Science.gov

Sample records for kanamycin neomycin gentamycin

  1. Two-stage method for purification of ceruloplasmin based on its interaction with neomycin.

    PubMed

    Sokolov, A V; Kostevich, V A; Romanico, D N; Zakharova, E T; Vasilyev, V B

    2012-06-01

    A two-stage chromatography that yields highly purified ceruloplasmin (CP) from human plasma and from rat and rabbit serum is described. The isolation procedure is based on the interaction of CP with neomycin, and it provides a high yield of CP. Constants of inhibition by gentamycin, kanamycin, and neomycin of oxidase activity of CP in its reaction with p-phenylenediamine were assayed. The lowest K(i) for neomycin (11 µM) corresponded to the highest specific adsorption of CP on neomycin-agarose (10 mg CP/ml of resin). Isolation of CP from 1.4 liters of human plasma using ion-exchange chromatography on UNO-Sphere Q and affinity chromatography on neomycin-agarose yields 348 mg of CP with 412-fold purification degree. Human CP preparation obtained with A(610)/A(280) ~ 0.052 contained neither immunoreactive prothrombin nor active thrombin. Upon storage at 37°C under sterile conditions, the preparation remained stable for two months. Efficient preparation of highly purified CP from rat and rabbit sera treated according to a similar protocol suggests the suitability of our method for isolation of CP from plasma and serum of other animals. The yield of CP in three separate purifications was no less than 78%.

  2. Neomycin Topical

    MedlinePlus

    ... medication.Do not apply neomycin to a child's diaper area, especially if the skin is raw, unless ... are directed to apply neomycin to a child's diaper area, do not use tightly fitting diapers or ...

  3. [Open comparative study between the combination clyndamicin/gentamycin and penicillin/gentamycin in septic abortion].

    PubMed

    French, A R; Kennion, G

    1985-01-01

    Septic abortion is not uncommon in countries where abortion is illegal, and antibiotics are second only to uterine evacuation in the treatment of such cases. Although the combination of penicillin and gentamycin has given excellent results, the high incidence of Bacteroides fragilis and other anerobics in septic abortion prompted a comparison of penicillin and gentamycin with clindamycin and gentamycin at the Hospital Santo Tomas in Panama City, Panama, beginning in May 1984. Among 30 febrile patients with diagnoses of septic abortion, 14 were treated with penicillin/gentamycin and 16 with clindamycin/gentamycin. The penicillin group ranged in age from 17-29 with an average age of 21.9, while the clindamycin group ranged from 18-32 years with an average of 24.3. The average gestational ages were 10.2 weeks for the penicillin group and 10.7 for the clindamycin group. The average body temperature of both groups was 38.9 degrees Celsius. 1 patient had a blood pressure of 80/60 without clinical evidence of shock. The average duration of fever was 43 hours in the penicillin group and 40.6 hours in the clindamycin group. The hospital stay ranged from 3-7 days with an average of 5.4 in the penicillin group and from 3-6 days with an average of 4.2 in the clindamycin group. Patients recovered rapidly after uterine curettage and initiation of antibiotic therapy. Bacteremia was not detected in any patient. Tolerance to the drugs was similar in both groups.

  4. Neomycin toxicity revisited.

    PubMed

    Masur, H; Whelton, P K; Whelton, A

    1976-07-01

    Nephrotoxicity and ototoxicity represent the most hazardous side effects of the clincial use of neomycin sulfate. Despite therapeutic restriction of the latter compound to topical, irrigant, and bowel sterilization use, serious toxicity is still encountered. A 69-year-old patient was recently treated by us for acute renal failure and total deafness induced as a result of intermittent seven-day lavage of a surgical cavity with neomycin. Peritoneal dialysis reduced the serum concentration of the antibiotic and promoted complete recovery of renal function. The patient, however, remained deaf. This case serves as a reminder that neomycin can be absorbed systemically following its use as an irrigant solution. In such cases, it may produce an unsuspected form of "high output" renal failure and concomitant hearing loss. The renal failure is usually reveesible, but the hearing loss is frequently permanent. PMID:938230

  5. 21 CFR 522.1204 - Kanamycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... kanamycin sulfate. (b) Sponsor. See No. 054771 in § 510.600(c) of this chapter. (c) Conditions of use in dogs and cats—(1) Amount. Administer by subcutaneous or intramuscular injection 5 mg per pound of body... of bacterial infections due to kanamycin sensitive organisms in dogs and cats. (3)...

  6. 35S Promoter Methylation in Kanamycin-Resistant Kalanchoe (Kalanchoe pinnata L.) Plants Expressing the Antimicrobial Peptide Cecropin P1 Transgene.

    PubMed

    Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I

    2016-09-01

    Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases. PMID:27682168

  7. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin sulfate. 558.364 Section 558.364 Food and... in Animal Feeds § 558.364 Neomycin sulfate. (a) Approvals. Type A medicated article: 325 grams per.... (c) (d) Conditions of use. Neomycin sulfate is used as follows: Neomycin Sulfate...

  8. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin. 520.1484 Section 520.1484 Food and Drugs..., AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1484 Neomycin. (a) Specifications—(1) Each ounce of powder contains 20.3 grams (g) neomycin sulfate (equivalent to 14.2 g neomycin base)....

  9. Neomycin, Polymyxin, and Bacitracin Topical

    MedlinePlus

    ... minor skin injuries such as cuts, scrapes, and burns from becoming infected. Neomycin, polymyxin, and bacitracin are ... treat deep cuts, puncture wounds, animal bites, serious burns, or any injuries that affect large areas of ...

  10. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c) of... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  11. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c) of... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  12. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., sheep, and goats. For treatment and control of colibacillosis (bacterial enteritis) caused by Escherichia coli susceptible to neomycin. To provide 10 milligrams (mg) of neomycin sulfate per pound of...

  13. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ..., sheep, and goats. For treatment and control of colibacillosis (bacterial enteritis) caused by Escherichia coli susceptible to neomycin. To provide 10 milligrams (mg) of neomycin sulfate per pound of...

  14. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  15. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  16. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  17. DNase I induced DNA degradation is inhibited by neomycin.

    PubMed

    Woegerbauer, M; Burgmann, H; Davies, J; Graninger, W

    2000-03-01

    Preparations of antimicrobials from biotechnological sources containing nucleic acids may serve as vector for the dissemination of resistance genes. An essential prerequisite for the acquisition of a new resistance phenotype in a transformational scenario is the availability of physically intact DNA molecules capable of transforming competent microorganisms. DNA is thought to be an easy target for catabolic processes when present in the natural habitat of bacteria (e.g. gastrointestinal tract, soil) due to the overall presence of nucleolytic enzymes. Aminoglycoside antibiotics are known to display a strong affinity to nucleic acids rendering these compounds to be primary candidates for exerting DNA protective functions in the gastrointestinal tract when applied orally during antibiotic chemotherapy. Using a DNase I protection assay it could be demonstrated that neomycin B at a concentration of 2 mM completely inhibited degradation of plasmid DNA in vitro. No inhibition of degradation was observed with streptomycin and kanamycin and the non-aminoglycoside antibiotics oxytetracycline and ampicillin under identical assay conditions. Thus, neomycin preparations may be able to promote structural integrity of contaminating DNA-fragments in DNase-rich environments. PMID:10819299

  18. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin. 556.430 Section 556.430 Food and Drugs... Residues of New Animal Drugs § 556.430 Neomycin. (a) Acceptable daily intake (ADI). The ADI for total residues of neomycin is 6 micrograms per kilogram of body weight per day. (b) Tolerances. Tolerances...

  19. Determination of neomycin and bacitracin in human or rabbit serum by HPLC-MS/MS.

    PubMed

    Mascher, Daniel G; Unger, Christian P; Mascher, Hermann J

    2007-01-17

    The method for the simultaneous determination of neomycin and bacitracin in human or rabbit serum was developed by using ion pairing reversed phase chromatography and tandem mass spectrometry (MS/MS) detection with electrospray (ESI) in positive mode. Both substances elute under these conditions at the same time and also kanamycin as internal standard elutes almost at the same time. The sample preparation was simple-only using 0.1 mL serum by protein precipitation with acetonitrile. Neomycin and bacitracin were detected as two-fold charged ions as well as the internal standard. The calibration range of these quite difficult detectable substances was 0.2-50 microg/mL of serum. The method was validated for both human or rabbit serum. The inter batch precision of quality control samples in human serum for neomycin ranged from 4.46% to 8.99% and for bacitracin from 6.85% to 11.17%. The inter batch accuracy for neomycin ranged from 98.7% to 100.7% and for bacitracin from 99.2% to 103.0%. At lower limit of quantitation (LLOQ) level of 0.2 microg/mL inter batch precision in human serum for neomycin was 12.05% and for bacitracin 11.91%, whereas accuracies were 99.9% for neomycin and 102.7% for bacitracin. Bench top stability in human or rabbit serum was given over three freeze thaw cycles and 4h at room temperature. The method can be considered to be specific and recoveries for sample preparation were high.

  20. Stable Agrobacterium-Mediated Transformation of Maritime Pine Based on Kanamycin Selection

    PubMed Central

    Alvarez, José M.; Ordás, Ricardo J.

    2013-01-01

    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β-glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL−1 kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD600 nm) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth. PMID:24376383

  1. Stable Agrobacterium-mediated transformation of maritime pine based on kanamycin selection.

    PubMed

    Alvarez, José M; Ordás, Ricardo J

    2013-01-01

    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β -glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL(-1) kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD(600 nm)) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth.

  2. Preparation and in vitro characterization of gentamycin-impregnated biodegradable beads suitable for treatment of osteomyelitis.

    PubMed

    Meyer, J D; Falk, R F; Kelly, R M; Shively, J E; Withrow, S J; Dernell, W S; Kroll, D J; Randolph, T W; Manning, M C

    1998-09-01

    A new method for preparing poly(L-lactide) (PLA) biodegradable beads impregnated with an ionic aminoglycoside, gentamycin, is described. The process employs hydrophobic ion pairing to solubilize gentamycin in a solvent compatible with PLA, followed by precipitation with a compressed antisolvent (supercritical carbon dioxide). The resulting precipitate is a homogeneous dispersion of the ion-paired drug in PLA microspheres. The microspheres are approximately 1 microm in diameter and can be compressed into beads (3-6 mm in diameter) strung on surgical sutures for implantation. The bead strings exhibit no significant change in release kinetics upon sterilization with a hydrogen peroxide plasma (Ster-Rad). The kinetics of gentamycin release from the PLA beads are consistent with a matrix-controlled diffusion mechanism. While nonbiodegradable poly(methyl methacrylate) (PMMA) beads initially release gentamycin in a similar manner, the drug release from PMMA ceases after 8 or 9 weeks, while the PLA beads continue to release drug for over 4 months. Moreover, only 10% of the gentamycin is released from the PMMA beads, while PLA beads release more than 60% of their load, if serum is present in the release medium. The PLA system displays improved release kinetics relative to PMMA, is biodegradable, is unaltered by gas sterilization, can be used for a range of antibiotics, and can be manipulated without disintegration. These are all desirable properties for an implantable drug delivery system for the prevention or treatment of osteomyelitis. PMID:9724569

  3. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin sulfate injection. 522.1204 Section 522.1204 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  4. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin sulfate injection. 522.1204 Section 522.1204 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  5. Inhibition of the hammerhead ribozyme by neomycin.

    PubMed Central

    Stage, T K; Hertel, K J; Uhlenbeck, O C

    1995-01-01

    A series of antibiotics was tested for stimulation or inhibition of the hammerhead ribozyme cleavage reaction. Neomycin was found to be a potent inhibitor of the reaction with a Kl of 13.5 microM. Two hammerheads with well-characterized kinetics were used to determine which steps in the reaction mechanism were inhibited by neomycin. The data suggest that neomycin interacts preferentially with the enzyme-substrate complex and that this interaction leads to a reduction in the cleavage rate by stabilizing the ground state of the complex and destabilizing the transition state of the cleavage step. A comparison of neomycin with other aminoglycosides and inhibitors of hammerhead cleavage implies that the ammonium ions of neomycin are important for the antibiotic-hammerhead interaction. PMID:7489494

  6. Adverse reactions to gentamycin in patients with ear, nose or throat infections.

    PubMed

    Singhal, S; Sharma, S C; Singhal, K C

    1992-07-01

    Eighty four patients requiring treatment with Gentamycin were selected from Otorhinolaryngology outpatient and those admitted to the hospital. Patients suffering from hepatic or renal disorders, pregnant women and children were excluded from the study. Seventy three were administered gentamycin 40 mg BD intramuscularly for 7-10 days and in 11 the drug was applied topically as ear drops for 6-12 weeks. Adverse reactions were observed in 9 (13.3%) and 11 (100%) patients given the drug parenterally and topically respectively. In parenteral group incidence was higher in females as compared to males and profile included nausea and vomiting, headache, cough, tinnitis, albuminuria, diminition of hearing and vertigo. Whereas diminition of hearing acuity was observed in all those who had topical application as evidenced by pure tone audiometry. PMID:1473850

  7. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... to kanamycin sensitive bacteria. It is used in treating conditions such as conjunctivities..., removal of foreign bodies, and intraocular surgery. Instill a few drops into the affected eye every...

  8. Penicillin combinations against multi-resistant urinary pathogens as an alternative to gentamycin treatment.

    PubMed

    Gnarpe, H; Alfredsson, H; Börstad, B

    1976-01-01

    A total of 42 multi-resistant urinary pathogens, sensitive to gentamycin only, were investigated with regard to the effects of dicloxacillin and ampicillin or cloxacillin/flucloxacillin and amoxycillin in combination. A synergistic antibiotic effect with resulting low MIC levels was demonstrated for 81% of the strains. It was also found that a further increase in sensitivity might be achieved by adjustment of the pH level.

  9. 21 CFR 522.1484 - Neomycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... of neomycin base). (b) Sponsor. See No. 054771 in § 510.600(c) of this chapter. (c) Conditions of use in dogs and cats—(1) Amount. Administer 5 mg per pound of body weight daily by intramuscular...

  10. Modulatory effects of dietary inclusion of garlic (Allium sativum) on gentamycin-induced hepatotoxicity and oxidative stress in rats

    PubMed Central

    Ademiluyi, Adedayo O; Oboh, Ganiyu; Owoloye, Tosin R; Agbebi, Oluwaseun J

    2013-01-01

    Objective To investigate the ameliorative effect of dietary inclusion of garlic (Allium sativum) on gentamycin-induced hepatotoxicity in rats. Methods Adult male rats were randomly divided into four groups with six animals in each group. Groups 1 and 2 were fed basal diet while Groups 3 and 4 were fed diets containing 2% and 4% garlic respectively for 27 d prior to gentamycin administration. Hepatotoxicity was induced by the intraperitoneal administration of gentamycin (100 mg/kg body weight) for 3 d. The liver and plasma were studied for hepatotoxicity and antioxidant indices. Results Gentamycin induces hepatic damage as revealed by significant (P<0.05) elevation of liver damage marker enzymes (aspartate transaminase and alanine aminotransferase) and reduction in plasma albumin level. Gentamycin also caused a significant (P<0.05) alteration in plasma and liver enzymatic (catalase, glutathione and super oxygen dehydrogenises) and non-enzymatic (glutathione and vitamin C) antioxidant indices with concomitant increase in the malondialdehyde content; however, there was a significant (P<0.05) restoration of the antioxidant status coupled with significant (P<0.05) decrease in the tissues' malondialdehyde content, following consumption of diets containing garlic. Conclusions These results suggest that dietary inclusion of garlic powder could protect against gentamycin-induced hepatotoxicity, improve antioxidant status and modulate oxidative stress; a function attributed to their phenolic constituents. PMID:23730560

  11. Attenuation of gentamycin-induced nephrotoxicity in rats by dietary inclusion of ginger (Zingiber officinale) and turmeric (Curcuma longa) rhizomes.

    PubMed

    Ademiluyi, Adedayo O; Oboh, Ganiyu; Ogunsuyi, Opeyemi B; Akinyemi, Ayodele J

    2012-10-01

    This study sought to investigate the modulatory effects of dietary inclusion of ginger (Zingiber officinale) and turmeric (Curcuma longa) rhizomes on antioxidant status and renal damage induced by gentamycin in rats. Renal damage was induced in albino rats pretreated with dietary inclusion of ginger and turmeric (2% and 4%) by intraperitoneal (i.p.) administration of gentamycin (100 mg/kg body weight) for three days. Assays for renal damage biomarkers (plasma creatinine, plasma urea, blood urea nitrogen and plasma uric acid), malondialdehyde (MDA) content and reduced glutathione (GSH) content as well as renal antioxidant enzymes (catalase, glutathione-S-transferase (GST), glutathione peroxidase (GPx) and superoxide dismutase (SOD)) were carried out. The study revealed significant (p < 0.05) increases in renal damage biomarkers following gentamycin administration with severe alteration in kidney antioxidant status. However, pretreatment with ginger and turmeric rhizome (2% and 4%) prior to gentamycin administration significantly (p < 0.05) protected the kidney and attenuated oxidative stress by modulating renal damage and antioxidant indices. This finding therefore suggests that dietary inclusion of ginger and turmeric rhizomes may protect against gentamycin-induced nephrotoxicity and oxidative stress.

  12. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... for use in dogs in various eye infections due to kanamycin sensitive bacteria. It is used treating... the affected eye three or four times daily or more frequently if deemed advisable. Treatment should be continued for at least 48 hours after the eye appears normal. For use only by or on the order of a...

  13. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Kanamycin test system. 862.3520 Section 862.3520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Toxicology Test Systems §...

  14. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Kanamycin test system. 862.3520 Section 862.3520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Toxicology Test Systems §...

  15. Crystal structure, conformation, and absolute configuration of kanamycin A.

    PubMed

    Puius, Yoram A; Stievater, Todd H; Srikrishnan, Thamarapu

    2006-12-11

    Kanamycin, an antibiotic complex produced by Streptomyces kanamycetius isolated from Japanese soil, was described by Okami and Umezawa as early as 1957 and consists of three components: Kanamycin A (the major component), B, and C. The disulfate salt of kanamycin A [4-O-(6-amino-6-deoxy-alpha-d-glucopyranosyl)-6-O-(3-amino-3-deoxy-alpha-d-glucopyranosyl)-2-deoxystreptamine] is a broad-spectrum antibiotic that is used to treat gonorrhea, salmonella, tuberculosis, and many other diseases. Crystals of kanamycin A monosulfate monohydrate obtained from water are triclinic, space group P1, with a=7.2294(14), b=12.4922(15), c=7.1168(9), alpha=94.74(1), beta=89.16(1), gamma=91.59(1), V=640.2(2)A(3), micro(CuKalpha)=18.4cm(-1), FW 600.6, D(calc)=1.558g/cm(3), CAD-4 diffractometric data (2693 reflections, 25543sigma(I)), structure by shelx-86 and refined by full-matrix least squares to a final R value of 0.038. The wrong conformer had an R value of 0.043. Both of the d-glucose moieties are attached to the deoxystreptamine by alpha linkages. This absolute configuration agrees with the earlier determination by both chemical and X-ray methods with photographic data. The (phi,psi) values for the glycosidic linkages are 101.6 degrees , -121.1 degrees , 106.3 degrees , and -140.4 degrees , respectively. Kanamycin interacts with the ribosomal S12 protein to stabilize the codon-anticodon binding between mRNA and the aminoacyl tRNA and inhibits the elongation of peptide chains through a series of reactions resulting in the prevention of ribosomes from moving along mRNA.

  16. Mutational biosynthesis of neomycin analogs by a mutant of neomycin-producing Streptomyces fradiae.

    PubMed

    Shi, Guanying; Zhang, Xingang; Wu, Lang; Xie, Jin; Tao, Ke; Hou, Taiping

    2011-11-01

    Neomycin, produced by Streptomyces fradiae, has been widely used for the treatment of bacterial infections in clinical and agricultural applications. In this study, a neomycin nonproducing mutant of S. fradiae was obtained by gene disruption technique for mutational biosynthesis. A crucial gene neoC (neo7) which encodes 2-deoxystreptamine (2-DOS) synthases was disrupted. The mutant could resume producing neomycin in the presence of 2-DOS. Salen derivatives of 2-DOS were synthesized and individually added to cultures of the mutant. Antibacterial activity of the mutasynthesis products against Staphylococcus aureus and four plant pathogenic bacteria (Pseudomonas solanacarum, Erwinia carotovora, Xanthomonas oryzae, and Xanthomonas campestris) was detected quantitatively by Oxford cup method. It is suggested that all 2-DOS derivatives were incorporated by the mutant into new active neomycin analogs except for 2-DOS derivative 2d ((1R,2r,3S,4R,6S)-4,6-bis((E)-3,5-di-tert-butyl-2-hydroxybenzylideneamino)cyclohexane-1,2,3-triol). Neomycin analogs produced by feeding 2-DOS derivative 2a ((1R,2r,3S,4R,6S)-4,6-bis((E)-2 hydroxybenzylideneamino)cyclohexane-1,2,3-triol) to cultures of the mutant displayed a similar antibacterial activity with neomycin produced by wild strain.

  17. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product...

  18. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) Conditions of use—(1) Cattle, swine, sheep, and goats—(i) Amount. 10 mg per pound (/lb) of body weight per... susceptible to neomycin sulfate. (iii) Limitations. Add powder to drinking water or milk; not for use in...; sheep, 2 days; swine and goats, 3 days. (2) Turkeys—(i) Amount. 10 mg/lb of body weight per day (22...

  19. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product...

  20. 21 CFR 520.1484 - Neomycin.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .../kg) for 5 days. (ii) Indications for use. For the control of mortality associated with E. coli... neomycin base). (b) Sponsors. See sponsors in § 510.600(c) of this chapter for use as in paragraph (e) of... paragraph (e)(1) of this section. (2) Nos. 000009, 046573, 058005, and 061623 for use of product...

  1. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.

    PubMed

    Li, Yuebin; Ruby, John; Wu, Hui

    2015-07-01

    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  2. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. PMID:21530479

  3. Recognition of HIV TAR RNA by triazole linked neomycin dimers.

    PubMed

    Kumar, Sunil; Arya, Dev P

    2011-08-15

    A series of neomycin dimers have been synthesized using 'click chemistry' with varying linker functionality and length to target the TAR RNA region of HIV virus. TAR (trans activation response) RNA region, a 59 base pair stem loop structure located at 5'-end of all nascent HIV-1 transcripts interacts with a key regulatory protein, Tat, and necessitates the replication of HIV-1 virus. Neomycin, an aminosugar, has been shown to exhibit more than one binding site with HIV TAR RNA. Multiple TAR binding sites of neomycin prompted us to design and synthesize a small library of neomycin dimers using click chemistry. The binding between neomycin dimers and HIV TAR RNA was characterized using spectroscopic techniques including FID (Fluorescent Intercalator Displacement) titration and UV-thermal denaturation. UV thermal denaturation studies demonstrate that neomycin dimer binding increase the melting temperature (T(m)) of the HIV TAR RNA up to 10°C. Ethidium bromide displacement titrations revealed nanomolar IC(50) between neomycin dimers and HIV TAR RNA, whereas with neomycin, a much higher IC(50) in the micromolar range is observed.

  4. Recognition of HIV TAR RNA by triazole linked neomycin dimers

    PubMed Central

    Kumar, Sunil

    2013-01-01

    A series of neomycin dimers have been synthesized using “click chemistry” with varying linker functionality and length to target the TAR RNA region of HIV virus. TAR (Trans Activation Response) RNA region, a 59 base pair stem loop structure located at 5′-end of all nascent HIV-1 transcripts interacts with a key regulatory protein, Tat, and necessitates the replication of HIV-1 virus. Neomycin, an aminosugar, has been shown to exhibit more than one binding site with HIV TAR RNA. Multiple TAR binding sites of neomycin prompted us to design and synthesize a small library of neomycin dimers using click chemistry. The binding between neomycin dimers and HIV TAR RNA was characterized using spectroscopic techniques including FID (Fluorescent Intercalator Displacement) titration and UV-thermal denaturation. UV thermal denaturation studies demonstrate that neomycin dimer binding increase the melting temperature (Tm) of the HIV TAR RNA up to 10 °C. Ethidium bromide displacement titrations revealed nanomolar IC50 between neomycin dimers and HIV TAR RNA, whereas with neomycin, a much higher IC50 in the micromolar range is observed. PMID:21757341

  5. Scar formation in mice deafened with kanamycin and furosemide.

    PubMed

    Żak, Magdalena; van der Linden, Cynthia A; Bezdjian, Aren; Hendriksen, Ferry G; Klis, Sjaak F L; Grolman, Wilko

    2016-08-01

    In mammals, hair cell loss is irreversible and leads to hearing loss. To develop and test the functioning of different strategies aiming at hair cell regeneration, animal models of sensorineural hearing loss are essential. Although cochleae of these animals should lack hair cells, supporting cells should be preserved forming an environment for the regenerated hair cells. In this study, we investigated how ototoxic treatment with kanamycin and furosemide changes the structure of cochlear sensory epithelium in mice. The study also compared different tissue preparation protocols for scanning electron microscopy (SEM). Cochleae were collected from deafened and nondeafened mice and further processed for plastic mid modiolar sections and SEM. For comparing SEM protocols, cochleae from nondeafened mice were processed using three protocols: osmium-thiocarbohydrazide-osmium (OTO), tannic acid-arginine-osmium, and the conventional method with gold-coating. The OTO method demonstrated optimal cochlear tissue preservation. Histological investigation of cochleae of deafened mice revealed that the supporting cells enlarged and ultimately replaced the lost hair cells forming types 1 and 2 phalangeal scars in a base towards apex gradient. The type 3 epithelial scar, flattened epithelium, has not been seen in analysed cochleae. The study concluded that mice deafened with kanamycin and furosemide formed scars containing supporting cells, which renders this mouse model suitable for testing various hair cell regeneration approaches. Microsc. Res. Tech. 79:766-772, 2016. © 2016 Wiley Periodicals, Inc. PMID:27311812

  6. Scar formation in mice deafened with kanamycin and furosemide.

    PubMed

    Żak, Magdalena; van der Linden, Cynthia A; Bezdjian, Aren; Hendriksen, Ferry G; Klis, Sjaak F L; Grolman, Wilko

    2016-08-01

    In mammals, hair cell loss is irreversible and leads to hearing loss. To develop and test the functioning of different strategies aiming at hair cell regeneration, animal models of sensorineural hearing loss are essential. Although cochleae of these animals should lack hair cells, supporting cells should be preserved forming an environment for the regenerated hair cells. In this study, we investigated how ototoxic treatment with kanamycin and furosemide changes the structure of cochlear sensory epithelium in mice. The study also compared different tissue preparation protocols for scanning electron microscopy (SEM). Cochleae were collected from deafened and nondeafened mice and further processed for plastic mid modiolar sections and SEM. For comparing SEM protocols, cochleae from nondeafened mice were processed using three protocols: osmium-thiocarbohydrazide-osmium (OTO), tannic acid-arginine-osmium, and the conventional method with gold-coating. The OTO method demonstrated optimal cochlear tissue preservation. Histological investigation of cochleae of deafened mice revealed that the supporting cells enlarged and ultimately replaced the lost hair cells forming types 1 and 2 phalangeal scars in a base towards apex gradient. The type 3 epithelial scar, flattened epithelium, has not been seen in analysed cochleae. The study concluded that mice deafened with kanamycin and furosemide formed scars containing supporting cells, which renders this mouse model suitable for testing various hair cell regeneration approaches. Microsc. Res. Tech. 79:766-772, 2016. © 2016 Wiley Periodicals, Inc.

  7. Suitability of a liquid chromatography assay of neomycin sulfate to replace the microbiological assay for neomycin in USP Monographs.

    PubMed

    Hanko, Valoran P; Rohrer, Jeffrey S

    2010-01-01

    The current USP National Formulary contains 65 Monographs for drug formulations containing neomycin. All 65 Monographs prescribe a bioassay for neomycin assay. This bioassay, based on cell culture, is labor intensive, has poor precision, and cannot be adapted for purity or identification. High-performance anion-exchange chromatography with integrated pulsed amperometric detection (HPAE-IPAD), a liquid chromatography technique, has been shown to be suitable for neomycin purity analysis and neomycin assay of an over-the-counter first aid cream (Hanko and Rohrer [17]). Here we propose that an HPAE-IPAD assay can replace the bioassay in the 65 neomycin-containing Monographs. We applied the HPAE-IPAD assay to four neomycin-containing drug products representing the four classes of formulations found in the 65 Monographs, liquid, solid, suspension, and cream. Each drug was analyzed with two chromatography systems, and on 3 separate days. For all products, HPAE-IPAD measurements were precise and accurate with respect to the label concentrations. There was also high accuracy for spike recovery of neomycin from the four drug products throughout 70-150% of the labeled concentration. These results suggest that an HPAE-IPAD assay would be an accurate assay for neomycin, and would be faster and more precise than the current bioassay.

  8. [Value of gentamycin concentration in aqueous humor of a rabbit's eye depending on the method of application. Summary of a doctoral thesis].

    PubMed

    Philips, R H

    1992-10-01

    Pharmacokinetics of gentamycin in the primary and secondary rabbit's aqueous was examined by using a new experimental method of subconjunctival application (without breaking the continuity of the conjunctiva). It was established that after subconjunctival application one cannot obtain any therapeutical concentrations in the primary or secondary aqueous. Presented are conditions which have to be fulfilled to obtain a therapeutical concentration of gentamycin in the secondary aqueous. PMID:1306533

  9. Fructose restores susceptibility of multidrug-resistant Edwardsiella tarda to kanamycin.

    PubMed

    Su, Yu-bin; Peng, Bo; Han, Yi; Li, Hui; Peng, Xuan-xian

    2015-03-01

    Edwardsiella tarda, the causative agent of Edwardsiellosis, imposes medical challenges in both the clinic and aquaculture. The emergence of multidrug resistant strains makes antibiotic treatment impractical. The identification of molecules that facilitate or promote antibiotic efficacy is in high demand. In the present study, we aimed to identify small molecules whose abundance is correlated with kanamycin resistance in E. tarda by gas chromatography-mass spectrometry. We found that the abundance of fructose was greatly suppressed in kanamycin-resistant strains. The incubation of kanamycin-resistant bacteria with exogenous fructose sensitized the bacteria to kanamycin. Moreover, the fructose also functioned in bacteria persisters and biofilm. The synergistic effects of fructose and kanamycin were validated in a mouse model. Furthermore, the mechanism relies on fructose in activating TCA cycle to produce NADH, which generates proton motive force to increase the uptake of the antibiotics. Therefore, we present a novel approach in fighting against multidrug resistant bacteria through exploration of antibiotic-suppressed molecules.

  10. Label-free gold nanoparticles for the determination of neomycin

    NASA Astrophysics Data System (ADS)

    Apyari, Vladimir V.; Dmitrienko, Stanislava G.; Arkhipova, Viktoriya V.; Atnagulov, Aydar G.; Gorbunova, Mariya V.; Zolotov, Yury A.

    2013-11-01

    A new spectrophotometric method for the determination of neomycin has been developed. The method is based on aggregation of label-free gold nanoparticles leading to change in absorption spectra and color of the solution. Influence of different factors (the concentration of ethylenediaminetetraacetate (EDTA), pH, the concentrations of neomycin and the nanoparticles) on the aggregation and analytical performance of the method was investigated. EDTA plays an important role not only as a masking agent to eliminate interferences of metal cations but strongly affects the sensitivity of the nanoparticles relative to neomycin. The method allows to determine neomycin with detection limit of 28 ng mL-1. It was applied to analysis of eye- and ear-drops. The sample pretreatment is simply done by diluting the formulation with water.

  11. Label-free gold nanoparticles for the determination of neomycin.

    PubMed

    Apyari, Vladimir V; Dmitrienko, Stanislava G; Arkhipova, Viktoriya V; Atnagulov, Aydar G; Gorbunova, Mariya V; Zolotov, Yury A

    2013-11-01

    A new spectrophotometric method for the determination of neomycin has been developed. The method is based on aggregation of label-free gold nanoparticles leading to change in absorption spectra and color of the solution. Influence of different factors (the concentration of ethylenediaminetetraacetate (EDTA), pH, the concentrations of neomycin and the nanoparticles) on the aggregation and analytical performance of the method was investigated. EDTA plays an important role not only as a masking agent to eliminate interferences of metal cations but strongly affects the sensitivity of the nanoparticles relative to neomycin. The method allows to determine neomycin with detection limit of 28ngmL(-1). It was applied to analysis of eye- and ear-drops. The sample pretreatment is simply done by diluting the formulation with water.

  12. Audiological Evaluation of Patients Taking Kanamycin for Multidrug Resistant Tuberculosis

    PubMed Central

    Sharma, Vishal; Bhagat, Sanjeev; Verma, Bhimsain; Singh, Ravinder; Singh, Surinderpal

    2016-01-01

    Introduction: The incidence of multidrug resistant tuberculosis is increasing in developing countries. Aminoglycosides are an integral part of second-line drugs, however ototoxicity is a major limitation for their use. This study aims to determine the extent of hearing loss in patients taking one of the commonly prescribed drugs for Multidrug resistant tuberculosis (MDR-TB), Kanamycin, at a Government Medical College, Patiala, Punjab, India, which is a 1200 bed tertiary care hospital. Materials and Methods: A total of 100 patients (68 males and 32 females) with confirmed diagnosis of MDR-TB were included in this study conducted between January 2012 and February 2014. Subjects were between 15 to 60 years of age, with a mean age of 37.46 ± 10.1. Pure tone audiometry (PTA) was performed before the start of the therapy, as a baseline, and was repeated after 1 week and 6 weeks of Kanamycin use to assess hearing loss as an effect of therapy. Results: Of the 100 patients examined, ototoxicity was found in 18 subjects post therapy. Incidence of high frequency hearing loss was 2% at week 1, and 12% after 6 weeks of follow up. However, 4% of the cases developed flat loss at week 6. The hearing loss was bilateral in 13 patients and unilateral in 5 patients. Ototoxicity was more common in males (66.67%) compared to females (33.3%). Maximum cases were found in the age group of 36 to 45 years (36.8%), the majority being from a rural background (83.3%). The association with socioeconomic status (P=0.024) and co-morbid conditions like diabetes and hypertension (P=0.001) reached statistical significance. Conclusion: Lack of specific guidelines to monitor patients taking aminoglycosides makes ototoxicity a major adverse effect of their use in MDR-TB. More studies are mandated to study the risk factors associated with the development of ototoxicity and for the development of alternate drugs for the treatment of MDR-TB. PMID:27429949

  13. Interaction of neomycin with ribosomes and ribosomal ribonucleic acid.

    PubMed

    Dahlberg, A E; Horodyski, F; Keller, P

    1978-02-01

    Neomycin binds ribosomes and ribosomal ribonucleic acid (rRNA) in vivo and in vitro producing changes detectable by increases in gel electrophoretic mobility. These changes were observed in gels that contain ethylenediaminetetraacetic acid or no added magnesium ion. The progressive increase in gel electrophoretic mobility with increasing antibiotic concentrations suggests that neomycin is binding at multiple sites on RNA. The binding was reversible but sufficiently stable to survive dialysis and electrophoresis. It is proposed that bound neomycin stabilizes the ribosome and RNA structures, restricting the unfolding of the particles during electrophoresis and thus allowing for a more rapid migration in the gel. Gentamicin produced an effect similar to that of neomycin. Paromomycin, differing from neomycin by only one amino group, had considerably less effect on ribosome and rRNA mobilities. The binding of neomycin to rRNA improved the linearity of the plot of log molecular weight versus mobility and thus may be of benefit in providing a more accurate estimation of molecular weights of large RNAs.

  14. Kanamycin and bumetanide ototoxicity: anatomical, physiological and behavioral correlates.

    PubMed

    Santi, P A; Ruggero, M A; Nelson, D A; Turner, C W

    1982-08-01

    Severe hair-cell degeneration and cochlear dysfunction was observed in chinchillas examined at 60 days (or longer) after administration of a single injection of 150 mg/kg kanamycin, followed 2 h later by a single injection of 20 mg/kg bumetanide. Outer hair cells in the cochlear base were most severely affected. While inner and outer hair-cell loss was common, some animals showed large regions along the basilar membrane where almost all inner hair cells were present and almost all outer hair cells were absent. Wherever areas of complete degeneration of the organ of Corti occurred, a small, diffuse population of nerve fibers within the spiral lamina was always present. Single-unit tuning curves correlated best with anatomical observations, compared with the other functional measures of auditory sensitivity that were obtained (behavioral audiogram and compound action potential thresholds). Results indicated that behavioral detection of auditory stimuli is relatively independent of innervation density as long as a few inner hair cells are present. Thus, the cross-fiber threshold envelope of the single-unit tuning curves appeared very similar to the behavioral audiogram. PMID:7118731

  15. Risk factors associated with kanamycin-resistant tuberculosis in a Beijing tuberculosis referral hospital.

    PubMed

    Yu, Hao Tian; Wang, Qi; Yang, Nan; Li, Hong Min; Liang, Jian Qin; Liu, Cui Hua

    2012-07-01

    The rapidly increasing number of multidrug-resistant tuberculosis (MDR-TB) cases worldwide underlines the necessity for the rational use of key second-line drugs such as kanamycin. In this study, we determined the prevalence of, and risk factors associated with, kanamycin-resistant tuberculosis (TB) in 309 Hospital, Beijing, China, with the aim of providing information for better case management in order to minimize further development of extensively drug-resistant TB (XDR-TB). Drug susceptibility testing results and clinical data were retrospectively analysed for hospitalized TB patients for whom such data were available in 309 Hospital for the period 1997-2009. Univariate and multivariate analyses were used to determine the risk factors associated with kanamycin-resistant TB. During 1997-2009, 553 (14.4 %) of 3843 tested Mycobacterium tuberculosis isolates from hospitalized TB patients were kanamycin-resistant. The increasing trend of resistance to kanamycin was reversed since 2000. The independent risk factors associated with kanamycin-resistant TB included living in urban areas [adjusted odds ratio (OR) = 1.89], being retreated for repeat cases (adjusted OR = 1.60), being smear-positive for acid-fast bacilli at admission to the hospital (adjusted OR = 1.39), having ofloxacin-resistant (adjusted OR = 1.61) or para-aminosalicylic acid-resistant TB (adjusted OR = 1.47), having MDR-TB (adjusted OR = 5.10), having MDR-TB plus ofloxacin resistance (adjusted OR = 4.27) and having poly-resistant TB (adjusted OR = 3.94). The remaining rate of kanamycin resistance is still high despite the reversal of the increasing trend during the past decade. Surveillance of kanamycin resistance, especially among high-risk populations, should be continued to closely monitor trends so that appropriate action can be taken.

  16. Screening for engineered neomycin riboswitches that control translation initiation.

    PubMed

    Weigand, Julia E; Sanchez, Martin; Gunnesch, Ewald-Bernd; Zeiher, Sabrina; Schroeder, Renee; Suess, Beatrix

    2008-01-01

    Riboswitches are genetic control elements that regulate gene expression in a small molecule-dependent way. We developed a two-stage strategy of in vitro selection followed by a genetic screen and identified several artificial small molecule-binding riboswitches that respond to the aminoglycoside neomycin. Structure-function relationships and structural probing revealed that they adopt the general neomycin-binding motif. They display no sequence similarities to in vitro selected neomycin aptamers but contain parts of the decoding site that is the binding site for neomycin on the ribosomal RNA. We propose a model of a composed binding pocket of an internal loop as primary docking site and a terminal flaplike loop structure fixing neomycin in a sandwich-like manner. Such binding pockets characterized by multiple contacts between ligand and RNA are described for both natural and engineered riboswitches. We anticipate that combination of in vitro selection and in vivo screening is a useful strategy to identify RNA molecules with a desired functionality.

  17. Screening for engineered neomycin riboswitches that control translation initiation.

    PubMed

    Weigand, Julia E; Sanchez, Martin; Gunnesch, Ewald-Bernd; Zeiher, Sabrina; Schroeder, Renee; Suess, Beatrix

    2008-01-01

    Riboswitches are genetic control elements that regulate gene expression in a small molecule-dependent way. We developed a two-stage strategy of in vitro selection followed by a genetic screen and identified several artificial small molecule-binding riboswitches that respond to the aminoglycoside neomycin. Structure-function relationships and structural probing revealed that they adopt the general neomycin-binding motif. They display no sequence similarities to in vitro selected neomycin aptamers but contain parts of the decoding site that is the binding site for neomycin on the ribosomal RNA. We propose a model of a composed binding pocket of an internal loop as primary docking site and a terminal flaplike loop structure fixing neomycin in a sandwich-like manner. Such binding pockets characterized by multiple contacts between ligand and RNA are described for both natural and engineered riboswitches. We anticipate that combination of in vitro selection and in vivo screening is a useful strategy to identify RNA molecules with a desired functionality. PMID:18000033

  18. 40 CFR 174.521 - Neomycin phosphotransferase II; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Neomycin phosphotransferase II...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.521 Neomycin phosphotransferase II; exemption from the requirement of a tolerance. Residues of the neomycin phosphotransferase II (NPTII)...

  19. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Neomycin, penicillin, polymyxin, hydrocortisone... NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin, hydrocortisone suspension. (a... milligrams of neomycin, 10,000 international units of penicillin G procaine, 5,000 international units...

  20. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Neomycin, penicillin, polymyxin, hydrocortisone... NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin, hydrocortisone suspension. (a... milligrams of neomycin, 10,000 international units of penicillin G procaine, 5,000 international units...

  1. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin B, and hydrocortisone suspension.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Neomycin, penicillin, polymyxin B, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1484h Neomycin, penicillin, polymyxin B, and hydrocortisone suspension... equivalent to 17.5 milligrams of neomycin, 10,000 international units of penicillin G procaine,...

  2. Direct electrochemical detection of kanamycin based on peroxidase-like activity of gold nanoparticles.

    PubMed

    Wang, Chunshuai; Liu, Chang; Luo, Jibao; Tian, Yaping; Zhou, Nandi

    2016-09-14

    An enzyme-free, ultrasensitive electrochemical detection of kanamycin residue was achieved based on mimetic peroxidase activity of gold nanoparticles (AuNPs) and target-induced replacement of the aptamer. AuNPs which were synthesized using tyrosine as a reducing and capping agent, exhibited mimetic peroxidase activity. In the presence of kanamycin-specific aptamer, however, the single-stranded DNA (ssDNA) adsorbed on the surface of AuNPs via the interaction between the bases of ssDNA and AuNPs, and therefore blocked the catalytic site of AuNPs, and inhibited their peroxidase activity. While in the presence of target kanamycin, it bound with the adsorbed aptamer on AuNPs with high affinity, exposed the surface of AuNPs and recovered the peroxidase activity. Then AuNPs catalyzed the reaction between H2O2 and reduced thionine to produce oxidized thionine. The latter exhibited a distinct reduction peak on gold electrode in differential pulse voltammetry (DPV), and could be utilized to quantify the concentration of kanamycin. Under the optimized conditions, the proposed electrochemical assay showed an extremely high sensitivity towards kanamycin, with a linear relationship between the peak current and the concentration of kanamycin in the range of 0.1-60 nM, and a detection limit of 0.06 nM. Moreover, the established approach was successfully applied in the detection of kanamycin in honey samples. Therefore, the proposed electrochemical assay has great potential in the fields of food quality control and environmental monitoring. PMID:27566341

  3. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity

    PubMed Central

    Payne, Jason N.; Waghwani, Hitesh K.; Connor, Michael G.; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B.; Dakshinamurthy, Rajalingam

    2016-01-01

    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents. PMID:27330535

  4. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay.

    PubMed

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future. PMID:25634469

  5. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    NASA Astrophysics Data System (ADS)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  6. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    PubMed Central

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5′-TGG GGG TTG AGG CTA AGC CGA-3′) can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA–TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future. PMID:25634469

  7. 21 CFR 522.1484 - Neomycin sulfate sterile solution.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Neomycin sulfate sterile solution. 522.1484 Section 522.1484 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... dogs and cats for the treatment of acute and chronic bacterial infections due to organisms...

  8. 21 CFR 522.1484 - Neomycin sulfate sterile solution.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin sulfate sterile solution. 522.1484 Section 522.1484 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... dogs and cats for the treatment of acute and chronic bacterial infections due to organisms...

  9. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... use—(1) Chickens. It is used in feed as follows: Oxytetracycline and neomycin sulfate amount in grams per ton of feed Indications for use Limitations Sponsors (i) 10 to 50 Chickens: For increased rate of weight gain and improved feed efficiency. Feed continuously; do not feed to chickens producing eggs...

  10. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... use—(1) Chickens. It is used in feed as follows: Oxytetracycline and neomycin sulfate amount in grams per ton of feed Indications for use Limitations Sponsors (i) 10 to 50 Chickens: For increased rate of weight gain and improved feed efficiency. Feed continuously; do not feed to chickens producing eggs...

  11. Novel plasmid conferring kanamycin and tetracycline resistance in turkey-derived Campylobacter jejuni strain 11601MD

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In Campylobacter spp., resistance to the antibiotics kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095 bp.) harboring tet(O) was identified in...

  12. [Antitoxic properties of pantothenic acid derivatives, precursors of coenzyme A biosynthesis, with regard to kanamycin].

    PubMed

    Moĭseenok, A G; Dorofeev, B F; Sheĭbak, V M; Khomich, T I

    1984-11-01

    The effect of calcium pantothenate (CPN)B 4'-phospho-CPN (PCP), pantetheine (PT) and calcium S-sulfopantetheine (SPN) on acute toxicity of kanamycin sulfate was studied on albino mice. The above derivatives of pantothenic acid except PT lowered the antibiotic toxicity. The coefficient of the antitoxic effect (LD50/ED50) of SPN and PCP was 1.3-1.4 times higher than that of CPN. The combined use of kanamycin (1/5 of the LD50) with CPN, PCP or PT (30 mg/kg bw was equivalent to CPN) for 15 days prevented the increase in the total content of CoA and in the content of the fraction of free CoA and the precursors of its biosynthesis participating in the reaction of N-acetylation in the liver and brain. The contents of these substances were within the normal during the whole experiment. A certain increase in the activity of pantothenate kinase in the liver cytosol due to the use of kanamycin was eliminated by the simultaneous use of PCP and PT. The vitamin-containing compounds PCP and SPN were recommended for the clinical trials as agents preventing complications of kanamycin therapy. PMID:6524887

  13. Synthesis and combinational antibacterial study of 5''-modified neomycin.

    PubMed

    Zhang, Jianjun; Keller, Katherine; Takemoto, Jon Y; Bensaci, Mekki; Litke, Anthony; Czyryca, Przemyslaw Greg; Chang, Cheng-Wei Tom

    2009-10-01

    A library of 5''-modified neomycin derivatives were synthesized for an antibacterial structure-activity optimization strategy. Two leads exhibited prominent activity against both methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE). Antibacterial activities were measured when combined with other clinically used antibiotics. Significant synergistic activities were observed, which may lead to the development of novel therapeutic practices in the battle against infectious bacteria.

  14. Minocycline protection of neomycin induced hearing loss in gerbils.

    PubMed

    Robinson, Alan M; Vujanovic, Irena; Richter, Claus-Peter

    2015-01-01

    This animal study was designed to determine if minocycline ameliorates cochlear damage is caused by intratympanic injection of the ototoxic aminoglycoside antibiotic neomycin. Baseline auditory-evoked brainstem responses were measured in gerbils that received 40 mM intratympanic neomycin either with 0, 1.2, or 1.5 mg/kg intraperitoneal minocycline. Four weeks later auditory-evoked brainstem responses were measured and compared to the baseline measurements. Minocycline treatments of 1.2 mg/kg and 1.5 mg/kg resulted in significantly lower threshold increases compared to 0 mg/kg, indicating protection of hearing loss between 6 kHz and 19 kHz. Cochleae were processed for histology and sectioned to allow quantification of the spiral ganglion neurons and histological evaluation of organ of Corti. Significant reduction of spiral ganglion neuron density was demonstrated in animals that did not receive minocycline, indicating that those receiving minocycline demonstrated enhanced survival of spiral ganglion neurons, enhanced survival of sensory hairs cells and spiral ganglion neurons, and reduced hearing threshold elevation correlates with minocycline treatment demonstrating that neomycin induced hearing loss can be reduced by the simultaneous application of minocycline.

  15. Distribution of Neomycin in Bull Calves After Intramuscular Injection

    PubMed Central

    Black, W. D.; Claxton, M. J.

    1982-01-01

    Neomycin sulfate was injected intramuscularly in calves. Blood and tissue samples were taken at zero, one, two, four, six, eight and 24 hours after administration. The tissues with high levels (greater than 10 μg/g) of drug at the one hour period were kidney cortex and medulla, urine, blood serum and the injection site. By 24 hours after administration only the kidney cortex and urine had high levels of neomycin. The drug could not be detected in any brain tissues and very small amounts (less than 1 μg/g) were present in the bile, thymus and vitreous humor. Levels greater than 5 μg/g were present in lung tissues for less than four hours but were greater than 2 μg/g for more than 24 hours. The mean level in the injection site was greater than 700 μg/g at one hour but only trace amounts were found at 24 hours. On the basis of the tissue drug concentration intramuscularly administered neomycin was suggested as therapeutically useful for respiratory and urinary tract infections caused by susceptible bacteria. PMID:17422184

  16. Ecabet sodium alleviates neomycin-induced hair cell damage.

    PubMed

    Rah, Yoon Chan; Choi, June; Yoo, Myung Hoon; Yum, Gunhwee; Park, Saemi; Oh, Kyoung Ho; Lee, Seung Hoon; Kwon, Soon Young; Cho, Seung Hyun; Kim, Suhyun; Park, Hae-Chul

    2015-12-01

    Ecabet sodium (ES) is currently applied to some clinical gastrointestinal disease primarily by the inhibition of the ROS production. In this study, the protective role of ES was evaluated against the neomycin-induced hair cell loss using zebrafish experimental animal model. Zebrafish larvae (5-7 dpf), were treated with each of the following concentrations of ES: 5, 10, 20, 40, and 80 μg/mL for 1 h, followed by 125 μM neomycin for 1h. The positive control group was established by 125 μM neomycin-only treatment (1h) and the negative control group with no additional chemicals was also established. Hair cells inside four neuromasts ( SO1, SO2, O1, OC1) were assessed using fluorescence microscopy (n = 10). Hair cell survival was calculated as the mean number of viable hair cells for each group. Apoptosis and mitochondrial damage were investigated using special staining (TUNEL and DASPEI assay, respectively), and compared among groups. Ultrastructural changes were evaluated using scanning electron microscopy. Pre-treatment group with ES increased the mean number of viable hair cells as a dose-dependent manner achieving almost same number of viable hair cells with 40 μM/ml ES treatment (12.98 ± 2.59 cells) comparing to that of the negative control group (14.15 ± 1.39 cells, p = 0.72) and significantly more number of viable hair cells than that of the positive control group (7.45 ± 0.91 cells, p < 0.01). The production of reactive oxygen species significantly increased by 183% with 125 μM neomycin treatment than the negative control group and significantly decreased down to 105% with the pre-treatment with 40 μM/ml ES (n = 40, p = 0.04). A significantly less number of TUNEL-positive cells (reflecting apoptosis, p < 0.01) and a significantly increased DASPEI reactivity (reflecting viable mitochondria, p < 0.01) were observed in 40 μM/ml ES pre-treatment group. Our data suggest that ES could protect against neomycin-induced hair cell loss possibly by reducing

  17. Possible role for TRPV1 in neomycin-induced inhibition of visceral hypersensitivity in rat.

    PubMed

    van den Wijngaard, R M; Welting, O; Bulmer, D C; Wouters, M M; Lee, K; de Jonge, W J; Boeckxstaens, G E

    2009-08-01

    Transient receptor ion channel 1 (TRPV1) is a nociceptor involved in visceral hypersensitivity. Aminoglycosides like neomycin are not only potent antibiotics but in vitro data suggest that neomycin also acts as a TRPV1-antagonist and alleviates somatic pain responses. To what extent neomycin reduces visceral hypersensitivity remains unknown. Therefore, we aimed to investigate whether neomycin can inhibit in vivo TRPV1-dependent hypersensitivity responses in two rat models of visceral pain. In the first model rats were pretreated with intraperitoneal (i.p.) capsazepine, the selective TRPV1 antagonist SB-705498, neomycin or vehicle alone and 30 min later instilled with intracolonic TRPV1-activating capsaicin. Likewise, rats were pretreated with 10 days oral neomycin and then subjected to intracolonic capsaicin. The visceromotor response (VMR) to distension was measured before and after capsaicin application. In addition, the VMR to distension was measured in adult maternal separated rats before and after acute stress. Before the 2nd distension protocol these rats were treated with i.p. neomycin, amoxycillin or vehicle alone. Our results showed that capsaicin administration induced an enhanced VMR to distension that was prevented by i.p. capsazepine, SB-705498 and neomycin. Oral neomycin treatment changed bacterial faecal content but could not inhibit capsaicin induced visceral hypersensitivity. In maternal separated rats acute stress induced an enhanced response to distension that was reversed by i.p. neomycin, but not amoxycillin. These data indicate that (i.p.) neomycin can inhibit visceral hypersensitivity to distension in a nonbactericidal manner and suggest that TRPV1-modulation may be involved.

  18. MAPLE fabrication of thin films based on kanamycin functionalized magnetite nanoparticles with anti-pathogenic properties

    NASA Astrophysics Data System (ADS)

    Grumezescu, Valentina; Andronescu, Ecaterina; Holban, Alina Maria; Mogoantă, Laurenţiu; Mogoşanu, George Dan; Grumezescu, Alexandru Mihai; Stănculescu, Anca; Socol, Gabriel; Iordache, Florin; Maniu, Horia; Chifiriuc, Mariana Carmen

    2015-05-01

    In this study we aimed to evaluate the biocompatibility and antimicrobial activity of kanamycin functionalized 5 nm-magnetite (Fe3O4@KAN) nanoparticles thin films deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) technique. A laser deposition regime was established in order to stoichiometrically transfer Fe3O4@KAN thin films on silicone and glass substrates. Morphological and physico-chemical properties of powders and coatings were characterized by XRD, TEM, SEM, AFM and IR microscopy (IRM). Our nanostructured thin films have proved efficiency in the prevention of microbial adhesion and mature biofilms development as a result of antibiotic release in its active form. Furthermore, kanamycin functionalized nanostructures exhibit a good biocompatibility, both in vivo and in vitro, demonstrating their potential for implants application. This is the first study reporting the assessment of the in vivo biocompatibility of a magnetite-antimicrobial thin films produced by MAPLE technique.

  19. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet contains both aminopropazine fumarate equivalent to 25 milligrams of aminopropazine base and...

  20. 21 CFR 524.1484 - Neomycin sulfate ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Neomycin sulfate ophthalmic and topical dosage forms. 524.1484 Section 524.1484 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... NEW ANIMAL DRUGS § 524.1484 Neomycin sulfate ophthalmic and topical dosage forms....

  1. From GUIDON to NEOMYCIN and HERACLES in Twenty Short Lessons. Final Report. ONR Technical Report #20.

    ERIC Educational Resources Information Center

    Clancey, William J.

    This paper reviews the research leading from the GUIDON rule-based tutoring system, including the reconfiguration of MYCIN into NEOMYCIN and NEOMYCIN's generalization into the heuristic classification shell, HERACLES. The presentation is organized chronologically around pictures and dialogues that represent turning points and crystallize the basic…

  2. Protective role of edaravone against neomycin-induced ototoxicity in zebrafish.

    PubMed

    Choi, June; Chang, Jiwon; Jun, Hyung Jin; Im, Gi Jung; Chae, Sung Won; Lee, Seung Hoon; Kwon, Soon-Young; Jung, Hak Hyun; Chung, Ah-Young; Park, Hae-Chul

    2014-05-01

    Aminoglycosides such as neomycin are one of the most commonly prescribed types of antibiotics worldwide. However, these drugs appear to generate free radicals within the inner ear, which can result in permanent hearing loss. We evaluated the effects of edaravone, a neuroprotective agent, on neomycin-induced ototoxicity in transgenic zebrafish. The 5-day post fertilization (dpf) zebrafish larvae were exposed to 125 μM neomycin and various concentrations of edaravone for 1 h. Hair cell survival was calculated as average numbers of the hair cells in the control group, which was not exposed to neomycin. Ultrastructural changes were evaluated using a scanning electron microscope (SEM) and transmission electron microscope (TEM). Edaravone protected against neomycin-induced hair cell loss in the neuromasts (1000 μM: 11.6 ± 1.1 cells, neomycin only: 5.5 ± 0.5 cells; n = 10, P<0.05) and decreased the TUNEL reaction for detecting apoptosis. In ultrastructural analysis, structures of mitochondria and hair cells within neuromasts were preserved in zebrafish exposed to 125 μM neomycin and 1000 μM edaravone for 1 h. Edaravone protected against neomycin-induced hair cell loss by preventing apoptosis.

  3. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Neomycin sulfate and polymyxin B sulfate ophthalmic solution. 524.1484e Section 524.1484e Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... DOSAGE FORM NEW ANIMAL DRUGS § 524.1484e Neomycin sulfate and polymyxin B sulfate ophthalmic solution....

  4. 21 CFR 524.1484g - Neomycin sulfate-thiabendazole-dexamethasone solution.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... solution. 524.1484g Section 524.1484g Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... NEW ANIMAL DRUGS § 524.1484g Neomycin sulfate-thiabendazole-dexamethasone solution. (a) Specifications. Each cubic centimeter of neomycin sulfate-thiabendazole-dexamethasone solution contains: 40...

  5. 21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... contains both aminopropazine fumarate equivalent to 25 milligrams of aminopropazine base and neomycin sulfate equivalent to 50 milligrams of neomycin base. (b) Sponsor. See No. 000061 in § 510.600(c) of this... administered at a dosage level of one to two tablets per 10 pounds of body weight twice daily for 3 days.1...

  6. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

    PubMed

    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

    2010-09-20

    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer. PMID:20015628

  7. Effect of the Antibiotic Neomycin on the Toxicity of the Glycoside Vicine in Rats

    PubMed Central

    Arbid, Mahmoud S.; Koriem, Khaled M. M.; Asaad, Gihan F.; Megahed, Hoda A.

    2013-01-01

    Vicine is hydrolyzed by microflora to highly reactive free radical generating compound divicine which causes mortality and other adverse effects. This study in the rats established the effect of a broad spectrum and poorly absorbed antibiotic, neomycin sulfate on the toxicity of vicine. The results showed extremely decrease in mortality rate in the group pretreated with neomycin. Hemoglobin (Hb) concentration, hematocrit (Hct) value, and red blood cells (RBCs) count were significantly decreased after injection of vicine and the improvement of these values in the group pretreated with neomycin. The same results were observed in white blood cells (WBCs). The results showed a significant decrease in glucose level and returned to normal in group pretreated with neomycin. Glutathione (GSH) was significantly decreased in the vicine group and returned to normal value in the group pretreated with neomycin. Lipid peroxide (TBARs) was significantly increased in the group treated with vicine and neomycin pretreated group decreased to the normal level. Glucose-6-phosphate dehydrogenase (G6-PD) activity was significantly decreased and returned to normal level in rats pretreated with neomycin. Serum protein and globulin were significantly decreased but serum albumin showed insignificant decrease in vicine and neomycin groups compared to control. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly decreased in the vicine group. The group pretreated with neomycin showed significantly increased activities of AST and ALT compared with vicine group. In conclusion, neomycin pretreatment of rats injected with glycoside vicine decreased to a great extent of its toxic and mortality effects and is useful in favism and hemolytic anemia. PMID:23840205

  8. Sequence-specific targeting of RNA with an oligonucleotide-neomycin conjugate.

    PubMed

    Charles, Irudayasamy; Xi, Hongjuan; Arya, Dev P

    2007-01-01

    The synthesis of neomycin covalently attached at the C5-position of 2'-deoxyuridine is reported. The synthesis outlined allows for incorporation of an aminoglycoside (neomycin) at any given site in an oligonucleotide (ODN) where a thymidine (or uridine) is present. Incorporation of this modified base into an oligonucleotide, which is complementary to a seven-bases-long alpha-sarcin loop RNA sequence, leads to enhanced duplex hybridization. The increase in Tm for this duplex (DeltaTm = 6 degrees C) suggests a favorable interaction of neomycin within the duplex groove. CD spectroscopy shows that the modified duplex adopts an A-type confirmation. ITC measurements indicate the additive effects of ODN and neomycin binding to the RNA target (Ka = 4.5 x 107 M-1). The enhanced stability of the hybrid duplex from this neomycin-ODN conjugate originates primarily from the enthalpic contribution of neomycin {DeltaDeltaHobs = -7.21 kcal/mol (DeltaHneomycin conjugated - DeltaH nonconjugated)} binding to the hybrid duplex. The short linker length allows for selective stabilization of the hybrid duplex over the hybrid triplex. The results described here open up new avenues in the design and synthesis of nucleo-aminoglycoside-conjugates (N-Ag-C) where the inclusion of any number of aminoglycoside (neomycin) molecules per oligonucleotide can be accomplished.

  9. Determination of neomycin in the form of neomycin derivative with dabsyl chloride by thin layer chromatography and densitometry.

    PubMed

    Hubicka, Urszula; Zuromska-Witek, Barbara; Piotrowska, Joanna; Krzek, Jan

    2015-01-01

    A thin layer chromatographic-densitometric method has been developed for identification and quantitative determination of neomycin derivative with dabsyl chloride. The analysis of antibiotic was achieved on the silica gel TLC plates with fluorescent indicator with n-butanol--2-butanone--25% ammonia--water (10 : 6 : 2 : 2, v/v/v/v) as the mobile phase. The densitometric measurements were made at 460 nm. Under these conditions good separation of chosen aminoglycoside antibiotic from reagent used to make a complex was obtained. The method is characterized by high sensitivity, LOD from 0.1953 μg per band and LOQ from 0.5918 μg per band, wide linearity range from 0.5918 to 2.1960 μg per band for neomycin. The precision of the method was good; RSD varied from 1.17 to 2.05%. Satisfactory results of validation of the method were also confirmed by determination of selected antibiotic in pharmaceutical commercial preparation. The results obtained by TLC-densitometric method were compared with those obtained by spectrophotometric method.

  10. Allergic hypersensitivity to neomycin. Relationship between patch test reactions and 'use' tests.

    PubMed

    Prystowsky, S D; Nonomura, J H; Smith, R W; Allen, A M

    1979-06-01

    The prevalence of neomycin patch test sensitivity in the general population is approximately 1%. We describe the relationship between positive neomycin patch tests and clinical "use tests" with two antibiotic combinations (Neosporin G cream and Neosporin ointment). The neomycin use test was positive in seven of eight subjects with a strongly positive patch test, and in two of four subjects with a weakly positive patch test. A positive use test usually occurred earlier and was always more intense with the cream base. The use test reactions were usually mild even with continued application of the antigen. Use tests with commercial products may be helpful in evaluating the clinical relevance of positive patch tests.

  11. Determination of neomycin residues in eggs and stability of residues after cooking.

    PubMed

    Katz, S E; Levine, P R

    1978-09-01

    The procedure for neomycin residues used a surfactant to improve extraction, a centrifuge step to eliminate solids that interfere with the diffusion of the antibiotic, and a heat treatment to destroy interfering lysozyme activity. The use of Bcillus stearothermophilus and a 65 degree C incubation yielded a rapid assay with a sensitivity of 0.2 microgram neomycin activity/g egg. Frying eggs caused little or no loss of activity, poaching resulted in 25% loss, and soft boiling and hard boiling caused little or no loss of applied activity. Neomycin residues in eggs were quite stable to normal egg preparation procedures.

  12. Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.

    PubMed

    Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian

    2015-02-01

    Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria.

  13. Ultrastructural correlates of selective outer hair cell destruction following kanamycin intoxication in the chinchilla.

