a new target for the prevention of aminoglycoside-induced HC loss.

  20. Development of enzyme-linked immunosorbent assay (ELISA) for the detection of neomycin residues in pig muscle, chicken muscle, egg, fish, milk and kidney.


    Wang, S; Xu, B; Zhang, Y; He, J X


    A colorimetric competitive direct enzyme-linked immunosorbent assay (ELISA) method was developed using polyclonal antibody to determine neomycin residues in food of animal origin. No cross-reactivity of the antibody was observed with other aminoglycosides. The limit of detection of the method was 0.1μg/kg. A simple and efficient sample extraction method was established with recoveries of neomycin ranged from 75% to 105%. The detection limits were 5μg/kg(l) in pig muscle, chicken muscle, fish and milk, 10μg/kg in kidney and 20μg/kg in egg, respectively. Chemiluminescence assay was developed for detecting neomycin residues in pig muscle and chicken muscle. The limit of detection of the method was 0.015μg/kg, and the detection limits were 1.5μg/kg in pig muscle and 6μg/kg in chicken muscle. The ELISA tests were validated by HPLC, and the results showed a good correlation (r(2)) which was greater than 0.9.

  1. 60Co-irradiation as an alternate method for sterilization of penicillin G, neomycin, novobiocin, and dihydrostreptomycin

    SciTech Connect

    Tsuji, K.; Rahn, P.D.; Steindler, K.A.


    The effects of the use of 60Co-irradiation to sterilize antibiotics were evaluated. The antibiotic powders were only occasionally contaminated with microorganisms. The D-values of the products and environmental isolates were 0.028, 0.027, 0.015, 0.046, 0.15, 0.018, and 0.19 Mrads for Aspergillus species (UC 7297, 7298), A. fumigatus (UC 7299), Rhodotorula species (UC 7300), Penicillium oxalicum (UC 7269), Pseudomonas maltophilia (UC 6855), and a biological indicator microorganism, Bacillus pumilus spores (ATCC 27142). An irradiation dose of 1.14 Mrads, therefore, was sufficient to achieve a six-log cycle destruction of B. pumilus spores. Based on the bioburden data, a minimum irradiation dose of 1.05 Mrads was calculated to be sufficient to obtain a 10(-6) probability of sterilizing the most radioresistant isolate, Pen. oxalicum. To determine the radiolytic degradation scheme and the stability of the antibiotics following irradiation, high-performance liquid chromatographic (HPLC) methods were developed. The resulting rates of degradation for the antibiotics were 0.6, 1.2, 2.3, and 0.95%/Mrad for penicillin G, neomycin, novobiocin, and dihydrostreptomycin, respectively. Furthermore, radiolytic degradation pathways for the antibiotics were identified and found to be similar to those commonly encountered when antibiotics are subjected to acidic, basic, hydrolytic, or oxidative treatments. No radiolytic compounds unique to 60Co-irradiation were found.

  2. The Tat antagonist neomycin B hexa-arginine conjugate inhibits gp-120-induced death of human neuroblastoma cells.


    Catani, Maria Valeria; Corasaniti, Maria Tiziana; Ranalli, Marco; Amantea, Diana; Litovchick, Alexander; Lapidot, Aviva; Melino, Gerry


    Several patients with acquired immunodeficiency syndrome (AIDS) develop neurological complications, which are referred to as human immunodeficiency virus (HIV)-associated dementia (HAD). The HIV-1 coat glycoprotein gp-120 has been proposed as the major etiologic agent for neuronal loss reported postmortem in the brain of AIDS patients. Chemokine receptors may play a role in gp-120-triggered neurotoxicity, both in vitro and in vivo, thus being an intriguing target for developing therapeutic strategies aimed to prevent or reduce neuronal damage occurring during HIV infection. We have previously shown that human CHP100 neuroblastoma cells express CXCR4 and CCR5 chemokine receptors and that interaction between gp-120 and these receptors contributes to cytotoxicity elicited by the protein. Here, we examined the neuroprotective potential of neomycin B hexa-arginine conjugate (NeoR), a recently synthesized compound with anti-HIV activity. We found that gp-120-triggered death is significantly reduced by NeoR, and this protective effect seems related to the ability of NeoR to interact with CXCR4 receptors. The ability of NeoR to cross the blood-brain barrier, as demonstrated in mice by systemic administration of the fluorescein conjugate drug, makes this compound a powerful and attractive therapeutic agent.

  3. Development of a novel pH sensitive silane crosslinked injectable hydrogel for controlled release of neomycin sulfate.


    Jabeen, Sehrish; Islam, Atif; Ghaffar, Abdul; Gull, Nafisa; Hameed, Ayesha; Bashir, Anbreen; Jamil, Tahir; Hussain, Tousif


    Silane crosslinked biopolymer based novel pH-responsive hydrogels were fabricated by blending the cationic (chitosan) and anionic (alginate) polymers with poly(vinyl alcohol). Tetraethoxysilane (TEOS) was used, as a crosslinker in different amounts due to its nonhazardous nature, to study its impact on physical and chemical properties of the prepared injectable hydrogels along with the controlled release of drug. The swelling response of the prepared hydrogels was examined in different solvent media which exhibited decreased swelling ratio with increase in the amount of TEOS. All the fabricated hydrogels represented highest swelling at acidic pH while low swelling at basic and neutral pH. This specific pH sensitive behavior at pH 7 made them an appropriate candidate for the injectable controlled drug delivery in which Neomycin Sulfate (NMS) was successfully loaded on suitable hydrogel (comprising 50μL TEOS) to study its release mechanism. The results revealed that in simulated gastric fluid (SGF), hydrogel released the entire drug (NMS) in initial 30min while in simulated intestinal fluid (SIF), NMS was released in a controlled way up to 83% in 80min. These results endorsed that the hydrogels could be practiced as a smart intelligent material for injectable controlled drug delivery as well as for other biomedical applications at physiological pH.

  4. Cotransfection of Pax2 and Math1 promote in situ cochlear hair cell regeneration after neomycin insult

    PubMed Central

    Chen, Yan; Yu, Huiqian; Zhang, Yanping; Li, Wen; Lu, Na; Ni, Wenli; He, Yingzi; Li, Jin; Sun, Shan; Wang, Zhengmin; Li, Huawei


    The ideal strategy for hair cell regeneration is promoting residual supporting cell proliferation followed by induction of hair cell differentiation. In this study, cultured neonatal mouse organs of Corti were treated with neomycin to eliminate hair cells followed by incubation with recombined adenovirus expressing Pax2 and/or Math1. Results showed that overexpression of Pax2 significantly promoted proliferation of supporting cells. The number of BrdU+/myosin VIIA+ cells increased significantly in hair cell pre-existing region two weeks after adenovirus infection in Ad-Pax2-IRES-Math1 group compared to Ad-Pax2 and Ad-Math1 groups. This indicated that cotransfection of Pax2 and Math1 induced supporting cells to proliferate and differentiate into hair cells in situ. Most new hair cells were labeled by FM1-43 suggesting they acquired certain function. The results also suggest that inducing proliferating cells rather than quiescent cells to differentiate into hair cells by forced expression of Math1 is feasible for mammalian hair cell regeneration. PMID:24141260

  5. Aptasensor based on the synergistic contributions of chitosan-gold nanoparticles, graphene-gold nanoparticles and multi-walled carbon nanotubes-cobalt phthalocyanine nanocomposites for kanamycin detection.


    Sun, Xia; Li, Falan; Shen, Guanghui; Huang, Jiadong; Wang, Xiangyou


    An electrochemical aptasensor was developed for the detection of kanamycin based on the synergistic contributions of chitosan-gold nanoparticles (CS-AuNPs), graphene-gold nanoparticles (GR-AuNPs) and multi-walled carbon nanotubes-cobalt phthalocyanine (MWCNTs-CoPc) nanocomposites. The aptasensor was prepared by sequentially dripping CS-AuNPs, GR-AuNPs and MWCNTs-CoPc nanocomposites onto a gold electrode (GE) surface. During the above process, these nanomaterials showed a remarkable synergistic effect towards the aptasensor. CS-AuNPs, GR-AuNPs and MWCNTs-CoPc as the nanocomposites mediator improved electron relay during the entire electron transfer process and the aptasensor response speed. The electrochemical properties of the modified processes were characterized by cyclic voltammetry (CV). The morphologies of the nanocomposites were characterized by scanning electron microscopy (SEM). The experimental conditions such as the concentration of the aptamer, the time, temperature and the pH were optimized. Based on the synergistic contributions of CS-AuNPs, GR-AuNPs and MWCNTs-CoPc nanocomposites, the proposed aptasensor displayed high sensitivity, high specificity, a low detection limit (5.8 × 10(-9) M) (S/N = 3) and excellent stability. It was successfully applied to the detection of kanamycin in real milk spiked samples.

  6. A novel electrochemical aptasensor for ultrasensitive detection of kanamycin based on MWCNTs-HMIMPF6 and nanoporous PtTi alloy.


    Guo, Wenjuan; Sun, Na; Qin, Xiaoli; Pei, Meishan; Wang, Luyan


    A novel aptasensor based on a novel composite film consisting of multi-walled carbon nanotubes (MWCNTs), ionic liquid (IL) of 1-hexyl-3-methylimidazolium hexafluorophosphate (HMIMPF6), and nanoporous PtTi (NP-PtTi) alloy was constructed for ultrasensitive detection of kanamycin. The NP-PtTi alloy was successfully fabricated by a simple dealloying of PtTiAl source alloy in HCl solution. The NP-PtTi alloy has uniform interconnected network structure with specific surface area and was used to immobilize aptamer. After modified with the composite material, current signal was amplified obviously, which attributed to the larger specific surface area and excellent electrical conductivity of NP-PtTi and MWCNTs. A number of factors affecting the activity of the aptasensor have been discussed and optimized. Under the optimized conditions, the proposed aptasensor provided a linear range of 0.05-100 ng mL(-1) with a low detection limit of 3.7 pg mL(-1). This aptasensor displayed high sensitivity, stability and reproducibility. In addition, the as-prepared aptasensor was successfully used for the determination of kanamycin in a real sample.

  7. Characterization of small ColE1-like plasmids conferring kanamycin resistance in Salmonella enterica subsp. enterica serovars Typhimurium and Newport.


    Chen, Chin-Yi; Strobaugh, Terence P; Frye, Jonathan G


    Multi-antibiotic resistant (MR) Salmonella enterica serovars Typhimurium and Newport are an increasing concern in human and animal health. Many strains are known to carry antibiotic resistance determinants on multiple plasmids, yet detailed information has been scarce. Three plasmids conferring kanamycin (Kan) resistance were isolated and nucleotide sequences were determined. Two Kan(R) plasmids from Salmonella Newport strains, pSN11/00Kan and pSN02/01Kan, were found to be identical and were 5698bp in size. Plasmid pG7601Kan from Salmonella Typhimurium phage type U302 strain G7601 was 3208bp, and was the same as the previously reported pU302S from another U302 strain G8430. All three plasmids carried identical aph(3')-I genes. The plasmids were ColE1-like, containing RNA I/RNA II and the rom gene. Plasmids pSN11/00Kan and pSN02/01Kan also carried mobilization genes mobC and mobABD, similar to those of the pColK-K235 and pColD-157 plasmids from the colicinogenic Escherichia coli strains. All three plasmids were stable without kanamycin selection for approximately 100 generations.

  8. β-Lactams and Florfenicol Antibiotics Remain Bioactive in Soils while Ciprofloxacin, Neomycin, and Tetracycline Are Neutralized▿

    PubMed Central

    Subbiah, Murugan; Mitchell, Shannon M.; Ullman, Jeffrey L.; Call, Douglas R.


    It is generally assumed that antibiotic residues in soils select for antibiotic-resistant bacteria. This assumption was tested by separately adding 10 different antibiotics (≥200 ppm) to three soil-water slurries (silt-loam, sand-loam, and sand; 20% soil [wt/vol]) and incubating mixtures for 24 h at room temperature. The antibiotic activity of the resultant supernatant was assessed by culturing a sensitive Escherichia coli strain in the filter-sterilized supernatant augmented with Luria-Bertani broth. We found striking differences in the abilities of supernatants to suppress growth of the indicator E. coli. Ampicillin, cephalothin, cefoxitin, ceftiofur, and florfenicol supernatants completely inhibited growth while bacterial growth was uninhibited in the presence of neomycin, tetracycline, and ciprofloxacin supernatants. High-performance liquid chromatography (HPLC) analysis demonstrated that cefoxitin and florfenicol were almost completely retained in the supernatants, whereas tetracycline and ciprofloxacin were mostly removed. Antibiotic dissipation in soil, presumably dominated by adsorption mechanisms, was sufficient to neutralize 200 ppm of tetracycline; this concentration is considerably higher than reported contamination levels. Soil pellets from the tetracycline slurries were resuspended in a minimal volume of medium to maximize the interaction between bacteria and soil particles, but sensitive bacteria were still unaffected by tetracycline (P = 0.6). Thus, residual antibiotics in soil do not necessarily exert a selective pressure, and the degree to which the pharmaceutical remains bioactive depends on the antibiotic. Efforts to control antibiotic contamination would be better directed toward compounds that retain biological activity in soils (e.g., cephalosporins and florfenicol) because these are the antibiotics that could exert a selective pressure in the environment. PMID:21856822

  9. β-lactams and florfenicol antibiotics remain bioactive in soils while ciprofloxacin, neomycin, and tetracycline are neutralized.


    Subbiah, Murugan; Mitchell, Shannon M; Ullman, Jeffrey L; Call, Douglas R


    It is generally assumed that antibiotic residues in soils select for antibiotic-resistant bacteria. This assumption was tested by separately adding 10 different antibiotics (≥200 ppm) to three soil-water slurries (silt-loam, sand-loam, and sand; 20% soil [wt/vol]) and incubating mixtures for 24 h at room temperature. The antibiotic activity of the resultant supernatant was assessed by culturing a sensitive Escherichia coli strain in the filter-sterilized supernatant augmented with Luria-Bertani broth. We found striking differences in the abilities of supernatants to suppress growth of the indicator E. coli. Ampicillin, cephalothin, cefoxitin, ceftiofur, and florfenicol supernatants completely inhibited growth while bacterial growth was uninhibited in the presence of neomycin, tetracycline, and ciprofloxacin supernatants. High-performance liquid chromatography (HPLC) analysis demonstrated that cefoxitin and florfenicol were almost completely retained in the supernatants, whereas tetracycline and ciprofloxacin were mostly removed. Antibiotic dissipation in soil, presumably dominated by adsorption mechanisms, was sufficient to neutralize 200 ppm of tetracycline; this concentration is considerably higher than reported contamination levels. Soil pellets from the tetracycline slurries were resuspended in a minimal volume of medium to maximize the interaction between bacteria and soil particles, but sensitive bacteria were still unaffected by tetracycline (P = 0.6). Thus, residual antibiotics in soil do not necessarily exert a selective pressure, and the degree to which the pharmaceutical remains bioactive depends on the antibiotic. Efforts to control antibiotic contamination would be better directed toward compounds that retain biological activity in soils (e.g., cephalosporins and florfenicol) because these are the antibiotics that could exert a selective pressure in the environment.

  10. Combating Enhanced Intracellular Survival (Eis)-Mediated Kanamycin Resistance of Mycobacterium tuberculosis by Novel Pyrrolo[1,5-a]pyrazine-Based Eis Inhibitors.


