Tan, Cheong H; Vythilingam, Indra; Matusop, Asmad; Chan, Seng T; Singh, Balbir
2008-01-01
Background A large focus of human infections with Plasmodium knowlesi, a simian parasite naturally found in long-tailed and pig-tailed macaques was discovered in the Kapit Division of Sarawak, Malaysian Borneo. A study was initiated to identify the vectors of malaria, to elucidate where transmission is taking place and to understand the bionomics of the vectors in Kapit. Methods Three different ecological sites in the forest, farm and longhouse in the Kapit district were selected for the study. Mosquitoes were collected by human landing collection at all sites and at the forest also by monkey-baited-traps situated on three different levels. All mosquitoes were identified and salivary glands and midguts of anopheline mosquitoes were dissected to determine the presence of malaria parasites. Results and Discussions Over an 11-month period, a total of 2,504 Anopheles mosquitoes comprising 12 species were caught; 1,035 at the farm, 774 at the forest and 425 at the longhouse. Anopheles latens (62.3%) and Anopheles watsonii (30.6%) were the predominant species caught in the forested ecotypes, while in the farm Anopheles donaldi (49.9%) and An. latens (35.6%) predominated. In the long house, An. latens (29.6%) and An. donaldi (22.8%) were the major Anopheline species. However, An. latens was the only mosquito positive for sporozoites and it was found to be attracted to both human and monkey hosts. In monkey-baited net traps, it preferred to bite monkeys at the canopy level than at ground level. An. latens was found biting early as 18.00 hours. Conclusion Anopheles latens is the main vector for P. knowlesi malaria parasites in the Kapit District of Sarawak, Malaysian Borneo. The study underscores the relationship between ecology, abundance and bionomics of anopheline fauna. The simio-anthropophagic and acrodendrophilic behaviour of An. latens makes it an efficient vector for the transmission of P. knowlesi parasites to both human and monkey hosts. PMID:18377652
Podin, Yuwana; Sarovich, Derek S; Price, Erin P; Kaestli, Mirjam; Mayo, Mark; Hii, KingChing; Ngian, Hieung; Wong, SeeChang; Wong, IngTien; Wong, JinShyan; Mohan, Anand; Ooi, MongHow; Fam, TemLom; Wong, Jack; Tuanyok, Apichai; Keim, Paul; Giffard, Philip M; Currie, Bart J
2014-01-01
Melioidosis is a potentially fatal disease caused by the saprophytic bacterium Burkholderia pseudomallei. Resistance to gentamicin is generally a hallmark of B. pseudomallei, and gentamicin is a selective agent in media used for diagnosis of melioidosis. In this study, we determined the prevalence and mechanism of gentamicin susceptibility found in B. pseudomallei isolates from Sarawak, Malaysian Borneo. We performed multilocus sequence typing and antibiotic susceptibility testing on 44 B. pseudomallei clinical isolates from melioidosis patients in Sarawak district hospitals. Whole-genome sequencing was used to identify the mechanism of gentamicin susceptibility. A novel allelic-specific PCR was designed to differentiate gentamicin-sensitive isolates from wild-type B. pseudomallei. A reversion assay was performed to confirm the involvement of this mechanism in gentamicin susceptibility. A substantial proportion (86%) of B. pseudomallei clinical isolates in Sarawak, Malaysian Borneo, were found to be susceptible to the aminoglycoside gentamicin, a rare occurrence in other regions where B. pseudomallei is endemic. Gentamicin sensitivity was restricted to genetically related strains belonging to sequence type 881 or its single-locus variant, sequence type 997. Whole-genome sequencing identified a novel nonsynonymous mutation within amrB, encoding an essential component of the AmrAB-OprA multidrug efflux pump. We confirmed the role of this mutation in conferring aminoglycoside and macrolide sensitivity by reversion of this mutation to the wild-type sequence. Our study demonstrates that alternative B. pseudomallei selective media without gentamicin are needed for accurate melioidosis laboratory diagnosis in Sarawak. This finding may also have implications for environmental sampling of other locations to test for B. pseudomallei endemicity.
Podin, Yuwana; Sarovich, Derek S.; Price, Erin P.; Kaestli, Mirjam; Mayo, Mark; Hii, KingChing; Ngian, HieUng; Wong, SeeChang; Wong, IngTien; Wong, JinShyan; Mohan, Anand; Ooi, MongHow; Fam, TemLom; Wong, Jack; Tuanyok, Apichai; Keim, Paul; Giffard, Philip M.
2014-01-01
Melioidosis is a potentially fatal disease caused by the saprophytic bacterium Burkholderia pseudomallei. Resistance to gentamicin is generally a hallmark of B. pseudomallei, and gentamicin is a selective agent in media used for diagnosis of melioidosis. In this study, we determined the prevalence and mechanism of gentamicin susceptibility found in B. pseudomallei isolates from Sarawak, Malaysian Borneo. We performed multilocus sequence typing and antibiotic susceptibility testing on 44 B. pseudomallei clinical isolates from melioidosis patients in Sarawak district hospitals. Whole-genome sequencing was used to identify the mechanism of gentamicin susceptibility. A novel allelic-specific PCR was designed to differentiate gentamicin-sensitive isolates from wild-type B. pseudomallei. A reversion assay was performed to confirm the involvement of this mechanism in gentamicin susceptibility. A substantial proportion (86%) of B. pseudomallei clinical isolates in Sarawak, Malaysian Borneo, were found to be susceptible to the aminoglycoside gentamicin, a rare occurrence in other regions where B. pseudomallei is endemic. Gentamicin sensitivity was restricted to genetically related strains belonging to sequence type 881 or its single-locus variant, sequence type 997. Whole-genome sequencing identified a novel nonsynonymous mutation within amrB, encoding an essential component of the AmrAB-OprA multidrug efflux pump. We confirmed the role of this mutation in conferring aminoglycoside and macrolide sensitivity by reversion of this mutation to the wild-type sequence. Our study demonstrates that alternative B. pseudomallei selective media without gentamicin are needed for accurate melioidosis laboratory diagnosis in Sarawak. This finding may also have implications for environmental sampling of other locations to test for B. pseudomallei endemicity. PMID:24145517
A preliminary field survey of ectoparasites of rodents in urban park, Sarawak, Malaysian Borneo.
Madinah, A; Mariana, A; Fatimah, A; Abdullah, M T
2013-09-01
A survey of ectoparasites was carried out during Eco-Zoonoses Expedition in Bukit Aup Jubilee Park (BAJP), Sibu, Sarawak, Malaysian Borneo from 5(th) to 9(th) June 2008. A total of nine individuals comprising two species of rodents were captured. The species of rodents screened for ectoparasites were Sundamys muelleri and Callosciurus notatus. Four genera and six species of ectoparasites were collected, namely, Ixodes granulatus, Ixodes sp., Laelaps sedlaceki, Laelaps nuttalli, Hoplopleura dissicula and Listrophoroides sp. Three species of the ectoparasites are known to have potential health risk. The species were Ixodes granulatus, Laelaps nuttalli and Hoplopleura dissicula. This survey produced the first list of ectoparasites in Bukit Aup Jubilee Park, Sarawak, Malaysia.
Chan, Kim Geok; Lim, Khatijah Abdullah; Ling, How Kee
2015-10-01
This paper examines the experiences of mothers caring for a child with Down syndrome in the Malaysian (Sarawak) context. Qualitative interviews were conducted with 26 biological mothers of children with Down syndrome aged 18 years and below. They were accessed through selected child health clinics, community-based rehabilitation centres and schools using purposive sampling within two regions in Sarawak, one of the two Borneo States of Malaysia. Major themes emerging within the context of care demands were children's health, developmental delays, daily needs and behaviour issues. The insights obtained into the care demands experienced by mothers of children with Down syndrome have several implications for practice by care professionals. © 2014 Wiley Publishing Asia Pty Ltd.
Insurgency in Sarawak: Myth or Real.
Does the present insurgency in the Eastern Malaysian province of Sarawak constitute a serious threat to the security of Malaysia. To properly...address the subject, data was gathered by literature research, and personal interview. The number of guerrillas estimated to be operating in the Sarawak
Bryan, Jane E.; Shearman, Philip L.; Asner, Gregory P.; Knapp, David E.; Aoro, Geraldine; Lokes, Barbara
2013-01-01
The Malaysian states of Sabah and Sarawak are global hotspots of forest loss and degradation due to timber and oil palm industries; however, the rates and patterns of change have remained poorly measured by conventional field or satellite approaches. Using 30 m resolution optical imagery acquired since 1990, forest cover and logging roads were mapped throughout Malaysian Borneo and Brunei using the Carnegie Landsat Analysis System. We uncovered ∼364,000 km of roads constructed through the forests of this region. We estimated that in 2009 there were at most 45,400 km2 of intact forest ecosystems in Malaysian Borneo and Brunei. Critically, we found that nearly 80% of the land surface of Sabah and Sarawak was impacted by previously undocumented, high-impact logging or clearing operations from 1990 to 2009. This contrasted strongly with neighbouring Brunei, where 54% of the land area remained covered by unlogged forest. Overall, only 8% and 3% of land area in Sabah and Sarawak, respectively, was covered by intact forests under designated protected areas. Our assessment shows that very few forest ecosystems remain intact in Sabah or Sarawak, but that Brunei, by largely excluding industrial logging from its borders, has been comparatively successful in protecting its forests. PMID:23874983
Importation and co-circulation of multiple serotypes of dengue virus in Sarawak, Malaysia.