    PubMed

    Ryan, A F; Woolf, N K; Bone, R C

    1980-12-01

    Kanamycin ototoxicity, combined with behavioral audiometry to evaluate threshold shifts, was used to destroy outer hair cells (OHCs) in the basal cochlea of the chincilla while leaving the inner hair cell (IHC) population largely intact. After survival times of four weeks to one year, transmission electron microscopy was employed to determine the condition of surviving hair cells and neural elements. Throughout the region of OHC loss, IHCs and their innervation were normal in appearance if their adjacent supporting cells were undamaged. When IHC supporting cells, specifically the inner pillar cells, were damaged or absent, damage to IHCs was commonly observed. Such supporting cell-related damage included extrusion of the cuticular plate from the surface of the reticular lamina, encapsulation and/or fusion of stereocilia, and gross distortion of hair cell shape. When the outer supporting cells of the organ of Corti were undamaged following OHC loss, outer spiral fibers were found to have survived in near-normal numbers in the region from 0.5-1.0 mm basal to the basal most surviving OHC, but suffered progressive attrition toward the basal end of the cochlea. It is concluded that kanamycin-induced OHC loss can occur without concommitant IHC damage or outer spiral fiber loss. PMID:7451380

  14. Collaborative study for the establishment of the 3rd international standard for neomycin.

    PubMed

    Rautmann, G; Daas, A; Buchheit, K-H

    2013-01-01

    An international collaborative study was organised to establish the World Health Organization (WHO) 3(rd) International Standard (IS) for neomycin. Ten laboratories from different countries participated in the collaborative study. The potency of the candidate material, a freeze-dried preparation, was estimated by microbiological assays with sensitive micro-organisms. To ensure continuity between consecutive batches, the 2(nd) IS for neomycin was used as a standard. Based on the results of the study, the 3(rd) IS for neomycin was adopted at the meeting of the WHO Expert Committee on Biological Standardization (ECBS) in 2012 with an assigned potency of 19,050 IU per vial. The 3(rd) IS for neomycin is available from the European Directorate for the Quality of Medicines & HealthCare (EDQM).

  15. Colorimetric and fluorometric detection of neomycin based on conjugated polydiacetylene supramolecules.

    PubMed

    Zhou, Guodong; Wang, Fang; Wang, Huilin; Kambam, Srinivasulu; Chen, Xiaoqiang

    2013-06-13

    Utilizing the colorimetric and fluorogenic changes, a system based on polydiacetylenes (PDAs) is developed for the detection of neomycin. The PDA supramolecules polymerized from the mixed liposome composed of N-(3-hydroxyphenyl)pentacosa-10,12-diynamide (PCDA-AP) and pentacosa-10,12-diynoic acid (PCDA) at an optimized ratio of 1:9 display a unique colorimetric change (blue to red) and fluorescent enhancement in the presence of neomycin. The detection limit for neomycin is estimated to be 2.55 × 10(-7) M by the fluorogenic method. The optical changes induced by neomycin can be attributed to the disruption of the hydrogen bonding between phenol and carboxylic acid from PCDA-AP and PCDA.

  16. Semi-solid-state fermentation: a promising alternative for neomycin production by the actinomycete Streptomyces fradiae.

    PubMed

    Machado, Isabel; Teixeira, José A; Rodríguez-Couto, Susana

    2013-06-10

    The production of neomycin by the actinomycete Streptomyces fradiae, under semi-solid-state fermentation conditions was the main subject of this study. Two supports (nylon sponge and orange peelings) were tested in order to determine the most suitable one for the production of neomycin by the above-mentioned microorganism. Nylon sponge led to the highest neomycin production, reaching a maximum value of 13,903 μg/mL on the 10th day of cultivation. As a control, the same experiment was performed under submerged fermentation (SmF) conditions, without solid support. Here the production of neomycin by S. fradiae was about 55-fold lower (i.e. 250 μg/mL) than that obtained for SSF.

  17. Molecular recognition of single-stranded RNA: neomycin binding to poly(A).

    PubMed

    Xi, Hongjuan; Gray, David; Kumar, Sunil; Arya, Dev P

    2009-07-01

    Poly(A) is a relevant sequence in cell biology due to its importance in mRNA stability and translation initiation. Neomycin is an aminoglycoside antibiotic that is well known for its ability to target various nucleic acid structures. Here it is reported that neomycin is capable of binding tightly to a single-stranded oligonucleotide (A(30)) with a K(d) in the micromolar range. CD melting experiments support complex formation and indicate a melting temperature of 47 degrees C. The poly(A) duplex, which melts at 44 degrees C (pH 5.5), was observed to melt at 61 degrees C in the presence of neomycin, suggesting a strong stabilization of the duplex by the neomycin.

  18. Rapid and Sensitive Chemiluminescent Enzyme Immunoassay for the Determination of Neomycin Residues in Milk.

    PubMed

    Luo, Peng Jie; Zhang, Jian Bo; Wang, Hua Li; Chen, Xia; Wu, Nan; Zhao, Yun Feng; Wang, Xiao Mei; Zhang, Hong; Zhang, Ji Yue; Zhu, Lei; Jiang, Wen Xiao

    2016-05-01

    Immunoassays greatly contribute to veterinary drug residue analysis. However, there are few reports on detecting neomycin residues by immunoassay. Here, a rapid and sensitive chemiluminescent enzyme immunoassay (CLIEA) was successfully developed for neomycin residue analysis. CLIEA demonstrated good cross-reactivity for neomycin, and the IC50 value was 2.4 ng/mL in buffer. The average recovery range was 88.5%-105.4% for spiked samples (10, 50, and 100 μg/kg), and the coefficient of variation was in the range of 7.5%-14.5%. The limit of detection of CLEIA was 9.4 μg/kg, and this method was compared with the liquid chromatography-tandem mass spectrometry method using naturally contaminated samples, producing a correlation coefficient of >0.95. We demonstrate a reliable CLIEA for the rapid screening of neomycin in milk. PMID:27353712

  19. Prevalence of transposons encoding kanamycin, ampicillin and trimethoprim resistance in isolates from urinary tract infections detected using DNA probes.

    PubMed

    Chang, S F; Chang, L L; Chow, T Y; Wu, W J; Chang, J C

    1992-03-01

    Drug resistant Gram-negative bacteria causing urinary tract infections were collected. Kanamycin, ampicillin or trimethoprim-resistant strains were analyzed separately for the presence of Tn5, Tn3, or Tn7 by colony hybridization. Of these isolates, kanamycin-resistant transposons were present in 38.2% of 60 kanamycin-resistant isolates. A 3.3 kb fragment containing SacI-BamHI transposase of Tn3 and 42.6% showed a positive reaction in 129 ampicillin-resistant clinical isolates. Among the 75 trimethoprim-resistant isolates studied, 52% were shown to contain Tn7 when probed with a 1 kb BamHI fragment of Tn7. Results from Southern hybridizations demonstrated that these antibiotic resistant genes had been born on plasmids in some clinical isolates.

  20. Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance

    SciTech Connect

    Mai, V.; Lorenz, W.W.; Wiegel, J.

    1997-12-31

    The industrial application of thermophilic (eu)bacteria is hampered by the lack of genetic systems for these bacteria. We report here the first unequivocal transformation of a Gram-positive, thermophilic, anaerobic microorganism, Thermoanaerobacterium, with the kanamycin resistance-mediating plasmid pIKM1. The construct pIKM1 is based on the Escherichia coli-Clostridium acetobutylicum shuttle vector pIMP1 and contains the thermostable kanamycin cassette from S. faecalis plasmid pKD102. Using electrotransformation, plasmid pIKM1 mediated kanamycin resistance in Thermoanaerobacterium sp. strain JW/SL-YS485 up to 400 {mu}g ml{sup -1} at 48{degrees}C and 200 {mu}g ml{sup -1} at 60{degrees}C.

  1. Probing the recognition surface of a DNA triplex: binding studies with intercalator-neomycin conjugates.

    PubMed

    Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skriba, Michael; Arya, Dev P

    2010-07-01

    Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA).2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalene diimide-neomycin (3) and anthraquinone-neomycin (4) conjugates were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2) conjugates, in our investigations. A combination of experiments, including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC), revealed that all four conjugates (1-4) stabilized poly(dA).2poly(dT) much more than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (T(m3-->2)) at which poly(dA).2poly(dT) dissociated into poly(dA).poly(dT) and poly(dT) increased dramatically (>12 degrees C) in the presence of intercalator-neomycin conjugates (1-4) even at a very low concentration (2 muM). In contrast to intercalator-neomycin conjugates, the increment of T(m3-->2) of poly(dA).2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin conjugates (1-4) to poly(dA).2poly(dT) was also confirmed by competition dialysis and a fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compounds 1-4 had slightly larger binding site size ( approximately 7-7.5) with poly(dA).2poly(dT) as compared to neomycin ( approximately 6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA).2poly(dT) were derived from an integrated van't Hoff equation using the T(m3-->2) values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA).2poly(dT) increased in the following order: neomycin < 1 < 3 < 4 < 2. Among them, the binding constant [(2.7 +/- 0.3) x 10(8) M(-1)] of

  2. Probing the recognition surface of a DNA triplex: Binding studies with intercalator-neomycin conjugates

    PubMed Central

    Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skirba, Michael; Arya, Dev P.

    2012-01-01

    Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA)•2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalenedimide-neomycin (3) and anthraquinone-neomycin (4) were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2), in our investigations. A combination of experiments including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC) revealed that all four conjugates (1–4) stabilized poly(dA)•2poly(dT) much greater than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (Tm3→2) at which poly(dA)•2poly(dT) dissociated into poly(dA)•poly(dT) and poly(dT) increased dramatically (> 12 °C) in the presence of intercalator-neomycin (1–4) even at a very low concentration (2 µM). In contrast to intercalator-neomycin conjugates, the increment of Tm3→2 of poly(dA)•2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin (1–4) to poly(dA)•2poly(dT) was also confirmed by competition dialysis and fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compound 1–4 had slightly larger binding site size (~7–7.5) with poly(dA)•2poly(dT) as compared to neomycin (~6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA)•2poly(dT) were derived from an integrated van’t Hoff equation using the Tm3→2 values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA)•2poly(dT) increased in the order neomycin < 1 < 3 < 4 < 2. Amongst them, the binding constant [(2.7 ± 0.3) × 108 M−1] of 2 with poly(dA)•2poly(dT) was the highest, almost 1000 fold more

  3. Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.

    PubMed

    Bera, Smritilekha; Zhanel, George G; Schweizer, Frank

    2008-10-01

    Aminoglycoside antibiotics and cationic detergents constitute two classes of clinically important drugs and antiseptics. Their bacteriological and clinical efficacy, however, has decreased recently due to antibiotic resistance. We have synthesized aminoglycoside-lipid conjugates in which the aminoglycoside neomycin forms the cationic headgroup of a polycationic detergent. Our results show that neomycin-C16 and neomycin-C20 conjugates exhibit strong Gram-positive activity but reduced Gram-negative activity. The MIC of neomycin-C16 (C20) conjugates against methicillin-resistant Staphylococcus aureus (MRSA) is comparable to clinically used antiseptics.

  4. High-performance liquid chromatographic analysis of neomycin in petrolatum-based ointments and in veterinary formulations.

    PubMed

    Binns, R B; Tsuji, K

    1984-01-01

    A high-performance liquid chromatographic (HPLC) method has been developed for the assay of neomycin in petrolatum-based ophthalmic and topical ointments and in veterinary formulations. Neomycin assay interferences from drugs, such as bacitracin and polymyxin B and inactive components, e.g. wax, were eliminated by a methanol wash and/or a partitioning method. The extracted neomycin was derivatized with 2,4-dinitrofluorobenzene followed by normal-phase HPLC with detection at 254 nm. The average recovery of neomycin from spiked samples was approximately 100% with a relative standard deviation of less than 1%.

  5. Synergy of Penicillin-Netilmicin Combinations Against Enterococci Including Strains Highly Resistant to Streptomycin or Kanamycin

    PubMed Central

    Sanders, Christine C.

    1977-01-01

    The in vitro activity of combinations of penicillin and netilimicin was determined against 20 clinical isolates of enterococci and compared with that obtained in simultaneous tests with penicillin/sisomicin, penicillin/streptomycin, and penicillin/kanamycin. Synergy between the two drugs in each combination was determined by the use of quantitative kill curves and was defined as a killing by the combination at least 100-fold greater than that produced by the most effective drug alone. Penicillin/netilmicin and penicillin/sisomicin combinations were found to be synergistic against the majority of isolates tested, including strains resistant to penicillin/streptomycin or penicillin/kanamycin combinations. This synergy with penicillin could be demonstrated at a concentration of ≤7 μg/ml for either netilmicin or sisomicin. Studies on the kinetics of killing produced by these combinations showed the rate and extent of killing to be directly dependent upon the organism's relative susceptibility to the aminoglycoside alone and the aminoglycoside concentration in the combination. Results also indicated that the interaction between penicillin and netilmicin was true synergy; i.e., rapid and complete killing was produced by combinations containing each drug at concentrations insufficient to produce any killing alone, and the killing observed could not be produced by either drug alone at a concentration equivalent to the total drug concentration in the combination. The potential clinical application of this synergistic interaction should be investigated further, especially in view of recent reports showing netilmicin to be considerably less toxic than gentamicin in experimental animals. PMID:242509

  6. Glutamate co-transmission from developing medial nucleus of the trapezoid body - Lateral superior olive synapses is cochlear dependent in kanamycin-treated rats

    SciTech Connect

    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol

    2011-02-11

    Research highlights: {yields} Glutamate co-transmission is enhanced in kanamycin-treated rats. {yields} VGLUT3 expression is increased in kanamycin-treated rats. {yields} GlyR expression is decreased in kanamycin-treated rats. {yields} GlyR, VGLUT3 expression patterns are asymmetric in unilaterally cochlear ablated rat. -- Abstract: Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  7. Mobilization properties of small ColE1-like plasmids carrying kanamycin resistance gene isolated from Salmonella enterica serotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Previously we isolated and characterized various groups of small kanamycin resistance (KanR) ColE1-like plasmids from different serotypes of Salmonella enterica isolates. These plasmids all carried the aph(3)-I gene encoding the aminoglycoside phosphotransferase responsible for the kanam...

  8. Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes.

    PubMed

    Kumar, Sunil; Xue, Liang; Arya, Dev P

    2011-05-18

    A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ∼10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT

  9. Interaction of weakly bound antibiotics neomycin and lincomycin with bovine and human serum albumin: biophysical approach.

    PubMed

    Keswani, Neelam; Choudhary, Sinjan; Kishore, Nand

    2010-07-01

    The thermodynamics of interaction of neomycin and lincomycin with bovine serum albumin (BSA) and human serum albumin (HSA) has been studied using isothermal titration calorimetry (ITC), in combination with UV-visible, steady state and time resolved fluorescence spectroscopic measurements. Neomycin is observed to bind weakly to BSA and HSA whereas lincomycin did not show any evidence for binding with the native state of these proteins, rather it interacts in the presence of surfactants. The ITC results suggest 1 : 1 binding stoichiometry for neomycin in the studied temperature range. The values of the van't Hoff enthalpy do not agree with the calorimetric enthalpy in the case of neomycin, suggesting conformational changes in the protein upon ligand binding, as well as with the rise in the temperature. Experiments at different ionic strengths, and in the presence of tetrabutyl ammonium bromide and surfactants suggest the predominant involvement of electrostatic interactions in the complexation process of neomycin with BSA and HSA, and non-specific interaction behaviour of lincomycin with these proteins.

  10. Effect of covalent attachment of neomycin on conformational and aggregation properties of catalase.

    PubMed

    Hashemnia, S; Mokhtari, Z; Tashkhourian, J; Moosavi-Movahedi, A A

    2015-04-01

    The carboxylic groups of glutamic acid and aspartic acid residues of catalase (CAT) were chemically modified using the treatment of the enzyme with 1-ethyl-3-(3'-dimethylamino) carbodiimide hydrochloride (EDC) and neomycin. The effect of covalent attachment of neomycin on the enzymatic activity, conformational and aggregation properties of CAT was investigated. The modification of CAT with different concentrations of neomycin showed two different types of behavior, depending up on the concentration range of neomycin. In the concentration range from 0.0 to 5.2 mM, neomycin-modified CAT, compared to the native enzyme exhibited higher a-helix content, reduced surface hydrophobicity, little enhancement in CAT activity and a better protection against thermal aggregation, whereas at concentrations greater than 5.2 mM, the modified enzyme exhibited a significant decrease in CAT activity and an increase in random coil content which may result in disorder in the protein structure and increase in thermal aggregation. This modification is a rapid and simple approach to investigate the role of aspartate and glutamate residues in the structure, function and folding of CAT.

  11. Loss of enzyme-sensitive antigens due to the presence of leukocytes, neomycin sulfate, and LISS.

    PubMed

    Velliquette, R W; Howard, P; Malyska, H; Reid, M E

    2003-01-01

    Previous studies have shown that RBCs with residual WBCs stored in LISS and neomycin sulfate develop characteristics associated with enzyme-treated RBCs. During a mass screening program to antigen type donor RBCs, we observed that the Fya antigens on a RBC sample from an in-house panel became non-detectable with anti-Fya after incubation overnight in Diluent 2 from Micro Typing Systems, Inc. (MTS, Pompano Beach, FL). In response to this observation, we initiated an investigation to determine the cause. Tests were performed according to the manfacturer's instructions in MTS neutral gel cards or gel cards containing anti-IgG. We found that a reduction or loss of the Fya, Fyb, and M antigens occurs when RBCs were prepared from samples containing residual WBCs (as a source of enzymes) and subsequently incubated in media containing neomycin sulfate and LISS. We showed that the effect did not occur in the absence of neomycin sulfate. RBC antigens can be altered in LISS if they have first been exposed to neomycin. We recommend restricting the use of RBCs suspended in MTS Diluent 2 to the day of dilution (as indicated in the package insert) if preparing reagent RBCs from sources that were not leukoreduced and were stored in the presence of neomycin.

  12. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5...

  13. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Bacitracin or bacitracin zinc-neomycin sulfate... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.154 Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B... units of polymyxin B. (2) To 000061 and 025463; each gram contains 400 units of bacitracin zinc,...

  14. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5...

  15. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Bacitracin zinc-polymyxin B sulfate-neomycin... zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate ophthalmic ointment... of ointment contains 400 units of bacitracin zinc, 10,000 units of polymyxin B sulfate, 5...

  16. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Bacitracin or bacitracin zinc-neomycin sulfate... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.154 Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B... units of polymyxin B. (2) To 000061 and 043264; each gram contains 400 units of bacitracin zinc,...

  17. Inhibition of H3K4me2 Demethylation Protects Auditory Hair Cells from Neomycin-Induced Apoptosis.

    PubMed

    He, Yingzi; Yu, Huiqian; Cai, Chengfu; Sun, Shan; Chai, Renjie; Li, Huawei

    2015-08-01

    Aminoglycoside-induced hair cell loss is a major cause of hearing impairment in children and deserves more attention in medical research. Epigenetic mechanisms have been shown to protect hair cells from ototoxic drugs. In this study, we focused on the role of dimethylated histone H3K4 (H3K4me2) in hair cell survival. To investigate the effects of lysine-specific demethylase 1 (LSD1)--the histone demethylase primarily responsible for demethylating H3K4me2--on neomycin-induced hair cell loss, isolated cochleae were pretreated with LSD1 inhibitors followed by neomycin exposure. There was a severe loss of hair cells in the organ of Corti after neomycin exposure, and inhibition of LSD1 significantly protected against neomycin-induced hair cell loss. H3K4me2 expression in the nuclei of hair cells decreased after exposure to neomycin, and blocking the decreased expression of H3K4me2 with LSD1 inhibitors prevented hair cell loss. Local delivery of these inhibitors in vivo also protected hair cells from neomycin-induced ototoxicity and maintained the hearing threshold in mice as determined by auditory brain stem response. This inhibition of neomycin-induced apoptosis occurs via reduced caspase-3 activation. Together, our findings demonstrate the protective role for H3K4me2 against neomycin-induced hair cell loss and hearing loss.

  18. Characterization of a radical S-adenosyl-L-methionine epimerase, NeoN, in the last step of neomycin B biosynthesis.

    PubMed

    Kudo, Fumitaka; Hoshi, Shota; Kawashima, Taiki; Kamachi, Toshiaki; Eguchi, Tadashi

    2014-10-01

    The last step of neomycin biosynthesis is the epimerization at C-5‴ of neomycin C to give neomycin B. A candidate enzyme responsible for the epimerization was a putative radical S-adenosyl-L-methionine (SAM) enzyme, NeoN, which is uniquely encoded in the neomycin biosynthetic gene cluster and remained an unassigned protein in the neomycin biosynthesis. The reconstituted and reduced NeoN showed the expected epimerization activity in the presence of SAM. In the epimerization, 1 equiv of SAM was consumed to convert neomycin C into neomycin B. The site of neomycin C reactive toward epimerization was clearly confirmed to be C-5‴ by detecting the incorporation of a deuterium atom from the deuterium oxide-based buffer solution. Further, alanine scanning of the NeoN cysteine residues revealed that C249 is a critical amino acid residue that provides a hydrogen atom to complete the epimerization. Furthermore, electron paramagnetic resonance analysis of the C249A variant in the presence of SAM and neomycin C revealed that a radical intermediate is generated at the C-5‴ of neomycin C. Therefore, the present study clearly illustrates that the epimerization of neomycin C to neomycin B is catalyzed by a unique radical SAM epimerase NeoN with a radical reaction mechanism. PMID:25230155

  19. Characterization of a radical S-adenosyl-L-methionine epimerase, NeoN, in the last step of neomycin B biosynthesis.

    PubMed

    Kudo, Fumitaka; Hoshi, Shota; Kawashima, Taiki; Kamachi, Toshiaki; Eguchi, Tadashi

    2014-10-01

    The last step of neomycin biosynthesis is the epimerization at C-5‴ of neomycin C to give neomycin B. A candidate enzyme responsible for the epimerization was a putative radical S-adenosyl-L-methionine (SAM) enzyme, NeoN, which is uniquely encoded in the neomycin biosynthetic gene cluster and remained an unassigned protein in the neomycin biosynthesis. The reconstituted and reduced NeoN showed the expected epimerization activity in the presence of SAM. In the epimerization, 1 equiv of SAM was consumed to convert neomycin C into neomycin B. The site of neomycin C reactive toward epimerization was clearly confirmed to be C-5‴ by detecting the incorporation of a deuterium atom from the deuterium oxide-based buffer solution. Further, alanine scanning of the NeoN cysteine residues revealed that C249 is a critical amino acid residue that provides a hydrogen atom to complete the epimerization. Furthermore, electron paramagnetic resonance analysis of the C249A variant in the presence of SAM and neomycin C revealed that a radical intermediate is generated at the C-5‴ of neomycin C. Therefore, the present study clearly illustrates that the epimerization of neomycin C to neomycin B is catalyzed by a unique radical SAM epimerase NeoN with a radical reaction mechanism.

  20. Wnt activation protects against neomycin-induced hair cell damage in the mouse cochlea.

    PubMed

    Liu, L; Chen, Y; Qi, J; Zhang, Y; He, Y; Ni, W; Li, W; Zhang, S; Sun, S; Taketo, M M; Wang, L; Chai, R; Li, H

    2016-01-01

    Recent studies have reported the role of Wnt/β-catenin signaling in hair cell (HC) development, regeneration, and differentiation in the mouse cochlea; however, the role of Wnt/β-catenin signaling in HC protection remains unknown. In this study, we took advantage of transgenic mice to specifically knockout or overactivate the canonical Wnt signaling mediator β-catenin in HCs, which allowed us to investigate the role of Wnt/β-catenin signaling in protecting HCs against neomycin-induced damage. We first showed that loss of β-catenin in HCs made them more vulnerable to neomycin-induced injury, while constitutive activation of β-catenin in HCs reduced HC loss both in vivo and in vitro. We then showed that loss of β-catenin in HCs increased caspase-mediated apoptosis induced by neomycin injury, while β-catenin overexpression inhibited caspase-mediated apoptosis. Finally, we demonstrated that loss of β-catenin in HCs led to increased expression of forkhead box O3 transcription factor (Foxo3) and Bim along with decreased expression of antioxidant enzymes; thus, there were increased levels of reactive oxygen species (ROS) after neomycin treatment that might be responsible for the increased aminoglycoside sensitivity of HCs. In contrast, β-catenin overexpression reduced Foxo3 and Bim expression and ROS levels, suggesting that β-catenin is protective against neomycin-induced HC loss. Our findings demonstrate that Wnt/β-catenin signaling has an important role in protecting HCs against neomycin-induced HC loss and thus might be a new therapeutic target for the prevention of HC death.

  1. Protective role of NecroX-5 against neomycin-induced hair cell damage in zebrafish.

    PubMed

    Song, Jae-Jun; Chang, Jiwon; Choi, Jungim; Im, Gi Jung; Chae, Sung Won; Lee, Seung Hoon; Kwon, Soon-Young; Jung, Hak Hyun; Chung, Ah-Young; Park, Hae-Chul; Choi, June

    2014-02-01

    NecroX-5, one of the derivatives of NecroX series compounds, is a mitochondrial reactive oxygen species and reactive nitrogen species scavenger that inhibits cell death against various kinds of oxidative stresses. The objective of the present study was to evaluate the effects of NecroX-5 on neomycin-induced ototoxicity in transgenic zebrafish (Brn3C: EGFP). Five days post-fertilization, zebrafish larvae were exposed to 125 μM neomycin and one of the following NecroX-5 concentrations for 1 h: 10, 25, 50, and 75 μM. Hair cells within the neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed using fluorescence microscopy (n = 10). The terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridiniumiodide (DASPEI) assay were performed for evaluation of apoptosis and mitochondrial damage. Ultrastructural changes were evaluated using scanning electron microscopy. NecroX-5 decreased neomycin-induced hair cell loss in the neuromasts (NecroX-5 50 μM: 13.4 ± 2.0 cells, 125 μM neomycin only: 8.1 ± 1.2 cells; n = 10, P < 0.05) and decreased the TUNEL reaction. The ultrastructural analysis showed that the structures of mitochondria and hair cells within the neuromasts were preserved in zebrafish exposed to 125 μM neomycin and 50 μM NecroX-5. NecroX-5 decreased apoptosis and mitochondrial damage. In conclusion, NecroX-5 attenuated neomycin-induced hair cell loss in zebrafish.

  2. Wnt activation protects against neomycin-induced hair cell damage in the mouse cochlea

    PubMed Central

    Liu, L; Chen, Y; Qi, J; Zhang, Y; He, Y; Ni, W; Li, W; Zhang, S; Sun, S; Taketo, M M; Wang, L; Chai, R; Li, H

    2016-01-01

    Recent studies have reported the role of Wnt/β-catenin signaling in hair cell (HC) development, regeneration, and differentiation in the mouse cochlea; however, the role of Wnt/β-catenin signaling in HC protection remains unknown. In this study, we took advantage of transgenic mice to specifically knockout or overactivate the canonical Wnt signaling mediator β-catenin in HCs, which allowed us to investigate the role of Wnt/β-catenin signaling in protecting HCs against neomycin-induced damage. We first showed that loss of β-catenin in HCs made them more vulnerable to neomycin-induced injury, while constitutive activation of β-catenin in HCs reduced HC loss both in vivo and in vitro. We then showed that loss of β-catenin in HCs increased caspase-mediated apoptosis induced by neomycin injury, while β-catenin overexpression inhibited caspase-mediated apoptosis. Finally, we demonstrated that loss of β-catenin in HCs led to increased expression of forkhead box O3 transcription factor (Foxo3) and Bim along with decreased expression of antioxidant enzymes; thus, there were increased levels of reactive oxygen species (ROS) after neomycin treatment that might be responsible for the increased aminoglycoside sensitivity of HCs. In contrast, β-catenin overexpression reduced Foxo3 and Bim expression and ROS levels, suggesting that β-catenin is protective against neomycin-induced HC loss. Our findings demonstrate that Wnt/β-catenin signaling has an important role in protecting HCs against neomycin-induced HC loss and thus might be a new therapeutic target for the prevention of HC death. PMID:26962686

  3. Dual recognition of the human telomeric G-quadruplex by a neomycin-anthraquinone conjugate.

    PubMed

    Ranjan, Nihar; Davis, Erik; Xue, Liang; Arya, Dev P

    2013-06-28

    The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of the G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for the G-quadruplex. One such example is a neomycin-anthraquinone conjugate (2) which exhibited nanomolar affinity for the quadruplex, and the affinity of (2) is nearly 1000 fold higher for the human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone.

  4. Neomycin and carbodiimide crosslinking as an alternative to glutaraldehyde for enhanced durability of bioprosthetic heart valves.

    PubMed

    Leong, Joshua; Munnelly, Amy; Liberio, Brianna; Cochrane, Leonard; Vyavahare, Naren

    2013-05-01

    Glutaraldehyde cross-linked porcine aortic valves, referred to as bioprosthetic heart valves (BHVs), are often used in heart valve replacements. Glutaraldehyde does not stabilize glycosaminoglycans (GAGs) and they are lost during preparation, in vivo implantation, cyclic fatigue, and storage. We report that binding of neomycin, a hyaluronidase inhibitor, to the tissues with carbodiimide cross-linking improves GAG retention without reducing collagen and elastin stability. It also led to improved biomechanical properties. Neomycin carbodiimide cross-linking did not significantly reduce calcification in a rat subdermal implantation model when they were stored in formaldehyde after cross-linking. Removal of formaldehyde storage significantly reduced calcification.

  5. Systemic lipopolysaccharide induces cochlear inflammation and exacerbates the synergistic ototoxicity of kanamycin and furosemide.

    PubMed

    Hirose, Keiko; Li, Song-Zhe; Ohlemiller, Kevin K; Ransohoff, Richard M

    2014-08-01

    Aminoglycoside antibiotics are highly effective agents against gram-negative bacterial infections, but they cause adverse effects on hearing and balance dysfunction as a result of toxicity to hair cells of the cochlea and vestibular organs. While ototoxicity has been comprehensively studied, the contributions of the immune system, which controls the host response to infection, have not been studied in antibiotic ototoxicity. Recently, it has been shown that an inflammatory response is induced by hair cell injury. In this study, we found that lipopolysaccharide (LPS), an important component of bacterial endotoxin, when given in combination with kanamycin and furosemide, augmented the inflammatory response to hair cell injury and exacerbated hearing loss and hair cell injury. LPS injected into the peritoneum of experimental mice induced a brisk cochlear inflammatory response with recruitment of mononuclear phagocytes into the spiral ligament, even in the absence of ototoxic agents. While LPS alone did not affect hearing, animals that received LPS prior to ototoxic agents had worse hearing loss compared to those that did not receive LPS pretreatment. The poorer hearing outcome in LPS-treated mice did not correlate to changes in endocochlear potential. However, LPS-treated mice demonstrated an increased number of CCR2(+) inflammatory monocytes in the inner ear when compared with mice treated with ototoxic agents alone. We conclude that LPS and its associated inflammatory response are harmful to the inner ear when coupled with ototoxic medications and that the immune system may contribute to the final hearing outcome in subjects treated with ototoxic agents.

  6. M. tuberculosis ferritin (Rv3841): Potential involvement in Amikacin (AK) & Kanamycin (KM) resistance.

    PubMed

    Sharma, Divakar; Lata, Manju; Faheem, Mohammad; Khan, Asad Ullah; Joshi, Beenu; Venkatesan, Krishnamurthy; Shukla, Sangeeta; Bisht, Deepa

    2016-09-16

    Tuberculosis is an infectious disease, caused by one of the most successful human pathogen, Mycobacterium tuberculosis. Aminoglycosides, Amikacin (AK) & Kanamycin (KM) are commonly used to treat drug resistant tuberculosis. They target the protein synthesis machinery by interacting with several steps of translation. Several explanations have been proposed to explain the mechanism of aminoglycoside resistance but still our information is inadequate. Iron storing/interacting proteins were found to be overexpressed in aminoglycosides resistant isolates. Iron assimilation and utilization in M. tuberculosis plays a crucial role in growth, virulence and latency. To establish the relationship of ferritin with AK & KM resistance ferritin (Rv3841/bfrB) was cloned, expressed and antimicrobial drug susceptibility testing (DST) was carried out. Rv3841/bfrB gene was cloned and expressed in E. coli BL21 using pQE2 expression vector. Etest results for DST against AK & KM showed that the minimum inhibitory concentration (MIC) of ferritin recombinant cells was changed. Recombinants showed two fold changes in MIC with AK and three fold with KM E-strips. Overexpression of ferritin reflect the MIC shift which might be playing a critical role in the survival of mycobacteria by inhibiting/modulating the effects of AK & KM. String analysis also suggests that ferritin interacted with few proteins which are directly and indirectly involved in M. tuberculosis growth, Iron assimilation, virulence, resistance, stresses and latency. PMID:27521892

  7. The Effect of Kanamycin and Tetracycline on Growth and Photosynthetic Activity of Two Chlorophyte Algae

    PubMed Central

    2016-01-01

    Antibiotics are routinely used in microalgae culture screening, stock culture maintenance, and genetic transformation. By studying the effect of antibiotics on microalgae growth, we can estimate the least value to inhibit growth of undesired pathogens in algal culture. We studied the effect of kanamycin and tetracycline on the growth and photosynthetic activity of two chlorophyte microalgae, Dictyosphaerium pulchellum and Micractinium pusillum. We measured CFU mL−1 on agar plates, optical density, fluorescence yields, and photosynthetic inhibition. Our results showed a significant effect of kan and tet on the tested microalgae species except tet, which showed a minor effect on M. pusillum. Both antibiotics are believed to interact with the protein synthesis machinery; hence, the inhibitory effect of the tested antibiotics was further confirmed by isolation and quantification of the whole cell protein. A significant reduction in protein quantity was observed at concentrations more than 5 mg L−1, except M. pusillum, which showed only a slight reduction in protein quantity even at the maximum tested concentration of tet (30 mg L−1). This study can further aid in aquaculture industry, for the maintenance of the microalgae stock cultures and it can also help the microalgae genetic engineers in the construction of molecular markers. PMID:27747232

  8. Amplification of the entire kanamycin biosynthetic gene cluster during empirical strain improvement of Streptomyces kanamyceticus.

    PubMed

    Yanai, Koji; Murakami, Takeshi; Bibb, Mervyn

    2006-06-20

    Streptomyces kanamyceticus 12-6 is a derivative of the wild-type strain developed for industrial kanamycin (Km) production. Southern analysis and DNA sequencing revealed amplification of a large genomic segment including the entire Km biosynthetic gene cluster in the chromosome of strain 12-6. At 145 kb, the amplifiable unit of DNA (AUD) is the largest AUD reported in Streptomyces. Striking repetitive DNA sequences belonging to the clustered regularly interspaced short palindromic repeats family were found in the AUD and may play a role in its amplification. Strain 12-6 contains a mixture of different chromosomes with varying numbers of AUDs, sometimes exceeding 36 copies and producing an amplified region >5.7 Mb. The level of Km production depended on the copy number of the Km biosynthetic gene cluster, suggesting that DNA amplification occurred during strain improvement as a consequence of selection for increased Km resistance. Amplification of DNA segments including entire antibiotic biosynthetic gene clusters might be a common mechanism leading to increased antibiotic production in industrial strains.

  9. Heterologous production of paromamine in Streptomyces lividans TK24 using kanamycin biosynthetic genes from Streptomyces kanamyceticus ATCC12853.

    PubMed

    Nepal, Keshav Kumar; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-05-31

    The 2-deoxystreptamine and paromamine are two key intermediates in kanamycin biosynthesis. In the present study, pSK-2 and pSK-7 recombinant plasmids were constructed with two combinations of genes: kanABK and kanABKF and kacA respectively from kanamycin producer Streptomyces kanamyceticus ATCC12853. These plasmids were heterologously expressed into Streptomyces lividans TK24 independently and generated two recombinant strains named S. lividans Sk-2/SL and S. lividans SK-7/SL, respectively. ESI/ MS and ESI-LC/MS analysis of the metabolite from S. lividans SK-2/SL showed that the compound had a molecular mass of 163 [M + H]+, which corresponds to that of 2-deoxystreptamine. ESI/MS and MS/MS analysis of metabolites from S. lividans SK-7/SL demonstrated the production of paromamine with a molecular mass of 324 [M + H]+. In this study, we report the production of paromamine in a heterologous host for the first time. This study will evoke to explore complete biosynthetic pathways of kanamycin and related aminoglycoside antibiotics.

  10. 21 CFR 524.1484b - Neomycin, isoflupredone, tetracaine, and myristyl-gamma-picolinium powder.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    .... For the treatment or as adjunctive therapy of certain ear and skin conditions caused by or associated with neomycin-susceptible organisms and/or allergy; as a superficial dressing applied to minor cuts... following ear trimming, castrating, and such surgical procedures as ovariohysterectomies. For the...

  11. 21 CFR 524.1484f - Neomycin, prednisolone, and tetracaine otic suspension.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    .... (2) Indications for use. For the treatment of acute otitis externa and, to a lesser degree, chronic otitis externa; as treatment or adjunctive therapy of certain ear conditions caused by or associated with neomycin-susceptible organisms and/or allergy. (3) Limitations. Federal law restricts this drug to use...

  12. Neomycin binding preserves extracellular matrix in bioprosthetic heart valves during in vitro cyclic fatigue and storage.

    PubMed

    Raghavan, Devanathan; Starcher, Barry C; Vyavahare, Naren R

    2009-05-01

    Bioprosthetic heart valve (BHV) cusps have a complex architecture consisting of an anisotropic arrangement of collagen, glycosaminoglycans (GAGs) and elastin. Glutaraldehyde (GLUT) is used as a fixative for all clinical BHV implants; however, it only stabilizes the collagen component of the tissue, and other components such as GAGs and elastin are lost from the tissue during processing, storage or after implantation. We have shown previously that the effectiveness of the chemical crosslinking can be increased by incorporating neomycin trisulfate, a hyaluronidase inhibitor, to prevent the enzyme-mediated GAG degradation. In the present study, we optimized carbodiimide-based GAG-targeted chemistry to incorporate neomycin into BHV cusps prior to conventional GLUT crosslinking. This crosslinking leads to enhanced preservation of GAGs during in vitro cyclic fatigue and storage. The neomycin group showed greater GAG retention after both 10 and 50 million accelerated fatigue cycles and after 1 year of storage in GLUT solution. Thus, additional binding of neomycin to the cusps prior to standard GLUT crosslinking could enhance tissue stability and thus heart valve durability.

  13. CRAC channel is inhibited by neomycin in a Ptdlns(4,5)P2-independent manner.

    PubMed

    Huang, Kun; Wang, Xuemei; Liu, Yanjun; Zhao, Yi

    2015-03-01

    Depletion of intracellular Ca(2+) stores evokes store-operated Ca(2+) entry through the Ca(2+) release-activated Ca(2+) (CRAC) channels. In this study, we found that the store-operated Ca(2+) entry was inhibited by neomycin, an aminoglycoside that strongly binds phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Patch clamp recordings revealed that neomycin blocked the CRAC currents reconstituted by co-expression of Orai1 and Stim1 in HEK293 cells. Using a rapamycin-inducible PtdIns(4,5)P2-specific phosphatase (Inp54p) system to manipulate the PtdIns(4,5)P2 in the plasma membrane, we found that the CRAC current was not altered by PtdIns(4,5)P2 depletion. This result suggests that PtdIns(4,5)P2 is not required for CRAC channel activity, and thereby, neomycin inhibits CRAC channels in a manner that is independent of neomycin-PtdIns(4,5)P2 binding.

  14. Recognition of HIV-TAR RNA using neomycin-benzimidazole conjugates.

    PubMed

    Ranjan, Nihar; Kumar, Sunil; Watkins, Derrick; Wang, Deyun; Appella, Daniel H; Arya, Dev P

    2013-10-15

    Synthesis of a novel class of compounds and their biophysical studies with TAR-RNA are presented. The synthesis of these compounds was achieved by conjugating neomycin, an aminoglycoside, with benzimidazoles modeled from a B-DNA minor groove binder, Hoechst 33258. The neomycin-benzimidazole conjugates have varying linkers that connect the benzimidazole and neomycin units. The linkers of varying length (5-23 atoms) in these conjugates contain one to three triazole units. The UV thermal denaturation experiments showed that the conjugates resulted in greater stabilization of the TAR-RNA than either neomycin or benzimidazole used in the synthesis of conjugates. These results were corroborated by the FID displacement and tat-TAR inhibition assays. The binding of ligands to the TAR-RNA is affected by the length and composition of the linker. Our results show that increasing the number of triazole groups and the linker length in these compounds have diminishing effect on the binding to TAR-RNA. Compounds that have shorter linker length and fewer triazole units in the linker displayed increased affinity towards the TAR RNA.

  15. Growth factors have a protective effect on neomycin-induced hair cell loss.

    PubMed

    Lou, Xiangxin; Yuan, Huihua; Xie, Jing; Wang, Xianliu; Yang, Liangliang; Zhang, Yanzhong

    2015-01-01

    We have demonstrated that selected growth factors are involved in regulating survival and proliferation of progenitor cells derived from the neonatal rat organ of Corti (OC). The protective and regenerative effects of these defined growth factors on the injured organ of Corti were therefore investigated. The organ of Corti dissected from the Wistar rat pups (P3-P5) was split into apical, middle, and basal parts, explanted and cultured with or without neomycin and growth factors. Insulin-like growth factor-1 (IGF-1), fibroblast growth factor-2 (FGF-2), and epidermal growth factor (EGF) protected the inner hair cells (IHCs) and outer hair cells (OHCs) from neomycin ototoxicity. Using EGF, IGF-1, and FGF-2 alone induced no protective effect on the survival of auditory hair cells. Combining 2 growth factors (EGF + IGF-1, EGF + FGF-2, or IGF-1 + FGF-2) gave statistically protective effects. Similarly, combining all three growth factors effectively protected auditory hair cells from the ototoxic insult. None of the growth factors induced regeneration of hair cells in the explants injured with neomycin. Thus various combinations of the three defined factors (IGF-1, FGF-2, and EGF) can protect the auditory hair cells from the neomycin-induced ototoxic damage, but no regeneration was seen. This offers a possible novel approach to the treatment of hearing loss.

  16. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1600a Nystatin, neomycin, thiostrepton, and triamcinolone...) For topical dermatological use: Clean affected areas and remove any encrusted discharge or exudate..., antifungal, and antibacterial treatment of superficial bacterial infections, and for dermatologic...

  17. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484c Neomycin sulfate, isoflupredone acetate, tetracaine..., following ear trimming and castrating operations. (2) In treatment of otitis externa and other inflammatory... noted, therapy with the drug should be stopped. Treatment should be limited to the period when...

  18. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  19. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  20. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  1. 21 CFR 524.1484d - Neomycin sulfate, hydrocortisone acetate, tetracaine hydrochloride ear ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ..., tetracaine hydrochloride ear ointment. 524.1484d Section 524.1484d Food and Drugs FOOD AND DRUG..., tetracaine hydrochloride ear ointment. (a) Specifications. The product contains 5 milligrams of neomycin... a lesser degree, chronic otitis externa in dogs and cats. In treatment of ear canker and...

  2. Neomycin Sulfate Improves the Antimicrobial Activity of Mupirocin-Based Antibacterial Ointments

    PubMed Central

    Blanchard, Catlyn; Brooks, Lauren; Beckley, Andrew; Colquhoun, Jennifer; Dewhurst, Stephen

    2015-01-01

    In the midst of the current antimicrobial pipeline void, alternative approaches are needed to reduce the incidence of infection and decrease reliance on last-resort antibiotics for the therapeutic intervention of bacterial pathogens. In that regard, mupirocin ointment-based decolonization and wound maintenance practices have proven effective in reducing Staphylococcus aureus transmission and mitigating invasive disease. However, the emergence of mupirocin-resistant strains has compromised the agent's efficacy, necessitating new strategies for the prevention of staphylococcal infections. Herein, we set out to improve the performance of mupirocin-based ointments. A screen of a Food and Drug Administration (FDA)-approved drug library revealed that the antibiotic neomycin sulfate potentiates the antimicrobial activity of mupirocin, whereas other library antibiotics did not. Preliminary mechanism of action studies indicate that neomycin's potentiating activity may be mediated by inhibition of the organism's RNase P function, an enzyme that is believed to participate in the tRNA processing pathway immediately upstream of the primary target of mupirocin. The improved antimicrobial activity of neomycin and mupirocin was maintained in ointment formulations and reduced S. aureus bacterial burden in murine models of nasal colonization and wound site infections. Combination therapy improved upon the effects of either agent alone and was effective in the treatment of contemporary methicillin-susceptible, methicillin-resistant, and high-level mupirocin-resistant S. aureus strains. From these perspectives, combination mupirocin-and-neomycin ointments appear to be superior to that of mupirocin alone and warrant further development. PMID:26596945

  3. 40 CFR 174.521 - Neomycin phosphotransferase II; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT...; exemption from the requirement of a tolerance. Residues of the neomycin phosphotransferase II (NPTII) enzyme are exempted from the requirement of a tolerance in all food commodities when used as a...

  4. 40 CFR 174.521 - Neomycin phosphotransferase II; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT...; exemption from the requirement of a tolerance. Residues of the neomycin phosphotransferase II (NPTII) enzyme are exempted from the requirement of a tolerance in all food commodities when used as a...

  5. 40 CFR 174.521 - Neomycin phosphotransferase II; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT...; exemption from the requirement of a tolerance. Residues of the neomycin phosphotransferase II (NPTII) enzyme are exempted from the requirement of a tolerance in all food commodities when used as a...

  6. 40 CFR 174.521 - Neomycin phosphotransferase II; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT...; exemption from the requirement of a tolerance. Residues of the neomycin phosphotransferase II (NPTII) enzyme are exempted from the requirement of a tolerance in all food commodities when used as a...

  7. The ryanodine receptor pore blocker neomycin also inhibits channel activity via a previously undescribed high-affinity Ca(2+) binding site.

    PubMed

    Laver, Derek R; Hamada, Tomoyo; Fessenden, James D; Ikemoto, Noriaki

    2007-12-01

    In this study, we present evidence for the mechanism of neomycin inhibition of skeletal ryanodine receptors (RyRs). In single-channel recordings, neomycin produced monophasic inhibition of RyR open probability and biphasic inhibition of [(3)H]ryanodine binding. The half-maximal inhibitory concentration (IC(50)) for channel blockade by neomycin was dependent on membrane potential and cytoplasmic [Ca(2+)], suggesting that neomycin acts both as a pore plug and as a competitive antagonist at a cytoplasmic Ca(2+) binding site that causes allosteric inhibition. This novel Ca(2+)/neomycin binding site had a neomycin affinity of 100 nM: and a Ca(2+) affinity of 35 nM,: which is 30-fold higher than that of the well-described cytoplasmic Ca(2+) activation site. Therefore, a new high-affinity class of Ca(2+) binding site(s) on the RyR exists that mediates neomycin inhibition. Neomycin plugging of the channel pore induced brief (1-2 ms) conductance substates at 30% of the fully open conductance, whereas allosteric inhibition caused complete channel closure with durations that depended on the neomycin concentration. We quantitatively account for these results using a dual inhibition model for neomycin that incorporates voltage-dependent pore plugging and Ca(2+)-dependent allosteric inhibition.

  8. A strategy to enhance the binding affinity of fluorophore-aptamer pairs for RNA tagging with neomycin conjugation.

    PubMed

    Jeon, Jongho; Lee, Kyung Hyun; Rao, Jianghong

    2012-10-14

    Fluorogenic sulforhodamine-neomycin conjugates have been designed and synthesized for RNA tagging. Conjugates were fluorescently activated by binding to RNA aptamers and exhibited greater than 250-400 fold enhancement in binding affinity relative to corresponding unconjugated fluorophores.

  9. Neomycin fixation followed by ethanol pretreatment leads to reduced buckling and inhibition of calcification in bioprosthetic valves.

    PubMed

    Raghavan, Devanathan; Shah, Sagar R; Vyavahare, Naren R

    2010-01-01

    Glutaraldehyde crosslinked bioprosthetic heart valves (BHVs) have two modalities of failure: degeneration (cuspal tear due to matrix failure) and calcification. They can occur independently as well as one can lead to the other causing co-existence. Calcific failure has been extensively studied before and several anti-calcification treatments have been developed; however, little research is directed to understand mechanisms of valvular degeneration. One of the shortcomings of glutaraldehyde fixation is its inability to stabilize all extracellular matrix components in the tissue. Previous studies from our lab have demonstrated that neomycin could be used as a fixative to stabilize glycosaminoglycans (GAGs) present in the valve to improve matrix properties. But neomycin fixation did not prevent cuspal calcification. In the present study, we wanted to enhance the anti-calcification potential of neomycin fixed valves by pre-treating with ethanol or removing the free aldehydes by sodium borohydride treatment. Ethanol treatment has been previously used and found to have excellent anti-calcification properties for valve cusps. Results demonstrated in this study suggest that neomycin followed by ethanol treatment effectively preserves GAGs both in vitro as well as in vivo after subdermal implantation in rats. In vivo calcification was inhibited in neomycin fixed cusps pretreated with ethanol compared to glutaraldehyde (GLUT) control. Sodium borohydride treatment by itself did not inhibit calcification nor stabilized GAGs against enzymatic degradation. Neomycin fixation followed by ethanol treatment of BHVs could prevent both modalities of failure, thereby increasing the effective durability and lifetime of these bioprostheses several fold.

  10. Transmissible Resistance to Penicillin G, Neomycin, and Chloramphenicol in Rhizobium japonicum1

    PubMed Central

    Cole, Michael A.; Elkan, Gerald H.

    1973-01-01

    The genetic basis for resistance to a number of antibiotics was examined in Rhizobium japonicum. Resistance to penicillin G, neomycin, and chloramphenicol appears to be mediated by an extrachromosomal element similar to that found in the Enterobacteriaceae. Resistance to these antibiotics was eliminated from cells by treatment with acridine orange, and resistance to all three antibiotics could be transferred en bloc to Agrobacterium tumefaciens under conditions excluding transformation or transduction as possible genetic mechanisms. PMID:4491197

  11. Inhibition of K+ currents in type I vestibular hair cells by gentamicin and neomycin.

    PubMed

    Mann, Scott E; Johnson, Matthew; Meredith, Frances L; Rennie, Katherine J

    2013-01-01

    Significant ototoxicity limits the use of aminoglycoside (AG) antibiotics. Several mechanisms may contribute to the death of both auditory and vestibular hair cells. In this study the effects of gentamicin and neomycin on K(+) currents in mature and early postnatal type I vestibular hair cells (HCI) were tested directly. The whole-cell patch clamp technique was used to assess the effects of AG and KCNQ channel modulators on K(+) currents (IK) in HCI acutely isolated from gerbil semicircular canals. Extracellular neomycin (1 mM) rapidly reduced peak outward IK by 16 ± 4% (n = 9) in mature HCI (postnatal days, P, 25-66). Gentamicin (5 mM) reduced outward IK by 16 ± 3% (n = 8). A similar reduction in outward current was seen in immature HCI (P5-9) that lacked the low-voltage-activated component of IK observed in mature cells. Intracellular application of gentamicin and neomycin also reduced IK in mature HCI. Modulators of KCNQ channels were used to probe KCNQ channel involvement. The selective KCNQ antagonist XE991 did not reduce IK and the neomycin-induced reduction in IK was not reversed by the KCNQ agonist flupirtine. Application of intracellular poly-D-lysine to sequester PIP2 did not reduce IK. Application of the K(+) channel blocker 4-aminopyridine (4-AP) strongly reduced IK, and extracellular AG in the presence of 4-AP gave no further inhibition of IK. In summary, AG significantly reduce the 4-AP-sensitive IK in early postnatal and mature HCI. K(+) current inhibition differs from that seen in outer hair cells, since it does not appear to involve PIP2 sequestration or KCNQ channels.

  12. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

    PubMed

    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

    2016-08-31

    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  13. Two-dimensional proton J-resolved NMR spectroscopy of neomycin B

    SciTech Connect

    Botto, R.E.; Coxon, B.

    1984-01-01

    The /sup 1/H NMR spectrum of a solution of neomycin B free base (Structure 1) in D/sub 2/O has been assigned completely by two-dimensional, homonuclear J-resolved NMR spectroscopy and spin decoupling at 400 MHz. Proton chemical shifts and proton-proton couplings are reported for all glycoside residues in neomycin B along with their computer simulated spectra. The /sup 4/C/sub 1/ chair conformation has been assigned to the 2,6-diamino-2,6-dideoxy-..beta..-L-idopyranosyl (ring D) portion of the antibiotic (1b) by analysis of the proton coupling constants and chemical shifts. The ..beta..-furanose form of the ribosyl portion (ring C) has been assigned. Vicinal proton couplings for the 2-deoxystreptaminyl group (ring B) are consistent with a chair conformation in which all ring substituents are equatorial, and proton chemical shift assignments are based on protonation studies. A computer simulated composite of the individual calculated spectra is presented for comparison with the experimental spectrum of neomycin B. 30 references, 5 figures, 3 tables.

  14. Neomycin inhibition of (+)-7-iso-jasmonoyl-L-isoleucine accumulation and signaling.

    PubMed

    Vadassery, Jyothilakshmi; Reichelt, Michael; Jimenez-Aleman, Guillermo H; Boland, Wilhelm; Mithöfer, Axel

    2014-07-01

    The majority of plant defenses against insect herbivores are coordinated by jasmonate (jasmonic acid, JA; (+)-7-iso-jasmonoyl-L-isoleucine, JA-Ile)-dependent signaling cascades. Insect feeding and mimicking herbivory by application of oral secretions (OS) from the insect induced both cytosolic Ca(2+) and jasmonate-phytohormone elevation in plants. Here it is shown that in Arabidopsis thaliana upon treatment with OS from lepidopteran Spodoptera littoralis larvae, the antibiotic neomycin selectively blocked the accumulation of OS-induced Ca(2+) elevation and level of the bioactive JA-Ile, in contrast to JA level. Furthermore, neomycin treatment affected the downstream expression of JA-Ile-responsive genes, VSP2 and LOX2, in Arabidopsis. The neomycin-dependent reduced JA-Ile level is partially due to increased CYP94B3 expression and subsequent JA-Ile turn-over to12-hydroxy-JA-Ile. It is neither due to the inhibition of the enzymatic conjugation process nor to substrate availability. Thus, blocking Ca(2+) elevation specifically controls JA-Ile accumulation and signaling, offering an insight into role of calcium in defense against insect herbivory.

  15. Ion-association method for the colorimetric determination of neomycin sulphate in pure and dosage forms

    NASA Astrophysics Data System (ADS)

    Amin, A. S.; Issa, Y. M.

    2003-03-01

    A simple, fairly rapid, sensitive and accurate method is described for the colorimetric determination of neomycin sulphate (NMS), based on the measurement of the absorbance of the extracted organic soluble ion-association complex formed between neomycin dictation and a bulky counter anion. Different chromotropic acid azo dyes were examined as counter ions. The effect of pH, the counter ion concentration, sequence of addition and solvents for extraction were also illustrated. The most suitable system is based on reagent VIII (pH 7.5) with chloroform as the extraction solvent. The use of other counter ions, in conjunction with their respective solvents, was found to be less sensitive. The neomycin-reagent VIII system exhibits negligible or no interference when used for the determination of up to 58 μg ml -1 of NMS in the presence of several drug excipiences. The method has been used for the determination of up to 58 μg ml -1 with a good recovery (99.8±1.5%), and the precision is supported by the low relative standard deviation ⩽1.35%. The sensitivity is discussed and the results are compared with the official method. The proposed method was applied successfully to the determination of NMS in pure and dosage forms, with a good precision and accuracy compared to the official one.

  16. Triple recognition of B-DNA by a neomycin-Hoechst 33258-pyrene conjugate.

    PubMed

    Willis, Bert; Arya, Dev P

    2010-01-26

    Recent developments have indicated that aminoglycoside binding is not limited to RNA, but to nucleic acids that, like RNA, adopt conformations similar to its A-form. We further sought to expand the utility of aminoglycoside binding to B-DNA structures by conjugating neomycin, an aminoglycoside antibiotic, with the B-DNA minor groove binding ligand Hoechst 33258. Envisioning a dual groove binding mode, we have extended the potential recognition process to include a third, intercalative moiety. Similar conjugates, which vary in the number of binding moieties but maintain identical linkages to allow direct comparisons to be made, have also been prepared. We report herein novel neomycin- and Hoechst 33258-based conjugates developed in our laboratories for exploring the recognition potential with B-DNA. Spectroscopic studies such as UV melting, differential scanning calorimetry, isothermal fluorescence titrations, and circular dichroism together illustrate the triple recognition of the novel conjugate containing neomycin, Hoechst 33258, and pyrene. This study represents the first example of DNA molecular recognition capable of minor versus major groove recognition in conjunction with intercalation.

  17. Follicular contact dermatitis revisited: A review emphasizing neomycin-associated follicular contact dermatitis

    PubMed Central

    Cohen, Philip R

    2014-01-01

    Follicular contact dermatitis clinically presents as individual papules that include a central hair follicle. Pathologic features involve the follicle and the surrounding dermis: spongiosis and vesicle formation of the follicular epithelium associated with perifollicular and perivascular lymphocytic inflammation. Using the PubMed database, an extensive literature search was performed on follicular contact dermatitis and neomycin. Relevant papers were reviewed and the clinical and pathologic features, the associated chemicals (including a more detailed description of neomycin), the hypothesized pathogenesis, and the management of follicular contact dermatitis were described. Several agents-either as allergens or irritants-have been reported to elicit follicular contact dermatitis. Several hypotheses have been suggested for the selective involvement of the follicles in follicular contact dermatitis: patient allergenicity, characteristics of the agent, vehicle containing the agent, application of the agent, and external factors. The differential diagnosis of follicular contact dermatitis includes not only recurrent infundibulofolliculitis, but also drug eruption, mite infestation, viral infection, and dermatoses that affect hair follicles. The primary therapeutic intervention for follicular contact dermatitis is withdrawal of the causative agent; treatment with a topical corticosteroid preparation may also promote resolution of the dermatitis. In conclusion, follicular contact dermatitis may be secondary to allergens or irritants; topical antibiotics, including neomycin, may cause this condition. Several factors may account for the selective involvement of the hair follicle in this condition. Treatment of the dermatitis requires withdrawal of the associated topical agent; in addition, topical corticosteroids may be helpful to promote resolution of lesions. PMID:25516854

  18. Osteoblasts detect pericellular calcium concentration increase via neomycin-sensitive voltage gated calcium channels.

    PubMed

    Sun, Xuanhao; Kishore, Vipuil; Fites, Kateri; Akkus, Ozan

    2012-11-01

    The mechanisms underlying the detection of critically loaded or micro-damaged regions of bone by bone cells are still a matter of debate. Our previous studies showed that calcium efflux originates from pre-failure regions of bone matrix and MC3T3-E1 osteoblasts respond to such efflux by an increase in the intracellular calcium concentration. The mechanisms by which the intracellular calcium concentration increases in response to an increase in the pericellular calcium concentration are unknown. Elevation of the intracellular calcium may occur via release from the internal calcium stores of the cell and/or via the membrane bound channels. The current study applied a wide range of pharmaceutical inhibitors to identify the calcium entry pathways involved in the process: internal calcium release from endoplasmic reticulum (ER, inhibited by thapsigargin and TMB-8), calcium receptor (CaSR, inhibited by calhex), stretch-activated calcium channel (SACC, inhibited by gadolinium), voltage-gated calcium channels (VGCC, inhibited by nifedipine, verapamil, neomycin, and ω-conotoxin), and calcium-induced-calcium-release channel (CICRC, inhibited by ryanodine and dantrolene). These inhibitors were screened for their effectiveness to block intracellular calcium increase by using a concentration gradient induced calcium efflux model which mimics calcium diffusion from the basal aspect of cells. The inhibitor(s) which reduced the intracellular calcium response was further tested on osteoblasts seeded on mechanically loaded notched cortical bone wafers undergoing damage. The results showed that only neomycin reduced the intracellular calcium response in osteoblasts, by 27%, upon extracellular calcium stimulus induced by concentration gradient. The inhibitory effect of neomycin was more pronounced (75% reduction in maximum fluorescence) for osteoblasts seeded on notched cortical bone wafers loaded mechanically to damaging load levels. These results imply that the increase in

  19. Determination of neomycin sulfate and impurities using high-performance anion-exchange chromatography with integrated pulsed amperometric detection.

    PubMed

    Hanko, Valoran P; Rohrer, Jeffrey S

    2007-01-01

    Neomycin B is one of a class of aminoglycoside antibiotics that lack a good chromophore, and is therefore difficult to determine using reversed-phase HPLC with absorbance detection. This is especially true for determining the quantity of each impurity. We show that neomycin sulfate and its major impurities, including neamine (neomycin A), can be separated on a strong anion-exchange column using a weak potassium hydroxide eluent (2.40 mM) at a column temperature of 30 degrees C, and directly detected by integrated pulsed amperometric detection (IPAD). The resolution (United States Pharmacopeia (USP) definition) between neomycin B and the closest major impurity ranged from 6.56 and 7.45 over 10 days of consecutive analysis (7.24+/-0.10, n=836 injections). Due to the difficulty of producing weak hydroxide eluents of the required purity (i.e. carbonate-free), this method depends on automatic eluent generation to ensure method ruggedness. This method exhibited good long-term (10 days, 822 injections) retention time stability with a R.S.D. of 0.6%. Peak area R.S.D. (10 microM) was 1.3%. Method robustness was evaluated by intentionally varying the flow rate, eluent concentration, column temperature, and column. The spike recoveries of neomycin B from extractions of three different topical ointments and cream formulations ranged from 95 to 100%. The measured concentration of neomycin B in these formulations ranged from 119 to 154% of the label concentration. The R.S.D. for the measured concentration of one of the formulations tested over three separate days, n=11 extracts, was 3.2%. Based on the results of these evaluations, we believe this method can be used for neomycin sulfate identity, assay, and purity.

  20. Effect of Mutations on the Binding of Kanamycin-B to RNA Hairpins Derived from the Mycobacterium tuberculosis Ribosomal A-Site.

    PubMed

    Truitt, Amber R; Choi, Bok-Eum; Li, Jenny; Soto, Ana Maria

    2015-12-29

    Kanamycin is an aminoglycoside antibiotic used in the treatment of drug-resistant tuberculosis. Mutations at the rRNA A-site have been associated with kanamycin resistance in Mycobacterium tuberculosis clinical isolates. Understanding the effect of these mutations on the conformation of the M. tuberculosis A-site is critical for understanding the mechanisms of antibiotic resistance in M. tuberculosis. In this work, we have studied RNA hairpins derived from the M. tuberculosis A-site, the wild type and three mutants at the following positions (M. tuberculosis/Escherichia coli numbering): A1400/1408 → G, C1401/1409 → U, and the double mutant G1483/1491 C1401/1409 → UA. Specifically, we used circular dichroism, ultraviolet spectroscopy, and fluorescence spectroscopy to characterize the conformation, stability, and binding affinity of kanamycin-B and other aminoglycoside antibiotics for these RNA hairpins. Our results show that the mutations affect the conformation of the decoding site, with the mutations at position 1401/1409 resulting in significant destabilizations. Interestingly, the mutants bind paromomycin with weaker affinity than the wild type, but they bind kanamycin-B with similar affinity than the wild type. The results suggest that the presence of mutations does not prevent kanamycin-B from binding. Instead, kanamycin may promote different interactions with a third partner in the mutants compared to the wild type. Furthermore, our results with longer and shorter hairpins suggest that the region of the A-site that varies among organisms may have modulating effects on the binding and interactions of the A-site. PMID:26560864

  1. In vitro evaluation of the synergistic activity of neomycin-polymyxin B association against pathogens responsible for otitis externa.

    PubMed

    Tempera, G; Mangiafico, A; Genovese, C; Giudice, E; Mastrojeni, S; Nicolosi, D; Ferneri, P M

    2009-01-01

    The most recent guidelines recommend, for otitis externa antibiotic therapy, the use of topical formulations in that they are very safe, have a quicker effect and do not induce bacterial resistance compared to systemic therapy. The choice of the class of antibiotics in empiric therapy of otitis externa must take into consideration the polymicrobic nature of the infection that includes both bacteria (Grampositive and Gram-negative) and mycetes. For this reason, in this study we evaluated the synergic activity of neomycin in association with polymyxin B against the pathogens commonly responsible for otitis externa, compared to that of a single antibiotic (ciprofloxacin). The polymyxinB/neomycin association shows clear synergic effects with values of both Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) reduced by 3-4 times with respect to the single antibiotic; and in P. aeruginosa the synergistic effect of the neomycin/polymyxin B association with respect to neomycin was more evident (5-6 times), with an intrinsic in vitro activity constantly higher than that of ciprofloxacin alone or in association with hydrocortisone. From the analysis of the data obtained in vitro, we can conclude that the possibility of using a topical formulation containing a synergistic association of antibiotics, such as neomycin-polymyxin B, in such a way as to obtain the maximum effect in the minimum time with an increase in the spectrum of action of non-bacterial pathogens, is an optimal choice for the clinician for the empiric therapy of otitis externa.