    Garzan, Atefeh; Willby, Melisa J; Ngo, Huy X; Gajadeera, Chathurada S; Green, Keith D; Holbrook, Selina Y L; Hou, Caixia; Posey, James E; Tsodikov, Oleg V; Garneau-Tsodikova, Sylvie


    Tuberculosis (TB) remains one of the leading causes of mortality worldwide. Hence, the identification of highly effective antitubercular drugs with novel modes of action is crucial. In this paper, we report the discovery and development of pyrrolo[1,5-a]pyrazine-based analogues as highly potent inhibitors of the Mycobacterium tuberculosis (Mtb) acetyltransferase enhanced intracellular survival (Eis), whose up-regulation causes clinically observed resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN). We performed a structure-activity relationship (SAR) study to optimize these compounds as potent Eis inhibitors both against purified enzyme and in mycobacterial cells. A crystal structure of Eis in complex with one of the most potent inhibitors reveals that the compound is bound to Eis in the AG binding pocket, serving as the structural basis for the SAR. These Eis inhibitors have no observed cytotoxicity to mammalian cells and are promising leads for the development of innovative AG adjuvant therapies against drug-resistant TB.

  11. E2F1-CDK1 pathway activation in kanamycin-induced spiral ganglion cell apoptosis and the protective effect of CR8.


    Liu, Yu-ying; Wang, Guo-peng; Peng, Zhe; Guo, Jing-ying; Wu, Qian; Xie, Jing; Gong, Shu-sheng


    Cochlear hair cell loss results in the secondary loss of spiral ganglion cells (SGCs). The death of these SGCs is due to apoptosis. The E2F1-cyclin dependent kinase 1 (CDK1) pathway is believed to represent an important mechanism of neuronal cell death. However, the role of this pathway in spiral ganglion neuronal apoptosis has not yet been reported. In this study, we deafened guinea pigs with a subcutaneous injection of kanamycin followed by an intravenous infusion of furosemide and then assayed the expression levels of cleaved caspase-3, E2F1, CDK1 and cleaved caspase-9 during the induced SGC apoptosis. Our results revealed that co-administration of kanamycin and furosemide rapidly induced hair cell loss in the guinea pigs and then resulted in a progressive loss of SGCs. Expression levels of E2F1 and CDK1 were obviously up-regulated at 1 and 3 days after deafening. Cleaved caspase-9 also increased robustly 1 or 2 weeks after the deafening procedure. The up-regulation of E2F1, CDK1 and cleaved caspase-9 was significantly attenuated by the systemic injection of CR8 (1mg/kg/day, intraperitoneally) starting at 5min after deafening. These findings indicate that the activation of the E2F1-CDK1 pathway and cell cycle re-entry contributes to the apoptosis of SGCs and that the selective inhibition of this signaling cascade may represent an attractive therapeutic strategy. CR8 has the potential to protect SGCs from apoptosis.

  12. Lactulose and neomycin attenuate leukocyte-endothelial cell adhesion in an animal model of inflammatory bowel disease.


    Arndt, H; Schölmerich, J; Palitzsch, K D


    The role of intestinal flora in the pathogenesis of inflammatory bowel disease is under discussion. The objective of this study was to assess the effect of lactulose (Lac) and neomycin (Neo), both of which are used clinically for changing or reducing intestinal flora, on leukocyte-endothelial cell interaction in an indomethacin (Indo)-induced long-lasting ileitis in Sprague-Dawley rats. Two doses of Indo (7.5 mg/kg, s.c.) were given 24 h apart. Animals were fed with standard rat chow for 10 days until 12 h prior to the experiment. Solutions of Lac (1.0 mg/kg b.w.) or Neo (0.1 g/kg) were gavaged daily for 10 days between Indo administration and the experiment. Ten mesenteric venules (30 microm diameter) per animal (n = 5 per group) were observed using intravital microscopy, and the following parameters were monitored: number of adherent and emigrated leukocytes, leukocyte rolling velocity, erythrocyte velocity, venular blood flow, and shear rate. Macroscopically visible injury was scored 0 to 5, and faecal pH was measured in the distal 20 cm of ileum. Ten days after Indo treatment leukocyte adherence and emigration were increased (2.2-fold and 3.3-fold vs. control, respectively) while leukocyte rolling velocity and venular wall shear rate were reduced (both parameters to 81% of control). Lac and Neo attenuated microcirculatory parameters to a similar extent while macroscopic damage was prevented only by Neo but not by Lac. The effects of both substances were accompanied by a normalization of faecal pH to control level which had been lowered by Indo. The Indo-induced increase in leukocyte-endothelial cell interaction is blunted by Lac and Neo. At the same time the Indo-induced lowering of faecal pH is normalized by both substances. The reduction of macroscopic injury by Neo but not by Lac in the chronic phase of Indo inflammation might be due to additional effects on other inflammatory cells such as macrophages.

  13. Transformation of human epidermal cells by transfection with plasmid containing simian virus 40 DNA linked to a neomycin gene is a defined medium

    SciTech Connect

    Su, R.T.; Yen-Chu Chang )


    A human epidermal cell culture was transformed by transfection with a recombinant plasmid containing simian virus 40 DNA with a deletion at the origin and an antibiotic (neomycin or G418) marker. A calcium phosphate-mediated DNA transfection method was optimized for introducing exogenous DNA into cells maintained in a fully defined medium. The transformed cells were propagated for more than 200 population doublings and did not appear to go through a crisis period. The growth characteristics of the transformed cells were similar to those found in normal epidermal cells. Transformed cells initially transfected with the recombinant plasmid could be propagated for more than 30 passages. Actively growing cells could then be repeatedly selected from cell populations based upon their neomycin (G418)-resistant phenotype for at least another 30 passages. Simian virus 40 T-antigen and extrachromosomal DNA containing plasmid- and SV40-specific DNA sequences were detected in the transformed cells. Because of their nononcogenic phenotype and defined growth requirements, the transformed cells provide a model for examining structural changes during cell proliferation and differentiation, and for exploring the multistage carcinogenesis of human epithelial cells.

  14. Flow microcalorimetric assay of antibiotics--II. Neomycin sulphate and its combinations with polymyxin B sulphate and zinc bacitracin on interaction with Bacillus pumilus (NCTC 8241).


    Joslin Kjeldsen, N; Beezer, A E; Miles, R J


    A flow microcalorimetric assay for Neomycin has been developed which is monitored through interaction of the antibiotic with Bacillus pumilus as the test organism. The assay has better reproducibility (relative standard deviation 2.3%) and is more sensitive than conventional microbiological bioassay (0.5-2 micrograms ml-1). The effects of combinations with zinc bacitracin, with polymyxin B sulphate, and with both zinc bacitracin and polymyxin B sulphate (both in equimolar proportions), and in those proportions present in the commercial preparation TrisepR (ICI, Macclesfield, UK) have also been investigated. Synergy was observed for the combinations of Neomycin with the other two antibiotics in binary mixtures at the relative proportions found in TrisepR. The addition of all three antibiotics at the levels used in TrisepR did not show synergy. However, addition of all three antibiotics at equimolar concentrations did show synergy. It is suggested that microcalorimetry may be useful in in vitro experiments for exploring the relative proportions required for maximal effect in antibiotic combinations.

  15. A new cyclic dipeptide penicimutide: the activated production of cyclic dipeptides by introduction of neomycin-resistance in the marine-derived fungus Penicillium purpurogenum G59.


    Wang, Nan; Cui, Cheng-Bin; Li, Chang-Wei


    A novel cyclic dipeptide, named penicimutide (1), and four known cyclic dipeptides, cyclo(L-Val-L-Pro) (2), cyclo(L-Ile-L-Pro) (3), cyclo(L-Leu-L-Pro) (4) and cyclo(L-Phe-L-Pro) (5), were isolated from a neomycin-resistant mutant of the marine-derived fungus Penicillium purpurogenum G59. The structure of 1, including the absolute configuration, was determined by spectroscopic and chemical methods, especially NMR and Marfey's analysis. An unusual amino acid in 1, 4,5-didehydro-L-leucine, was found for the first time occurring in nature. HPLC-ESI-MS analysis evidenced that 1-3 were produced only in the mutant strain, but 4 and 5 were produced in both the mutant and parental strains, indicating that the introduction of neomycin-resistance in the mutant activated pathways of 1-3 biosynthesis that were silent in the parental strain. Compound 1 selectively inhibited HeLa cells (among five tested human cancer cell lines) with an inhibition rate (IR %) of 39.4 % at 100 µg/mL, a similar inhibition intensity to that of the positive control 5-fluorouracil (IR % of 41.4 % at 100 µg/mL against HeLa cells). The present work exemplifies the effectiveness of our previous DMSO-mediated method for introducing drug-resistance in fungi to activate silent biosynthetic pathways to obtain new bioactive compounds.

  16. Hydrocortisone, Neomycin, and Polymyxin


    ... Wash your hands thoroughly with soap and warm water. Gently clean your ear with a damp facecloth and then dry your ear. Warm the drops to near body temperature by holding the container in the palm of ...

  17. Protection by low-dose kanamycin against noise-induced hearing loss in mice: dependence on dosing regimen and genetic background.


    Ohlemiller, Kevin K; Rybak Rice, Mary E; Rosen, Allyson D; Montgomery, Scott C; Gagnon, Patricia M


    We recently demonstrated that sub-chronic low-dose kanamycin (KM, 300 mg/kg sc, 2×/day, 10 days) dramatically reduces permanent noise-induced hearing loss (NIHL) and hair cell loss in 1 month old CBA/J mice (Fernandez et al., 2010, J. Assoc. Res. Otolaryngol. 11, 235-244). Protection by KM remained for at least 48 h after the last dose, and appeared to involve a cumulative effect of multiple doses as part of a preconditioning process. The first month of life lies within the early 'sensitive period' for both cochlear noise and ototoxic injury in mice, and CBA/J mice appear exquisitely vulnerable to noise during this period (Ohlemiller et al., 2011; Hearing Res. 272, 13-20). From our initial data, we could not rule out 1) that less rigorous treatment protocols than the intensive one we applied may be equally-or more-protective; 2) that protection by KM is tightly linked to processes unique to the sensitive period for noise or ototoxins; or 3) that protection by KM is exclusive to CBA/J mice. The present experiments address these questions by varying the number and timing of fixed doses (300 mg/kg sc) of KM, as well as the age at treatment in CBA/J mice. We also tested for protection in young C57BL/6J (B6) mice. We find that nearly complete protection against at least 2 h of intense (110 dB SPL) broadband noise can be observed in CBA/J mice at least for ages up to 1 year. Reducing dosing frequency to as little as once every other day (a four-fold decrease in dosing frequency) appeared as protective as twice per day. However, reducing the number of doses to just 1 or 2, followed by noise 24 or 48 h later greatly reduced protection. Notably, hearing thresholds and hair cells in young B6 mice appeared completely unprotected by the same regimen that dramatically protects CBA/J mice. We conclude that protective effects of KM against NIHL in CBA/J mice can be engaged by a wide range of dosing regimens, and are not exclusive to the sensitive period for noise or ototoxins

  18. Neomycin damage and regeneration of hair cells in both mechanoreceptor and electroreceptor lateral line organs of the larval Siberian sturgeon (Acipenser baerii).


    Fan, Chunxin; Zou, Sha; Wang, Jian; Zhang, Bo; Song, Jiakun


    The lateral line found in some amphibians and fishes has two distinctive classes of sensory organs: mechanoreceptors (neuromasts) and electroreceptors (ampullary organs). Hair cells in neuromasts can be damaged by aminoglycoside antibiotics and they will regenerate rapidly afterward. Aminoglycoside sensitivity and the capacity for regeneration have not been investigated in ampullary organs. We treated Siberian sturgeon (Acipenser baerii) larvae with neomycin and observed loss and regeneration of sensory hair cells in both organs by labeling with DASPEI and scanning electron microscopy (SEM). The numbers of sensory hair cells in both organs were reduced to the lowest levels at 6 hours posttreatment (hpt). New sensory hair cells began to appear at 12 hpt and were regenerated completely in 7 days. To reveal the possible mechanism for ampullary hair cell regeneration, we analyzed cell proliferation and the expression of neural placodal gene eya1 during regeneration. Both cell proliferation and eya1 expression were concentrated in peripheral mantle cells and both increased to the highest level at 12 hpt, which is consistent with the time course for regeneration of the ampullary hair cells. Furthermore, we used Texas Red-conjugated gentamicin in an uptake assay following pretreatment with a cation channel blocker (amiloride) and found that entry of the antibiotic was suppressed in both organs. Together, our results indicate that ampullary hair cells in Siberian sturgeon larvae can be damaged by neomycin exposure and they can regenerate rapidly. We suggest that the mechanisms for aminoglycoside uptake and hair cell regeneration are conserved for mechanoreceptors and electroreceptors. J. Comp. Neurol. 524:1443-1456, 2016. © 2015 Wiley Periodicals, Inc.

  19. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss--A Manganese-Enhanced MRI (MEMRI) Study.


    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar


    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms.

  20. Mycobacterium tuberculosis rrs A1401G mutation correlates with high-level resistance to kanamycin, amikacin, and capreomycin in clinical isolates from mainland China.


    Du, Qinglin; Dai, Guangming; Long, Quanxin; Yu, Xia; Dong, Lingling; Huang, Hairong; Xie, Jianping


    Mutations correlating phenotypic resistance level with the injectable second-line anti-tuberculosis drugs (SLDs) including kanamycin (KAN), amikacin (AMK), and capreomycin (CAP) remain elusive. A collection of 114 Mycobacterium tuberculosis clinical isolates from mainland China was analyzed. The minimum inhibitory concentration (MIC) of each strain was determined and the sequences of rrs, tlyA, promoter of eis as well as 5' untranslated region (UTR) of whiB7 were amplified and sequenced. No mutation in tlyA, promoter of eis and 5' UTR of whiB7, was found to be associated with resistance among these samples. Sequencing data of 1400 rrs region demonstrated the A1401G mutation in rrs was prevalent, which presented in 84% of the KAN resistant isolates while only in about 50% of the AMK or CAP resistant isolates. Furthermore, most of the resistant isolates with A1401G mutation showed high-level resistance to these injectable SLDs. In conclusion, our results suggest the rrs A1401G mutation was related to high-level resistance to KAN, AMK, and CAP in M. tuberculosis isolates from mainland China.

  1. Detection of kanamycin and gentamicin residues in animal-derived food using IgY antibody based ic-ELISA and FPIA.


    Li, Cui; Zhang, Yaoyao; Eremin, Sergei A; Yakup, Omar; Yao, Gang; Zhang, Xiaoying


    Our aim in this study is to show that IgY antibody based immunoassays could be used to detect antibiotic residues in animal-derived food. Briefly, full antigens of gentamicin (Gent) and kanamycin (Kana) were used to immunize the laying chickens to prepare IgY antibodies. Then, these antibodies were evaluated by FPIA and ic-ELISA to detect Gent/Kana in animal-derived samples. The IC50 of FPIA and ic-ELISA based anti-Gent IgY were 7.70±0.6μg/mL and 0.32±0.06μg/mL, respectively. The IC50 of FPIA and ic-ELISA based anti-Kana IgY were 7.97±0.9μg/mL and 0.15±0.01μg/mL. The limits of detection (LOD, IC10) for FPIA based anti-Gent/Kana IgY were 0.17 and 0.007μg/mL, respectively. The LOD for ic-ELISA were both 0.001μg/mL. These results indicated that the ic-ELISA might more suitable for antibiotic residues detection than FPIA.