Holmes, Edward C; Tio, Phaik-Hooi; Perera, David; Muhi, Jamail; Cardosa, Jane
2009-07-01
Although dengue is a common disease in South-East Asia, there is a marked absence of virological data from the Malaysian state of Sarawak located on the island of Borneo. From 1997 to 2002 we noted the co-circulation of DENV-2, DENV-3 and DENV-4 in Sarawak. To determine the origins of these Sarawak viruses we obtained the complete E gene sequences of 21 isolates. A phylogenetic analysis revealed multiple entries of DENV-2 and DENV-4 into Sarawak, such that multiple lineages co-circulate, yet with little exportation from Sarawak. Notably, all viral isolates were most closely related to those circulating in different localities in South-East Asia. In sum, our analysis reveals a frequent traffic of DENV in South-East Asia, with Sarawak representing a local sink population.
Siner, Angela; Liew, Sze-Tze; Kadir, Khamisah Abdul; Mohamad, Dayang Shuaisah Awang; Thomas, Felicia Kavita; Zulkarnaen, Mohammad; Singh, Balbir
2017-10-17
Plasmodium knowlesi, a simian malaria parasite, has become the main cause of malaria in Sarawak, Malaysian Borneo. Epidemiological data on malaria for Sarawak has been derived solely from hospitalized patients, and more accurate epidemiological data on malaria is necessary. Therefore, a longitudinal study of communities affected by knowlesi malaria was undertaken. A total of 3002 blood samples on filter paper were collected from 555 inhabitants of 8 longhouses with recently reported knowlesi malaria cases in the Betong Division of Sarawak, Malaysian Borneo. Each longhouse was visited bimonthly for a total of 10 times during a 21-month study period (Jan 2014-Oct 2015). DNA extracted from blood spots were examined by a nested PCR assay for Plasmodium and positive samples were then examined by nested PCR assays for Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, Plasmodium knowlesi, Plasmodium cynomolgi and Plasmodium inui. Blood films of samples positive by PCR were also examined by microscopy. Genus-specific PCR assay detected Plasmodium DNA in 9 out of 3002 samples. Species-specific PCR identified 7 P. knowlesi and one P. vivax. Malaria parasites were observed in 5 thick blood films of the PCR positive samples. No parasites were observed in blood films from one knowlesi-, one vivax- and the genus-positive samples. Only one of 7 P. knowlesi-infected individual was febrile and had sought medical treatment at Betong Hospital the day after sampling. The 6 knowlesi-, one vivax- and one Plasmodium-infected individuals were afebrile and did not seek any medical treatment. Asymptomatic human P. knowlesi and P. vivax malaria infections, but not P. cynomolgi and P. inui infections, are occurring within communities affected with malaria.
2017-10-31
The southwestern border of Brunei with Sarawak, Malaysia is strikingly apparent due to differences in land use practice. On the Malaysian side, a spider web of small roads indicates intensive land use: in this case clearing of the forest for palm oil plantations. On the Brunei side, the virgin forest is preserved, with few if any roads cutting through the forest. The image was acquired September 10, 2012, covers an area of 38 by 38 km, and is located at 4.2 degrees north, 114.4 degrees east. https://photojournal.jpl.nasa.gov/catalog/PIA22034
Dow, Rory A; Reels, Graham T
2018-02-15
Drepanosticta adenani sp. nov. (holotype ♂, from a tributary of Sungai Jela, Nanga Segerak area, Lanjak Entimau Wildlife Sanctuary, Sri Aman Division, Sarawak, Malaysian Borneo, 18 vii 2016, deposited in the Natural History Museum, London) is described from both sexes.
Meal patterns of malaysian adults: findings from the Malaysian adults nutrition survey (MANS).
Wan Abdul Manan, W M; Nur Firdaus, I; Safiah, M Y; Siti Haslinda, M D; Poh, B K; Norimah, A K; Azmi, M Y; Tahir, A; Mirnalini, K; Zalilah, M S; Fatimah, S; Siti Norazlin, M M; Fasiah, W
2012-08-01
Meal patterns have received little attention in nutrition studies. The aim of this study is to present the findings on general meal patterns of Malaysian adults. The Malaysian Adults Nutrition Survey (MANS), carried out in 2002 and 2003, involved 6,928 adults selected by stratified random sampling from all households by zone in Peninsular Malaysia, Sabah and Sarawak. In general, the results showed that most respondents (74.16%) ate three meals per day; 89.20% of the respondents consumed breakfast, while 88.57% consumed lunch and 91.97% consumed dinner with no significant difference in terms of sex. In Peninsular Malaysia, the Northern Zone had the highest number of people consuming breakfast compared to other zones. Meanwhile, the population in Sarawak had the largest proportion of people consuming lunch and dinner, but the smallest proportion of people consuming breakfast. A significantly higher number of the rural population consumed breakfast and lunch than urbanites; however there was no significant difference in dinner consumption. Generally, breakfast consumption increased with age whereby significant difference existed between the 18 to 19 years age group and the age group of 30 years and older. Lunch intake among the age groups showed no significant difference. In contrast, dinner consumption was significantly lower among the 18 to 19 years age group compared to all other age groups. Comparison among the ethnic groups showed that the Indian population had the lowest percentage of having breakfast and lunch while the Orang Asli had the lowest percentage of consuming dinner. However, the Orang Asli recorded the highest percentage for taking breakfast and lunch while the Chinese had the highest percentage of taking dinner. Considering that Malaysian adults consumed their conventional breakfast, lunch and dinner, these findings indicatethat Malaysians are maintaining their traditional meal patterns.
Pui, Yong Min; Karin, Benjamin R; Bauer, Aaron M; Das, Indraneil
2017-05-03
A new species of the genus Tropidophorus is described from Putai, upper Baleh, Kapit districts, Sarawak, East Malaysia (Borneo). Tropidophorus sebi sp. nov. is diagnosable from congeners from Borneo by the combination of the following characters: head shields present, dorsal and lateral scales smooth; parietal scales in two pairs; supraciliaries eight; supraoculars four; supralabials seven; infralabials four; postmental undivided; longitudinal scale rows 58; ventrals 53; transverse scale rows at midbody 34; subcaudals 98; preanals enlarged, single; and subdigital lamellae of Toe IV 19. In addition, we determine the phylogenetic position of this species within the Tropidophorus group based on mitochondrial markers, and present a key to identification of the known Bornean species in the genus.
Over two decades of Plasmodium knowlesi infections in Sarawak: Trend and forecast.
Ooi, Choo Huck; Bujang, Mohamad Adam; Tg Abu Bakar Sidik, Tg Mohd Ikhwan; Ngui, Romano; Lim, Yvonne Ai-Lian
2017-12-01
Malaria is still of great public health concern, especially in Malaysian Borneo. The aim of this study was to determine the trends of P. knowlesi infection in Sarawak, Malaysia and to forecast the incidence of P. knowlesi until the year 2040. Data on P. knowlesi malaria cases from 1992 to the year 2014 were obtained from the Sarawak Health Department, Malaysia. ARIMA model was applied to forecast the future incidence of P. knowlesi infection. The data for the whole of Sarawak and subsequently the selected six districts which have high incidence rates of P. knowlesi infection were analyzed. Results of the analysis showed that there was an increasing trend of P. knowlesi cases from the year 1992-2014 (p<0.001). The trend in the incidence started to increase in the year 2008 (p=0.029). The incidence rate per 100,000 populations was between 4.15 in the year 1992 and 42.03 in the year 2014. High incidence of P. knowlesi infections has been detected in the districts adjacent to each other within the interior region of Sarawak. The forecasted incidence and incidence rate per 100,000 populations in the year 2020 were 1229 and 44.04, respectively, while those in the year 2040 were 2056 and 62.91, respectively. The forecasted incidence showed an upward trend highlighting an urgent need to draw up strategic and holistic prevention plans to limit further the increase in P. knowlesi morbidity and mortality in Sarawak. It is imperative that these measures are customized taking into consideration the challenges faced in the interior areas of Sarawak and the behavior of the main vector of P. knowlesi (i.e., An. latens) in Sarawak. Copyright © 2017 Elsevier B.V. All rights reserved.
Checklist of Gastropods from the Exclusive Economic Zone (EEZ), Sarawak, Malaysia.
Morni, Wan Zabidii Wan; Rahim, Siti Akmar Khadijah Ab; Rumpet, Richard; Musel, Jamil; Hassan, Ruhana
2017-01-01
This study provides the first marine gastropod checklist from the Sarawak Exclusive Economic Zone (EEZ). Gastropod samples were collected from selected stations in the Sarawak EEZ using an otter trawl net with a stretched mesh size of 38 mm at the cod end. The trawling operations were conducted more than 12 nautical miles from the coast, and the area was divided into three depth strata: I) 20-50 m, II) 50-100 m and III) 100-200 m. A total of 23 gastropod species were identified during the two-month sampling period from 16 August until 6 October 2015, representing 8 superfamilies, 15 families and 20 genera. Superfamily Tonnoidea was represented by 7 species, followed by Muricoidea (5 species), Cypraeoidea (4 species), and Buccinoidea and Conoidea (both with 2 species). Other superfamilies were represented by a single species. Only 3 species were obtained in 2 depth strata, namely Melo melo , Murex aduncospinosus and Tonna galea . In addition, 9, 13 and 4 species of gastropods were found in strata I, II and III, respectively. The information on gastropod distributions at different depth strata in the Sarawak EEZ could be useful in updating the Malaysian species diversity database.