  2. Inhibition by lithium of neomycin-induced release of N-acetyl-beta-glucosaminidase in the rat heart.

    PubMed

    Dehpour, A R; Samini, M; Ghafourifar, P; Kyani, H

    1995-03-01

    The effects of neomycin, lithium and concurrent therapy of these drugs on subcellular distribution of lysosomal enzyme, N-acetyl-beta-glucosaminidase (NAG) in the heart was studied. Released activity of NAG was used as a marker for assessing myocardial lysosomal integrity. The activity of NAG was determined in non-sedimentable and sedimentable fractions after centrifugation of the tissue extracted for assessment of the subcellular distribution of the lysosomal enzyme. Daily intraperitoneal injection of 100 mg/kg/day of neomycin increased the ratio of the non-sedimentable activity (free) to the non-sedimentable plus sedimentable activities (total) of NAG. Daily intraperitoneal injection of lithium decreased the total activity of NAG but did not affect the ratio of free: total activities of the enzyme. Lithium in doses of 2 and 4 mM/kg/day one hour prior to neomycin reduced the neomycin-induced enhancement of the ratio of free: total activity of NAG. Neomycin like other aminoglycosides altered the acidic phospholipid metabolism in lysosomal membranes and/or impairment of some important lysosomal functions. In this regard, the protective effects of lithium may be due to interference of this ion with phosphoinositide cycle. PMID:7617546

  3. Auditory thresholds and kanamycin-induced hearing loss in the guinea pig assessed by a positive reinforcement procedure.

    PubMed

    Prosen, C A; Petersen, M R; Moody, D B; Stebbins, W C

    1978-02-01

    Absolute thresholds from 125 Hz to 52 kHz are determined for six guinea pigs trained by a positive reinforcement method. Four to five hundred trials were conducted during daily testing sessions and little between- or within-subject variability was found. Two of the six animals were subsequently treated with kanamycin and the development of a hearing loss for the high frequencies was followed. Loss of outer and to a lesser extent inner hair cells was well correlated with the threshold shift observed. Contrary to the experience of previous investigators, this operant training procedure has proved as efficient as that for other species of experimental animals, such as the monkey and the chinchilla. It holds excellent promise for future auditory behavioral work with the guinea pig.

  4. Characterization of the transition-state structure of the reaction of kanamycin nucleotidyltransferase by heavy-atom kinetic isotope effects.

    PubMed

    Gerratana, B; Frey, P A; Cleland, W W

    2001-03-01

    The transition-state structure for the reaction catalyzed by kanamycin nucleotidyltransferase has been determined from kinetic isotope effects. The primary (18)O isotope effects at pH 5.7 (close to the optimum pH) and at pH 7.7 (away from the optimum pH) are respectively 1.016 +/- 0.003 and 1.014 +/- 0.002. Secondary (18)O isotope effects of 1.0033 +/- 0.0004 and 1.0024 +/- 0.0002 for both nonbridge oxygen atoms were measured respectively at pH 5.7 and 7.7. These isotope effects are consistent with a concerted reaction with a slightly associative transition-state structure.

  5. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.

    PubMed

    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian

    2015-06-01

    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance. PMID:25940639

  6. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.

    PubMed

    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian

    2015-06-01

    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance.

  7. Synthesis and spectroscopic studies of the aminoglycoside (neomycin)--perylene conjugate binding to human telomeric DNA.

    PubMed

    Xue, Liang; Ranjan, Nihar; Arya, Dev P

    2011-04-12

    Synthesis of a novel perylene-neomycin conjugate (3) and the properties of its binding to human telomeric G-quadruplex DNA, 5'-d[AG3(T2AG3)3] (4), are reported. Various spectroscopic techniques were employed to characterize the binding of conjugate 3 to 4. A competition dialysis assay revealed that 3 preferentially binds to 4, in the presence of other nucleic acids, including DNA, RNA, DNA-RNA hybrids, and other higher-order structures (single strands, duplexes, triplexes, other G-quadruplexes, and the i-motif). UV thermal denaturation studies showed that thermal stabilization of 4 increases as a function of the increasing concentration of 3. The fluorescence intercalator displacement (FID) assay displayed a significantly tighter binding of 3 with 4 as compared to its parent constituents [220-fold stronger than neomycin (1) and 4.5-fold stronger than perylene diamine (2), respectively]. The binding of 3 with 4 resulted in pronounced changes in the molar ellipticity of the DNA absorption region as confirmed by circular dichroism. The UV-vis absorption studies of the binding of 3 to 4 resulted in a red shift in the spectrum of 3 as well as a marked hypochromic change in the perylene absorption region, suggesting that the ligand-quadruplex interaction involves stacking of the perylene moiety. Docking studies suggest that the perylene moiety serves as a bridge that end stacks on 4, making contacts with two thymine bases in the loop, while the two neomycin moieties branch into the grooves of 4.

  8. Characterization of RbmD (glycosyltransferase in ribostamycin gene cluster) through neomycin production reconstituted from the engineered Streptomyces fradiae BS1.

    PubMed

    Nepal, Keshav Kumar; Oh, Tae-Jin; Subba, Bimala; Yoo, Jin Cheol; Sohng, Jae Kyung

    2009-01-31

    Amino acid homology analysis predicted that rbmD, a putative glycosyltransferase from Streptomyces ribosidificus ATCC 21294, has the highest homology with neoD in neomycin biosynthesis. S. fradiae BS1, in which the production of neomycin was abolished, was generated by disruption of the neoD gene in the neomycin producer S. fradiae. The restoration of neomycin by self complementation suggested that there was no polar effect in the mutant. In addition, S. fradiae BS6 was created with complementation by rbmD in S. fradiae BS1, and secondary metabolite analysis by ESI/MS, LC/MS and MS/MS showed the restoration of neomycin production in S. fradiae BS6. These gene inactivation and complementation studies suggested that, like neoD, rbmD functions as a 2-N-acetlyglucosaminyltransferase and demonstrated the potential for the generation of novel aminoglycoside antibiotics using glycosyltransferases in vivo.

  9. Determination of neomycin and related substances in pharmaceutical preparations by reversed-phase high performance liquid chromatography with mass spectrometry and charged aerosol detection.

    PubMed

    Stypulkowska, K; Blazewicz, A; Fijalek, Z; Warowna-Grzeskiewicz, M; Srebrzynska, K

    2013-03-25

    A new, simple and repeatable liquid chromatographic method with charged aerosol detection (LC-CAD) for determination of neomycin and related substances has been developed. Analysis of neomycin or other aminoglycosides is problematic due to a lack of chromophores. Universal response of CAD enables direct quantification of neomycin and related substances, for which no reference standard are available. Separation was performed on C18 Hypersil(®) Gold aQ column using water, methanol and heptaflurobutyric acid as mobile phase. Under developed chromatographic conditions all impurities were well separated from neomycin B. Peaks identification was evaluated by electrospray ionization mass spectrometry. The proposed method was validated according to ICH guidelines and applied to the content determination of neomycin and related substances in pharmaceutical preparations.

  10. Sodium Selenite Acts as an Otoprotectant against Neomycin-Induced Hair Cell Damage in a Zebrafish Model

    PubMed Central

    Chang, Jiwon; Choi, June; Rah, Yoon Chan; Yoo, Myung Hoon; Oh, Kyoung Ho; Im, Gi Jung; Lee, Seung Hoon; Kwon, Soon Young; Park, Hae-Chul; Chae, Sung Won; Jung, Hak Hyun

    2016-01-01

    Sodium selenite is a trace element essential for many physiological functions in the body. It is involved in various biological processes; it acts as a cofactor for antioxidant enzymes that protect against free radicals and is reported to limit metal-mediated oxidative DNA damage. In the present study, we investigated the effect of sodium selenite on neomycin ototoxicity in wild-type and transgenic zebrafish (Brn3C: EGFP). Five or six days post-fertilization, zebrafish larvae were co-exposed to 125 μM neomycin and various concentrations (10 μM, 100 μM, 250 μM, and 500 μM) of sodium selenite for 1 h. Hair cells within neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed by fluorescence microscopy (n = 10 fish per treatment). Hair cell survival was estimated as the ratio of the hair cell numbers in each group compared to those of the control group that were not exposed to neomycin. Apoptosis and hair cell damage of neuromasts were evaluated using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridinium iodide (DASPEI) assay, respectively. Ultrastructural changes were evaluated using scanning electron microscopy and transmission electron microscopy. Neuromast hair cells were preserved in zebrafish exposed to 125 μM neomycin and 500 μM sodium selenite for 1 h. Sodium selenite protected against neomycin-induced hair cell loss of neuromasts, reduced apoptosis, and prevented zebrafish ultrastructural changes. We propose that sodium selenite protects against neomycin-induced hair cell damage by inhibiting apoptosis, decreasing the disarray of stereocilia, and preventing ultrastructural changes in the neuromast hair cells of the zebrafish. PMID:26974429

  11. Sodium Selenite Acts as an Otoprotectant against Neomycin-Induced Hair Cell Damage in a Zebrafish Model.

    PubMed

    Chang, Jiwon; Choi, June; Rah, Yoon Chan; Yoo, Myung Hoon; Oh, Kyoung Ho; Im, Gi Jung; Lee, Seung Hoon; Kwon, Soon Young; Park, Hae-Chul; Chae, Sung Won; Jung, Hak Hyun

    2016-01-01

    Sodium selenite is a trace element essential for many physiological functions in the body. It is involved in various biological processes; it acts as a cofactor for antioxidant enzymes that protect against free radicals and is reported to limit metal-mediated oxidative DNA damage. In the present study, we investigated the effect of sodium selenite on neomycin ototoxicity in wild-type and transgenic zebrafish (Brn3C: EGFP). Five or six days post-fertilization, zebrafish larvae were co-exposed to 125 μM neomycin and various concentrations (10 μM, 100 μM, 250 μM, and 500 μM) of sodium selenite for 1 h. Hair cells within neuromasts of the supraorbital (SO1 and SO2), otic (O1), and occipital (OC1) lateral lines were analyzed by fluorescence microscopy (n = 10 fish per treatment). Hair cell survival was estimated as the ratio of the hair cell numbers in each group compared to those of the control group that were not exposed to neomycin. Apoptosis and hair cell damage of neuromasts were evaluated using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) assay and 2-[4-(dimethylamino) styryl]-N-ethylpyridinium iodide (DASPEI) assay, respectively. Ultrastructural changes were evaluated using scanning electron microscopy and transmission electron microscopy. Neuromast hair cells were preserved in zebrafish exposed to 125 μM neomycin and 500 μM sodium selenite for 1 h. Sodium selenite protected against neomycin-induced hair cell loss of neuromasts, reduced apoptosis, and prevented zebrafish ultrastructural changes. We propose that sodium selenite protects against neomycin-induced hair cell damage by inhibiting apoptosis, decreasing the disarray of stereocilia, and preventing ultrastructural changes in the neuromast hair cells of the zebrafish.

  12. Inhibition of the activation and recruitment of microglia-like cells protects against neomycin-induced ototoxicity.

    PubMed

    Sun, Shan; Yu, Huiqian; Yu, Hui; Honglin, Mei; Ni, Wenli; Zhang, Yanping; Guo, Luo; He, Yingzi; Xue, Zhen; Ni, Yusu; Li, Jin; Feng, Yi; Chen, Yan; Shao, Ruijin; Chai, Renjie; Li, Huawei

    2015-02-01

    One of the most unfortunate side effects of aminoglycoside (AG) antibiotics such as neomycin is that they target sensory hair cells (HCs) and can cause permanent hearing impairment. We have observed HC loss and microglia-like cell (MLC) activation in the inner ear (cochlea) following neomycin administration. We focused on CX3CL1, a membrane-bound glycoprotein expressed on neurons and endothelial cells, as a way to understand how the MLCs are activated and the role these cells play in HC loss. CX3CL1 is the exclusive ligand for CX3CR1, which is a chemokine receptor expressed on the surface of macrophages and MLCs. In vitro experiments showed that the expression levels of CX3CL1 and CX3CR1 increased in the cochlea upon neomycin treatment, and CX3CL1 was expressed on HCs, while CX3CR1 was expressed on MLCs. When cultured with 1 μg/mL exogenous CX3CL1, MLCs were activated by CX3CL1, and the cytokine level was increased in the cochleae leading to apoptosis in the HCs. In CX3CR1 knockout mice, a significantly greater number of cochlear HCs survived than in wild-type mice when the cochlear explants were cultured with neomycin in vitro. Furthermore, inhibiting the activation of MLCs with minocycline reduced the neomycin-induced HC loss and improved the hearing function in neomycin-treated mice in vivo. Our results demonstrate that CX3CL1-induced MLC activation plays an important role in the induction of HC death and provide evidence for CX3CL1 and CX3CR1 as promising new therapeutic targets for the prevention of hearing loss.

  13. Growth of soil bacteria, on penicillin and neomycin, not previously exposed to these antibiotics.

    PubMed

    Zhang, Qichun; Dick, Warren A

    2014-09-15

    There is growing evidence that bacteria, in the natural environment (e.g. the soil), can exhibit naturally occurring resistance/degradation against synthetic antibiotics. Our aim was to assess whether soils, not previously exposed to synthetic antibiotics, contained bacterial strains that were not only antibiotic resistant, but could actually utilize the antibiotics for energy and nutrients. We isolated 19 bacteria from four diverse soils that had the capability of growing on penicillin and neomycin as sole carbon sources up to concentrations of 1000 mg L(-1). The 19 bacterial isolates represent a diverse set of species in the phyla Proteobacteria (84%) and Bacteroidetes (16%). Nine antibiotic resistant genes were detected in the four soils but some of these genes (i.e. tetM, ermB, and sulI) were not detected in the soil isolates indicating the presence of unculturable antibiotic resistant bacteria. Most isolates that could subsist on penicillin or neomycin as sole carbon sources were also resistant to the presence of these two antibiotics and six other antibiotics at concentrations of either 20 or 1000 mg L(-1). The potentially large and diverse pool of antibiotic resistant and degradation genes implies ecological and health impacts yet to be explored and fully understood. PMID:24956077

  14. Growth of soil bacteria, on penicillin and neomycin, not previously exposed to these antibiotics.

    PubMed

    Zhang, Qichun; Dick, Warren A

    2014-09-15

    There is growing evidence that bacteria, in the natural environment (e.g. the soil), can exhibit naturally occurring resistance/degradation against synthetic antibiotics. Our aim was to assess whether soils, not previously exposed to synthetic antibiotics, contained bacterial strains that were not only antibiotic resistant, but could actually utilize the antibiotics for energy and nutrients. We isolated 19 bacteria from four diverse soils that had the capability of growing on penicillin and neomycin as sole carbon sources up to concentrations of 1000 mg L(-1). The 19 bacterial isolates represent a diverse set of species in the phyla Proteobacteria (84%) and Bacteroidetes (16%). Nine antibiotic resistant genes were detected in the four soils but some of these genes (i.e. tetM, ermB, and sulI) were not detected in the soil isolates indicating the presence of unculturable antibiotic resistant bacteria. Most isolates that could subsist on penicillin or neomycin as sole carbon sources were also resistant to the presence of these two antibiotics and six other antibiotics at concentrations of either 20 or 1000 mg L(-1). The potentially large and diverse pool of antibiotic resistant and degradation genes implies ecological and health impacts yet to be explored and fully understood.

  15. A novel inducible protein production system and neomycin resistance as selection marker for Methanosarcina mazei.

    PubMed

    Mondorf, Sebastian; Deppenmeier, Uwe; Welte, Cornelia

    2012-01-01

    Methanosarcina mazei is one of the model organisms for the methanogenic order Methanosarcinales whose metabolism has been studied in detail. However, the genetic toolbox is still limited. This study was aimed at widening the scope of utilizable methods in this group of organisms. (i) Proteins specific to methanogens are oftentimes difficult to produce in E. coli. However, a protein production system is not available for methanogens. Here we present an inducible system to produce Strep-tagged proteins in Ms. mazei. The promoter p1687, which directs the transcription of methyl transferases that demethylate methylamines, was cloned into plasmid pWM321 and its activity was determined by monitoring β-glucuronidase production. The promoter was inactive during growth on methanol but was rapidly activated when trimethylamine was added to the medium. The gene encoding the β-glucuronidase from E. coli was fused to a Strep-tag and was cloned downstream of the p1687 promoter. The protein was overproduced in Ms. mazei and was purified in an active form by affinity chromatography. (ii) Puromycin is currently the only antibiotic used as a selectable marker in Ms. mazei and its relatives. We established neomycin resistance as a second selectable marker by designing a plasmid that confers neomycin resistance in Ms. mazei.

  16. Neomycin enhances extracellular matrix stability of glutaraldehyde crosslinked bioprosthetic heart valves.

    PubMed

    Friebe, Vincent M; Mikulis, Brandon; Kole, Sourav; Ruffing, Christy S; Sacks, Michael S; Vyavahare, Naren R

    2011-11-01

    Glutaraldehyde (GLUT) crosslinked porcine aortic heart valves are continued to be extensively used in heart valve replacement surgeries. GLUT does not crosslink glycosaminoglycans in the tissue and we have demonstrated that GAG loss is associated with tissue degeneration. In this study, we examined the ability of neomycin to enhance GLUT crosslinking to stabilize GAGs, as well as provide evidence of improved functional integrity. Neomycin enhanced GLUT crosslinked (NG) leaflets exposed to collagenase and elastase enzymes exhibited an increased resistance to proteolytic degradation. Furthermore, NG leaflets exhibited small but significant increases in collagen denaturation temperatures when compared to that of standard GLUT crosslinked BHVs. NG leaflets subjected to storage, accelerated cyclic fatigue, and in vitro enzyme mediated GAG degradation revealed improved GAG stabilization versus standard GLUT crosslinked valves, which sustained substantial decreases in GAG content. Ultrastructural analysis using transmission electron microscopy qualitatively confirmed NG leaflets preserved GAGs after enzymatic degradation. Biomechanical analyses demonstrated that NG leaflets were functionally similar to GLUT tissues but were slightly stiffer under both planar biaxial tension and under flexure. Interestingly, after GAGase treatment, GLUT tissues showed increased areal compliance and reduced hysteresis, while NG leaflets were unchanged. Collectively, NG cross-linking functionally insulated the tissue from GAG digestion, and imparted modest additional matrix stiffness but maintained tissue hysteresis properties.

  17. Identification of nuclear phosphatidylinositol 4,5-bisphosphate-interacting proteins by neomycin extraction.

    PubMed

    Lewis, Aurélia E; Sommer, Lilly; Arntzen, Magnus Ø; Strahm, Yvan; Morrice, Nicholas A; Divecha, Nullin; D'Santos, Clive S

    2011-02-01

    Considerable insight into phosphoinositide-regulated cytoplasmic functions has been gained by identifying phosphoinositide-effector proteins. Phosphoinositide-regulated nuclear functions however are fewer and less clear. To address this, we established a proteomic method based on neomycin extraction of intact nuclei to enrich for nuclear phosphoinositide-effector proteins. We identified 168 proteins harboring phosphoinositide-binding domains. Although the vast majority of these contained lysine/arginine-rich patches with the following motif, K/R-(X(n= 3-7)-K-X-K/R-K/R, we also identified a smaller subset of known phosphoinositide-binding proteins containing pleckstrin homology or plant homeodomain modules. Proteins with no prior history of phosphoinositide interaction were identified, some of which have functional roles in RNA splicing and processing and chromatin assembly. The remaining proteins represent potentially other novel nuclear phosphoinositide-effector proteins and as such strengthen our appreciation of phosphoinositide-regulated nuclear functions. DNA topology was exemplar among these: Biochemical assays validated our proteomic data supporting a direct interaction between phosphatidylinositol 4,5-bisphosphate and DNA Topoisomerase IIα. In addition, a subset of neomycin extracted proteins were further validated as phosphatidyl 4,5-bisphosphate-interacting proteins by quantitative lipid pull downs. In summary, data sets such as this serve as a resource for a global view of phosphoinositide-regulated nuclear functions.

  18. Actions of neomycin on electrical light responses, Ca2+ release, and intracellular Ca2+ changes in photoreceptors of the honeybee drone.

    PubMed

    Walz, B; Ukhanov, K; Zimmermann, B

    2000-11-01

    Neomycin, known to inhibit phospholipase C-mediated IP3 formation, was applied in the bath or injected into cells and its effects on electrical light responses were analyzed. Neomycin effects on inositol 1,4,5-trisphosphate- and Ca2+-induced Ca2+ release from the endoplasmic reticulum and/or the light-induced Ca2+ elevation were also studied. Neomycin (0.5 mmol x l(-1)) blocked inositol 1,4,5-trisphosphate-, caffeine-, and Ca2+-induced Ca2+ release. Bath application of neomycin decreased the sensitivity to 20-ms light flashes by a factor of up to 100 and slowed the kinetics of dim flash responses. Intracellularly injected neomycin desensitized the photoreceptors more than 1 log unit, increased the latency, and slowed the rate of rise of the light response. Neomycin (0.5 mmol x l(-1)) in the bath delayed and reduced the transient component of responses to 1-s steps of light at intermediate intensities. It also decreased and slowed the light-induced, and it blocked the caffeine-induced intracellular Ca2+ elevation. The combined pharmacological effects of neomycin are suggested to decrease the Ca2+-mediated amplification of the phototransduction cascade and the Ca2+-mediated acceleration of processes determining the kinetics of light responses.

  19. Actions of neomycin on electrical light responses, Ca2+ release, and intracellular Ca2+ changes in photoreceptors of the honeybee drone.

    PubMed

    Walz, B; Ukhanov, K; Zimmermann, B

    2000-11-01

    Neomycin, known to inhibit phospholipase C-mediated IP3 formation, was applied in the bath or injected into cells and its effects on electrical light responses were analyzed. Neomycin effects on inositol 1,4,5-trisphosphate- and Ca2+-induced Ca2+ release from the endoplasmic reticulum and/or the light-induced Ca2+ elevation were also studied. Neomycin (0.5 mmol x l(-1)) blocked inositol 1,4,5-trisphosphate-, caffeine-, and Ca2+-induced Ca2+ release. Bath application of neomycin decreased the sensitivity to 20-ms light flashes by a factor of up to 100 and slowed the kinetics of dim flash responses. Intracellularly injected neomycin desensitized the photoreceptors more than 1 log unit, increased the latency, and slowed the rate of rise of the light response. Neomycin (0.5 mmol x l(-1)) in the bath delayed and reduced the transient component of responses to 1-s steps of light at intermediate intensities. It also decreased and slowed the light-induced, and it blocked the caffeine-induced intracellular Ca2+ elevation. The combined pharmacological effects of neomycin are suggested to decrease the Ca2+-mediated amplification of the phototransduction cascade and the Ca2+-mediated acceleration of processes determining the kinetics of light responses. PMID:11195278

  20. Computer-based design of novel HIV-1 entry inhibitors: neomycin conjugated to arginine peptides at two specific sites.

    PubMed

    Berchanski, Alexander; Lapidot, Aviva

    2009-03-01

    Aminoglycoside-arginine conjugates (AAC and APAC) are multi-target inhibitors of human immunodeficiency virus type-1 (HIV-1). Here, we predict new conjugates of neomycin with two arginine peptide chains binding at specific sites on neomycin [poly-arginine-neomycin-poly-arginine (PA-Neo-PA)]. The rationale for the design of such compounds is to separate two short arginine peptides with neomycin, which may extend the binding region of the CXC chemokine receptor type 4 (CXCR4). We used homology models of CXCR4 and unliganded envelope glycoprotein 120 (HIV-1(IIIB) gp120) and docked PA-Neo-PAs and APACs to these using a multistep docking procedure. The results indicate that PA-Neo-PAs spread over two negatively charged patches of CXCR4. PA-Neo-PA-CXCR4 complexes are energetically more favorable than AACs/APAC-CXCR4 complexes. Notably, our CXCR4 model and docking procedure can be applied to predict new compounds that are either inhibitors of gp120-CXCR4 binding without affecting stromal cell-derived factor 1 alpha (SDF-1 alpha) chemotaxis activity, or inhibitors of SDF-1 alpha-CXCR4 binding resulting in an anti-metastasis effect. We also predict that PA-Neo-PAs and APACs can interfere with CD4-gp120 binding in unliganded conformation.

  1. Optimization of Medium Composition for the Production of Neomycin by Streptomyces fradiae NCIM 2418 in Solid State Fermentation

    PubMed Central

    Vastrad, B. M.; Neelagund, S. E.

    2014-01-01

    Neomycin production of Streptomyces fradiae NCIM 2418 was optimized by using response surface methodology (RSM), which is powerful mathematical approach comprehensively applied in the optimization of solid state fermentation processes. In the first step of optimization, with Placket-Burman design, ammonium chloride, sodium nitrate, L-histidine, and ammonium nitrate were established to be the crucial nutritional factors affecting neomycin production significantly. In the second step, a 24 full factorial central composite design and RSM were applied to determine the optimal concentration of significant variable. A second-order polynomial was determined by the multiple regression analysis of the experimental data. The optimum values for the important nutrients for the maximum were obtained as follows: ammonium chloride 2.00%, sodium nitrate 1.50%, L-histidine 0.250%, and ammonium nitrate 0.250% with a predicted value of maximum neomycin production of 20,000 g kg−1 dry coconut oil cake. Under the optimal condition, the practical neomycin production was 19,642 g kg−1 dry coconut oil cake. The determination coefficient (R2) was 0.9232, which ensures an acceptable admissibility of the model. PMID:25009746

  2. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND... milligrams of neomycin, and 10,000 units of polymyxin B sulfate. (b) Conditions of use. Dogs and Cats—(1... superficial bacterial infections of the eyelid and conjunctiva of dogs and cats when due to...

  3. 21 CFR 524.154 - Bacitracin or bacitracin zinc-neomycin sulfate-polymyxin B sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND... milligrams of neomycin, and 10,000 units of polymyxin B sulfate. (b) Conditions of use. Dogs and Cats—(1... superficial bacterial infections of the eyelid and conjunctiva of dogs and cats when due to...

  4. Impact of environmental stress desiccation, acidity, alkalinity, heat or cold on antibiotic susceptibility of Cronobacter sakazakii.

    PubMed

    Al-Nabulsi, Anas A; Osaili, Tareq M; Elabedeen, Noor A Zain; Jaradat, Ziad W; Shaker, Reyad R; Kheirallah, Khalid A; Tarazi, Yaser H; Holley, Richard A

    2011-03-30

    Cronobacter sakazakii is an emerging foodborne pathogen that has been implicated in severe forms of meningitis, septicemia or necrotizing colitis in pre-term neonates. Although illness outbreaks (primarily associated with powdered infant formula, PIF) caused by this pathogen are rare, the case-fatality rate may reach 50%. Successful treatment of C. sakazakii infection is reliant upon clinical use of antibiotics (AB) such as ampicillin. Recent reports showed increased resistance of C. sakazakii to broad-spectrum antibiotics. The objective of this study was to evaluate the effect of extreme pH (3.5 for 30 min or 11.25 for 5 min), cold (4°C for 24h), heat (55°C for 5 min), and desiccation (cells were dried at 40°C for 2h and held at 21°C for 4 d) stresses on susceptibility of five isolated strains of C. sakazakii to streptomycin, gentamicin, kanamycin, neomycin, tetracycline, doxycycline, tilmicosin, florfenicol, ampicillin, amoxicillin, vancomycin, ciprofloxacin and enrofloxacin. All unstressed strains of C. sakazakii were sensitive to streptomycin, gentamycin, kanamycin, ciprofloxacin, enrofloxacin, ampicillin and amoxicillin, but were moderately resistant or resistant to the rest. Exposing cells to alkaline or acidic stress did not change their sensitivity toward streptomycin, gentamycin, kanamycin or ciprofloxacin, but their resistance toward the other AB was increased. Cells stressed by desiccation showed increased sensitivity toward streptomycin, gentamicin, kanamycin, ciprofloxacin, enrofloxacin, ampicillin and doxycycline, but showed resistance toward the others. Cold-stressed cells were more sensitive to streptomycin, gentamicin, kanamycin, and ciprofloxacin compared with heat-stressed cells, but both heat and cold-stressed cells showed increased resistance toward all the other AB. Results obtained will help in understanding the effect of environmental stresses during processing on C. sakazakii susceptibility to AB. PMID:21402424

  5. Protective role of L-ascorbic acid, N-acetylcysteine and apocynin on neomycin-induced hair cell loss in zebrafish.

    PubMed

    Wu, Chia-Yen; Lee, Han-Jung; Liu, Chi-Fang; Korivi, Mallikarjuna; Chen, Hwei-Hsien; Chan, Ming-Huan

    2015-03-01

    Hair cells are highly sensitive to environmental insults and other therapeutic drugs. The adverse effects of drugs such as aminoglycosides can cause hair cell death and lead to hearing loss and imbalance. The objective of the present study was to evaluate the protective activity of L-ascorbic acid, N-acetylcysteine (NAC) and apocynin on neomycin-induced hair cell damage in zebrafish (Danio rerio) larvae at 5 days post fertilization (dpf). Results showed that the loss of hair cells within the neuromasts of the lateral lines after neomycin exposure was evidenced by a significantly lower number of neuromasts labeled with fluorescent dye FM1-43FX observed under a microscope. Co-administration with L-ascorbic acid, NAC and apocynin protected neomycin-induced hair cell loss within the neuromasts. Moreover, these three compounds reduced the production of reactive oxygen species (ROS) in neuromasts exposed to neomycin, indicating that their antioxidant action is involved. In contrast, the neuromasts were labeled with specific fluorescent dye Texas-red conjugated with neomycin to detect neomycin uptake. Interestingly, the uptake of neomycin into hair cells was not influenced by these three antioxidant compounds. These data imply that prevention of hair cell damage against neomycin by L-ascorbic acid, NAC and apocynin might be associated with inhibition of excessive ROS production, but not related to modulating neomycin uptake. Our findings conclude that L-ascorbic acid, NAC and apocynin could be used as therapeutic drugs to protect aminoglycoside-induced listening impairment after further confirmatory studies.

  6. Synthesis, characterization and in vitro evaluation of amphiphilic ion pairs of erythromycin and kanamycin antibiotics with liposaccharides.

    PubMed

    Pignatello, Rosario; Simerska, Pavla; Leonardi, Antonio; Abdelrahim, Adel S; Petronio, Giulio Petronio; Fuochi, Virginia; Furneri, Pio Maria; Ruozi, Barbara; Toth, Istvan

    2016-09-14

    The hydrophilic ion paring strategy (HIP) is a method explored to improve the cell/tissue uptake of poorly adsorbed drugs and to optimize their physico-chemical characteristics. In this context, we here describe the synthesis of some ion pairs of two model cationic antibiotics, erythromycin (ERY) and kanamycin A (KAN), with liposaccharides having different levels of lipophilicity and charge. The formation of drug-liposaccharide complexes was confirmed by Fourier transform infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD) analysis. The effect of the amphiphilic liposaccharide moieties on the antimicrobial activity of ERY and KAN was assessed by measuring the minimal inhibitory concentration (MIC) of the compounds against a panel of bacterial strains that were susceptible or resistant to the parent antibiotics. The ion pairing did not depress the in vitro antibiotic activity, although no lowering of MIC values was registered. The experimental findings would motivate the future investigation of this ion pairing strategy in drug design, for instance allowing improvement of the encapsulation efficiency of hydrophilic antibiotics in lipid-based nanocarriers, or changing their in vivo biodistribution and pharmacokinetic profile. PMID:27236014

  7. Metabolic pathway for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) formation in Nocardia corallina: inactivation of mutB by chromosomal integration of a kanamycin resistance gene.

    PubMed Central

    Valentin, H F; Dennis, D

    1996-01-01

    The gene encoding the large subunit of the methylmalonyl-coenzyme A (CoA) mutase in Nocardia corallina (mutBNc) was cloned. A 4.3-kbp BamHI fragment containing almost the entire mutBNc was identified by Southern hybridization experiments employing a digoxigenin-labeled probe deduced from mutB of Streptomyces cinnamonensis, mutBNc was interrupted by insertion of a kanamycin resistance gene block (mutB::kan or mutB::neo) and introduced into N. corallina to obtain mutB-negative strains by homologous recombination. Four of sixteen kanamycin-resistant clones occurred via double-crossover events and harbored only the interrupted mutBNc. These exhibited no growth on odd-chain fatty acids in the presence of kanamycin but exhibited wild-type growth on even-chain fatty acids, glucose, and succinate. Whereas the wild type of N. corallina accumulates a copolyester of 3-hydroxybutyrate (3HB) and 3-hydroxyvalerate (3HV) containing more than 60 mol% 3HV from most carbon sources, mutB-negative strains accumulated poly(3HB-co-3HV) containing only 2 to 6 mol% 3HV. Methylmalonyl-CoA mutase activity was not found in these clones. Therefore, this study provides strong evidence that the majority of 3HV units in poly(3HB-co-3HV) accumulated by N. corallina are synthesized via the methylmalonyl-CoA pathway. PMID:8593043

  8. Guanidinylated neomycin mediates heparan sulfate-dependent transport of active enzymes to lysosomes.

    PubMed

    Sarrazin, Stéphane; Wilson, Beth; Sly, William S; Tor, Yitzhak; Esko, Jeffrey D

    2010-07-01

    Guanidinylated neomycin (GNeo) can transport bioactive, high molecular weight cargo into the interior of cells in a process that depends on cell surface heparan sulfate proteoglycans. In this report, we show that GNeo-modified quantum dots bind to cell surface heparan sulfate, undergo endocytosis and eventually reach the lysosomal compartment. An N-hydroxysuccinimide activated ester of GNeo (GNeo-NHS) was prepared and conjugated to two lysosomal enzymes, beta-D-glucuronidase (GUS) and alpha-L-iduronidase. Conjugation did not interfere with enzyme activity and enabled binding of the enzymes to heparin-Sepharose and heparan sulfate on primary human fibroblasts. Cells lacking the corresponding lysosomal enzyme took up sufficient amounts of the conjugated enzymes to restore normal turnover of glycosaminoglycans. The high capacity of proteoglycan-mediated uptake suggests that this method of delivery might be used for enzyme replacement or introduction of foreign enzymes into cells.

  9. Spectroscopic probe of the competitive binding of ethidium bromide and neomycin to DNA

    NASA Astrophysics Data System (ADS)

    Pal, Medini Kanta; Ghosh, Jimut Kanti

    1995-03-01

    The three spectroscopic changes of ethidium bromide (EB) on its binding to DNA, namely red-shift of the νmax, enhancement of fluorescence and induced dichroism are utilized to study the competitive binding of neomycin (NMC) and EB to DNA. Reversion of νmax, decrease in fluorescence and reduction of dichroism of DNA-EB on addition of NMC shows that the binding of NMC and EB to DNA is competitive in nature, over a limited concentration of the polymer. The binding constant of EB-DNA falls from 4.00 × 10 6 to 2.27 × 10 4 1 mol -1 in the presence of added NMC.

  10. Neomycin-loaded poly(styrene sulfonic acid-co-maleic acid) (PSSA-MA)/polyvinyl alcohol (PVA) ion exchange nanofibers for wound dressing materials.

    PubMed

    Nitanan, Todsapon; Akkaramongkolporn, Prasert; Rojanarata, Theerasak; Ngawhirunpat, Tanasait; Opanasopit, Praneet

    2013-05-01

    In this study, poly(styrene sulfonic acid-co-maleic acid) (PSSA-MA) blended with polyvinyl alcohol (PVA) was electrospun and then subjected to thermal crosslinking to produce PSSA-MA/PVA ion exchange nanofiber mats. The cationic drug neomycin (0.001, 0.01, and 0.1%, w/v) was loaded onto the cationic exchange fibers. The amount of neomycin loaded and released and the cytotoxicity of the fiber mats were analyzed. In vivo wound healing tests were also performed in Wistar rats. The results indicated that the diameters of the fibers were on the nanoscale (250 ± 21 nm). The ion exchange capacity (IEC) value and the percentage of water uptake were 2.19 ± 0.1 mequiv./g-dry fibers and 268 ± 15%, respectively. The loading capacity was increased upon increasing the neomycin concentration. An initial concentration of 0.1% (w/v) neomycin (F3) showed the highest loading capacity (65.7 mg/g-dry fibers). The neomycin-loaded nanofiber mats demonstrated satisfactory antibacterial activity against both Gram-positive and Gram-negative bacteria, and an in vivo wound healing test revealed that these mats performed better than gauze and blank nanofiber mats in decreasing acute wound size during the first week after tissue damage. In conclusion, the antibacterial neomycin-loaded PSSA-MA/PVA cationic exchange nanofiber mats have the potential for use as wound dressing materials.

  11. Synthesis and properties of vitamin E analog-conjugated neomycin for delivery of RNAi drugs to liver cells.

    PubMed

    Iwata, Rintaro; Nakayama, Futoshi; Hirochi, Sakie; Sato, Kazuki; Piao, Wenying; Nishina, Kazutaka; Yokota, Takanori; Wada, Takeshi

    2015-02-15

    RNA interference (RNAi) is a promising tool to regulate gene expression by external double stranded RNAs (dsRNAs) such as siRNAs. As an efficient method to deliver siRNAs to liver cells, we propose a novel strategy using vitamin E (VE)-conjugated neomycin derivatives. With the aim of delivering RNAi-based drugs to liver cells, several tripod-type and prodrug-type neomycin derivatives were synthesized, all of which were thermodynamically stabilized RNA duplexes. The prodrug-type derivative 7 and the tripod-type derivative 10 were delivered to liver cancer cells and successfully induced RNAi activity. These results indicated the potential use of natural aminoglycosides as carriers of RNAi drugs.

  12. Neomycin and pentagalloyl glucose enhanced cross-linking for elastin and glycosaminoglycans preservation in bioprosthetic heart valves.

    PubMed

    Tripi, Daniel R; Vyavahare, Naren R

    2014-01-01

    Glutaraldehyde cross-linked bioprosthetic heart valves fail within 12-15 years of implantation due to limited durability. Glutaraldehyde does not adequately stabilize extracellular matrix components such as glycosaminoglycans and elastin, and loss of these components could be a major cause of degeneration of valve after implantation. We have shown earlier that neomycin-based cross-linking stabilizes glycosaminoglycans in the tissue but fails to stabilize elastin component. Here, we report a new treatment where neomycin and pentagalloyl glucose (PGG) were incorporated into glutaraldehyde cross-linking neomycin-PGG-Glutaraldehyde (NPG) to stabilize both glycosaminoglycans and elastin in porcine aortic valves. In vitro studies demonstrated a marked increase in extracellular matrix stability against enzymatic degradation after cross-linking and 10 month storage in NPG group when compared to glutaraldehyde controls. Tensile properties showed increased lower elastic modulus in both radial and circumferential directions in NPG group as compared to glutaraldehyde, probably due to increased elastin stabilization with no changes in upper elastic modulus and extensibility. The enhanced extracellular matrix stability was further maintained in NPG-treated tissues after rat subdermal implantation for three weeks. NPG group also showed reduced calcification when compared to glutaraldehyde controls. We conclude that NPG cross-linking would be an excellent alternative to glutaraldehyde cross-linking of bioprosthetic heart valves to improve its durability.

  13. Determination of aminoglycoside residues in kidney and honey samples by hydrophilic interaction chromatography-tandem mass spectrometry.

    PubMed

    Kumar, Praveen; Rúbies, Antoni; Companyó, Ramon; Centrich, Francesc

    2012-10-01

    Two methods based on liquid chromatography-tandem mass spectrometry were developed for the determination of ten aminoglycosides (streptomycin, dihydrostreptomycin, spectinomycin, apramycin, paromomycin, kanamycin A, gentamycin C1, gentamycin C2/C2a, gentamycin C1a, and neomycin B) in kidney samples from food-producing animals and in honey samples. The methods involved extraction with an aqueous solution (for the kidney samples) or sample dissolution in water (for the honey samples), solid-phase extraction with a weak cation exchange cartridge and injection of the eluate into a liquid chromatography-tandem mass spectrometry system. A zwitterionic hydrophilic interaction chromatography column was used for separation of aminoglycosides and a triple quadrupole mass analyzer was used for detection. The methods were validated according to Decision 2002/657/EC. The limits of quantitation ranged from 2 to 125 μg/kg in honey and 25 to 264 μg/kg in the kidney samples. Interday precision (RSD%) ranged from 6 to 26% in honey and 2 to 21% in kidney. Trueness, expressed as the percentage of error, ranged from 7 to 20% in honey and 1 to 11% in kidney.

  14. Hydrophilic interaction chromatography for the analysis of aminoglycosides.

    PubMed

    Kumar, Praveen; Rubies, Antoni; Companyó, Ramon; Centrich, Francesc

    2012-02-01

    The effect of mobile-phase constituents (pH and ionic strength) and chromatographic behaviour of ten aminoglycosides (streptomycin, dihydrostreptomycin, spectinomycin, apramycin, paramomycin, kanamycin A, gentamycin C1, gentamycin C2/C2a, gentamycin C1a and neomycin) in the bare silica, amino, amide and zwitterionic phases of hydrophilic interaction chromatography (HILIC) were studied systematically. Among the stationary phases studied, the zwitterionic phase provided the best separation of aminoglycosides. The effect of pH, ionic concentration and column temperature on retention time, peak shape and sensitivity was studied using a central composite design. pH affected sensitivity of the detection of analytes but not the retention time. High ionic strength in the mobile phase was necessary to control the ionic interactions between ionised aminoglycosides and the hydrophilic phase, thereby influencing peak shape and retention time. Column temperature affected sensitivity of the detection but not the retention time. During method development, crosstalk between the MS/MS channels of the analytes was observed and resolved.

  15. Determination of aminoglycoside residues in kidney and honey samples by hydrophilic interaction chromatography-tandem mass spectrometry.

    PubMed

    Kumar, Praveen; Rúbies, Antoni; Companyó, Ramon; Centrich, Francesc

    2012-10-01

    Two methods based on liquid chromatography-tandem mass spectrometry were developed for the determination of ten aminoglycosides (streptomycin, dihydrostreptomycin, spectinomycin, apramycin, paromomycin, kanamycin A, gentamycin C1, gentamycin C2/C2a, gentamycin C1a, and neomycin B) in kidney samples from food-producing animals and in honey samples. The methods involved extraction with an aqueous solution (for the kidney samples) or sample dissolution in water (for the honey samples), solid-phase extraction with a weak cation exchange cartridge and injection of the eluate into a liquid chromatography-tandem mass spectrometry system. A zwitterionic hydrophilic interaction chromatography column was used for separation of aminoglycosides and a triple quadrupole mass analyzer was used for detection. The methods were validated according to Decision 2002/657/EC. The limits of quantitation ranged from 2 to 125 μg/kg in honey and 25 to 264 μg/kg in the kidney samples. Interday precision (RSD%) ranged from 6 to 26% in honey and 2 to 21% in kidney. Trueness, expressed as the percentage of error, ranged from 7 to 20% in honey and 1 to 11% in kidney. PMID:23065931

  16. Hydrophilic interaction chromatography for the analysis of aminoglycosides.

    PubMed

    Kumar, Praveen; Rubies, Antoni; Companyó, Ramon; Centrich, Francesc

    2012-02-01

    The effect of mobile-phase constituents (pH and ionic strength) and chromatographic behaviour of ten aminoglycosides (streptomycin, dihydrostreptomycin, spectinomycin, apramycin, paramomycin, kanamycin A, gentamycin C1, gentamycin C2/C2a, gentamycin C1a and neomycin) in the bare silica, amino, amide and zwitterionic phases of hydrophilic interaction chromatography (HILIC) were studied systematically. Among the stationary phases studied, the zwitterionic phase provided the best separation of aminoglycosides. The effect of pH, ionic concentration and column temperature on retention time, peak shape and sensitivity was studied using a central composite design. pH affected sensitivity of the detection of analytes but not the retention time. High ionic strength in the mobile phase was necessary to control the ionic interactions between ionised aminoglycosides and the hydrophilic phase, thereby influencing peak shape and retention time. Column temperature affected sensitivity of the detection but not the retention time. During method development, crosstalk between the MS/MS channels of the analytes was observed and resolved. PMID:22282410

  17. Kaposi's sarcoma-associated herpesvirus-positive primary effusion lymphoma tumor formation in NOD/SCID mice is inhibited by neomycin and neamine blocking angiogenin's nuclear translocation.

    PubMed

    Bottero, Virginie; Sadagopan, Sathish; Johnson, Karen E; Dutta, Sujoy; Veettil, Mohanan Valiya; Chandran, Bala

    2013-11-01

    Angiogenin (ANG) is a 14-kDa multifunctional proangiogenic secreted protein whose expression level correlates with the aggressiveness of several tumors. We observed increased ANG expression and secretion in endothelial cells during de novo infection with Kaposi's sarcoma-associated herpesvirus (KSHV), in cells expressing only latency-associated nuclear antigen 1 (LANA-1) protein, and in KSHV latently infected primary effusion lymphoma (PEL) BCBL-1 and BC-3 cells. Inhibition of phospholipase Cγ (PLCγ) mediated ANG's nuclear translocation by neomycin, an aminoglycoside antibiotic (not G418-neomicin), resulted in reduced KSHV latent gene expression, increased lytic gene expression, and increased cell death of KSHV(+) PEL and endothelial cells. ANG detection in significant levels in KS and PEL lesions highlights its importance in KSHV pathogenesis. To assess the in vivo antitumor activity of neomycin and neamine (a nontoxic derivative of neomycin), BCBL-1 cells were injected intraperitoneally into NOD/SCID mice. We observed significant extended survival of mice treated with neomycin or neamine. Markers of lymphoma establishment, such as increases in animal body weight, spleen size, tumor cell spleen infiltration, and ascites volume, were observed in nontreated animals and were significantly diminished by neomycin or neamine treatments. A significant decrease in LANA-1 expression, an increase in lytic gene expression, and an increase in cleaved caspase-3 were also observed in neomycin- or neamine-treated animal ascitic cells. These studies demonstrated that ANG played an essential role in KSHV latency maintenance and BCBL-1 cell survival in vivo, and targeting ANG function by neomycin/neamine to induce the apoptosis of cells latently infected with KSHV is an attractive therapeutic strategy against KSHV-associated malignancies.

  18. Influence of linker length and composition on enzymatic activity and ribosomal binding of neomycin dimers.

    PubMed

    Watkins, Derrick; Kumar, Sunil; Green, Keith D; Arya, Dev P; Garneau-Tsodikova, Sylvie

    2015-07-01

    The human and bacterial A site rRNA binding as well as the aminoglycoside-modifying enzyme (AME) activity against a series of neomycin B (NEO) dimers is presented. The data indicate that by simple modifications of linker length and composition, substantial differences in rRNA selectivity and AME activity can be obtained. We tested five different AMEs with dimeric NEO dimers that were tethered via triazole, urea, and thiourea linkages. We show that triazole-linked dimers were the worst substrates for most AMEs, with those containing the longer linkers showing the largest decrease in activity. Thiourea-linked dimers that showed a decrease in activity by AMEs also showed increased bacterial A site binding, with one compound (compound 14) even showing substantially reduced human A site binding. The urea-linked dimers showed a substantial decrease in activity by AMEs when a conformationally restrictive phenyl linker was introduced. The information learned herein advances our understanding of the importance of the linker length and composition for the generation of dimeric aminoglycoside antibiotics capable of avoiding the action of AMEs and selective binding to the bacterial rRNA over binding to the human rRNA.

  19. [Development and application of indirect competitive enzyme immunoassay for detection of neomycin in milk].

    PubMed

    Burkin, M A; Gal'vidis, I A

    2011-01-01

    As a result of immunization of rabbits with neomycin B (N M) conjugated to periodate-oxidized transferrin, polyclonal antibodies were generated and used to develop an indirect competitive enzyme-linked immunosorbent assay (ELISA) of NM. Several heterologous conjugates, namely, glutaraldehyde (GA)-polymerized NM, gelatin-ribostamycin (sp), and gelatin-NM (ga) were used as coating antigens in different ELISA variants for quantification of NM in milk. These variants were characterized by different dynamic ranges and detection limits of 1.0, 0.1, and 0.01 ng/ml, respectively. Maximum residue level (MRL) of this antibiotic in milk accepted in the EU can be detected without any special pretreatment at a 100-fold sample dilution in the least sensitive assay variant. The mean recovery rate from NM-spiked milk containing 1.5-10% fat was 111.7% and ranged from 84 to 125.2%. We found that 57 of 106 tested milk samples contained NM at concentrations higher than 100 ng/ml. In ten percent of cases (11/1 06), the residual level of this antibiotic was greater than 500 ng/ml. In one case, the M RL was exceeded (1690 ng/ml). The assay developed in this study is specific shows no cross-reactivity with other veterinary aminoglycosides, has a good sensitivity reserve, and can serve as an effective tool to monitor the NM content in milk stuff.

  20. Amplification strategy based on gold nanoparticle-decorated carbon nanotubes for neomycin immunosensors.

    PubMed

    Zhu, Ye; Son, Jung Ik; Shim, Yoon-Bo

    2010-11-15

    A novel amperometric immunosensor with an enhanced sensitivity for the detection of neomycin (Neo) was prepared by covalently immobilizing a monoclonal Neo antibody onto a new conducting polymer, poly-[2,5-di-(2-thienyl)-1H-pyrrole-1-(p-benzoic acid)] (pDPB), as a sensor probe. The probe was used to detect Neo in a sandwich-type approach, where the secondary antibody was attached to gold nanoparticle-decorated multi-wall carbon nanotubes labeled with hydrazine (Hyd-MWCNT(AuNP)-Ab(2)). Hydrazine on the conjugate served as a catalyst for the reduction of hydrogen peroxide, and the catalytic current was monitored at -0.45 V vs. Ag/AgCl. The performance of the immunosensor with and without AuNPs on the probe and the conjugate was compared. The parameters affecting the immunosensor response in terms of antibody dilution ratio, incubation time, pH, applied potential, and temperature were optimized. A linear dynamic range for Neo analysis was obtained between 10 ng/mL and 250 ng/mL with a detection limit of 6.76 ± 0.17 ng/mL. The proposed immunosensor was successfully applied to detect Neo content in real meat samples.

  1. Rapid analytical procedure for neomycin determination in ointments by CE with direct UV detection.

    PubMed

    Huidobro, A L; García, A; Barbas, C

    2009-07-12

    The purpose of this study was the development of an analytical methodology for the determination of neomycin in a complex pharmaceutical preparation. The simplified methodology consisted of a primary liquid-liquid extraction, employing a mixture of chloroform and water (1.25:1, v/v) and subsequent analysis by CE applying a capillary zone electrophoresis method with a 30 cm (effective length), 50 microm (internal diameter) polyacrylamide-coated silica capillary. The background electrolyte consisted of 35 mM phosphate and 15 mM acetate buffer set at pH 4.7, under normal polarity mode and direct UV detection at 200 nm. The separation of the target analyte from the complex matrix was accomplished in less than 3 min. The analytical method was successfully validated in order to verify its proper selectivity, linearity, accuracy and precision for the goal intended and its further implementation for the quantification of the active compound in the pharmaceutical speciality for quality control.

  2. What a Difference an OH Makes: Conformational Dynamics as the Basis for the Ligand Specificity of the Neomycin-Sensing Riboswitch.

    PubMed

    Duchardt-Ferner, Elke; Gottstein-Schmidtke, Sina R; Weigand, Julia E; Ohlenschläger, Oliver; Wurm, Jan-Philip; Hammann, Christian; Suess, Beatrix; Wöhnert, Jens

    2016-01-22

    To ensure appropriate metabolic regulation, riboswitches must discriminate efficiently between their target ligands and chemically similar molecules that are also present in the cell. A remarkable example of efficient ligand discrimination is a synthetic neomycin-sensing riboswitch. Paromomycin, which differs from neomycin only by the substitution of a single amino group with a hydroxy group, also binds but does not flip the riboswitch. Interestingly, the solution structures of the two riboswitch-ligand complexes are virtually identical. In this work, we demonstrate that the local loss of key intermolecular interactions at the substitution site is translated through a defined network of intramolecular interactions into global changes in RNA conformational dynamics. The remarkable specificity of this riboswitch is thus based on structural dynamics rather than static structural differences. In this respect, the neomycin riboswitch is a model for many of its natural counterparts.

  3. Structural elucidation of biologically active neomycin N-octyl derivatives in a regioisomeric mixture by means of liquid chromatography/ion trap time-of-flight mass spectrometry.

    PubMed

    Giera, Martin; de Vlieger, Jon S B; Lingeman, Henk; Irth, Hubertus; Niessen, Wilfried M A

    2010-05-30

    Structural elucidation of six regioisomers of mono-N-octyl derivatized neomycin is achieved using MS(n) (up to n = 4) on an ion trap time-of-flight (IT-TOF) instrument equipped with electrospray ionization. The mixture of six derivatized neomycin analogues was generated by reductive amination in a shotgun synthetic approach. In parallel to the liquid chromatography/mass spectrometry (LC/MS) detection, the antibacterial activity of the neomycin regioisomers was tested by post-column addition of buffer and bacterial inocula, subsequent microfractionation of the resulting mixture, incubation, and finally a chemiluminescence-based bioactivity measurement based on the production of bacterial ATP. The MS-based high-resolution screening approach described can be applied in medicinal chemistry to help in designing and producing new antibiotic substances, which is particularly challenging due to the high functionality of most antibiotic substances, therefore requiring advanced (hyphenated) separation and detection techniques for compound mixtures.

  4. Normal phenotype in conditional androgen receptor (AR) exon 3-floxed neomycin-negative male mice.

    PubMed

    Rana, Kesha; Clarke, Michele V; Zajac, Jeffrey D; Davey, Rachel A; MacLean, Helen E

    2014-01-01

    Androgens (testosterone and dihydrotestosterone) acting via the androgen receptor (AR) are required for male sexual differentiation, and also regulate the development of many other tissues including muscle, fat and bone. We previously generated an AR(lox) mouse line with exon 3 of the AR gene targeted by loxP sites. The deletion of exon 3 is in-frame, so only the DNA binding-dependent actions of the AR are deleted, but non-DNA binding-dependent actions are retained. This line also contained an antibiotic resistance selection cassette, neomycin (neo) in intron 3, which was also flanked by loxP sites. Hemizygous AR(lox) male mice demonstrated a phenotype of hyperandrogenization, with increased mass of androgen-dependent tissues. We hypothesized that this hyperandrogenization was likely to be due to the presence of the neo cassette. In this study, we have generated an AR(lox) neo-negative mouse line, using the EIIa-cre deleter mouse line to remove the neo cassette. Hemizygous AR(lox) neo-negative male mice have a normal phenotype, with normal body mass and normal mass of androgen-dependent tissues including the testis, seminal vesicles, kidney, spleen, heart and retroperitoneal fat. This neo-negative exon 3-targeted mouse line is the only floxed AR mouse line available to study the DNA binding-dependent actions of the AR in a tissue-specific manner, and is suitable for investigation in all tissues. This study demonstrates the importance of removing the selection cassette, which can potentially alter the phenotype of floxed mouse lines even in the absence of detectable effects on target gene expression.

  5. Decreased expression of humanized Fat-1 in porcine fetal fibroblasts following deletion of PGK-neomycin resistance.

    PubMed

    Han, X J; Liang, H; Yun, T; Zhao, Y H; Zhang, M L; Zhao, L H; Li, R F; Li, X L

    2015-09-28

    The neomycin-resistance (neo(r)) gene is widely used as a selectable marker in eukaryotic expression vectors; however, its expression often affects that of target genes. Cre recombinase recognizes LoxP sites, leading to site-specific recombination and deletion of DNA and RNA between two LoxP sites. In the present study, a humanized Fat-1 gene (hFat-1) was generated by DNA Works and used to construct a pC-PGK-neo(r)-hfat-1 expression vector, in which PGK-neo(r) was flanked by two LoxP sites. The pC-PGK-neo(r)-hfat-1 plasmids were transfected into porcine fetal fibroblasts using liposomes, and three transgenic cell lines were obtained by culturing with 400 μg/mL G418 for 7 days. Next, these cell lines were transfected with a Cre recombinase expression plasmid, which contains a puromycin resistance gene, in order to delete neo(r), which was integrated into the genome. hFat-1-neo(r) negative cells were obtained following puromycin selection. Real-time quantitative polymerase chain reaction data indicated that neomycin-resistant cells had higher hFat-1 expression than neomycin-sensitive cells. High performance gas chromatography data suggested that the n-6/n-3 ratio was significantly lower in transfected cells than in wild-type cells. The n-6/n-3 ratio in Cre-treated hFat-1-transfected cells was higher than that in untreated cells, suggesting that deletion of PGK-neo(r) decreased hFat-1 expression.

  6. Decreased expression of humanized Fat-1 in porcine fetal fibroblasts following deletion of PGK-neomycin resistance.

    PubMed

    Han, X J; Liang, H; Yun, T; Zhao, Y H; Zhang, M L; Zhao, L H; Li, R F; Li, X L

    2015-01-01

    The neomycin-resistance (neo(r)) gene is widely used as a selectable marker in eukaryotic expression vectors; however, its expression often affects that of target genes. Cre recombinase recognizes LoxP sites, leading to site-specific recombination and deletion of DNA and RNA between two LoxP sites. In the present study, a humanized Fat-1 gene (hFat-1) was generated by DNA Works and used to construct a pC-PGK-neo(r)-hfat-1 expression vector, in which PGK-neo(r) was flanked by two LoxP sites. The pC-PGK-neo(r)-hfat-1 plasmids were transfected into porcine fetal fibroblasts using liposomes, and three transgenic cell lines were obtained by culturing with 400 μg/mL G418 for 7 days. Next, these cell lines were transfected with a Cre recombinase expression plasmid, which contains a puromycin resistance gene, in order to delete neo(r), which was integrated into the genome. hFat-1-neo(r) negative cells were obtained following puromycin selection. Real-time quantitative polymerase chain reaction data indicated that neomycin-resistant cells had higher hFat-1 expression than neomycin-sensitive cells. High performance gas chromatography data suggested that the n-6/n-3 ratio was significantly lower in transfected cells than in wild-type cells. The n-6/n-3 ratio in Cre-treated hFat-1-transfected cells was higher than that in untreated cells, suggesting that deletion of PGK-neo(r) decreased hFat-1 expression. PMID:26436400

  7. Neomycin-phenolic conjugates: polycationic amphiphiles with broad-spectrum antibacterial activity, low hemolytic activity and weak serum protein binding.

    PubMed

    Findlay, Brandon; Zhanel, George G; Schweizer, Frank

    2012-02-15

    Here we present a proof-of-concept study, combining two known antimicrobial agents into a hybrid structure in order to develop an emergent cationic detergent-like interaction with the bacterial membrane. Six amphiphilic conjugates were prepared by copper (I)-catalyzed 1,3-dipolar cycloaddition between a neomycin B-derived azide and three alkyne-modified phenolic disinfectants. Three conjugates displayed good activity against a variety of clinically relevant Gram positive and Gram negative bacteria, including MRSA, without the high level of hemolysis or strong binding to serum proteins commonly observed with other cationic antimicrobial peptides and detergents.

  8. Antibiotic resistance of lactic acid bacteria isolated from Chinese yogurts.

    PubMed

    Zhou, N; Zhang, J X; Fan, M T; Wang, J; Guo, G; Wei, X Y

    2012-09-01

    The aim of this study was to evaluate the susceptibility of 43 strains of lactic acid bacteria, isolated from Chinese yogurts made in different geographical areas, to 11 antibiotics (ampicillin, penicillin G, roxithromycin, chloramphenicol, tetracycline, chlortetracycline, lincomycin, kanamycin, streptomycin, neomycin, and gentamycin). The 43 isolates (18 Lactobacillus bulgaricus and 25 Streptococcus thermophilus) were identified at species level and were typed by random amplified polymorphic DNA analysis. Thirty-five genotypically different strains were detected and their antimicrobial resistance to 11 antibiotics was determined using the agar dilution method. Widespread resistance to ampicillin, chloramphenicol, chlortetracycline, tetracyclines, lincomycin, streptomycin, neomycin, and gentamycin was found among the 35 strains tested. All of the Strep. thermophilus strains tested were susceptible to penicillin G and roxithromycin, whereas 23.5 and 64.7% of Lb. bulgaricus strains, respectively, were resistant. All of the Strep. thermophilus and Lb. bulgaricus strains were found to be resistant to kanamycin. The presence of the corresponding resistance genes in the resistant isolates was investigated through PCR, with the following genes detected: tet(M) in 1 Lb. bulgaricus and 2 Strep. thermophilus isolates, ant(6) in 2 Lb. bulgaricus and 2 Strep. thermophilus isolates, and aph(3')-IIIa in 5 Lb. bulgaricus and 2 Strep. thermophilus isolates. The main threat associated with these bacteria is that they may transfer resistance genes to pathogenic bacteria, which has been a major cause of concern to human and animal health. To our knowledge, the aph(3')-IIIa and ant(6) genes were found in Lb. bulgaricus and Strep. thermophilus for the first time. Further investigations are required to analyze whether the genes identified in Lb. bulgaricus and Strep. thermophilus isolates might be horizontally transferred to other species.

  9. Antimicrobial effect of combinations of EDTA-Tris and amikacin or neomycin on the microorganisms associated with otitis externa in dogs.

    PubMed

    Sparks, T A; Kemp, D T; Wooley, R E; Gibbs, P S

    1994-01-01

    Combinations of EDTA-Tris and two aminoglycoside antibiotics (amikacin and neomycin) were tested for synergistic activities against the microorganisms associated with otitis externa in dogs and for the solutions' stability over time. Synergistic activity was observed when EDTA-Tris plus amikacin and EDTA-Tris plus neomycin were tested against Staphylococcus intermedius, Proteus mirabilis, Pseudomonas aeruginosa, and Escherichia coli, but not against Candida albicans. Stability studies over a 3-month period indicated that the test solutions were stable at room temperature and that their antimicrobial activity was maintained.

  10. E2F1-CDK1 pathway activation in kanamycin-induced spiral ganglion cell apoptosis and the protective effect of CR8.

    PubMed

    Liu, Yu-ying; Wang, Guo-peng; Peng, Zhe; Guo, Jing-ying; Wu, Qian; Xie, Jing; Gong, Shu-sheng

    2016-03-23

    Cochlear hair cell loss results in the secondary loss of spiral ganglion cells (SGCs). The death of these SGCs is due to apoptosis. The E2F1-cyclin dependent kinase 1 (CDK1) pathway is believed to represent an important mechanism of neuronal cell death. However, the role of this pathway in spiral ganglion neuronal apoptosis has not yet been reported. In this study, we deafened guinea pigs with a subcutaneous injection of kanamycin followed by an intravenous infusion of furosemide and then assayed the expression levels of cleaved caspase-3, E2F1, CDK1 and cleaved caspase-9 during the induced SGC apoptosis. Our results revealed that co-administration of kanamycin and furosemide rapidly induced hair cell loss in the guinea pigs and then resulted in a progressive loss of SGCs. Expression levels of E2F1 and CDK1 were obviously up-regulated at 1 and 3 days after deafening. Cleaved caspase-9 also increased robustly 1 or 2 weeks after the deafening procedure. The up-regulation of E2F1, CDK1 and cleaved caspase-9 was significantly attenuated by the systemic injection of CR8 (1mg/kg/day, intraperitoneally) starting at 5min after deafening. These findings indicate that the activation of the E2F1-CDK1 pathway and cell cycle re-entry contributes to the apoptosis of SGCs and that the selective inhibition of this signaling cascade may represent an attractive therapeutic strategy. CR8 has the potential to protect SGCs from apoptosis. PMID:26905670

  11. Light-dependent repetitive Ca2+ spikes induced by extracellular application of neomycin in honeybee drone photoreceptors.

    PubMed

    Walz, B; Zimmermann, B; Ukhanov, K

    2000-05-01

    Photoreceptor cells of the honeybee drone fire, in the presence of the polycationic aminoglycoside neomycin, repetitive slow spike-like potentials superimposed on the receptor potential plateau phase. We have used conventional intracellular recordings and microfluorometric intracellular Ca2+ measurements to characterize these spike potentials. We have shown that the spike frequency increases in a light-intensity-dependent manner. The spikes are fired only when light stimuli depolarize the cell from a resting potential of -50 to -60 mV to at least -40 to -45 mV; they are tetrodotoxin insensitive and blocked by the Ca2+ channel blockers Ni2+, Cd2+, omega-agatoxin TK, verapamil and methoxyverapamil. Depolarization of the photoreceptors with high extracellular K+ in the presence of neomycin in darkness does not generate spikes. Small intracellular Ca2+ oscillations superimposed on the plateau phase of the light-induced increase in intracellular free Ca2+ concentration have a similar temporal pattern as the spike-like potentials. We conclude that the spike-like potentials require stimulation by light and are generated by voltage-dependent Ca2+ channels localized on the soma of the photoreceptors, distal to the basal lamina.

  12. Light-dependent repetitive Ca2+ spikes induced by extracellular application of neomycin in honeybee drone photoreceptors.