  2. Two versatile shuttle vectors for Thermus thermophilus-Escherichia coli containing multiple cloning sites, lacZα gene and kanamycin or hygromycin resistance marker.


    Fujita, Atsushi; Misumi, Yoshio; Koyama, Yoshinori


    Two versatile shuttle vectors for Thermus thermophilus and Escherichia coli were developed on the basis of the T. thermophilus cryptic plasmid pTT8 and E. coli vector pUC13. These shuttle vectors, pTRK1T and pTRH1T, carry a gene encoding a protein homologous to replication protein derived from pTT8, a replicon for E. coli, new multiple cloning sites and a lacZα gene from E. coli vector pUC13, and also have a gene encoding a thermostable protein that confers resistance to kanamycin or hygromycin, which can be used as a selection marker in T. thermophilus. These shuttle vectors are useful to develop enzymes and proteins of biotechnological interest. We also constructed a plasmid, pUC13T, which carries the same multiple cloning sites of pTRK1T and pTRH1T. These vectors should facilitate cloning procedures both in E. coli and T. thermophilus.

  3. Detection of Isoniazid-, Fluoroquinolone-, Amikacin-, and Kanamycin-Resistant Tuberculosis in an Automated, Multiplexed 10-Color Assay Suitable for Point-of-Care Use.


    Chakravorty, Soumitesh; Roh, Sandy S; Glass, Jennifer; Smith, Laura E; Simmons, Ann Marie; Lund, Kevin; Lokhov, Sergey; Liu, Xin; Xu, Peng; Zhang, Guolong; Via, Laura E; Shen, Qingyu; Ruan, Xianglin; Yuan, Xing; Zhu, Hong Zhu; Viazovkina, Ekaterina; Shenai, Shubhada; Rowneki, Mazhgan; Lee, Jong Seok; Barry, Clifton E; Gao, Qian; Persing, David; Kwiatkawoski, Robert; Jones, Martin; Gall, Alexander; Alland, David


    Extensively drug-resistant (XDR) tuberculosis (TB) cannot be easily or quickly diagnosed. We developed a rapid, automated assay for the detection of XDR-TB plus resistance to the drug isoniazid (INH) for point-of-care use. Using a simple filter-based cartridge with an integrated sample processing function, the assay identified a wide selection of wild-type and mutant sequences associated with XDR-TB directly from sputum. Four new large-Stokes-shift fluorophores were developed. When these four Stokes-shift fluorophores were combined with six conventional fluorophores, 10-color probe detection in a single PCR tube was enabled. A new three-phase, double-nested PCR approach allowed robust melting temperature analysis with enhanced limits of detection (LODs). Finally, newly designed sloppy molecular beacons identified many different mutations using a small number of probes. The assay correctly distinguished wild-type sequences from 32 commonly occurring mutant sequences tested in gyrA, gyrB, katG, and rrs genes and the promoters of inhA and eis genes responsible for resistance to INH, the fluoroquinolone (FQ) drugs, amikacin (AMK), and kanamycin (KAN). The LOD was 300 CFU of Mycobacterium tuberculosis in 1 ml sputum. The rate of detection of heteroresistance by the assay was equivalent to that by Sanger sequencing. In a blind study of 24 clinical sputum samples, resistance mutations were detected in all targets with 100% sensitivity, with the specificity being 93.7 to 100%. Compared to the results of phenotypic susceptibility testing, the sensitivity of the assay was 75% for FQs and 100% each for INH, AMK, and KAN and the specificity was 100% for INH and FQ and 94% for AMK and KAN. Our approach could enable testing for XDR-TB in point-of-care settings, potentially identifying highly drug-resistant TB more quickly and simply than currently available methods.

  4. Detection of Isoniazid-, Fluoroquinolone-, Amikacin-, and Kanamycin-Resistant Tuberculosis in an Automated, Multiplexed 10-Color Assay Suitable for Point-of-Care Use

    PubMed Central

    Roh, Sandy S.; Glass, Jennifer; Smith, Laura E.; Simmons, Ann Marie; Lund, Kevin; Lokhov, Sergey; Liu, Xin; Xu, Peng; Zhang, Guolong; Via, Laura E.; Shen, Qingyu; Ruan, Xianglin; Yuan, Xing; Zhu, Hong Zhu; Viazovkina, Ekaterina; Shenai, Shubhada; Rowneki, Mazhgan; Lee, Jong Seok; Barry, Clifton E.; Gao, Qian; Persing, David; Kwiatkawoski, Robert; Jones, Martin; Gall, Alexander; Alland, David


    ABSTRACT Extensively drug-resistant (XDR) tuberculosis (TB) cannot be easily or quickly diagnosed. We developed a rapid, automated assay for the detection of XDR-TB plus resistance to the drug isoniazid (INH) for point-of-care use. Using a simple filter-based cartridge with an integrated sample processing function, the assay identified a wide selection of wild-type and mutant sequences associated with XDR-TB directly from sputum. Four new large-Stokes-shift fluorophores were developed. When these four Stokes-shift fluorophores were combined with six conventional fluorophores, 10-color probe detection in a single PCR tube was enabled. A new three-phase, double-nested PCR approach allowed robust melting temperature analysis with enhanced limits of detection (LODs). Finally, newly designed sloppy molecular beacons identified many different mutations using a small number of probes. The assay correctly distinguished wild-type sequences from 32 commonly occurring mutant sequences tested in gyrA, gyrB, katG, and rrs genes and the promoters of inhA and eis genes responsible for resistance to INH, the fluoroquinolone (FQ) drugs, amikacin (AMK), and kanamycin (KAN). The LOD was 300 CFU of Mycobacterium tuberculosis in 1 ml sputum. The rate of detection of heteroresistance by the assay was equivalent to that by Sanger sequencing. In a blind study of 24 clinical sputum samples, resistance mutations were detected in all targets with 100% sensitivity, with the specificity being 93.7 to 100%. Compared to the results of phenotypic susceptibility testing, the sensitivity of the assay was 75% for FQs and 100% each for INH, AMK, and KAN and the specificity was 100% for INH and FQ and 94% for AMK and KAN. Our approach could enable testing for XDR-TB in point-of-care settings, potentially identifying highly drug-resistant TB more quickly and simply than currently available methods. PMID:27807153

  5. Kanamycin Sulphate Loaded PLGA-Vitamin-E-TPGS Long Circulating Nanoparticles Using Combined Coating of PEG and Water-Soluble Chitosan

    PubMed Central

    Mustafa, Sanaul


    Kanamycin sulphate (KS) is a Mycobacterium tuberculosis protein synthesis inhibitor. Due to its intense hydrophilicity, KS is cleared from the body within 8 h. KS has a very short plasma half-life (2.5 h). KS is used in high concentrations to reach the therapeutic levels in plasma, which results in serious nephrotoxicity/ototoxicity. To overcome aforementioned limitations, the current study aimed to develop KS loaded PLGA-Vitamin-E-TPGS nanoparticles (KS-PLGA-TPGS NPs), to act as an efficient carrier for controlled delivery of KS. To achieve a substantial extension in blood circulation, a combined design, affixation of polyethylene glycol (PEG) to KS-PLGA-TPGS NPs and adsorption of water-soluble chitosan (WSC) (cationic deacetylated chitin) to particle surface, was raised for surface modification of NPs. Surface modified NPs (KS-PEG-WSC NPs) were prepared to provide controlled delivery and circulate in the bloodstream for an extended period of time, thus minimizing dosing frequency. In vivo pharmacokinetics and in vivo biodistribution following intramuscular administration were investigated. NPs surface charge was close to neutral +3.61 mV and significantly affected by the WSC coating. KS-PEG-WSC NPs presented striking prolongation in blood circulation, reduced protein binding, and long drew-out the blood circulation half-life with resultant reduced kidney sequestration vis-à-vis KS-PLGA-TPGS NPs. The studies, therefore, indicate the successful formulation development of KS-PEG-WSC NPs with reduced frequency of dosing of KS indicating low incidence of nephrotoxicity/ototoxicity. PMID:28352475

  6. Detection of methicillin/oxacillin resistance and typing in aminoglycoside-susceptible methicillin-resistant and kanamycin-tobramycin-resistant methicillin-susceptible Staphylococcus aureus.


    Hamdad, F; Donda, F; Lefebvre, J F; Laurans, G; Biendo, M; Thomas, D; Canarelli, B; Rousseau, F; Eb, F


    Eighty-five atypical isolates of Staphylococcus aureus divided into 73 aminoglycoside-susceptible methicillinresistant (AS-MRSA) and 12 kanamycin-tobramycin-resistant methicillin-susceptible (KTR-MSSA) were phenotypically and genotypically examined for methicillin resistance. Among these tests, the diffusion method using the oxacillin and cefoxitin disks on Mueller-Hinton agar with and without NaCl, the incubation at 35 degrees C or 30 degrees C for 24 or 48 hr, respectively, and the determination of oxacillin MICs by E-test were performed. We also examined the presence of the mecA gene by PCR and its product PBP 2a by the Slidex MRSA Detection test after induction by cefoxitin disk. All of the AS-MRSA strains (100%) were detected by the cefoxitin disk in all conditions and by the oxacillin disk on Mueller-Hinton agar with 2% of NaCl at 35 degrees C. Without NaCl, the sensitivity fell to 97.2% by oxacillin disk. The oxacillin MICs for these isolates ranged from 2 to 128 mg/L. The mecA gene determinant and its product PBP 2a were detected in all AS-MRSA strains. All KTR-MSSA strains were phenotypically methicillin-susceptible and oxacillin MICs were below or borderline of breakpoint (< or =2 mg/L). The mecA gene determinant and its product were detected in one strain. Pulsed-field gel electrophoresis (PFGE) was applied and revealed the presence of two major patterns A (36.9%) and B (46.2%) in AS-MRSA isolates and seven patterns in the KTR-MSSA strains.

  7. Comparison of Boric Acid and Combination Drug of Polymyxin, Neomycin and Hydrocortisone (polymyxin NH) in the Treatment of Acute Otitis Externa

    PubMed Central

    Moeini, Mohammad


    Introduction Acute otitis externa is an inflammation of the external auditory canal known as "swimmer’s ear". Direct costs including medical treatment, painkillers, antibiotics, steroids or both and indirect costs are also remarkable. Aim The aim of this study was to compare the effect of boric acid and polymyxin, neomycin and hydrocortisone composition in the treatment of acute otitis externa. Materials and Methods This randomized clinical trial was carried out on 80 patients aged more than 17-year-old who were referred to Kashani hospital clinic with a diagnosis of acute otitis externa by otolaryngologist. The patients were randomly allocated to two groups (A: Boric acid and B: polymyxin NH ear drops) and Painkiller was prescribed and administered orally for all patients and in the presence of fever, cellulitis around the ears and neck adenopathy, broad-spectrum systemic antibiotics were used besides topical treatment. Symptoms of patients who were evaluated by a physician includes pain, discharge from the ear, swelling of the ear canal, auricle swelling, tenderness, and ear itching. In addition, pain was evaluated in patients and was recorded by Macgill Pain Questionnaire, in the first, third, seventh and tenth days. Results Results showed that itching on third day (p=0.007) and swelling of the ear canal in the examination of the third day (p=0.006) and the seventh day (p=0.001) in the polymyxin NH group was more than those of boric acid group. Overall mean pain based on McGill questionnaire was 11.10±1.49 in boric acid group in the examination on the first day and was 4.05±0.22 in the examination on the tenth day and in the polymyxin NH group, it was 10.9±0.99 on the first day and 4.20±0.40 on the tenth day. In both groups, pain relief was the same and there was no significant difference between two groups (p=0.075). Conclusion The findings of this study showed slight differences in the effectiveness of the boric acid drug and combination of polymyxin

  8. Comparison of Boric Acid and Combination Drug of Polymyxin, Neomycin and Hydrocortisone (polymyxin NH) in the Treatment of Acute Otitis Externa.


    Amani, Soroush; Moeini, Mohammad


    Acute otitis externa is an inflammation of the external auditory canal known as "swimmer's ear". Direct costs including medical treatment, painkillers, antibiotics, steroids or both and indirect costs are also remarkable. The aim of this study was to compare the effect of boric acid and polymyxin, neomycin and hydrocortisone composition in the treatment of acute otitis externa. This randomized clinical trial was carried out on 80 patients aged more than 17-year-old who were referred to Kashani hospital clinic with a diagnosis of acute otitis externa by otolaryngologist. The patients were randomly allocated to two groups (A: Boric acid and B: polymyxin NH ear drops) and Painkiller was prescribed and administered orally for all patients and in the presence of fever, cellulitis around the ears and neck adenopathy, broad-spectrum systemic antibiotics were used besides topical treatment. Symptoms of patients who were evaluated by a physician includes pain, discharge from the ear, swelling of the ear canal, auricle swelling, tenderness, and ear itching. In addition, pain was evaluated in patients and was recorded by Macgill Pain Questionnaire, in the first, third, seventh and tenth days. Results showed that itching on third day (p=0.007) and swelling of the ear canal in the examination of the third day (p=0.006) and the seventh day (p=0.001) in the polymyxin NH group was more than those of boric acid group. Overall mean pain based on McGill questionnaire was 11.10±1.49 in boric acid group in the examination on the first day and was 4.05±0.22 in the examination on the tenth day and in the polymyxin NH group, it was 10.9±0.99 on the first day and 4.20±0.40 on the tenth day. In both groups, pain relief was the same and there was no significant difference between two groups (p=0.075). The findings of this study showed slight differences in the effectiveness of the boric acid drug and combination of polymyxin, neomycin and hydrocortisone in the treatment of patients with

  9. Treating Combat Hearing Loss with Atoh1 Gene Therapy

    DTIC Science & Technology


    such as neomycin or kanamycin , as the dose at which hair cell death is observed with these drugs is close to the toxic dose for the mouse. Recent work...turns of the mouse cochlea by administration of 1g/kg kanamycin , followed by 200mg/kg furosemide given at 30 minutes and 4 hours after kanamycin ...application (See Figure 5). Figure 4: Treatment of adult mice with kanamycin followed by two doses of furosemide is able to efficiently kill

  10. Examination of calcium-binding protein expression in the inner ear of wild-type, heterozygous and homozygous pituitary adenylate cyclase-activating polypeptide (PACAP)-knockout mice in kanamycin-induced ototoxicity.


    Nemeth, A; Szabadfi, K; Fulop, B; Reglodi, D; Kiss, P; Farkas, J; Szalontai, B; Gabriel, R; Hashimoto, H; Tamas, A


    Pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide with diverse biological effects. It also occurs and exerts protective effects in sensory organs; however, little is known about its effects in the auditory system. Recently, we have shown that PACAP protects cochlear cells against oxidative-stress-induced apoptosis and homozygous PACAP-deficient animals show stronger expression of Ca(2+)-binding proteins in the hair cells of the inner ear, but there are no data about the consequences of the lack of endogenous PACAP in different ototoxic insults such as aminoglycoside-induced toxicity. In this study, we examined the effect of kanamycin treatment on Ca(2+)-binding protein expression in hair cells of wild-type, heterozygous and homozygous PACAP-deficient mice. We treated 5-day-old mice with kanamycin, and 2 days later, we examined the Ca(2+)-binding protein expression of the hair cells with immunohistochemistry. We found stronger expression of Ca(2+)-binding proteins in the hair cells of control heterozygous and homozygous PACAP-deficient mice compared with wild-type animals. Kanamycin induced a significant increase in Ca(2+)-binding protein expression in wild-type and heterozygous PACAP-deficient mice, but the baseline higher expression in homozygous PACAP-deficient mice did not show further changes after the treatment. Elevated endolymphatic Ca(2+) is deleterious for the cochlear function, against which the high concentration of Ca(2+)-buffers in hair cells may protect. Meanwhile, the increased immunoreactivity of Ca(2+)-binding proteins in the absence of PACAP provide further evidence for the important protective role of PACAP in ototoxicity, but further investigations are necessary to examine the exact role of endogenous PACAP in ototoxic insults.