Checklist of Gastropods from the Exclusive Economic Zone (EEZ), Sarawak, Malaysia
Morni, Wan Zabidii Wan; Rahim, Siti Akmar Khadijah Ab; Rumpet, Richard; Musel, Jamil; Hassan, Ruhana
2017-01-01
This study provides the first marine gastropod checklist from the Sarawak Exclusive Economic Zone (EEZ). Gastropod samples were collected from selected stations in the Sarawak EEZ using an otter trawl net with a stretched mesh size of 38 mm at the cod end. The trawling operations were conducted more than 12 nautical miles from the coast, and the area was divided into three depth strata: I) 20–50 m, II) 50–100 m and III) 100–200 m. A total of 23 gastropod species were identified during the two-month sampling period from 16 August until 6 October 2015, representing 8 superfamilies, 15 families and 20 genera. Superfamily Tonnoidea was represented by 7 species, followed by Muricoidea (5 species), Cypraeoidea (4 species), and Buccinoidea and Conoidea (both with 2 species). Other superfamilies were represented by a single species. Only 3 species were obtained in 2 depth strata, namely Melo melo, Murex aduncospinosus and Tonna galea. In addition, 9, 13 and 4 species of gastropods were found in strata I, II and III, respectively. The information on gastropod distributions at different depth strata in the Sarawak EEZ could be useful in updating the Malaysian species diversity database. PMID:28228920
Teh, C L; Ling, G R; Aishah, Wan Sharifah
2015-01-01
Systemic lupus erythematosus (SLE) has been well studied in West Malaysian populations but lacking in East Malaysian populations. The aim of this study was to examine the clinical features and disease patterns of patients with SLE in a multiethnic East Malaysian population in Sarawak. All SLE patients who were treated in Sarawak General Hospital were reviewed in a retrospective longitudinal study using a standard protocol from 1 January 2006 to 31 December 2013. There were a total of 633 patients in our study with the female to male ratio of 12:1. Our study patients were of multiethnic origins with predominant Chinese ethnic group. They had a mean age of 36.9 ± 13.2 years and a mean duration of illness of 7.2 ± 6.0 years. The main involvements were haematological (74.2 %), malar rash (64.0 %) and renal (58.6 %). Chinese patients were less likely to have discoid lupus, pleuritis and pericarditis, while Malay patients were more likely to have arthritis. Bidayuh patients were more likely to have oral ulcer. Secondary antiphospholipid syndrome was more common in Chinese. The majority of patients were in clinical remission with low SDI. There were 58 deaths (9.2 %) during 2006-2013 with the main causes of death being flare of disease and infection.
Suut, Lela; Mazlan, Mohamad Nur-Azim; Arif, Mohamad Taha; Yusoff, Haironi; Abdul Rahim, Nor-Aliza; Safii, Razitasham; Suhaili, Mohamad Raili
2016-07-01
Leptospirosis is an important zoonotic disease globally and is endemic in Malaysia. A study was conducted in the Rejang basin of Sarawak from June 2011 to May 2013 to determine the seroprevalence of leptospirosis among the communities and dominant infecting Leptospira serovars. A total of 508 human sera were analyzed using ELISA and the microscopic agglutination test (MAT). The seroprevalence of leptospirosis in the study area was 37.4%, with the highest prevalence in Kapit division. More women were positive for leptospirosis (59.5%), and the mean age of seropositive individuals was 42.2 (SD = 18.7) years. Antibody titers between 1:50 and 1:1600 were reported, and serovars djasiman (22.1%), shermani (13.2%), and pomona (7.9%) predominated, with varied distribution between geographical locations. This study highlighted the endemicity and diversity of existing Leptospira serovars within the community. This information should be communicated to local health personnel and communities at risk, and rapid diagnostic capability should be made available to local health facilities. © 2016 APJPH.
Devi, B C R; Tang, T S; Corbex, M
2008-12-01
The provision of palliative care (PC) and opioids is difficult to ensure in remote areas in low- and middle-income countries. We describe here the set up of a home-care program in Sarawak (the Malaysian part of the Borneo Island), where half the population lives in villages that are difficult to access. The establishment of this program, initiated in 1994 by the Department of Radiotherapy of Sarawak General Hospital, consisted of training, empowering nurses, simplifying referral, facilitating access to medication, and increasing awareness among public and health professionals about PC. The program has been sustainable and cost efficient, serving 936 patients in 2006. The total morphine usage in the program increased from <200 g in 1993 to >1400 g in 2006. The results show that pain medication can be provided even in remote areas with effective organization and empowerment of nurses, who were the most important determinants for the set up of this program. Education of family was also a key aspect. The authors believe that the experience gained in Sarawak may help other regions with low or middle resources in the set up of their PC program especially for their remote rural population.
Continental Shelf Sediments of Sarawak, Malaysian Borneo.
Morni, Wan Zabidii Wan; Ab Rahim, Siti Akmar Khadijah; Masron, Tarmiji; Rumpet, Richard; Musel, Jamil; Hassan, Ruhana
2017-01-01
Sediment distributions in deep sea influence the benthic community structure and thus play an important role in shaping the marine ecosystem. Several studies on sediment characteristics had been conducted in South China Sea (SCS), but only limited to coastal areas of regions within SCS territories. Therefore, this study was carried out to analyze the benthic sediment profile in an area beyond 12 nautical miles off the coast of Sarawak, southern SCS. Sediment samples were collected from 31 stations, comprising three depth ranges: (I) 20-50 m, (II) 50-100 m, and (III) 100-200 m. The total organic matter (TOM) contents were determined and subjected to dry and wet sieving methods for particle size analysis. TOM contents in the deep area (>50 m) were significantly higher ( p = 0.05) and positively correlated ( r = 0.73) with silt-clay fraction. About 55% and 82% of stations in strata II and III, respectively, were dominated by silt-clay fractions (<63 μ m mean diameter), coherent with TOM data. In addition, sediments in the deep area (>50 m) tend to be poorly sorted, very fine skewed, and platykurtic. Unlike data obtained 20 years ago which reported high content of silt-clay (58%), this study recorded a lower content (35%); therefore, changes in sediment load had been observed in southern SCS.
Continental Shelf Sediments of Sarawak, Malaysian Borneo
Masron, Tarmiji; Rumpet, Richard; Musel, Jamil
2017-01-01
Sediment distributions in deep sea influence the benthic community structure and thus play an important role in shaping the marine ecosystem. Several studies on sediment characteristics had been conducted in South China Sea (SCS), but only limited to coastal areas of regions within SCS territories. Therefore, this study was carried out to analyze the benthic sediment profile in an area beyond 12 nautical miles off the coast of Sarawak, southern SCS. Sediment samples were collected from 31 stations, comprising three depth ranges: (I) 20–50 m, (II) 50–100 m, and (III) 100–200 m. The total organic matter (TOM) contents were determined and subjected to dry and wet sieving methods for particle size analysis. TOM contents in the deep area (>50 m) were significantly higher (p = 0.05) and positively correlated (r = 0.73) with silt-clay fraction. About 55% and 82% of stations in strata II and III, respectively, were dominated by silt-clay fractions (<63 μm mean diameter), coherent with TOM data. In addition, sediments in the deep area (>50 m) tend to be poorly sorted, very fine skewed, and platykurtic. Unlike data obtained 20 years ago which reported high content of silt-clay (58%), this study recorded a lower content (35%); therefore, changes in sediment load had been observed in southern SCS. PMID:29075660
Devi, B. C. R.; Corbex, M.
2008-01-01
Background: The provision of palliative care (PC) and opioids is difficult to ensure in remote areas in low- and middle-income countries. We describe here the set up of a home-care program in Sarawak (the Malaysian part of the Borneo Island), where half the population lives in villages that are difficult to access. Methods: The establishment of this program, initiated in 1994 by the Department of Radiotherapy of Sarawak General Hospital, consisted of training, empowering nurses, simplifying referral, facilitating access to medication, and increasing awareness among public and health professionals about PC. Results: The program has been sustainable and cost efficient, serving 936 patients in 2006. The total morphine usage in the program increased from <200 g in 1993 to >1400 g in 2006. The results show that pain medication can be provided even in remote areas with effective organization and empowerment of nurses, who were the most important determinants for the set up of this program. Education of family was also a key aspect. Conclusion: The authors believe that the experience gained in Sarawak may help other regions with low or middle resources in the set up of their PC program especially for their remote rural population. PMID:18641007
Cadmium and lead in blood cockle (Anadara granosa) from Asajaya, Sarawak, Malaysia.
Hossen, Md Faruk; Hamdan, Sinin; Rahman, Md Rezaur
2014-01-01
The concentrations were ranged from 1.35 ± 0.16 to 2.22 ± 0.34 µg/g (dry weight) and 2.65 ± 0.34 to 4.36 ± 0.53 µg/g (dry weight) for Cd and Pb, respectively, in blood cockle Anadara granosa from four sites of Sabang River, namely, Kampung Sambir, Kampung Tambirat, Beliong Temple, and Kampung Tanjung Apong, which are located at Asajaya, Sarawak, Malaysia. All values exceeded safety limits set by Malaysian Food Regulation (1985). It may be the cause of serious human health problems after long term consumption. Thus, consumer should have consciousness about such type of seafood from mentioned sites and need further investigation.