    PubMed

    Walz, B; Zimmermann, B; Ukhanov, K

    2000-05-01

    Photoreceptor cells of the honeybee drone fire, in the presence of the polycationic aminoglycoside neomycin, repetitive slow spike-like potentials superimposed on the receptor potential plateau phase. We have used conventional intracellular recordings and microfluorometric intracellular Ca2+ measurements to characterize these spike potentials. We have shown that the spike frequency increases in a light-intensity-dependent manner. The spikes are fired only when light stimuli depolarize the cell from a resting potential of -50 to -60 mV to at least -40 to -45 mV; they are tetrodotoxin insensitive and blocked by the Ca2+ channel blockers Ni2+, Cd2+, omega-agatoxin TK, verapamil and methoxyverapamil. Depolarization of the photoreceptors with high extracellular K+ in the presence of neomycin in darkness does not generate spikes. Small intracellular Ca2+ oscillations superimposed on the plateau phase of the light-induced increase in intracellular free Ca2+ concentration have a similar temporal pattern as the spike-like potentials. We conclude that the spike-like potentials require stimulation by light and are generated by voltage-dependent Ca2+ channels localized on the soma of the photoreceptors, distal to the basal lamina. PMID:10879952

  13. Validation of an enzyme-linked immunosorbent assay for qualitative screening of neomycin in muscle, liver, kidney, eggs and milk.

    PubMed

    Solomun, B; Bilandzic, N; Varenina, I; Scortichini, G

    2011-01-01

    A rapid and sensitive enzyme-linked immunosorbent assay (ELISA) was used for the qualitative screening analysis of neomycin in food of animal origin (muscle, liver, kidney, eggs and milk) at levels corresponding to the European Union maximum residue limit (MRL) set for this substance. The method validation was performed according to the criteria of Commission Decision 2002/657/EC established for qualitative screening methods. In this regard, the following parameters were determined: detection capability (CCβ), specificity, detection limit (LOD), quantification limit (LOQ), recovery, precision, linearity and ruggedness. LODs ranged from 5.7 microg kg(-1) in kidney to 29.3 microg kg(-1) in milk; LOQs ranged from 11.4 microg kg(-1) in kidney to 59.7 microkg(-1) in eggs. The recoveries from spiked samples at the MRL, half the MRL and double the MRL levels ranged from 65.8% to 122.8%, with a coefficient of variation (CV) between 5.9% and 28.6%. The CCβ value was less than the MRL for all examined matrices. Moderate variations of some critical factors in the sample pretreatment for muscle, milk and eggs were deliberately introduced for ruggedness evaluation and had a slight but not statistically significant effect on method performance. The proposed method is suitable for qualitative screening analysis of neomycin in the above-mentioned food in conformity with current European Union performance requirements.

  14. Development, optimization and validation of a rapid colorimetric microplate bioassay for neomycin sulfate in pharmaceutical drug products.

    PubMed

    Francisco, Fabiane Lacerda; Saviano, Alessandro Morais; Pinto, Terezinha de Jesus Andreoli; Lourenço, Felipe Rebello

    2014-08-01

    Microbiological assays have been used to evaluate antimicrobial activity since the discovery of the first antibiotics. Despite their limitations, microbiological assays are widely employed to determine antibiotic potency of pharmaceutical dosage forms, since they provide a measure of biological activity. The aim of this work is to develop, optimize and validate a rapid colorimetric microplate bioassay for the potency of neomycin in pharmaceutical drug products. Factorial and response surface methodologies were used in the development and optimization of the choice of microorganism, culture medium composition, amount of inoculum, triphenyltetrazolium chloride (TTC) concentration and neomycin concentration. The optimized bioassay method was validated by the assessment of linearity (range 3.0 to 5.0μg/mL, r=0.998 and 0.994 for standard and sample curves, respectively), precision (relative standard deviation (RSD) of 2.8% and 4.0 for repeatability and intermediate precision, respectively), accuracy (mean recovery=100.2%) and robustness. Statistical analysis showed equivalency between agar diffusion microbiological assay and rapid colorimetric microplate bioassay. In addition, microplate bioassay had advantages concerning the sensitivity of response, time of incubation, and amount of culture medium and solutions required.

  15. Electrochemical sensor using neomycin-imprinted film as recognition element based on chitosan-silver nanoparticles/graphene-multiwalled carbon nanotubes composites modified electrode.

    PubMed

    Lian, Wenjing; Liu, Su; Yu, Jinghua; Li, Jie; Cui, Min; Xu, Wei; Huang, Jiadong

    2013-06-15

    A novel imprinted electrochemical sensor for neomycin recognition was developed based on chitosan-silver nanoparticles (CS-SNP)/graphene-multiwalled carbon nanotubes (GR-MWCNTs) composites decorated gold electrode. Molecularly imprinted polymers (MIPs) were synthesized by electropolymerization using neomycin as the template, and pyrrole as the monomer. The mechanism of the fabrication process and a number of factors affecting the activity of the imprinted sensor have been discussed and optimized. The characterization of imprinted sensor has been carried out by scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FTIR). The performance of the proposed imprinted sensor has been investigated using cyclic voltammetry (CV) and amperometry. Under the optimized conditions, the linear range of the sensor was from 9×10(-9)mol/L to 7×10(-6)mol/L, with the limit of detection (LOD) of 7.63×10(-9)mol/L (S/N=3). The film exhibited high binding affinity and selectivity towards the template neomycin, as well as good reproducibility and stability. Furthermore, the proposed sensor was applied to determine the neomycin in milk and honey samples based on its good reproducibility and stability, and the acceptable recovery implied its feasibility for practical application.

  16. In vitro protection of auditory hair cells by salicylate from the gentamicin-induced but not neomycin-induced cell loss.

    PubMed

    Mazurek, Birgit; Lou, Xiangxin; Olze, Heidi; Haupt, Heidemarie; Szczepek, Agnieszka J

    2012-01-01

    Salicylate has been shown to protect animals and people from the gentamicin-induced hearing loss. The objective of our study was to determine if salicylate is otoprotective in vitro. In this fashion, we wanted to validate the use of explant culture system for future studies on the ototoxicity prevention. In addition, we wanted to find out if salicylate protects from the ototoxicity of other aminoglycosides. As a model, we used the membranous cochlear tissues containing the organ of Corti, spiral limbus and spiral ganglion neurons dissected from the cochleas of p3-p5 Wistar pups. The explants were divided into apical, medial and basal parts and cultured in presence or absence of 100μM gentamicin, 100μM neomycin and 5mM salicylate. Following the tissue fixation and staining with phalloidin-TRITC, the number of inner and outer hair cells (IHCs, OHCs) was scored under the fluorescent microscope. Presence of 5mM salicylate in explants cultures exposed to 100μM gentamicin significantly reduced the loss of IHCs and OHCs, as compared to explants exposed to gentamicin alone. In contrast, neomycin-induced auditory hair cell loss remained unaffected by the presence of salicylate. Our results corroborate earlier in vivo findings and validate the use of cochlear explants for future studies on ototoxicity and its prevention. Moreover, the inability of salicylate to prevent neomycin-induced ototoxicity implies possible differences between the mechanisms of auditory hair cell loss induced by gentamicin and neomycin.

  17. Activation of dormant secondary metabolite production by introducing neomycin resistance into the deep-sea fungus, Aspergillus versicolor ZBY-3.

    PubMed

    Dong, Yuan; Cui, Cheng-Bin; Li, Chang-Wei; Hua, Wei; Wu, Chang-Jing; Zhu, Tian-Jiao; Gu, Qian-Qun

    2014-07-29

    A new ultrasound-mediated approach has been developed to introduce neomycin-resistance to activate silent pathways for secondary metabolite production in a bio-inactive, deep-sea fungus, Aspergillus versicolor ZBY-3. Upon treatment of the ZBY-3 spores with a high concentration of neomycin by proper ultrasound irradiation, a total of 30 mutants were obtained by single colony isolation. The acquired resistance of the mutants to neomycin was confirmed by a resistance test. In contrast to the ZBY-3 strain, the EtOAc extracts of 22 of the 30 mutants inhibited the human cancer K562 cells, indicating that these mutants acquired a capability to produce antitumor metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses of the EtOAc extracts of seven bioactive mutants and the ZBY-3 strain indicated that diverse secondary metabolites have been newly produced in the mutant extracts in contrast to the ZBY-3 extract. The followed isolation and characterization demonstrated that six metabolites, cyclo(D-Pro-D-Phe) (1), cyclo(D-Tyr-D-Pro) (2), phenethyl 5-oxo-L-prolinate (3), cyclo(L-Ile-L-Pro) (4), cyclo(L-Leu-L-Pro) (5) and 3β,5α,9α-trihydroxy-(22E,24R)-ergosta-7,22-dien-6-one (6), were newly produced by the mutant u2n2h3-3 compared to the parent ZBY-3 strain. Compound 3 was a new compound; 2 was isolated from a natural source for the first time, and all of these compounds were also not yet found in the metabolites of other A. versicolor strains. Compounds 1-6 inhibited the K562 cells, with inhibition rates of 54.6% (1), 72.9% (2), 23.5% (3), 29.6% (4), 30.9% (5) and 51.1% (6) at 100 μg/mL, and inhibited also other human cancer HL-60, BGC-823 and HeLa cells, to some extent. The present study demonstrated the effectiveness of the ultrasound-mediated approach to activate silent metabolite production in fungi by introducing acquired resistance to aminoglycosides and its potential for discovering new compounds from silent fungal

  18. Activation of Dormant Secondary Metabolite Production by Introducing Neomycin Resistance into the Deep-Sea Fungus, Aspergillus versicolor ZBY-3

    PubMed Central

    Dong, Yuan; Cui, Cheng-Bin; Li, Chang-Wei; Hua, Wei; Wu, Chang-Jing; Zhu, Tian-Jiao; Gu, Qian-Qun

    2014-01-01

    A new ultrasound-mediated approach has been developed to introduce neomycin-resistance to activate silent pathways for secondary metabolite production in a bio-inactive, deep-sea fungus, Aspergillus versicolor ZBY-3. Upon treatment of the ZBY-3 spores with a high concentration of neomycin by proper ultrasound irradiation, a total of 30 mutants were obtained by single colony isolation. The acquired resistance of the mutants to neomycin was confirmed by a resistance test. In contrast to the ZBY-3 strain, the EtOAc extracts of 22 of the 30 mutants inhibited the human cancer K562 cells, indicating that these mutants acquired a capability to produce antitumor metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses of the EtOAc extracts of seven bioactive mutants and the ZBY-3 strain indicated that diverse secondary metabolites have been newly produced in the mutant extracts in contrast to the ZBY-3 extract. The followed isolation and characterization demonstrated that six metabolites, cyclo(d-Pro-d-Phe) (1), cyclo(d-Tyr-d-Pro) (2), phenethyl 5-oxo-l-prolinate (3), cyclo(l-Ile-l-Pro) (4), cyclo(l-Leu-l-Pro) (5) and 3β,5α,9α-trihydroxy-(22E,24R)-ergosta-7,22-dien-6-one (6), were newly produced by the mutant u2n2h3-3 compared to the parent ZBY-3 strain. Compound 3 was a new compound; 2 was isolated from a natural source for the first time, and all of these compounds were also not yet found in the metabolites of other A. versicolor strains. Compounds 1–6 inhibited the K562 cells, with inhibition rates of 54.6% (1), 72.9% (2), 23.5% (3), 29.6% (4), 30.9% (5) and 51.1% (6) at 100 μg/mL, and inhibited also other human cancer HL-60, BGC-823 and HeLa cells, to some extent. The present study demonstrated the effectiveness of the ultrasound-mediated approach to activate silent metabolite production in fungi by introducing acquired resistance to aminoglycosides and its potential for discovering new compounds from silent

  19. Protection by low-dose kanamycin against noise-induced hearing loss in mice: dependence on dosing regimen and genetic background.

    PubMed

    Ohlemiller, Kevin K; Rybak Rice, Mary E; Rosen, Allyson D; Montgomery, Scott C; Gagnon, Patricia M

    2011-10-01

    We recently demonstrated that sub-chronic low-dose kanamycin (KM, 300 mg/kg sc, 2×/day, 10 days) dramatically reduces permanent noise-induced hearing loss (NIHL) and hair cell loss in 1 month old CBA/J mice (Fernandez et al., 2010, J. Assoc. Res. Otolaryngol. 11, 235-244). Protection by KM remained for at least 48 h after the last dose, and appeared to involve a cumulative effect of multiple doses as part of a preconditioning process. The first month of life lies within the early 'sensitive period' for both cochlear noise and ototoxic injury in mice, and CBA/J mice appear exquisitely vulnerable to noise during this period (Ohlemiller et al., 2011; Hearing Res. 272, 13-20). From our initial data, we could not rule out 1) that less rigorous treatment protocols than the intensive one we applied may be equally-or more-protective; 2) that protection by KM is tightly linked to processes unique to the sensitive period for noise or ototoxins; or 3) that protection by KM is exclusive to CBA/J mice. The present experiments address these questions by varying the number and timing of fixed doses (300 mg/kg sc) of KM, as well as the age at treatment in CBA/J mice. We also tested for protection in young C57BL/6J (B6) mice. We find that nearly complete protection against at least 2 h of intense (110 dB SPL) broadband noise can be observed in CBA/J mice at least for ages up to 1 year. Reducing dosing frequency to as little as once every other day (a four-fold decrease in dosing frequency) appeared as protective as twice per day. However, reducing the number of doses to just 1 or 2, followed by noise 24 or 48 h later greatly reduced protection. Notably, hearing thresholds and hair cells in young B6 mice appeared completely unprotected by the same regimen that dramatically protects CBA/J mice. We conclude that protective effects of KM against NIHL in CBA/J mice can be engaged by a wide range of dosing regimens, and are not exclusive to the sensitive period for noise or ototoxins

  20. An adaptable pentaloop defines a robust neomycin-B RNA aptamer with conditional ligand-bound structures

    PubMed Central

    Ilgu, Muslum; Fulton, D. Bruce; Yennamalli, Ragothaman M.; Lamm, Monica H.; Sen, Taner Z.; Nilsen-Hamilton, Marit

    2014-01-01

    Aptamers can be highly specific for their targets, which implies precise molecular recognition between aptamer and target. However, as small polymers, their structures are more subject to environmental conditions than the more constrained longer RNAs such as those that constitute the ribosome. To understand the balance between structural and environmental factors in establishing ligand specificity of aptamers, we examined the RNA aptamer (NEO1A) previously reported as specific for neomycin-B. We show that NEO1A can recognize other aminoglycosides with similar affinities as for neomycin-B and its aminoglycoside specificity is strongly influenced by ionic strength and buffer composition. NMR and 2-aminopurine (2AP) fluorescence studies of the aptamer identified a flexible pentaloop and a stable binding pocket. Consistent with a well-structured binding pocket, docking analysis results correlated with experimental measures of the binding energy for most ligands. Steady state fluorescence studies of 2AP-substituted aptamers confirmed that A16 moves to a more solvent accessible position upon ligand binding while A14 moves to a less solvent accessible position, which is most likely a base stack. Analysis of binding affinities of NEO1A sequence variants showed that the base in position 16 interacts differently with each ligand and the interaction is a function of the buffer constituents. Our results show that the pentaloop provides NEO1A with the ability to adapt to external influences on its structure, with the critical base at position 16 adjusting to incorporate each ligand into a stable pocket by hydrophobic interactions and/or hydrogen bonds depending on the ligand and the ionic environment. PMID:24757168

  1. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss--A Manganese-Enhanced MRI (MEMRI) Study.

    PubMed

    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar

    2016-01-01

    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms. PMID:27078034

  2. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss--A Manganese-Enhanced MRI (MEMRI) Study.

    PubMed

    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar

    2016-01-01

    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms.

  3. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss - A Manganese-Enhanced MRI (MEMRI) Study

    PubMed Central

    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar

    2016-01-01

    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms. PMID:27078034

  4. Cochlear repair by transplantation of human cord blood CD133+ cells to nod-scid mice made deaf with kanamycin and noise.

    PubMed

    Revoltella, Roberto P; Papini, Sandra; Rosellini, Alfredo; Michelini, Monica; Franceschini, Valeria; Ciorba, Andrea; Bertolaso, Lucia; Magosso, Sara; Hatzopoulos, Stavros; Lorito, Guiscardo; Giordano, Pietro; Simoni, Edi; Ognio, Emanuela; Cilli, Michele; Saccardi, Riccardo; Urbani, Serena; Jeffery, Rosemary; Poulsom, Richard; Martini, Alessandro

    2008-01-01

    We investigated the fate of human cord blood CD133+ hematopoietic stem cells (HSC) transplanted intravenously (IV) into irradiated nod-scid mice previously made deaf by ototoxic treatment with kanamycin and/ or intense noise, to verify whether HSC engraft the cochlea and contribute to inner ear restoration, in vivo. We tested the presence of HLA.DQalpha1 by PCR, used for traceability of engrafted cells, finding evidence that HSC migrated to various host tissues, including the organ of Corti (OC). By histology, antibody and lectin-staining analysis, we confirmed that HSC IV transplantation in mice previously damaged by ototoxic agents correlated with the repair process and stimulation ex novo of morphological recovery in the inner ear, while the cochlea of control oto-injured, nontransplanted mice remained seriously damaged. Dual color FISH analysis also provided evidence of positive engraftment in the inner ear and in various mouse tissues, also revealing small numbers of heterokaryons, probably derived from fusion of donor with endogenous cells, for up to 2 months following transplantation. These observations offer the first evidence that transplanted human HSC migrating to the inner ear of oto-injured mice may provide conditions for the resumption of deafened cochlea, emerging as a potential strategy for inner ear rehabilitation. PMID:18819255

  5. Synthesis of C-5, C-2' and C-4'-neomycin-conjugated triplex forming oligonucleotides and their affinity to DNA-duplexes.

    PubMed

    Tähtinen, Ville; Granqvist, Lotta; Virta, Pasi

    2015-08-01

    Neomycin-conjugated homopyrimidine oligo 2'-deoxyribonucleotides have been synthesized on a solid phase and their potential as triplex forming oligonucleotides (TFOs) with DNA-duplexes has been studied. For the synthesis of the conjugates, C-5, C-2' and C-4'-tethered alkyne-modified nucleoside derivatives were used as an integral part of the standard automated oligonucleotide chain elongation. An azide-derived neomycin was then conjugated to the incorporated terminal alkynes by Cu(I)-catalyzed 1,3-dipolar cycloaddition (the click chemistry). Concentrated ammonia released the desired conjugates in acceptable purity and yields. The site of conjugation was expectedly important for the Hoogsteen-face recognition: C-5-conjugation showed a notable positive effect, whereas the influence of the C-2' and C-4'-modification remained marginal. In addition to conventional characterization methods (UV- and CD-spectroscopy), (19)F NMR spectroscopy was applied for the monitoring of triplex/duplex/single strand-conversions.

  6. Activation of the silent secondary metabolite production by introducing neomycin-resistance in a marine-derived Penicillium purpurogenum G59.

    PubMed

    Wu, Chang-Jing; Yi, Le; Cui, Cheng-Bin; Li, Chang-Wei; Wang, Nan; Han, Xiao

    2015-04-22

    Introduction of neomycin-resistance into a marine-derived, wild-type Penicillium purpurogenum G59 resulted in activation of silent biosynthetic pathways for the secondary metabolite production. Upon treatment of G59 spores with neomycin and dimethyl sulfoxide (DMSO), a total of 56 mutants were obtained by single colony isolation. The acquired resistance of mutants to neomycin was testified by the resistance test. In contrast to the G59 strain, the EtOAc extracts of 28 mutants inhibited the human cancer K562 cells, indicating that the 28 mutants have acquired the capability to produce bioactive metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses further indicated that diverse secondary metabolites have been newly produced in the bioactive mutant extracts. Followed isolation and characterization demonstrated that five bioactive secondary metabolites, curvularin (1), citrinin (2), penicitrinone A (3), erythro-23-O-methylneocyclocitrinol (4) and 22E-7α-methoxy-5α, 6α-epoxyergosta-8(14),22-dien-3β-ol (5), were newly produced by a mutant, 4-30, compared to the G59 strain. All 1-5 were also not yet found in the secondary metabolites of other wild type P. purpurogenum strains. Compounds 1-5 inhibited human cancer K562, HL-60, HeLa and BGC-823 cells to varying extents. Both present bioassays and chemical investigations demonstrated that the introduction of neomycin-resistance into the marine-derived fungal G59 strain could activate silent secondary metabolite production. The present work not only extended the previous DMSO-mediated method for introducing drug-resistance in fungi both in DMSO concentrations and antibiotics, but also additionally exemplified effectiveness of this method for activating silent fungal secondary metabolites. This method could be applied to other fungal isolates to elicit their metabolic potentials to investigate secondary metabolites from silent biosynthetic pathways.

  7. Reduced TRMU expression increases the sensitivity of hair-cell-like HEI-OC-1 cells to neomycin damage in vitro.

    PubMed

    He, Zuhong; Sun, Shan; Waqas, Muhammad; Zhang, Xiaoli; Qian, Fuping; Cheng, Cheng; Zhang, Mingshu; Zhang, Shasha; Wang, Yongming; Tang, Mingliang; Li, Huawei; Chai, Renjie

    2016-07-13

    Aminoglycosides are ototoxic to the cochlear hair cells, and mitochondrial dysfunction is one of the major mechanisms behind ototoxic drug-induced hair cell death. TRMU (tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase) is a mitochondrial protein that participates in mitochondrial tRNA modifications, but the role of TRMU in aminoglycoside-induced ototoxicity remains to be elucidated. In this study, we took advantage of the HEI-OC-1 cell line to investigate the role of TRMU in aminoglycoside-induced cell death. We found that TRMU is expressed in both hair cells and HEI-OC-1 cells, and its expression is significantly decreased after 24 h neomycin treatment. We then downregulated TRMU expression with siRNA and found that cell death and apoptosis were significantly increased after neomycin injury. Furthermore, when we down-regulated TRMU expression, we observed significantly increased mitochondrial dysfunction and increased levels of reactive oxygen species (ROS) after neomycin injury, suggesting that TRMU regulates mitochondrial function and ROS levels. Lastly, the antioxidant N-acetylcysteine rescued the mitochondrial dysfunction and cell apoptosis that was induced by TRMU downregulation, suggesting that ROS accumulation contributed to the increased aminoglycosides sensitivity of HEI-OC-1 cells after TRMU downregulation. This study provides evidence that TRMU might be a new therapeutic target for the prevention of aminoglycoside-induced hair cell death.

  8. Reduced TRMU expression increases the sensitivity of hair-cell-like HEI-OC-1 cells to neomycin damage in vitro

    PubMed Central

    He, Zuhong; Sun, Shan; Waqas, Muhammad; Zhang, Xiaoli; Qian, Fuping; Cheng, Cheng; Zhang, Mingshu; Zhang, Shasha; Wang, Yongming; Tang, Mingliang; Li, Huawei; Chai, Renjie

    2016-01-01

    Aminoglycosides are ototoxic to the cochlear hair cells, and mitochondrial dysfunction is one of the major mechanisms behind ototoxic drug-induced hair cell death. TRMU (tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase) is a mitochondrial protein that participates in mitochondrial tRNA modifications, but the role of TRMU in aminoglycoside-induced ototoxicity remains to be elucidated. In this study, we took advantage of the HEI-OC-1 cell line to investigate the role of TRMU in aminoglycoside-induced cell death. We found that TRMU is expressed in both hair cells and HEI-OC-1 cells, and its expression is significantly decreased after 24 h neomycin treatment. We then downregulated TRMU expression with siRNA and found that cell death and apoptosis were significantly increased after neomycin injury. Furthermore, when we down-regulated TRMU expression, we observed significantly increased mitochondrial dysfunction and increased levels of reactive oxygen species (ROS) after neomycin injury, suggesting that TRMU regulates mitochondrial function and ROS levels. Lastly, the antioxidant N-acetylcysteine rescued the mitochondrial dysfunction and cell apoptosis that was induced by TRMU downregulation, suggesting that ROS accumulation contributed to the increased aminoglycosides sensitivity of HEI-OC-1 cells after TRMU downregulation. This study provides evidence that TRMU might be a new therapeutic target for the prevention of aminoglycoside-induced hair cell death. PMID:27405449

  9. Determination of neomycin and oxytetracycline in the presence of their impurities in veterinary dosage forms by high-performance liquid chromatography/tandem mass spectrometry.

    PubMed

    Vucićević-Prcetić, Katarina; Cservenák, Robert; Radulović, Niko

    2011-01-01

    Two HPLC/MS/MS methods, one for determination of neomycin sulfate and the other for determination of oxytetracycline hydrochloride in the presence of their impurities, were developed and validated. Separations were achieved with gradient elution on a C18 column. All components were ionized by positive-ion electrospray and detected by multiple reaction monitoring. Calibration curves were linear, with correlation coefficients >0.99. Precision of the methods was confirmed by RSD values of 0.34 and 0.71% for neomycin and oxytetracycline, respectively. Recovery values of 101.5 and 101.0%, respectively, indicated adequate accuracy. Analysis time for neomycin was 24 min, with the retention time of the main compound at 10.1 min; for oxytetracycline, the analysis time was 18 min, with the main peak at 9.95 min. Longer retention times than expected were a consequence of the necessity of chromatographic separation of isomers with the same ion transition. All impurities defined in the pharmacopoeias were determined and their identities confirmed. The methods were tested for QC of veterinary dosage forms (commercial powders and injections containing these antibiotics).

  10. The neomycin biosynthetic gene cluster of Streptomyces fradiae NCIMB 8233: genetic and biochemical evidence for the roles of two glycosyltransferases and a deacetylase.

    PubMed

    Fan, Qingzhi; Huang, Fanglu; Leadlay, Peter F; Spencer, Jonathan B

    2008-09-21

    An efficient protocol has been developed for the genetic manipulation of Streptomyces fradiae NCIMB 8233, which produces the 2-deoxystreptamine (2-DOS)-containing aminoglycoside antibiotic neomycin. This has allowed the in vivo analysis of the respective roles of the glycosyltransferases Neo8 and Neo15, and of the deacetylase Neo16 in neomycin biosynthesis. Specific deletion of each of the neo8, neo15 and neo16 genes confirmed that they are all essential for neomycin biosynthesis. The pattern of metabolites produced by feeding putative pathway intermediates to these mutants provided unambiguous support for a scheme in which Neo8 and Neo15, whose three-dimensional structures are predicted to be highly similar, have distinct roles: Neo8 catalyses transfer of N-acetylglucosamine to 2-DOS early in the pathway, while Neo15 catalyses transfer of the same aminosugar to ribostamycin later in the pathway. The in vitro substrate specificity of Neo15, purified from recombinant Escherichia coli, was fully consistent with these findings. The in vitro activity of Neo16, the only deacetylase so far recognised in the neo gene cluster, showed that it is capable of acting in tandem with both Neo8 and Neo15 as previously proposed. However, the deacetylation of N-acetylglucosaminylribostamycin was still observed in a strain deleted of the neo16 gene and fed with suitable pathway precursors, providing evidence for the existence of a second enzyme in S. fradiae with this activity.

  11. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  12. Mechanistic Study on the Nuclear Modifier Gene MSS1 Mutation Suppressing Neomycin Sensitivity of the Mitochondrial 15S rRNA C1477G Mutation in Saccharomyces cerevisiae

    PubMed Central

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations. PMID:24595024

  13. Reduced TRMU expression increases the sensitivity of hair-cell-like HEI-OC-1 cells to neomycin damage in vitro.

    PubMed

    He, Zuhong; Sun, Shan; Waqas, Muhammad; Zhang, Xiaoli; Qian, Fuping; Cheng, Cheng; Zhang, Mingshu; Zhang, Shasha; Wang, Yongming; Tang, Mingliang; Li, Huawei; Chai, Renjie

    2016-01-01

    Aminoglycosides are ototoxic to the cochlear hair cells, and mitochondrial dysfunction is one of the major mechanisms behind ototoxic drug-induced hair cell death. TRMU (tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase) is a mitochondrial protein that participates in mitochondrial tRNA modifications, but the role of TRMU in aminoglycoside-induced ototoxicity remains to be elucidated. In this study, we took advantage of the HEI-OC-1 cell line to investigate the role of TRMU in aminoglycoside-induced cell death. We found that TRMU is expressed in both hair cells and HEI-OC-1 cells, and its expression is significantly decreased after 24 h neomycin treatment. We then downregulated TRMU expression with siRNA and found that cell death and apoptosis were significantly increased after neomycin injury. Furthermore, when we down-regulated TRMU expression, we observed significantly increased mitochondrial dysfunction and increased levels of reactive oxygen species (ROS) after neomycin injury, suggesting that TRMU regulates mitochondrial function and ROS levels. Lastly, the antioxidant N-acetylcysteine rescued the mitochondrial dysfunction and cell apoptosis that was induced by TRMU downregulation, suggesting that ROS accumulation contributed to the increased aminoglycosides sensitivity of HEI-OC-1 cells after TRMU downregulation. This study provides evidence that TRMU might be a new therapeutic target for the prevention of aminoglycoside-induced hair cell death. PMID:27405449

  14. The expression of NLRX1 in C57BL/6 mice cochlear hair cells: Possible relation to aging- and neomycin-induced deafness.

    PubMed

    Yang, Qianqian; Sun, Gaoying; Cao, Zhixin; Yin, Haiyan; Qi, Qi; Wang, Jinghan; Liu, Wenwen; Bai, Xiaohui; Wang, Haibo; Li, Jianfeng

    2016-03-11

    Nucleotide-binding domain and leucine-rich-repeat-containing family member X1 (NLRX1) is a cytoplasmic pattern recognition receptor that is predominantly located in mitochondria, which is tightly related to mitochondrial damage, reactive oxygen species (ROS) production, inflammation and apoptosis. The present study was designed to explore whether NLRX1 expresses in C57BL/6 mice cochlear hair cells and, if so, to investigate the possible correlations between NLRX1 and hearing. The location and dynamic expression of NLRX1 were investigated by immunofluorescence, real-time PCR and Western blotting. Hearing thresholds of C57BL/6 mice were measured by auditory brainstem response (ABR). Moreover, the downstream inflammatory and apoptotic pathways regulated by NLRX1 were examined in age-related and neomycin-induced hair cell damage. Data showed that NLRX1 expressed in cytoplasm of C57BL/6 cochlear hair cells, especially in the cilia, which were essential for sound sensation. The expression of NLRX1 in hair cells increased as the mice grew up, and, decreased as they aged. Additionally, the activated apoptotic JNK pathway was detected in 9-month old mice with worse-hearing and 3-month old mice treated with neomycin. Overall, results indicate that NLRX1 may relate to hair cell maturity, hearing formation and maintenance, and promote hair cell apoptosis through JNK pathway induced by aging and neomycin.

  15. The expression of NLRX1 in C57BL/6 mice cochlear hair cells: Possible relation to aging- and neomycin-induced deafness.

    PubMed

    Yang, Qianqian; Sun, Gaoying; Cao, Zhixin; Yin, Haiyan; Qi, Qi; Wang, Jinghan; Liu, Wenwen; Bai, Xiaohui; Wang, Haibo; Li, Jianfeng

    2016-03-11

    Nucleotide-binding domain and leucine-rich-repeat-containing family member X1 (NLRX1) is a cytoplasmic pattern recognition receptor that is predominantly located in mitochondria, which is tightly related to mitochondrial damage, reactive oxygen species (ROS) production, inflammation and apoptosis. The present study was designed to explore whether NLRX1 expresses in C57BL/6 mice cochlear hair cells and, if so, to investigate the possible correlations between NLRX1 and hearing. The location and dynamic expression of NLRX1 were investigated by immunofluorescence, real-time PCR and Western blotting. Hearing thresholds of C57BL/6 mice were measured by auditory brainstem response (ABR). Moreover, the downstream inflammatory and apoptotic pathways regulated by NLRX1 were examined in age-related and neomycin-induced hair cell damage. Data showed that NLRX1 expressed in cytoplasm of C57BL/6 cochlear hair cells, especially in the cilia, which were essential for sound sensation. The expression of NLRX1 in hair cells increased as the mice grew up, and, decreased as they aged. Additionally, the activated apoptotic JNK pathway was detected in 9-month old mice with worse-hearing and 3-month old mice treated with neomycin. Overall, results indicate that NLRX1 may relate to hair cell maturity, hearing formation and maintenance, and promote hair cell apoptosis through JNK pathway induced by aging and neomycin. PMID:26836140

  16. Cotransfection of Pax2 and Math1 promote in situ cochlear hair cell regeneration after neomycin insult.

    PubMed

    Chen, Yan; Yu, Huiqian; Zhang, Yanping; Li, Wen; Lu, Na; Ni, Wenli; He, Yingzi; Li, Jin; Sun, Shan; Wang, Zhengmin; Li, Huawei

    2013-10-21

    The ideal strategy for hair cell regeneration is promoting residual supporting cell proliferation followed by induction of hair cell differentiation. In this study, cultured neonatal mouse organs of Corti were treated with neomycin to eliminate hair cells followed by incubation with recombined adenovirus expressing Pax2 and/or Math1. Results showed that overexpression of Pax2 significantly promoted proliferation of supporting cells. The number of BrdU⁺/myosin VIIA⁺ cells increased significantly in hair cell pre-existing region two weeks after adenovirus infection in Ad-Pax2-IRES-Math1 group compared to Ad-Pax2 and Ad-Math1 groups. This indicated that cotransfection of Pax2 and Math1 induced supporting cells to proliferate and differentiate into hair cells in situ. Most new hair cells were labeled by FM1-43 suggesting they acquired certain function. The results also suggest that inducing proliferating cells rather than quiescent cells to differentiate into hair cells by forced expression of Math1 is feasible for mammalian hair cell regeneration.

  17. 60Co-irradiation as an alternate method for sterilization of penicillin G, neomycin, novobiocin, and dihydrostreptomycin

    SciTech Connect

    Tsuji, K.; Rahn, P.D.; Steindler, K.A.

    1983-01-01

    The effects of the use of 60Co-irradiation to sterilize antibiotics were evaluated. The antibiotic powders were only occasionally contaminated with microorganisms. The D-values of the products and environmental isolates were 0.028, 0.027, 0.015, 0.046, 0.15, 0.018, and 0.19 Mrads for Aspergillus species (UC 7297, 7298), A. fumigatus (UC 7299), Rhodotorula species (UC 7300), Penicillium oxalicum (UC 7269), Pseudomonas maltophilia (UC 6855), and a biological indicator microorganism, Bacillus pumilus spores (ATCC 27142). An irradiation dose of 1.14 Mrads, therefore, was sufficient to achieve a six-log cycle destruction of B. pumilus spores. Based on the bioburden data, a minimum irradiation dose of 1.05 Mrads was calculated to be sufficient to obtain a 10(-6) probability of sterilizing the most radioresistant isolate, Pen. oxalicum. To determine the radiolytic degradation scheme and the stability of the antibiotics following irradiation, high-performance liquid chromatographic (HPLC) methods were developed. The resulting rates of degradation for the antibiotics were 0.6, 1.2, 2.3, and 0.95%/Mrad for penicillin G, neomycin, novobiocin, and dihydrostreptomycin, respectively. Furthermore, radiolytic degradation pathways for the antibiotics were identified and found to be similar to those commonly encountered when antibiotics are subjected to acidic, basic, hydrolytic, or oxidative treatments. No radiolytic compounds unique to 60Co-irradiation were found.

  18. Gene-targeted embryonic stem cells: real-time PCR assay for estimation of the number of neomycin selection cassettes

    PubMed Central

    2011-01-01

    In the preparation of transgenic murine ES cells it is important to verify the construct has a single insertion, because an ectopic neomycin phosphortransferase positive selection cassette (NEO) may cause a position effect. During a recent work, where a knockin SCA28 mouse was prepared, we developed two assays based on Real-Time PCR using both SYBR Green and specific minor groove binder (MGB) probes to evaluate the copies of NEO using the comparative delta-delta Ct method versus the Rpp30 reference gene. We compared the results from Southern blot, routinely used to quantify NEO copies, with the two Real-Time PCR assays. Twenty-two clones containing the single NEO copy showed values of 0.98 ± 0.24 (mean ± 2 S.D.), and were clearly distinguishable from clones with two or more NEO copies. This method was found to be useful, easy, sensitive and fast and could substitute for the widely used, but laborious Southern blot method. PMID:22035318

  19. Conjugation of a Ru(II) arene complex to neomycin or to guanidinoneomycin leads to compounds with differential cytotoxicities and accumulation between cancer and normal cells.

    PubMed

    Grau-Campistany, Ariadna; Massaguer, Anna; Carrion-Salip, Dolors; Barragán, Flavia; Artigas, Gerard; López-Senín, Paula; Moreno, Virtudes; Marchán, Vicente

    2013-05-01

    A straightforward methodology for the synthesis of conjugates between a cytotoxic organometallic ruthenium(II) complex and amino- and guanidinoglycosides, as potential RNA-targeted anticancer compounds, is described. Under microwave irradiation, the imidazole ligand incorporated on the aminoglycoside moiety (neamine or neomycin) was found to replace one triphenylphosphine ligand from the ruthenium precursor [(η(6)-p-cym)RuCl(PPh3)2](+), allowing the assembly of the target conjugates. The guanidinylated analogue was easily prepared from the neomycin-ruthenium conjugate by reaction with N,N'-di-Boc-N″-triflylguanidine, a powerful guanidinylating reagent that was compatible with the integrity of the metal complex. All conjugates were purified by semipreparative high-performance liquid chromatography (HPLC) and characterized by electrospray ionization (ESI) and matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) and NMR spectroscopy. The cytotoxicity of the compounds was tested in MCF-7 (breast) and DU-145 (prostate) human cancer cells, as well as in the normal HEK293 (Human Embryonic Kidney) cell line, revealing a dependence on the nature of the glycoside moiety and the type of cell (cancer or healthy). Indeed, the neomycin-ruthenium conjugate (2) displayed moderate antiproliferative activity in both cancer cell lines (IC50 ≈ 80 μM), whereas the neamine conjugate (4) was inactive (IC50 ≈ 200 μM). However, the guanidinylated analogue of the neomycin-ruthenium conjugate (3) required much lower concentrations than the parent conjugate for equal effect (IC50 = 7.17 μM in DU-145 and IC50 = 11.33 μM in MCF-7). Although the same ranking in antiproliferative activity was found in the nontumorigenic cell line (3 ≫ 2 > 4), IC50 values indicate that aminoglycoside-containing conjugates are about 2-fold more cytotoxic in normal cells (e.g., IC50 = 49.4 μM for 2) than in cancer cells, whereas an opposite tendency was found

  20. Bax, Bcl2, and p53 differentially regulate neomycin- and gentamicin-induced hair cell death in the zebrafish lateral line.

    PubMed

    Coffin, Allison B; Rubel, Edwin W; Raible, David W

    2013-10-01

    Sensorineural hearing loss is a normal consequence of aging and results from a variety of extrinsic challenges such as excessive noise exposure and certain therapeutic drugs, including the aminoglycoside antibiotics. The proximal cause of hearing loss is often death of inner ear hair cells. The signaling pathways necessary for hair cell death are not fully understood and may be specific for each type of insult. In the lateral line, the closely related aminoglycoside antibiotics neomycin and gentamicin appear to kill hair cells by activating a partially overlapping suite of cell death pathways. The lateral line is a system of hair cell-containing sense organs found on the head and body of aquatic vertebrates. In the present study, we use a combination of pharmacologic and genetic manipulations to assess the contributions of p53, Bax, and Bcl2 in the death of zebrafish lateral line hair cells. Bax inhibition significantly protects hair cells from neomycin but not from gentamicin toxicity. Conversely, transgenic overexpression of Bcl2 attenuates hair cell death due to gentamicin but not neomycin, suggesting a complex interplay of pro-death and pro-survival proteins in drug-treated hair cells. p53 inhibition protects hair cells from damage due to either aminoglycoside, with more robust protection seen against gentamicin. Further experiments evaluating p53 suggest that inhibition of mitochondrial-specific p53 activity confers significant hair cell protection from either aminoglycoside. These results suggest a role for mitochondrial p53 activity in promoting hair cell death due to aminoglycosides, likely upstream of Bax and Bcl2.

  1. Transformation of human epidermal cells by transfection with plasmid containing simian virus 40 DNA linked to a neomycin gene is a defined medium

    SciTech Connect

    Su, R.T.; Yen-Chu Chang )

    1989-01-01

    A human epidermal cell culture was transformed by transfection with a recombinant plasmid containing simian virus 40 DNA with a deletion at the origin and an antibiotic (neomycin or G418) marker. A calcium phosphate-mediated DNA transfection method was optimized for introducing exogenous DNA into cells maintained in a fully defined medium. The transformed cells were propagated for more than 200 population doublings and did not appear to go through a crisis period. The growth characteristics of the transformed cells were similar to those found in normal epidermal cells. Transformed cells initially transfected with the recombinant plasmid could be propagated for more than 30 passages. Actively growing cells could then be repeatedly selected from cell populations based upon their neomycin (G418)-resistant phenotype for at least another 30 passages. Simian virus 40 T-antigen and extrachromosomal DNA containing plasmid- and SV40-specific DNA sequences were detected in the transformed cells. Because of their nononcogenic phenotype and defined growth requirements, the transformed cells provide a model for examining structural changes during cell proliferation and differentiation, and for exploring the multistage carcinogenesis of human epithelial cells.

  2. Hydrocortisone, Neomycin, and Polymyxin

    MedlinePlus

    ... Wash your hands thoroughly with soap and warm water. Gently clean your ear with a damp facecloth and then ... directions: Wash your hands thoroughly with soap and water. Avoid touching ... must be kept clean. Holding the tube between your thumb and forefinger, ...

  3. Neomycin damage and regeneration of hair cells in both mechanoreceptor and electroreceptor lateral line organs of the larval Siberian sturgeon (Acipenser baerii).

    PubMed

    Fan, Chunxin; Zou, Sha; Wang, Jian; Zhang, Bo; Song, Jiakun

    2016-05-01

    The lateral line found in some amphibians and fishes has two distinctive classes of sensory organs: mechanoreceptors (neuromasts) and electroreceptors (ampullary organs). Hair cells in neuromasts can be damaged by aminoglycoside antibiotics and they will regenerate rapidly afterward. Aminoglycoside sensitivity and the capacity for regeneration have not been investigated in ampullary organs. We treated Siberian sturgeon (Acipenser baerii) larvae with neomycin and observed loss and regeneration of sensory hair cells in both organs by labeling with DASPEI and scanning electron microscopy (SEM). The numbers of sensory hair cells in both organs were reduced to the lowest levels at 6 hours posttreatment (hpt). New sensory hair cells began to appear at 12 hpt and were regenerated completely in 7 days. To reveal the possible mechanism for ampullary hair cell regeneration, we analyzed cell proliferation and the expression of neural placodal gene eya1 during regeneration. Both cell proliferation and eya1 expression were concentrated in peripheral mantle cells and both increased to the highest level at 12 hpt, which is consistent with the time course for regeneration of the ampullary hair cells. Furthermore, we used Texas Red-conjugated gentamicin in an uptake assay following pretreatment with a cation channel blocker (amiloride) and found that entry of the antibiotic was suppressed in both organs. Together, our results indicate that ampullary hair cells in Siberian sturgeon larvae can be damaged by neomycin exposure and they can regenerate rapidly. We suggest that the mechanisms for aminoglycoside uptake and hair cell regeneration are conserved for mechanoreceptors and electroreceptors. J. Comp. Neurol. 524:1443-1456, 2016. © 2015 Wiley Periodicals, Inc.

  4. [Treatment of puerperal endometritis. Evaluation of the efficacy and safety of clindamycin + gentamycin vs. penicillin + chloramphenicol + gentamycin].

    PubMed

    Gutiérrez, C; Carrillo, C; Escudero, F; Caciano, S; García Hjarles, M

    1994-11-01

    This was a prospective, single-blind, comparative study in patients with diagnosis of puerperal endometritis, carried out at the Loayza Hospital in Lima, Peru. The objective of this study was to evaluate the efficacy and safety of clindamycin and gentamicin in the management of endometritis vs. penicillin, chloramphenicol and gentamicin for 10 days. Sixty-five patients were enrolled and 62 were evaluable for efficacy. Both treatment groups were comparable in the pre-treatment period in terms of age, history of pregnancies, controls by gynecologist, days of disease and fever, clinical symptoms like fever, pelvic pain, pulse, uterine size and in laboratory, in hematocrit and leukocytes count. In the culture of endometrium tissue, 27/32 patients (84.4%) in Group A (penicillin + CAF + gentamicin) and 27/30 patients (90%) in Group B (clindamycin + gentamicin) had positive cultures at baseline; 18 and 22 patients showed anaerobes; 8 and 4 patients showed anaerobes plus aerobes and, one patient in each treatment group showed aerobes only. Peptostreptococcus and Bacteroides fragilis were the most frequently isolated pathogens. Improvement in lochia fetidity was more rapid in Group B, it turned transparent and not fetid since day 3. Complete cure was significantly better in Group B 24/30 (80%) in comparison with Group A 16/32 (50%) (p = 0.02). Partial response was found in 15 patients (43.3%) in Group A and 5 patients (16.6%) in Group B. Only one case was considered as bacteriological failure in Group A and only one patient in Group B was considered as failure and required an additional operation due to residual abscess.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7821833

  5. Comparison of Boric Acid and Combination Drug of Polymyxin, Neomycin and Hydrocortisone (polymyxin NH) in the Treatment of Acute Otitis Externa

    PubMed Central

    Moeini, Mohammad

    2016-01-01

    Introduction Acute otitis externa is an inflammation of the external auditory canal known as "swimmer’s ear". Direct costs including medical treatment, painkillers, antibiotics, steroids or both and indirect costs are also remarkable. Aim The aim of this study was to compare the effect of boric acid and polymyxin, neomycin and hydrocortisone composition in the treatment of acute otitis externa. Materials and Methods This randomized clinical trial was carried out on 80 patients aged more than 17-year-old who were referred to Kashani hospital clinic with a diagnosis of acute otitis externa by otolaryngologist. The patients were randomly allocated to two groups (A: Boric acid and B: polymyxin NH ear drops) and Painkiller was prescribed and administered orally for all patients and in the presence of fever, cellulitis around the ears and neck adenopathy, broad-spectrum systemic antibiotics were used besides topical treatment. Symptoms of patients who were evaluated by a physician includes pain, discharge from the ear, swelling of the ear canal, auricle swelling, tenderness, and ear itching. In addition, pain was evaluated in patients and was recorded by Macgill Pain Questionnaire, in the first, third, seventh and tenth days. Results Results showed that itching on third day (p=0.007) and swelling of the ear canal in the examination of the third day (p=0.006) and the seventh day (p=0.001) in the polymyxin NH group was more than those of boric acid group. Overall mean pain based on McGill questionnaire was 11.10±1.49 in boric acid group in the examination on the first day and was 4.05±0.22 in the examination on the tenth day and in the polymyxin NH group, it was 10.9±0.99 on the first day and 4.20±0.40 on the tenth day. In both groups, pain relief was the same and there was no significant difference between two groups (p=0.075). Conclusion The findings of this study showed slight differences in the effectiveness of the boric acid drug and combination of polymyxin

  6. Comparison of Boric Acid and Combination Drug of Polymyxin, Neomycin and Hydrocortisone (polymyxin NH) in the Treatment of Acute Otitis Externa

    PubMed Central

    Moeini, Mohammad

    2016-01-01

    Introduction Acute otitis externa is an inflammation of the external auditory canal known as "swimmer’s ear". Direct costs including medical treatment, painkillers, antibiotics, steroids or both and indirect costs are also remarkable. Aim The aim of this study was to compare the effect of boric acid and polymyxin, neomycin and hydrocortisone composition in the treatment of acute otitis externa. Materials and Methods This randomized clinical trial was carried out on 80 patients aged more than 17-year-old who were referred to Kashani hospital clinic with a diagnosis of acute otitis externa by otolaryngologist. The patients were randomly allocated to two groups (A: Boric acid and B: polymyxin NH ear drops) and Painkiller was prescribed and administered orally for all patients and in the presence of fever, cellulitis around the ears and neck adenopathy, broad-spectrum systemic antibiotics were used besides topical treatment. Symptoms of patients who were evaluated by a physician includes pain, discharge from the ear, swelling of the ear canal, auricle swelling, tenderness, and ear itching. In addition, pain was evaluated in patients and was recorded by Macgill Pain Questionnaire, in the first, third, seventh and tenth days. Results Results showed that itching on third day (p=0.007) and swelling of the ear canal in the examination of the third day (p=0.006) and the seventh day (p=0.001) in the polymyxin NH group was more than those of boric acid group. Overall mean pain based on McGill questionnaire was 11.10±1.49 in boric acid group in the examination on the first day and was 4.05±0.22 in the examination on the tenth day and in the polymyxin NH group, it was 10.9±0.99 on the first day and 4.20±0.40 on the tenth day. In both groups, pain relief was the same and there was no significant difference between two groups (p=0.075). Conclusion The findings of this study showed slight differences in the effectiveness of the boric acid drug and combination of polymyxin

  7. Thermodynamic insights into drug-surfactant interactions: Study of the interactions of naporxen, diclofenac sodium, neomycin, and lincomycin with hexadecytrimethylammonium bromide by using isothermal titration calorimetry.

    PubMed

    Choudhary, Sinjan; Talele, Paurnima; Kishore, Nand

    2015-08-01

    The success of drug delivery depends on the efficiency of the route of administration, which in turn relies on properties of the drug and its transport vehicle. A quantitative knowledge of association of drugs with transport vehicles is lacking when the latter are in the category of self assembled structures. The work reported in this manuscript addresses the mechanism of partitioning of naproxen, diclofenac sodium, neomycin and lincomycin in the micelles of hexadecytrimethylammonium bromide and that is quantitatively based on the measurement of thermodynamic parameters of interactions by using isothermal titration calorimetry. The addressed mechanism of partitioning is based on the identification of the type of interactions of these drugs with the surfactant micelles and monomers, along with the effect of the former on the micellization properties of the surfactant. The conclusions are based on the interpretation of the values of partitioning constant, standard molar enthalpy change, standard molar entropy change and the stoichiometry of the interaction. The results of this study have implications for deriving guidelines for the target oriented synthesis of new drugs that are to be used for effective delivery via micellar media.

  8. Occurrence of antibiotics in pharmaceutical industrial wastewater, wastewater treatment plant and sea waters in Tunisia.

    PubMed

    Tahrani, Leyla; Van Loco, Joris; Ben Mansour, Hedi; Reyns, Tim

    2016-04-01

    Antibiotics are among the most commonly used group of pharmaceuticals in human medicine. They can therefore reach surface and groundwater bodies through different routes, such as wastewater treatment plant effluents, surface runoff, or infiltration of water used for agricultural purposes. It is well known that antibiotics pose a significant risk to environmental and human health, even at low concentrations. The aim of the present study was to evaluate the presence of aminoglycosides and phenicol antibiotics in municipal wastewaters, sea water and pharmaceutical effluents in Tunisia. All analysed water samples contained detectable levels of aminoglycoside and phenicol antibiotics. The highest concentrations in wastewater influents were observed for neomycin and kanamycin B (16.4 ng mL(-1) and 7.5 ng mL(-1), respectively). Chloramphenicol was found in wastewater influents up to 3 ng mL(-1). It was observed that the waste water treatment plants were not efficient in completely removing these antibiotics. Chloramphenicol and florfenicol were found in sea water samples near aquaculture sites at levels up to, respectively, 15.6 ng mL(-1) and 18.4 ng mL(-1). Also aminoglycoside antibiotics were found near aquaculture sites with the highest concentration of 3.4 ng mL(-1) for streptomycin. In pharmaceutical effluents, only gentamycin was found at concentrations up to 19 ng mL(-1) over a sampling period of four months. PMID:27105406

  9. Occurrence of antibiotics in pharmaceutical industrial wastewater, wastewater treatment plant and sea waters in Tunisia.

    PubMed

    Tahrani, Leyla; Van Loco, Joris; Ben Mansour, Hedi; Reyns, Tim

    2016-04-01

    Antibiotics are among the most commonly used group of pharmaceuticals in human medicine. They can therefore reach surface and groundwater bodies through different routes, such as wastewater treatment plant effluents, surface runoff, or infiltration of water used for agricultural purposes. It is well known that antibiotics pose a significant risk to environmental and human health, even at low concentrations. The aim of the present study was to evaluate the presence of aminoglycosides and phenicol antibiotics in municipal wastewaters, sea water and pharmaceutical effluents in Tunisia. All analysed water samples contained detectable levels of aminoglycoside and phenicol antibiotics. The highest concentrations in wastewater influents were observed for neomycin and kanamycin B (16.4 ng mL(-1) and 7.5 ng mL(-1), respectively). Chloramphenicol was found in wastewater influents up to 3 ng mL(-1). It was observed that the waste water treatment plants were not efficient in completely removing these antibiotics. Chloramphenicol and florfenicol were found in sea water samples near aquaculture sites at levels up to, respectively, 15.6 ng mL(-1) and 18.4 ng mL(-1). Also aminoglycoside antibiotics were found near aquaculture sites with the highest concentration of 3.4 ng mL(-1) for streptomycin. In pharmaceutical effluents, only gentamycin was found at concentrations up to 19 ng mL(-1) over a sampling period of four months.

  10. A method of batch-purifying microalgae with multiple antibiotics at extremely high concentrations

    NASA Astrophysics Data System (ADS)

    Han, Jichang; Wang, Song; Zhang, Lin; Yang, Guanpin; Zhao, Lu; Pan, Kehou

    2016-01-01

    Axenic microalgal strains are highly valued in diverse microalgal studies and applications. Antibiotics, alone or in combination, are often used to avoid bacterial contamination during microalgal isolation and culture. In our preliminary trials, we found that many microalgae ceased growing in antibiotics at extremely high concentrations but could resume growth quickly when returned to an antibiotics-free liquid medium and formed colonies when spread on a solid medium. We developed a simple and highly efficient method of obtaining axenic microalgal cultures based on this observation. First, microalgal strains of different species or strains were treated with a mixture of ampicillin, gentamycin sulfate, kanamycin, neomycin and streptomycin (each at a concentration of 600 mg/L) for 3 days; they were then transferred to antibiotics-free medium for 5 days; and finally they were spread on solid f/2 media to allow algal colonies to form. With this method, five strains of Nannochloropsis sp. (Eustigmatophyceae), two strains of Cylindrotheca sp. (Bacillariophyceae), two strains of Tetraselmis sp. (Chlorodendrophyceae) and one strain of Amphikrikos sp. (Trebouxiophyceae) were purified successfully. The method shows promise for batch-purifying microalgal cultures.

  11. [Microbiological research for the Hungarian pharmaceutical industry].

    PubMed

    Ambrus, G

    2001-01-01

    A survey is presented on the last 50 years of biotechnological R & D activities in the Institute for Drug Research, Budapest. In the 1950s and 1960s this Institute played an important role in the industry of antibiotics in Hungary, contributing to the development of manufacturing processes for streptomycin, oxytetracycline, neomycin and nystatine. In the late 1950s a microbial screening program was initiated, which led to the discovery of several new antibiotics and the isolation of microorganisms producing medically important, known antibiotics and other therapeutical agents of microbial origin from natural sources. In the 1970s and 1980s the biotechnological research group elaborated new industrial processes for the production of several antibacterial antibiotics, such as gentamycin C, sisomicin, tobramycin, apramycin, kanamycin B and mupirocin and the antitumor antibiotic daunomycin. In the last 15 years new processes have been developed for manufacturing the immunosuppressants cyclosporin A and mycophenolic acid and the hypocholesterolemic agents mevinolin and pravastatin as well as recombinant hirudin, a thrombin inhibitor. Research on steroid bioconversions has also been continued from the mid 1950s up to now. In the early 1960s manufacturing processes were developed for the anti-inflammatory prednisolone and the anabolic drug methandrostenolone. The results on microbial transformations (stereoselective reduction, hydroxylation) were utilized in the synthesis of contraceptive drugs. Since the mid 1960s several new microbial processes have been discovered for the selective side chain cleavage of natural sterols, resulting in various key intermediates for the synthesis of a wide variety of steroid drugs. PMID:11769096

  12. [Determination of ten aminoglycoside residues in milk and dairy products using high performance liquid chromatography-tandem mass spectrometry].

    PubMed

    Gong, Qiang; Ding, Li; Zhu, Shaohua; Jiao, Yanna; Cheng, Jing; Fu, Shanliang; Wang, Libing

    2012-11-01

    A high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/ MS) analytical method was developed for the simultaneous determination of ten aminoglycoside residues (streptomycin, dihydrostrepmycin, neomycin, kanamycin, tobramycin, gentamycin, apramycin, hygromycin B, paromomycin, and amkacin) in milk and dairy products. The sample was extracted with 5% trichloroacetic acid aqueous solution, then the extract was purified by a hydrophilic-lipophilic balance (HLB) cartridge. The ten aminoglycoside residues were separated by ion-pair reversed phase high performance liquid chromatography. Heptafluorobutyric acid was used as ion pair agent due to its volatility. Then the analytes were detected by electrospray ionization tandem mass spectrometry. The pretreatment condition of the sample, the HPLC condition and the MS operation parameters were optimized. The results showed that the linearities of the ten aminoglycoside residues in 20-1000 microg/L had the correlation coefficient between 0.9946-0.9997. The recoveries ranged from 71.2% and 101.7% with the relative standard deviations of 3.4%-13.8%. The proposed method was successfully applied to the determination of the mass concentrations of the analytes in related samples, which provides a simple, and convenient method for the quality control of milk and dairy products. Furthermore, this method is effective for the safety monitoring of aminoglycoside residues in milk and dairy products.

  13. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of water.

    PubMed

    Titilawo, Yinka; Sibanda, Timothy; Obi, Larry; Okoh, Anthony

    2015-07-01

    We evaluated the antibiogram profile of Escherichia coli (n = 300) isolated from selected rivers in Osun State, Nigeria. The identities of the E. coli isolates were confirmed by polymerase chain reaction (PCR) technique. Susceptibility of the isolates to 20 antibiotics conventionally used in clinical cases was assessed in vitro by the standardized agar disc-diffusion method. All the isolates were susceptible to imipenem, meropenem, amikacin and gatilofloxacin. The isolates were variously susceptible to the other antibiotics as follows: ciprofloxacin (96 %), kanamycin (95 %), neomycin (92 %), streptomycin (84 %), chloramphenicol (73 %), nalidixic acid (66 %), nitrofurantoin (64 %), gentamycin (63 %), doxycycline (58 %), cefepime (57 %), tetracycline (49 %) and cephalothin (42 %). The multiple antibiotic resistance indexing ranged from 0.50 to 0.80 for all the sampling locations and exceeded the threshold value of 0.2, suggesting the origin of the isolates to be of high antimicrobial usage. Our findings signify an increase in the incidence of antimicrobial resistance of E. coli towards conventionally used antibiotics necessitating proper surveillance programmes towards the monitoring of antimicrobial resistance determinants in water bodies. PMID:25779106

  14. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).

    PubMed

    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye

    2015-08-01

    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  15. Genotypic susceptibility testing of Mycobacterium tuberculosis isolates for amikacin and kanamycin resistance by use of a rapid sloppy molecular beacon-based assay identifies more cases of low-level drug resistance than phenotypic Lowenstein-Jensen testing.

    PubMed

    Chakravorty, Soumitesh; Lee, Jong Seok; Cho, Eun Jin; Roh, Sandy S; Smith, Laura E; Lee, Jiim; Kim, Cheon Tae; Via, Laura E; Cho, Sang-Nae; Barry, Clifton E; Alland, David

    2015-01-01

    Resistance to amikacin (AMK) and kanamycin (KAN) in clinical Mycobacterium tuberculosis strains is largely determined by specific mutations in the rrs gene and eis gene promoter. We developed a rapid, multiplexed sloppy molecular beacon (SMB) assay to identify these mutations and then evaluated assay performance on 603 clinical M. tuberculosis DNA samples collected in South Korea. Assay performance was compared to gold-standard phenotypic drug susceptibility tests, including Lowenstein-Jensen (LJ) absolute concentration, mycobacterial growth indicator tubes (MGIT), and TREK Sensititre MycoTB MIC plate (MycoTB) methods. Target amplicons were also tested for mutations by Sanger sequencing. The SMB assay correctly detected 115/116 mutant and mixed sequences and 487/487 wild-type sequences (sensitivity and specificity of 99.1 and 100%, respectively). Using the LJ method as the reference, sensitivity and specificity for AMK resistance were 92.2% and 100%, respectively, and sensitivity and specificity for KAN resistance were 87.7% and 95.6%, respectively. Mutations in the rrs gene were unequivocally associated with high-level cross-resistance to AMK and KAN in all three conventional drug susceptibility testing methods. However, eis promoter mutations were associated with KAN resistance using the MGIT or MycoTB methods but not the LJ method. No testing method associated eis promoter mutations with AMK resistance. Among the discordant samples with AMK and/or KAN resistance but wild-type sequence at the target genes, we discovered four new mutations in the whiB7 5' untranslated region (UTR) in 6/22 samples. All six samples were resistant only to KAN, suggesting the possible role of these whiB7 5' UTR mutations in KAN resistance.

  16. Effects of tiamulin, neomycin, tetracycline, fluorophenicol, penicillin G, Linco-Spectin, erythromycin and oxytetracycline on controlling bacterial contaminations of the river buffalo (Buballus bubalis) semen.

    PubMed

    Alavi-Shoushtari, S M; Ahmadi, M; Shahvarpour, S; Kolahian, S

    2007-09-15

    In order to investigate the effects of tiamulin, neomycin, tetracycline, fluorophenicol, penicillin G, Linco-Spectin (0.15 mg mL(-1) lincomycin + 0.3 mg mL(-1) spectinomycin), erythromycin and oxytetracycline on controlling bacterial contaminations of the river buffalo semen, 120 mL diluted buffalo bull semen (diluted by tris-egg yolk extender) was divided into 5 mL tubes after initial evaluation and before (control sample) and at 0, 2, 6, 12 and 24 h after adding each of the above antibiotics at the recommended dose (D) and twice the recommended dose (Dx2) to the semen samples, each sample was cultured 4 times on Muller-Hinton agar medium and the results were recorded after 18 h incubation at 37 degrees C. Tiamulin, tetracycline, neomycin and fluorophenicol were ineffective. Oxytetracycline was effective in both D and Dx2 (p < 0.001). Penicillin G in both D and Dx2 was effective (p < 0.001). Linco-Spectin was effective, though not significant, in D at 2 h and in Dx2 at 0 h only. Erythromycin in D was not significantly effective, but, in Dx2 was effective (p < 0.001). Duration of the antibiotic exposure had no significant effect on the antibiotic potentials except for Linco-Spectin at 2 h (p < 0.014). The biochemical tests identified the contaminant bacteria as being a member of Arcanobacter (Corynebacterium) sp. In the next step, the semen sample of the same bull was taken, semen quality tests were carried out and the semen was diluted with the same extender (tris-egg yolk) + 7% glycerol, containing a double dose (Dx2) of these antibiotics and semen quality tests were carried out immediately after dilution, 18 h after storage at 4 degrees C and after the semen was packed in the straws, frozen in liquid nitrogen (-196 degrees C) and later thawed in 37 degrees C water bath to investigate whether these antibiotics have any adverse effect on the spermatozoa during the process of freezing and thawing. The comparison of the results with those of the control group (the

  17. Agrobacterium tumefaciens-mediated transformation of Vigna mungo (L.) Hepper.

    PubMed

    Karthikeyan, A S; Sarma, K S; Veluthambi, K

    1996-01-01

    Transformed Vigna mungo (blackgram) calli were obtained by cocultivating segments of primary leaves with Agrobacterium tumefaciens vir helper strains harbouring the binary vector pGA472 having kanamycin resistance gene as plant transformation marker. Transformed calli were selected on Murashige and Skoog medium supplemented with 50 mg/l kanamycin and 500 mg/l carbenicillin. Transformed calli were found to be resistant to kanamycin up to 900 mg/l concentration. Expression of kanamycin resistance gene in transformed calli was demonstrated by neomycin phosphotransferase assay. Stable integration of transferred DNA into V. mungo genome was confirmed by Southern blot analysis.

  18. Structural investigation of a high-affinity MnII binding site in the hammerhead ribozyme by EPR spectroscopy and DFT calculations. Effects of neomycin B on metal-ion binding.