  11. Experimental evidence for the existence of non-exo-anomeric conformations in branched oligosaccharides: NMR analysis of the structure and dynamics of aminoglycosides of the neomycin family.


    Asensio, Juan Luis; Hidalgo, Ana; Cuesta, Igor; González, Carlos; Cañada, Javier; Vicent, Cristina; Chiara, Jose Luis; Cuevas, Gabriel; Jiménez-Barbero, Jesús


    It is commonly known that the exo-anomeric effect is a major factor governing the conformational behavior of naturally occurring oligosaccharides. Conformational flexibility in these molecules mainly concerns the aglycon psi angle since phi is restricted by this stereo-electronic effect. In fact, to the best of our knowledge no case of a natural glycoside adopting a non-exo-anomeric conformation in solution has yet been reported. With respect to the flexibility among naturally occurring carbohydrates, branched type oligosaccharides including sugar residues glycosidated at contiguous positions (such as blood type carbohydrate antigens Lewis X) have been considered as the paradigm of rigid saccharides--the rigidity being enhanced by van der Waals interactions. Herein, we demonstrate unambiguously that both common beliefs are not to be generalized. For example in neomycin B, a branched oligosaccharide antibiotic, a large number of non-exo-anomeric conformations was detected in solution for the first time in naturally occurring sugars. This unusual behavior is attributed to branching. Here, polar contacts between non-vicinal sugar units lead to an enhanced flexibility of the ribose glycosidic torsion phi. The influence of sugar flexibility on RNA recognition will also be discussed.

  12. Thermodynamic insights into drug-surfactant interactions: Study of the interactions of naporxen, diclofenac sodium, neomycin, and lincomycin with hexadecytrimethylammonium bromide by using isothermal titration calorimetry.


    Choudhary, Sinjan; Talele, Paurnima; Kishore, Nand


    The success of drug delivery depends on the efficiency of the route of administration, which in turn relies on properties of the drug and its transport vehicle. A quantitative knowledge of association of drugs with transport vehicles is lacking when the latter are in the category of self assembled structures. The work reported in this manuscript addresses the mechanism of partitioning of naproxen, diclofenac sodium, neomycin and lincomycin in the micelles of hexadecytrimethylammonium bromide and that is quantitatively based on the measurement of thermodynamic parameters of interactions by using isothermal titration calorimetry. The addressed mechanism of partitioning is based on the identification of the type of interactions of these drugs with the surfactant micelles and monomers, along with the effect of the former on the micellization properties of the surfactant. The conclusions are based on the interpretation of the values of partitioning constant, standard molar enthalpy change, standard molar entropy change and the stoichiometry of the interaction. The results of this study have implications for deriving guidelines for the target oriented synthesis of new drugs that are to be used for effective delivery via micellar media.

  13. Effects of tiamulin, neomycin, tetracycline, fluorophenicol, penicillin G, Linco-Spectin, erythromycin and oxytetracycline on controlling bacterial contaminations of the river buffalo (Buballus bubalis) semen.


    Alavi-Shoushtari, S M; Ahmadi, M; Shahvarpour, S; Kolahian, S


    In order to investigate the effects of tiamulin, neomycin, tetracycline, fluorophenicol, penicillin G, Linco-Spectin (0.15 mg mL(-1) lincomycin + 0.3 mg mL(-1) spectinomycin), erythromycin and oxytetracycline on controlling bacterial contaminations of the river buffalo semen, 120 mL diluted buffalo bull semen (diluted by tris-egg yolk extender) was divided into 5 mL tubes after initial evaluation and before (control sample) and at 0, 2, 6, 12 and 24 h after adding each of the above antibiotics at the recommended dose (D) and twice the recommended dose (Dx2) to the semen samples, each sample was cultured 4 times on Muller-Hinton agar medium and the results were recorded after 18 h incubation at 37 degrees C. Tiamulin, tetracycline, neomycin and fluorophenicol were ineffective. Oxytetracycline was effective in both D and Dx2 (p < 0.001). Penicillin G in both D and Dx2 was effective (p < 0.001). Linco-Spectin was effective, though not significant, in D at 2 h and in Dx2 at 0 h only. Erythromycin in D was not significantly effective, but, in Dx2 was effective (p < 0.001). Duration of the antibiotic exposure had no significant effect on the antibiotic potentials except for Linco-Spectin at 2 h (p < 0.014). The biochemical tests identified the contaminant bacteria as being a member of Arcanobacter (Corynebacterium) sp. In the next step, the semen sample of the same bull was taken, semen quality tests were carried out and the semen was diluted with the same extender (tris-egg yolk) + 7% glycerol, containing a double dose (Dx2) of these antibiotics and semen quality tests were carried out immediately after dilution, 18 h after storage at 4 degrees C and after the semen was packed in the straws, frozen in liquid nitrogen (-196 degrees C) and later thawed in 37 degrees C water bath to investigate whether these antibiotics have any adverse effect on the spermatozoa during the process of freezing and thawing. The comparison of the results with those of the control group (the

  14. Displacement of Mn2+ from RNA by K+, Mg2+, neomycin B, and an arginine-rich peptide: indirect detection of nucleic acid/ligand interactions using phosphorus relaxation enhancement.


    Summers, Jack S; Shimko, John; Freedman, Fredric L; Badger, Christopher T; Sturgess, Michael


    We have developed a novel method to study the interactions of nucleic acids with cationic species. The method, called phosphorus relaxation enhancement (PhoRE), uses (1)H-detected (31)P NMR of exogenous probe ions to monitor changes in the equilibrium between free Mn(2+) and Mn(2+) bound to the RNA. To demonstrate the technique, we describe the interactions of four RNA molecules with metal ions (K(+) and Mg(2+)), a small molecule drug (neomycin b), and a cationic peptide (RSG1.2). In each case, cationic ligand binding caused Mn(2+) to be displaced from the RNA. Free Mn(2+) was determined from its effect on the T(2) NMR relaxation rate of either phosphite (HPO(3)(2-)) or methyl phosphite (MeOPH, CH(3)OP(H)O(2-)). Using this method, the effects of [RNA] as low as 1 microM could be measured in 20 min of accumulation using a low field (200 MHz) instrument without pulsed field gradients. Cation association behavior was sequence and [RNA] dependent. At low [K(+)], Mn(2+) association with each of the RNAs decreased with increasing [K(+)] until approximately 40 mM, where saturation was reached. While saturating K(+) displaced all the bound Mn(2+) from a 31-nucleotide poly-uridine (U(31)), Mn(2+) remained bound to each of three hairpin-forming sequences (A-site, RRE1, and RRE2), even at 150 mM K(+). Bound Mn(2+) was displaced from each of the hairpins by Mg(2+), allowing determination of Mg(2+) dissociation constants (K(d,Mg)) ranging from 50 to 500 microM, depending on the RNA sequence and [K(+)]. Both neomycin b and RSG1.2 displaced Mn(2+) upon binding the hairpins. At [RNA] approximately 3 microM, RRE1 bound a single equivalent of RSG1.2, whereas neither RRE2 nor A-site bound the peptide. These behaviors were confirmed by fluorescence polarization using TAMRA-labeled peptide. At 2.7 microM RNA, the A-site hairpin bound a single neomycin b molecule. The selectivity of RSG1.2 binding was greatly diminished at higher [RNA]. Similarly, each hairpin bound multiple equivalents

  15. Metal and antibiotic resistance of bacteria isolated from the Baltic Sea.


    Moskot, Marta; Kotlarska, Ewa; Jakóbkiewicz-Banecka, Joanna; Gabig-Cimińska, Magdalena; Fari, Karolina; Wegrzyn, Grzegorz; Wróbel, Borys


    The resistance of 49 strains of bacteria isolated from surface Baltic Sea waters to 11 antibiotics was analyzed and the resistance of selected strains to three metal ions (Ni2+, Mn2+, Zn2+) was tested. Most isolates belonged to Gammaproteobacteria (78%), while Alphaproteobacteria (8%), Actinobacteria (10%), and Bacteroidetes (4%) were less abundant. Even though previous reports suggested relationships between resistance and the presence of plasmids or the ability to produce pigments, no compelling evidence for such relationships was obtained for the strains isolated in this work. In particular, strains resistant to multiple antibiotics did not carry plasmids more frequently than sensitive strains. A relation between resistance and the four aminoglycosides tested (gentamycin, kanamycin, neomycin, and streptomycin), but not to spectinomycin, was demonstrated. This observation is of interest given that spectinomycin is not always classified as an aminoglycoside because it lacks a traditional sugar moiety. Statistical analysis indicated relationships between resistance to some antibiotics (ampicillin and erythromycin, chloramphenicol and erythromycin, chloramphenicol and tetracycline, erythromycin and tetracycline), suggesting the linkage of resistance genes for antibiotics belonging to different classes. The effects of NiSO4, ZnCl2 and MnCl2 on various media suggested that the composition of Marine Broth might result in low concentrations of Mn2+ due to chemical interactions that potentially lead to precipitation.

  16. Multidrug resistant gram-negative bacteria in clinical isolates from Karachi.


    Saeed, Asma; Khatoon, Hajra; Ansari, Fasihuddin Ahmed


    A total of 54 gram-negative bacteria obtained from various pathological labs and hospitals of Karachi were screened for their resistance to ampicillin, chloramphenicol, gentamycin, kanamycin, neomycin, streptomycin and tetracycline antibiotics. Of the 54 bacteria, 50 were resistant to one or more antibiotics. Among the resistant bacteria, 13 out of 28 were found to transfer their resistances by conjugation. This indicates that at least 46% of clinical gram-negative bacteria in Karachi possess various types of transferable R plasmids, such as pAK5, pAK9, pAK10, pAK11, pAK12, pAK13, pAK14, pAK15, pAK16, pAK17, pAK18, pAK19, pAK20 and pAK21. The non-conjugative R plasmids included pMT14 and pZ26. Only pAK15 showed 26% segregation even after 20 consecutive transfers in plain broth (spontaneous segregation) whereas only pAK15 and pAK16 showed any significant loss of their markers in curing by acridine orange. The stability of R plasmids is more dangerous from clinical point of view.

  17. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).


    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye


    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  18. A method of batch-purifying microalgae with multiple antibiotics at extremely high concentrations

    NASA Astrophysics Data System (ADS)

    Han, Jichang; Wang, Song; Zhang, Lin; Yang, Guanpin; Zhao, Lu; Pan, Kehou


    Axenic microalgal strains are highly valued in diverse microalgal studies and applications. Antibiotics, alone or in combination, are often used to avoid bacterial contamination during microalgal isolation and culture. In our preliminary trials, we found that many microalgae ceased growing in antibiotics at extremely high concentrations but could resume growth quickly when returned to an antibiotics-free liquid medium and formed colonies when spread on a solid medium. We developed a simple and highly efficient method of obtaining axenic microalgal cultures based on this observation. First, microalgal strains of different species or strains were treated with a mixture of ampicillin, gentamycin sulfate, kanamycin, neomycin and streptomycin (each at a concentration of 600 mg/L) for 3 days; they were then transferred to antibiotics-free medium for 5 days; and finally they were spread on solid f/2 media to allow algal colonies to form. With this method, five strains of Nannochloropsis sp. (Eustigmatophyceae), two strains of Cylindrotheca sp. (Bacillariophyceae), two strains of Tetraselmis sp. (Chlorodendrophyceae) and one strain of Amphikrikos sp. (Trebouxiophyceae) were purified successfully. The method shows promise for batch-purifying microalgal cultures.

  19. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of water.


    Titilawo, Yinka; Sibanda, Timothy; Obi, Larry; Okoh, Anthony


    We evaluated the antibiogram profile of Escherichia coli (n = 300) isolated from selected rivers in Osun State, Nigeria. The identities of the E. coli isolates were confirmed by polymerase chain reaction (PCR) technique. Susceptibility of the isolates to 20 antibiotics conventionally used in clinical cases was assessed in vitro by the standardized agar disc-diffusion method. All the isolates were susceptible to imipenem, meropenem, amikacin and gatilofloxacin. The isolates were variously susceptible to the other antibiotics as follows: ciprofloxacin (96 %), kanamycin (95 %), neomycin (92 %), streptomycin (84 %), chloramphenicol (73 %), nalidixic acid (66 %), nitrofurantoin (64 %), gentamycin (63 %), doxycycline (58 %), cefepime (57 %), tetracycline (49 %) and cephalothin (42 %). The multiple antibiotic resistance indexing ranged from 0.50 to 0.80 for all the sampling locations and exceeded the threshold value of 0.2, suggesting the origin of the isolates to be of high antimicrobial usage. Our findings signify an increase in the incidence of antimicrobial resistance of E. coli towards conventionally used antibiotics necessitating proper surveillance programmes towards the monitoring of antimicrobial resistance determinants in water bodies.

  20. Occurrence of antibiotics in pharmaceutical industrial wastewater, wastewater treatment plant and sea waters in Tunisia.


    Tahrani, Leyla; Van Loco, Joris; Ben Mansour, Hedi; Reyns, Tim


    Antibiotics are among the most commonly used group of pharmaceuticals in human medicine. They can therefore reach surface and groundwater bodies through different routes, such as wastewater treatment plant effluents, surface runoff, or infiltration of water used for agricultural purposes. It is well known that antibiotics pose a significant risk to environmental and human health, even at low concentrations. The aim of the present study was to evaluate the presence of aminoglycosides and phenicol antibiotics in municipal wastewaters, sea water and pharmaceutical effluents in Tunisia. All analysed water samples contained detectable levels of aminoglycoside and phenicol antibiotics. The highest concentrations in wastewater influents were observed for neomycin and kanamycin B (16.4 ng mL(-1) and 7.5 ng mL(-1), respectively). Chloramphenicol was found in wastewater influents up to 3 ng mL(-1). It was observed that the waste water treatment plants were not efficient in completely removing these antibiotics. Chloramphenicol and florfenicol were found in sea water samples near aquaculture sites at levels up to, respectively, 15.6 ng mL(-1) and 18.4 ng mL(-1). Also aminoglycoside antibiotics were found near aquaculture sites with the highest concentration of 3.4 ng mL(-1) for streptomycin. In pharmaceutical effluents, only gentamycin was found at concentrations up to 19 ng mL(-1) over a sampling period of four months.