Cadmium and Lead in Blood Cockle (Anadara granosa) from Asajaya, Sarawak, Malaysia
Hossen, Md. Faruk; Hamdan, Sinin; Rahman, Md. Rezaur
2014-01-01
The concentrations were ranged from 1.35 ± 0.16 to 2.22 ± 0.34 µg/g (dry weight) and 2.65 ± 0.34 to 4.36 ± 0.53 µg/g (dry weight) for Cd and Pb, respectively, in blood cockle Anadara granosa from four sites of Sabang River, namely, Kampung Sambir, Kampung Tambirat, Beliong Temple, and Kampung Tanjung Apong, which are located at Asajaya, Sarawak, Malaysia. All values exceeded safety limits set by Malaysian Food Regulation (1985). It may be the cause of serious human health problems after long term consumption. Thus, consumer should have consciousness about such type of seafood from mentioned sites and need further investigation. PMID:25538965
Wave power potential in Malaysian territorial waters
NASA Astrophysics Data System (ADS)
Asmida Mohd Nasir, Nor; Maulud, Khairul Nizam Abdul
2016-06-01
Up until today, Malaysia has used renewable energy technology such as biomass, solar and hydro energy for power generation and co-generation in palm oil industries and also for the generation of electricity, yet, we are still far behind other countries which have started to optimize waves for similar production. Wave power is a renewable energy (RE) transported by ocean waves. It is very eco-friendly and is easily reachable. This paper presents an assessment of wave power potential in Malaysian territorial waters including waters of Sabah and Sarawak. In this research, data from Malaysia Meteorology Department (MetMalaysia) is used and is supported by a satellite imaginary obtained from National Aeronautics and Space Administration (NASA) and Malaysia Remote Sensing Agency (ARSM) within the time range of the year 1992 until 2007. There were two types of analyses conducted which were mask analysis and comparative analysis. Mask analysis of a research area is the analysis conducted to filter restricted and sensitive areas. Meanwhile, comparative analysis is an analysis conducted to determine the most potential area for wave power generation. Four comparative analyses which have been carried out were wave power analysis, comparative analysis of wave energy power with the sea topography, hot-spot area analysis and comparative analysis of wave energy with the wind speed. These four analyses underwent clipping processes using Geographic Information System (GIS) to obtain the final result. At the end of this research, the most suitable area to develop a wave energy converter was found, which is in the waters of Terengganu and Sarawak. Besides that, it was concluded that the average potential energy that can be generated in Malaysian territorial waters is between 2.8kW/m to 8.6kW/m.
Neural tube defects in Malaysia: data from the Malaysian National Neonatal Registry.
Boo, Nem-Yun; Cheah, Irene G S; Thong, Meow-Keong
2013-10-01
This study aimed to determine the prevalence and early outcome of neural tube defects (NTDs) in Malaysia. This prospective study included all neonates with NTDs (spina bifida, anencephaly, encephalocoele) born in 2009 in 32 Malaysian hospitals in the Malaysian National Neonatal Network. The prevalence of NTDs was 0.42 per 1000 live births, being highest among the indigenous people of Sarawak (1.09 per 1000 live births) and lowest among Malaysians of Chinese descent (0.09 per 1000 live births). The most common type of NTDs was anencephaly (0.19 per 1000 live births), followed by spina bifida (0.11 per 1000 live births) and encephalocoele (0.07 per 1000 live births). Majority of the infants with anencephaly (94.5%, n = 51), 45.8% (n = 11) with encephalocoele and 9.5% (n = 4) with spina bifida died. The median duration of hospital stay was 4 (range: 0-161) days. NTDs were common in Malaysia. Mortality was high. Long-term monitoring of NTD prevalence following folic fortification of food is recommended.
Lee, Kim-Sung; Cox-Singh, Janet; Brooke, George; Matusop, Asmad; Singh, Balbir
2009-01-01
Human infections with Plasmodium knowlesi have been misdiagnosed by microscopy as Plasmodium malariae due to their morphological similarities. Although microscopy-identified P. malariae cases have been reported in the state of Sarawak (Malaysian Borno) as early as 1952, recent epidemiological studies suggest the absence of indigenous P. malariae infections. The present study aimed to determine the past incidence and distribution of P. knowlesi infections in the state of Sarawak based on archival blood films from patients diagnosed by microscopy as having P. malariae infections. Nested PCR assays were used to identify Plasmodium species in DNA extracted from 47 thick blood films collected in 1996 from patients in seven different divisions throughout the state of Sarawak. Plasmodium knowlesi DNA was detected in 35 (97.2%) of 36 blood films that were positive for Plasmodium DNA, with patients originating from all seven divisions. Only one sample was positive for P. malariae DNA. This study provides further evidence of the widespread distribution of human infections with P. knowlesi in Sarawak and its past occurrence. Taken together with data from previous studies, our findings suggest that P. knowlesi malaria is not a newly emergent disease in humans. PMID:19358848
Teng, Sing Tung; Tan, Suh Nih; Lim, Hong Chang; Dao, Viet Ha; Bates, Stephen S; Leaw, Chui Pin
2016-12-01
Forty-eight isolates of Pseudo-nitzschia species were established from the Miri coast of Sarawak (Malaysian Borneo) and underwent TEM observation and molecular characterization. Ten species were found: P. abrensis, P. batesiana, P. fukuyoi, P. kodamae, P. lundholmiae, P. multistriata, P. pungens, P. subfraudulenta, as well as two additional new morphotypes, herein designated as P. bipertita sp. nov. and P. limii sp. nov. This is the first report of P. abrensis, P. batesiana, P. kodamae, P. fukuyoi, and P. lundholmiae in coastal waters of Malaysian Borneo. Pseudo-nitzschia bipertita differs from its congeners by the number of sectors that divide the poroids, densities of band striae, and its cingular band structure. Pseudo-nitzschia limii, a pseudo-cryptic species in the P. pseudodelicatissima complex sensu lato, is distinct by having wider proximal and distal mantles, a higher number of striae, and greater poroid height in the striae of the valvocopula. The species were further supported by the phylogenetic reconstructions of the nuclear-encoded large subunit ribosomal gene and the second internal transcribed spacer. Phylogenetically, P. bipertita clustered with its sister taxa (P. subpacifica + P. heimii); P. limii appears as a sister taxon to P. kodamae and P. hasleana in the ITS2 tree. Pairwise comparison of ITS2 transcripts with its closest relatives revealed the presence of both hemi- and compensatory base changes. Toxicity analysis showed detectable levels of domoic acid in P. abrensis, P. batesiana, P. lundholmiae, and P. subfraudulenta, but both new species tested below the detection limit. © 2016 Phycological Society of America.
Young, Katherine I; Mundis, Stephanie; Widen, Steven G; Wood, Thomas G; Tesh, Robert B; Cardosa, Jane; Vasilakis, Nikos; Perera, David; Hanley, Kathryn A
2017-08-31
Mosquito-borne dengue virus (DENV) is maintained in a sylvatic, enzootic cycle of transmission between canopy-dwelling non-human primates and Aedes mosquitoes in Borneo. Sylvatic DENV can spill over into humans living in proximity to forest foci of transmission, in some cases resulting in severe dengue disease. The most likely vectors of such spillover (bridge vectors) in Borneo are Ae. albopictus and Ae. niveus. Borneo is currently experiencing extensive forest clearance. To gauge the effect of this change in forest cover on the likelihood of sylvatic DENV spillover, it is first necessary to characterize the distribution of bridge vectors in different land cover types. In the current study, we hypothesized that Ae. niveus and Ae. albopictus would show significantly different distributions in different land cover types; specifically, we predicted that Ae. niveus would be most abundant in forests whereas Ae. albopictus would have a more even distribution in the landscape. Mosquitoes were collected from a total of 15 sites using gravid traps and a backpack aspirator around Kampong Puruh Karu, Sarawak, Malaysian Borneo, where sylvatic DENV spillover has been documented. A total of 2447 mosquitoes comprising 10 genera and 4 species of Aedes, were collected over the three years, 2013, 2014 and 2016, in the three major land cover types in the area, homestead, agriculture and forest. Mosquitoes were identified morphologically, pooled by species and gender, homogenized, and subject to DNA barcoding of each Aedes species and to arbovirus screening. As predicted, Ae. niveus was found almost exclusively in forests whereas Ae. albopictus was collected in all land cover types. Aedes albopictus was significantly (P = 0.04) more abundant in agricultural fields than forests. Sylvatic DENV was not detected in any Aedes mosquito pools, however genomes of 14 viruses were detected using next generation sequencing. Land cover type affects the abundance and distribution of the most
A new species of Rock Gecko genus Cnemaspis (Squamata: Gekkonidae) from Western Sarawak, Malaysia.
Kurita, Takaki; Nishikawa, Kanto; Matsui, Masafumi; Hikida, Tsutomu
2017-05-03
A new species of Asian rock gecko, genus Cnemaspis, is described from Padawan, western Sarawak, Malaysian Borneo. The new species forms a clade with C. paripari and C. nigridia of the C. nigridia group in a mitochondrial DNA phylogeny and is similar to them morphologically in some characters such as caudal scalation. It differs from the other Asian Cnemaspis species in its unique combination of snout-vent length (up to 62.7 mm), 4-9 precloacal pores in males, keeled subcaudals with an enlarged, smooth, median row, presence of ventrolateral caudal tubercles, and coloration (head and upper flanks dark-yellow; anterior portion of tail black; posterior portion of tail white with black, paravertebral blob). Phylogenetic relationships within the C. nigridia group and the distributional ranges of species within the group suggest allopatric speciation by geographic isolation.