    PubMed

    Schiemann, Olav; Fritscher, Jörg; Kisseleva, Natalja; Sigurdsson, Snorri Th; Prisner, Thomas F

    2003-10-01

    Electron paramagnetic resonance spectroscopy and density functional theory methods were used to study the structure of a single, high-affinity Mn(II) binding site in the hammerhead ribozyme. This binding site exhibits a dissociation constant Ke of 4.4 microM in buffer solutions containing 1 M NaCl, as shown by titrations monitored by continuous wave (cw) EPR. A combination of electron spin echo envelope modulation (ESEEM) and hyperfine sublevel correlation (HYSCORE) experiments revealed that the paramagnetic manganese(II) ion in this binding site is coupled to a single nitrogen atom with a quadrupole coupling constant kappa of 0.7 MHz, an asymmetry parameter eta of 0.4, and an isotropic hyperfine coupling constant of Aiso(14N)=2.3 MHz. All three EPR parameters are sensitive to the arrangement of the Mn(II) ligand sphere and can therefore be used to determine the structure of the binding site. A possible location for this binding site may be at the G10.1, A9 site found to be occupied by Mn(II) in crystals (MacKay et al., Nature 1994, 372, 68 and Scott et al., Science 1996, 274, 2065). To determine whether the structure of the binding site is the same in frozen solution, we performed DFT calculations for the EPR parameters, based on the structure of the Mn(II) site in the crystal. Computations with the BHPW91 density function in combination with a 9s7p4d basis set for the manganese(II) center and the Iglo-II basis set for all other atoms yielded values of kappa(14N)=+0.80 MHz, eta=0.324, and Aiso(14N)=+2.7 MHz, in excellent agreement with the experimentally obtained EPR parameters, which suggests that the binding site found in the crystal and in frozen solution are the same. In addition, we demonstrated by EPR that Mn(II) is released from this site upon binding of the aminoglycoside antibiotic neomycin B (Kd=1.2 microM) to the hammerhead ribozyme. Neomycin B has previously been shown to inhibit the catalytic activity of this ribozyme (Uhlenbeck et al., Biochemistry

  19. Controlled multicenter study on chronic suppurative otitis media treated with topical applications of ciprofloxacin 0.2% solution in single-dose containers or combination of polymyxin B, neomycin, and hydrocortisone suspension.

    PubMed

    Miró, N

    2000-11-01

    Otic drops of either ciprofloxacin 0.2% solution (CIP) or a combination of polymyxin B, neomycin, and hydrocortisone suspension (PNH) were administered for 6 to 12 days to patients (14-71 years old) with chronic suppurative otitis media in a randomized, nonblinded, multicenter clinical trial. Two hundred thirty-two enrolled patients were analyzed for efficacy on a "per protocol" basis. The most frequently identified causal agents were Staphylococcus aureus (28% of the patients), Pseudomonas aeruginosa (19%), and Staphylococcus sp (9%). Clinical success was observed in 91% and 87% of the CIP-and PNH-treated patients, respectively. At 1-month follow-up, 4% of CIP and 6% of PNH patients showed a relapse of otorrhea. Bacteriologic eradication was seen in 89% and 85% of patients in the CIP and PNH groups, respectively. At 1-month follow-up, reinfection or recurrence of infection appeared in 3 patients in the PNH group and in 1 patient in the CIP group. Both treatments were well tolerated. The most frequently reported adverse events were pruritus, stinging, and earache. Audiometric tests did not show changes attributable to study drugs in any but 1 patient in the PNH group. This clinical trial shows that topical 0.2% ciprofloxacin solution in single-dose containers is effective and well tolerated in patients with chronic suppurative otitis media. PMID:11077352

  20. [Production of transgenic sugarbeet plants (Beta vulgaris L.) using Agrobacterium rhizogenes].

    PubMed

    Kishchenko, E M; Komarnitskiĭ, I K; Kuchuk, N V

    2005-01-01

    Normal phenotype sugarbeet plants transformed with Agrobacterium rhizogenes were produced using direct regeneration from explants without hairy root phase. Kanamycin resistant plants and Ri-roots carrying the genes of neomycin phosphotransferase II and b-glucuronidase have been obtained. Integration of transgenes into sugarbeet genome was confirmed with GUS-assay and PCR using primers for the introduced genes. PMID:16018172

  1. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... solution including suitable and harmless preservatives and buffer substances, contains 10 milligrams of..., removal of foreign bodies, and intraocular surgery. Instill a few drops into the affected eye every...

  2. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... solution including suitable and harmless preservatives and buffer substances, contains 10 milligrams of..., removal of foreign bodies, and intraocular surgery. Instill a few drops into the affected eye every...

  3. 21 CFR 524.1200b - Kanamycin ophthalmic solution.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... chapter. (c) Conditions of use in dogs—(1) Amount. Instill a few drops into the affected eye every 3 hours... 48 hours after the eye appears normal. (2) Indications for use. For the treatment of various...

  4. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... chapter. (c) Conditions of use in dogs—(1) Amount. Apply a thin film to the affected eye three or four... after the eye appears normal. (2) Indications for use. For the treatment of various eye...

  5. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS... hours, after which the frequency of applications may be decreased. Treatment should be continued for...

  6. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS... the affected eye three or four times daily or more frequently if deemed advisable. Treatment should...

  7. 21 CFR 524.1204 - Kanamycin, amphomycin, and hydrocortisone ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., folliculitis, pruritus, anal gland infections, erythema, decubital ulcers, superficial wounds, and superficial abscesses associated with bacterial infections caused by organisms susceptible to one or both...

  8. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... attapulgite. 520.1204 Section 520.1204 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS... No. 000856 in § 510.600(c) of this chapter. (c) Conditions of use in dogs—(1) Amount. 5 mL...

  9. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... attapulgite. 520.1204 Section 520.1204 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS... No. 000856 in § 510.600(c) of this chapter. (c) Conditions of use in dogs—(1) Amount. 5 mL...

  10. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., sheep, and goats. For treatment and control of colibacillosis (bacterial enteritis) caused by... 1 day, swine 3 days, sheep 2 days, and goats 3 days. A withdrawal period has not been established... has not been established for use in lactating dairy cattle or lactating dairy goats. Do not use...

  11. 21 CFR 558.364 - Neomycin sulfate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... age or older or female dairy goats 12 months of age or older. For use in milk replacers only. 000009 ..., sheep, and goats. For treatment and control of colibacillosis (bacterial enteritis) caused by... 1 day, swine 3 days, sheep 2 days, and goats 3 days. A withdrawal period has not been...

  12. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  13. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  14. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  15. 21 CFR 556.430 - Neomycin.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., and goats. 7.2 parts per million (ppm) in kidney (target tissue) and fat, 3.6 ppm in liver, and 1.2 ppm in muscle. (2) Turkeys. 7.2 ppm in skin with adhearing fat, 3.6 ppm in liver, and 1.2 ppm...

  16. Micellar Electrokinetic Chromatography of Aminoglycosides.

    PubMed

    Holzgrabe, Ulrike; Schmitt, Stefanie; Wienen, Frank

    2016-01-01

    The components of the aminoglycosides, e.g., gentamicin, sisomicin, netilmicin, kanamycin, amikacin, and tobramycin, and related impurities of these antibiotics can be separated by means of micellar electrokinetic chromatography (MEKC). Derivatization with o-phthaldialdehyde and thioglycolic acid is found to be appropriate for these antibiotics. The background electrolyte was composed of sodium tetraborate (100 mM), sodium deoxycholate (20 mM), and β-cyclodextrin (15 mM) having a pH value of 10.0. This method is valid for evaluation of gentamicin, kanamycin, and tobramycin. It has to be adopted for amikacin, paromomycin, neomycin, and netilmicin. PMID:27645732

  17. Sensitivity of cellulolytic bacteria to antibiotics.

    PubMed

    Szegi, J; El-Din, H G

    1977-01-01

    The sensitivity of eight cellulolytic bacterial strains to eight antibiotics was tested. The results showed that, in general, the strains belonging to Cytophaga, Cellvibrio, and Cellfalcicula are more sensitive to antibiotics than those strains that belong to Sporocytophaga and Cellulomonas. The inhibitory activity of the tested antibiotics, though differing with different strains, showed the following categories: tetracycline, erythromycin, and chloromycetin were most active, kanamycin, streptomycin, and neomycin were intermediate, while novobiocin and penicillin showed low activity. PMID:414477

  18. Complexation of anionic copolymers of acrylamide and N-(2-hydroxypropyl)methacrylamide with aminoglycoside antibiotics

    NASA Astrophysics Data System (ADS)

    Solovskii, M. V.; Tarabukina, E. B.; Amirova, A. I.; Zakharova, N. V.; Smirnova, M. Yu.; Gavrilova, I. I.

    2014-03-01

    The complexation of aminoglycoside antibiotics neomycin, gentamicin, kanamycin, and amikacin in the form of free bases with carboxyl- and sulfo-containing copolymers of acrylamide and N-(2-hydroxypropyl)methacrylamide (HPMA) in water and water-salt solutions is studied by means of viscometry, equilibrium dialysis, potentiometric titration, and molecular hydrodynamics. Factors influencing the stability of formed copolymer-antibiotic complexes and determinations of their toxicity are established.

  19. Evaluation of Efficacy, Safety, and Tolerability of Fixed Dose Combination (FDC) of Halometasone 0.05% and Fusidic Acid 2% W/W Topical Cream Versus FDC of Betamethasone Valerate 0.12% and Neomycin Sulphate 0.5% W/W Topical Cream in the Treatment of Infected Eczematous Dermatosis in Indian Subjects: A Randomized Open-Label Comparative Phase III Multi-Centric Trial

    PubMed Central

    Pratap, Dasiga Venkata Subrahmanya; Philip, Mariam; Rao, Narayana T; Jerajani, Hemangi R; Kumar, Sainath A; Kuruvila, Maria; Moodahadu, Latha S; Dhawan, Shilpi

    2013-01-01

    Aim: To evaluate the efficacy and safety of fixed drug combination (FDC) halometasone 0.05% and fusidic acid 2% (group A) vs FDC betamethasone 0.12% and neomycin sulfate 0.5% cream (group B) in acute or chronic infected eczematous dermatosis, through a randomized open-label, comparative, multicentric study. Materials and Methods: A total of 152 patients were randomized to either Group A or Group B. EASI (Eczema Area and Severity Index), IGA (Investigator's global assessment), scale for severity of eczema, pruritus, and safety parameters were assessed at baseline, Day 5/Day 10, Day 10/20, and Day 20/Day 30 for acute/chronic cases. Skin swabs were tested at screening, Day 10, and end of the study. Results: Staphylococcus aureus was the frequently encountered causative agent. There was a significant reduction within the study groups in EASI, IGA scales for severity of eczema, pruritus at various visits, compared to baseline. At the end of study, 83.87% in group A and 65.71% in group B were culture negative. Cure rate was 54.28% and 50% in group A and B, respectively. Five adverse events were reported in five patients, of which three patients withdrew from the study. Conclusion: Halometasone 0.05% and Fusidic acid 2% cream is effective, safe, well tolerated with comparable efficacy to the comparator in the treatment of acute and chronic infected eczematous dermatosis. PMID:23716800

  20. Investigation on gene transfer from genetically modified corn (Zea mays L.) plants to soil bacteria.

    PubMed

    Ma, B L; Blackshaw, Robert E; Roy, Julie; He, Tianpei

    2011-01-01

    Knowledge about the prevalence and diversity of antibiotic resistance genes in soil bacteria communities is required to evaluate the possibility and ecological consequences of the transfer of these genes carried by genetically modified (GM) plants to soil bacteria. The neomycin phosphotransferase gene (nptII) conferring resistance to kanamycin and neomycin is one of the antibiotic resistance genes commonly present in GM plants. In this study, we investigated kanamycin-resistant (Km(R)) and neomycin-resistant (Nm(R)) soil bacterial populations in a 3-year field trial using a commercial GM corn (Zea mays L.) carrying the nptII gene and its near isogenic line. The results showed that a portion (2.3 - 15.6 %) of cultivable soil bacteria was naturally resistant to kanamycin or neomycin. However, no significant difference in the population level of Km(R) or Nm(R) soil bacteria was observed between the GM and non-GM corn fields. The nptII gene was not detected in any of the total 3000 Km(R) or Nm(R) isolates screened by PCR. Further, total soil bacterial cells were collected through Nycodenz gradient centrifugation and bacterial community DNA was subjected to PCR. Detection limit was about 500 cells per gram of fresh soil. Our study suggests that the nptII gene was relatively rare in the soil bacterial populations and there was no evidence of gene transfer from a GM corn plant to soil bacteria based on the data from total soil bacterial communities.

  1. 21 CFR 524.1484a - Neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS... for use in dogs and cats for the treatment of superficial ocular bacterial infections limited to...

  2. 21 CFR 524.1484a - Neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... for use in dogs and cats for the treatment of superficial ocular bacterial infections limited to the... bacteria or fungi appear during therapy, appropriate measures should be taken. (6) Federal law...

  3. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...

  4. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...

  5. 21 CFR 558.455 - Oxytetracycline and neomycin.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... by M. gallisepticum and Escherichia coli susceptible to oxytetracycline. Feed continuously for 7 to... (air-sac- infection) caused by E. coli susceptible to oxytetracycline. Feed continuously for 5 d; do... treatment of bacterial enteritis caused by E. coli and Salmonella choleraesuis and treatment of...

  6. A prospective study on evaluation of pathogenesis, biofilm formation, antibiotic susceptibility of microbial community in urinary catheter

    NASA Astrophysics Data System (ADS)

    Younis, Khansa Mohammed; Usup, Gires; Ahmad, Asmat

    2015-09-01

    This study is aimed to isolate, detect biofilm formation ability and antibiotic susceptibility of urinary catheter adherent microorganisms from elderly hospitalized patient at the Universiti Kebangsaan Malaysia Medical Center. Microorganisms were isolated from three samples of urinary catheters (UC) surface; one of the acute vascular rejection patient (UCB) and two from benign prostate hyperplasia patients (UCC and UCD). A total of 100 isolates was isolated with 35 from UCB, 38 (UCC) and 28 (UCD). Ninety six were identified as Gram-negative bacilli, one Gram-positive bacilli and three yeasts. Results of biofilm forming on sterile foley catheter showed that all the isolates can form biofilm at different degrees; strong biofilm forming: 32% from the 35 isolates (UCB), 25% out of 38 isolates (UCC), 26% out of 28 isolates (UCD). As for moderate biofilm forming; 3% from UCB, 10% from UCC and 2% from UCD. Weak biofilm forming in UCC (3%). The antibiotic susceptibility for (UCB) isolates showed highly resistant to ampicillin, novobiocin and penicillin 100 (%), kanamycin (97%), tetracycline (94%), chloramphenicol (91%), streptomycin (77%) and showed low level of resistance to gentamycin (17%), while all the isolates from (UCC-D) showed high resistant towards ampicillin and penicillin, novobiocin (94%), tetracycline (61%), streptomycin (53%), gentamycin (50%) and low level of resistance to kanamycin (48%), chloramphenicol (47%). The findings indicate that these isolates can spread within the community on urinary catheters surface and produce strong biofilm, therefore, monitoring antibiotic susceptibility of bacteria isolated in the aggregation is recommended.

  7. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... antibiotics: Acute otitis externa, furunculosis, folliculitis, pruritus, anal gland infections, erythema... of the anal gland, the drug should be introduced into the orifice of the gland and not through...

  8. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... antibiotics: Acute otitis externa, furunculosis, folliculitis, pruritus, anal gland infections, erythema... of the anal gland, the drug should be introduced into the orifice of the gland and not through...

  9. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL... apply the ointment more than twice daily. After some improvement is observed, treatment can usually...

  10. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) Its moisture content is not more than 10 percent; and (iii) Its pH in a 2-percent aqueous suspension... area should be thoroughly cleansed of crusts, scales, dirt, or other detritus. When treating...

  11. Genetic transformation and gene expression in white pine (pinus strobus)

    SciTech Connect

    Minocha, R.

    1987-10-01

    The objectives of the study were: (1) to develop protocols for transformation of white pine (Pinus strobus) embryonic tissue; and (2) to analyze the regulation of foreign gene expression in Pinus strobus. A number of Agrobacterium tumefaciens strains containing chimeric genes for neomycin phosphotransferase (NPTII for kanamycin resistance) and chloramphenicol acetyl transferase (CAT) under the control of either a constitutive promoter (NOS-nopaline synthase) or light-inducible promoters (RuBisCO small subunit and chlorophyll a/b binding protein) were used. A variety of tissues from white pine seedlings and mature trees was used. The techniques for transformation were modified from those used for tobacco transformation. The results show that white pine tissue from young seedlings is high suitable for transformation by A. tumefaciens. Whereas the normal tissues are very sensitive to kanamycin, transformed callus was quite resistant to this antibiotic.

  12. Agrobacterium-mediated transformation of Ruta graveolens L.

    PubMed

    Lièvre, Karine; Tran, Thi Lê Minh; Doerper, Sébastien; Hehn, Alain; Lacoste, Paul; Thomasset, Brigitte; Bourgaud, Frédéric; Gontier, Eric

    2009-01-01

    Agrobacterium tumefaciens is used to develop a genetic transformation method for a medicinal plant Ruta graveolens. The direct plant regeneration strategy is preferred to callus line establishment. In vitro seedlings, 2- -to 3-wk-old, are used to excise hypocotyls and co-cultivated for 3 d with A. tumefaciens strain C58C1Rif containing plasmid pTDE4 harbouring neomycin phosphotransferase (npt II, kanamycin resistance) and beta-glucuronidase encoding genes. The Southern blot analysis has shown that 78% kanamycin resistant plants contain gene encoding beta-glucuronidase. The GUS histochemical assay shows that 67% transgenic plants exhibit the corresponding enzymatic activity. Routine transformation efficiency of R. graveolens L. is 11% and could reach up to 22%. Transgenic plants are grown in the greenhouse within 4 months after the initial seedlings.

  13. Deciphering the details of RNA aminoglycoside interactions: from atomistic models to biotechnological applications

    SciTech Connect

    Ilgu, Muslum

    2012-01-01

    A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.

  14. Aminoglycoside Antibiotic-Inactivating Enzymes in Actinomycetes Similar to Those Present in Clinical Isolates of Antibiotic-Resistant Bacteria

    PubMed Central

    Benveniste, Raoul; Davies, Julian

    1973-01-01

    Various species of Streptomyces possess aminoglycoside-modifying enzymes. Streptomyces kanamyceticus contains an enzyme that acetylates the 6′-amino group of kanamycin A and B, gentamicin C1a, and neomycin. Streptomyces spectabilis produces an enzyme that acetylates the 2′-amino group of the hexose ring of gentamicin C1a. These enzymes catalyze reactions identical to those catalyzed by enzymes found in gram-negative bacteria containing R(antibiotic resistance)-factors. The discovery of these enzymes suggests the possibility of an evolutionary relationship between the aminoglycosideinactivating enzymes (produced by resistance determinants) in bacteria containing R-factors and similar enzymes found in the actinomycetes. PMID:4209515

  15. Mechanistic Study of the Synergistic Antibacterial Activity of Combined Silver Nanoparticles and Common Antibiotics.

    PubMed

    Deng, Hua; McShan, Danielle; Zhang, Ying; Sinha, Sudarson S; Arslan, Zikri; Ray, Paresh C; Yu, Hongtao

    2016-08-16

    A combination of silver nanoparticles (AgNPs) and an antibiotic can synergistically inhibit bacterial growth, especially against the drug-resistant bacteria Salmonella typhimurium. However, the mechanism for the synergistic activity is not known. This study chooses four classes of antibiotics, β-lactam (ampicillin and penicillin), quinolone (enoxacin), aminoglycoside (kanamycin and neomycin), and polykeptide (tetracycline) to explore their synergistic mechanism when combined with AgNPs against the multidrug-resistant bacterium Salmonella typhimurium DT 104. Enoxacin, kanamycin, neomycin, and tetracycline show synergistic growth inhibition against the Salmonella bacteria when combined with AgNPs, while ampicillin and penicillin do not. UV-vis and Raman spectroscopy studies reveal that all these four synergistic antibiotics can form complexes with AgNPs, while ampicillin and penicillin do not. The presence of tetracycline enhances the binding of Ag to Salmonella by 21% and Ag(+) release by 26% in comparison to that without tetracycline, while the presence of penicillin does not enhance the binding of Ag or Ag(+) release. This means that AgNPs first form a complex with tetracycline. The tetracycline-AgNPs complex interacts more strongly with the Salmonella cells and causes more Ag(+) release, thus creating a temporal high concentration of Ag(+) near the bacteria cell wall that leads to growth inhibition of the bacteria. These findings agree with the recent findings that Ag(+) release from AgNPs is the agent causing toxicity. PMID:27390928

  16. Antibacterial activity of amphiphilic tobramycin.

    PubMed

    Dhondikubeer, Ramesh; Bera, Smritilekha; Zhanel, George G; Schweizer, Frank

    2012-10-01

    Amphiphilic aminoglycoside antimicrobials are an emerging class of new antibacterial agents with novel modes of action. Previous studies have shown that amphiphilic neomycin-B and kanamycin-A analogs restore potent antibacterial activity against Gram-positive neomycin-B- and kanamycin-A-resistant organisms. In this paper, we investigated the antibacterial properties of a series of amphiphilic tobramycin analogs. We prepared tobramycin-lipid conjugates, as well as tobramycin-peptide triazole conjugates, and studied their antibacterial activities against a panel of Gram-positive and Gram-negative bacterial strains, including isolates obtained from Canadian hospitals. Our results demonstrate that the antibacterial activity of amphiphilic tobramycin is greatly affected by the length and nature of the hydrophobic lipid tail, whereas the nature of the polycationic headgroup or the number of cationic charges appear to be less important. Replacement of the hydrophobic tail by a fluorinated lipid confers good activity against two Pseudomonas strains and reduces hemolytic activity. However, susceptibility studies in the presence of bovine serum albumin indicate that all amphiphilic tobramycin analogs are strongly protein-bound, leading to a typical four- to eight-fold increase in MIC.

  17. Mass mortality in ornamental fish, Cyprinus carpio koi caused by a bacterial pathogen, Proteus hauseri.

    PubMed

    Kumar, Raj; Swaminathan, T Raja; Kumar, Rahul G; Dharmaratnam, Arathi; Basheer, V S; Jena, J K

    2015-09-01

    Moribund koi carp, Cyprinus carpio koi, from a farm with 50% cumulative mortality were sampled with the aim of isolating and detecting the causative agent. Three bacterial species viz., Citrobacter freundii (NSCF-1), Klebsiella pneumoniae (NSKP-1) and Proteus hauseri [genomospecies 3 of Proteus vulgaris Bio group 3] (NSPH-1) were isolated, identified and characterized on the basis of biochemical tests and sequencing of the 16S rDNA gene using universal bacterial primers. Challenge experiments with these isolates using healthy koi carp showed that P. hauseri induced identical clinical and pathological states within 3 d of intramuscular injection. The results suggest P. hauseri (NSPH-1) was the causative agent. In phylogenetic analysis, strain NSPH-1 formed a distinct cluster with other P. hauseri reference strains with ≥99% sequence similarity. P. hauseri isolates were found sensitive to Ampicillin, Cefalexin, Ciprofloxacin and Cefixime and resistant to Gentamycin, Oxytetracycline, Chloramphenicol, and Kanamycin. The affected fish recovered from the infection after ciprofloxacin treatment.

  18. A series of medium and high copy number arabinose-inducible Escherichia coli expression vectors compatible with pBR322 and pACYC184.

    PubMed

    Chakravartty, Vandana; Cronan, John E

    2015-09-01

    The original pBAD24 plasmid and the derived lower copy number (the pBAD322 series) expression vectors have been widely used in Escherichia coli, Salmonella enterica, and related bacteria. However, a flexible pBAD expression system has been available only in pMB1 (ColE1) vectors. We report a series of pBAD vectors that replicate using the origin of plasmid RSF1030 that are compatible with pMB1 (ColE1) and p15A (pACYC) vectors. Both high (≥pBAD24) and medium (~pBAD322) copy number plasmids encoding resistance to ampicillin, chloramphenicol, kanamycin, tetracycline, spectinomycin/streptomycin, gentamycin, or trimethoprim are available.

  19. Characterization and distribution of ColE1-like kanamycin-resistance plasmids in Salmonella enterica from food animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Antimicrobial resistant foodborne pathogens cause public health concerns and multi-drug resistant (MDR) pathogens present difficulties when treatment is warranted. Large plasmids are responsible for the majority of the MDR and subsequently, the focus of most research. Previous studies sh...

  20. Characterisation of Phenotypic and Genotypic Antibiotic Resistance Profile of Enterococci from Cheeses in Turkey.

    PubMed

    Kürekci, Cemil; Önen, Sevda Pehlivanlar; Yipel, Mustafa; Aslantaş, Özkan; Gündoğdu, Aycan

    2016-01-01

    The aim of this study was to determine the prevalence of enterococci in cheese samples and to characterize their antimicrobial resistance profiles as well as the associated resistance genes. A total of 139 enterococci were isolated from 99 cheese samples, the isolates were identified as E. faecalis (61.2%), E. faecium (15.1%), E. gallinarum (12.9%), E. durans (5.0%), E. casseliflavis (2.9%) and E. avium (2.9%). The most frequent antimicrobial resistance observed in enterococci isolates was to lincomycin (88.5%), followed by kanamycin (84.2%), gentamycin (low level, 51.1%), rifampin (46.8%) and tetracycline (33.8%). Among the isolates, the frequencies of high level gentamycin and streptomycin resistant enterococci strains were 2.2% and 5.8%, respectively. Apart from the mentioned antibiotics, low levels of resistance to ciprofloxacin, erythromycin and chloramphenicol were found. Moreover no resistance was observed against penicillin and ampicillin. The antimicrobial resistance genes including tetM, tetL, ermB, cat, aph(3')-IIIa, ant(6)-Ia and aac(6')-Ieaph(2")-Ia were found in enterococci from Turkish cheese samples. In the current study, we provided data for antibiotic resistance and the occurrence of resistance genes among enterococci. Regulatory and quality control programs for milk and other dairy products from farms to retail outlets has to be established and strengthened to monitor trends in antimicrobial resistance among emerging food borne pathogens in Turkey. PMID:27433106

  1. Characterisation of Phenotypic and Genotypic Antibiotic Resistance Profile of Enterococci from Cheeses in Turkey

    PubMed Central

    Yipel, Mustafa; Aslantaş, Özkan; Gündoğdu, Aycan

    2016-01-01

    The aim of this study was to determine the prevalence of enterococci in cheese samples and to characterize their antimicrobial resistance profiles as well as the associated resistance genes. A total of 139 enterococci were isolated from 99 cheese samples, the isolates were identified as E. faecalis (61.2%), E. faecium (15.1%), E. gallinarum (12.9%), E. durans (5.0%), E. casseliflavis (2.9%) and E. avium (2.9%). The most frequent antimicrobial resistance observed in enterococci isolates was to lincomycin (88.5%), followed by kanamycin (84.2%), gentamycin (low level, 51.1%), rifampin (46.8%) and tetracycline (33.8%). Among the isolates, the frequencies of high level gentamycin and streptomycin resistant enterococci strains were 2.2% and 5.8%, respectively. Apart from the mentioned antibiotics, low levels of resistance to ciprofloxacin, erythromycin and chloramphenicol were found. Moreover no resistance was observed against penicillin and ampicillin. The antimicrobial resistance genes including tetM, tetL, ermB, cat, aph(3’)-IIIa, ant(6)-Ia and aac(6’)-Ieaph(2”)-Ia were found in enterococci from Turkish cheese samples. In the current study, we provided data for antibiotic resistance and the occurrence of resistance genes among enterococci. Regulatory and quality control programs for milk and other dairy products from farms to retail outlets has to be established and strengthened to monitor trends in antimicrobial resistance among emerging food borne pathogens in Turkey. PMID:27433106

  2. Mechanistic studies of copper(II)-aminoglycoside mediated DNA damage and magnesium catalyzed nuclease activity of hammerhead ribozyme

    NASA Astrophysics Data System (ADS)

    Patwardhan, Anjali A.

    The antibacterial activity of aminoglycosides stems from their high affinity binding to the 16S rRNA in bacteria resulting in inhibition of protein synthesis. Used to treat acute bacterial infections these antibiotics have limited applications due to their high dosage requirements and the emergence of resistant strains. We have synthesized and characterized Cu(II) derivatives of the aminoglycosides, kanamycin A, tobramycin, neamine, kanamycin B, neomycin B, and paromomycin. The first three exhibit preferential and tight binding to Cu(II) as against neomycin B and kanamycin B and paromomycin. EPR of frozen solutions and UV-visible spectroscopy suggest a change in geometry around the Cu(II) but the stabilities of the complexes in water differ. These copper derivatives efficiently cleave plasmid DNA at micromolar concentrations (hydrolytic) and at nanomolar concentrations in the presence co-reactants like hydrogen peroxide or ascorbic acid. Hydrolysis is multi turnover and exhibits Michelis-Menten kinetics with enzyme-like behavior whereas oxidative cleavage is highly specific with C-4' H abstraction resulting in characteristic base propenal and nucleotide base products. Hydroxyl radicals generated are copper based and are generated in close proximity of the substrate. Hammerhead ribozymes are selectively hydrolyzed in the presence of divalent ions with Mg2+ being the metal ion of choice in vivo . Our studies with complex ions like cobalt hexaammine and fac-triamminetriaquochromium(III) establish outer sphere interactions of Mg2+ with the hammerhead in the catalytic site. There are two sets of sites, one structural and one catalytic. Complex ions in the catalytic site and divalent ions in the structural site result in a slow but active hammerhead ribozyme suggesting that the complex ions are not inhibitory, contrary to what was suggested previously.

  3. Efficient transformation of potato (Solanum tuberosum L.) using a binary vector in Agrobacterium rhizogenes.

    PubMed

    Visser, R G; Jacobsen, E; Witholt, B; Feenstra, W J

    1989-10-01

    We transformed three potato (Solanum tuberosum L.) genotypes by using A. rhizogenes or a mixture of A. rhizogenes and A. tumefaciens. Inoculations of potato stem segments were performed with Agrobacterium rhizogenes AM8703 containing two independent plasmids: the wild-type Ri-plasmid, pRI1855, and the binary vector plasmid, pBI121. In mixed inoculation experiments, Agrobacterium rhizogenes LBA1334 (pRI1855) and Agrobacterium tumefaciens AM8706 containing the disarmed Ti-plasmid (pAL4404) and the binary vector plasmid (pBI121) were mixed in a 1∶1 ratio. The T-DNA of the binary vector plasmid pBI121 contained two marker genes encoding neomycin phosphotransferase, which confers resistance to kanamycin, and β-glucuronidase. Both transformation procedures gave rise to hairy roots on potato stem segments within 2 weeks. With both procedures it was possible to obtain transformed hairy roots, able to grow on kanamycin and possessing β-glucuronidase activity, without selection pressure. The efficiency of the A. rhizogenes AM8703 transformation, however, was much higher than that of the "mixed" transformation. Up to 60% of the hairy roots resulting from the former transformation method were kanamycin resistant and possessed β-glucuronidase activity. There was no correlation between the height of the kanamycin resistance and that of the β-glucuronidase activity in a root clone. Hairy roots obtained from a diploid potato genotype turned out to be diploid in 80% of the cases. Transformed potato plants were recovered from Agrobacterium rhizogenes AM8703-induced hairy roots.

  4. 21 CFR 524.1484j - Neomycin and prednisolone ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... quantity of the ointment should be expressed into the conjunctival sac 4 times a day (at intervals of 1 to... allergic reactions or gross irritants. (3) Limitations. Federal law restricts this drug to use by or on...

  5. 21 CFR 524.154 - Bacitracin, neomycin, and polymyxin B ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 10,000 units of polymyxin B sulfate. (b) Sponsors. See sponsor numbers in § 510.600(c) of this... paragraph (c) of this section. (c) Conditions of use in dogs and cats.—(1) Amount. Apply a thin film over... of the eyelid and conjunctiva of dogs and cats when due to susceptible organisms. (3)...

  6. 21 CFR 524.1883 - Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL... of cats and dogs, such as those associated with allergic reactions or gross irritants.1 1 These... information. (2) A small quantity of the ointment should be expressed into the conjunctival sac 4 times a...

  7. 21 CFR 524.1880 - Prednisolone-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .... 524.1880 Section 524.1880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... of cats and dogs, such as those associated with allergic reactions or gross irritants. A small quantity of the ointment should be expressed into the conjunctival sac four times a day for 7 days. After...

  8. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) Limitations. All topical ophthalmic preparations containing corticosteroids, with or without an antimicrobial... corticosteroid responsive lesions may be due to the presence of nonsusceptible organisms or to prolonged use...

  9. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) Limitations. All topical ophthalmic preparations containing corticosteroids, with or without an antimicrobial... corticosteroid responsive lesions may be due to the presence of nonsusceptible organisms or to prolonged use...

  10. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...) Limitations. All topical ophthalmic preparations containing corticosteroids, with or without an antimicrobial... corticosteroid responsive lesions may be due to the presence of nonsusceptible organisms or to prolonged use...

  11. The effect of neomycin and streptomycin on the electrical polarisability of aqueous suspensions of Escherichia coli.

    PubMed

    Morris, V J; Jennings, B R

    1975-06-12

    Aqueous suspensions of bacteria scatter light strongly. In addition, the bacteria exhibit strong induced dipole moments in an electric field. In this note we report how, by measuring the intensity of the scattered light, the electric polarisability (alpha) of Escherichia coli could be monitored as small quantities of antibiotics were added to the suspensions. The effect of the presence of quite small quantities of antibiotic on the electrical polarisability, which gave rise to the induced dipole, was dramatic. From the hypothesis that alpha had its origins in the bacteria-solvent interface, a theory is presented which adequately accounts for both alpha and its changes in the presence of these antibiotics. The study is taken to suggest that the antibiotic molecules were adsorbed on to the bacterial surface thereby reducing the surface charge. This in turn reduces the number of counterions and the apparent induced dipole moment. Because the electric-field scattering method is both quick and sensitive to changes in alpha, it may prove a valuable method for the study of antibiotic action on cell and microorganism surfaces. PMID:1093570

  12. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL...(c) of this chapter. (c) Conditions of use. (1) The drug is recommended for the treatment of bacterial infections associated with topical ophthalmological conditions such as corneal...

  13. 21 CFR 524.1484i - Neomycin sulfate, hydrocortisone acetate, sterile ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM... conjunctival sac. With improvement, frequency may be reduced to two or three times daily. For treatment of ear...) Limitations. All topical ophthalmic preparations containing corticosteroids, with or without an...

  14. 21 CFR 524.1881b - Prednisolone acetate-neomycin sulfate sterile suspension.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM... conjunctivitis, acute otitis externa, and chronic otitis externa in dogs and cats. (2) For beginning treatment of... externa, 2 to 6 drops may be placed in the external ear canal 2 or 3 times daily. (3) All...

  15. 21 CFR 524.1880 - Prednisolone-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW... topical ophthalmic preparations containing corticosteroids with or without an antimicrobial agent are contraindicated in the initial treatment of corneal ulcers. They should not be used until the infection is...

  16. 21 CFR 524.1484g - Neomycin sulfate-thiabendazole-dexamethasone solution.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM... is recommended for use as an aid in the treatment of bacterial, mycotic, and inflammatory...

  17. 21 CFR 524.1883 - Prednisolone sodium phosphate-neomycin sulfate ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... Treatment may require from a few days to several weeks.1 (3) All topical ophthalmic preparations containing corticosteroids with or without an antimicrobial agent are contraindicated in the initial treatment of corneal... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND...

  18. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ..., following ear trimming and castrating operations. (2) In treatment of otitis externa and other inflammatory conditions of the external ear canal, a quantity of ointment sufficient to fill the external ear canal may be... anesthesia is essential to control self-inflicted trauma. (4) Federal law restricts this drug to use by or...

  19. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., following ear trimming and castrating operations. (2) In treatment of otitis externa and other inflammatory conditions of the external ear canal, a quantity of ointment sufficient to fill the external ear canal may be... anesthesia is essential to control self-inflicted trauma. (4) Federal law restricts this drug to use by or...

  20. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... acetonide ointment. (a) Specifications. Each milliliter of petrolatum base or each gram of vanishing cream... petrolatum base ointments see 000069, 000856, 025463, 053501, and 054925 in § 510.600(c) of this chapter. For... petrolatum base ointment. Preliminary use of a local anesthetic may be advisable. (iii) For infected...

  1. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) Specifications. Each milliliter of petrolatum base or each gram of vanishing cream base ointment contains: 100... thiostrepton; and 1.0 milligram of triamcinolone acetonide. (b) Sponsors. For petrolatum base ointments see Nos... such as grass awns and ticks, and instill three to five drops of petrolatum base ointment....

  2. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... acetonide ointment. (a) Specifications. Each milliliter of petrolatum base or each gram of vanishing cream... petrolatum base ointments see 000069, 000856, 025463, 053501, and 054925 in § 510.600(c) of this chapter. For... petrolatum base ointment. Preliminary use of a local anesthetic may be advisable. (iii) For infected...

  3. 21 CFR 524.1600a - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... acetonide ointment. (a) Specifications. Each milliliter of petrolatum base or each gram of vanishing cream... petrolatum base ointments see 000069, 000856, 025463, 053501, and 054925 in § 510.600(c) of this chapter. For... petrolatum base ointment. Preliminary use of a local anesthetic may be advisable. (iii) For infected...

  4. 21 CFR 524.1600b - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... conjunctivitis in cats and dogs and for infectious kerato-conjunctivitis (pink eye) in cattle. (2) It is to be administered as follows: (i) For conjunctivitis and keratitis: Apply one drop of ointment to the affected eye(s... infectious kerato-conjunctivitis: Apply small line of ointment to the affected eye(s) once daily....

  5. 21 CFR 524.1600b - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... conjunctivitis in cats and dogs and for infectious kerato-conjunctivitis (pink eye) in cattle. (2) It is to be administered as follows: (i) For conjunctivitis and keratitis: Apply one drop of ointment to the affected eye(s... infectious kerato-conjunctivitis: Apply small line of ointment to the affected eye(s) once daily....

  6. 21 CFR 524.1600b - Nystatin, neomycin, thiostrepton, and triamcinolone ophthalmic ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... antibacterial ointment for local therapy in keratitis and conjunctivitis. (iii) Limitations. Federal law... necessary. (ii) Indications for use. For infectious kerato-conjunctivitis (pinkeye). (iii)...

  7. 21 CFR 524.1600b - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... conjunctivitis in cats and dogs and for infectious kerato-conjunctivitis (pink eye) in cattle. (2) It is to be administered as follows: (i) For conjunctivitis and keratitis: Apply one drop of ointment to the affected eye(s... infectious kerato-conjunctivitis: Apply small line of ointment to the affected eye(s) once daily....

  8. 21 CFR 524.1600b - Nystatin, neomycin, thiostrepton, and triamcinolone acetonide ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... conjunctivitis in cats and dogs and for infectious kerato-conjunctivitis (pink eye) in cattle. (2) It is to be administered as follows: (i) For conjunctivitis and keratitis: Apply one drop of ointment to the affected eye(s... infectious kerato-conjunctivitis: Apply small line of ointment to the affected eye(s) once daily....

  9. 21 CFR 524.960 - Flumethasone, neomycin, and polymyxin B ophthalmic solution.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., incipient pannus, superficial keratitis, conjunctivitis, acute nongranulomatous anterior uveitis, kerato- conjunctivitis, and blepharitis. (3) Limitations. Federal law restricts this drug to use by or on the order of...

  10. 21 CFR 524.1484c - Neomycin, isoflupredone, and tetracaine ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... externa in dogs. It also is effective in treating anal gland infections and moist dermatitis in the dog and is a useful dressing for minor cuts, lacerations, abrasions, and post-surgical therapy in...

  11. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... and cats: 2 to 3 drops per eye, every 4 hours. (2) Indications for use. Treatment of the inflammation... contraindicated in infectious tuberculous lesions of the eye, early acute stages of viral diseases of the...

  12. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... and cats: 2 to 3 drops per eye, every 4 hours. (2) Indications for use. Treatment of the inflammation... contraindicated in infectious tuberculous lesions of the eye, early acute stages of viral diseases of the...

  13. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... and cats: 2 to 3 drops per eye, every 4 hours. (2) Indications for use. Treatment of the inflammation... contraindicated in infectious tuberculous lesions of the eye, early acute stages of viral diseases of the...

  14. 21 CFR 524.960 - Flumethasone, neomycin sulfate, and polymyxin B sulfate ophthalmic solutions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... and cats: 2 to 3 drops per eye, every 4 hours. (2) Indications for use. Treatment of the inflammation... contraindicated in infectious tuberculous lesions of the eye, early acute stages of viral diseases of the...

  15. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE... in which infectious bacterial gastroenteritis is associated with emotional stress. (3)...

  16. 21 CFR 524.1484f - Neomycin sulfate, prednisolone acetate, tetracaine hydrochloride eardrops.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL..., to a lesser degree, chronic otitis externa in dogs and cats. It is indicated as treatment or adjunctive therapy of certain ear conditions in dogs and cats caused by or associated with...

  17. 21 CFR 524.1484f - Neomycin sulfate, prednisolone acetate, tetracaine hydrochloride eardrops.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL..., to a lesser degree, chronic otitis externa in dogs and cats. It is indicated as treatment or adjunctive therapy of certain ear conditions in dogs and cats caused by or associated with...

  18. 21 CFR 524.1484c - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... dermatitis in the dog and is a useful dressing for minor cuts, lacerations, abrasions, and post-surgical... anesthesia is essential to control self-inflicted trauma. (4) Federal law restricts this drug to use by or...

  19. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE... orally twice daily to dogs as follows: Animal weight (pounds) Number of capsules per dose Capsule No. 1 Capsule No. 3 10 to 20 1 20 to 30 2 Over 30 3 1 Over 60 2 (2) Indications for use. For treatment of...

  20. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... suspension. 524.1484h Section 524.1484h Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM... shall state: This medication contains penicillin. Allergic reactions in humans are known to occur...

  1. 21 CFR 524.981c - Fluocinolone acetonide, neomycin sulfate cream.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .... 524.981c Section 524.981c Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... dermatoses in dogs. It is used in the treatment of such conditions as allergic and acute moist dermatoses and nonspecific dermatoses in dogs. It is used in the treatment of wound infections in dogs and cats. (2) A...

  2. 21 CFR 520.1921 - Prochlorperazine, isopropamide, with neomycin sustained-release capsules.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE... orally twice daily to dogs as follows: Animal weight (pounds) Number of capsules per dose Capsule No. 1 Capsule No. 3 10 to 20 1 20 to 30 2 Over 30 3 1 Over 60 2 (2) Indications for use. For treatment of...

  3. 21 CFR 524.1484k - Neomycin sulfate, prednisolone, tetracaine, and squalane topical-otic suspension.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND... in dogs and cats for treating acute otitis externa and as adjunctive therapy in management of chronic otitis externa. The product may also be used for treating moist dermatitis in dogs. (3)...

  4. 21 CFR 524.981c - Fluocinolone acetonide, neomycin sulfate cream.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... 524.981c Section 524.981c Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... dermatoses in dogs. It is used in the treatment of such conditions as allergic and acute moist dermatoses and nonspecific dermatoses in dogs. It is used in the treatment of wound infections in dogs and cats. (2) A...

  5. 21 CFR 524.1484k - Neomycin sulfate, prednisolone, tetracaine, and squalane topical-otic suspension.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND... in dogs and cats for treating acute otitis externa and as adjunctive therapy in management of chronic otitis externa. The product may also be used for treating moist dermatitis in dogs. (3)...

  6. 21 CFR 524.1484h - Neomycin, penicillin, polymyxin, hydrocortisone suspension.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... suspension. 524.1484h Section 524.1484h Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM... shall state: This medication contains penicillin. Allergic reactions in humans are known to occur...

  7. 21 CFR 524.1484f - Neomycin sulfate, prednisolone acetate, tetracaine hydrochloride eardrops.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...-susceptible organisms and/or allergy. In otitis externa, 2 to 6 drops may be placed in the external ear canal... hypersensitivity or allergy. If such signs are noted, therapy should be stopped.1 (3) Federal law restricts...

  8. 21 CFR 524.1484f - Neomycin sulfate, prednisolone acetate, tetracaine hydrochloride eardrops.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...-susceptible organisms and/or allergy. In otitis externa, 2 to 6 drops may be placed in the external ear canal... hypersensitivity or allergy. If such signs are noted, therapy should be stopped.1 (3) Federal law restricts...

  9. Complete genome sequence of Marivirga tractuosa type strain (H-43T)

    SciTech Connect

    Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla L.; Lucas, Susan; Glavina Del Rio, Tijana; Tice, Hope; Copeland, A; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth H; Pitluck, Sam; Held, Brittany; Goodwin, Lynne A.; Liolios, Konstantinos; Ovchinnikova, Galina; Ivanova, N; Mavromatis, K; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Jeffries, Cynthia; Detter, J. Chris; Han, Cliff; Tapia, Roxanne; Ngatchou, Olivier Duplex; Rohde, Manfred; Goker, Markus; Spring, Stefan; Sikorski, Johannes; Woyke, Tanja; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C

    2011-01-01

    Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,511,574 bp long chromosome and the 4,916 bp plasmid with their 3,808 protein-coding and 49 RNA genes are a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  10. Transformation and regeneration of Brassica rapa using Agrobacterium tumefaciens.

    PubMed

    Radke, S E; Turner, J C; Facciotti, D

    1992-09-01

    Transformation and regeneration procedures for obtaining transgenic Brassica rapa ssp. oleifera plants are described. Regeneration frequencies were increasedby using silver nitrate and by adjusting the duration of exposure to 2,4-D. For transformation, Agrobacterium tumefaciens strain EHA101 containing a binary plasmid with the neomycin phosphotransferase gene (NPT II) and the b-glucuronidase gene (GUS) was cocultivated with hypocotyl explants from the oilseed B. rapa cvs. Tobin and Emma. Transformed plants were obtained within three months of cocultivation. Transformation frequencies for the cultivars Tobin and Emma were 1-9%. Evidence for transformation was shown by NPT II dot blot assay, the GUS fluorometric assay, Southern analysis, and segregation of the kanamycin-resistance trait in the progeny. The transformation and regeneration procedure described here has been used routinely to transform two cultivars of B. rapa and 18 cultivars of B. napus.

  11. Validated spectrofluorimetric method for determination of selected aminoglycosides

    NASA Astrophysics Data System (ADS)

    Omar, Mahmoud A.; Ahmed, Hytham M.; Hammad, Mohamed A.; Derayea, Sayed M.

    2015-01-01

    New, sensitive, and selective spectrofluorimetric method was developed for determination of three aminoglycoside drugs in different dosage forms, namely; neomycin sulfate (NEO), tobramycin (TOB) and kanamycin sulfate (KAN). The method is based on Hantzsch condensation reaction between the primary amino group of aminoglycosides with acetylacetone and formaldehyde in pH 2.7 yielding highly yellow fluorescent derivatives measured emission (471 nm) and excitation (410 nm) wavelengths. The fluorescence intensity was directly proportional to the concentration over the range 10-60, 40-100 and 5-50 ng/mL for NEO, TOB and KAN respectively. The proposed method was applied successfully for determination of these drugs in their pharmaceutical dosage forms.

  12. Transformation and regeneration of Brassica rapa using Agrobacterium tumefaciens.

    PubMed

    Radke, S E; Turner, J C; Facciotti, D

    1992-09-01

    Transformation and regeneration procedures for obtaining transgenic Brassica rapa ssp. oleifera plants are described. Regeneration frequencies were increasedby using silver nitrate and by adjusting the duration of exposure to 2,4-D. For transformation, Agrobacterium tumefaciens strain EHA101 containing a binary plasmid with the neomycin phosphotransferase gene (NPT II) and the b-glucuronidase gene (GUS) was cocultivated with hypocotyl explants from the oilseed B. rapa cvs. Tobin and Emma. Transformed plants were obtained within three months of cocultivation. Transformation frequencies for the cultivars Tobin and Emma were 1-9%. Evidence for transformation was shown by NPT II dot blot assay, the GUS fluorometric assay, Southern analysis, and segregation of the kanamycin-resistance trait in the progeny. The transformation and regeneration procedure described here has been used routinely to transform two cultivars of B. rapa and 18 cultivars of B. napus. PMID:24213157

  13. [Profiles of resistance to aminosides of Pseudomonas aeruginosa].

    PubMed

    Lesage, D; Delisle-Mizon, F; Vergez, P; Daguet, G

    1987-05-01

    Among all Gram-negative bacilli, Pseudomonas aeruginosa is one of the most resistant to aminoglycosides. Five hundred and seventeen P. aeruginosa strains were studied. Isolates came from three Paris hospitals. Reference strains were provided by P. Courvalin and A. Philippon. The following aminoglycosides were used: streptomycin (S), spectinomycin (Sp), kanamycin (K), neomycin (N), gentamicin (G), sisomicin (Ss), netilmicin (Nt), tobramycin (T), amikacin (A), habekacin (H). The in vitro activity of antibiotics was evaluated by the standardized disk agar diffusion test. Distribution of inhibition zone diameters among susceptible strains were represented by histograms. Resistance frequency to aminoglycosides was: G: 61.5%, Ss: 38.1%, T: 35.8%, Nt: 58.2%, A: 15.5%, Seven resistance patterns were identified: G: 3%, G Ss: 3%, G Nt: 8%, G Ss Nt: 7%, G Ss T: 5%, G Ss T Nt: 53%, G Ss T Nt A: 21%. Hypothesis about resistance mechanisms and interpretation of disk agar diffusion test are discussed.

  14. Eggplant (Solanum melongena L.).

    PubMed

    Van Eck, Joyce; Snyder, Ada

    2006-01-01

    Eggplant is an economically important vegetable crop in Asia and Africa, and although it is grown in Europe and the United States, it does not account for a significant percentage of agricultural production. It is susceptible to a number of pathogens and insects, with bacterial and fungal wilts being the most devastating. Attempts to improve resistance through introgression of traits from wild relatives have had limited success owing to sexual incompatibilities. Therefore, a crop improvement approach that combines both conventional breeding and biotechnological techniques would be beneficial. This chapter describes an Agrobacterium-mediated transformation protocol for eggplant based on inoculation of seedling explants (cotyledons and hypocotyls) and leaves. We have used this protocol to recover transformants from two different types of eggplant, a Solanum melongena L. breeding line, and S. melongena L. var. Black Eggplant. The selectable marker gene used was neomycin phosphotransferase II (nptII) and the selection agent was kanamycin. In vitro grown transformants acclimated readily to greenhouse conditions.

  15. Elimination of bacteria from dogs with antibiotics*

    PubMed Central

    Hayes, Norman R.; van der Waaij, D.; Cohen, Bennett J.

    1974-01-01

    The effect of oral administration of neomycin cephalothin or kanamycin cephalothin on the aerobic intestinal bacterial flora, was studied in dogs maintained under isolation conditions in a conventional animal room. The dogs were successfully freed of aerobic bacteria with both combinations within two to seven days after the start of antibiotic treatment, and were maintained bacteria free for up to 21 days. Decontamination was attained more rapidly in dogs that were bathed in hexachlorophene surgical soap before and during the first and third days of antibiotic treatment. There was no evidence of toxicity from either of the antibiotic combinations. These results indicate that, as with mice and monkeys, decontamination of dogs with oral antibiotics is feasible. The technique is of potential value in preventing endogenous bacterial infections in canine experimental studies involving use of immunosuppressive agents. PMID:4529233

  16. Genetic transformation of the figwort, Scrophularia buergeriana Miq., an Oriental medicinal plant.

    PubMed

    Park, S-U; Chae, Y-A; Facchini, P J

    2003-08-01

    Scrophularia buergeriana Miq. (figwort) contains a diverse group of bioactive natural products and is used to treat a variety of ailments, including fever, constipation, neuritis, and laryngitis. A transformation protocol was established for S. buergeriana using Agrobacterium tumefaciens. Kanamycin-resistant plants were regenerated from leaf explants co-cultivated with A. tumefaciens strain GV3101. The shoot regeneration medium was supplemented with 2 mg l(-1) 6-benzylaminopurine and 70 mg l(-1) putrescine to improve the efficiency of organogenesis. Detection of the neomycin phosphotransferase gene, the presence of high levels of beta-glucuronidase (GUS) transcripts and enzyme activity, and the histochemical localization of GUS confirmed the genetic transformation of S. buergeriana. This work demonstrates the potential of using A. tumefaciens to efficiently transfer foreign genes into a commercially and culturally important Oriental medicinal plant.

  17. [Sensitivity of Proteus hauseri bacteria to chemotherapeutic preparations depending on the cultivation conditions and on the composition of the nutrient medium].

    PubMed

    Shvidenko, I G

    1977-05-01

    Sensitivity of 227 Proteus strains isolated from patients was studied comparatively using the agar-diffusion method (disks) and the method of serial dilutions. Marked differences in the numbers of the strains resistant to benzylpenicillin and chloramphenicol were found with the above methods. It was shown that the ingredients of Ploskirev's medium significantly (by 2.8--13.5 times) inhibited the antibacterial activity of streptomycin, neomycin, monomycin, kanamycin, ampicillin and nalidixic acid and had practically no effect on the activity of benzylpenicillin, chloramphenicol and furazolidone. The values of the MIC of the drugs used in the experiment with liquid media correlated with those obtained with Sabouro's medium, which provided recommendation of the latter for determination of Proteus sensitivity by the method of serial dilutions in the solid medium, Cultivation of Proteus at a temperature of 40 degrees C resulted in a decrease of the resistance to most of the drugs tested by (by 3--12.4 times).

  18. Co-transformation of grapevine somatic embryos to produce transgenic plants free of marker genes.

    PubMed

    Dutt, Manjul; Li, Zhijian T; Dhekney, Sadanand A; Gray, Dennis J

    2012-01-01

    A cotransformation system using somatic embryos was developed to produce grapevines free of selectable marker genes. This was achieved by transforming Vitis vinifera L. "Thompson Seedless" somatic embryos with a mixture of two Agrobacterium strains. The first strain contained a binary plasmid with an egfp gene of interest between the T-DNA borders. The second strain harbored the neomycin phosphotransferase (nptII) gene for positive selection and the cytosine deaminase (codA) gene for negative selection, linked together by a bidirectional dual promoter complex. Our technique included a short positive selection phase of cotransformed somatic embryos on liquid medium containing 100 mg/L kanamycin before subjecting cultures to prolonged negative selection on medium containing 250 mg/L 5-fluorocytosine. PMID:22351010

  19. Molecular epidemiology and genetic linkage of macrolide and aminoglycoside resistance in Staphylococcus intermedius of canine origin.

    PubMed

    Boerlin, P; Burnens, A P; Frey, J; Kuhnert, P; Nicolet, J

    2001-03-20

    A collection of 77 Staphylococcus intermedius isolates from dogs and cats in Switzerland was examined for resistance to erythromycin. Resistance profiles for 14 additional antibiotics were compared between erythromycin-resistant and susceptible isolates. A resistance prevalence of 27% for erythromycin was observed in the population under study. Complete correlation between resistance to erythromycin, and to spiramycin, streptomycin, and neomycin was observed. The erythromycin-resistant isolates all had a reduced susceptibility to clindamycin when compared to the erythromycin-susceptible isolates. Both constitutive and inducible resistance phenotypes were observed for clindamycin. Ribotyping showed that macrolide-aminoglycoside resistance was randomly distributed among unrelated strains. This suggests that this particular resistance profile is not related to a single bacterial clone but to the horizontal transfer of resistance gene clusters in S. intermedius populations. The erythromycin-resistant isolates were all carrying erm(B), but not erm(A), erm(C), or msr(A). The erm(B) gene was physically linked to Tn5405-like elements known as resistance determinants for streptomycin, streptothricin, neomycin and kanamycin. Analysis of the region flanking erm(B) showed the presence of two different groups of erm(B)-Tn5405-like elements in the S. intermedius population examined and of elements found in Gram-positive species other than staphylococci. This strongly suggests that erm(B) or the whole erm(B)-Tn5405-like elements in S. intermedius originate from other bacterial species, possibly from enterococci. PMID:11230937

  20. Expression of bacterial genes in plant cells.

    PubMed Central

    Fraley, R T; Rogers, S G; Horsch, R B; Sanders, P R; Flick, J S; Adams, S P; Bittner, M L; Brand, L A; Fink, C L; Fry, J S; Galluppi, G R; Goldberg, S B; Hoffmann, N L; Woo, S C

    1983-01-01

    Chimeric bacterial genes conferring resistance to aminoglycoside antibiotics have been inserted into the Agrobacterium tumefaciens tumor-inducing (Ti) plasmid and introduced into plant cells by in vitro transformation techniques. The chimeric genes contain the nopaline synthase 5' and 3' regulatory regions joined to the genes for neomycin phosphotransferase type I or type II. The chimeric genes were cloned into an intermediate vector, pMON120, and inserted into pTiB6S3 by recombination and then introduced into petunia and tobacco cells by cocultivating A. tumefaciens cells with protoplast-derived cells. Southern hybridization was used to confirm the presence of the chimeric genes in the transformed plant tissues. Expression of the chimeric genes was determined by the ability of the transformed cells to proliferate on medium containing normally inhibitory levels of kanamycin (50 micrograms/ml) or other aminoglycoside antibiotics. Plant cells transformed by wild-type pTiB6S3 or derivatives carrying the bacterial neomycin phosphotransferase genes with their own promoters failed to grow under these conditions. The significance of these results for plant genetic engineering is discussed. Images PMID:6308651

  1. The comparative effects of aminoglycoside antibiotics and muscle relaxants on electrical field stimulation response in rat bladder smooth muscle.

    PubMed

    Min, Chang Ho; Min, Young Sil; Lee, Sang Joon; Sohn, Uy Dong

    2016-06-01

    It has been reported that several aminoglycoside antibiotics have a potential of prolonging the action of non-depolarizing muscle relaxants by drug interactions acting pre-synaptically to inhibit acetylcholine release, but antibiotics itself also have a strong effect on relaxing the smooth muscle. In this study, four antibiotics of aminoglycosides such as gentamicin, streptomycin, kanamycin and neomycin were compared with skeletal muscle relaxants baclofen, tubocurarine, pancuronium and succinylcholine, and a smooth muscle relaxant, papaverine. The muscle strips isolated from the rat bladder were stimulated with pulse trains of 40 V in amplitude and 10 s in duration, with pulse duration of 1 ms at the frequency of 1-8 Hz, at 1, 2, 4, 6, 8 Hz respectively. To test the effect of four antibiotics on bladder smooth muscle relaxation, each of them was treated cumulatively from 1 μM to 0.1 mM with an interval of 5 min. Among the four antibiotics, gentamicin and neomycin inhibited the EFS response. The skeletal muscle relaxants (baclofen, tubocurarine, pancuronium and succinylcholine) and inhibitory neurotransmitters (GABA and glycine) did not show any significant effect. However, papaverine, had a significant effect in the relaxation of the smooth muscle. It was suggested that the aminoglycoside antibiotics have inhibitory effect on the bladder smooth muscle.

  2. Molecular epidemiology and genetic linkage of macrolide and aminoglycoside resistance in Staphylococcus intermedius of canine origin.

    PubMed

    Boerlin, P; Burnens, A P; Frey, J; Kuhnert, P; Nicolet, J

    2001-03-20

    A collection of 77 Staphylococcus intermedius isolates from dogs and cats in Switzerland was examined for resistance to erythromycin. Resistance profiles for 14 additional antibiotics were compared between erythromycin-resistant and susceptible isolates. A resistance prevalence of 27% for erythromycin was observed in the population under study. Complete correlation between resistance to erythromycin, and to spiramycin, streptomycin, and neomycin was observed. The erythromycin-resistant isolates all had a reduced susceptibility to clindamycin when compared to the erythromycin-susceptible isolates. Both constitutive and inducible resistance phenotypes were observed for clindamycin. Ribotyping showed that macrolide-aminoglycoside resistance was randomly distributed among unrelated strains. This suggests that this particular resistance profile is not related to a single bacterial clone but to the horizontal transfer of resistance gene clusters in S. intermedius populations. The erythromycin-resistant isolates were all carrying erm(B), but not erm(A), erm(C), or msr(A). The erm(B) gene was physically linked to Tn5405-like elements known as resistance determinants for streptomycin, streptothricin, neomycin and kanamycin. Analysis of the region flanking erm(B) showed the presence of two different groups of erm(B)-Tn5405-like elements in the S. intermedius population examined and of elements found in Gram-positive species other than staphylococci. This strongly suggests that erm(B) or the whole erm(B)-Tn5405-like elements in S. intermedius originate from other bacterial species, possibly from enterococci.

  3. Stable transformation of tobacco by electroporation: evidence for plasmid concatenation.

    PubMed Central

    Riggs, C D; Bates, G W

    1986-01-01

    Electroporation (electric field-mediated DNA transfer) of tobacco protoplasts in the presence of the linearized plasmid pMON200 has led to the formation of transgenic plants. Defined electric shocks were delivered by capacitive discharges with readily available, low-cost electrical components. This transformation procedure is simple and efficient and may suggest a quick method for determining the appropriate electric fields for new cell systems. An optimal transformation frequency of 2.2 X 10(-4) (based on the number of cells subjected to the shock) was obtained with a single 2000-V/cm, 250-microseconds-duration capacitive discharge. Calli transformed to kanamycin resistance have been regenerated into whole plants. Southern blots of DNA from the transgenic plants demonstrate the integration of the selectable marker gene (neomycin phosphotransferase) at single or multiple genomic sites. In some cases, the plasmid appears to be integrated intact; in others, it is rearranged. The blots also provide evidence of plasmid recircularization and/or the formation of head-to-head and head-to-tail concatemers in most of the plants analyzed. Although some plants apparently have multiple integration sites, analysis of progeny obtained by self-fertilization of the transgenic plants indicates that the kanamycin-resistance marker is inherited as a single dominant gene. Images PMID:3016708

  4. Antimicrobial Sensitivity of Avibacterium paragallinarum Isolates from Four Latin American Countries.

    PubMed

    Luna-Galaz, G A; Morales-Erasto, V; Peñuelas-Rivas, C G; Blackall, P J; Soriano-Vargas, E

    2016-09-01

    The antimicrobial sensitivity of 11 reference strains and 66 Avibacterium paragallinarum isolates from four Latin American countries was investigated. All 11 reference strains were sensitive to amoxicillin-clavulanic acid, ampicillin, fosfomycin, gentamicin, kanamycin, neomycin, penicillin, tetracycline, and trimethoprim-sulfamethoxazole. The 11 reference strains were all resistant to lincomycin. All isolates (100%) from Mexico, Panama, and Peru were sensitive to amoxicillin-clavulanic acid, ampicillin, and fosfomycin. The Ecuadorian isolates showed some level of resistance to all 16 agents tested. The Ecuadorian isolates were significantly more sensitive to erythromycin, lincomycin, and streptomycin, and significantly more resistant to gentamicin, kanamycin, penicillin, and tetracycline, than the Mexican isolates. A total of 57.5% (38/66) of tested isolates were multi-drug resistant (MDR), with 16 MDR patterns detected in 88.4% (23/26) of the antimicrobial-resistant isolates from Ecuador, and 8 MDR patterns detected in 42.8% (15/35) of the antimicrobial-resistant isolates from Mexico. In conclusion, the variation in antimicrobial sensitivity patterns between isolates from Ecuador and Mexico emphasizes the importance of active, ongoing monitoring of A. paragallinarum isolates. PMID:27610729

  5. Axenic culture of free-living conchocelis of Porphyra yezoensis and Porphyra haitanensis

    NASA Astrophysics Data System (ADS)

    Liu, Hui-Lian; Shuai, Li; Duan, De-Lin; Xu, Huai-Shu

    2002-03-01

    After discarding marine microorganisms from conchocelis of Porphyra yezoensis and Porphyra haitanensis, their axenic cultures were obtained through treatment with antibiotics. Antibiotic disc tests were carried out to determine the effectiveness of each antibiotic in eliminating contaminating microorganisms. Five of 12 antibiotics tested were selected and used to produce the axenic cultures in this study, which showed that 200 μg/mL streptomycin, 250 μg/mL penicillin, 252 μg/mL kanamycin, 30 μg/mL chloramphenicol were effective concentrations for eliminating microorganisms from conchocelis when antibiotics were added singly step by step; whereas simultaneous combination of 150 μg/mL streptomycin, 250 (or 350) μg/mL penicillin, 150 (or 250) μg/mL kanamycin, 70 μg/mL neomycin and 200 μg/mL chloramphenicol was also effective for producing the axenic cultures. However, it seemed that the treatments with antibiotics applied individually were more feasible than those will all antibiotics added at the same time. This may be due to the combined inhibiting effect of antibiotics on the growth and development of conchocelis.