  1. Occurrence of antimicrobial residues in Brazilian food animals in 2008 and 2009.


    Nonaka, C K V; Oliveira, A M G; Paiva, C R; Almeida, M P; Rezende, C P; Moraes, C G O; Botelho, B G; Souza, L F; Dias, P G


    Brazil is one of the most important countries as a producer and exporter of cattle and poultry. In 2009 cattle accounted for 30% of the export market and 41.4% for poultry meat. The Brazilian National Residues and Contaminants Control Plan (PNCRC) follows the guidelines set by the Codex Alimentarius Commission and checks compliance maximum residue limits (MRLs) to ensure the quality of these commodities. Kidney samples (n = 2978) were analysed between January 2008 and December 2009. Fifteen antibiotics of the macrolide and aminoglycoside groups (clindamycin, eritromycin, lincomycin, tylmicosin, tylosin, amikacin, apramycin, dihydrostreptomycin, gentamycin, higromycin, kanamycin, neomycin, spectinomycin, streptomycin, tobramycin) were determined by a microbiological screening method (FAST) and confirmed/quantified using liquid chromatography (LC-MS/MS and UPLC-MS/MS). In 2008, 1459 samples were analysed by a screening test and liquid chromatography with only one sample (0.07%) exceeded Brazilian legislation limits (>MRL). In 2009, 1519 samples were analysed and none exceeding Brazilian legislation limits (>MRL). The slaughterhouses of 16 states were monitored during the year of 2008, and 18 states were monitored in 2009, being the major producing states most sampled by the PNCRC.

  2. Simultaneous determination of 15 aminoglycoside(s) residues in animal derived foods by automated solid-phase extraction and liquid chromatography-tandem mass spectrometry.


    Tao, Yanfei; Chen, Dongmei; Yu, Huan; Huang, Lingli; Liu, Zhaoying; Cao, Xiaoqin; Yan, Caixia; Pan, Yuanhu; Liu, Zhenli; Yuan, Zonghui


    An automated method has been developed for the simultaneous quantification of 15 aminoglycosides in muscle, liver (pigs, chicken and cattle), kidney (pigs and cattle), cow milk, and hen eggs by liquid chromatography tandem mass spectrometry. Homogenized samples were extracted by monopotassium phosphate buffer (including ethylene diamine tetraacetic acid), and cleaned up with auto solid-phase extraction by carboxylic acid cartridges. The analytes were separated by a specialized column for aminoglycosides, and eluted with trifluoroacetic acid and acetonitrile. The decision limits (CCα) of apramycin, gentamycin, tobramycin, paromomycin, hygromycin, neomycin, kanamycin, sisomicin, netilmicin, ribostamycin, kasugamycin, amikacin, streptomycin, dihydrostreptomycin and spectinomycin were ranged from 8.1 to 11.8 μg/kg and detection capabilities (CCβ) from 16.4 to 21.8 μg/kg. High correlation coefficients (r(2)>0.99) of calibration curves for the analytes were obtained within linear from 20 to 1000 μg/kg. Reasonable recoveries (71-108%) were demonstrated with excellent relative standard deviation (RSD). This method is simple pretreatment, rapid determination and high sensitivity, which can be used in the determination of multi-aminoglycosides in complex samples. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. [Determination of ten aminoglycoside residues in milk and dairy products using high performance liquid chromatography-tandem mass spectrometry].


    Gong, Qiang; Ding, Li; Zhu, Shaohua; Jiao, Yanna; Cheng, Jing; Fu, Shanliang; Wang, Libing


    A high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/ MS) analytical method was developed for the simultaneous determination of ten aminoglycoside residues (streptomycin, dihydrostrepmycin, neomycin, kanamycin, tobramycin, gentamycin, apramycin, hygromycin B, paromomycin, and amkacin) in milk and dairy products. The sample was extracted with 5% trichloroacetic acid aqueous solution, then the extract was purified by a hydrophilic-lipophilic balance (HLB) cartridge. The ten aminoglycoside residues were separated by ion-pair reversed phase high performance liquid chromatography. Heptafluorobutyric acid was used as ion pair agent due to its volatility. Then the analytes were detected by electrospray ionization tandem mass spectrometry. The pretreatment condition of the sample, the HPLC condition and the MS operation parameters were optimized. The results showed that the linearities of the ten aminoglycoside residues in 20-1000 microg/L had the correlation coefficient between 0.9946-0.9997. The recoveries ranged from 71.2% and 101.7% with the relative standard deviations of 3.4%-13.8%. The proposed method was successfully applied to the determination of the mass concentrations of the analytes in related samples, which provides a simple, and convenient method for the quality control of milk and dairy products. Furthermore, this method is effective for the safety monitoring of aminoglycoside residues in milk and dairy products.

  4. Neomycin, Polymyxin, and Bacitracin Topical


    ... Talk to your pharmacist or contact your local garbage/recycling department to learn about take-back programs in your community. See the FDA's Safe Disposal of Medicines website ( for ...

  5. Genotypic susceptibility testing of Mycobacterium tuberculosis isolates for amikacin and kanamycin resistance by use of a rapid sloppy molecular beacon-based assay identifies more cases of low-level drug resistance than phenotypic Lowenstein-Jensen testing.


    Chakravorty, Soumitesh; Lee, Jong Seok; Cho, Eun Jin; Roh, Sandy S; Smith, Laura E; Lee, Jiim; Kim, Cheon Tae; Via, Laura E; Cho, Sang-Nae; Barry, Clifton E; Alland, David


    Resistance to amikacin (AMK) and kanamycin (KAN) in clinical Mycobacterium tuberculosis strains is largely determined by specific mutations in the rrs gene and eis gene promoter. We developed a rapid, multiplexed sloppy molecular beacon (SMB) assay to identify these mutations and then evaluated assay performance on 603 clinical M. tuberculosis DNA samples collected in South Korea. Assay performance was compared to gold-standard phenotypic drug susceptibility tests, including Lowenstein-Jensen (LJ) absolute concentration, mycobacterial growth indicator tubes (MGIT), and TREK Sensititre MycoTB MIC plate (MycoTB) methods. Target amplicons were also tested for mutations by Sanger sequencing. The SMB assay correctly detected 115/116 mutant and mixed sequences and 487/487 wild-type sequences (sensitivity and specificity of 99.1 and 100%, respectively). Using the LJ method as the reference, sensitivity and specificity for AMK resistance were 92.2% and 100%, respectively, and sensitivity and specificity for KAN resistance were 87.7% and 95.6%, respectively. Mutations in the rrs gene were unequivocally associated with high-level cross-resistance to AMK and KAN in all three conventional drug susceptibility testing methods. However, eis promoter mutations were associated with KAN resistance using the MGIT or MycoTB methods but not the LJ method. No testing method associated eis promoter mutations with AMK resistance. Among the discordant samples with AMK and/or KAN resistance but wild-type sequence at the target genes, we discovered four new mutations in the whiB7 5' untranslated region (UTR) in 6/22 samples. All six samples were resistant only to KAN, suggesting the possible role of these whiB7 5' UTR mutations in KAN resistance.

  6. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2012 CFR


    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  7. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2010 CFR


    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  8. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2014 CFR


    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  9. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2011 CFR


    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  10. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2013 CFR


    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  11. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2010 CFR


    ... Indications for Use Limitations Sponsor (1) 250 to 2,250 grams per ton (g/t) of dry type C feed. Cattle, swine... hours beyond remission of disease symptoms. Discontinue treatment prior to slaughter as follows: Cattle 1 day, swine 3 days, sheep 2 days, and goats 3 days. A withdrawal period has not been...

  12. Molecular Determinants of Antibiotic Recognition and Resistance by Aminoglycoside Phosphotransferase (3′)-IIIa: A Calorimetric and Mutational Analysis

    PubMed Central

    Kaul, Malvika; Barbieri, Christopher M.; Srinivasan, Annankoil R.; Pilch, Daniel S.


    Summary The growing threat from the emergence of multidrug resistant pathogens highlight a critical need to expand our currently available arsenal of broad-spectrum antibiotics. In this connection, new antibiotics must be developed that exhibit the abilities to circumvent known resistance pathways. An important step toward achieving this goal is to define the key molecular interactions that govern antibiotic resistance. Here, we use site-specific mutagenesis, coupled with calorimetric, NMR, and enzymological techniques, to define the key interactions that govern the binding of the aminoglycoside antibiotics neomycin and kanamycin B to APH(3′)-IIIa (an antibiotic phosphorylating enzyme that produces resistance). Our mutational analyses identify the D261, E262, and C-terminal F264 residues of the enzyme as being critical for recognition of the two drugs as well as the manifestation of the resistance phenotype. In addition, the E160 residue is more important for recognition of kanamycin B than neomycin, with mutation of this residue partially restoring sensitivity to kanamycin B but not to neomycin. By contrast, the D193 residue partially restores sensitivity to neomycin but not to kanamycin B, with the origins of this differential effect being due to the importance of D193 for catalyzing the phosphorylation of neomycin. These collective mutational results, coupled with 15N NMR-derived pKa and calorimetrically-derived binding-linked drug protonation data, identify the 1-, 3-, and 2′-amino groups of both neomycin and kanamycin B as being critical functionalities for binding to APH(3′)-IIIa. These drug amino functionalities represent potential sites of modification in the design of next-generation compounds that can overcome APH(3′)-IIIa-induced resistance. PMID:17418235

  13. Molecular determinants of antibiotic recognition and resistance by aminoglycoside phosphotransferase (3')-IIIa: a calorimetric and mutational analysis.


    Kaul, Malvika; Barbieri, Christopher M; Srinivasan, Annankoil R; Pilch, Daniel S


    The growing threat from the emergence of multidrug resistant pathogens highlights a critical need to expand our currently available arsenal of broad-spectrum antibiotics. In this connection, new antibiotics must be developed that exhibit the abilities to circumvent known resistance pathways. An important step toward achieving this goal is to define the key molecular interactions that govern antibiotic resistance. Here, we use site-specific mutagenesis, coupled with calorimetric, NMR, and enzymological techniques, to define the key interactions that govern the binding of the aminoglycoside antibiotics neomycin and kanamycin B to APH(3')-IIIa (an antibiotic phosphorylating enzyme that confers resistance). Our mutational analyses identify the D261, E262, and C-terminal F264 residues of the enzyme as being critical for recognition of the two drugs as well as for the manifestation of the resistance phenotype. In addition, the E160 residue is more important for recognition of kanamycin B than neomycin, with mutation of this residue partially restoring sensitivity to kanamycin B but not to neomycin. By contrast, the D193 residue partially restores sensitivity to neomycin but not to kanamycin B, with the origins of this differential effect being due to the importance of D193 for catalyzing the phosphorylation of neomycin. These collective mutational results, coupled with (15)N NMR-derived pK(a) and calorimetrically derived binding-linked drug protonation data, identify the 1-, 3-, and 2'-amino groups of both neomycin and kanamycin B as being critical functionalities for binding to APH(3')-IIIa. These drug amino functionalities represent potential sites of modification in the design of next-generation compounds that can overcome APH(3')-IIIa-induced resistance.

  14. Effect of polyhexanide and gentamycin on human osteoblasts and endothelial cells.


    Ince, Akif; Schütze, Norbert; Hendrich, Christian; Jakob, Franz; Eulert, Jochen; Löhr, Jochen F


    Infection of total joint replacements is painful, disabling and difficult to treat because of the increasing bacterial resistance against antibiotics. In view of this, antiseptics show limited bacterial tolerance and have a broad-spectrum antimicrobial activity. However, the application of antiseptics to bone is insufficiently studied in literature. Therefore, we investigated the biocompatibility of the antiseptic polyhexanide with bone related cells and asked whether supplementation to bone cement is appropriate in the management of total arthroplasty infections. We performed an in vitro study with immortalised human foetal osteoblast cells (hFOB 1.19) and human endothelial cells (EAhy 926). The cultured cells were exposed to media containing various concentrations of gentamicin (12.5-800 microg/ml) and polyhexanide (0.0006-0.01%) for six hours. We measured the phase-contrast microscopy images, the cell viability, cell number and the alkaline phosphatase activity as a parameter for osteogenic function. The exposure of hFOB and endothelial cells to polyhexanide showed a severe reduction of viability and cell number. Gentamicin did not have negative effects on hFOB and endothelial cell number and viability. The alkaline phosphatase activity of hFOB showed a significant decrease after exposure to polyhexanide and gentamicin. The viability and the cell number of endothelial cells seem more negatively affected by polyhexanide than the parameters of the hFOB-cells. The exposure of human osteoblasts and endothelial cells to polyhexanide at concentrations with questionable antibacterial activity resulted in severe cell damage whereas exposure to high dosed gentamicin did not. These results raise questions as to the feasibility of using antiseptics in bone cement for the treatment of total arthroplasty infections. Further in vivo studies are necessary to show the in vivo relevance of these in vitro findings.

  15. [Antibiotic prophylaxis in oncologic pharyngolaryngeal surgery: ceftriaxone versus clindamycin and gentamycin].


    Subirana, F X; Lorente, J; Pérez, M; Quesada, J L; Grasa, J; Fortuny, P; Roselló, J; Quesada, P


    There are many papers comparing two antibiotic protocols for the profilaxis of head and neck infections after laryngeal surgery. We present one prospective and randomised study in 60 patients comparing the efficacy of two protocols. The comparison was between ceftriaxone versus the association of clindamicyn and gentamicyn. In our database we included the risk factors for infection, the surgical approach, the duration of surgery and the patient characteristics. We observed an incidence of 28% of infection, with a 23.3% in the clindamicyn + gentamicyn group and a 33.3% in the ceftriaxone group. The differences between the two groups were not statistically significant. In this study we observed a small difference between the amount of alcohol comsuption, the effectiveness of the surgical drainage, the surgical approach and the presence of wound infection. The difference was not statistical significant due to the small group of patients. The profilaxis was adequate for the total laryngectomy and cordectomy group, with a higher incidence of wound infection in patients treated with a supraglottic laryngectomy.

  16. Aph(3′)-IIc, an Aminoglycoside Resistance Determinant from Stenotrophomonas maltophilia▿

    PubMed Central

    Okazaki, Aki; Avison, Matthew B.


    We report the characterization of an intrinsic, chromosomally carried aph(3′)-IIc gene from Stenotrophomonas maltophilia clinical isolate K279a, encoding an aminoglycoside phosphotransferase enzyme that significantly increases MICs of kanamycin, neomycin, butirosin, and paromomycin when expressed in Escherichia coli. Disruption of aph(3′)-IIc in K279a results in decreased MICs of these drugs. PMID:17088477

  17. Two-dimensional combinatorial screening enables the bottom-up design of a microRNA-10b inhibitor.


    Velagapudi, Sai Pradeep; Disney, Matthew D


    The RNA motifs that bind guanidinylated kanamycin A (G Kan A) and guanidinylated neomycin B (G Neo B) were identified via two-dimensional combinatorial screening (2DCS). The results of these studies enabled the "bottom-up" design of a small molecule inhibitor of oncogenic microRNA-10b.

  18. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR


    ... chapter. (c) Conditions of use in dogs—(1) Amount. Apply a thin film to the affected eye three or four... after the eye appears normal. (2) Indications for use. For the treatment of various eye...

  19. 21 CFR 524.1200b - Kanamycin ophthalmic solution.

    Code of Federal Regulations, 2014 CFR


    ... chapter. (c) Conditions of use in dogs—(1) Amount. Instill a few drops into the affected eye every 3 hours... 48 hours after the eye appears normal. (2) Indications for use. For the treatment of various...

  20. Spectrophotometric assay for amikacin using purified kanamycin acetyltransferase.


    Scarbrough, E; Williams, J W; Northrop, D B


    A rapid spectrophotometric assay has been developed for measuring the concentrations of amikacin and related antibiotics in serum. The assay uses a purified enzyme from R-factor E. coli which acetylates amikacin with the production of coenzyme A, the latter in turn being reacted with a sulfhydryl reagent to produce stoichiometric amounts of a sensitive chromophore, that is measured in the visible spectrum. The system complements an earlier assay for gentamicin-related antibiotics thereby facilitating the rapid measurement of the concentrations of all clinically important aminoglycosides in serum.