Chang, Yuet Meng; Swaran, Yuvaneswari; Phoon, Yoong Keat; Sothirasan, Kavin; Sim, Hang Thiew; Lim, Kong Boon; Kuehn, Daniel
2009-06-01
17 Y-STRs (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) have been analyzed in 320 male individuals from Sarawak, an eastern state of Malaysia on the Borneo island using the AmpFlSTR Y-filer (Applied Biosystems, Foster City, CA). These individuals were from three indigenous ethnic groups in Sarawak comprising of 103 Ibans, 113 Bidayuhs and 104 Melanaus. The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three groups. Analysis of molecular variance (AMOVA) indicated that 87.6% of the haplotypic variation was found within population and 12.4% between populations (fixation index F(ST)=0.124, p=0.000). This study has revealed that the indigenous populations in Sarawak are distinctly different to each other, and to the three major ethnic groups in Malaysia (Malays, Chinese and Indians), with the Melanaus having a strikingly high degree of shared haplotypes within. There are rare unusual variants and microvariants that were not present in Malaysian Malay, Chinese or Indian groups. In addition, occurrences of DYS385 duplications which were only noticeably present in Chinese group previously was also observed in the Iban group whilst null alleles were detected at several Y-loci (namely DYS19, DYS392, DYS389II and DYS448) in the Iban and Melanau groups.
Energy and Nutrient Intakes: Findings from the Malaysian Adult Nutrition Survey (MANS).
Mirnalini, K; Zalilah, M S; Safiah, M Y; Tahir, A; Siti Haslinda, M D; Siti Rohana, D; Khairul Zarina, M Y; Mohd Hasyami, S; Normah, H
2008-03-01
Nutrition surveys based on a representative sample of the Malaysian adult population have hitherto not been reported. In 2003, the Ministry of Health, Malaysia, conducted the Malaysian Adult Nutrition Survey (MANS), the first and largest nutrition survey in the country which aimed to provide detailed quantitative information on nutritional status, food and nutrient intakes, and physical activity pattern on a nationwide representative sample of adult subjects between the ages of 18 and 59 years. The survey covered four zones in Peninsular Malaysia (Central, Southern, Northern and East Coast), Sabah and Sarawak. This paper presents the mean and selected percentiles of energy and nutrient intake of 6886 subjects by selected demographic and socioeconomic characteristics. Energy contributions by macronutrients and dietary adequacy in relation to the Recommended Nutrient Intake for Malaysians are also described. Information on dietary intake was collected by trained nutritionists using a one day 24-hour diet recall. Dietary data were analysed using Nutritionist Pro, a diet analysis software and statistical analysis was carried out using the SPSS ver. 13.0. In most of the demographic and socioeconomic groups, males had higher mean energy (1776 kcal) and nutrient intake and percent achievement of RNI than females (1447 kcal). The proportions of calories derived from macronutrients were within the recommendations for a healthy diet. Intake of micronutrients such as iron, calcium and vitamin A was about 50% of RNI particularly in women. Sodium intake of Malaysians, not reported in earlier studies, is also made available. Under-reporting using the EI/BMR ratio was found in half of the population studied. The present study provides the first national estimates of energy and nutrient intake of the Malaysian adult population. Regular nutrition surveys are needed at the national level to provide valuable information on trends in food and nutrient intake, particularly among age
Dehling, J Maximilian; Matsui, Masafumi
2013-01-01
We describe a new species of Leptolalax from Gunung Mulu National Park in eastern Sarawak, Malaysian Borneo. The new species had been assigned to Leptolalax dringi and Leptolalax gracilis in the past. It is shown to differ from both these species and from all other species of the genus by a unique combination of morphological characters including large body size, rounded snout, interorbital distance being smaller than width of upper eyelid, bipartite subgular vocal sac in males, basal toe webbing, shagreened skin with tiny tubercles on dorsum and dorsal side of head, angled supratympanic fold, small pectoral glands, absence of supraaxillary glands and ventrolateral glandular ridges, spotted venter, advertisement call consisting of long series of 8-289 notes, each composed of three or four pulses, and dominant frequency at 7225-9190 Hz, with prominent frequency modulation.
Kho, Boon Phiaw; Hassali, Mohamed Azmi; Lim, Ching Jou; Saleem, Fahad
2018-03-15
The aims of this research were to determine extra-organisational challenges (e.g. market competition, governing policies) faced by community pharmacies in Sarawak, the coping strategies employed to deal with these challenges and explore potential legislative changes that can attenuate the intensity of these challenges. Survey questionnaires (n = 184) were posted to all eligible community pharmacies in Sarawak, Malaysia. The questionnaire included sections on participants' demographic data, extra-organisational challenges faced, coping strategies employed and proposals to improve community pharmacy legislations. Items were constructed based on the findings of a prior qualitative research supplemented with relevant literature about these issues. High levels of homogeneity in responses were recorded on various extra-organisational challenges faced, particularly those economy-oriented. Strategic changes to counter these challenges were focused on pricing and product stocked, rather than services provision. Highly rated strategies included increasing discounts for customers (n = 54; 68%) and finding cheaper suppliers (n = 70; 88%). Legislative changes proposed that might increase their share of the pharmaceutical market were strongly supported by respondents, particularly about making it compulsory for general practitioners to provide patients the option to have their medicines dispensed in community pharmacies (n = 72; 90%). Current legislative conditions and Malaysian consumer mindset may have constrained the strategic choices of community pharmacies to deal with the strong extra-organisational challenges. A long-term multipronged approach to address these issues and increased involvement of community pharmacists themselves in this agenda are required to influence practice change. © 2018 Royal Pharmaceutical Society.
The structure and stratigraphy of deepwater Sarawak, Malaysia: Implications for tectonic evolution
NASA Astrophysics Data System (ADS)
Madon, Mazlan; Kim, Cheng Ly; Wong, Robert
2013-10-01
The structural-stratigraphic history of the North Luconia Province, Sarawak deepwater area, is related to the tectonic history of the South China Sea. The Sarawak Basin initiated as a foreland basin as a result of the collision of the Luconia continental block with Sarawak (Sarawak Orogeny). The foreland basin was later overridden by and buried under the prograding Oligocene-Recent shelf-slope system. The basin had evolved through a deep foreland basin ('flysch') phase during late Eocene-Oligocene times, followed by post-Oligocene ('molasse') phase of shallow marine shelf progradation to present day. Seismic interpretation reveals a regional Early Miocene Unconformity (EMU) separating pre-Oligocene to Miocene rifted basement from overlying undeformed Upper Miocene-Pliocene bathyal sediments. Seismic, well data and subsidence analysis indicate that the EMU was caused by relative uplift and predominantly submarine erosion between ˜19 and 17 Ma ago. The subsidence history suggests a rift-like subsidence pattern, probably with a foreland basin overprint during the last 10 Ma. Modelling results indicate that the EMU represents a major hiatus in the sedimentation history, with an estimated 500-2600 m of missing section, equivalent to a time gap of 8-10 Ma. The EMU is known to extend over the entire NW Borneo margin and is probably related to the Sabah Orogeny which marks the cessation of sea-floor spreading in the South China Sea and collision of Dangerous Grounds block with Sabah. Gravity modelling indicates a thinned continental crust underneath the Sarawak shelf and slope and supports the seismic and well data interpretation. There is a probable presence of an overthrust wedge beneath the Sarawak shelf, which could be interpreted as a sliver of the Rajang Group accretionary prism. Alternatively, magmatic underplating beneath the Sarawak shelf could equally explain the free-air gravity anomaly. The Sarawak basin was part of a remnant ocean basin that was closed by
Clinical presentation of nasopharyngeal carcinoma in Sarawak Malaysia.
Tiong, T S; Selva, K S
2005-12-01
Nasopharyngeal carcinoma (NPC) is a common cancer in Malaysia. The clinical presentation in Sarawak has not been well documented. A retrospective review of 213 selected NPC cases was undertaken on the clinical records in Sarawak General Hospital, Sarawak, from June 1999 to June 2003. There were 116 patients in Kuching and 97 in Serian. There were twice as many males as females. The youngest patient was 16 and the oldest 88 years old with a mean age of 51 years. The four most common symptoms in order of frequencies were cervical lymphadenopathy, epistaxis, hearing loss and diplopia. 80.8% of the patients presented with cervical lymphadenopathy and about 85% of the patients presented in the advanced stages. Very small percentages of the patients were found to have single presenting symptoms of epistaxis (2.4%) and hearing loss (0.5%).
McLean, Duncan; John, Sujit; Barrett, Robert; McGrath, John; Loa, Peter; Thara, Rangaswamy; Mowry, Bryan
2012-04-30
We contrasted demographic and clinical characteristics in transethnic schizophrenia populations from Australia (n=821), India (n=520) and Sarawak, Malaysia (n=298) and proposed cultural explanations for identified site differences. From these we aimed to identify candidate variables free from significant cultural confounding that are hence suitable for inclusion in genetic analyses. We observed five phenomena: (1) more individuals were living alone in Australia than India or Sarawak; (2) drug use was lower in India than Australia or Sarawak; (3) duration of untreated psychosis (DUP) was longer in India than Australia or Sarawak; (4) the rate of schizoaffective disorder was lower in India than Australia or Sarawak; and (5) age at psychosis onset (AAO) was older in Sarawak than Australia or India. We suggest that site differences for living arrangements, drug use and DUP are culturally confounded. The schizoaffective site difference likely results from measurement bias. The AAO site difference, however, has no obvious cultural or measurement bias explanation. Therefore, this may be an ideal candidate for use in genetic studies, given that genetic variants affecting AAO have already been proposed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
The Unified Levelling Network of Sarawak and its Adjustment
NASA Astrophysics Data System (ADS)
Som, Z. A. M.; Yazid, A. M.; Ming, T. K.; Yazid, N. M.