  6. Herbal therapy associated with antibiotic therapy: potentiation of the antibiotic activity against methicillin – resistant Staphylococcus aureus by Turnera ulmifolia L

    PubMed Central

    Coutinho, Henrique DM; Costa, José GM; Lima, Edeltrudes O; Falcão-Silva, Vivyanne S; Siqueira, José P

    2009-01-01

    Background Staphylococcus genus is widely spread in nature being part of the indigenous microbiota of skin and mucosa of animal and birds. Some Staphylococcus species are frequently recognized as etiological agents of many animal and human opportunistic infections This is the first report testing the antibiotic resistance-modifying activity of Turnera ulmifolia against methicillin-resistant Staphylococcus aureus – MRSA strain. Methods In this study an ethanol extract of Turnera ulmifolia L. and chlorpromazine were tested for their antimicrobial activity alone or in combination with aminoglycosides against an MRSA strain. Results The synergism of the ethanol extract and aminoglycosides were verified using microdillution method. A synergistic effect of this extract on gentamicin and kanamycin was demonstrated. Similarly, a potentiating effect of chlorpromazine on kanamycin, gentamicin and neomycin, indicating the involvement of an efflux system in the resistance to these aminoglycosides. Conclusion It is therefore suggested that extracts from Turnera ulmifolia could be used as a source of plant-derived natural products with resistance-modifying activity, constituting a new weapon against the problem of bacterial resistance to antibiotics demonstrated in MRSA strains. PMID:19426487

  7. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    PubMed

    Hailey, Dale W; Roberts, Brock; Owens, Kelly N; Stewart, Andrew K; Linbo, Tor; Pujol, Remy; Alper, Seth L; Rubel, Edwin W; Raible, David W

    2012-01-01

    Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  8. Natural products from the termite Nasutitermes corniger lowers aminoglycoside minimum inhibitory concentrations

    PubMed Central

    Coutinho, Henrique D. M.; Vasconcellos, Alexandre; Freire-Pessôa, Hilzeth L.; Gadelha, Carlos A.; Gadelha, Tatiane S.; Almeida-Filho, Geraldo G.

    2010-01-01

    Bacterial infectious agents present a risk to populations, as they are responsible for high morbidity and mortality. For combating these pathogens, our main line of defense is the use of antibiotics. However, indiscriminate use of these drugs develops resistant strains to these same drugs. The present study has tested the antibacterial and modifying antibiotic activity of natural products from Nasutitermes corniger (Termitidae) (Motschulsky), a termite used in folk medicine in Northeast Brazil, by the microdilution and checkerboard methods, respectively. In this study, the aqueous extract from the nest of N. corniger (ANCE) was prepared and tested with chlorpromazine (CPZ) for its antimicrobial activity, using the microdilution method. CPZ and ANCE were used independently and also in combination with aminoglycosides, against a strain of Escherichia coli resistant to these antibiotics, to determine the participation of efflux systems in resistance mechanisms. The fractional inhibitory concentration (FIC) index was calculated and evaluated for the occurrence of synergism, using the checkerboard method. The minimum inhibitory concentrations (MIC) and minimum bactericidal concentrations (MBC) values were ≥ 2048 μg/mL for both strains of E. coli assayed, indicating low antibacterial activity. However, synergism was observed with kanamycin when the decoction was used, but when chlorpromazine was used, synergism was observed with kanamycin, amikacin, and neomycin. This synergism with CPZ indicated the involvement of an efflux system in the resistance to these aminoglycosides. Therefore, it was suggested that the natural products from N. corniger could be used as a source of zoo-derived natural products with kanamycin-modifying activity, resulting in a new approach against bacterial resistance to antibiotics. PMID:20548928

  9. Agrobacterium tumefaciens-mediated genetic transformation of Salix matsudana Koidz. using mature seeds.

    PubMed

    Yang, Jingli; Yi, Jaeseon; Yang, Chuanping; Li, Chenghao

    2013-06-01

    An Agrobacterium tumefaciens-mediated transformation method was developed for Salix matsudana Koidz. using mature seeds as starting material. Multiple shoots were induced directly from embryonic shoot apices of germinating seeds. Although thidiazuron, 6-benzylaminopurine and zeatin induced multiple shoot induction with high frequency, zeatin (4.5 μM) was more effective for elongation of shoots and roots. The binary vector pCAMBIA1303, which contained neomycin phosphotransferase as a selectable marker gene and β-glucuronidase as a reporter gene, was used for transformation. Factors affecting transformation efficiency were examined for optimization of the procedure. Up to 35 of 180 seeds regenerated kanamycin-resistant shoots under optimal transformation conditions as follows: seeds were precultured for 4 days, apices of embryonic shoots were removed and infected with A. tumefaciens strain LBA4404 grown to a cell density equivalent (OD600) of 0.6, and then the infected explants were cultivated at 21 °C for 4 days. Storage of seeds at -20 °C for as long as 3 years had no significant effect on the induction of kanamycin-resistant shoots. Using this method, transgenic plants were obtained within ∼5 months with a transformation frequency of 7.2%. Analysis by polymerase chain reaction (PCR) showed that 36.4-93.8% of plants from all 13 tested kanamycin-resistant lines were PCR positive. Several 'escapes' were eliminated by a second round of selection. PCR, Southern blot and reverse transcriptase-PCR analyses of selected transgenic individuals 2 years after cutting propagation confirmed the successful generation of stable transformants. Our method, which minimizes the duration of axenic culture, may provide an alternative procedure for transformation of other recalcitrant Salix species.

  10. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .... (1) It is used in horses, dogs, and cats in the treatment or adjunctive therapy of certain ear and... and/or allergy. In addition the product is indicated as superficial dressing applied to minor cuts... ovariohysterectomies. The product may also be used in the treatment of acute otitis externa in dogs, acute...

  11. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .... (1) It is used in horses, dogs, and cats in the treatment or adjunctive therapy of certain ear and... and/or allergy. In addition the product is indicated as superficial dressing applied to minor cuts... ovariohysterectomies. The product may also be used in the treatment of acute otitis externa in dogs, acute...

  12. Toxicity modulation, resistance enzyme evasion, and A-site X-ray structure of broad-spectrum antibacterial neomycin analogs.

    PubMed

    Maianti, Juan Pablo; Kanazawa, Hiroki; Dozzo, Paola; Matias, Rowena D; Feeney, Lee Ann; Armstrong, Eliana S; Hildebrandt, Darin J; Kane, Timothy R; Gliedt, Micah J; Goldblum, Adam A; Linsell, Martin S; Aggen, James B; Kondo, Jiro; Hanessian, Stephen

    2014-09-19

    Aminoglycoside antibiotics are pseudosaccharides decorated with ammonium groups that are critical for their potent broad-spectrum antibacterial activity. Despite over three decades of speculation whether or not modulation of pKa is a viable strategy to curtail aminoglycoside kidney toxicity, there is a lack of methods to systematically probe amine-RNA interactions and resultant cytotoxicity trends. This study reports the first series of potent aminoglycoside antibiotics harboring fluorinated N1-hydroxyaminobutyryl acyl (HABA) appendages for which fluorine-RNA contacts are revealed through an X-ray cocrystal structure within the RNA A-site. Cytotoxicity in kidney-derived cells was significantly reduced for the derivative featuring our novel β,β-difluoro-HABA group, which masks one net charge by lowering the pKa without compromising antibacterial potency. This novel side-chain assists in evasion of aminoglycoside-modifying enzymes, and it can be easily transferred to impart these properties onto any number of novel analogs.

  13. Studies on the Conformational Features of Neomycin-B and its Molecular Recognition by RNA and Bacterial Defense Proteins

    NASA Astrophysics Data System (ADS)

    Asensio, Juan Luis; Bastida, Agatha; Jiménez-Barbero, Jesús

    According to NMR and molecular dynamics simulations, the conformational behavior of natural aminoglycosides is characterized by a remarkable flexibility, with different conformations, even non-exo-anomeric ones, in fast exchange. Very probably, this feature allows the adaptation of these ligands to the spatial and electronic requirements of different receptors. The large diversity of structures adopted by aminoglycosides in the binding pocket of the different RNA receptors and the distinct enzymes involved in bacterial resistance are consistent with this view. This conformational diversity can, in certain favorable cases, be exploited in the design of new antibiotic derivatives not susceptible to enzymatic inactivation, by designing tailor-made conformationally locked aminoglycosides.

  14. 21 CFR 524.155 - Bacitracin zinc-polymyxin B sulfate-neomycin sulfate-hydrocortisone or hydrocortisone acetate...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS... 10 milligrams of hydrocortisone acetate. (b) Conditions of use. Dogs and cats—(1) Amount. Apply...

  15. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL.... (1) It is used in horses, dogs, and cats in the treatment or adjunctive therapy of certain ear and... ovariohysterectomies. The product may also be used in the treatment of acute otitis externa in dogs, acute...

  16. 21 CFR 524.1484b - Neomycin sulfate, isoflupredone acetate, tetracaine hydrochloride, and myristyl-gamma-picolinium...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL.... (1) It is used in horses, dogs, and cats in the treatment or adjunctive therapy of certain ear and... ovariohysterectomies. The product may also be used in the treatment of acute otitis externa in dogs, acute...

  17. Elucidating pharmacodynamic interaction of silver nanoparticle - topical deliverable antibiotics.

    PubMed

    Thirumurugan, G; Seshagiri Rao, J V L N; Dhanaraju, M D

    2016-01-01

    In order to exploit the potential benefits of antimicrobial combination therapy, we need a better understanding of the circumstances under which pharmacodynamic interactions expected. In this study, Pharmacodynamic interactions between silver nanoparticle (SNP) and topical antibiotics such as Cefazolin (CEF), Mupirocin (MUP), Gentamycin (GEN), Neomycin (NEO), Tetracycline (TET), Vancomycin (VAN) were investigated using the MIC test, Combination assay followed by Fractional Inhibitory concentration Index and Agar well diffusion method. SNP + MUP, SNP + NEO, SNP + VAN combinations showed Synergism (SN) and SNP + CEF, SNP + GEN, SNP + TET showed Partial synergism (PS) against Staphylococcus aureus. Four combinations (SNP + CEF, SNP + MUP, SNP + GEN, SNP + VAN) showed SN, SNP + TET showed PS and Indifferent effect (ID) were observed for SNP + NEO against Pseudomonas aeruginosa. SN was observed for SNP + CEF, SNP + GEN, SNP + NEO, SNP + TET and SNP + MUP showed ID, SNP + VAN showed PS against Escherichia coli. In addition, we elucidated the possible mechanism involved in the pharmacodynamic interaction between SNP-topical antibiotics by increased ROS level, membrane damage following protein release, K(+) leakage and biofilm inhibition. Thus, our findings support that conjugation of the SNP with topical antibiotics have great potential in the topical formulation when treating complex resistant bacterial infections and where there is a need of more concentration to kill pathogenic bacteria. PMID:27427207

  18. [Proposed neotype Streptomyces ruber (Krainsky, 1914) Waksman et Henrici, 1948].

    PubMed

    Kuznetsov, V D; Filippova, S N; Poltorak, V A

    1987-01-01

    Culture 78 was proposed as a neotype of Streptomyces ruber. It was isolated from the soils of the Baikal region and was closest, in its taxonomic properties, to the original description of the species [13] whose representative had been lost. Cultures from different microbial collections designated as S. ruber were shown to be unlike the original description. The neotype had the following taxononic properties: the cell wall of type I; spiral sporophores with extended spirals having 2-3 coils; oval spores with a smooth envelope; greyish pink aerial and dark-red substrate mycelia; a red pigment not passing into the medium; slow gelatin liquefaction and milk peptonization; weak starch hydrolysis; assimilation of glucose, xylose, rammose, fructose, and inositol; weak growth on arabinose, raffinose and mannitol, but not on sucrose; no formation of melanoid pigments; synthesis of riboflavin and prodigiosin pigments; inhibition of Gram-positive bacterial and acid-resistant mycobacterial growth; no inhibition of yeast and fungal growth. The culture was sensitive to streptomycin, neomycin, gentamycin, monomycin, tetracycline,erythromycin, oleandomycin, lincomycin, ristomycin, levomycetin, polymyxin and fusidin, but resistant in penicillin. The population was composed of six variants [3]: main, faded, asporogenic red, asporogenic yellow, asporogenic white and nocardia-like. The latter two were not capable of riboflavin and prodigiosin formation. The asporogenic yellow variant was a monosynthetic organism: it formed riboflavin, but could not synthesize prodigiosin. The neotype of S. ruber 78 is deposited withthe national Collection of Microorganisms (the reference number is VKM A-611). PMID:3613997

  19. Elucidating pharmacodynamic interaction of silver nanoparticle - topical deliverable antibiotics

    NASA Astrophysics Data System (ADS)

    Thirumurugan, G.; Seshagiri Rao, J. V. L. N.; Dhanaraju, M. D.

    2016-07-01

    In order to exploit the potential benefits of antimicrobial combination therapy, we need a better understanding of the circumstances under which pharmacodynamic interactions expected. In this study, Pharmacodynamic interactions between silver nanoparticle (SNP) and topical antibiotics such as Cefazolin (CEF), Mupirocin (MUP), Gentamycin (GEN), Neomycin (NEO), Tetracycline (TET), Vancomycin (VAN) were investigated using the MIC test, Combination assay followed by Fractional Inhibitory concentration Index and Agar well diffusion method. SNP + MUP, SNP + NEO, SNP + VAN combinations showed Synergism (SN) and SNP + CEF, SNP + GEN, SNP + TET showed Partial synergism (PS) against Staphylococcus aureus. Four combinations (SNP + CEF, SNP + MUP, SNP + GEN, SNP + VAN) showed SN, SNP + TET showed PS and Indifferent effect (ID) were observed for SNP + NEO against Pseudomonas aeruginosa. SN was observed for SNP + CEF, SNP + GEN, SNP + NEO, SNP + TET and SNP + MUP showed ID, SNP + VAN showed PS against Escherichia coli. In addition, we elucidated the possible mechanism involved in the pharmacodynamic interaction between SNP-topical antibiotics by increased ROS level, membrane damage following protein release, K+ leakage and biofilm inhibition. Thus, our findings support that conjugation of the SNP with topical antibiotics have great potential in the topical formulation when treating complex resistant bacterial infections and where there is a need of more concentration to kill pathogenic bacteria.

  20. Physiological Properties and Salmonella Growth Inhibition of Probiotic Bacillus Strains Isolated from Environmental and Poultry Sources

    PubMed Central

    Morgan, Marion J.; Pumford, Neil R.; Hargis, Billy M.

    2013-01-01

    The objective of the present study was to describe the physiological properties of seven potential probiotic strains of Bacillus spp. Isolates were characterized morphologically, biochemically, and by 16S rRNA sequence analyses for identification. Tolerance to acidic pH, high osmotic concentrations of NaCl, and bile salts were tested. Isolates were also evaluated for their ability to metabolize different carbohydrates sources. The antimicrobial sensitivity profiles were determined. Inhibition of gastrointestinal Salmonella colonization in an avian model was also evaluated. Five strains of Bacillus were tolerant to acidic conditions (pH 2.0) and all strains were tolerant to a high osmotic pressure (NaCl at 6.5%). Moreover, all strains were able to tolerate concentration of 0.037% bile salts after 24 h of incubation. Three strains were able to significantly reduce Salmonella Typhimurium levels in the crop and in the ceca of broiler-type chickens. Among the 12 antibiotics tested for antibiotic resistance, all strains were resistant to bacitracin and susceptible to gentamycin, neomycin, ormethoprim, triple sulfa, and spectinomycin. Bacterial spore formers have been shown to prevent gastrointestinal diseases in animals and humans. The results obtained in this study show important characteristics to be evaluated when selecting Bacillus spp. candidates to be used as probiotics. PMID:26904728

  1. Elucidating pharmacodynamic interaction of silver nanoparticle - topical deliverable antibiotics

    PubMed Central

    Thirumurugan, G.; Seshagiri Rao, J. V. L. N.; Dhanaraju, M. D.

    2016-01-01

    In order to exploit the potential benefits of antimicrobial combination therapy, we need a better understanding of the circumstances under which pharmacodynamic interactions expected. In this study, Pharmacodynamic interactions between silver nanoparticle (SNP) and topical antibiotics such as Cefazolin (CEF), Mupirocin (MUP), Gentamycin (GEN), Neomycin (NEO), Tetracycline (TET), Vancomycin (VAN) were investigated using the MIC test, Combination assay followed by Fractional Inhibitory concentration Index and Agar well diffusion method. SNP + MUP, SNP + NEO, SNP + VAN combinations showed Synergism (SN) and SNP + CEF, SNP + GEN, SNP + TET showed Partial synergism (PS) against Staphylococcus aureus. Four combinations (SNP + CEF, SNP + MUP, SNP + GEN, SNP + VAN) showed SN, SNP + TET showed PS and Indifferent effect (ID) were observed for SNP + NEO against Pseudomonas aeruginosa. SN was observed for SNP + CEF, SNP + GEN, SNP + NEO, SNP + TET and SNP + MUP showed ID, SNP + VAN showed PS against Escherichia coli. In addition, we elucidated the possible mechanism involved in the pharmacodynamic interaction between SNP-topical antibiotics by increased ROS level, membrane damage following protein release, K+ leakage and biofilm inhibition. Thus, our findings support that conjugation of the SNP with topical antibiotics have great potential in the topical formulation when treating complex resistant bacterial infections and where there is a need of more concentration to kill pathogenic bacteria. PMID:27427207

  2. Detection limits of antimicrobials in ewe milk by delvotest photometric measurements.

    PubMed

    Althaus, R L; Torres, A; Montero, A; Balasch, S; Molina, M P

    2003-02-01

    The Delvotest method detection limits per manufacturer's instructions at a fixed reading time of 3 h for 24 antimicrobial agents were determined in ewe milk by photometric measurement. For each drug, eight concentrations were tested on 20 ewe milk samples from individual ewes. Detection limits, determined by means of logistic regression models, were (microg/kg): 3, amoxycillin; 2, ampicillin; 18, cloxacillin; 1, penicillin "G"; 34, cefadroxil; 430, cephalosporin "C"; 40, cephalexin; 20, cefoperazone; 33, Ceftiofur; 18, cefuroxime; 6100, streptomycin; 1200, gentamycin; 2600, neomycin; 830, erythromycin; 100, tylosin; 180, doxycycline; 320, oxytetracycline; 590, tetracycline; 88, sulfadiazine; 44, sulfamethoxazole; 140, sulfametoxypyridazine; 48, sulfaquinoxaline; 12,000, chloramphenicol; and 290, trimethoprim. Whereas the beta-lactam antibiotics, sulphonamides, and tylosin were detected by Delvotest method at levels equal to those of maximum residue limits, its sensitivity needs to be enhanced to detect aminoglycosides, tetracyclines, streptomycin, chloramphenicol, and trimethoprim residues in ewe milk or to develop an integrated residue detection system for ewe milk with different sensitive microorganisms for each group of antiinfectious agents. PMID:12647952

  3. Antimicrobial resistance of non-typhoidal Salmonella isolates from egg layer flocks and egg shells.

    PubMed

    Pande, Vivek V; Gole, Vaibhav C; McWhorter, Andrea R; Abraham, Sam; Chousalkar, Kapil K

    2015-06-16

    This study was conducted to examine the antimicrobial resistance (AMR) of Salmonella spp. isolated from commercial caged layer flocks in New South Wales and South Australia. All Salmonella isolates (n=145) were subjected to phenotypic and genotypic characterisation of AMR and carriage of integrons. The majority of Salmonella isolates (91.72%) were susceptible to all antimicrobials tested in this study. Limited resistance was observed to amoxicillin and ampicillin (5.51%), tetracycline (4.13%), cephalothin (2.06%) and trimethoprim (0.68%). None of the isolates were resistant to cefotaxime, ceftiofur, ciprofloxacin, chloramphenicol, gentamycin, neomycin or streptomycin. A low frequency of Salmonella isolates (4.83%) harboured antimicrobial resistance genes and a class 1 integron. The most commonly detected AMR genes among the Salmonella isolates were blaTEM (2.07%), tet A (1.38%) and dhfrV (0.69%). Overall, Salmonella enterica isolates exhibited a low frequency of AMR and represent a minimal public health risk associated with the emergence of multidrug resistant Salmonella spp. from the Australian layer industry.

  4. Antibacterial activities of multi drug resistant Myroides odoratimimus bacteria isolated from adult flesh flies (Diptera: sarcophagidae) are independent of metallo beta-lactamase gene

    PubMed Central

    Dharne, M.S.; Gupta, A.K.; Rangrez, A.Y.; Ghate, H.V.; Patole, M.S.; Shouche, Y.S.

    2008-01-01

    Flesh flies (Diptera: Sarcophagidae) are well known cause of myiasis and their gut bacteria have never been studied for antimicrobial activity against bacteria. Antimicrobial studies of Myroides spp. are restricted to nosocomial strains. A Gram-negative bacterium, Myroides sp., was isolated from the gut of adult flesh flies (Sarcophaga sp.) and submitted to evaluation of nutritional parameters using Biolog GN, 16S rRNA gene sequencing, susceptibility to various antimicrobials by disc diffusion method and detection of metallo β-lactamase genes (TUS/MUS). The antagonistic effects were tested on Gram-negative and Gram-positive bacteria isolated from human clinical specimens, environmental samples and insect mid gut. Bacterial species included were Aeromonas hydrophila, A. culicicola, Morganella morganii subsp. sibonii, Ochrobactrum anthropi, Weissella confusa, Escherichia coli, Ochrobactrum sp., Serratia sp., Kestersia sp., Ignatzschineria sp., Bacillus sp. The Myroides sp. strain was resistant to penicillin-G, erythromycin, streptomycin, amikacin, kanamycin, gentamycin, ampicillin, trimethoprim and tobramycin. These strain showed antibacterial action against all bacterial strains except W. confusa, Ignatzschineria sp., A. hydrophila and M. morganii subsp. sibonii. The multidrug resistance of the strain was similar to the resistance of clinical isolates, inhibiting growth of bacteria from clinical, environmental and insect gut samples. The metallo β-lactamase (TUS/MUS) genes were absent, and resistance due to these genes was ruled out, indicating involvement of other secretion machinery. PMID:24031236

  5. Isolation and Characterization of Four Gram-PositiveNickel-Tolerant Microorganisms from Contaminated Riparian Sediments

    SciTech Connect

    Van Nostrand, Joy D.; Khijniak, Tatiana V.; Gentry, Terry J.; Novak, Michelle T.; Sowder, Andrew G.; Zhou, Jizhong Z.; Bertsch, PaulM.; Morris, Pamela J.

    2006-08-30

    Microbial communities from riparian sediments contaminatedwith high levels of Ni and U were examined for metal-tolerantmicroorganisms. Isolation of four aerobic Ni-tolerant, Gram-positiveheterotrophic bacteria indicated selection pressure from Ni. Theseisolates were identified as Arthrobacter oxydans NR-1, Streptomycesgalbus NR-2, Streptomyces aureofaciens NR-3, and Kitasatosporacystarginea NR-4 based on partial 16S rDNA sequences. A functional genemicroarray containing gene probes for functions associated withbiogeochemical cycling, metal homeostasis, and organic contaminantdegradation showed little overlap among the four isolates. Fifteen of thegenes were detected in all four isolates with only two of these relatedto metal resistance, specifically to tellurium. Each of the four isolatesalso displayed resistance to at least one of six antibiotics tested, withresistance to kanamycin, gentamycin, and ciprofloxacin observed in atleast two of the isolates. Further characterization of S. aureofaciensNR-3 and K. cystarginea NR-4 demonstrated that both isolates expressed Nitolerance constitutively. In addition, both were able to grow in higherconcentrations of Ni at pH 6 as compared to pH 7 (42.6 and 8.5 mM Ni atpH 6 and 7, respectively). Tolerance to Cd, Co, and Zn was also examinedin these two isolates; a similar pH-dependent metal tolerance wasobserved when grown with Co and Zn. Neither isolate was tolerant to Cd.These findings suggest that Ni is exerting a selection pressure at thissite for metal-resistant actinomycetes.

  6. Carnobacterium Pleistocaenium sp. nov.: A Novel Psychrotolerant, Facultative Anaerobe Isolated from Permafrost of the Fox Tunnel in Alaska

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena V.; Marsic, Damien; Bej, Asim; Tang, Jane; Krader, Paul; Hoover, Richard B.

    2004-01-01

    A novel, psychrotolerant, facultative anaerobe, strain FTRIT1(sup T), was isolated from Pleistocene ice from the permafrost tunnel in Fox, Alaska. Gram-positive, motile, rod-shaped cells with sizes 0.6-0.7 x 0.9-1.5 micrometers were observed. Growth occurred within the pH range 6.5-9.5 and optimum at pH 7.3-7.5. The temperature range of the new isolate was 0-28 C and optimum growth occurred at 24 C. The novel isolate requires NaCl (growth absent at 0 %) and growth was observed between 0 and 5% NaCl with optimum at 0.5% (w/v). The new isolate was a catalase-negative chemoorganoheterotroph that used as substrates sugars and some products of proteolysis. The metabolic end products were: acetate, ethanol and CO2. Strain FTRl was sensitive to ampicillin, tetracycline, chloramphenicol, rifampin, kanamycin, and gentamycin. The 16S rDNA sequence analysis showed 99.8% similarity of strain FTR1 with Carnobacterium alterfunditum, but the DNA-DNA hybridization between them demonstrated 39 plus or minus 5% homology. On the basis of genotypic and phenotypic characteristics, it is proposed that the strain FTR1(sup T) (= ATCC BAA-754(sup T) = JSM 12174(sup T) is assigned to the new species of the genus Carnobacterium with proposed name Carnobacterium pleistocaenium sp. nov.

  7. Desulfonatronum paiuteum sp. nov.: A New Alkaliphilic, Sulfate-Reducing Bacterium, Isolated from Soda Mono Lake, California

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Hoover, Richard B.; Marsic, Damien; Whitman, William; Cleland, David; Krader, Paul; Six, N. Frank (Technical Monitor)

    2002-01-01

    A novel alkaliphilic, sulfate reducing bacterium strain MLF1(sup T) was isolated from sediments of soda Mono Lake, California. Gram-negative vibrion cells, motile by singular polar flagellum, with sizes 0.5 - 0.6x 1.2 - 2.0 micron occurred singly, in pairs or short spirilla. Growth was observed over the temperature range of +15 C to +48 C (optimum +37 C), NaCl concentration range is greater than 1 - 7 %, wt/vol (optimum 3 %, wt/vol) and pH range 7.8 - 10.5 (optimum pH 9.0 - 9.4). The novel isolate is strictly alkaliphilic, requires high carbonate concentration in medium, obligately anaerobic and catalase negative. As electron donors strain MLF1(sup T) uses hydrogen, formate, ethanol. Sulfate, sulfite, and thiosulfate (but not sulfur or nitrate) can be used as electron acceptors. The sole end product of growth on formate was H2S. Strain MLF1(sup T) is resistant to kanamycin and gentamycin, but sensitive to chloramphenicol and tetracycline. Na2MoO4 inhibits growth of strain MLF1(sup T). The sum of G+C in DNA is 63.1 mol% (by HPLC method). On the basis of physiological and molecular properties, the isolate was considered as novel species of genus Desulfonatronum; and the name Desulfonatronum paiuteum sp. nov., is proposed (type strain MLF1(sup T) = ATCC BAA-395(sup T) = DSMZ 14708(sup T).

  8. Gelidivirgula Patagoniensis Gen. Nov., Sp. Nov., A Novel Psychrotolerant, Sporeforming Anaerobe Isolated from Magellanic Penguin Guano in Patagonia, Chile

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena V.; Hoover, Richard B.; Marsic, Damien; Whitman, William B.; Tang, Jane; Krader, Paul

    2003-01-01

    A novel obligately anaerobic, psychrotrophic bacterium, strain PPP2(sup T), was isolated from guano of the Magellanic penguin (Spheniscus magellanicus) in Patagonia, Chile. The Gram-positive, sporeforming, straight rods with sizes 0.6-0.9 x 3.0-5.0 microns, are motile by peritrichous flagella. Growth was observed to occur within the pH range 6.0-9.5 (optimum pH x), and temperature range 2-28 C (optimum 20 C). The novel isolate does not require NaCl for growth, but is halotolerant and growth was observed between 0 and 7 % NaCl (w/v) with optimum at 0.5 % (w/v). The new isolate is a catalase negative chemoorganohetherotroph with fermentative metabolism and uses as substrates: peptone, Bacto-tryptone, Casamino acids, and yeast extract. The major metabolic products are: acetate, butyrate, ethanol, and hydrogen is a minor gas product.. Strain PPP2 was sensitive to ampicillin, tetracycline, chloramphenicol, rifampin, kanamycin, and gentamycin. The G+C content of the DNA is 43.6 mol%. On the basis of 16S rDNA gene sequences and phenotypic characteristics, it is proposed that the strain PPP2(sup T) (= ATCC BAA-755(sup T) = JSM ...(sup T)) is assigned to the new genus Gelidivirgula gen. nov., as a representative of the new species, Gelidivirgula patagonensis sp. nov.

  9. Spirochaeta americana sp. nov.: A New Haloalkaliphilic, Obligately Anaerobic Spirochete Isolated from Soda Mono Lake, California

    NASA Technical Reports Server (NTRS)

    Hoover, Richard B.; Pikuta, Elena V.; Marsic, Damien; Whitman, William B.; Tang, Jane; Krader, Paul; Six, N. Frank (Technical Monitor)

    2002-01-01

    A novel obligately anaerobic, mesophilic, haloalkaliphilic spirochete, strain ASpG1, was isolated from sediments of the alkaline, hypersaline Mono Lake in California, U.S.A. The gram-negative cells are motile and spirochete-shaped with sizes of 0.22 x 10-15 micron. Growth was observed over the temperature range of 10 C to 44 C (optimum 37 C), NaCl concentration range of greater than 1 - 12 % (wt/vol) (optimum 3%), and pH range 7.5 - 10.5 (optimum pH 9.5). The novel isolate is strictly alkaliphilic, requires high concentrations of carbonate in the medium, and is capable of utilizing D-glucose, fructose, maltose, sucrose, starch, and D-mannitol. Main end products of glucose fermentation are: H2, acetate, ethanol, and formate. Strain AspG1 is resistant to kanamycin, but sensitive to chloramphenicol, gentamycin and tetracycline. The G+C content of its DNA is 58.5 mol%. On the basis of its physiological and molecular properties, the isolate appears to be a novel species among the genus Spirochaeta; and the name Spirochaeta americana sp. nov., is proposed for the taxon (type strain ASpG1(sup T) = ATCC BAA_392(sup T) = DSMZ 14872(sup T)).

  10. Antimicrobial activity and the presence of virulence factors and bacteriocin structural genes in Enterococcus faecium CM33 isolated from ewe colostrum

    PubMed Central

    Nami, Yousef; Haghshenas, Babak; Haghshenas, Minoo; Yari Khosroushahi, Ahmad

    2015-01-01

    Screening of lactic acid bacteria (LAB) isolated from ewe colostrum led to the identification and isolation of Enterococcus faecium CM33 with interesting features like high survival rates under acidic or bile salts condition, high tolerance for the simulated gastrointestinal condition, and high adhesive potential to Caco-2 cells. According the inhibition of pathogen adhesion test results, this strain can reduce more than 50% adhesion capacity of Escherichia coli, Shigella flexneri, Klebsiella pneumoniae, Listeria monocytogenes, and Staphylococcus aureus to Caco-2 cells. Based on the antibiotic sensitivity test findings, E. faecium CM33 was susceptible to gentamycin, vancomycin, erythromycin, ampicillin, penicillin, tetracycline, and rifampicin, but resistant to chloramphenicol, clindamycin, and kanamycin. Upon assessment of the virulence determinants for E. faecium CM33, this strain was negative for all tested virulence genes. Furthermore, the genome of this strain was evaluated for the incidence of the known enterocin genes by specific PCR amplification and discovered the genes encoding enterocins A, 31, X, and Q. Based on this study findings, the strain E. faecium CM33 can be considered as a valuable nutraceutical and can be introduced as a new potential probiotic. PMID:26284059

  11. Hierarchal clustering yields insight into multidrug-resistant bacteria isolated from a cattle feedlot wastewater treatment system.

    PubMed

    Jahne, Michael A; Rogers, Shane W; Ramler, Ivan P; Holder, Edith; Hayes, Gina

    2015-01-01

    Forty-two percent of Escherichia coli and 58% of Enterococcus spp. isolated from cattle feedlot runoff and associated infiltration basin and constructed wetland treatment system were resistant to at least one antibiotic of clinical importance; a high level of multidrug resistance (22% of E. coli and 37% of Enterococcus spp.) was observed. Hierarchical clustering revealed a closely associated resistance cluster among drug-resistant E. coli isolates that included cephalosporins (ceftiofur, cefoxitin, and ceftriaxone), aminoglycosides (gentamycin, kanamycin, and amikacin), and quinolone nalidixic acid; antibiotics from these classes were used at the study site, and cross-resistance may be associated with transferrable multiple-resistance elements. For Enterococcus spp., co-resistance among vancomycin, linezolid, and daptomycin was common; these antibiotics are reserved for complicated clinical infections and have not been approved for animal use. Vancomycin resistance (n = 49) only occurred when isolates were resistant to linezolid, daptomycin, and all four of the MLSB (macrolide-lincosamide-streptogramin B) antibiotics tested (tylosin, erythromycin, lincomycin, and quinipristin/dalfopristin). This suggests that developing co-resistance to MLSB antibiotics along with cyclic lipopeptides and oxazolidinones may result in resistance to vancomycin as well. Effects of the treatment system on antibiotic resistance were pronounced during periods of no rainfall and low flow (long residence time). Increased hydraulic loading (short residence time) under the influence of rain caused antibiotic-resistant bacteria to be flushed through the treatment system. This presents concern for environmental discharge of multidrug-resistant organisms relevant to public health.

  12. Multidrug-resistant Klebsiella pneumoniae isolated from farm environments and retail products in Oklahoma.

    PubMed

    Kim, Shin-Hee; Wei, Cheng-I; Tzou, Ywh-Min; An, Haejung

    2005-10-01

    Multidrug-resistant enteric bacteria were isolated from turkey, cattle, and chicken farms and retail meat products in Oklahoma. Among the isolated species, multidrug-resistant Klebsiella pneumoniae was prevalently isolated from most of the collected samples. Therefore, a total of 132 isolates of K. pneumoniae were characterized to understand their potential roles in the dissemination of antibiotic-resistance genes in the food chains. Multidrug-resistant K. pneumoniae was most frequently recovered from a turkey farm and ground turkey products among the tested samples. All isolates were resistant to ampicillin, tetracycline, streptomycin, gentamycin, and kanamycin. Class 1 integrons located in plasmids were identified as a common carrier of the aadA1 gene, encoding resistance to streptomycin and spectinomycin. Production of beta-lactamase in the K. pneumoniae isolates played a major role in the resistance to beta-lactam agents. Most isolates (96%) possessed bla(SHV1). Five strains were able to express both SHV-11 (pI 6.2) and TEM-1 (pI 5.2) beta-lactamase. Transfer of these antibiotic-resistance genes to Escherichia coli was demonstrated by transconjugation. The bacterial genomic DNA restriction patterns by pulsed-field gel electrophoresis showed that the same clones of multidrug-resistant K. pneumoniae remained in feathers, feed, feces, and drinking water in turkey environments, indicating the possible dissemination of antibiotic-resistance genes in the ecosystem and cross-contamination of antibiotic-resistant bacteria during processing and distribution of products.

  13. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health

    PubMed Central

    Igbinosa, Etinosa O.; Beshiru, Abeni; Akporehe, Lucy U.; Oviasogie, Faith E.; Igbinosa, Owen O.

    2016-01-01

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%–100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p < 0.05) suggesting a consequence of the dissemination of resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities. PMID:27669285

  14. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    PubMed

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p < 0.05) suggesting a consequence of the dissemination of resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  15. Isolation, antibiogram and pathogenicity of Salmonella spp. recovered from slaughtered food animals in Nagpur region of Central India

    PubMed Central

    Kalambhe, D. G.; Zade, N. N.; Chaudhari, S. P.; Shinde, S. V.; Khan, W.; Patil, A. R.

    2016-01-01

    Aim: To determine the prevalence, antibiogram and pathogenicity of Salmonella spp. in the common food animals slaughtered for consumption purpose at government approved slaughter houses located in and around Nagpur region during a period of 2010-2012. Materials and Methods: A total of 400 samples comprising 50 each of blood and meat from each slaughtered male cattle, buffaloes, pigs and goats were collected. Isolation was done by pre-enrichment in buffered peptone water and enrichment in Rappaport-Vassiliadis broth with subsequent selective plating onto xylose lysine deoxycholate agar. Presumptive Salmonella colonies were biochemically confirmed and analyzed for pathogenicity by hemolysin production and Congo red dye binding assay (CRDA). An antibiotic sensitivity test was performed to assess the antibiotic resistance pattern of the isolates. Results: A total of 10 isolates of Salmonella spp. from meat (3 from cattle, 1 from buffaloes and 6 from pigs) with an overall prevalence of 5% among food animals was recorded. No isolation was reported from any blood samples. Pathogenicity assays revealed 100% and 80% positivity for CRDA and hemolytic activity, respectively. Antimicrobial sensitivity test showed multi-drug resistance. The overall resistance of 50% was noted for trimethoprim followed by ampicillin (20%). A maximum sensitivity (80%) was reported to gentamycin followed by 40% each to ampicillin and trimethoprim, 30% to amikacin and 10% to kanamycin. Conclusion: The presence of multidrug resistant and potentially pathogenic Salmonella spp. in slaughtered food animals in Nagpur region can be a matter of concern for public health. PMID:27051204

  16. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    PubMed

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-01-01

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p < 0.05) suggesting a consequence of the dissemination of resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities. PMID:27669285

  17. [Sensitivity to drugs of Escherichia coli strains isolated from poultry with coli septicemia].

    PubMed

    Giurov, B

    1985-01-01

    Investigations were carried out into the susceptibility of a total of 223 strains of Escherichia coli to therapeutic agents with the employment of the disk diffusion method. The organisms were isolated from internal organs and bone marrow of birds died of coli septicaemia. The serologic classification of the strains was defined with the use of 88 anti-group OK-agglutinating sera obtained through hyperimmunization of rabbits with the following Escherichia coli serotypes: 01-063, 068, 071, 073, 075, 078, 086, 0101, 0103, 0111-0114, 0119, 0124, 0129, 0135-0141, 0146, 0147, and 0149. It was found that serologically the strains referred as follows: 01-41 strains, 02-70 strains, 04-2 strains, 08-3 strains, 026-1 strain, 078-70 strains, 0111-2 strains, 0103-1 strain, 0141-1 strain. The number of untypable strains amounted to 32. Highest number of strains proved sensitive to colistin--96.06%, the remaining drugs following in a descending order: flumequine--95.65%, apramycin - 95.5%, gentamycin--93.72%, amoxicillin--93,8%, amikacin--88.57%, carbenicillin--86.88%, furazolidone--83,13%, and kanamycin--79.36%. High was the percent of strains resistant to tetracycline--66.17%, spectinomycin--61.67%, ampicillin--51.12%, chloramphenicol--50.23%, and streptomycin--44.84%.

  18. Hierarchal clustering yields insight into multidrug-resistant bacteria isolated from a cattle feedlot wastewater treatment system.

    PubMed

    Jahne, Michael A; Rogers, Shane W; Ramler, Ivan P; Holder, Edith; Hayes, Gina

    2015-01-01

    Forty-two percent of Escherichia coli and 58% of Enterococcus spp. isolated from cattle feedlot runoff and associated infiltration basin and constructed wetland treatment system were resistant to at least one antibiotic of clinical importance; a high level of multidrug resistance (22% of E. coli and 37% of Enterococcus spp.) was observed. Hierarchical clustering revealed a closely associated resistance cluster among drug-resistant E. coli isolates that included cephalosporins (ceftiofur, cefoxitin, and ceftriaxone), aminoglycosides (gentamycin, kanamycin, and amikacin), and quinolone nalidixic acid; antibiotics from these classes were used at the study site, and cross-resistance may be associated with transferrable multiple-resistance elements. For Enterococcus spp., co-resistance among vancomycin, linezolid, and daptomycin was common; these antibiotics are reserved for complicated clinical infections and have not been approved for animal use. Vancomycin resistance (n = 49) only occurred when isolates were resistant to linezolid, daptomycin, and all four of the MLSB (macrolide-lincosamide-streptogramin B) antibiotics tested (tylosin, erythromycin, lincomycin, and quinipristin/dalfopristin). This suggests that developing co-resistance to MLSB antibiotics along with cyclic lipopeptides and oxazolidinones may result in resistance to vancomycin as well. Effects of the treatment system on antibiotic resistance were pronounced during periods of no rainfall and low flow (long residence time). Increased hydraulic loading (short residence time) under the influence of rain caused antibiotic-resistant bacteria to be flushed through the treatment system. This presents concern for environmental discharge of multidrug-resistant organisms relevant to public health. PMID:25504186

  19. Mass mortality in ornamental fish, Cyprinus carpio koi caused by a bacterial pathogen, Proteus hauseri.

    PubMed

    Kumar, Raj; Swaminathan, T Raja; Kumar, Rahul G; Dharmaratnam, Arathi; Basheer, V S; Jena, J K

    2015-09-01

    Moribund koi carp, Cyprinus carpio koi, from a farm with 50% cumulative mortality were sampled with the aim of isolating and detecting the causative agent. Three bacterial species viz., Citrobacter freundii (NSCF-1), Klebsiella pneumoniae (NSKP-1) and Proteus hauseri [genomospecies 3 of Proteus vulgaris Bio group 3] (NSPH-1) were isolated, identified and characterized on the basis of biochemical tests and sequencing of the 16S rDNA gene using universal bacterial primers. Challenge experiments with these isolates using healthy koi carp showed that P. hauseri induced identical clinical and pathological states within 3 d of intramuscular injection. The results suggest P. hauseri (NSPH-1) was the causative agent. In phylogenetic analysis, strain NSPH-1 formed a distinct cluster with other P. hauseri reference strains with ≥99% sequence similarity. P. hauseri isolates were found sensitive to Ampicillin, Cefalexin, Ciprofloxacin and Cefixime and resistant to Gentamycin, Oxytetracycline, Chloramphenicol, and Kanamycin. The affected fish recovered from the infection after ciprofloxacin treatment. PMID:26028178

  20. In vitro regeneration and Agrobacterium tumefaciens-mediated genetic transformation in asakura-sanshoo (Zanthoxylum piperitum (L.) DC. F. inerme Makino) an important medicinal plant

    PubMed Central

    Zeng, Xiaofang; Zhao, Degang

    2015-01-01

    Context: Asakura-sanshoo (Zanthoxylum piperitum [L.] DC. f. inerme Makino) is an important medicinal plant in East Asia. Transgenic technique could be applied to improve plant traits and analyze gene function. However, there is no report on regeneration and genetic transformation in Asakura-sanshoo. Aims: To establish a regeneration and Agrobacterium tumefaciens-mediated genetic transformation system in Asakura-sanshoo, which could be used for cultivar improvement and gene function analysis. Settings and Design: The various combinations of indole-3-butyric acid (IBA), 6-benzylaminopurine (BA) and naphthalene acetic acid (NAA) were explored for the optimal plant regeneration from petiole and stem of Asakura-sanshoo. The half-strength woody plant medium (WPM) with different concentrations of NAA and IBA was used to induce root. For genetic transformation, A. tumefaciens strain EHA-105 harboring the plasmid pBin-Ex-H-ipt which carries the isopentenyl transferase (ipt) gene, β-glucuronidase (GUS) gene and kanamycin resistance gene neomycin phosphotransferase II (NPTII) were used. The transformation efficiency was detected by the kanamycin resistant frequency. Materials and Methods: Petioles and stems were obtained from the in vitro cultured Asakura-sanshoo. The petiole and stem segments were precultured for 3 days, and then inflected using the bacterium at the concentration of OD600 0.5–0.8 for 10 min, followed by 3 days co-cultivation. Selection of the transgenic plants was carried out after 7 days the regeneration using gradient kanamycin at 30 mg/L and 50 mg/L, respectively. Successful transformed plants were confirmed by GUS histochemical assays, polymerase chain reaction (PCR), reverse transcription-PCR (RT-PCR), and Southern blotting analysis. Results: The highest shoots regeneration was obtained on WPM supplement with 0.5 mg/L BA and 0.2 mg/L NAA. The optimal rooting medium was half strength macro-element WPM. The kanamycin resistant frequency of petiole and

  1. Bacitracin Ophthalmic

    MedlinePlus

    ... as a combination product containing Bacitracin Zinc, Hydrocortisone, Neomycin, Polymyxin B Sulfates) ... as a combination product containing Bacitracin Zinc, Hydrocortisone, Neomycin, Polymyxin B Sulfates)

  2. SEROVARS AND ANTIMICROBIAL RESISTANCE OF Salmonella spp. ISOLATED FROM TURKEY AND BROILER CARCASSES IN SOUTHERN BRAZIL BETWEEN 2004 AND 2006.

    PubMed

    Palmeira, Andre; Santos, Luciana Ruschel dos; Borsoi, Anderlise; Rodrigues, Laura Beatriz; Calasans, Max; Nascimento, Vladimir Pinheiro do

    2016-01-01

    Salmonella spp. causes diseases in fowls, when species-specific serovars (Salmonella Pullorum and S.Gallinarum) are present in flocks, and public health problems, when non-typhoid serovars are isolated, as well as possible bacterial resistance induced by the preventive and therapeutic use of antimicrobials in animal production. This study describes the serovars and bacterial resistance of 280 Salmonella spp. strains isolated from turkey and broiler carcasses in Southern Brazil between 2004 and 2006. Salmonella Enteritidis was the most prevalent serovar (55.7%), followed by Heidelberg (5.0%), Agona (4.3%), Bredeney (3.9%), Hadar (3.2%), and Typhimurium (2.9%). Tennessee and S. Enterica subspecies enterica(O: 4.5) were isolated only in turkeys, and Hadar (18.6%) was the most prevalent serovar in this species. Antimicrobial susceptibility tests were performed in 178 isolates (43 from turkeys and 135 from broilers). All isolates were sensitive to amoxicillin + clavulanic acid, polymyxin B, ciprofloxacin, and norfloxacin, and were resistant to bacitracin and penicillin. Broiler carcass isolates showed resistance to nalidixic acid (48.9%), nitrofurantoin (34.3%), neomycin (9.6%), tetracycline (5.2%), and kanamycin (8.9%); and turkey carcass isolates were resistant to nalidixic acid (62.8%), tetracycline (34.9%), and neomycin (30.2%), with a significant difference in turkeys when compared to broiler carcass isolates. These results indicate the need for judicious use of antimicrobials in livestock production, given that the serovars identified are potential causes of food poisoning. PMID:27007562

  3. SEROVARS AND ANTIMICROBIAL RESISTANCE OF Salmonella spp. ISOLATED FROM TURKEY AND BROILER CARCASSES IN SOUTHERN BRAZIL BETWEEN 2004 AND 2006

    PubMed Central

    PALMEIRA, Andre; dos SANTOS, Luciana Ruschel; BORSOI, Anderlise; RODRIGUES, Laura Beatriz; CALASANS, Max; do NASCIMENTO, Vladimir Pinheiro

    2016-01-01

    Salmonella spp. causes diseases in fowls, when species-specific serovars (Salmonella Pullorum and S.Gallinarum) are present in flocks, and public health problems, when non-typhoid serovars are isolated, as well as possible bacterial resistance induced by the preventive and therapeutic use of antimicrobials in animal production. This study describes the serovars and bacterial resistance of 280Salmonella spp. strains isolated from turkey and broiler carcasses in Southern Brazil between 2004 and 2006. SalmonellaEnteritidis was the most prevalent serovar (55.7%), followed by Heidelberg (5.0%), Agona (4.3%), Bredeney (3.9%), Hadar (3.2%), and Typhimurium (2.9%). Tennessee and S. Enterica subspecies enterica(O: 4.5) were isolated only in turkeys, and Hadar (18.6%) was the most prevalent serovar in this species. Antimicrobial susceptibility tests were performed in 178 isolates (43 from turkeys and 135 from broilers). All isolates were sensitive to amoxicillin + clavulanic acid, polymyxin B, ciprofloxacin, and norfloxacin, and were resistant to bacitracin and penicillin. Broiler carcass isolates showed resistance to nalidixic acid (48.9%), nitrofurantoin (34.3%), neomycin (9.6%), tetracycline (5.2%), and kanamycin (8.9%); and turkey carcass isolates were resistant to nalidixic acid (62.8%), tetracycline (34.9%), and neomycin (30.2%), with a significant difference in turkeys when compared to broiler carcass isolates. These results indicate the need for judicious use of antimicrobials in livestock production, given that the serovars identified are potential causes of food poisoning. PMID:27007562

  4. Induction and inhibition of pinocytosis by aminoglycoside antibiotics.

    PubMed Central

    Johansson, P.; Josefsson, J. O.; Nässberger, L.

    1984-01-01

    We investigated whether differences in induction or stimulation of pinocytosis by six amino-glycosides reflected reported differences in their nephrotoxicity. Pinocytosis induced by antibiotics, Na+, K+ or Ca2+ was quantified by the number of pinocytotic channels in Amoeba proteus, a cell suitable for the study of the pinocytotic process. The aminoglycosides were potent inducers of pinocytosis. They were effective in the order of their cationic charge: neomycin greater than gentamicin greater than netilmicin = tobramycin greater than kanamycin greater than streptomycin. Factors which reduced the charge of the molecules, i.e. alkaline pH and combination with carbenicillin or heparin, diminished pinocytosis. Like La3+ the antibiotics inhibited Na+ -induced pinocytosis. The order of efficacy was netilmicin greater than gentamicin greater than neomycin. A similar rank order, which is the reverse of the order of nephrotoxicity, was observed for inhibition of Ca2+ -stimulated, Na+ -induced pinocytosis. Netilmicin was also the most potent inhibitor of the Ca2+-induced pinocytosis in cells treated with concanavalin A. Inhibition of Ca2+ -stimulated pinocytosis by netilmicin was reversed by Ca2+, the calcium ionophore A 23187, or 4-aminopyridine. We have shown that several nephrotoxic cations are strong inducers of pinocytosis in the amoeba, that aminoglycosides in Ringer solution induce pinocytosis in the approximate order of their nephrotoxicity and that factors which are known to diminish toxicity reduce pinocytosis. It, therefore, appears that the mechanism of aminoglycoside nephrotoxicity is related to their ability to induce pinocytosis in the amoeba. Low inducing potency and strong Ca2+ -antagonism, as for netilmicin, are qualities which may reduce the tendency of polycationic compounds to damage proximal tubular cells. PMID:6439268

  5. SEROVARS AND ANTIMICROBIAL RESISTANCE OF Salmonella spp. ISOLATED FROM TURKEY AND BROILER CARCASSES IN SOUTHERN BRAZIL BETWEEN 2004 AND 2006.

    PubMed

    Palmeira, Andre; Santos, Luciana Ruschel dos; Borsoi, Anderlise; Rodrigues, Laura Beatriz; Calasans, Max; Nascimento, Vladimir Pinheiro do

    2016-01-01

    Salmonella spp. causes diseases in fowls, when species-specific serovars (Salmonella Pullorum and S.Gallinarum) are present in flocks, and public health problems, when non-typhoid serovars are isolated, as well as possible bacterial resistance induced by the preventive and therapeutic use of antimicrobials in animal production. This study describes the serovars and bacterial resistance of 280 Salmonella spp. strains isolated from turkey and broiler carcasses in Southern Brazil between 2004 and 2006. Salmonella Enteritidis was the most prevalent serovar (55.7%), followed by Heidelberg (5.0%), Agona (4.3%), Bredeney (3.9%), Hadar (3.2%), and Typhimurium (2.9%). Tennessee and S. Enterica subspecies enterica(O: 4.5) were isolated only in turkeys, and Hadar (18.6%) was the most prevalent serovar in this species. Antimicrobial susceptibility tests were performed in 178 isolates (43 from turkeys and 135 from broilers). All isolates were sensitive to amoxicillin + clavulanic acid, polymyxin B, ciprofloxacin, and norfloxacin, and were resistant to bacitracin and penicillin. Broiler carcass isolates showed resistance to nalidixic acid (48.9%), nitrofurantoin (34.3%), neomycin (9.6%), tetracycline (5.2%), and kanamycin (8.9%); and turkey carcass isolates were resistant to nalidixic acid (62.8%), tetracycline (34.9%), and neomycin (30.2%), with a significant difference in turkeys when compared to broiler carcass isolates. These results indicate the need for judicious use of antimicrobials in livestock production, given that the serovars identified are potential causes of food poisoning.

  6. Enhanced Agrobacterium-mediated transformation of embryogenic calli of upland cotton.

    PubMed

    Zhang, Tianzhen; Wu, Shen-Jie

    2012-01-01

    Agrobacterium tumefaciens-mediated transformation of cotton embryogenic calli (EC) was enhanced by choosing appropriate EC and improving efficiency of coculture, selection cultivation, and plant regeneration. The binary vector pBI121 (containing a neomycin phosphotransferase II gene npt-II as a selection marker and a uidA gene as a reporter gene) was used to research transformation efficiency. After 48 h cocultivation, the number of β-glucuronidase (GUS)-positive calli characterized by yellow, loose, and fine-grained EC was twofold greater than that of gray, brown, and coarse granule EC. It indicated that the efficiency of transient transformation was affected by EC morphology. Transient transformation efficiency also was improved by cocultivation on the medium by adding 50 mg/L acetosyringone at 19°C for 48 h. Subculturing EC on the selection medium with low cell density increased the production of kanamycin-resistant (Km-R) calli lines. From an original 0.3 g EC, an average of 20 Km-R calli lines were obtained from a selection dish, and the GUS-positive rate of Km-R clones was 81.97%. A large number of normal plants were rapidly regenerated on the differentiation medium with dehydration treatments, and the GUS-positive rate of regeneration plants was about 72.6%. Polymerase chain reaction analysis of GUS-positive plantlets revealed a 100% positive detection rate for neomycin phosphotransferase II gene and gus gene. Southern blot of transgenic plants regenerated from different Km-R calli lines demonstrated that the target gene, mostly with the low copy number, was integrated into the cotton genome. PMID:22351014

  7. Agrobacterium-mediated genetic transformation and plant regeneration of the hardwood tree species Fraxinus profunda.

    PubMed

    Stevens, Micah E; Pijut, Paula M

    2014-06-01

    This transformation and regeneration protocol provides an integral framework for the genetic improvement of Fraxinus profunda (pumpkin ash) for future development of plants resistant to the emerald ash borer. Using mature hypocotyls as the initial explants, an Agrobacterium tumefaciens-mediated genetic transformation system was successfully developed for pumpkin ash (Fraxinus profunda). This transformation protocol is an invaluable tool to combat the highly aggressive, non-native emerald ash borer (EAB), which has the potential to eliminate native Fraxinus spp. from the natural landscape. Hypocotyls were successfully transformed with Agrobacterium strain EHA105 harboring the pq35GR vector, containing an enhanced green fluorescent protein (EGFP) as well as a fusion gene between neomycin phosphotransferase (nptII) and gusA. Hypocotyls were cultured for 7 days on Murashige and Skoog (MS) medium with 22.2 μM 6-benzyladenine (BA), 4.5 μM thidiazuron (TDZ), 50 mg L(-1) adenine hemisulfate (AS), and 10 % coconut water (CW) prior to transformation. Hypocotyls were transformed using 90 s sonication plus 10 min vacuum infiltration after Agrobacterium was exposed to 100 μM acetosyringone for 1 h. Adventitious shoots were regenerated on MS medium with 22.2 μM BA, 4.5 μM TDZ, 50 mg L(-1) AS, 10 % CW, 400 mg L(-1) timentin, and 20 mg L(-1) kanamycin. Timentin at 400 and 20 mg L(-1) kanamycin were most effective at controlling Agrobacterium growth and selecting for transformed cells, respectively. The presence of nptII, GUS (β-glucuronidase), and EGFP in transformed plants was confirmed using polymerase chain reaction (PCR), while the expression of EGFP was also confirmed through fluorescent microscopy and reverse transcription-PCR. This transformation protocol provides an integral foundation for future genetic modifications of F. profunda to provide resistance to EAB. PMID:24493252

  8. Molecular identification of aminoglycoside-modifying enzymes in clinical isolates of Escherichia coli resistant to amoxicillin/clavulanic acid isolated in Spain.

    PubMed

    Fernández-Martínez, Marta; Miró, Elisenda; Ortega, Adriana; Bou, Germán; González-López, Juan José; Oliver, Antonio; Pascual, Alvaro; Cercenado, Emilia; Oteo, Jesús; Martínez-Martínez, Luis; Navarro, Ferran

    2015-08-01

    The activity of eight aminoglycosides (amikacin, apramycin, arbekacin, gentamicin, kanamycin, neomycin, netilmicin and tobramycin) against a collection of 257 amoxicillin/clavulanic acid (AMC)-resistant Escherichia coli isolates was determined by microdilution. Aminoglycoside resistance rates, the prevalence of aminoglycoside-modifying enzyme (AME) genes, the relationship between AME gene detection and resistance phenotype to aminoglycosides, and the association of AME genes with mechanisms of AMC resistance in E. coli isolates in Spain were investigated. Aminoglycoside-resistant isolates were screened for the presence of genes encoding common AMEs [aac(3)-Ia, aac(3)-IIa, aac(3)-IVa, aac(6')-Ib, ant(2″)-Ia, ant(4')-IIa and aph(3')-Ia] or 16S rRNA methylases (armA, rmtB, rmtC and npmA). In total, 105 isolates (40.9%) were resistant to at least one of the aminoglycosides tested. Amikacin, apramycin and arbekacin showed better activity, with MIC90 values of 2mg/L (arbekacin) and 8mg/L (amikacin and apramycin). Kanamycin presented the highest MIC90 (128mg/L). The most common AME gene was aac(6')-Ib (36 strains; 34.3%), followed by aph(3')-Ia (31 strains; 29.5%), ant(2″)-Ia (29 strains; 27.6%) and aac(3)-IIa (23 strains; 21.9%). aac(3)-Ia, aac(3)-IVa, ant(4')-IIa and the four methylases were not detected. The ant(2″)-Ia gene was usually associated with OXA-1 [21/30; 70%], whilst 23/25 (92%) strains producing CTX-M-15 had the aac(6')-Ib gene. The most prevalent AME gene was aac(6')-Ib (18/41; 44%) in nosocomial isolates, whilst ant(2″)-Ia and aph(3')-Ia genes (20/64; 31%) were more frequent in strains of community origin. In 64.6% isolates the phenotypic profile correlated with the presence of commonly encountered AMEs.

  9. Selective condensation of DNA by aminoglycoside antibiotics.

    PubMed

    Kopaczynska, M; Schulz, A; Fraczkowska, K; Kraszewski, S; Podbielska, H; Fuhrhop, J H

    2016-05-01

    The condensing effect of aminoglycoside antibiotics on the structure of double-stranded DNA was examined. The selective condensation of DNA by small molecules is an interesting approach in biotechnology. Here, we present the interaction between calf thymus DNA and three types of antibiotic molecules: tobramycin, kanamycin, and neomycin. Several techniques were applied to study this effect. Atomic force microscopy, transmission electron microscopy images, and nuclear magnetic resonance spectra showed that the interaction of tobramycin with double-stranded DNA caused the rod, toroid, and sphere formation and very strong condensation of DNA strands, which was not observed in the case of other aminoglycosides used in the experiment. Studies on the mechanisms by which small molecules interact with DNA are important in understanding their functioning in cells, in designing new and efficient drugs, or in minimizing their adverse side effects. Specific interactions between tobramycin and DNA double helix was modeled using molecular dynamics simulations. Simulation study shows the aminoglycoside specificity to bend DNA double helix, shedding light on the origins of toroid formation. This phenomenon may lighten the ototoxicity or nephrotoxicity issues, but also other adverse reactions of aminoglycoside antibiotics in the human body.

  10. Surveillance and characterization of Riemerella anatipestifer from wild birds in South Korea.

    PubMed

    Cha, Se-Yeoun; Seo, Hye-Suk; Wei, Bai; Kang, Min; Roh, Jae-Hee; Yoon, Ran-Hee; Kim, Ji-Hyuk; Jang, Hyung-Kwan

    2015-04-01

    We conducted surveillance for Riemerella anatipestifer (RA) in wild birds along the East Asian-Australasian flyway in South Korea. Detected RA were characterized by serotype, antibiotic susceptibility, and sequence analysis of the 16S rRNA gene. We collected 944 wild birds of 34 species from 19 of South Korea's major migratory wild bird habitats between 2011 and 2012. We identified RA by PCR and rRNA gene sequence in 71/102 (69.6%) pharyngeal swabs and 19/944 (2.0%) cloacal swabs of wild birds. Most RA positives (71/75 [95%] pharyngeal and 19/704 [(2.6%] cloacal) were from three duck species (family Anatidae): Mallard Duck (Anas platyrhynchos), Northern Pintail (Anas acuta), and Spot-billed Duck (Anas poecilorhyncha). Thirty-three RA isolates obtained and examined were highly resistant to aminoglycosides: kanamycin (100%), gentamicin (94%), amikacin (91%), neomycin (88%), and streptomycin (82%). Six isolates were identified as serotype 4 by agar gel precipitation. Serotypes 1 and 7, which are known virulent serotypes, were also identified in three isolates from wild duck species.

  11. Variable patterns of expression of luciferase in transgenic tobacco leaves.

    PubMed

    Barnes, W M

    1990-12-01

    A carboxyl-terminally modified firefly luciferase, encoded as a gene fusion to the neomycin phosphotransferase gene (which confers kanamycin resistance), was found to be enzymatically active for both enzymes when expressed in bacteria and in transgenic plants. A military-type starlight vision system was used to conveniently analyze the pattern of gene expression in transgenic tobacco plant leaves. Transgenic tobacco plants which expressed luciferase uniformly in all areas of the leaf, and assays for luciferin, demonstrated that luciferin rapidly penetrates all regions of a tobacco leaf in at least two dimensions. Depending on the test gene structure or, presumably, on the transferred DNA (T-DNA) insertional context, other transgenic plants were obtained that expressed luciferase with a wide range of nonuniform patterns from nominally the same cauliflower mosaic virus 35S promoter. For instance, the veins can be dark, while only the interveinal regions of the leaf lamina glow, or only the small capillary veins glow, or only the major veins glow. Local and/or systemic induction in response to wounding was also demonstrated. PMID:2251262

  12. Water dispersible cross-linked magnetic chitosan beads for increasing the antimicrobial efficiency of aminoglycoside antibiotics.

    PubMed

    Grumezescu, Alexandru Mihai; Andronescu, Ecaterina; Holban, Alina Maria; Ficai, Anton; Ficai, Denisa; Voicu, Georgeta; Grumezescu, Valentina; Balaure, Paul Cătălin; Chifiriuc, Carmen Mariana

    2013-09-15

    The aim of this study was to obtain a nano-active system to improve antibiotic activity of certain drugs by controlling their release. Magnetic composite nanomaterials based on magnetite core and cross-linked chitosan shell were synthesized via the co-precipitation method and characterized by Fourier transform infrared spectroscopy (FT-IR), infrared microscopy (IRM), scanning electron microscopy (SEM), dynamic light scattering (DLS), thermogravimetric analysis (TGA) and X-ray diffraction (XRD). The prepared magnetic composite nanomaterials exhibit a significant potentiating effect on the activity of two cationic (kanamycin and neomycin) drugs, reducing the amount of antibiotics necessary for the antimicrobial effect. The increase in the antimicrobial activity was explained by the fact that the obtained nanosystems provide higher surface area to volume ratio, resulting into higher surface charge density thus increasing affinity to microbial cell and also by controlling their release. In addition to the nano-effect, the positive zeta potential of the synthesized magnetite/cross-linked chitosan core/shell magnetic nanoparticles allows for a more favorable interaction with the usually negatively charged cell wall of bacteria. The novelty of the present contribution is just the revealing of this synergistic effect exhibited by the synthesized water dispersible magnetic nanocomposites on the activity of different antibiotics against Gram-positive and Gram-negative bacterial strains. The results obtained in this study recommend these magnetic water dispersible nanocomposite materials for applications in the prevention and treatment of infectious diseases. PMID:23830944

  13. A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome.

    PubMed

    Gleave, A P

    1992-12-01

    A versatile gene expression cartridge and binary vector system was constructed for use in Agrobacterium-mediated plant transformation. The expression cartridge of the primary cloning vector, pART7, comprises of cauliflower mosaic virus Cabb B-JI isolate 35S promoter, a multiple cloning site and the transcriptional termination region of the octopine synthase gene. The entire cartridge can be removed from pART7 as a Not I fragment and introduced directly into the binary vector, pART27, recombinants being selected by blue/white screening for beta-galactosidase. pART27 carries the RK2 minimal replicon for maintenance in Agrobacterium, the ColE1 origin of replication for high-copy maintenance in Escherichia coli and the Tn7 spectinomycin/streptomycin resistance gene as a bacterial selectable marker. The organisational structure of the T-DNA of pART27 has been constructed taking into account the right to left border, 5' to 3' model of T-DNA transfer. The T-DNA carries the chimaeric kanamycin resistance gene (nopaline synthase promoter-neomycin phosphotransferase-nopaline synthase terminator) distal to the right border relative to the lacZ' region. Utilisation of these vectors in Agrobacterium-mediated transformation of tobacco demonstrated efficient T-DNA transfer to the plant genome.