  1. [Joint action of aminoglycoside antibiotics and nitrofurans with bile on bacteria of the genus Proteus].


    Sytnik, I A; Puzakova, E V


    The combined effect of monomycin, kanamycin, neomycin and nitrofurans, such as furacillin, furagin, nitrofurantoin and furazolidone with bovine bile was studied on 36 strains of Proteus mirabilis and 14 strains of Proteus vulgaris. It was found that sub-bacteriostatic doses of the bile significantly increased the antiproteus activity of the aminoglycoside antibiotics and nitrofurans. The combinations of the bile with monomycin and kanamycin and the bile with furazolidone and nitrofurantoin proved to be most effective. Clinical trials of the drugs in treatment of inflammatory diseases of the biliferous system of the Proteus etiology are recommended.

  2. Antifungal Amphiphilic Aminoglycosides

    PubMed Central

    Chang, C.-W. T.; Takemoto, J.Y.


    The attachment of alkyl and other hydrophobic groups to traditional antibacterial kanamycins and neomycins creates amphiphilic aminoglycosides with altered antimicrobial properties. In this review, we summarize the discovery of amphiphilic kanamycins that are antifungal, but not antibacterial, and that inhibit the growth of fungi by perturbation of plasma membrane functions. With low toxicities against plant and mammalian cells, they appear to specifically target the fungal plasma membrane. These new antifungal agents offer new options for fighting fungal pathogens and are examples of reviving old drugs to confront new therapeutic challenges. PMID:25110571

  3. Stable genetic transformation of intact Nicotiana cells by the particle bombardment process

    PubMed Central

    Klein, Theodore M.; Harper, Elisabeth C.; Svab, Zora; Sanford, John C.; Fromm, Michael E.; Maliga, Pal


    We show that the genetic transformation of Nicotiana tabacum can be achieved by bombarding intact cells and tissues with DNA-coated particles. Leaves or suspension culture cells were treated with tungsten microprojectiles carrying plasmid DNA containing a neomycin phosphotransferase gene. Callus harboring the foreign gene was recovered from the bombarded tissue by selection on medium containing kanamycin. Kanamycin-resistant plants have subsequently been regenerated from the callus derived from leaves. Transient expression of an introduced β-glucuronidase gene was used to assess the efficiency of DNA delivery by microprojectiles. The frequency of cells that were stably transformed with the neomycin phosphotransferase gene was a few percent of the cells that transiently expressed the β-glucuronidase gene. These results show that gene transfer by high-velocity microprojectiles is a rapid and direct means for transforming intact plant cells and tissues that eliminates the need for production of protoplasts or infection by Agrobacterium. Images PMID:16593993

  4. The aminoglycosides modulate the acid-sensing ionic channel currents in dorsal root ganglion neurons from the rat.


    Garza, Aníbal; López-Ramírez, Omar; Vega, Rosario; Soto, Enrique


    Acid-sensing ionic channels (ASICs) have been shown to have a significant role in a growing number of physiological and pathological processes, such as nociception, synaptic transmission and plasticity, mechanosensation, and acidosis-induced neuronal injury. The discovery of pharmacological agents targeting ASICs has significant therapeutic potential and use as a research tool. In our work, we studied the action of transient perfusion (5-15 s) of aminoglycosides (AGs) (streptomycin and neomycin) on the proton-gated ionic currents in dorsal root ganglion (DRG) neurons of the rat and in human embryonic kidney (HEK)-293 cells. In DRG neurons, streptomycin and neomycin (30 microM) produced a significant, concentration-dependent, and reversible reduction in the amplitude of the proton-gated current, and a slowing of the desensitization rate of the ASIC current. Gentamycin (30 microM) also showed a significant reversible action on the ASIC currents. The curves of the pH effect for streptomycin and neomycin indicated that their effect was not significantly affected by pH. In HEK-293 cells, streptomycin (30 microM) produced a significant reduction in the amplitude of the proton-gated current. Neomycin and gentamycin had no significant action. Reduction of extracellular Ca(2+) concentration produced a significant increase in the action of streptomycin and neomycin on the desensitization time course of ASIC currents. These results indicate that ASICs are molecular targets for AGs, which may contribute to the understanding of their actions on excitable cells. Moreover, AGs may constitute a source to develop novel molecules with a greater affinity, specificity, and selectivity for the different ASIC subunits.

  5. Complexation of anionic copolymers of acrylamide and N-(2-hydroxypropyl)methacrylamide with aminoglycoside antibiotics

    NASA Astrophysics Data System (ADS)

    Solovskii, M. V.; Tarabukina, E. B.; Amirova, A. I.; Zakharova, N. V.; Smirnova, M. Yu.; Gavrilova, I. I.


    The complexation of aminoglycoside antibiotics neomycin, gentamicin, kanamycin, and amikacin in the form of free bases with carboxyl- and sulfo-containing copolymers of acrylamide and N-(2-hydroxypropyl)methacrylamide (HPMA) in water and water-salt solutions is studied by means of viscometry, equilibrium dialysis, potentiometric titration, and molecular hydrodynamics. Factors influencing the stability of formed copolymer-antibiotic complexes and determinations of their toxicity are established.

  6. Salmonellosis in Indonesia: Phage-Type of Salmonella oranienburg Obtained from Hospitalized Patients in Jakarta, Indonesia

    DTIC Science & Technology


    difference of two proportions) and greater overall reistance (all antibiotics combined P = 0.-001, even when tetracycline isI excluded; P = 0-022 ((’hi...susceptible to dehydration. Phage type I was sig- nificantly more resistant than phage type II to the individual antibiotics : tetra- cycline, chloramphenicol...kanamycin and neomycin. However, there was no difference in their respective antibiotic resistance patterns as measured by disk and MIC assay. All

  7. A survey of antibiotic resistance among E. coli strains isolated from poultry in Karachi.


    Ansari, F A; Khatoon, H


    Studies were carried out to investigate the incidence of multiple antibiotic resistance among E .coli (total 152) isolated from poultry in Karachi to eight commonly used antibiotics: ampicillin (A), chloramphenicol (C), gentamycin (G), anamycin (K), neomycin (N), polymyxin B (P), streptomycin (S) and tetracycline (T) at the levels of 50 microg/ml, 100 microg/ml and 500 microg/ml. Tables of the results are given, showing the number of resistant strains of different patterns of antibiotic resistance at different levels. A comparison of antibiotic resistance to different number of antibiotics and the frequency of resistance to individual antibiotic at different levels is also reported. The highest frequency of resistance was against tetracycline whereas the lowest frequency of resistance was against gentamycin. Thirty R plasmids were isolated from the resistant strains and will be reported elsewhere.

  8. 21 CFR 524.981c - Fluocinolone and neomycin cream.

    Code of Federal Regulations, 2014 CFR


    ... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS.... 099207 in § 510.600(c) of this chapter. (c) Conditions of use in dogs—(1) Amount—A small amount is applied to the affected area two or three times daily. (2) Indications for use—(i) Dogs. For the relief of...

  9. From GUIDON to NEOMYCIN and HERACLES in Twenty Short Lessons.

    DTIC Science & Technology


    infection might be Diplococcus, Psuedomonas , present-values RULE or Neisseria. MYCIN rules that conclude about the organ- 0{X. isms causing the infection are...goals. not the negative evidence. GUIDON concludes in a simi- lar way that Psesdomonas is believed by the student be- cause the patient is burned -but not...consistent with KNOWLEDGE OTITIS-MEDIA? paltient infection -ecifiC * NO factors 38) Has J. Smith ever undergone splenectomy? ** NO 39) Is J. Smith a burn

  10. 21 CFR 524.1484k - Prednisolone and neomycin suspension.

    Code of Federal Regulations, 2014 CFR


    ... use in dogs and cats—(1) Amount. For beginning treatment of acute ocular inflammations place 1 or 2 drops in the conjunctival sac 3 to 6 times during a 24 hour period. When improvement occurs, reduce the dosage to 1 drop 2 to 4 times daily. For otitis externa, place 2 to 6 drops in the external ear canal...

  11. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2011 CFR


    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...

  12. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2014 CFR


    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...

  13. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2012 CFR


    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...

  14. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2013 CFR


    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...


    PubMed Central

    Watanabe, Tsutomu; Ogata, Chizuko; Sato, Sachiko


    Watanabe, Tsutomu (Keio University School of Medicine, Tokyo, Japan), Chizuko Ogata, and Sachiko Sato. Episome-mediated transfer of drug resistance in Enterobacteriaceae. VIII. Six-drug-resistance R factor. J. Bacteriol. 88:922–928. 1964.—The multiple-drug-resistant Escherichia coli strain isolated by Lebek in 1963 was found to transfer resistance to sulfonamide, streptomycin, chloramphenicol, tetracycline, kanamycin, and neomycin together by conjugation, as well as by transduction with phage P1kc, suggesting that these drug-resistance markers are carried by a single R factor (R6). The results of transductional and spontaneous segregations of the drug-resistance markers of R6 have shown that R6 has independent genetic determinants for sulfonamide, streptomycin, chloramphenicol, tetracycline, and kanamycin-neomycin resistance. Resistance to kanamycin and neomycin is probably controlled by a single gene, because no segregation was observed between these two. The resistance transfer factor of R6 was found to be of the fi+ type. PMID:14219055

  16. Investigation on gene transfer from genetically modified corn (Zea mays L.) plants to soil bacteria.


    Ma, B L; Blackshaw, Robert E; Roy, Julie; He, Tianpei


    Knowledge about the prevalence and diversity of antibiotic resistance genes in soil bacteria communities is required to evaluate the possibility and ecological consequences of the transfer of these genes carried by genetically modified (GM) plants to soil bacteria. The neomycin phosphotransferase gene (nptII) conferring resistance to kanamycin and neomycin is one of the antibiotic resistance genes commonly present in GM plants. In this study, we investigated kanamycin-resistant (Km(R)) and neomycin-resistant (Nm(R)) soil bacterial populations in a 3-year field trial using a commercial GM corn (Zea mays L.) carrying the nptII gene and its near isogenic line. The results showed that a portion (2.3 - 15.6 %) of cultivable soil bacteria was naturally resistant to kanamycin or neomycin. However, no significant difference in the population level of Km(R) or Nm(R) soil bacteria was observed between the GM and non-GM corn fields. The nptII gene was not detected in any of the total 3000 Km(R) or Nm(R) isolates screened by PCR. Further, total soil bacterial cells were collected through Nycodenz gradient centrifugation and bacterial community DNA was subjected to PCR. Detection limit was about 500 cells per gram of fresh soil. Our study suggests that the nptII gene was relatively rare in the soil bacterial populations and there was no evidence of gene transfer from a GM corn plant to soil bacteria based on the data from total soil bacterial communities.

  17. Real-time examination of aminoglycoside activity towards bacterial mimetic membranes using Quartz Crystal Microbalance with Dissipation monitoring (QCM-D).


    Joshi, Tanmaya; Voo, Zhi Xiang; Graham, Bim; Spiccia, Leone; Martin, Lisandra L


    The rapid increase in multi-drug resistant bacteria has resulted in previously discontinued treatments being revisited. Aminoglycosides are effective "old" antibacterial agents that fall within this category. Despite extensive usage and understanding of their intracellular targets, there is limited mechanistic knowledge regarding how aminoglycosides penetrate bacterial membranes. Thus, the activity of two well-known aminoglycosides, kanamycin A and neomycin B, towards a bacterial mimetic membrane (DMPC:DMPG (4:1)) was examined using a Quartz Crystal Microbalance with Dissipation monitoring (QCM-D). The macroscopic effect of increasing the aminoglycoside concentration showed that kanamycin A exerts a threshold response, switching from binding to the membrane to disruption of the surface. Neomycin B, however, disrupted the membrane at all concentrations examined. At concentrations above the threshold value observed for kanamycin A, both aminoglycosides revealed similar mechanistic details. That is, they both inserted into the bacterial mimetic lipid bilayer, prior to disruption via loss of materials, presumably aminoglycoside-membrane composites. Depth profile analysis of this membrane interaction was achieved using the overtones of the quartz crystal sensor. The measured data is consistent with a two-stage process in which insertion of the aminoglycoside precedes the 'detergent-like' removal of membranes from the sensor. The results of this study contribute to the insight required for aminoglycosides to be reconsidered as active antimicrobial agents/co-agents by providing details of activity at the bacterial membrane. Kanamycin and neomycin still offer potential as antimicrobial therapeutics for the future and the QCM-D method illustrates great promise for screening new antibacterial or antiviral drug candidates.

  18. A prospective study on evaluation of pathogenesis, biofilm formation, antibiotic susceptibility of microbial community in urinary catheter

    NASA Astrophysics Data System (ADS)

    Younis, Khansa Mohammed; Usup, Gires; Ahmad, Asmat


    This study is aimed to isolate, detect biofilm formation ability and antibiotic susceptibility of urinary catheter adherent microorganisms from elderly hospitalized patient at the Universiti Kebangsaan Malaysia Medical Center. Microorganisms were isolated from three samples of urinary catheters (UC) surface; one of the acute vascular rejection patient (UCB) and two from benign prostate hyperplasia patients (UCC and UCD). A total of 100 isolates was isolated with 35 from UCB, 38 (UCC) and 28 (UCD). Ninety six were identified as Gram-negative bacilli, one Gram-positive bacilli and three yeasts. Results of biofilm forming on sterile foley catheter showed that all the isolates can form biofilm at different degrees; strong biofilm forming: 32% from the 35 isolates (UCB), 25% out of 38 isolates (UCC), 26% out of 28 isolates (UCD). As for moderate biofilm forming; 3% from UCB, 10% from UCC and 2% from UCD. Weak biofilm forming in UCC (3%). The antibiotic susceptibility for (UCB) isolates showed highly resistant to ampicillin, novobiocin and penicillin 100 (%), kanamycin (97%), tetracycline (94%), chloramphenicol (91%), streptomycin (77%) and showed low level of resistance to gentamycin (17%), while all the isolates from (UCC-D) showed high resistant towards ampicillin and penicillin, novobiocin (94%), tetracycline (61%), streptomycin (53%), gentamycin (50%) and low level of resistance to kanamycin (48%), chloramphenicol (47%). The findings indicate that these isolates can spread within the community on urinary catheters surface and produce strong biofilm, therefore, monitoring antibiotic susceptibility of bacteria isolated in the aggregation is recommended.