2016-09-01
The height reference network of Sarawak has seen major improvement in over the past two decades. The most significant improvement was the establishment of extended precise leveling network of which is now able to connect all three major datum points at Pulau Lakei, Original and Bintulu. Datum by following the major accessible routes across Sarawak. This means the leveling network in Sarawak has now been inter-connected and unified. By having such a unified network leads to the possibility of having a common single least squares adjustment been performed for the first time. The least squares adjustment of this unified levelling network was attempted in order to compute the height of all Bench Marks established in the entire levelling network. The adjustment was done by using MoreFix levelling adjustment package developed at FGHT UTM. The computational procedure adopted is linear parametric adjustment by minimum constraint. Since Sarawak has three separate datums therefore three separate adjustments were implemented by utilizing datum at Pulau Lakei, Original Miri and Bintulu Datum respectively. Results of the MoreFix unified adjustment agreed very well with adjustment repeated using Starnet. Further the results were compared with solution given by Jupem and they are in good agreement as well. The difference in height analysed were within 10mm for the case of minimum constraint at Pulau Lakei datum and with much better agreement in the case of Original Miri Datum.
English Teaching Profile: Sarawak--Malaysia.
ERIC Educational Resources Information Center
British Council, London (England). English Language and Literature Div.
This review of the status of English language instruction in Sarawak, Malaysia, provides an overview of the role of English in the society in general and outlines the status of English use and instruction in the educational system at all levels (preprimary, elementary, secondary, higher, vocational, adult, and teacher education). Topics covered…
NASA Astrophysics Data System (ADS)
Salleh, Khalijah Mohd; Abdullah, Abu Bakar Bin
2008-05-01
An explorative study was carried out to confirm Malaysian Physics teachers' perception that Archimedes' principle is a difficult topic for secondary level students. The interview method was used for data collection. The study sample was made of nine national secondary schools teachers from Miri, Sarawak. The data was analysed qualitatively using the Atlas-ti version 5.2 software. The findings of the study showed that i) Archimedes' principle as compared to Bernoulli's and Pascal's is the most difficult principle of hydrodynamics for students, ii) more time was given in the teaching and learning (TL) of Archimedes principle compared to the other two principles, iii) the major TL problems include conceptual understanding, application of physics principles and ideas, and lack of mathematical skills. These findings implicate the need to develop corresponding instructional materials and learning kits that can assist students' understanding of Archimedes' principle.
Occupational health in sawmills of Sarawak.
Tan, C C; Cheu, K T; Hardin, S
1991-09-01
A self-administered questionnaire survey was conducted among sawmill managers in Sarawak to explore certain health and safety aspects of workers in this industry. The survey reveals that many sawmills are lacking in the provision of occupational health facilities and activities for their employees.
Report of Sarawak Council for Further Education.
ERIC Educational Resources Information Center
Sarawak Council for Further Education, Kuching (Malaysia).
The 1972 report of the Sarawak Council for Further Education and the minutes of its 31 March 1973 meetings are provided. Information regarding committee memberships, staff, education centers, yearly examinations, and finances is provided. (KM)
NASA Astrophysics Data System (ADS)
Ahmadi, Eltefat; Hamid, Sheikh Abdul Rezan Sheikh Abdul; Hussin, Hashim; Baharun, Norlia; Ariffin, Kamar Shah; Ramakrishnan, Sivakumar; Fauzi, M. N. Ahmad; Ismail, Hanafi
2017-07-01
In this paper, the carbothermal reduction and nitridation (CTRN) of Malaysian ilmenite has been studied as a part of crucial steps involved in reduction and subsequent chlorination processes for synthesizing titanium tetrachloride (TiCl4) from nitrided Malaysian ilmenite concentrates. In CTRN, waste plastics such as polyethylene terephthalate (PET) could be utilized as an alternative source of carbon reductant. In this study, titanium oxycarbonitride (TiOxCyNz) separated from iron (Fe) phase was synthesized by non-isothermal CTRN of Malaysian ilmenite under H2-N2 atmosphere by utilizing a mixture of Sarawak Mukah-Balingan coal and PET as reducing agents in a horizontal tube furnace. Experiments have been carried out in the temperature range of 1150-1250°C for 3 hours with various ratios of PET to coal (25 wt.% PET, 50 wt.% PET, and 75 wt.% PET). X-ray diffraction (XRD), X-ray fluorescence (XRF), scanning electron microscopy (SEM) and energy dispersive X-ray (EDX) methods of analysis were conducted to assess the microstructures and chemical compositions of the unreduced and reduced samples. The results indicated that utilizing PET had a significant effect on iron separation from titanium oxycarbonitride (TiO0.02C0.13N0.85) at 1250°C with a mixture of 75 wt.% PET. Furthermore, XRD and SEM studies demonstrated that with increasing PET weight ratio in the mixtures, the rate of conversion increased and a low-carbon TiOxCyNz with minimal intermediate titanium sub-oxides was synthesized. The method of applying PET as potential reductant for CTRN of ilmenite has beneficial side effects in sustainable recycling of waste PET.
Sahimi, Hani Nabilia Muhd; Chubo, John Keen; Top Mohd Tah, Marina Mohd; Saripuddin, Noor Bahiah; Ab Rahim, Siti Sarah
2018-03-01
Tarsius bancanus borneanus was first reported by Elliot in 1990 which an endemic species that can be found on the Island of Borneo consisting of Sabah and Sarawak of Malaysia, Brunei Darussalam and Kalimantan, Indonesia. This sub-species has been listed as a totally protected animal under the Sarawak Wild Life Protection Ordinance (1998) and vulnerable by the International Union for Conservation of Nature (IUCN). The present study was conducted at Universiti Putra Malaysia Bintulu Campus (UPMKB), Sarawak from October 2014 till March 2015. Through mark and recapture sampling covering an area of 37 ha of secondary forest patches and 7.13 ha of rehabilitated forest, a total of 16 tarsiers were captured using mist nets while one tarsier was recapture. The population density was 38 individuals/km 2 was captured using mist nets in the secondary forest while 28 individuals/km 2 was recorded for the rehabilitated forest. Using the catch per unit effort (net hour) method, the average time for capturing tarsiers in the secondary forest patches was 26.6 net hour per animal and 30.0 net hour per animal in the rehabilitated forest. The presented results provides information on the presence of tarsiers in both the secondary and rehabilitated forests of UPMKB, Sarawak, Malaysia which underlines the conservation value of these forested areas.
The impact of A. R. Wallace's Sarawak Law paper reassessed.
van Wyhe, John
2016-12-01
This article examines six main elements in the modern story of the impact of Alfred Russel Wallace's 1855 Sarawak Law paper, particularly in the many accounts of Charles Darwin's life and work. These elements are: Each of these are very frequently repeated as straightforward facts in the popular and scholarly literature. It is here argued that each of these is erroneous and that the role of the Sarawak Law paper in the historiography of Darwin and Wallace needs to be revised. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.
Sahimi, Hani Nabilia Muhd; Chubo, John Keen; Top @ Mohd. Tah, Marina Mohd.; Saripuddin, Noor Bahiah; Ab Rahim, Siti Sarah
2018-01-01
Tarsius bancanus borneanus was first reported by Elliot in 1990 which an endemic species that can be found on the Island of Borneo consisting of Sabah and Sarawak of Malaysia, Brunei Darussalam and Kalimantan, Indonesia. This sub-species has been listed as a totally protected animal under the Sarawak Wild Life Protection Ordinance (1998) and vulnerable by the International Union for Conservation of Nature (IUCN). The present study was conducted at Universiti Putra Malaysia Bintulu Campus (UPMKB), Sarawak from October 2014 till March 2015. Through mark and recapture sampling covering an area of 37 ha of secondary forest patches and 7.13 ha of rehabilitated forest, a total of 16 tarsiers were captured using mist nets while one tarsier was recapture. The population density was 38 individuals/km2 was captured using mist nets in the secondary forest while 28 individuals/km2 was recorded for the rehabilitated forest. Using the catch per unit effort (net hour) method, the average time for capturing tarsiers in the secondary forest patches was 26.6 net hour per animal and 30.0 net hour per animal in the rehabilitated forest. The presented results provides information on the presence of tarsiers in both the secondary and rehabilitated forests of UPMKB, Sarawak, Malaysia which underlines the conservation value of these forested areas. PMID:29644021
Mohan, Anand; Podin, Yuwana; Tai, Nickson; Chieng, Chae-Hee; Rigas, Vanessa; Machunter, Barbara; Mayo, Mark; Wong, Desiree; Chien, Su-Lin; Tan, Lee-See; Goh, Charles; Bantin, Reginal; Mijen, Alexander; Chua, Wen-Yi; Hii, King-Ching; Wong, See-Chang; Ngian, Hie-Ung; Wong, Jin-Shyan; Hashim, Jamilah; Currie, Bart J; Ooi, Mong-How
2017-06-01
Melioidosis is a serious, and potentially fatal community-acquired infection endemic to northern Australia and Southeast Asia, including Sarawak, Malaysia. The disease, caused by the usually intrinsically aminoglycoside-resistant Burkholderia pseudomallei, most commonly affects adults with predisposing risk factors. There are limited data on pediatric melioidosis in Sarawak. A part prospective, part retrospective study of children aged <15 years with culture-confirmed melioidosis was conducted in the 3 major public hospitals in Central Sarawak between 2009 and 2014. We examined epidemiological, clinical and microbiological characteristics. Forty-two patients were recruited during the 6-year study period. The overall annual incidence was estimated to be 4.1 per 100,000 children <15 years, with marked variation between districts. No children had pre-existing medical conditions. Twenty-three (55%) had disseminated disease, 10 (43%) of whom died. The commonest site of infection was the lungs, which occurred in 21 (50%) children. Other important sites of infection included lymph nodes, spleen, joints and lacrimal glands. Seven (17%) children had bacteremia with no overt focus of infection. Delays in diagnosis and in melioidosis-appropriate antibiotic treatment were observed in nearly 90% of children. Of the clinical isolates tested, 35/36 (97%) were susceptible to gentamicin. Of these, all 11 isolates that were genotyped were of a single multi-locus sequence type, ST881, and possessed the putative B. pseudomallei virulence determinants bimABp, fhaB3, and the YLF gene cluster. Central Sarawak has a very high incidence of pediatric melioidosis, caused predominantly by gentamicin-susceptible B. pseudomallei strains. Children frequently presented with disseminated disease and had an alarmingly high death rate, despite the absence of any apparent predisposing risk factor.