  14. Association of antibiotic resistance in agricultural Escherichia coli isolates with attachment to quartz.

    PubMed

    Liu, Ping; Soupir, Michelle L; Zwonitzer, Martha; Huss, Bridgette; Jarboe, Laura R

    2011-10-01

    Surface water can be contaminated by bacteria from various sources, including manure from agricultural facilities. Attachment of these bacteria to soil and organic particles contributes to their transport through the environment, though the mechanism of attachment is unknown. As bacterial attachment to human tissues is known to be correlated with antibiotic resistance, we have investigated here the relationship between bacterial attachment to environmental particles and antibiotic resistance in agricultural isolates. We evaluated 203 Escherichia coli isolates collected from swine facilities for attachment to quartz, resistance to 13 antibiotics, and the presence of genes encoding 13 attachment factors. The genes encoding type I, EcpA, P pili, and Ag43 were detected, though none was significantly related to attachment. Quartz attachment was positively and significantly (P < 0.0038) related to combined resistance to amoxicillin/streptomycin/tetracycline/sulfamethazine/tylosin/chlortetracycline and negatively and significantly (P < 0.0038) related to combined resistance to nalidixic acid/kanamycin/neomycin. These results provide clear evidence for a link between antibiotic resistance and attachment to quartz in agricultural isolates. We propose that this may be due to encoding by the responsible genes on a mobile genetic element. Further exploration of the relationship between antibiotic resistance and attachment to environmental particles will improve the understanding and modeling of environmental transport processes, with the goal of preventing human exposure to antibiotic-resistant or virulent microorganisms.

  15. Susceptibility of recently isolated bacteria to amikacin in vitro: comparisons with four other aminoglycoside antibiotics.

    PubMed

    Finland, M; Garner, C; Wilcox, C; Sabath, L D

    1976-11-01

    In vitro tests for susceptibility to amikacin and to four other aminoglycoside antibiotics were carried out with strains of many bacterial species by use of an agar dilution method and an inocula replicator. In general, amikacin was as active as or more active against most of the organims than kanamycin, neomycin, and streptomycin; in particular, amikacin was active against strains resistant to one or more of these three antibiotics. Amikacin was more active than gentamicin against strains of Nocardia asteroides and Providencia stuartii and also against gentamicin-resistant strains of some other gram-negative bacilli, notably Serratia marcescens. However, gentamicin was more active than amikacin against most of the other gram-positive and gram-negative bacteria that were tested. In comparative tests of four media, minimal inhibitory concentrations MICs) were greater in tests with Mueller-Hinton agar, and generally somewhat lower in those with heart infusion agar, than in tests with trypticase soy agar and nutrient agar. Inocula of a 1:1,000 dilution of culture generally gave MICs lower than those obtained with undiluted cultures; the differences were small with enterococci, but they were greater with amikacin than with gentamicin in tests on strains of Klebsiella pneumoniae. These findings generally confirm those previously reported by others.

  16. Isolation and characterization of Keratinibaculum paraultunense gen. nov., sp. nov., a novel thermophilic, anaerobic bacterium with keratinolytic activity.

    PubMed

    Huang, Yan; Sun, Yingjie; Ma, Shichun; Chen, Lu; Zhang, Hui; Deng, Yu

    2013-08-01

    A novel thermophilic, anaerobic, keratinolytic bacterium designated KD-1 was isolated from grassy marshland. Strain KD-1 was a spore-forming rod with a Gram-positive type cell wall, but stained Gram-negative. The temperature, pH, and NaCl concentration range necessary for growth was 30-65 °C (optimum 55 °C), 6.0-10.5 (optimum 8.0-8.5), and 0-6% (optimum 0.2%) (w/v), respectively. Strain KD-1 possessed extracellular keratinase, and the optimum activity of the crude enzyme was pH 8.5 and 70 °C. The enzyme was identified as a thermostable serine-type protease. The strain was sensitive to rifampin, chloramphenicol, kanamycin, and tetracycline and was resistant to erythromycin, neomycin, penicillin, and streptomycin. The main cellular fatty acid was predominantly C15:0 iso (64%), and the G+C content was 28 mol%. Morphological and physiological characterization, together with phylogenetic analysis based on 16S rRNA gene sequencing identified KD-1 as a new species of a novel genus of Clostridiaceae with 95.3%, 93.8% 16S rRNA gene sequence similarity to Clostridium ultunense BS(T) (DSM 10521(T)) and Tepidimicrobium xylanilyticum PML14(T) (= JCM 15035(T)), respectively. We propose the name Keratinibaculum paraultunense gen. nov., sp. nov., with KD-1 (=JCM 18769(T) =DSM 26752(T)) as the type strain. PMID:23710623

  17. Symbiotic effectiveness of antibiotic-resistant mutants of fast- and slow-growing strains of Rhizobium nodulating Lotus species.

    PubMed

    Pankhurst, C E

    1977-08-01

    Mutants resistant ot 16 individual antibiotics were isolated from two fast-growing and two slow-growing strains of Lotus rhizobia and their symbiotic effectiveness on Lotus pedunculatus evaluated. Resistance to streptomycin, spectinomycin, chloramphenicol, and tetracycline (inhibitors of protein synthesis) was associated with little or no loss of effectiveness with all four strains but resistance to nalidixic acid and rifampicin (inhibitors of nucleic acid synthesis), and to D-cycloserine, novobiocin, and penicillin (inhibitors of cell wall-cell membrane synthesis) was associated with significant loss of effectiveness in 20-100% of the mutants. Resistance to viomycin, neomycin, kanamycin, and vibramycin was associated with loss of effectiveness with mutants of the two fast-growing strains but not with mutants of the two slow-growing strains. When tested on four alternate host legumes individual mutants of a slow-growing strain showed significantly different levels of effectiveness. The results suggest that both the inherent characteristics of the bacterium and of the host plant will influence the symbiotic effectiveness of antibiotic-resistant mutants of Rhizobium. PMID:890601

  18. Antibiotic resistance of bacterial litter isolates.

    PubMed

    Kelley, T R; Pancorbo, O C; Merka, W C; Barnhart, H M

    1998-02-01

    Use of antibiotics in subtherapeutic doses as growth-promoting feed additives for animal production is widespread in the U.S. and throughout the world. Previous studies by our research group concluded that size fractionation of poultry (broiler) litter followed by storage facilitated reutilization of litter as a soil amendment or bedding supplement. However, litter microbial contamination, including antibiotic-resistant populations, and accumulation of metals and other elements may limit litter reutilization. Litter from four broiler houses was separated into a fine fraction for use as a soil amendment, and a coarse fraction for reutilization as a bedding supplement in growing subsequent flocks of broilers. Fractions and whole litter were stored in indoor piles simulating farm storage conditions for 4 mo with periodic analysis for metals, other elements, and culturable bacteria (including total and fecal coliform, Aeromonas hydrophila, Pseudomonas aeruginosa, Yersinia enterocolitica, and Campylobacter jejuni). Representative bacterial isolates were tested for their sensitivity to 12 common antibiotics (ampicillin, bacitracin, cephalothin, erythromycin, gentamicin, kanamycin, nalidixic acid, neomycin, penicillin, streptomycin, sulfisoxazole, and tetracycline) using the Kirby-Bauer technique. Pathogens and indicator bacteria tested were found to be resistant to multiple antibiotics. Data suggest that microbial contamination of litter should be reduced or eliminated prior to reutilization to minimize environmental health risks related to transfer of antibiotic-resistant bacteria to humans or other animals. PMID:9495488

  19. Genetic transformation of Indian isolate of Lemna minor mediated by Agrobacterium tumefaciens and recovery of transgenic plants.

    PubMed

    Chhabra, Gulshan; Chaudhary, Darshna; Sainger, Manish; Jaiwal, Pawan K

    2011-04-01

    Transgenic plants of an Indian isolate of Lemna minor have been developed for the first time using Agrobacterium tumefaciens and hard nodular cell masses 'nodular calli' developed on the BAP - pretreated daughter frond explants in B5 medium containing sucrose (1.0 %) with 2,4-D (5.0 μM) and 2-iP (50.0 μM) or 2,4-D (50.0 μM) and TDZ (5.0 μM) under light conditions. These calli were co-cultured with A. tumefaciens strain EHA105 harboring a binary vector that contained genes for β-glucuronidase with intron and neomycin phosphortransferase. Transformed cells selected on kanamycin selection medium were regenerated into fronds whose transgenic nature was confirmed by histochemical assay for GUS activity, PCR analysis and Southern hybridization. The frequency of transformation obtained was 3.8 % and a period of 11-13 weeks was required from initiation of cultures from explants to fully grown transgenic fronds. The pretreatment of daughter fronds with BAP, use of non-ionic surfactant, presence of acetosyringone in co-cultivation medium, co-culture duration of 3 d and 16 h photoperiod during culture were found crucial for callus induction, frond regeneration and transformation of L. minor. This transformation system can be used for the production of pharmaceutically important protein and in bioremediation.

  20. Antibiotic resistance patterns of gram-negative bacteria isolated from environmental sources.

    PubMed Central

    Kelch, W J; Lee, J S

    1978-01-01

    A total of 2,445 gram-negative bacteria belonging to fecal coliform, Pseudomonas, Moraxella, Acinetobacter, and Flavobacterium-Cytophaga groups were isolated from the rivers and bay of Tillamook, Oregon, and their resistances to chloramphenicol (25 microgram/ml), streptomycin (10 microgram/ml), ampicillin (10 microgram/ml), tetracycline (25 microgram/ml), chlortetracycline (25 microgram/ml), oxytetracycline (25 microgram/ml), neomycin (50 microgram/ml), nitrofurazone (12.5 microgram/ml), nalidixic acid (25 microgram/ml), kanamycin (25 microgram/ml), and penicillin G (10 IU/ml) were determined. Among fecal coliforms the bay isolates showed greater resistance to antibiotics than those from tributaries or surface runoff. No such well-defined difference was found among other bacterial groups. The antibiotic resistance patterns of gram-negative bacteria from different sources correlated well, perhaps indicating their common origin. The antibiotic resistance patterns of gram-negative bacteria of different general also correlated well, perhaps indicating that bacteria which share a common environment also share a common mode for developing antibiotic resistance. PMID:727777

  1. Isolation and characterization of Keratinibaculum paraultunense gen. nov., sp. nov., a novel thermophilic, anaerobic bacterium with keratinolytic activity.

    PubMed

    Huang, Yan; Sun, Yingjie; Ma, Shichun; Chen, Lu; Zhang, Hui; Deng, Yu

    2013-08-01

    A novel thermophilic, anaerobic, keratinolytic bacterium designated KD-1 was isolated from grassy marshland. Strain KD-1 was a spore-forming rod with a Gram-positive type cell wall, but stained Gram-negative. The temperature, pH, and NaCl concentration range necessary for growth was 30-65 °C (optimum 55 °C), 6.0-10.5 (optimum 8.0-8.5), and 0-6% (optimum 0.2%) (w/v), respectively. Strain KD-1 possessed extracellular keratinase, and the optimum activity of the crude enzyme was pH 8.5 and 70 °C. The enzyme was identified as a thermostable serine-type protease. The strain was sensitive to rifampin, chloramphenicol, kanamycin, and tetracycline and was resistant to erythromycin, neomycin, penicillin, and streptomycin. The main cellular fatty acid was predominantly C15:0 iso (64%), and the G+C content was 28 mol%. Morphological and physiological characterization, together with phylogenetic analysis based on 16S rRNA gene sequencing identified KD-1 as a new species of a novel genus of Clostridiaceae with 95.3%, 93.8% 16S rRNA gene sequence similarity to Clostridium ultunense BS(T) (DSM 10521(T)) and Tepidimicrobium xylanilyticum PML14(T) (= JCM 15035(T)), respectively. We propose the name Keratinibaculum paraultunense gen. nov., sp. nov., with KD-1 (=JCM 18769(T) =DSM 26752(T)) as the type strain.

  2. Water dispersible cross-linked magnetic chitosan beads for increasing the antimicrobial efficiency of aminoglycoside antibiotics.

    PubMed

    Grumezescu, Alexandru Mihai; Andronescu, Ecaterina; Holban, Alina Maria; Ficai, Anton; Ficai, Denisa; Voicu, Georgeta; Grumezescu, Valentina; Balaure, Paul Cătălin; Chifiriuc, Carmen Mariana

    2013-09-15

    The aim of this study was to obtain a nano-active system to improve antibiotic activity of certain drugs by controlling their release. Magnetic composite nanomaterials based on magnetite core and cross-linked chitosan shell were synthesized via the co-precipitation method and characterized by Fourier transform infrared spectroscopy (FT-IR), infrared microscopy (IRM), scanning electron microscopy (SEM), dynamic light scattering (DLS), thermogravimetric analysis (TGA) and X-ray diffraction (XRD). The prepared magnetic composite nanomaterials exhibit a significant potentiating effect on the activity of two cationic (kanamycin and neomycin) drugs, reducing the amount of antibiotics necessary for the antimicrobial effect. The increase in the antimicrobial activity was explained by the fact that the obtained nanosystems provide higher surface area to volume ratio, resulting into higher surface charge density thus increasing affinity to microbial cell and also by controlling their release. In addition to the nano-effect, the positive zeta potential of the synthesized magnetite/cross-linked chitosan core/shell magnetic nanoparticles allows for a more favorable interaction with the usually negatively charged cell wall of bacteria. The novelty of the present contribution is just the revealing of this synergistic effect exhibited by the synthesized water dispersible magnetic nanocomposites on the activity of different antibiotics against Gram-positive and Gram-negative bacterial strains. The results obtained in this study recommend these magnetic water dispersible nanocomposite materials for applications in the prevention and treatment of infectious diseases.

  3. Effects of antibacterial agents on in vitro ovine ruminal biotransformation of the hepatotoxic pyrrolizidine alkaloid jacobine.

    PubMed

    Wachenheim, D E; Blythe, L L; Craig, A M

    1992-08-01

    Ingestion of pyrrolizidine alkaloids, naturally occurring plant toxins, causes illness and death in a number of animal species. Senecio jacobaea pyrrolizidine alkaloids cause significant economic losses due to livestock poisoning, particularly in the Pacific Northwest. Some sheep are resistant to pyrrolizidine alkaloid poisoning, because ovine ruminal biotransformation detoxifies free pyrrolizidine alkaloids in digesta. Antibacterial agents modify ruminal fermentation. Pretreatment with antibacterial agents may account for some animal variability in resistance to pyrrolizidine alkaloid toxicosis, and antibacterial agents can also be used for characterizing ruminal pyrrolizidine alkaloid-biotransforming microflora. The objective of this study was to evaluate the effects of antibacterial agents on biotransformation of a predominant S. jacobaea pyrrolizidine alkaloid, jacobine, in ovine ruminal contents. Ovine ruminal jacobine biotransformation was tested in vitro with 20 independent antibacterial agents. Low amounts of rifampin and erythromycin prevented jacobine biotransformation. Chlortetracycline, lasalocid, monensin, penicillin G, and tetracycline were slightly less effective at inhibiting jacobine biotransformation. Bacitracin, crystal violet, kanamycin, and neomycin were moderately inhibitory against jacobine biotransformation. Brilliant green, chloramphenicol, gramicidin, nalidixic acid, polymyxin B SO4, sodium azide, streptomycin, sulfisoxazole, and vancomycin had little to no effect on jacobine biotransformation. The antibiotics that were most effective at inhibiting biotransformation were those that are active against gram-positive bacteria. Therefore, gram-positive bacteria are most likely critical members of the jacobine-biotransforming consortia.

  4. Transferring cucumber mosaic virus-white leaf strain coat protein gene into Cucumis melo L. and evaluating transgenic plants for protection against infections

    SciTech Connect

    Gonsalves, C.; Xue, B.; Yepes, M.; Fuchs, M.; Ling, K.; Namba, S. . Dept. of Plant Pathology)

    1994-03-01

    A single regeneration procedure using cotyledon examples effectively regenerated five commercially grown muskmelon cultivars. This regeneration scheme was used to facilitate gene transfers using either Agrobacterium tumefaciens or microprojectile bombardment methods. In both cases, the transferred genes were from the T-DNA region of the binary vector plasmid pGA482GG/cp cucumber mosaic virus-white leaf strain (CMV-WL), which contains genes that encode neomycin phosphotransferase II (NPT II), [beta]-glucuronidase (GUS), and the CMV-WL coat protein (CP). Explants treated with pGA482GG/cpCMV-WL regenerated shoots on Murashige and Skoog medium containing 4.4 [mu]m 6-benzylaminopurine (BA), kanamycin (Km) at 150 mg[center dot]liter[sup [minus]1] and carbenicillin (Cb) at 500 mg[center dot]liter[sup [minus]1]. The authors' comparison of A. tumefaciens- and microprojectile-mediated gene transfer procedures shows that both methods effectively produce nearly the same percentage of transgenic plants. R[sub 0] plants were first tested for GUS or NPT II expression, then the polymerase chain reaction (PCR) and other tests were used to verify the transfer of the NPT II, GUS, and CMV-WL CP genes.

  5. [Elimination of multidrug resistance in E. coli in calves in vivo with rimactan].

    PubMed

    Karaivanov, L; Koleva, P; Bonovska, M; Mateev, M; Kozarev, A

    1980-01-01

    An experiment was carried out for eliminating the multimedicinal resistance markers of E. coli, populating the intestinal tract of calves, in vivo with rimactan introduced per os, and rationed 10 mg/kg of live weight, once during a period of 8 days. The highest percentage and the longest elimination were observed for the neomycin, the novobiocin and the chlornitromycin resistance markers. The elimination was weaker for the erythromycin, the streptomycin and the kanamycin markers and the weakest was for the penicillin and tetracycline markers. There appeared a difference in the elimination of the resistance markers with the different calves, especially for the markers with a low degree of elimination, depending on the individual peculiarities of the calves. Riphamycin proved to be an eliminating means for the resistance markers of E coli in vivo of calves suffering from enteritis. Alongside with the elimination of the resistance markers, due to the treatment of calves with rimactan, an almost complete recovery was achieved. Rimactan is a reliable means for fighting enteric illnesses with calves, caused by enteropathogenic E. coli.

  6. Prevalence, molecular characterization and antimicrobial resistance of Salmonella serovars isolated from northwestern Spanish broiler flocks (2011-2015).

    PubMed

    Lamas, A; Fernandez-No, I C; Miranda, J M; Vázquez, B; Cepeda, A; Franco, C M

    2016-09-01

    The present study investigated the prevalence, antimicrobial resistance to twenty antibiotics, and class 1 integron and virulence genes of Salmonella isolated from poultry houses of broilers in northwestern Spain between 2011 and 2015. Strains were classified to the serotype level using the Kauffman-White typing scheme and subtyping with enterobacterial repetitive intergenic consensus PCR. The prevalence of Salmonella spp. was 1.02%. Sixteen different serotypes were found, with S. typhimurium and S. arizonae 48:z4, z23:- being the most prevalent. A total of 59.70% of strains were resistant to at least one, and 19.70% were resistant to multiple drugs. All Salmonella spp. were susceptible to cefotaxime, ciprofloxacin, gentamicin, kanamycin, levofloxacin, neomycin, and trimethoprim. The highest level of resistance was to sulfamethoxazole (40.29%), doxycycline (17.91%), and nalidixic acid (17.91%). None of the isolates carried class 1 integron and only isolates of S. enterica subspecies enterica were positive for all virulence factors tested, whereas S. arizonae lacked genes related to replication and invasion in nonphagocytic cells. This study demonstrates that the prevalence and antimicrobial resistance of Salmonella spp. in poultry houses of broilers of northwestern Spain is low compared with those found in other studies and in other steps of the food chain.

  7. Validation of a method for the determination of aminoglycosides in different matrices and species based on an in-house concept.

    PubMed

    Bohm, D A; Stachel, C S; Gowik, P

    2013-01-01

    A simple, rapid, and sensitive method for the determination and confirmation of the aminoglycosides streptomycin, dihydrostreptomycin, spectinomycin, apramycin, kanamycin, paromomycin, gentamicin and neomycin in cow's milk as well as in bovine and porcine muscle and kidney was developed. Validation was performed on the basis of an in-house concept with different factor-level combinations in accordance with Commission Decision 2002/657/EC. After extraction with trichloroacetic acid solution, clean-up was performed by way of SPE. LC-MS/MS analysis was carried out by means of an HILIC column for the separation of the analytes, and by using MS/MS in positive ESI mode to measure the transitions of the substances in MRM mode. For quantification, matrix calibration curves in the linear range around the MRLs as well as the internal standard tobramycin were used. The calculated validation parameters like CCα, CCβ, recovery (94-103%), relative repeatability RSDr (3.6-9.7%), and relative within-laboratory reproducibility RSDwR (4.6-10.0%) fulfilled the requirements of Commission Decision 2002/657/EC. PMID:23550922

  8. Quantifying Attachment and Antibiotic Resistance of from Conventional and Organic Swine Manure.

    PubMed

    Zwonitzer, Martha R; Soupir, Michelle L; Jarboe, Laura R; Smith, Douglas R

    2016-03-01

    Broad-spectrum antibiotics are often administered to swine, contributing to the occurrence of antibiotic-resistant bacteria in their manure. During land application, the bacteria in swine manure preferentially attach to particles in the soil, affecting their transport in overland flow. However, a quantitative understanding of these attachment mechanisms is lacking, and their relationship to antibiotic resistance is unknown. The objective of this study is to examine the relationships between antibiotic resistance and attachment to very fine silica sand in collected from swine manure. A total of 556 isolates were collected from six farms, two organic and four conventional (antibiotics fed prophylactically). Antibiotic resistance was quantified using 13 antibiotics at three minimum inhibitory concentrations: resistant, intermediate, and susceptible. Of the 556 isolates used in the antibiotic resistance assays, 491 were subjected to an attachment assay. Results show that isolates from conventional systems were significantly more resistant to amoxicillin, ampicillin, chlortetracycline, erythromycin, kanamycin, neomycin, streptomycin, tetracycline, and tylosin ( < 0.001). Results also indicate that isolated from conventional systems attached to very fine silica sand at significantly higher levels than those from organic systems ( < 0.001). Statistical analysis showed that a significant relationship did not exist between antibiotic resistance levels and attachment in from conventional systems but did for organic systems ( < 0.001). Better quantification of these relationships is critical to understanding the behavior of in the environment and preventing exposure of human populations to antibiotic-resistant bacteria. PMID:27065408

  9. Horticultural characteristics of transgenic tobacco expressing the rolC gene from Agrobacterium rhizogenes

    SciTech Connect

    Scorza, R.; Zimmerman, T.W.; Cordts, J.M.; Footen, K.J. ); Ravelonandro, M. . Station de Pathologie Vegetale)

    1994-09-01

    Wisconsin 38 tobacco (Nicotiana tabacum L.) leaf discs were transformed with the disarmed Agrobacterium tumefaciens strain EHA 101 carrying the rolC gene from A. rhizogenes and NPT II and GUS genes. Shoots that regenerated on kanamycin-containing medium were confirmed as transgenic through GUS assays, polymerase chain reaction (PCR), Southern blot analyses, and transmission of the foreign genes through the sexual cycle. Transgenic plants were as short as half the height of control plants; were earlier flowering by up to 35 days; and had smaller leaves, shorter internodes, smaller seed capsules, fewer seeds, smaller flowers, and reduced pollen viability. The number of seed capsules, leaf number, and specific root length were similar between transgenic and control plants. Transgenic clones varied in the expression of the rolC-induced growth alterations as did the first generation of seedlings from these clones. Such differences suggested the potential for selecting for different levels of expression. Transformation with the rolC gene presents a potentially useful method of genetically modifying horticultural crops, particularly for flowering date, height, and leaf and flower size. Chemical names used: neomycin phosphotransferase (NPTII), [beta]-glucuronidase (GUS).

  10. Fabrication of surface plasmon resonance nanosensor for the selective determination of erythromycin via molecular imprinted nanoparticles.

    PubMed

    Sari, Esma; Üzek, Recep; Duman, Memed; Denizli, Adil

    2016-04-01

    The main objective of this study was to develop a novel surface plasmon resonance (SPR) nanosensor method based on a more rapid and selective determination of erythromycin (ERY) in the aqueous solution. This study is a combination of three techniques, which are miniemulsion polymerization, molecular imprinting and surface plasmon resonance techniques. In the first part, nanoparticles prepared with methacryl groups of functional monomer at surface acted as reactive sites for erythromycin as a template molecule. The molecularly imprinted nanoparticles were characterized by FTIR, SEM and zetasizer. After immobilization of nanoparticles on gold surface of SPR chip, nanosensor was characterized with contact angle measurements. This nanosensor was then used for selective determination of erythromycin. The linearity range and detection limit were obtained as 0.99 (r(2)) and 0.29 ppm, respectively. Association kinetic analysis, Scatchard, Langmuir, Freundlich and Freundlich-Langmuir isotherms were applied data. The selectivity of the SPR nanosensor was determined by using competitor agents (kanamycin sulfate, neomycin sulfate, spiramycin). The non-imprinted nanosensor was also used to evaluate the selectivity of ERY imprinted nanosensor. Finally, the nanosensor was tested for repeatability and it gave satisfactory response. These results demonstrate a method which is of low cost, rapid and provide reliable results in order to be used in detection of erythromycin from aqueous solution.

  11. Enhanced resistance to fungal pathogens in transgenic Populus tomentosa Carr. by overexpression of an nsLTP-like antimicrobial protein gene from motherwort (Leonurus japonicus).

    PubMed

    Jia, Zhichun; Gou, Jiqing; Sun, Yimin; Yuan, Li; Tang, Qiao; Yang, Xingyong; Pei, Yan; Luo, Keming

    2010-12-01

    The antimicrobial protein gene LJAMP2 is a plant non-specific lipid transfer protein from motherwort (Leonurus japonicus). In this study, it was introduced into Chinese white poplar (Populus tomentosa Carr.) via Agrobacterium-mediated transformation with neomycin phosphotransferase II gene conferring kanamycin resistance as selectable marker. A total of 16 poplar lines were obtained, and polymerase chain reaction (PCR) analysis established the stable integration of transgenes in the plant genome. Reverse transcription-PCR detected LJAMP2 expression in transgenic plants. Resistance to fungal pathogens Alternaria alternata (Fr.) Keissler and Colletotrichum gloeosporioides (Penz.) of transgenic poplar lines was tested. In vitro inhibitory activity against the fungal pathogens was evident from the crude leaf extracts from the transformants. In vivo assays showed that, after infection with both A. alternata (Fr.) Keissler and C. gloeosporioides (Penz.), there was a significant reduction in disease symptoms in transgenic poplar plants compared with the control. These results suggest that constitutive expression of the LJAMP2 gene from motherwort can be exploited to improve resistance to fungal pathogens in poplar.

  12. Drug resistance and biochemical characteristics of Salmonella from turkeys.

    PubMed Central

    Poppe, C; Kolar, J J; Demczuk, W H; Harris, J E

    1995-01-01

    A study was conducted to determine the antibiotic resistance and biochemical characteristics of 2690 Salmonella strains belonging to 52 serovars and isolated from environmental and feed samples from 270 turkey flocks in Canada. Resistance of the Salmonella strains to the aminoglycoside antibiotics varied widely; none of the strains were resistant to amikacin, 14.2% were resistant to neomycin, 25.8% were resistant to gentamicin, and 27.7% of the strains were resistant to kanamycin. Most strains (97.6%) were resistant to the aminocyclitol, spectinomycin. Regarding resistance to the beta-lactam antibiotics, 14.3% and 14.4% of the strains were resistant to ampicillin and carbenicillin, respectively, whereas only 5 (0.2%) of the strains were resistant to cephalothin. None of the strains were resistant to the fluoroquinolone ciprofloxacin or to polymyxin B. Resistance to chloramphenicol and nitrofurantoin was found in 2.4% and 7% of the strains, respectively. Only 1.7% of the strains were resistant to the trimethoprimsulfamethoxazole combination, whereas 58.1% were resistant to sulfisoxazole. Thirty-eight percent of the strains were resistant to tetracycline. Salmonella serovars differed markedly in their drug resistance profiles. Biochemical characterization of the Salmonella showed that the S. anatum, S. saintpaul and S. reading serovars could be divided into distinct biotypes. PMID:8548684

  13. Quantifying Attachment and Antibiotic Resistance of from Conventional and Organic Swine Manure.

    PubMed

    Zwonitzer, Martha R; Soupir, Michelle L; Jarboe, Laura R; Smith, Douglas R

    2016-03-01

    Broad-spectrum antibiotics are often administered to swine, contributing to the occurrence of antibiotic-resistant bacteria in their manure. During land application, the bacteria in swine manure preferentially attach to particles in the soil, affecting their transport in overland flow. However, a quantitative understanding of these attachment mechanisms is lacking, and their relationship to antibiotic resistance is unknown. The objective of this study is to examine the relationships between antibiotic resistance and attachment to very fine silica sand in collected from swine manure. A total of 556 isolates were collected from six farms, two organic and four conventional (antibiotics fed prophylactically). Antibiotic resistance was quantified using 13 antibiotics at three minimum inhibitory concentrations: resistant, intermediate, and susceptible. Of the 556 isolates used in the antibiotic resistance assays, 491 were subjected to an attachment assay. Results show that isolates from conventional systems were significantly more resistant to amoxicillin, ampicillin, chlortetracycline, erythromycin, kanamycin, neomycin, streptomycin, tetracycline, and tylosin ( < 0.001). Results also indicate that isolated from conventional systems attached to very fine silica sand at significantly higher levels than those from organic systems ( < 0.001). Statistical analysis showed that a significant relationship did not exist between antibiotic resistance levels and attachment in from conventional systems but did for organic systems ( < 0.001). Better quantification of these relationships is critical to understanding the behavior of in the environment and preventing exposure of human populations to antibiotic-resistant bacteria.

  14. A new high-frequency Agrobacterium-mediated transformation technique for Sesamum indicum L. using de-embryonated cotyledon as explant.

    PubMed

    Chowdhury, Supriyo; Basu, Arpita; Kundu, Surekha

    2014-09-01

    In spite of the economic importance of sesame (Sesamum indicum L.) and the recent availability of its genome sequence, a high-frequency transformation protocol is still not available. The only two existing Agrobacterium-mediated transformation protocols that are available have poor transformation efficiencies of less than 2%. In the present study, we report a high-frequency, simple, and reproducible transformation protocol for sesame. Transformation was done using de-embryonated cotyledons via somatic embryogenic stages. All the critical parameters of transformation, like incubation period of explants in pre-regeneration medium prior to infection by Agrobacterium tumefaciens, cocultivation period, concentrations of acetosyringone in cocultivation medium, kanamycin concentration, and concentration of plant hormones, including 6-benzylaminopurine, have been optimized. This protocol is superior to the two existing protocols in its high regeneration and transformation efficiencies. The transformed sesame lines have been tested by PCR, RT-PCR for neomycin phosphotransferase II gene expression, and β-glucuronidase (GUS) assay. The regeneration frequency and transformation efficiency are 57.33 and 42.66%, respectively. T0 and T1 generation transgenic plants were analyzed, and several T1 plants homozygous for the transgenes were obtained.

  15. A rapid and stable Agrobacterium-mediated transformation method of a medicinal plant Chelone glabra L.

    PubMed

    Gao, Zhenrui; Li, Ying; Chen, Jinhua; Chen, Zhixing; Cui, Min-Long

    2015-03-01

    Transformation approach is a useful tool for the study of gene function, the mechanism of molecular regulation, and increase usefulness of components by reverse genetic approach in plants. In this study, we developed a stable and rapid method for Agrobacterium-mediated transformation of a medicinal plant Chelone glabra L. using leaf explants. Stable transformants were obtained using Agrobacterium tumefaciens strains GV2260 and GV3101 that harbored the binary vector pBI121 and contained the neomycin phosphotransferase gene (NPT II) as a selectable marker and a reporter gene β-glucuronidase (GUS). Putative transformants were identified by kanamycin selection and a histochemical assay. PCR and Southern blot analysis confirmed the integration of the GUS gene into transformed genomes as well as detected stable expression of the β-glucuronidase gene (GUS) by RT-PCR. Resulting transformed plants had morphologically normal phenotypes. This method requires two changes of medium and few leaf explants as well as the transformation efficiency of 2-8 % after 2-3 months of inoculation. This method can provide a quick and economical transformation method for reverse genetic approach to change the secondary metabolic pathway to increase useful components in C. glabra.

  16. Transgenic rose lines harboring an antimicrobial protein gene, Ace-AMP1, demonstrate enhanced resistance to powdery mildew ( Sphaerotheca pannosa).

    PubMed

    Li, Xiangqian; Gasic, Ksenjia; Cammue, Bruno; Broekaert, Willem; Korban, Schuyler S

    2003-12-01

    An antimicrobial protein gene, Ace-AMP1, was introduced into Rosa hybrida cv. Carefree Beauty via Agrobacterium-mediated transformation. A total of 500 putative transgenic plants were obtained from 100 primary embryogenic calli co-cultivated with A. tumefaciens following selection on a regeneration medium containing 100 mg/l kanamycin. Polymerase chain reaction analysis of these putative transgenic lines, using primers for both Ace-AMP1 and neomycin phosphotransferase ( npt II) genes, showed that 62% of these plants were positive for both transgenes. These lines were further confirmed for stable integration of Ace-AMP1 and npt II genes by Southern blotting. Transcription of the Ace-AMP1 transgene in various transgenic rose lines was determined using Northern blotting. Transgenic rose lines inoculated with conidial spores of Sphaerotheca pannosa (Wallr.: Fr.) Lev. var. rosae showed enhanced resistance to powdery mildew using both a detached-leaf assay and an in vivo greenhouse whole-plant assay. PMID:14508687

  17. Somatic Embryogenesis and Genetic Modification of Vitis.

    PubMed

    Dhekney, Sadanand A; Li, Zhijian T; Grant, Trudi N L; Gray, Dennis J

    2016-01-01

    Grapevine embryogenic cultures are ideal target tissues for inserting desired traits of interest and improving existing cultivars via precision breeding (PB). PB is a new approach that, like conventional breeding, utilizes only DNA fragments obtained from sexually compatible grapevine plants. Embryogenic culture induction occurs by placing leaves or stamens and pistils on induction medium with a dark/light photoperiod cycle for 12-16 weeks. Resulting cultures produce sectors of embryogenic and non-embryogenic callus, which can be identified on the basis of callus morphology and color. Somatic embryo development occurs following transfer of embryogenic callus to development medium and cultures can be maintained for extended periods of time by transfer of the proliferating proembryonic masses to fresh medium at 4-6-week intervals. To demonstrate plant recovery via PB, somatic embryos at the mid-cotyledonary stage are cocultivated with Agrobacterium containing the desired gene of interest along with a, non-PB, enhanced green fluorescent protein/neomycin phosphotransferase II (egfp/nptII) fusion gene. Modified cultures are grown on proliferation and development medium to produce uniformly modified somatic embryos via secondary embryogenesis. Modified embryos identified on the basis of green fluorescence and kanamycin resistance are transferred to germination medium for plant development. The resulting plants are considered to prototype examples of the PB approach, since they contain egfp/nptII, a non-grapevine-derived fusion gene. Uniform green fluorescent protein (GFP) fluorescence can be observed in all tissues of regenerated plants.

  18. Increased Putrescine Biosynthesis through Transfer of Mouse Ornithine Decarboxylase cDNA in Carrot Promotes Somatic Embryogenesis.

    PubMed Central

    Bastola, D. R.; Minocha, S. C.

    1995-01-01

    Carrot (Daucus carota L.) cells were transformed with Agrobacterium tumefaciens strains containing 3[prime]-truncated mouse ornithine decarboxylase (ODC) cDNA under the control of a cauliflower mosaic virus 35S promoter. A neomycin phosphotransferase gene linked with a nopaline synthase promoter was used to select transformed cell lines on kanamycin. Although the nontransformed cells contained no ODC, high amounts of mouse-specific ODC activity were observed in the transformed cells. Transgenic cells showed a significant increase in the cellular content of putrescine compared to control cells. Spermidine, however, remained unaffected. Not only did the transformed cells exhibit improved somatic embryogenesis in the auxin-free medium, they also regenerated some embryos in the presence of inhibitory concentrations of 2,4-dichlorophenoxyacetic acid. These cells acquired tolerance to [alpha]-difluoromethylarginine (a potent inhibitor of arginine decarboxylase) at concentrations that inhibit growth as well as embryogenesis in nontransformed carrot cells, showing that the mouse ODC can replace the carrot arginine decarboxylase for putrescine biosynthesis in the transgenic cells. PMID:12228581

  19. Transformation of blackgram (Vigna mungo (L.) Hepper) by barley chitinase and ribosome-inactivating protein genes towards improving resistance to Corynespora leaf spot fungal disease.

    PubMed

    Chopra, Rajan; Saini, Raman

    2014-12-01

    Blackgram (Vigna mungo (L.) Hepper), an important grain legume crop, is sensitive to many fungal pathogens including Corynespora cassiicola, the causal agent of corynespora leaf spot disease. In the present study, plasmid pGJ42 harboring neomycin phosphotransferase (nptII) a selectable marker gene, the barley antifungal genes chitinase (AAA56786) and ribosome-inactivating protein (RIP; AAA32951) were used for the transformation, to develop fungal resistance for the first time in blackgram. The presence and integration of transgene into the blackgram genome was confirmed by PCR and Southern analysis with an overall transformation frequency of 10.2 %. Kanamycin selection and PCR analysis of T0 progeny revealed the inheritance of transgene in Mendelian fashion (3:1). Transgenic plants (T1), evaluated for fungal resistance by in vitro antifungal assay, arrested the growth of C. cassiicola up to 25-40 % over the wild-type plants. In fungal bio-assay screening, the transgenic plants (T1) sprayed with C. cassiicola spores showed a delay in onset of disease along with their lesser extent in terms of average number of diseased leaves and reduced number and size of lesions. The percent disease protection among different transformed lines varies in the range of 27-47 % compare to control (untransformed) plants. These results demonstrate potentiality of chitinase and RIP from a heterologous source in developing fungal disease protection in blackgram and can be helpful in increasing the production of blackgram.

  20. Transformation of a recalcitrant grain legume, Vigna mungo L. Hepper, using Agrobacterium tumefaciens-mediated gene transfer to shoot apical meristem cultures.

    PubMed

    Saini, Raman; Jaiwal, Pawan K

    2005-06-01

    The efficiency of Vigna mungo L. Hepper transformation was significantly increased from an average of 1% to 6.5% by using shoot apices excised from embryonic axes precultured on 10 microM benzyl-6-aminopurine (BAP) for 3 days and wounded prior to inoculation in Agrobacterium tumefaciens strain EHA105 carrying the binary vector pCAMBIA2301, which contains a neomycin phosphotransferase gene (nptII) and a beta-glucuronidase (GUS) gene (gusA) interrupted by an intron. The transformed green shoots that were selected and rooted on medium containing kanamycin, and which tested positive for nptII gene by polymerase chain reaction, were established in soil to collect seeds. GUS activity was detected in whole T(0) shoots and T(1) seedlings. All T(0) plants were morphologically normal, fertile and the majority of them transmitted transgenes in a 3:1 ratio to their progenies. Southern analysis of T(1) plants showed integration of nptII into the plant genome.

  1. Stable genetic transformation of Vigna mungo L. Hepper via Agrobacterium tumefaciens.

    PubMed

    Saini, R; Sonia; Jaiwal, P K; Jaiwal, S

    2003-06-01

    Vigna mungo is one of the large-seeded grain legumes that has not yet been transformed. We report here for the first time the production of morphologically normal and fertile transgenic plants from cotyledonary-node explants inoculated with Agrobacterium tumefaciens carrying binary vector pCAMBIA2301, the latter of which contains a neomycin phosphotransferase ( nptII) gene and a beta-glucuronidase (GUS) gene ( uidA) interrupted with an intron. The transformed green shoots, selected and rooted on medium containing kanamycin, tested positive for nptII and uidA genes by polymerase chain reaction (PCR) analysis. These shoots were established in soil and grown to maturity to collect the seeds. Mechanical wounding of the explants prior to inoculation with Agrobacterium, time lag in regeneration due to removal of the cotyledons from explants and a second round of selection at the rooting stage were found to be critical for transformation. Analysis of T(0) plants showed the expression and integration of uidA into the plant genome. GUS activity in leaves, roots, flowers, anthers and pollen grains was detected by histochemical assay. PCR analysis of T(1) progeny revealed a Mendelian transgene inheritance pattern. The transformation frequency was 1%, and 6-8 weeks were required for the generation of transgenics.

  2. Herd- and individual-level prevalences of and risk factors for Salmonella spp. fecal shedding in dairy farms in Al-Dhulail Valley, Jordan.

    PubMed

    Tarazi, Yaser H; Abo-Shehada, Mahmoud N

    2015-10-01

    Salmonellosis is an important disease frequently associated with diarrhea in calves. From January to September 2009, a cross-sectional study involving 91 dairy farms was conducted to determine the prevalence of Salmonella spp. infection in cattle in Al-Dhulail Valley, Jordan. A total of 910 calve and cow fecal samples were collected. Information on farm management practices was obtained through personal interviews using a standardized questionnaire and was tested as risk factors for Salmonella spp. positivity in farms by using logistic regression analysis. Standard conventional methods for Salmonella isolation and serotyping were used, and the disk agar diffusion test was used for antimicrobial testing. The herd-level prevalence of Salmonella spp. in calves, cows, and dairy farms was 12, 12, and 23 %, respectively, and the individual-level prevalence was 4 % for calves, cows, and dairy farms. Forty-six percent of the dairy farms had calf diarrhea, and 4 % had cow diarrhea. Seven (17 %) of the 42 farms with calf diarrhea had Salmonella. However, only 7 % (95 % CI: 4, 10) of the 221 diarrheic and 1 % (95 % CI: 0.2, 4) of the 234 of non-diarrheic calves had Salmonella. A total of 33 Salmonella isolates were obtained from the fecal samples: 12 isolates were Salmonella typhimurium, 6 were Salmonella montevideo, 6 were Salmonella anatum, 2 were Salmonella enteritidis, and 7 isolates were not serotyped. All isolates were susceptible to ciprofloxacin, trimethoprim-sulfamethoxazole, gentamycin, neomycin, colisitin, and amoxicillin at 100, 91, 85, 79, 79, and 70 %, respectively. Out of the 11 variables/categories, the frequency of cleaning every 2 months or more was associated with high odds of infection among calves (OR = 5.6) and farms (OR = 7.0).

  3. Occurrence of resistance to antibiotics, UV-B, and arsenic in bacteria isolated from extreme environments in high-altitude (above 4400 m) Andean wetlands.

    PubMed

    Dib, Julián; Motok, Jessica; Zenoff, Verónica Fernández; Ordoñez, Omar; Farías, María Eugenia

    2008-05-01

    High-altitude Andean wetlands are pristine environments with extreme conditions such as high UV radiation, high heavy metal content (mainly arsenic), high salinity, and oligotrophy. In this paper, the UV-B resistance and tolerance to arsenic of phylogenetically characterized bacteria (Actinobacteria [six isolates], Firmicutes [four isolates], and gamma-Proteobacteria [three isolates]) isolated from Laguna Vilama (4400-m altitude) and Laguna Azul (4560 m) were determined. In addition, given that multiple antibiotic resistances were also determined, a relationship between antibiotic resistances as a consequence of mutagenic ability or in relation to metal resistance is proposed. High UV-B resistances were found, since after 30 min (0.7 KJ m(-2)) and 60 min (1.4 KJ m(-2)) of irradiation, most of the studied bacteria did not show a decreased survival; what is more, many of them had an improved survival with the increased doses. Augmentations in mutagenesis rates were observed after UV-B irradiation in only 4 of the 13 tested isolates. Arsenite tolerance was also established in 8 of the 13 tested strains: Staphylococcus saprophyticus A3 and Micrococcus sp. A7, which were able to grow in media containing up to 10 mM As(III). Finally, predominance of antibiotic resistances (azithromycin, erythromycin, clarithromycin, roxithromycin, streptomycin, chloramphenicol, gentamycin, kanamycin, tetracycline, and ampicillin) was found, in all the isolated strains from both wetlands, with unexpectedly high minimal inhibitory concentrations (MICs; >2 mg mL(-1)) for macrolides. These results demonstrate that in extreme environments like high-altitude wetlands there is a correlation of multiresistances to UV-B radiation and arsenic, and that antibiotic resistances are also widespread in these pristine environments, where antibiotic selective pressure is supposed to be absent. PMID:18330637

  4. Thermococcus Thioreducens sp. Nov., a Novel Hyperthermophilic, Obligately Sulfur-reducing Archaeon from a Deep-sea Hydrothermal Vent

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena V.; Marsic, Damien; Itoh, Takashi; Bej, Asim K.; Tang, Jane; Whitman, William B.; Ng, Joseph D.; Garriott, Owen K.; Hoover, Richard B.

    2007-01-01

    A hyperthermophilic, sulfur-reducing, organo-heterotrophic archaeon, strain OGL-20P was isolated from black smoker chimney material from the Rainbow hydrothermal vent site on the Mid-Atlantic Ridge (36.2 N, 33.9 W). The cells of strain OGL-20P(sup T) have an irregular coccoid shape and are motile with a single flagellum. Growth was observed within the pH range 5.0-8.5 (optimum pH 7.0), NaCl concentration range 1-5 % (w/v) (optimum 3%), and temperature range 55-94 C (optimum 83-85 C). The novel isolate is strictly anaerobic and obligately dependent upon elemental sulfur as an electron acceptor, but it does not reduce sulfate, sulfite, thiosulfate, iron (III) or nitrate. Proteolysis products (peptone, bacto-tryptone, casamino-acids, and yeast extract) are utilized as substrates during sulfur-reduction. Strain OGL-20P(sup T) is resistant to ampicillin, chloramphenicol, kanamycin, and gentamycin, but sensitive to tetracycline and rifampicin. The G+C content of DNA is 52.9 mol%. The 16S rRNA gene sequence analysis revealed that strain OGL-20P(sup T) is closely related to Thermococcus coalescens and related species, but no significant homology by DNA-DNA hybridization was observed between those species and the new isolate. On the basis of physiological and molecular properties of the new isolate, we conclude that strain OGL-20P(sup T) represents a new separate species within the genus Thermococcus, and propose the name Thermococcus thioreducens sp. nov. The type strain is OGL-20P(sup T) (= ATCC BAA-394(sup T) = JCM 12859(sup T) = DSM 14981(sup T)).

  5. Tindallia Californiensis sp. nov.: A New Halo-Alkaliphilic Primary Anaerobe, Isolated from Meromictic soda Mono Lake in California and the Correction of Diagnosis for Genus Tindallia

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena; Marsic, Damien; Hoover, Richard B.; Kevbrin, Vadim; Whitman, William B.; Krader, Paul; Cleland, Dave; Six, N. Frank (Technical Monitor)

    2002-01-01

    A novel extremely halo-alkaliphilic, bacterium strain APO (sup T) was isolated from sediments of the athalassic, meromictic, soda Mono Lake in California. Gram positive, spore-forming, slightly curved rods with sizes 0.6-0.7x 2.5-4.0 micrometers which occur singly, in pairs or short curved chains. Cells, are motile by singular subcentral flagellum. Strain APO (sup T) is mesophilic: growth was observed over the temperature range of +10 C to +48 C (optimum +37 C), NaCl concentration range 1-20 %, wt/vol (optimum 3-5%, wt/vol) and pH range 8.0-11.0 (optimum pH 9.5). The novel isolate is strictly halo-alkaliphilic, requires sodium chloride in medium, obligately anaerobic and catalase-negative. Strain APO (sup T) is organo-heterotroph with fermentative type of metabolism, and uses as substrates: peptone, badotryptone, casamino acids, yeast extract, L-serine, L-lysine, L-histidine, L-arginine, and pyruvate. The main end products of growth on peptone medium were: lactate, acetate, propionate, and ethanol. Strain APO (sup T) is resistant to kanamycin, but sensitive to chloramphenicol, tetracycline, and gentamycin. The sum of G+C in DNA is 44.4 mol% (by HPLC method). On the bait of physiological and molecular properties, the isolate was considered as novel species of genus Tindallia; and the name Tindallia californiensis sp. nov., is proposed for new isolate (type strain APO (sup T) - ATCC BAA_393(sup T) = DSMZ 14871 (sup T)).

  6. Spirochaeta Americana Sp. Nov., A new Haloalkaliphilic, Obligately Anaerobic Spirochete Isolated from Soda Mono Lake in California

    NASA Technical Reports Server (NTRS)

    Hoover, Richard B.; Pikuta, Elena V.; Bej, Asim K.; Marsic, Damien; Whitman, William B.; Tang, Jane; Krader, Paul; Six, N. Frank (Technical Monitor)

    2002-01-01

    A novel obligately anaerobic, mesophilic, haloalkaliphilic spirochete, strain ASpG1(sup T), was isolated from sediments of the alkaline, hypersaline Mono Lake in California, U.S.A. The Gram-negative cells are motile and spirochete-shaped with sizes of 0.2 - 0.22 X 8-15 microns. Growth was observed over the following ranges: temperature 10 C to 44 C; optimum +37 C; NaCl concentration 2 - 12 % (w/v); optimum NaCl3 % and pH 8 - 10.5; optimum pH 9.5. The novel isolate is strictly alkaliphilic, requires high concentrations of carbonate in the medium, and is capable of utilizing D-glucose, fructose, maltose, sucrose, starch, and D-mannitol. The main end products of glucose fermentation are: H2, acetate, ethanol, and formate. Strain ASpG(sup T) is resistant to kanamycin, and rifampin, but sensitive to chloramphenicol, gentamycin and tetracycline. The G+C content of its DNA is 58.5 mol%, genome size is 2.98 x l0(exp 9) Daltons, Tm of the genomic DNA is 68 +/- 2 C, and DNA-DNA hybridization with the most closely related species, Spirocheta alkalica Strain Z-7491(sup T), exhibited 48.7% homology. On the basis of its physiological and molecular properties, the isolate appears to be a novel species of the genus Spirochaeta; and the name Spirochaeta americana sp. nov., is proposed for the taxon (type strain ASpG1(sup T) = ATCC BAA-392(sup T) = DSMZ 14872(sup T)).

  7. Tindallia californiensis sp. nov., a new anaerobic, haloalkaliphilic, spore-forming acetogen isolated from Mono Lake in California

    NASA Technical Reports Server (NTRS)

    Pikuta, E. V.; Hoover, R. B.; Bej, A. K.; Marsic, D.; Detkova, E. N.; Whitman, W. B.; Krader, P.

    2003-01-01

    A novel extremely haloalkaliphilic, strictly anaerobic, acetogenic bacterium strain APO was isolated from sediments of the athalassic, meromictic, alkaline Mono Lake in California. The Gram-positive, spore-forming, slightly curved rods with sizes 0.55- 0.7x1.7-3.0 microns were motile by a single laterally attached flagellum. Strain APO was mesophilic (range 10-48 C, optimum of 37 C); halophilic (NaCl range 1-20% (w/v) with optimum of 3-5% (w/v), and alkaliphilic (pH range 8.0-10.5, optimum 9.5). The novel isolate required sodium ions in the medium. Strain APO was an organotroph with a fermentative type of metabolism and used the substrates peptone, bacto-tryptone, casamino acid, yeast extract, L-serine, L-lysine, L-histidine, L-arginine, and pyruvate. The new isolate performed the Stickland reaction with the following amino acid pairs: proline + alanine, glycine + alanine, and tryptophan + valine. The main end product of growth was acetate. High activity of CO dehydrogenase and hydrogenase indicated the presence of a homoacetogenic, non-cycling acetyl-coA pathway. Strain APO was resistant to kanamycin but sensitive to chloramphenicol, tetracycline, and gentamycin. The G+C content of the genomic DNA was 44.4 mol% (by HPLC method). The sequence of the 16s rRNA gene of strain APO possessed 98.2% similarity with the sequence from Tindullia magadiensis Z-7934, but the DNA-DNA hybridization value between these organisms was only 55%. On the basis of these physiological and molecular properties, strain APO is proposed to be a novel species of the genus Tindallia with the name Tindallia californiensis sp. nov., (type strain APO = ATCC BAA-393 - DSM 14871).

  8. Prevalence and characterization of multi-drug resistant Salmonella Enterica serovar Gallinarum biovar Pullorum and Gallinarum from chicken

    PubMed Central

    Parvej, Md. Shafiullah; Nazir, K. H. M. Nazmul Hussain; Rahman, M. Bahanur; Jahan, Mueena; Khan, Mohammad Ferdousur Rahman; Rahman, Marzia

    2016-01-01

    Aim: Salmonella is an important zoonotic pathogen responsible for animal and human diseases. The aim of the present study was to determine the prevalence and stereotyping of Salmonella isolates isolated from apparently healthy poultry. Furthermore, the clonal relatedness among the isolated Salmonella serovars was assessed. Materials and Methods: A total of 150 cloacal swab samples from apparently healthy chickens were collected, and were subjected for the isolation and identification of associated Salmonella organisms. The isolated colonies were identified and characterized on the basis of morphology, cultural characters, biochemical tests, slide agglutination test, polymerase chain reaction, and pulsed-field gel electrophoresis (PFGE). Antibiotic sensitivity patterns were also investigated using commonly used antibiotics. Results: Of the 150 samples, 11 (7.33%) produced characteristics pink colony with black center on XLD agar medium, and all were culturally and biochemically confirmed to be Salmonella. All possessed serovar-specific gene SpeF and reacted uniformly with group D antisera, suggesting that all of the isolates were Salmonella Enterica serovar Gallinarum, biovar Pullorum and/or Gallinarum. Antimicrobial susceptibility testing revealed that 54.54% of the isolated Salmonella Enterica serovars were highly sensitive to ciprofloxacin, whereas the 81.81% isolates were resistant to amoxycillin, doxycycline, kanamycin, gentamycin, and tetracycline. Pulsed-field gel electrophoresis of the XbaI-digested genomic DNA exhibited identical banding patterns, suggesting that the multidrug resistant Salmonella Enterica serovars occurring in commercial layers are highly clonal in Bangladesh. Conclusion: The present study was conducted to find out the prevalence of poultry Salmonella in layer chicken and to find out the clonal relationship among them. The data in this study suggest the prevalence of Salmonella Enterica, which is multidrug resistant and highly clonal for

  9. Isolation and Characterization of Four Gram-Positive Nickel-Tolerant Microorganisms from Contaminated Sediments

    SciTech Connect

    Van Nostrand, J. D.; Khijniak, T. V.; Gentry, T. J.; Novak, M. T.; Sowder, A. G.; Zhou, J. Z.; Bertsch, P. M.; Morris, P. J.

    2007-01-01

    Microbial communities from riparian sediments contaminated with high levels of Ni and U were examined for metal-tolerant microorganisms. Isolation of four aerobic Ni-tolerant, Gram-positive heterotrophic bacteria indicated selection pressure from Ni. These isolates were identified as Arthrobacter oxydans NR-1, Streptomyces galbus NR-2, Streptomyces aureofaciens NR-3, and Kitasatospora cystarginea NR-4 based on partial 16S rDNA sequences. A functional gene microarray containing gene probes for functions associated with biogeochemical cycling, metal homeostasis, and organic contaminant degradation showed little overlap among the four isolates. Fifteen of the genes were detected in all four isolates with only two of these related to metal resistance, specifically to tellurium. Each of the four isolates also displayed resistance to at least one of six antibiotics tested, with resistance to kanamycin, gentamycin, and ciprofloxacin observed in at least two of the isolates. Further characterization of S. aureofaciens NR-3 and K. cystarginea NR-4 demonstrated that both isolates expressed Ni tolerance constitutively. In addition, both were able to grow in higher concentrations of Ni at pH 6 as compared with pH 7 (42.6 and 8.5 mM Ni at pH 6 and 7, respectively). Tolerance to Cd, Co, and Zn was also examined in these two isolates; a similar pH-dependent metal tolerance was observed when grown with Co and Zn. Neither isolate was tolerant to Cd. These findings suggest that Ni is exerting a selection pressure at this site for metal-resistant actinomycetes.

  10. Class 1 and class 2 integrons in avian pathogenic Escherichia coli from poultry in Italy.

    PubMed

    Cavicchio, Lara; Dotto, Giorgia; Giacomelli, Martina; Giovanardi, Davide; Grilli, Guido; Franciosini, Maria Pia; Trocino, Angela; Piccirillo, Alessandra

    2015-06-01

    The aim of this study was to investigate the occurrence of class 1 and 2 integrons in avian pathogenic Escherichia coli (APEC) from poultry in northern Italy. Strains were tested for phenotypic resistance to aminoglycosides and sulphonamides, and the association between the presence of integrons and the resistance to these antimicrobials was evaluated. A total of 299 isolates (158 from turkeys, 110 from broilers, and 31 from layer hens) were collected from 200 industrial farms. Antimicrobial susceptibility test by the disk diffusion method was performed in accordance with the Clinical and Laboratory Standards Institute (CLSI) guidelines. All strains were screened for the presence of class 1 and 2 integrons by PCR and sequencing. About 55% of APEC contained integrons (class 1, 49.8%; class 2, 10.4%). Different variants of the aadA (5 variants) and the dfrA (4 variants) genes, encoding for streptomycin and trimethoprim resistance respectively, were detected in integron-positive isolates. Less common gene cassettes, such as sat, estX, and orfF, were also identified. Fifteen and 4 gene cassette arrays were found among class 1 and 2 integrons, respectively. High levels of resistance were observed for triple sulphonamides (79.3%), streptomycin (67.2%), and sulfamethoxazole combined with trimethoprim (62.2%), whereas resistance against gentamycin (16.7%), kanamycin (14.7%), and apramycin 3.0%) was low. Integron positivity was significantly higher in isolates phenotypically resistant to aminoglycosides (63.6% vs. 37.8%, P<0.001) and sulfonamides (64.1% vs. 21.1%, P<0.001) than in susceptible ones. Integron-borne aminoglycoside and sulfonamide resistance in APEC represents a concern for the poultry industry in Italy, since they are among the most commonly used antimicrobials in poultry therapy.

  11. Thermococcus Thioreducens sp. nov., A Novel Hyperthermophilic, Obligately Sulfur-Reducing Archaeon from a Deep-Sea Hydrothermal Vent

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena V.; Hoover, Richard B.; Marsic, Damien; Bej, Asim K.; Garriott, Owen

    2003-01-01

    A novel hyperthermophilic organo-heterotrophic archaeon, strain OGL-20P(sup T), was isolated from 'black smoker' chimney material from the Rainbow hydrothermal vent site on the Mid-Atlantic Ridge (36.2 N; 33.9 W). The cells of strain OGL-20P(sup T) have an irregular coccoid shape and are motile with a single flagellum. Growth was observed to occur within the pH range 5.0-8.5 (optimum pH 7.0), NaCl concentration range 1-5 % (w/v) (optimum 3 %), and temperature range 55-94 C (optimum 83-85 C). Novel isolate is strictly anaerobic and obligately dependent from elemental sulfur as electron acceptor, but it cannot reduce sulfate, sulfite, thiosulfate, iron (III) or nitrate. Proteolysis products that can be utilized as substrates during sulfur-reduction are: peptone, bactotryptone, casamino-acids, and yeast extract. Strain OGL-20P(sup T) is resistant to ampicillin, chloramphenicol, kanamycin, and gentamycin, but sensitive to tetracycline and rifampicin. The G+C content of DNA is 57.1 mol% . Comparative 16S rRNA gene sequence analysis revealed that strain OGL-20P(sup T) is most closely related to Thermococcus celer and 'T. barossii', but no significant homology by DNA-DNA hybridization was observed between those species and the new isolate. On the basis of physiological and molecular properties of the new isolate, the name Thermococcus thioreducens sp. nov., is proposed. The type strain is OGL-20P(sup T) (= ATCC BAA-394(sup T) = DSM 1498(sup T)).

  12. Thermococcus sulfurophilus sp. nov., a New Hyperthermophilic, Sulfur-Reducing Archaeon Isolated from Deep-Sea Hydrothermal Vent

    NASA Technical Reports Server (NTRS)

    Pikuta, Elena V.; Hoover, Richard B.; Whitman, William B.; Marsic, Damien; Garriott, Owen; Six, N. Frank (Technical Monitor)

    2002-01-01

    A new hyperthermophilic, anaerobic, sulfur-reducing, organo-heterotrophic archaeon, strain OGL-20P, was isolated from "black smoker" chimney material at the Rainbow hydrothermal vent site in the Atlantic Ocean (36.2 N; 33.9 W). The cells of strain OGL-20P have irregular coccoid shape and are motile with a single flagellum. Growth occurs within pH range of 5.5-8.2 (optimal at pH 7.0-7.2), salinity range of 1-5% NaCl (optimal concentration 3% NaCl wt/vol), and temperature range of +55 C to +94 C (optimal growth at +83 C to +85 C). Strain OGL-20P is resistant to freezing (at -20 C). New isolate is strictly anaerobic with sulfur-type of respiration. A limited number of compounds are utilized as electron donors, including peptone, becto-tryptone, casamino-acids, and yeast extract but does not grow with separate amino acids. Sulfur and Iron can be used as electron acceptors; but not sulfate, sulfite, thiosulfate or nitrate. Strain OGL-20P is resistant to chloramphenicol, kanamycin, and gentamycin. Growth of str. OGL20P is inhibited by tetracyclin but not by Na2MoO4. The G+C content of DNA is 57.2 mol%. The 16S ribosomal RNA sequence analysis allows one to classify strain OGL-20P as a representative of a now species of Thermococcus genus. The name Thermococcus sulfurophilus op. nov., was suggested for the new isolate, type strain OGL-20P (sup T) (= ATCC BAA_394 (sup T) = DSM...(supT)).

  13. Prevalence and characterization of Salmonella enterica in dried milk-related infant foods in Shaanxi, China.

    PubMed

    Yang, B; Zhao, H; Cui, S; Wang, Y; Xia, X; Xi, M; Wang, X; Meng, J; Ge, W

    2014-11-01

    The aim of this study was to investigate the existence and characteristics of Salmonella enterica in dried milk-related infant foods. Twenty-four (3.4%) of 705 samples, including 5 (2.0%) of 246 powdered infant formula, 18 (4.0%) of 445 infant rice cereal, and 1 (7.1%) of 14 other infant foods, were positive for Salmonella. Fifteen serotypes were identified in 40 Salmonella isolates; Salmonella Duesseldorf (15.0%) and Salmonella Indiana (15.0%) were more frequently detected than other serotypes. Resistance to chloramphenicol (82.5%) was most common, followed by tetracycline (57.5%), ceftiofur (52.5%), kanamycin (52.5%), streptomycin (50.0%), gentamycin (45.0%), nalidixic acid (35.0%), ceftriaxone (32.5%), ciprofloxacin (25.0%), amikacin (20.0%), and cefoxitin (15.0%). Twenty-eight (70.0%) isolates were resistant to ≥ 8 antimicrobials, with 5 (12.5%) being resistant to 14 antimicrobials. Amino acid substitutions in gyrase A (GyrA) were most frequently detected as Ser83Arg/Asp87Glu and in p53-associated Parkin-like cytoplasmic protein (ParC), they were all Ser80Arg; the quinolone resistance gene qnrS (47.5%) was commonly detected as well as aminoglycoside acetyltransferase [aac(6')-Ib; 25.0%], qnrA (17.5%), and qnrB (15.0%) genes. Thirty distinct pulsed-field gel electrophoresis patterns were identified among 40 isolates; no identical pulsed-field gel electrophoresis pattern was detected among Salmonella isolates with the same serovar that was recovered in 2010 and 2012. Our results suggest that dried milk-related infant foods could be contaminated with Salmonella and highlight that the dangers to infant health should not be neglected.

  14. Sequences of Two Related Multiple Antibiotic Resistance Virulence Plasmids Sharing a Unique IS26-Related Molecular Signature Isolated from Different Escherichia coli Pathotypes from Different Hosts

    PubMed Central

    Venturini, Carola; Hassan, Karl A.; Roy Chowdhury, Piklu; Paulsen, Ian T.; Walker, Mark J.; Djordjevic, Steven P.