  19. Effect of in-feed paromomycin supplementation on antimicrobial resistance of enteric bacteria in turkeys.


    Kempf, Isabelle; Le Roux, Aurélie; Perrin-Guyomard, Agnès; Mourand, Gwenaëlle; Le Devendec, Laetitia; Bougeard, Stéphanie; Richez, Pascal; Le Pottier, Gilles; Eterradossi, Nicolas


    Histomoniasis in turkeys can be prevented by administering paromomycin sulfate, an aminoglycoside antimicrobial agent, in feed. The aim of this study was to evaluate the impact of in-feed paromomycin sulfate supplementation on the antimicrobial resistance of intestinal bacteria in turkeys. Twelve flocks of breeder turkeys were administered 100 ppm paromomycin sulfate from hatching to day 120; 12 flocks not supplemented with paromomycin were used as controls. Faecal samples were collected monthly from days 0 to 180. The resistance of Escherichia coli, Enterococcus faecium and Staphylococcus aureus to paramomycin and other antimicrobial agents was compared in paromomycin supplemented (PS) and unsupplemented (PNS) flocks. E. coli from PS birds had a significantly higher frequency of resistance to paromomycin, neomycin and kanamycin until 1 month after the end of supplementation compared to PNS birds. Resistance to amoxicillin or trimethoprim-sulfamethoxazole was also more frequent in PS turkeys. Resistance was mainly due to the presence of aph genes, which could be transmitted by conjugation, sometimes with streptomycin, tetracycline, amoxicillin, trimethoprim or sulfonamide resistance genes. Resistance to kanamycin and streptomycin in E. faecium was significantly different in PS and PNS breeders on days 60 and 90. Significantly higher frequencies of resistance to paromomycin, kanamycin, neomycin and tobramycin were observed in S. aureus isolates from PS birds. Paromomycin supplementation resulted in resistance to aminoglycosides in bacteria of PS turkeys. Co-selection for resistance to other antimicrobial agents was observed in E. coli isolates. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. [Experimental transmission of antibiotic resistance in chicks].


    Todorov, T; Todorova, P; Kokosharov, T


    Multi-drug resistance of Salmonella heidelberg was transmitted to normal intestinal flora (E. coli organisms were resistant to ampicillin, streptomycin, tetracycline, erythromycin, and oleandomycin. The donor strains of Salmonella heidelberg used in the experiment was a carrier of the following nine markers of resistance: ampicillin, streptomycin, chloramphenicol, kanamycin, neomycin, novobiocin, tetracycline, erythromycin, and oleandomycin. The donor strains of Salmonella heidelberg used in the experiment was a carrier of the following nine markers of resistance: ampicillin, streptomycin, chloramphenicol, kanamycin, neomycin, novobiocin, tetracycline, erythromycin, and oeandomycin, novobiocin, tetracycline, erythromycin, and oleandomycin. The resistance to drugs was transmitted with the oral administration of the donor strain at the preliminary neutralization of the action of hydrochloric acid in the stomah secretion through sodium bicarbonate (1 cm3 of a 10 per cent sol.) an hour prior to feeding the birds with Salmonella heidelberg (1 cm3 of 10(10). In other experiments carboneum tetrachloratum was injected at rates of 0.08 to 0.15 cm3 (acocrting with the body weight of birds) one day prior to infection, followed by the administration of 0.20 to 0.40 cm3 of a 2 per cent solution of omnopon. Escherichia coli organisms acquired new markers of resistance--to chloramphenicol, kanamycin, neomycin and novobiocin. The level of resistance proved equal with that to the donor strain. A total of 1.8 to 5.4 per cent of the intestinal E. coli investigated proved to be carriers of the indicated markers of resitance. Highest level in acquiring markers of multi-drug resistance (13 per cent) showed E. coli organisms isolated from the liver of birds injected additionally with C. tetrachloratum omnopon.

  1. Genetic transformation and gene expression in white pine (pinus strobus)

    SciTech Connect

    Minocha, R.


    The objectives of the study were: (1) to develop protocols for transformation of white pine (Pinus strobus) embryonic tissue; and (2) to analyze the regulation of foreign gene expression in Pinus strobus. A number of Agrobacterium tumefaciens strains containing chimeric genes for neomycin phosphotransferase (NPTII for kanamycin resistance) and chloramphenicol acetyl transferase (CAT) under the control of either a constitutive promoter (NOS-nopaline synthase) or light-inducible promoters (RuBisCO small subunit and chlorophyll a/b binding protein) were used. A variety of tissues from white pine seedlings and mature trees was used. The techniques for transformation were modified from those used for tobacco transformation. The results show that white pine tissue from young seedlings is high suitable for transformation by A. tumefaciens. Whereas the normal tissues are very sensitive to kanamycin, transformed callus was quite resistant to this antibiotic.

  2. Transgenic maize plants by tissue electroporation.

    PubMed Central

    D'Halluin, K; Bonne, E; Bossut, M; De Beuckeleer, M; Leemans, J


    In this paper, we describe the transformation of regenerable maize tissues by electroporation. In many maize lines, immature zygotic embryos can give rise to embryogenic callus cultures from which plants can be regenerated. Immature zygotic embryos or embryogenic type I calli were wounded either enzymatically or mechanically and subsequently electroporated with a chimeric gene encoding neomycin phosphotransferase (neo). Transformed embryogenic calli were selected from electroporated tissues on kanamycin-containing media and fertile transgenic maize plants were regenerated. The neo gene was transmitted to the progeny of kanamycin-resistant transformants in a Mendelian fashion. This showed that all transformants were nonchimeric, suggesting that transformation and regeneration are a single-cell event. The maize transformation procedure presented here does not require the establishment of genotype-dependent embryogenic type II callus or cell suspension cultures and facilitates the engineering of new traits into agronomically relevant maize inbred lines. PMID:1334743

  3. Agrobacterium-mediated transformation of Ruta graveolens L.


    Lièvre, Karine; Tran, Thi Lê Minh; Doerper, Sébastien; Hehn, Alain; Lacoste, Paul; Thomasset, Brigitte; Bourgaud, Frédéric; Gontier, Eric


    Agrobacterium tumefaciens is used to develop a genetic transformation method for a medicinal plant Ruta graveolens. The direct plant regeneration strategy is preferred to callus line establishment. In vitro seedlings, 2- -to 3-wk-old, are used to excise hypocotyls and co-cultivated for 3 d with A. tumefaciens strain C58C1Rif containing plasmid pTDE4 harbouring neomycin phosphotransferase (npt II, kanamycin resistance) and beta-glucuronidase encoding genes. The Southern blot analysis has shown that 78% kanamycin resistant plants contain gene encoding beta-glucuronidase. The GUS histochemical assay shows that 67% transgenic plants exhibit the corresponding enzymatic activity. Routine transformation efficiency of R. graveolens L. is 11% and could reach up to 22%. Transgenic plants are grown in the greenhouse within 4 months after the initial seedlings.

  4. Indian mustard [Brassica juncea (L.) Czern.].


    Gasic, Ksenija; Korban, Schuyler S


    All economically important Brassica species have been successfully transformed using Agrobacterium tumefaciens. Although different tissues have been used as explants, hypocotyls remain the most desirable explants for Brassica tissue culture owing to their amenability to regeneration. Young explants excised from 3- to 4-d-old seedlings have exhibited optimal regeneration potential; the addition of adjuvants such as silver nitrate to the selection medium is necessary to achieve high efficiency of transformation. This chapter describes an Agrobacterium-mediated transformation protocol for Indian mustard based on inoculation of hypocotyls. The selectable marker gene used encodes for neomycin phosphotransferase II (nptII), and the selection agent is kanamycin.

  5. Genetic Transformation of Maize Cells by Particle Bombardment

    PubMed Central

    Klein, Theodore M.; Kornstein, Laura; Sanford, John C.; Fromm, Michael E.


    Intact maize cells were bombarded with microprojectiles bearing plasmid DNA coding for selectable (neomycin phosphotransferase [NPT II]) and screenable (β-glucuronidase [GUS]) marker genes. Kanamycin-resistant calli were selected from bombarded cells, and these calli carried copies of the NPT II and GUS genes as determined by Southern blot analysis. All such calli expressed GUS although the level of expression varied greatly between transformed cell lines. These results show that intact cells of important monocot species can be stably transformed by microprojectiles. Images Figure 2 Figure 3 PMID:16667039

  6. Novel ABC Transporter Gene, vga(C), Located on a Multiresistance Plasmid from a Porcine Methicillin-Resistant Staphylococcus aureus ST398 Strain ▿

    PubMed Central

    Kadlec, Kristina; Schwarz, Stefan


    A novel ABC transporter gene, vga(C), was identified on the 14,365-bp multiresistance plasmid pKKS825 in a porcine methicillin (meticillin)-resistant Staphylococcus aureus isolate of sequence type 398. The vga(C) gene encodes a 523-amino-acid protein which confers resistance not only to streptogramin A antibiotics but also to lincosamides and pleuromutilins. Plasmid pKKS825 also carries the resistance genes aadD, tet(L), and dfrK, which may enable the coselection of vga(C) under selective pressure by kanamycin/neomycin, tetracyclines, and trimethoprim. PMID:19470508

  7. Novel Plasmid-Borne Multidrug Resistance Gene Cluster Including lsa(E) from a Linezolid-Resistant Enterococcus faecium Isolate of Swine Origin

    PubMed Central

    Si, Hongbin; Zhang, Wan-Jiang; Chu, Shengbo; Wang, Xiu-Mei; Dai, Lei; Hua, Xin; Dong, Zhimin


    A novel nonconjugative plasmid of 28,489 bp from a porcine linezolid-resistant Enterococcus faecium isolate was completely sequenced. This plasmid harbored a novel type of multiresistance gene cluster that comprised the resistance genes lnu(B), lsa(E), spw, aadE, aphA3, and two copies of erm(B), which account for resistance to macrolides, lincosamides, streptogramins, pleuromutilins, streptomycin, spectinomycin, and kanamycin/neomycin. Structural comparisons suggested that this plasmid might have developed from other enterococcal plasmids by insertion element (IS)-mediated interplasmid recombination processes. PMID:26324271

  8. Deciphering the details of RNA aminoglycoside interactions: from atomistic models to biotechnological applications

    SciTech Connect

    Ilgu, Muslum


    A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.

  9. Antibiotic Resistance Associated with Inositol Metabolism in Salmonellae from Ontario Cattle

    PubMed Central

    Lynch, John A.; Kierstead, Marsha E.


    During 12 months in 1983-1984, Salmonellae were isolated from cattle 110 times. Salmonella typhimurium and Salmonella muenster were the most prevalent serotypes identified. All isolates were sensitive to polymyxin B. Isolates that did not produce acid from inositol were more frequently resistant to ampicillin, carbenicillin, kanamycin, sulfisoxazole, tetracycline and neomycin than isolates which could. Salmonella muenster isolates, which were almost exclusively inositol positive, demonstrated a high frequency of senstivity to commonly used antibiotics. The antibiotic sensitivities of the S. typhimurium isolates showed much greater variability, with multiple antibiotic resistance being frequently associated with those isolates that were inositol negative. PMID:17422563

  10. Antibiotic Susceptibility of Streptococcus mutans: Comparison of Serotype Profiles

    PubMed Central

    Little, Wayne A.; Thomson, Lynn A.; Bowen, William H.


    A total of 82 strains of Streptococcus mutans representing serotypes a through g were tested for susceptibility to erythromycin, penicillin, methicillin, lincomycin, tetracycline, vancomycin, gentamicin, streptomycin, neomycin, kanamycin, bacitracin, and polymyxin B. Strains included stock cultures and isolates from human and animal dental plaque. Minimal inhibitory concentrations were determined by a broth-microdilution procedure. The major differences in antibiotic susceptibility observed among the serotypes resulted with antibiotics which act on the cell surface. Bacitracin was most active against serotype a strains and polymyxin B against serotype b strains. Serotypes a, d, and g were less susceptible than the other serotypes to methicillin. PMID:464571

  11. 2-Deoxystreptamine-containing aminoglycoside antibiotics: recent advances in the characterization and manipulation of their biosynthetic pathways.


    Park, Sung Ryeol; Park, Je Won; Ban, Yeon Hee; Sohng, Jae Kyung; Yoon, Yeo Joon


    The 2-deoxystreptamine-containing aminoglycosides, such as neomycin, kanamycin and gentamicin, are an important class of antibiotics. A detailed understanding of the complete biosynthetic pathway of aminoglycosides and their biosynthetic enzymes will allow us to not only generate more robust antibiotic agents or drugs with other altered biological activities, but also to produce clinically important semi-synthetic antibiotics by direct fermentation. This Highlight focuses on recent advances in the characterization of their biosynthetic enzymes and pathway as well as some chemo-enzymatic and metabolic engineering approaches for the biological production of natural, semi-synthetic, and novel aminoglycosides.

  12. Immunochemical Investigations of Cell Surface Antigens of Anaerobic Bacteria.

    DTIC Science & Technology


    containing 6% sheep’s blood and 10 pg/ml menadione (BMB); BMB containing 100 jig/ml neomycin sulfate; and laked blood agar containing 75 pg/ml kanamycin and...34). Tests for toxicity were done on chicken embryos as dencribed by Smith and Thomas (35). Serial 10-fold dilutions of samnle in 0.1 ml sterile...0.15 M saline were injected into lowered chorioallantoic membrane of 10-day old I -26- chicken embryos. Six to 10 eggs received injections of each

  13. Effect of salt concentration on the conformation of TAR RNA and its association with aminoglycoside antibiotics.


    Smith, Amy L; Kassman, Joseph; Srour, Khalid J; Soto, Ana Maria


    RNA is an important biological target because it plays essential roles in many pathogenic and normal cellular processes. The design of inhibitors that target RNA involves optimization of noncovalent interactions, including van der Waals, hydrogen bond, and electrostatic interactions. Although sometimes regarded as nonspecific, electrostatic interactions are important in this optimization because the specific position of the phosphates may allow for specific charge-charge interactions with bound ligands. In this work, we have investigated the contribution of electrostatic interactions to the binding affinity of aminoglycoside antibiotics for TAR RNA. Because the charges in aminoglycoside antibiotics are provided by protonated amino groups, it is difficult to separate the contribution of hydrogen bonds and electrostatics to their binding specificity. Hence, we have investigated the dependence of the binding affinity on salt concentration, which should affect only the electrostatic contributions. Our results show that four aminoglycoside antibiotics (paromomycin, kanamycin-B, gentamycin, and tobramycin) bind TAR RNA with different affinities. Furthermore, the dependence of the binding affinity on salt concentration is different for kanamycin-B and paromomycin, with kanamycin-B showing a stronger dependence. Because all these antibiotics contain five positive charges, the results suggest that each antibiotic orients its charges in different ways when bound to TAR RNA. Our overall results support the idea that charge-charge interactions can contribute significantly to the specific binding of antibiotics to TAR RNA. Hence, the exact position of the charges should be considered in the design of any inhibitor of the interactions of TAR RNA.

  14. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2010 CFR


    ... antibiotics: Acute otitis externa, furunculosis, folliculitis, pruritus, anal gland infections, erythema... of the anal gland, the drug should be introduced into the orifice of the gland and not through any...

  15. Multiple keys for a single lock: the unusual structural plasticity of the nucleotidyltransferase (4')/kanamycin complex.


    Matesanz, Ruth; Diaz, José Fernando; Corzana, Francisco; Santana, Andrés G; Bastida, Agatha; Asensio, Juan Luis


    The most common mode of bacterial resistance to aminoglycoside antibiotics is the enzyme-catalysed chemical modification of the drug. Over the last two decades, significant efforts in medicinal chemistry have been focused on the design of non- inactivable antibiotics. Unfortunately, this strategy has met with limited success on account of the remarkably wide substrate specificity of aminoglycoside-modifying enzymes. To understand the mechanisms behind substrate promiscuity, we have performed a comprehensive experimental and theoretical analysis of the molecular-recognition processes that lead to antibiotic inactivation by Staphylococcus aureus nucleotidyltransferase 4'(ANT(4')), a clinically relevant protein. According to our results, the ability of this enzyme to inactivate structurally diverse polycationic molecules relies on three specific features of the catalytic region. First, the dominant role of electrostatics in aminoglycoside recognition, in combination with the significant extension of the enzyme anionic regions, confers to the protein/antibiotic complex a highly dynamic character. The motion deduced for the bound antibiotic seem to be essential for the enzyme action and probably provide a mechanism to explore alternative drug inactivation modes. Second, the nucleotide recognition is exclusively mediated by the inorganic fragment. In fact, even inorganic triphosphate can be employed as a substrate. Third, ANT(4') seems to be equipped with a duplicated basic catalyst that is able to promote drug inactivation through different reactive geometries. This particular combination of features explains the enzyme versatility and renders the design of non-inactivable derivatives a challenging task.