NASA Astrophysics Data System (ADS)
Schmidtke, Eric A.; Fuller, Michael D.; Haston, Roger B.
1990-02-01
Paleomagnetic data from 231 samples from 31 sites in rocks of Upper Jurassic to Miocene age in Sarawak (Malaysian Borneo) reveal a trend of increasing counterclockwise (CCW) declination deflection with age. Six sites in Tertiary hypabyssal intrusions show 8° to 52° of CCW deflection. The intrusion deflected 52° CCW was K-Ar dated at 26 m.y. (Upper Oligocene), while one deflected 22° CCW gives a 17 m. y. age (Lower Miocene). Three sites in the Upper Eocene to Miocene(?) Silantek Formation show an average 40° of CCW deflection. Prefolding directions, showing 90° of CCW deflection, are isolated in 4 sites (including two positive fold tests) in Upper Jurassic and Cretaceous rocks of the Bau Limestone and Pedawan Formations. A postfolding, Cenozoic remagnetization with an average of 60° of CCW deflection is found in five Bau Limestone sites. Three sites in the Upper Jurassic Kedadom Formation show an average of 50° of CCW deflection. CCW declination deflections found in Mesozoic and Cenozoic rocks as far as 400 km east and 150 km south of Sarawak, in Kalimantan (Indonesian Borneo), also fit the trend of deflection versus age. On the basis of the regional consistency of declination deflection versus age, along with geologic evidence the data are considered to be evidence of a regional (rather than a local block or distributed shear) rotation. The domain of CCW rotation extends into West Malaysia, suggesting that West Borneo and the Malay Peninsula may have been a stable block during the latest Cretaceous and Cenozoic. West Malaysia and Borneo may have had different histories in the rest of the Mesozoic. The data imply up to 108° CCW rotation of Borneo with respect to stable Eurasia, sometime during the Cretaceous and Cenozoic. Cenozoic rotation may also have occurred between Indochina and Borneo. The sense of rotation shown by the data does not support the "propagating extrusion tectonics" model for Cenozoic Southeast Asia.
Acceleration of Sea Level Rise Over Malaysian Seas from Satellite Altimeter
NASA Astrophysics Data System (ADS)
Hamid, A. I. A.; Din, A. H. M.; Khalid, N. F.; Omar, K. M.
2016-09-01
Sea level rise becomes our concern nowadays as a result of variously contribution of climate change that cause by the anthropogenic effects. Global sea levels have been rising through the past century and are projected to rise at an accelerated rate throughout the 21st century. Due to this change, sea level is now constantly rising and eventually will threaten many low-lying and unprotected coastal areas in many ways. This paper is proposing a significant effort to quantify the sea level trend over Malaysian seas based on the combination of multi-mission satellite altimeters over a period of 23 years. Eight altimeter missions are used to derive the absolute sea level from Radar Altimeter Database System (RADS). Data verification is then carried out to verify the satellite derived sea level rise data with tidal data. Eight selected tide gauge stations from Peninsular Malaysia, Sabah and Sarawak are chosen for this data verification. The pattern and correlation of both measurements of sea level anomalies (SLA) are evaluated over the same period in each area in order to produce comparable results. Afterwards, the time series of the sea level trend is quantified using robust fit regression analysis. The findings clearly show that the absolute sea level trend is rising and varying over the Malaysian seas with the rate of sea level varies and gradually increase from east to west of Malaysia. Highly confident and correlation level of the 23 years measurement data with an astonishing root mean square difference permits the absolute sea level trend of the Malaysian seas has raised at the rate 3.14 ± 0.12 mm yr-1 to 4.81 ± 0.15 mm yr-1 for the chosen sub-areas, with an overall mean of 4.09 ± 0.12 mm yr-1. This study hopefully offers a beneficial sea level information to be applied in a wide range of related environmental and climatology issue such as flood and global warming.
Podin, Yuwana; Tai, Nickson; Chieng, Chae-Hee; Rigas, Vanessa; Machunter, Barbara; Mayo, Mark; Wong, Desiree; Chien, Su-Lin; Tan, Lee-See; Goh, Charles; Bantin, Reginal; Mijen, Alexander; Chua, Wen-Yi; Hii, King-Ching; Wong, See-Chang; Ngian, Hie-Ung; Wong, Jin-Shyan; Hashim, Jamilah; Currie, Bart J.; Ooi, Mong-How
2017-01-01
Background Melioidosis is a serious, and potentially fatal community-acquired infection endemic to northern Australia and Southeast Asia, including Sarawak, Malaysia. The disease, caused by the usually intrinsically aminoglycoside-resistant Burkholderia pseudomallei, most commonly affects adults with predisposing risk factors. There are limited data on pediatric melioidosis in Sarawak. Methods A part prospective, part retrospective study of children aged <15 years with culture-confirmed melioidosis was conducted in the 3 major public hospitals in Central Sarawak between 2009 and 2014. We examined epidemiological, clinical and microbiological characteristics. Findings Forty-two patients were recruited during the 6-year study period. The overall annual incidence was estimated to be 4.1 per 100,000 children <15 years, with marked variation between districts. No children had pre-existing medical conditions. Twenty-three (55%) had disseminated disease, 10 (43%) of whom died. The commonest site of infection was the lungs, which occurred in 21 (50%) children. Other important sites of infection included lymph nodes, spleen, joints and lacrimal glands. Seven (17%) children had bacteremia with no overt focus of infection. Delays in diagnosis and in melioidosis-appropriate antibiotic treatment were observed in nearly 90% of children. Of the clinical isolates tested, 35/36 (97%) were susceptible to gentamicin. Of these, all 11 isolates that were genotyped were of a single multi-locus sequence type, ST881, and possessed the putative B. pseudomallei virulence determinants bimABp, fhaB3, and the YLF gene cluster. Conclusions Central Sarawak has a very high incidence of pediatric melioidosis, caused predominantly by gentamicin-susceptible B. pseudomallei strains. Children frequently presented with disseminated disease and had an alarmingly high death rate, despite the absence of any apparent predisposing risk factor. PMID:28599008
Hamzah, Azimi; Krauss, Steven E; Shaffril, Hayrol A M; Suandi, Turiman; Ismail, Ismi A; Abu Samah, Bahaman
2014-10-01
The vast majority of Malaysia's fishermen are located in rural areas, specifically in the Western and Eastern coastal regions of Peninsular Malaysia and the Sabah and Sarawak central zones. In these areas, the fishing industry is relied upon as a major economic contributor to the region's residents. Despite the widespread application of various modern technologies into the fishing industry (i.e., GPS, sonar, echo sounder, remote sensing), and the Malaysian government's efforts to encourage their adoption, many small-scale fishermen in the country's rural areas continue to rely on traditional fishing methods. This refusal to embrace new technologies has resulted in significant losses in fish yields and needed income, and has raised many questions regarding the inputs to decision making of the fishermen. Drawing on multiple literatures, in this article we argue for the use of a mental model approach to gain an in-depth understanding of rural Malaysian fishermen's choices of technology adoption according to four main constructs--prior experience, knowledge, expertise and beliefs or values. To provide needed inputs to agricultural specialists and related policy makers for the development of relevant plans of action, this article aims to provide a way forward for others to understand dispositional barriers to technology adoption among fishermen who use traditional methods in non-Western contexts. © 2013 International Union of Psychological Science.