    2013-01-01

    Enterohemorrhagic Escherichia coli (EHEC) and atypical enteropathogenic E. coli (aEPEC) are important zoonotic pathogens that increasingly are becoming resistant to multiple antibiotics. Here we describe two plasmids, pO26-CRL125 (125 kb) from a human O26:H- EHEC, and pO111-CRL115 (115kb) from a bovine O111 aEPEC, that impart resistance to ampicillin, kanamycin, neomycin, streptomycin, sulfathiazole, trimethoprim and tetracycline and both contain atypical class 1 integrons with an identical IS26-mediated deletion in their 3´-conserved segment. Complete sequence analysis showed that pO26-CRL125 and pO111-CRL115 are essentially identical except for a 9.7 kb fragment, present in the backbone of pO26-CRL125 but absent in pO111-CRL115, and several indels. The 9.7 kb fragment encodes IncI-associated genes involved in plasmid stability during conjugation, a putative transposase gene and three imperfect repeats. Contiguous sequence identical to regions within these pO26-CRL125 imperfect repeats was identified in pO111-CRL115 precisely where the 9.7 kb fragment is missing, suggesting it may be mobile. Sequences shared between the plasmids include a complete IncZ replicon, a unique toxin/antitoxin system, IncI stability and maintenance genes, a novel putative serine protease autotransporter, and an IncI1 transfer system including a unique shufflon. Both plasmids carry a derivate Tn21 transposon with an atypical class 1 integron comprising a dfrA5 gene cassette encoding resistance to trimethoprim, and 24 bp of the 3´-conserved segment followed by Tn6026, which encodes resistance to ampicillin, kanymycin, neomycin, streptomycin and sulfathiazole. The Tn21-derivative transposon is linked to a truncated Tn1721, encoding resistance to tetracycline, via a region containing the IncP-1α oriV. Absence of the 5 bp direct repeats flanking Tn3-family transposons, indicates that homologous recombination events played a key role in the formation of this complex antibiotic resistance

  15. [Investigation of pathogenic phenotypes and virulence determinants of food-borne Salmonella enterica strains in Caenorhabditis elegans animal model].

    PubMed

    Aksoy, Deniz; Şen, Ece

    2015-10-01

    Salmonellosis, caused by non-typhoidal Salmonella enterica serovars with the consumption of contaminated food, is one of the leading food-borne disease that makes microbial food safety an important public health issue. This study was performed in order to determine the antibiotic resistance, serotyping, plasmid profiles and pathogenicity potentials of food-borne Salmonella isolates in Caenorhabditis elegans animal model system in Edirne province, located at Thrace region of Turkey. In this study, 32 Salmonella isolates, of which 26 belonged to Infantis, four to Enteritidis, one to Telaviv and one to Kentucky serovars, isolated from chicken carcasses were used. Antibiotic resistance profiles were determined by disc diffusion and broth microdilution methods. A new C.elegans nematode animal model system was used to determine the pathogenicity potential of the isolates. The antibiotic resistance profiles revealed that one (3.1%) isolate was resistant to gentamicin, two (6.2%) to ciprofloxacin, three (9.4%) to ampicillin, 18 (56.3%) to kanamycin, 19 (60.8%) to neomycin, 25 (78.1%) to tetracycline, 25 (78.1%) to trimethoprim, 26 (81.25%) to nalidixic acid, 27 (84.4%) to streptomycin and 32 (100%) to sulfonamide. All of the 32 strains were susceptible to chloramphenicol and ampicillin/sulbactam. High levels of resistance to streptomycin, nalidixic acid, tetracycline, trimethoprim, sulfonamide, kanamycin and neomycin was determined. According to the plasmid analysis, six isolates (18.75%) harboured 1-3 plasmids with sizes between 1.2 and 42.4 kb. In C.elegans nematode animal model system, the time (in days) required to kill 50% (TD50) of nematodes was calculated for each experimental group. TD50 values of the nematode group fed with S.Typhimurium ATCC 14028 that was used as the positive control and another group fed with E.coli OP50 as the negative control were 4.2 ± 0.5 days and 8.0 ± 0.02 days, respectively. TD50 of the groups fed with Salmonella isolates ranged

  16. Occurrence of aminoglycoside phosphotransferase subclass I and II structural genes among Enterobacteriaceae spp. isolated from meat samples.

    PubMed

    Jayaratne, A H; Collins-Thompson, D L; Trevors, J T

    1990-08-01

    3'-Aminoglycoside phosphotransferase [APH(3')] enzymes are a group responsible for resistance to the antibiotics kanamycin (Km) and neomycin (Nm) in bacteria. Escherichia coli ECT24, originally isolated from a meat sample, harboured an 83-kb conjugative R-plasmid (pRPJ24) that carries transferable resistance to Km and Nm. Plasmid pRPJ24 was transferred by conjugation to Enterobacter cloacae 94R, which was used as the source of plasmid DNA in development of a probe for the Km-resistance determinant. Random cloning of BamHI and HindIII double-digest restriction fragments of pRPJ24 in the pUC18 vector plasmid produced clones resistant to both Nm and Km carrying a 1.9-kb DNA insert. Southern hybridization of pRPJ24 cloned chimeric plasmid DNA (pKPJ94) showed homology with the APH(3')II gene from transposon Tn5. A PstI digest of pKPJ94 produced a 920-bp fragment which hybridized with the APH(3')II structural gene, and was used as a DNA probe for the APH(3')II subclass gene. A 980-bp BamHI fragment from plasmid pGH54 carrying the APH(3')I gene from transposon Tn903 was used as a subclass I probe. Total DNA from 206 randomly screened Km-resistant Enterobacteriaceae isolates from raw ground beef and chicken meat samples were examined for the occurrence of APH(3') subclass I and II using non-radioactively-labelled DNA probes. Thirty-six percent and 60% of the isolates examined carried subclass I and II resistances, respectively, in the isolates from chicken meat samples. The corresponding values for bacterial strains from raw ground beef samples were 51% and 72%, respectively. Four percent of the resistant bacterial isolates from chicken samples did not display homology to either probe.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Functional Activity of Plasmid DNA after Entry into the Atmosphere of Earth Investigated by a New Biomarker Stability Assay for Ballistic Spaceflight Experiments

    PubMed Central

    Thiel, Cora S.; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

    2014-01-01

    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130°C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000°C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukariotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925

  18. Characterization and identification of streptococci from golden pompano in China.

    PubMed

    Cai, X H; Peng, Y H; Wang, Z C; Huang, T; Xiong, X Y; Huang, Y C; Wang, B; Xu, L W; Wu, Z H

    2016-05-26

    Streptococcal infections cause significant mortality and high economic losses in the fish farm industry worldwide, including in the culture of golden pompano Trachinotus ovatus L., a species gaining popularity in China. A total of 9 streptococcal strains were isolated from cage-cultured diseased golden pompano in Beihai, Zhanjing, and Shenzhen, China, between 2012 and 2014. Conventional and rapid identification systems were used to determine that the isolates were Streptococcus agalactiae, S. iniae, and S. dysgalactiae subsp. dysgalactiae. All isolates were gram-positive cocci cells in pairs or short-chain, non-motile, catalase negative, α or β hemolytic cocci. The results of multiplex PCR assays and 16S rRNA BLAST analysis also showed that the β hemolytic strains were S. agalactiae and S. iniae and the α hemolytic strain was S. dysgalactiae subsp. dysgalactiae, respectively. Pathogenicity assays revealed that S. agalactiae (lethal dose [LD50]: 6.38 × 10(4) CFU ml(-1)) was more virulent for golden pompano than S. iniae (LD50: 1.47 × 10(7) CFU ml(-1)) and S. dysgalactiae subsp. dysgalactiae (LD50: 2.57 × 10(6) CFU ml(-1)) when they were challenged by intraperiotoneal (i.p.) injection. The results of antibiotic susceptibility showed that all strains were extremely susceptible to cefradine, erythromycin, and cefotaxime but resistant to gentamicin, penicillin G, novobiocin, neomycin, ciprofloxacin, roxithromycin, furazolidone, enrofloxacin, norfloxacin, kanamycin, ampicillin, tetracycline, and vancomycin This is the first report of a phenomenon of golden pompano coinfection with S. agalactiae and S. iniae, which will contribute to the diagnosis and prevention of streptococcicosis. PMID:27225204

  19. Antimicrobial resistance trends among Salmonella isolates obtained from dairy cattle in the northeastern United States, 2004-2011.

    PubMed

    Cummings, Kevin J; Perkins, Gillian A; Khatibzadeh, Sarah M; Warnick, Lorin D; Altier, Craig

    2013-04-01

    Monitoring antimicrobial resistance trends among bacteria isolated from food animals and people is necessary to inform public policy regarding appropriate antimicrobial use. Our objectives were to describe the antimicrobial resistance status of Salmonella isolates from dairy cattle in the northeastern United States and to identify trends in resistance to various antimicrobial agents over time. Data were collected retrospectively for all bovine Salmonella isolates that were obtained from samples submitted to Cornell University's Animal Health Diagnostic Center between January 1, 2004 and December 31, 2011. Temporal trends in the prevalence of resistant Salmonella were investigated for each antimicrobial agent using the Cochran-Armitage trend test. Antimicrobial susceptibility testing was performed on 2745 bovine Salmonella isolates from clinical samples submitted during the study period. Overall resistance to each antimicrobial agent ranged from 0% (amikacin, ciprofloxacin, and nalidixic acid) to 72.0% (sulfadimethoxine). There was evidence of a significantly decreasing trend in prevalence of resistance to most agents: amoxicillin/clavulanic acid (AUG), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (AXO), chloramphenicol (CHL), chlortetracycline (CTET), florfenicol (FFN), kanamycin (KAN), neomycin (NEO), oxytetracycline (OXY), spectinomycin (SPE), streptomycin (STR), sulfadimethoxine (SDM), sulfisoxazole (FIS), and tetracycline (TET). Among the 265 isolates that were tested using the National Antimicrobial Resistance Monitoring System (NARMS) panel, the most common resistance patterns were pansusceptible (54.0%), AUG-AMP-FOX-TIO-AXO-CHL-KAN-STR-FIS-TET (18.1%), and AUG-AMP-FOX-TIO-AXO-CHL-STR-FIS-TET (12.1%). Increasing prevalence of S. enterica serovar Cerro over the course of the study period presumably had an impact on the observed resistance trends. Nevertheless, these results do not support the notion that the current level of antimicrobial

  20. Transformation of Montmorency sour cherry (Prunus cerasus L.) and Gisela 6 (P. cerasus x P. canescens) cherry rootstock mediated by Agrobacterium tumefaciens.

    PubMed

    Song, Guo-Qing; Sink, K C

    2006-03-01

    Sour cherry (Prunus cerasus L.) scion cv. Montmorency and rootstock cv. Gisela 6 (P. cerasus x P. canescens) were transformed using Agrobacterium tumefaciens strain EHA105:pBISN1 carrying the neomycin phosphotransferase gene (nptII) and an intron interrupted ss-glucuronidase (GUS) reporter gene (gusA). Whole leaf explants were co-cultivated with A. tumefaciens, and selection and regeneration of transformed cells and shoots of both cultivars was carried out for 12 weeks on selection medium containing 50 mg l(-1) kanamycin (Km) and 250 mg l(-1) timentin. These media were [Quoirin and Lepoivre (Acta Hortic 78:437-442, 1977)] supplemented with 0.5 mg l(-1) benzylaminopurine (BA) + 0.05 mg l(-1) indole-3-butyric acid (IBA), and woody plant medium [Lloyd and McCown (Proc Int Plant Prop Soc 30:421-427, 1980)] containing 2.0 mg l(-1) BA + 1.0 mg l(-1) IBA for cv. Montmorency and cv. Gisela 6, respectively. Seven out of 226 (3.1%) explants of cv. Montmorency and five out of 152 (3.9%) explants of cv. Gisela 6 produced 30/39 GUS- and PCR-positive shoots from the cut midribs via an intermediate callus. Southern analysis of the GUS- and PCR-positive transformants confirmed stable integration of the transgenes with 1-3 copy numbers in the genomes of seven lines of cv. Montmorency and five of cv. Gisela 6. The selected transformants have a normal phenotype in vitro. PMID:16369768

  1. Schiff base formation and recognition of amino sugars, aminoglycosides and biological polyamines by 2-formyl phenylboronic acid in aqueous solution.

    PubMed

    Gutiérrez-Moreno, Nini J; Medrano, Felipe; Yatsimirsky, Anatoly K

    2012-09-14

    Interactions of 2-, 3- and 4-formyl phenylboronic acids (FPBAs) with sugars, amino sugars, aminoglycosides and various poly- and monoamines have been studied by UV-vis, (1)H and (11)B NMR titrations in water at variable pH. Behavior of 2-FPBA was anomalous in several aspects. Transformation of the acid into its conjugate base was slow in NMR time scale and was accompanied by intramolecular cyclization affording the respective benzoboroxole. The equilibrium constants for imine formation (K(imine)) between 2-FPBA and simple monoamines including amino sugars were ca. 2 orders of magnitude larger than those with other isomers. Still one order of magnitude larger K(imine) values were observed for 2-FPBA with aminoglycosides (kanamycin, amikacin, gentamicin, neomycin) and polyamines (spermine, spermidine). The examination of UV-vis and (11)B NMR spectra of imines formed with 2-FPBA showed that formally neutral Schiff bases in fact were zwitterionic species containing a protonated imine group and an anionic B(OH)(3)(-) group. The enhanced stability of imines with monoamines can therefore be attributed to the electrostatic stabilization provided by the zwitterionic structure and further increased stability of imines with antibiotics and polyamines is explicable by additional stabilization of the borate anionic group by ion paring with ammonium groups not involved in Schiff base formation. Thanks to high molar absorptivity of protonated imines interaction of 2-FPBA with aminoglycosides allows detecting them spectrophotometrically in a μM concentration range in neutral aqueous solutions in the presence of sugars, amino sugars and amino acids.

  2. Longitudinal characterization of monophasic Salmonella Typhimurium throughout the pig's life cycle.

    PubMed

    Fernandes, Laura; Centeno, Maria Madalena; Couto, Natacha; Nunes, Telmo; Almeida, Virgílio; Alban, Lis; Pomba, Constança

    2016-08-30

    Swine have been described as an important reservoir of multidrug resistant monophasic Salmonella Typhimurium, though information on its ecology is scarce. A longitudinal study was performed in order to elucidate the Salmonella 4,[5],12:i:- dynamics throughout the pig's production cycle. A total of 209 faecal samples were collected from 10 sows and in six sampling times during the life of 70 pigs from a Portuguese industrial farm, and 43 isolates of S. 4,[5],12:i:- were identified and characterized regarding clonality and antimicrobial resistance phenotype and genotype. Most isolates (n=42) exhibited resistance to at least ampicillin, kanamycin, neomycin, streptomycin, tetracycline and sulfonamides (encoded by blaTEM, aphAI-IAB, strA, strB, tetB and sul2, respectively). Isolates obtained during the finishing phase showed additional resistance to chloramphenicol and florfenicol (floR), gentamicin and netilmicin (aac(3')-IV). To our knowledge, this study is the first description of aphAI-IAB in S. 4,[5],12:i:-. PFGE analysis showed uneven distribution of isolates into three clusters, A (n=34), B (n=8) and C (n=1). PFGE cluster A was predominant in sows (n=5) and piglets in the farrowing phase (n=17) and in pigs in the early finishing phase (n=11) suggesting a carryover from birth to adult age. The introduction of PFGE cluster B isolates in adulthood could have had an external source, reinforcing the relevance of environmental transmission in the farm ecosystem. This study reveals a dynamic interaction between monophasic S. Typhimurium and the pressures exerted under an intensive swine production setting. PMID:27527788

  3. Genetic transformation of Ornithogalum via particle bombardment and generation of Pectobacterium carotovorum-resistant plants.

    PubMed

    Lipsky, Alexander; Cohen, Avner; Ion, Aurel; Yedidia, Iris

    2014-11-01

    Bacterial soft rot caused by Pectobacterium carotovorum subsp. carotovorum (Pcc) is one of the most devastating diseases of Ornithogalum species. No effective control measures are currently available to use against this pathogen; thus, introduction of resistant genes via genetic transformation into this crop is a promising approach. Tachyplesin I, an antimicrobial peptide, has been shown to effectively control numerous pathogenic bacteria, including Pcc. In this study, liquid-grown cell clusters of Ornithogalum dubium and Ornithogalum thyrsoides were bombarded with a pCAMBIA2301 vector containing a celI leader sequence fused to a gene encoding tachyplesin I, a neomycin phosphotransferase (nptII) gene that served as a selectable marker and a β-glucuronidase (GUS) gene that served as a reporter. Selection was carried out in the dark in liquid medium containing 80mg/L kanamycin. Regeneration was executed in the light after 6-14 months depending on the cultivar. Hundreds of transgenic plantlets were produced and their identity was confirmed through GUS activity assays. PCR and RT-PCR were used to confirm the presence of the target, reporter and selection genes in the divergent lines of plantlets. The resistance of the O. dubium plants to Pcc was evaluated in vitro, following infection with a highly virulent isolate from calla lily. Although control plantlets were completely macerated within a week, 87 putative transgenic subclones displayed varying levels of disease resistance. During three growing seasons in the greenhouse, the transgenic O. dubium lines grew poorly, whereas the transgenic O. thyrsoides plants grew similarly to non-transgenic plants.

  4. Determination of aminoglycoside residues in milk and muscle based on a simple and fast extraction procedure followed by liquid chromatography coupled to tandem mass spectrometry and time of flight mass spectrometry.

    PubMed

    Arsand, Juliana Bazzan; Jank, Louíse; Martins, Magda Targa; Hoff, Rodrigo Barcellos; Barreto, Fabiano; Pizzolato, Tânia Mara; Sirtori, Carla

    2016-07-01

    Antibiotics are widely used in veterinary medicine mainly for treatment and prevention of diseases. The aminoglycosides are one of the antibiotics classes that have been extensively employed in animal husbandry for the treatment of bacterial infections, but also as growth promotion. The European Union has issued strict Maximum Residue Levels (MRLs) for aminoglycosides in several animal origin products including bovine milk, bovine, swine and poultry muscle. This paper describes a fast and simple analytical method for the determination of ten aminoglycosides (spectinomycin, tobramycin, gentamicin, kanamycin, hygromycin, apramycin, streptomycin, dihydrostreptomycin, amikacin and neomycin) in bovine milk and bovine, swine and poultry muscle. For sample preparation, an extraction method was developed using trichloroacetic acid and clean up with low temperature precipitation and C18 bulk. Liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) was used to carry out quantitative analysis and liquid chromatography-quadrupole-time of flight-mass spectrometry (LC-QTOF-MS) was used to screening purposes. Both methods were validated according to the European Union Commission Directive 2002/657/EC. Good performance characteristics were obtained for recovery, precision, calibration curve, specificity, decision limits (CCα) and detection capabilities (CCβ) in all matrices evaluated. The detection limit (LOD) and quantification limit (LOQ) were ranging from 5 to 100ngg(-1) and 12.5 to 250ngg(-1), respectively. Good linearity (r)-above 0.99-was achieved in concentrations ranging from 0.0 to 2.0×MRL. Recoveries ranged from 36.8% to 98.0% and the coefficient of variation from 0.9 to 20.2%, noting that all curves have been made into their own matrices in order to minimize the matrix effects. The CCβ values obtained in qualitative method were between 25 and 250ngg(-1). The proposed method showed to be simple, easy, and adequate for high-throughput analysis of a large

  5. Two different erm(C)-carrying plasmids in the same methicillin-resistant Staphylococcus aureus CC398 isolate from a broiler farm.

    PubMed

    Wendlandt, Sarah; Kadlec, Kristina; Feßler, Andrea T; van Duijkeren, Engeline; Schwarz, Stefan

    2014-07-16

    During a study on plasmid-borne antimicrobial resistance among methicillin-resistant Staphylococcus aureus (MRSA) isolates from broiler farms, an MRSA isolate was identified which carried multiple plasmids. This MRSA isolate belonged to CC398 and exhibited spa type t3015 and dru type dt11a. Plasmid profiling revealed the presence of one large and two small plasmids. The resistance genes tet(L) (tetracycline resistance), dfrK (trimethoprim resistance) and aadD (kanamycin/neomycin resistance) were located on the large plasmid. Both small plasmids, designated pSWS371 and pSWS372, carried only an erm(C) gene for macrolide/lincosamide resistance. Sequence analysis revealed that the 2458-bp plasmid pSWS371 carried only a repL gene for plasmid replication in addition to the erm(C) gene. In contrast, the 3882-bp plasmid pSWS372 harbored - in addition to the erm(C) gene - three more genes: a repF gene for plasmid replication, a cop-6 gene for a small protein potentially involved in copy number control of the plasmid and a novel pre/mob gene for a protein involved in plasmid recombination and mobilization. The erm(C) genes of both small plasmids exhibited constitutive erm(C) gene expression and analysis of the respective translational attenuators identified deletions of 16 bp and 74 bp which explain the constitutive expression. The simultaneous presence of two small plasmids that carry the same resistance gene in the same MRSA isolate is a rare observation. The fact that both plasmids belong to different incompatibility groups as specified by the different rep genes, repL and repF, explains why they can stably coexist in the same bacterial cell.

  6. Novel erm(T)-carrying multiresistance plasmids from porcine and human isolates of methicillin-resistant Staphylococcus aureus ST398 that also harbor cadmium and copper resistance determinants.

    PubMed

    Gómez-Sanz, Elena; Kadlec, Kristina; Feßler, Andrea T; Zarazaga, Myriam; Torres, Carmen; Schwarz, Stefan

    2013-07-01

    This study describes three novel erm(T)-carrying multiresistance plasmids that also harbor cadmium and copper resistance determinants. The plasmids, designated pUR1902, pUR2940, and pUR2941, were obtained from porcine and human methicillin-resistant Staphylococcus aureus (MRSA) of the clonal lineage ST398. In addition to the macrolide-lincosamide-streptogramin B (MLSB) resistance gene erm(T), all three plasmids also carry the tetracycline resistance gene tet(L). Furthermore, plasmid pUR2940 harbors the trimethoprim resistance gene dfrK and the MLSB resistance gene erm(C), while plasmids pUR1902 and pUR2941 possess the kanamycin/neomycin resistance gene aadD. Sequence analysis of approximately 18.1 kb of the erm(T)-flanking region from pUR1902, 20.0 kb from pUR2940, and 20.8 kb from pUR2941 revealed the presence of several copies of the recently described insertion sequence ISSau10, which is probably involved in the evolution of the respective plasmids. All plasmids carried a functional cadmium resistance operon with the genes cadD and cadX, in addition to the multicopper oxidase gene mco and the ATPase copper transport gene copA, which are involved in copper resistance. The comparative analysis of S. aureus RN4220 and the three S. aureus RN4220 transformants carrying plasmid pUR1902, pUR2940, or pUR2941 revealed an 8-fold increase in CdSO4 and a 2-fold increase in CuSO4 MICs. The emergence of multidrug resistance plasmids that also carry heavy metal resistance genes is alarming and requires further surveillance. The colocalization of antimicrobial resistance genes and genes that confer resistance to heavy metals may facilitate their persistence, coselection, and dissemination.

  7. Schiff base formation and recognition of amino sugars, aminoglycosides and biological polyamines by 2-formyl phenylboronic acid in aqueous solution.

    PubMed

    Gutiérrez-Moreno, Nini J; Medrano, Felipe; Yatsimirsky, Anatoly K

    2012-09-14

    Interactions of 2-, 3- and 4-formyl phenylboronic acids (FPBAs) with sugars, amino sugars, aminoglycosides and various poly- and monoamines have been studied by UV-vis, (1)H and (11)B NMR titrations in water at variable pH. Behavior of 2-FPBA was anomalous in several aspects. Transformation of the acid into its conjugate base was slow in NMR time scale and was accompanied by intramolecular cyclization affording the respective benzoboroxole. The equilibrium constants for imine formation (K(imine)) between 2-FPBA and simple monoamines including amino sugars were ca. 2 orders of magnitude larger than those with other isomers. Still one order of magnitude larger K(imine) values were observed for 2-FPBA with aminoglycosides (kanamycin, amikacin, gentamicin, neomycin) and polyamines (spermine, spermidine). The examination of UV-vis and (11)B NMR spectra of imines formed with 2-FPBA showed that formally neutral Schiff bases in fact were zwitterionic species containing a protonated imine group and an anionic B(OH)(3)(-) group. The enhanced stability of imines with monoamines can therefore be attributed to the electrostatic stabilization provided by the zwitterionic structure and further increased stability of imines with antibiotics and polyamines is explicable by additional stabilization of the borate anionic group by ion paring with ammonium groups not involved in Schiff base formation. Thanks to high molar absorptivity of protonated imines interaction of 2-FPBA with aminoglycosides allows detecting them spectrophotometrically in a μM concentration range in neutral aqueous solutions in the presence of sugars, amino sugars and amino acids. PMID:22842531

  8. Characterization and identification of streptococci from golden pompano in China.

    PubMed

    Cai, X H; Peng, Y H; Wang, Z C; Huang, T; Xiong, X Y; Huang, Y C; Wang, B; Xu, L W; Wu, Z H

    2016-05-26

    Streptococcal infections cause significant mortality and high economic losses in the fish farm industry worldwide, including in the culture of golden pompano Trachinotus ovatus L., a species gaining popularity in China. A total of 9 streptococcal strains were isolated from cage-cultured diseased golden pompano in Beihai, Zhanjing, and Shenzhen, China, between 2012 and 2014. Conventional and rapid identification systems were used to determine that the isolates were Streptococcus agalactiae, S. iniae, and S. dysgalactiae subsp. dysgalactiae. All isolates were gram-positive cocci cells in pairs or short-chain, non-motile, catalase negative, α or β hemolytic cocci. The results of multiplex PCR assays and 16S rRNA BLAST analysis also showed that the β hemolytic strains were S. agalactiae and S. iniae and the α hemolytic strain was S. dysgalactiae subsp. dysgalactiae, respectively. Pathogenicity assays revealed that S. agalactiae (lethal dose [LD50]: 6.38 × 10(4) CFU ml(-1)) was more virulent for golden pompano than S. iniae (LD50: 1.47 × 10(7) CFU ml(-1)) and S. dysgalactiae subsp. dysgalactiae (LD50: 2.57 × 10(6) CFU ml(-1)) when they were challenged by intraperiotoneal (i.p.) injection. The results of antibiotic susceptibility showed that all strains were extremely susceptible to cefradine, erythromycin, and cefotaxime but resistant to gentamicin, penicillin G, novobiocin, neomycin, ciprofloxacin, roxithromycin, furazolidone, enrofloxacin, norfloxacin, kanamycin, ampicillin, tetracycline, and vancomycin This is the first report of a phenomenon of golden pompano coinfection with S. agalactiae and S. iniae, which will contribute to the diagnosis and prevention of streptococcicosis.

  9. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    PubMed

    Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

    2014-01-01

    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  10. Molecular characterization of the antimicrobial resistance of Riemerella anatipestifer isolated from ducks.

    PubMed

    Sun, Na; Liu, Jian-Hua; Yang, Fan; Lin, Da-Chuan; Li, Guang-Hui; Chen, Zhang-Liu; Zeng, Zhen-Ling

    2012-08-17

    The antimicrobial susceptibility of 103 Riemerella anatipestifer isolates obtained from ducks during 2008 and 2010 in Southern China, to 23 antimicrobial agents was investigated using the agar dilution method. The MIC(50) and MIC(90) values of streptomycin, kanamycin, gentamicin, apramycin, amikacin, neomycin, nalidixic acid and sulfadimidine were high (32-≥ 128 μg/ml) among the 103 R. anatipestifer isolates. However, relatively low MIC(90) values (8 μg/ml) of ampicillin and florfenicol were observed among these isolates. The presence of resistance genes and integrons was determined using PCR. The genes bla(TEM-1), aph(3')-VII, aadA1, aadA2, aac(3')-IV, aac(3')-IIc, aac(6')-Ib, cat2, cmlA, floR, tet(A), tet(B), tet(C), sul1, and sul2 were detected in 1, 2, 24, 35, 11, 4, 67, 16, 26, 10, 6, 1, 9, 36 and 2 isolates, respectively. Twenty isolates contained one or two class 1 integrons carrying aadA2 or aac(6')-II-catB3-aadA1 gene cassette(s). Mutation analysis of the quinolone resistance-determining regions (QRDRs) of 43 R. anatipestifer isolates with nalidixic acid MICs ≥ 32 μg/ml, showed that the most prevalent mutations in gyrA were those resulting in the amino acid exchanges Ser83-Ile (n=37), followed by Asp87-His (n=7) and Ser83-Arg (n=5). Point mutations in parC (Arg120-Glu) were observed in 5 isolates with a ciprofloxacin MIC of >16 μg/ml. No plasmid-mediated quinolone resistance gene was detected. PFGE analysis showed that the clonal spread of multi-drug resistant R. anatipestifer isolates occurred in the same farm or between different farms. Our results reported, for the first time, the mechanism of quinolone resistance in R. anatipestifer. PMID:22464155

  11. Stable Recombinase-Mediated Cassette Exchange in Arabidopsis Using Agrobacterium tumefaciens1

    PubMed Central

    Louwerse, Jeanine D.; van Lier, Miranda C.M.; van der Steen, Dirk M.; de Vlaam, Clementine M.T.; Hooykaas, Paul J.J.; Vergunst, Annette C.

    2007-01-01

    Site-specific integration is an attractive method for the improvement of current transformation technologies aimed at the production of stable transgenic plants. Here, we present a Cre-based targeting strategy in Arabidopsis (Arabidopsis thaliana) using recombinase-mediated cassette exchange (RMCE) of transferred DNA (T-DNA) delivered by Agrobacterium tumefaciens. The rationale for effective RMCE is the precise exchange of a genomic and a replacement cassette both flanked by two heterospecific lox sites that are incompatible with each other to prevent unwanted cassette deletion. We designed a strategy in which the coding region of a loxP/lox5171-flanked bialaphos resistance (bar) gene is exchanged for a loxP/lox5171-flanked T-DNA replacement cassette containing the neomycin phosphotransferase (nptII) coding region via loxP/loxP and lox5171/lox5171 directed recombination. The bar gene is driven by the strong 35S promoter, which is located outside the target cassette. This placement ensures preferential selection of RMCE events and not random integration events by expression of nptII from this same promoter. Using root transformation, during which Cre was provided on a cotransformed T-DNA, 50 kanamycin-resistant calli were selected. Forty-four percent contained a correctly exchanged cassette based on PCR analysis, indicating the stringency of the selection system. This was confirmed for the offspring of five analyzed events by Southern-blot analysis. In four of the five analyzed RMCE events, there were no additional T-DNA insertions or they easily segregated, resulting in high-efficiency single-copy RMCE events. Our approach enables simple and efficient selection of targeting events using the advantages of Agrobacterium-mediated transformation. PMID:17921337

  12. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    PubMed

    Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

    2014-01-01

    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925

  13. [Correlation between multiple antibiotic resistance and heavy-metal tolerance among some E.coli strains isolated from polluted waters].

    PubMed

    Lazăr, Veronica; Cernat, Ramona; Balotescu, Carmen; Cotar, Ani; Coipan, Elena; Cojocaru, Cristina

    2002-01-01

    Self-transmissible plasmids conferring multiple antibiotic resistance are wide-spread in coliforms populations. In soil and water, multiple antibiotic resistance is clearly associated with resistance/tolerance to heavy-metals (Hg2+, Cu2+, Pb2+, Zn2+, Ca2+). For different genera the genes for heavy-metals resistance are often plasmid encoded. Since these genes are clustered on the same plasmids, heavy-metals and drugs are environmental factors which exert a selective pressure for the populations of these plasmid-harboring bacteria. The aim of this preliminary study was to find possible correlation between resistance genotype determined by genetic analysis and antibiotic and heavy-metal resistance patterns of 12 E. coli strains isolated from chronically polluted waters. Antimicrobial susceptibility testing was performed for ampicillin, tetracycline, gentamycin, kanamycin, chloramphenicol, ceftazidime and cefotaxime by standard disk diffusion Kirby-Bauer method following NCCLS recommendations. These antibiotics were chosen because of their wide-spread use and importance in the treatment of Gram-negative bacterial infections. MICs values of antibiotics and heavy-metals were determined by dilution method in Mueller-Hinton broth using an inoculum of about 1-2 x 10(8) CFU/ml. The concentration range for antimicrobials and heavy-metals salts (CuSO4, CdCl2, Co(NO3)2, Cr(NO3)3, HgCl2, NiCl2 and ZnSO4) was 0.06-64 [symbol: see text] g/ml, 0.5-256 [symbol: see text] g/ml respectively. Plasmid DNA was isolated from E. coli strains by an alkaline lysis. Genetic characterization was performed by agarose gel electrophoresis and spectrophotometric analysis. All strains are multiple antibiotic resistant, 16% of them being resistant to 3, 4 and 6 antibiotics, 32% to 5 and 8% to all 7 antibiotics, respectively. Multiple tolerance to high levels of Cd2+, Cu2+, Cr3+ and Ni2+ was common among multiple antibioresistant strains. Screening for plasmids relieved the presence of several

  14. Characterisation of probiotic properties in human vaginal lactobacilli strains

    PubMed Central

    Hütt, Pirje; Lapp, Eleri; Štšepetova, Jelena; Smidt, Imbi; Taelma, Heleri; Borovkova, Natalja; Oopkaup, Helen; Ahelik, Ave; Rööp, Tiiu; Hoidmets, Dagmar; Samuel, Külli; Salumets, Andres; Mändar, Reet

    2016-01-01

    Background Vaginal lactobacilli offer protection against recurrent urinary infections, bacterial vaginosis, and vaginal candidiasis. Objective To characterise the isolated vaginal lactobacilli strains for their probiotic properties and to compare their probiotic potential. Methods The Lactobacillus strains were isolated from vaginal samples by conventional culturing and identified by sequencing of the 16S rDNA fragment. Several functional properties were detected (production of hydrogen peroxide and lactic acid; antagonistic activity against Escherichia coli, Candida albicans, Candida glabrata, and Gardnerella vaginalis; auto-aggregation and adhesiveness) as well as safety (haemolytic activity, antibiotic susceptibility, presence of transferrable resistance genes). Results A total of 135 vaginal lactobacilli strains of three species, Lactobacillus crispatus (56%), Lactobacillus jensenii (26%), and Lactobacillus gasseri (18%) were characterised using several functional and safety tests. Most of L. crispatus (89%) and L. jensenii (86%) strains produced H2O2. The best lactic acid producers were L. gasseri (18.2±2.2 mg/ml) compared to L. crispatus (15.6±2.8 mg/ml) and L. jensenii (11.6±2.6 mg/ml) (p<0.0001; p<0.0001, respectively). L. crispatus strains showed significantly higher anti-E. coli activity compared to L. jensenii. L. gasseri strains expressed significantly lower anticandidal activity compared to L. crispatus and L. jensenii (p<0.0001). There was no significant difference between the species in antagonistic activity against G. vaginalis. Nearly a third of the strains were able to auto-aggregate while all the tested strains showed a good ability to adhere to HeLa cells. None of the tested lactobacilli caused haemolysis. Although phenotypical resistance was not found to ampicillin, chloramphenicol, erythromycin, gentamycin, tetracycline, and vancomycin, the erm(B), tet(M), and tet(K) were detected in some strains. All strains were resistant to metronidazole

  15. Coenzyme Q10 protects hair cells against aminoglycoside.

    PubMed

    Sugahara, Kazuma; Hirose, Yoshinobu; Mikuriya, Takefumi; Hashimoto, Makoto; Kanagawa, Eiju; Hara, Hirotaka; Shimogori, Hiroaki; Yamashita, Hiroshi

    2014-01-01

    It is well known that the production of free radicals is associated with sensory cell death induced by an aminoglycoside. Many researchers have reported that antioxidant reagents protect sensory cells in the inner ear, and coenzyme Q10 (CoQ10) is an antioxidant that is consumed as a health food in many countries. The purpose of this study was to investigate the role of CoQ10 in mammalian vestibular hair cell death induced by aminoglycoside. Cultured utricles of CBA/CaN mice were divided into three groups (control group, neomycin group, and neomycin + CoQ10 group). In the neomycin group, utricles were cultured with neomycin (1 mM) to induce hair cell death. In the neomycin + CoQ10 group, utricles were cultured with neomycin and water-soluble CoQ10 (30-0.3 µM). Twenty-four hours after exposure to neomycin, the cultured tissues were fixed, and vestibular hair cells were labeled using an anti-calmodulin antibody. Significantly more hair cells survived in the neomycin + CoQ10 group than in the neomycin group. These data indicate that CoQ10 protects sensory hair cells against neomycin-induced death in the mammalian vestibular epithelium; therefore, CoQ10 may be useful as a protective drug in the inner ear. PMID:25265538

  16. Prophylactic subconjunctival cefuroxime during cataract surgery in patients with a penicillin allergy.

    PubMed

    Mitra, Arijit; McElvanney, Andrena

    2006-01-01

    The incidence of cross-reaction after subconjunctival cefuroxime following cataract surgery in penicillin allergy patients is not common and therefore cefuroxime with its better spectrum of action and lower toxicity is probably a better choice than gentamycin.

  17. [Factors of multiple resistance to antibiotics in nodule bacteria].

    PubMed

    Pariĭskaia, A N; Gorelova, O P

    1976-01-01

    Multiple resistance to antibiotics (penicillin, levomycetin, neomycin, tetracycline) was found in 15% of collection strains of nodule bacteria and in strains isolated from natural environment. PMID:1050635

  18. IncM Plasmid R1215 Is the Source of Chromosomally Located Regions Containing Multiple Antibiotic Resistance Genes in the Globally Disseminated Acinetobacter baumannii GC1 and GC2 Clones

    PubMed Central

    Blackwell, Grace A.

    2016-01-01

    ABSTRACT Clear similarities between antibiotic resistance islands in the chromosomes of extensively antibiotic-resistant isolates from the two dominant, globally distributed Acinetobacter baumannii clones, GC1 and GC2, suggest a common origin. A close relative of the likely progenitor of both of these regions was found in R1215, a conjugative IncM plasmid from a Serratia marcescens strain isolated prior to 1980. The 37.8-kb resistance region in R1215 lies within the mucB gene and includes aacC1, aadA1, aphA1b, blaTEM, catA1, sul1, and tetA(A), genes that confer resistance to gentamicin, streptomycin and spectinomycin, kanamycin and neomycin, ampicillin, chloramphenicol, sulfamethoxazole, and tetracycline, respectively. The backbone of this region is derived from Tn1721 and is interrupted by a hybrid Tn2670 (Tn21)-Tn1696-type transposon, Tn6020, and an incomplete Tn1. After minor rearrangements, this R1215 resistance island can generate AbGRI2-0*, the predicted earliest form of the IS26-bounded AbGRI2-type resistance island of GC2 isolates, and to the multiple antibiotic resistance region (MARR) of AbaR0, the precursor of this region in AbaR-type resistance islands in the GC1 group. A 29.9-kb circle excised by IS26 has been inserted into the A. baumannii chromosome to generate AbGRI2-0*. To create the MARR of AbaR0, a different circular form, again generated by IS26 from an R1215 resistance region variant, has been opened at a different point by recombination with a copy of the sul1 gene already present in the AbaR precursor. Recent IncM plasmids related to R1215 have a variant resistance island containing a blaSHV gene in the same location. IMPORTANCE Two lineages of extensively antibiotic-resistant A. baumannii currently plaguing modern medicine each acquired resistance to all of the original antibiotics (ampicillin, tetracycline, kanamycin, and sulfonamides) by the end of the 1970s and then became resistant to antibiotics from newer families after they were

  19. Conjugal Transfer of Plasmid-Borne Multiple Antibiotic Resistance in Streptococcus faecalis var. zymogenes

    PubMed Central

    Jacob, Alan E.; Hobbs, Susan J.

    1974-01-01

    A strain of Streptococcus faecalis var. zymogenes, designated JH1, had high-level resistance to the antibiotics streptomycin, kanamycin, neomycin, erythromycin, and tetracycline. These resistances were lost en bloc from approximately 0.1% of cells grown in nutrient broth at 45 C. The frequency of resistance loss was not increased by growth in the presence of the “curing” agents acriflavine or acridine orange, but after prolonged storage in nutrient agar 17% of cells became antibiotic sensitive. Covalently closed circular deoxyribonucleic acid (DNA) molecules were isolated from the parental strain and from antibiotic-sensitive segregants by using cesium chloride-ethidium bromide gradients. DNA molecular species were identified by using neutral sucrose gradients. Strain JH1 contained two covalently closed circular DNA species of molecular weights 50 × 106 and 38 × 106. An antibiotic-sensitive segregant, strain JH1-9, had lost the larger molecular species. A second sensitive segregant, strain JH1-5, had also lost the larger molecular species but a new molecular species of approximate molecular weight 6 × 106 was present. The antibiotic resistances that were curable from the parental strain were transferred to antibiotic-sensitive strains of S. faecalis and to strain JH1-9, during mixed incubation in nutrient broth at 37 C. Data to be described are interpreted to suggest that the transfer is by a conjugal mechanism. Analysis of the plasmid species in recipient clones showed that all had received the plasmid of molecular weight 50 × 106. Strain JH1-5 was not a good recipient. Analysis of one successful recipient clone of JH1-5 revealed that it had gained the 50 × 106 molecular weight plasmid but lost the 6 × 106 molecular weight species. These data are interpreted to mean that the multiple antibiotic resistance is borne by a transferable plasmid of 50 × 106 molecular weight, and that in clone JH1-5 this plasmid suffered a large deletion leaving only a 6

  20. First identification of methicillin-resistant Staphylococcus pseudintermedius strains among coagulase-positive staphylococci isolated from dogs with otitis externa in Trinidad, West Indies

    PubMed Central

    Dziva, Francis; Wint, Crystal; Auguste, Tennille; Heeraman, Carolyn; Dacon, Cherrelle; Yu, Priscilla; Koma, Lee M.

    2015-01-01

    Background Otitis externa is a common inflammatory ear disease in dogs caused by a variety of pathogens, and coagulase-positive staphylococci are frequently isolated from such infections. Objective To identify antimicrobial susceptibility profiles and methicillin-resistant strains among coagulase-positive staphylococci isolated from otitis externa in dogs. Methods A cross-sectional study was performed over 2 years on 114 client-owned dogs presented to the Veterinary Teaching Hospital with a primary complaint of ear infections. Swabs were obtained from both ears and cultured for staphylococci which were subsequently confirmed as coagulase-positive using rabbit plasma. Antimicrobial susceptibility assays were assessed on all isolates followed by subsequent genetic analysis for species identification and detection of the mecA gene. Results Sixty-five coagulase-positive staphylococci were isolated from 114 client-owned dogs. The isolates exhibited resistance against neomycin (58.5%), streptomycin (49.2%), penicillin (49.2%), polymyxin B (44.6%), tetracycline (36.9%), sulphamethoxazole/trimethoprim (33.8%), kanamycin (33.8%), doxycycline (32.3%), norfloxacin (23.1%), amoxicillin/clavulanate (20%), ciprofloxacin (20%), enrofloxacin (18.5%), gentamicin (16.9%), and cephalothin (9.2%). Forty (61.5%) of the isolates were resistant to at least three or more antimicrobials and 10 were sensitive to all. Using a multiplex polymerase chain reaction assay based on species-specific regions of the thermonuclease (nuc) gene, 38/65 (58.5%) isolates were classified as Staphylococcus aureus, 23/65 (35.4%) as S. pseudintermedius, 2/65 (3.1%) as S. intermedius, and 2/65 (3.1%) as S. schleiferi. Analysis for the mecA gene revealed two positive isolates of S. pseudintermedius which were oxacillin-resistant, representing a first report of such organisms in the Caribbean. Conclusion Despite the relatively high prevalence of multidrug-resistant coagulase-positive staphylococci in Trinidad

  1. The IncF plasmid pRSB225 isolated from a municipal wastewater treatment plant's on-site preflooder combining antibiotic resistance and putative virulence functions is highly related to virulence plasmids identified in pathogenic E. coli isolates.

    PubMed

    Wibberg, Daniel; Szczepanowski, Rafael; Eikmeyer, Felix; Pühler, Alfred; Schlüter, Andreas

    2013-03-01

    The IncF antibiotic resistance and virulence plasmid pRSB225, isolated from an unknown bacterium released with the purified wastewater from a municipal sewage treatment plant into the environment has been analysed at the genomic level by pyrosequencing. The 164,550bp plasmid comprises 210 coding sequences (cds). It is composed of three replicons (RepFIA, RepFIB, and RepFII) and encodes further plasmid-specific functions for stable maintenance and inheritance and conjugative plasmid transfer. The plasmid is self-transmissible and shows a narrow host range limited to the family Enterobacteriaceae. The accessory modules of the plasmid mainly comprise genes conferring resistance to ampicillin (bla(TEM-1b)), chloramphenicol (catA1), erythromycin (mphA), kanamycin and neomycin (aphA1), streptomycin (strAB), sulphonamides (sul2), tetracycline (tetA(B)) and trimethoprim (dfrA14), as well as mercuric ions (mer genes). In addition, putative virulence-associated genes coding for iron uptake (iutA/iucABCD, sitABCD, and a putative high-affinity Fe²⁺ uptake system) and for a toxin/antitoxin system (vagCD) were identified on the plasmid. All antibiotic and heavy metal resistance genes are located either on class 1 (Tn10-remnant, Tn4352B) and class 2 transposons (Tn2-remnant, Tn21, Tn402-remnant) or a class 1 integron, whereas almost all putative virulence genes are associated with IS elements (IS1, IS26), indicating that transposition and/or recombination events were responsible for acquisition of the accessory pRSB225 modules. Particular modules of plasmid pRSB225 are related to corresponding segments of different virulence plasmids harboured by pathogenic Escherichia coli strains. Moreover, pRSB225 modules were also detected in entero-aggregative-haemorrhagic E. coli (EAHEC) draft genome sequences suggesting that IncF plasmids related to pRSB225 mediated gene transfer into pathogenic E. coli derivatives. PMID:23212116

  2. Acquiring, Representing, and Evaluating a Competence Model of Diagnostic Strategy.

    ERIC Educational Resources Information Center

    Clancey, William J.

    This paper describes NEOMYCIN, a computer program that models one physician's diagnostic reasoning within a limited area of medicine. NEOMYCIN's knowledge base and reasoning procedure constitute a model of how human knowledge is organized and how it is used in diagnosis. The hypothesis is tested that such a procedure can be used to simulate both…

  3. Antibacterial activity of ribostamycin on Enterobacteriaceae.

    PubMed

    Yourassowsky, E; Vander Linden, M P

    1976-02-01

    The study of the inhibitory activity of ribostamvcin (Vistamycin), an antibiotic derived from Streptomyces ribosidificus, on 161 strains of Gram-negative bacilli shows that the antibacterial spectrum of this antibiotic is identical to that of kanamycin. If controlled clinical studies confirm that ribostamycin is less toxic than kanamycin on the otovestibular system, this antibiotic will constitute a real therapeutic advance.

  4. Aminoglycoside-induced phosphatidylserine externalisation in sensory hair cells is regionally restricted, rapid and reversible

    PubMed Central

    Goodyear, R.J.; Gale, J.E.; Ranatunga, K.M.; Kros, C.J.; Richardson, G.P.

    2012-01-01

    The aminophospholipid phosphatidylserine (PS) is normally restricted to the inner leaflet of the plasmalemma. During certain cellular processes, including apoptosis, PS translocates to the outer leaflet and can be labelled with externally-applied annexin-V, a calcium-dependent PS-binding protein. In mouse cochlear cultures, annexin-V labelling reveals the aminoglycoside antibiotic neomycin induces rapid PS externalisation, specifically on the apical surface of hair cells. PS externalisation is observed within ~75 seconds of neomycin perfusion, first on the hair bundle and then on membrane blebs forming around the apical surface. Whole-cell capacitance also increases significantly within minutes of neomycin application indicating blebbing is accompanied by membrane addition to the hair-cell surface. PS-externalisation and membrane blebbing can, nonetheless, occur independently. Pre-treating hair cells with calcium chelators, a procedure that blocks mechanotransduction, or overexpressing a PIP2-binding pleckstrin-homology domain, can reduce neomycin-induced PS externalisation, suggesting neomycin enters hair cells via transduction channels, clusters PIP2, and thereby activates lipid scrambling. The effects of short-term neomycin treatment are reversible. Following neomycin washout, PS is no longer detected on the apical surface, apical membrane blebs disappear and surface-bound annexin-V is internalised, distributing throughout the supra-nuclear cytoplasm of the hair cell. Hair cells can therefore repair, and recover from, neomycin-induced surface damage. Hair cells lacking myosin VI, a minus-end directed actin-based motor implicated in endocytosis, can also recover from brief neomycin treatment. Internalised annexin-V, however, remains below the apical surface thereby pinpointing a critical role for myosin VI in the transport of endocytosed material away from the hair cell’s periphery. PMID:18829952

  5. Role of activity of gastrointestinal microflora in absorption of calcium and magnesium in rats fed beta1-4 linked galactooligosaccharides.

    PubMed

    Chonan, O; Takahashi, R; Watanuki, M

    2001-08-01

    Rats fed a diet containing beta1-4 linked galactooligosaccharides (GOS) (5 g/100 g of diet) absorbed calcium and magnesium more efficiently than those fed the control diet. However, the increment obtained through GOS-feeding was reduced by neomycin sulfate (0.67 g/100 g of diet). Since the decrease in cecal pH in rats fed GOS was suppressed by neomycin-feeding, bacterial action in the digestive tract was considered to be reduced by neomycin-feeding. Our findings suggest that the action of intestinal bacteria is necessary for the effects of GOS.

  6. Varicose and other vein problems - self-care

    MedlinePlus

    ... healthy. Talk with your provider before using any lotions, creams, or antibiotic ointments. DO NOT use: Topical antibiotics, such as neomycin Drying lotions, such as calamine Lanolin, a natural moisturizer Benzocaine ...

  7. Stasis dermatitis and ulcers

    MedlinePlus

    ... with your health care provider before using any lotions, creams, or antibiotic ointments. Things to avoid: Topical antibiotics, such as neomycin Drying lotions, such as calamine Lanolin Benzocaine and other products ...

  8. Plant derived compounds inactivate antibiotic resistant Campylobacter jejuni strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sixty-three Campylobacter isolates were screened for their resistance to the antibiotics ampicillin, cefaclor, ciprofloxacin, erythromycin, gentamycin, tetracycline, and trimethroprim/sulfamethoxazole. Based on this screen, the resistant strains D28a and H2a and the nonresistant strain A24a were se...

  9. IS26-Mediated Formation of Transposons Carrying Antibiotic Resistance Genes.

    PubMed

    Harmer, Christopher J; Hall, Ruth M

    2016-01-01

    The IS26 transposase, Tnp26, catalyzes IS26 movement to a new site and deletion or inversion of adjacent DNA via a replicative route. The intramolecular deletion reaction produces a circular molecule consisting of a DNA segment and a single IS26, which we call a translocatable unit or TU. Recently, Tnp26 was shown to catalyze an additional intermolecular, conservative reaction between two preexisting copies of IS26 in different plasmids. Here, we have investigated the relative contributions of homologous recombination and Tnp26-catalyzed reactions to the generation of a transposon from a TU. Circular TUs containing the aphA1a kanamycin and neomycin resistance gene or the tet(D) tetracycline resistance determinant were generated in vitro and transformed into Escherichia coli recA cells carrying R388::IS26. The TU incorporated next to the IS26 in R388::IS26 forms a transposon with the insertion sequence (IS) in direct orientation. Introduction of a second TU produced regions containing both the aphA1a gene and the tet(D) determinant in either order but with only three copies of IS26. The integration reaction, which required a preexisting IS26, was precise and conservative and was 50-fold more efficient when both IS26 copies could produce an active Tnp26. When both ISs were inactivated by a frameshift in tnp26, TU incorporation was not detected in E. coli recA cells, but it did occur in E. coli recA (+) cells. However, the Tnp-catalyzed reaction was 100-fold more efficient than RecA-dependent homologous recombination. The ability of Tnp26 to function in either a replicative or conservative mode is likely to explain the prominence of IS26-bounded transposons in the resistance regions found in Gram-negative bacteria. IMPORTANCE In Gram-negative bacteria, IS26 recruits antibiotic resistance genes into the mobile gene pool by forming transposons carrying many different resistance genes. In addition to replicative transposition, IS26 was recently shown to use a novel

  10. Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain.

    PubMed

    Mora, Azucena; Blanco, Jesús E; Blanco, Miguel; Alonso, M Pilar; Dhabi, Ghizlane; Echeita, Aurora; González, Enrique A; Bernárdez, M Isabel; Blanco, Jorge

    2005-08-01

    A total of 722 Shiga toxin-producing Escherichia coli (STEC) isolates recovered from humans, cattle, ovines and food during the period from 1992 to 1999 in Spain were examined to determine antimicrobial resistance profiles and their association with serotypes, phage types and virulence genes. Fifty-eight (41%) out of 141 STEC O157:H7 strains and 240 (41%) out of 581 non-O157 STEC strains showed resistance to at least one of the 26 antimicrobial agents tested. STEC O157:H7 showed a higher percentage of resistant strains recovered from bovine (53%) and beef meat (57%) than from human (23%) and ovine (20%) sources, whereas the highest prevalence of antimicrobial resistance in non-O157 STEC was found among isolates recovered from beef meat (55%) and human patients (47%). Sulfisoxazole (36%) had the most common antimicrobial resistance, followed by tetracycline (32%), streptomycin (29%), ampicillin (10%), trimethoprim (8%), cotrimoxazole (8%), chloramphenicol (7%), kanamycin (7%), piperacillin (6%), and neomycin (5%). The multiple resistance pattern most often observed was that of streptomycin, sulfisoxazole, and tetracycline. Ten (7%) STEC O157:H7 and 71 (12%) non-O157 strains were resistant to five or more antimicrobial agents. Most strains showing resistance to five or more antimicrobial agents belonged to serotypes O4:H4 (4 strains), O8:H21 (3 strains), O20:H19 (6 strains), O26:H11 (8 strains eae-beta1), O111:H- (3 strains eae-gamma2), O118:H- (2 strains eae-beta1), O118:H16 (5 strains eae-beta1), O128:H- (2 strains), O145:H8 or O145:H- (2 strains eae-gamma1), O157:H7 (10 strains eae-gamma1), O171:H25 (3 strains), O177:H11 (5 strains eae-beta1), ONT:H- (3 strains/1 eae-beta1) and ONT:H21 (2 strains). Interestingly, most of these serotypes, i.e., those indicated in bold) were found among human STEC strains isolated from patients with hemolytic uremic-syndrome (HUS) reported in previous studies. We also detected, among non-O157 strains, an association between a higher

  11. Insulin internalization in isolated rat hepatocytes

    SciTech Connect

    Galan, J.; Trankina, M.; Noel, R.; Ward, W. )

    1990-02-26

    This project was designed to determine whether neomycin, an aminoglycoside antibiotic, has a significant effect upon the pathways of ligand endocytosis in isolated rat hepatocytes. The pathways studied include receptor-mediated endocytosis and fluid-phase endocytosis. Neomycin causes a dose-dependent acceleration of {sup 125}I-insulin internalization. Since fluid-phase endocytosis can also be a significant factor in {sup 125}I-insulin internalization, lucifer yellow (LY), a marker for fluid-phase endocytosis, was incorporated into an assay similar to the {sup 125}I-insulin internalization procedure. In the presence of 5 mM neomycin, a significant increase in LY uptake was evident at 0.2 and 0.4 mg/ml of LY. At 0.8 mg/ml, a decrease in LY uptake was observed. The increased rate of {sup 125}I-insulin internalization in the presence of neomycin was intriguing. Since one action of neomycin is to inhibit phosphoinositidase C, it suggests that the phosphotidylinositol cycle may be involved in ligand internalization by hepatocytes. At low insulin concentrations, receptor-mediated uptake predominates. Fluid-phase uptake can become an important uptake route as insulin concentrations are increased. Since neomycin stimulates fluid-phase endocytosis, it must also be taken into account when measuring ligand internalization.

  12. [Labelling of nif-plasmid pEA9 from Enterobacter agglomerans 339].

    PubMed

    Liu, Cheng-jun; Klingmüller, Walter

    2002-07-01

    The authors describe the in vivo labelling of the plasmid pEA9 in Enterobacter agglomerans 339 with a kanamycin resistance gene. For labelling purposes the donor plasmid pST5 was constructed. This plasmid contains the nif ENX region from pEA9,in which a kanamycin resistance gene is cloned.pST5 was transformed into E.a.339 and subsequently cured from the host. Curing was achieved with AP medium. Fourty strains that had lost pST5,but retained the kanamycin resistance, could be isolated. It showed that none of these clones contained co-integrates of pST5 and pEA9. This is evident that in all clones the kanamycin resistance gene was integrated into pEA9 by homologous recombination.

  13. Clonal Population Structure and Specific Genotypes of Multi-drug Resistant Campylobacter coli from Turkeys.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Commercial turkey flocks in eastern North Carolina have been found to be colonized frequently with Campylobacter coli strains that are resistant to several antimicrobials (tetracycline, streptomycin, erythromycin, kanamycin, and ciprofloxacin/nalidixic acid); such strains have been designated multid...

  14. Mechanisms of antimicrobial resistance and genetic relatedness among enterococci isolated from dogs and cats in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aims: In this study, mechanisms of antimicrobial resistance and genetic relatedness among resistant enterococci from dogs and cats in the United States were determined. Methods and Results: Enterococci resistant to chloramphenicol, ciprofloxacin, erythromycin, gentamicin, kanamycin, streptomycin,...

  15. [Regulation of Yersinia pseudotuberculosis major porin expression in response to antibiotic stress].

    PubMed

    Bystritskaia, E P; Stenkova, A M; Portniagina, O Iu; Rakin, A V; Rasskazov, V A; Isaeva, M P

    2014-01-01

    The OmpF porin gene expression in Yersinia pseudotuberculosis in response to antibiotics of two different classes (kanamycin and nalidixic acid) was analyzed using quantitative PCR and a fluorescence reporter system. Both antibiotics downregulated the expression of the ompF gene. The nalidixic acid significantly reduced ompF expression, while kanamycin, for which porins are considered to be an alternative transport route, only slightly reduced the ompF level.

  16. [Regulation of Yersinia pseudotuberculosis major porin expression in response to antibiotic stress].

    PubMed

    Bystritskaia, E P; Stenkova, A M; Portniagina, O Iu; Rakin, A V; Rasskazov, V A; Isaeva, M P

    2014-01-01

    The OmpF porin gene expression in Yersinia pseudotuberculosis in response to antibiotics of two different classes (kanamycin and nalidixic acid) was analyzed using quantitative PCR and a fluorescence reporter system. Both antibiotics downregulated the expression of the ompF gene. The nalidixic acid significantly reduced ompF expression, while kanamycin, for which porins are considered to be an alternative transport route, only slightly reduced the ompF level. PMID:25080814

  17. Chromosomal Integration of tcb Chlorocatechol Degradation Pathway Genes as a Means of Expanding the Growth Substrate Range of Bacteria To Include Haloaromatics

    PubMed Central

    Klemba, Michael; Jakobs, Barbara; Wittich, Rolf-Michael; Pieper, Dietmar

    2000-01-01

    The tcbR-tcbCDEF gene cluster, coding for the chlorocatechol ortho-cleavage pathway in Pseudomonas sp. strain P51, has been cloned into a Tn5-based minitransposon. The minitransposon carrying the tcb gene cluster and a kanamycin resistance gene was transferred to Pseudomonas putida KT2442, and chromosomal integration was monitored by selection either for growth on 3-chlorobenzoate or for kanamycin resistance. Transconjugants able to utilize 3-chlorobenzoate as a sole carbon source were obtained, although at a >100-fold lower frequency than kanamycin-resistant transconjugants. The vast majority of kanamycin-resistant transconjugants were not capable of growth on 3-chlorobenzoate. Southern blot analysis revealed that many transconjugants selected directly on 3-chlorobenzoate contained multiple chromosomal copies of the tcb gene cluster, whereas those selected for kanamycin resistance possessed a single copy. Subsequent selection of kanamycin resistance-selected single-copy transconjugants for growth on 3-chlorobenzoate yielded colonies capable of utilizing this carbon source, but no amplification of the tcb gene cluster was apparent. Introduction of two copies of the tcb gene cluster without prior 3-chlorobenzoate selection resulted in transconjugants able to grow on this carbon source. Expression of the tcb chlorocatechol catabolic operon in P. putida thus represents a useful model system for analysis of the relationship among gene dosage, enzyme expression level, and growth on chloroaromatic substrates. PMID:10919778

  18. Calorimetric and spectroscopic studies of aminoglycoside binding to AT-rich DNA triple helices

    PubMed Central

    Xi, Hongjuan; Kumar, Sunil; Dosen-Micovic, Ljiljana; Arya, Dev P.

    2013-01-01

    Calorimetric and fluorescence techniques were used to characterize the binding of aminoglycosides-neomycin, paromomycin, and ribostamycin, with 5′-dA12-x-dT12-x-dT12-3′ intramolecular DNA triplex (x = hexaethylene glycol) and poly(dA).2poly(dT) triplex. Our results demonstrate the following features: (1) UV thermal analysis reveals that the Tm for triplex decreases with increasing pH value in the presence of neomycin, while the Tm for the duplex remains unchanged. (2) The binding affinity of neomycin decreases with increased pH, although there is an increase in observed binding enthalpy. (3) ITC studies conducted in two buffers (sodium cacodylate and MOPS) yield the number of protonated drug amino groups (Δn) as 0.29 and 0.40 for neomycin and paromomycin interaction with 5′-dA12-x-dT12-x-dT12-3′, respectively. (4) The specific heat capacity change (ΔCp) determined by ITC studies is negative, with more negative values at lower salt concentrations. From 100 mM to 250 mM KCl, the ΔCp ranges from −402 to −60 cal/(mol K) for neomycin. At pH 5.5, a more positive ΔCp is observed, with a value of −98 cal/(mol K) at 100 mM KCl. ΔCp is not significantly affected by ionic strength. (5) Salt dependence studies reveal that there are at least three amino groups of neomycin participating in the electrostatic interactions with the triplex. (6) FID studies using thiazole orange were used to derive the AC50 (aminoglycoside concentration needed to displace 50% of the dye from the triplex) values. Neomycin shows a seven fold higher affinity than paromomycin and eleven fold higher affinity than ribostamycin at pH 6.8. (7) Modeling studies, consistent with UV and ITC results, show the importance of an additional positive charge in triplex recognition by neomycin. The modeling and thermodynamic studies indicate that neomycin binding to the DNA triplex depends upon significant contributions from charge as well as shape complementarity of the drug to the DNA triplex

  19. Antibiotic interactions with the hammerhead ribozyme:tetracyclines as a new class of hammerhead inhibitor.

    PubMed Central

    Murray, J B; Arnold, J R

    1996-01-01

    A screening of a range of common laboratory antibiotics for inhibition of the hammerhead ribozyme has shown that in addition to certain aminoglycosides (most notably neomycin B) the tetracyclines are also effective inhibitors, with chlorotetracycline being more effective than tetracycline. Inhibition by chlorotetracycline is not as strong as that by neomycin B but is more complicated, with at least two binding sites apparent. As with hammerhead inhibition by neomycin B, chlorotetracycline inhibition can be overcome by raising the concentration of the Mg2+ ion cofactor. We find that around six Mg2+ ions will displace neomycin B, compared with twelve for chlorotetracycline. Inhibition observed in the presence of mixtures of neomycin B and chlorotetracycline is consistent with separate binding sites on the hammerhead for these two classes of antibiotic. Under certain conditions of the mixing order and low concentration of chlorotetracycline, enhancement of single-turnover hammerhead cleavage by up to 20% is observed, with higher concentrations of antibiotic being inhibitory. We have also found that the presence of 2.5% (v/v) DMSO causes a 30% enhancement of the single-turnover cleavage. These results thus extend the range of known inhibitors of hammerhead cleavage, and also demonstrate how the cleavage can be accelerated. PMID:8760373

  20. Liposome-mediated transformation of tobacco mesophyll protoplasts by an Escherichia coli plasmid.

    PubMed Central

    Deshayes, A; Herrera-Estrella, L; Caboche, M

    1985-01-01

    An Escherichia coli plasmid, pLGV23neo, carrying a kanamycin resistance gene expressed in plant cells, was encapsulated into negatively charged liposomes prepared by the reverse phase evaporation technique. These liposomes were induced to fuse with tobacco mesophyll protoplasts by polyethyleneglycol treatment. Kanamycin-resistant clones were reproducibly isolated from transfected cultures at an average frequency of 4 X 10(-5). Plants regenerated from these resistant colonies were confirmed to be transformed according to three criteria. Protoplasts isolated from their leaves were resistant to 100 micrograms/ml kanamycin. The enzyme aminoglycoside 3'-phosphotransferase II encoded by the plasmid pLGV23neo was detected in leaf extracts. Approximately 3-5 copies of the gene encoding for kanamycin resistance were inserted in the genome of at least one of the studied transformants. The restriction pattern of inserted DNA was best explained by assuming a tandem integration of the pPLGV23neo sequences, implying an homologous recombination event between these sequences during transformation. Kanamycin resistance was transmitted as a single dominant nuclear marker to the progeny of resistant plants after selfing or cross-pollination with the wild-type. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:3905385