  16. Antibacterial activity of amphiphilic tobramycin.


    Dhondikubeer, Ramesh; Bera, Smritilekha; Zhanel, George G; Schweizer, Frank


    Amphiphilic aminoglycoside antimicrobials are an emerging class of new antibacterial agents with novel modes of action. Previous studies have shown that amphiphilic neomycin-B and kanamycin-A analogs restore potent antibacterial activity against Gram-positive neomycin-B- and kanamycin-A-resistant organisms. In this paper, we investigated the antibacterial properties of a series of amphiphilic tobramycin analogs. We prepared tobramycin-lipid conjugates, as well as tobramycin-peptide triazole conjugates, and studied their antibacterial activities against a panel of Gram-positive and Gram-negative bacterial strains, including isolates obtained from Canadian hospitals. Our results demonstrate that the antibacterial activity of amphiphilic tobramycin is greatly affected by the length and nature of the hydrophobic lipid tail, whereas the nature of the polycationic headgroup or the number of cationic charges appear to be less important. Replacement of the hydrophobic tail by a fluorinated lipid confers good activity against two Pseudomonas strains and reduces hemolytic activity. However, susceptibility studies in the presence of bovine serum albumin indicate that all amphiphilic tobramycin analogs are strongly protein-bound, leading to a typical four- to eight-fold increase in MIC.

  17. Survival of multidrug-resistant bacteria in thermophilic and mesophilic anaerobic co-digestion of dairy manure and waste milk.


    Beneragama, Nilmini; Iwasaki, Masahiro; Lateef, Suraju A; Yamashiro, Takaki; Ihara, Ikko; Umetsu, Kazutaka


    Anaerobic digestion is considered as a promising method to manage animal waste with antibiotic-resistant bacteria. Current research was conducted to investigate the survival of multidrug-resistant bacteria (MDRB) resistant to three groups of antibiotics: (i) cefazolin, neomycin, vancomycin, kanamycin (group 1); (ii) penicillin, oxytetracycline, ampicillin, streptomycin (group 2); and (iii) cefazolin, neomycin, vancomycin, kanamycin, penicillin, oxytetracycline, ampicillin, streptomycin (group 3), in anaerobic digestion of dairy manure and co-digestion of dairy manure and waste milk at 37°C and 55°C for 22 days, respectively. The population densities of three groups of MDRB on peptone, tryptone, yeast and glucose agar plates incubated at 30°C for 7 days before and after digestion showed 100% destruction in both digestates at thermophilic temperature. Overall reduction of more than 90% of three groups of MDRB was observed in mesophilic digestion with no significant differences (P > 0.05) between manure and milk mixture. Co-digestion of dairy manure and waste milk always produced significantly (P < 0.05) higher total gas and methane gas than digestion of manure alone at both temperatures. Gas production in each case was significantly (P < 0.05) higher in thermophilic digestion than in mesophilic digestion. The results demonstrate that thermophilic co-digestion of dairy manure and waste milk offers more benefits in terms of the environment and economy.

  18. Effect of heat treatments on aminoglycosides in milk.


    Zorraquino, M A; Althaus, R L; Roca, M; Molina, M P


    The presence of antibiotic residues in milk not only is a potential consumer risk but also may cause serious problems in the fermentation processes used in the dairy industry. There is very limited information available on the effect of heat treatments on aminoglycoside activity in milk. For this reason, the objective of this study was to analyze the effect of different heat treatments (60 degrees C for 30 min, 120 degrees C for 20 min, and 140 degrees C for 10 s) on milk samples spiked with four aminoglycosides (gentamicin, 50, 100, and 200 microg/liter; kanamycin, 300, 600, and 1200 microg/liter, neomycin, 200, 400, and 800 microg/liter; and streptomycin, 200, 400, and 800 microg/liter). The method used was a bioassay based on the inhibition of Bacillus subtilis BGA. Statistical analysis of the three heat treatments studied showed that the one at 60 degrees C for 30 min did not inactivate the aminoglycosides, the treatment at 140 degrees C for 10 s produced inactivation levels of between 17% for kanamycin and 40% for neomycin, and the classic sterilization (120 degrees C for 20 min) showed a high heat inactivation (>95%) for all the concentrations of aminoglycosides tested with respect to the samples without treatment (control group).

  19. Two-dimensional combinatorial screening and the RNA Privileged Space Predictor program efficiently identify aminoglycoside-RNA hairpin loop interactions.


    Paul, Dustin J; Seedhouse, Steven J; Disney, Matthew D


    Herein, we report the identification of RNA hairpin loops that bind derivatives of kanamycin A, tobramycin, neamine, and neomycin B via two-dimensional combinatorial screening, a method that screens chemical and RNA spaces simultaneously. An arrayed aminoglycoside library was probed for binding to a 6-nucleotide RNA hairpin loop library (4096 members). Members of the loop library that bound each aminoglycoside were excised from the array, amplified and sequenced. Sequences were analyzed with our newly developed RNA Privileged Space Predictor (RNA-PSP) program, which analyzes selected sequences to identify statistically significant trends. RNA-PSP identified the following unique trends: 5'UNNNC3' loops for the kanamycin A derivative (where N is any nucleotide); 5'UNNC3' loops for the tobramycin derivative; 5'UNC3' loops for the neamine derivative; and 5'UNNG3' loops for the neomycin B derivative. The affinities and selectivities of a subset of the ligand-hairpin loop interactions were determined. The selected interactions have K(d) values ranging from 10 nM to 605 nM. Selectivities ranged from 0.4 to >200-fold. Interestingly, the results from RNA-PSP are able to qualitatively predict specificity based on overlap between the RNA sequences selected for the ligands. These studies expand the information available on small molecule-RNA motif interactions, which could be useful to design ligands targeting RNA.

  20. Detection of antibiotic residues in poultry meat.


    Sajid, Abdul; Kashif, Natasha; Kifayat, Nasira; Ahmad, Shabeer


    The antibiotic residues in poultry meat can pose certain hazards to human health among them are sensitivity to antibiotics, allergic reactions, mutation in cells, imbalance of intestinal micro biota and bacterial resistance to antibiotics. The purpose of the present paper was to detect antibiotic residue in poultry meat. During the present study a total of 80 poultry kidney and liver samples were collected and tested for detection of different antibiotic residues at different pH levels Eschericha coli at pH 6, 7 and Staphyloccocus aureus at pH 8 & 9. Out of 80 samples only 4 samples were positive for antibiotic residues. The highest concentrations of antibiotic residue found in these tissues were tetracycline (8%) followed by ampicilin (4%), streptomycine (2%) and aminoglycosides (1%) as compared to other antibiotics like sulfonamides, neomycine and gentamycine. It was concluded that these microorganism at these pH levels could be effectively used for detection of antibiotic residues in poultry meat.

  1. Mass mortality in ornamental fish, Cyprinus carpio koi caused by a bacterial pathogen, Proteus hauseri.


    Kumar, Raj; Swaminathan, T Raja; Kumar, Rahul G; Dharmaratnam, Arathi; Basheer, V S; Jena, J K


    Moribund koi carp, Cyprinus carpio koi, from a farm with 50% cumulative mortality were sampled with the aim of isolating and detecting the causative agent. Three bacterial species viz., Citrobacter freundii (NSCF-1), Klebsiella pneumoniae (NSKP-1) and Proteus hauseri [genomospecies 3 of Proteus vulgaris Bio group 3] (NSPH-1) were isolated, identified and characterized on the basis of biochemical tests and sequencing of the 16S rDNA gene using universal bacterial primers. Challenge experiments with these isolates using healthy koi carp showed that P. hauseri induced identical clinical and pathological states within 3 d of intramuscular injection. The results suggest P. hauseri (NSPH-1) was the causative agent. In phylogenetic analysis, strain NSPH-1 formed a distinct cluster with other P. hauseri reference strains with ≥99% sequence similarity. P. hauseri isolates were found sensitive to Ampicillin, Cefalexin, Ciprofloxacin and Cefixime and resistant to Gentamycin, Oxytetracycline, Chloramphenicol, and Kanamycin. The affected fish recovered from the infection after ciprofloxacin treatment.

  2. [Isolation of antibiotic resistance bacterial strains from East Siberia permafrost sediments].


    Mindlin, S Z; Soina, V S; Ptrova, M A; Gorlenko, Zh M


    A collection of bacterial antibiotic resistance strains isolated from arctic permafrost subsoil sediments of various age and genesis was created. The collection included approximately 100 strains of Gram-positive (Firmicutes, Arthrobacter) and Gram-negative bacteria (Bacteroidetes, gamma-Proteobacteria, and alpha-Proteobacteria) resistant to aminoglycoside antibiotics (gentamycin, kanamycin, and streptomycin), chloramphenicol and tetracycline. Antibiotic resistance spectra were shown to differ in Gram-positive and Gram-negative bacteria. Multidrug resistance strains were found for the first time in ancient bacteria. In studies of the molecular nature of determinants for streptomycin resistance, determinants of the two types were detected: strA-strB genes coding for aminoglycoside phosphotransferases and genes aadA encoding aminoglycoside adenylyltransferases. These genes proved to be highly homologous to those of contemporary bacteria.

  3. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2013 CFR


    ... glands and cystic areas: Drain gland or cyst and fill with petrolatum base ointment. (2) Indications for... candidal (Candida albicans) infections. (ii) Otitis, cysts, and anal gland infections: Use petrolatum base... for anal gland infections. (3) Limitations. For mild inflammations, use once daily to once a week....

  4. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone ointment.

    Code of Federal Regulations, 2014 CFR


    ... use of a local anesthetic may be advisable. (iii) For infected anal glands and cystic areas: Drain gland or cyst and fill with petrolatum base ointment. (2) Indications for use. (i) Topically: Use either...) Otitis, cysts, and anal gland infections: Use petrolatum base ointment in dogs and cats for the...

  5. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2012 CFR


    ... glands and cystic areas: Drain gland or cyst and fill with petrolatum base ointment. (2) Indications for... candidal (Candida albicans) infections. (ii) Otitis, cysts, and anal gland infections: Use petrolatum base... for anal gland infections. (3) Limitations. For mild inflammations, use once daily to once a week....

  6. 21 CFR 524.981c - Fluocinolone acetonide, neomycin sulfate cream.

    Code of Federal Regulations, 2010 CFR


    ... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW... dermatoses in dogs. It is used in the treatment of such conditions as allergic and acute moist dermatoses and nonspecific dermatoses in dogs. It is used in the treatment of wound infections in dogs and cats. (2) A small...

  7. 21 CFR 524.981c - Fluocinolone acetonide, neomycin sulfate cream.

    Code of Federal Regulations, 2013 CFR


    ... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW... dermatoses in dogs. It is used in the treatment of such conditions as allergic and acute moist dermatoses and nonspecific dermatoses in dogs. It is used in the treatment of wound infections in dogs and cats. (2) A small...

  8. 21 CFR 524.981c - Fluocinolone acetonide, neomycin sulfate cream.

    Code of Federal Regulations, 2011 CFR


    ... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW... dermatoses in dogs. It is used in the treatment of such conditions as allergic and acute moist dermatoses and nonspecific dermatoses in dogs. It is used in the treatment of wound infections in dogs and cats. (2) A small...

  9. 21 CFR 524.1484c - Neomycin, isoflupredone, and tetracaine ointment.

    Code of Federal Regulations, 2014 CFR


    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM.... (b) Sponsor. See No. 054771 in § 510.600(c) of this chapter. (c) Conditions of use in dogs—(1) Amount...) Indications for use. For the treatment of acute otitis externa in dogs and to a lesser degree, chronic otitis...

  10. 21 CFR 524.981c - Fluocinolone acetonide, neomycin sulfate cream.

    Code of Federal Regulations, 2012 CFR


    ... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW... dermatoses in dogs. It is used in the treatment of such conditions as allergic and acute moist dermatoses and nonspecific dermatoses in dogs. It is used in the treatment of wound infections in dogs and cats. (2) A small...

  11. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2012 CFR


    .... Dogs: 1 to 2 drops per eye, every 6 hours. (ii) Preparation without hydroxyproply methylcellulose. Dogs and cats: 2 to 3 drops per eye, every 4 hours. (2) Indications for use. Treatment of the inflammation, edema, and secondary bacterial infections associated with topical ophthalmological conditions of the...

  12. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2011 CFR


    .... Dogs: 1 to 2 drops per eye, every 6 hours. (ii) Preparation without hydroxyproply methylcellulose. Dogs and cats: 2 to 3 drops per eye, every 4 hours. (2) Indications for use. Treatment of the inflammation, edema, and secondary bacterial infections associated with topical ophthalmological conditions of the...

  13. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2010 CFR


    ..., antifungal, and antibacterial treatment of superficial bacterial infections, and for dermatologic disorders.... Not intended for treatment of deep abscesses or deep-seated infections. Not for ophthalmic use... candidal (Candida albicans) infections. (ii) Otitis, cysts, and anal gland infections: Use petrolatum...

  14. 21 CFR 524.1880 - Prednisolone-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR


    ... contraindicated in the initial treatment of corneal ulcers. They should not be used until the infection is under... superficial ocular inflammations or infections limited to the conjunctiva or the anterior segment of the...

  15. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    Code of Federal Regulations, 2011 CFR


    ...(c) of this chapter. (c) Conditions of use. (1) The drug is recommended for the treatment of bacterial infections associated with topical ophthalmological conditions such as corneal injuries... associated with bacterial infections the drug is contraindicated in those cases in which microorganisms...

  16. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2011 CFR


    ..., antifungal, and antibacterial treatment of superficial bacterial infections, and for dermatologic disorders.... Not intended for treatment of deep abscesses or deep-seated infections. Not for ophthalmic use... candidal (Candida albicans) infections. (ii) Otitis, cysts, and anal gland infections: Use petrolatum...

  17. 21 CFR 524.1880 - Prednisolone-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR


    ... contraindicated in the initial treatment of corneal ulcers. They should not be used until the infection is under... superficial ocular inflammations or infections limited to the conjunctiva or the anterior segment of the...

  18. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    Code of Federal Regulations, 2013 CFR


    ... bacterial infections associated with topical ophthalmological conditions such as corneal injuries... associated with bacterial infections the drug is contraindicated in those cases in which microorganisms...

  19. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    Code of Federal Regulations, 2012 CFR


    ... bacterial infections associated with topical ophthalmological conditions such as corneal injuries... associated with bacterial infections the drug is contraindicated in those cases in which microorganisms...

  20. 21 CFR 524.1484k - Neomycin sulfate, prednisolone, tetracaine, and squalane topical-otic suspension.

    Code of Federal Regulations, 2010 CFR


    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND... in dogs and cats for treating acute otitis externa and as adjunctive therapy in management of chronic otitis externa. The product may also be used for treating moist dermatitis in dogs. (3)...