Chang, C T
2007-01-01
There is an increase in the prevalence of overweight and obesity in Malaysia. Besides prevalence studies, not much is known about either overweight or obese individuals. The objective of this study was to determine the stages of change in losing weight and the self-efficacy in eating control of three indigenous groups of overweight and obese adults in Sarawak, Malaysia. A cross-sectional study was conducted in one rural region in Sarawak using a purposive sample. A structured questionnaire, which included two scales: (1) Weight: Stages of change (SOC) to assess readiness to change; and (2) Weight Efficacy Lifestyle Questionnaire (WEL) (both adopted from the transtheoretical model of change); and a set of pre-tested questionnaires on socio-demographic data, the presence of health problems and self-assessment of weight appropriateness, was used to interview respondents. The stage distribution for weight loss of these adults respondents (n = 271) showed that 60.5% (n = 164) were in the pre-contemplation stage, 20.7% (n = 56) were in the contemplation stage, 8.5% (n = 23) were in the preparation stage, and 8.9% (n = 24) were in the action stage, while only 1.5% (n = 4) were in the maintenance stage. Except for education, the stage differences were generally stable across age, sex, race, household income, presence or absence of health problem, self-perceived weight and presence of overweight or obesity. Respondents were least able to control their eating under social pressure and food availability, according to their WEL score. A large proportion of the overweight or obese adults was not intending to lose weight. The factor structure of the two WEL original subscales enabled partial differentiation between respondents who were able or unable to resist eating in situations where there were availability of food and experienced physical discomfort. The study results indicate the importance of assessing individuals' SOC score in order to implement stage-matched intervention
Dow, Rory A; Hämäläinen, Matti; Stokvis, Frank R
2015-10-23
Species of Devadatta from Borneo are studied using both morphological and molecular methods. As well as D. podolestoides Laidlaw, four new species are recognised from the island: D. aran spec. nov. (holotype ♂, from Pulong Tau National Park, Miri division, Sarawak, Malaysia, deposited in RMNH), D. clavicauda spec. nov. (holotype ♂, from Bukit Mina, Bukit Mina Wildlife Corridor, Sarawak Planted Forest Project, Bintulu division, Sarawak, Malaysia, deposited in RMNH), D. somoh spec. nov. (holotype ♂, from the Sungai Kahei area, Ulu Balui, Kapit division, Sarawak, Malaysia, deposited in RMNH) and D. tanduk spec. nov. (holotype ♂, from Poring Hot Springs, Kinabalu National Park, West Coast division, Sabah, Malaysia, deposited in RMNH). The Philippine taxon D. basilanensis Laidlaw is considered a good species rather than a subspecies of D. podolestoides. The Bornean species plus D. basilanensis are provisionally considered to form a species group, the podolestoides-group, within Devadatta. The species of the podolestoides-group are so similar in morphology and colouration that they are close to truly cryptic species. Two species appear to exhibit character displacement where their ranges overlap with other Devadatta species. A molecular analysis using four markers (COI, 16S, ITS and 28S) is presented. This analysis includes specimens of all species from the podolestoides-group and two Devadatta species from mainland Asia.
Lee, Suet Yee; Morni, Wan Zabidii Wan
2017-01-01
Sea star (class Asteroidea, phylum Echinodermata) is one of the most successful marine organisms inhabiting a wide range of habitats. As one of the key stone species, sea stars are responsible for maintaining much of the local diversity of species within certain communities. Malaysian Exclusive Economic Zone (EEZ) Resource Survey had been carried out from 16th Aug to 6th Nov 2015 and one of the invertebrate by-catch organisms is sea star Stellaster childreni Gray, 1840. This study documents morphological characters and diet of the sea star, besides providing brief descriptions of the habitats based on particle size analysis and vessel log data sheet. A total of 217 individuals had been examined throughout this study. Fragments of flora and fauna were found in the gut including Mollusca (gastropod, bivalves, and scaphopods), sponge seagrass, and seaweed as well as benthic Foraminifera. Stellaster childreni were found at depth of 45 m to 185 m in the South China Sea off Sarawak Malaysia, with various sea bottom substrata. Approximately 41% of S. childreni were found at a mixture of sandy and muddy substratum, followed by mixture of sandy and coral (19.3%), muddy substratum (17.5%), coral substratum (11.5%), and sandy areas (10.6%). The widely distributed sea star on different types of sea beds suggested healthy deep sea ecosystem; thus Malaysia should explore further potential fisheries resources in the EEZ off Sarawak coast. PMID:28695188
Hassan, Ruhana; Lee, Suet Yee; Morni, Wan Zabidii Wan
2017-01-01
Sea star (class Asteroidea, phylum Echinodermata) is one of the most successful marine organisms inhabiting a wide range of habitats. As one of the key stone species, sea stars are responsible for maintaining much of the local diversity of species within certain communities. Malaysian Exclusive Economic Zone (EEZ) Resource Survey had been carried out from 16th Aug to 6th Nov 2015 and one of the invertebrate by-catch organisms is sea star Stellaster childreni Gray, 1840. This study documents morphological characters and diet of the sea star, besides providing brief descriptions of the habitats based on particle size analysis and vessel log data sheet. A total of 217 individuals had been examined throughout this study. Fragments of flora and fauna were found in the gut including Mollusca (gastropod, bivalves, and scaphopods), sponge seagrass, and seaweed as well as benthic Foraminifera. Stellaster childreni were found at depth of 45 m to 185 m in the South China Sea off Sarawak Malaysia, with various sea bottom substrata. Approximately 41% of S. childreni were found at a mixture of sandy and muddy substratum, followed by mixture of sandy and coral (19.3%), muddy substratum (17.5%), coral substratum (11.5%), and sandy areas (10.6%). The widely distributed sea star on different types of sea beds suggested healthy deep sea ecosystem; thus Malaysia should explore further potential fisheries resources in the EEZ off Sarawak coast.
JPRS Report, Environmental Issues
1991-09-13
icy continent. The Malaysian representative, Mr. Hussein Haniff, has further stressed that the environmental issues related to Antarctica should be...prime minister said that the problem of the Penans, a tribe found in the East Malaysian state of Sarawak, was only a new approach devised by them to...to it that the Penans enjoy the same benefits as other Malaysians . Dr. Mahathir said that Malaysia could do nothing against the groups which had
Reading Strategies among ESL Malaysian Secondary School Students
ERIC Educational Resources Information Center
Semtin, Semry Anak; Maniam, Mahendran
2015-01-01
This study aimed to investigate the types of cognitive and metacognitive reading strategies employed by secondary school students in Malaysia to improve their comprehension. The study employed a mixed-method approach which involves the instruments of a questionnaire and an interview. This study was conducted at SMK Kapit, involving ninety Form 4…
Eddy Covariance Measurements of Methane Flux at a Tropical Peat Forest in Sarawak, Malaysian Borneo
NASA Astrophysics Data System (ADS)
Tang, Angela C. I.; Stoy, Paul C.; Hirata, Ryuichi; Musin, Kevin K.; Aeries, Edward B.; Wenceslaus, Joseph; Melling, Lulie
2018-05-01
Tropical biogenic sources are a likely cause of the recent increase in global atmospheric methane concentration. To improve our understanding of tropical methane sources, we used the eddy covariance technique to measure CH4 flux (FCH4) between a tropical peat forest ecosystem and the atmosphere in Malaysian Borneo over a 2-month period during the wet season. Mean daily FCH4 during the measurement period, on the order of 0.024 g C-CH4·m-2·day-1, was similar to eddy covariance FCH4 measurements from tropical rice agroecosystems and boreal fen ecosystems. A linear modeling analysis demonstrated that air temperature (Tair) was critical for modeling FCH4 before the water table breached the surface and that water table alone explained some 20% of observed FCH4 variability once standing water emerged. Future research should measure FCH4 on an annual basis from multiple tropical ecosystems to better constrain tropical biogenic methane sources.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1995-01-06
The study, conducted by Sargent & Lundy, was funded by the U.S. Trade and Development Agency on behalf of the Sarawak Electricity Supply Corporation. The purpose of the project is to determine the feasibility of an interconnection of the electric power systems of Sarawak and West Kalimantan as is being done elsewhere in the region. The report presents technical and economic evaluations and assesses the realibility of the system after the interconnection. The study is divided into three volumes. This is Volume 3 and it contains the Appendices.
Cardiff acne disability index in Sarawak, Malaysia.
Yap, Felix Boon-Bin
2012-05-01
Acne is considered a cosmetic nuisance in Malaysia since no insurance coverage is provided for its treatment. Its psychological impact is unknown. The aim of this study is to determine the impact of acne on quality of life and its relationship with severity. A cross-sectional study using the Cardiff acne disability index (CADI) and Global Acne Grading System for acne severity grading was done in three government-run dermatology clinics in Sarawak, Malaysia. The study cohort of 200 patients had a mean CADI score of 5.1. Most of the patients (59.5%) had mild CADI impairment, with the domain of feelings most affected. Patients with a family income <1,000 United States Dollor/month had a higher mean CADI (mean 5.5 vs. 4.4; p=0.04). Females, indigenous groups, and patients with tertiary education tended to have more severe CADI impairment (p>0.05). The correlation between CADI and mild acne severity was low (Pearson correlation coefficient=0.35; p<0.001) but became insignificant for moderate and severe acne. Acne impairment in Sarawak was moderate and must be addressed. It should be viewed as a psychologically disabling disease requiring optimal management and resource allocation.
Thayaparan, S; Robertson, I D; Fairuz, A; Suut, L; Gunasekera, U C; Abdullah, M T
2015-10-01
Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Malaysia. the purpose of this particular study was to determine the common leptospiral serovars present in human communities living around wildlife reserves/disturbed forest habitats. the objective of this study was to estimate the seroprevalence of leptospirosis and finding infecting serovars in villages surrounded habitats where wildlife lives in Sarawak, Malaysia. A cross-sectional serological survey of 198 humans was conducted in four villages around Kuching, Sarawak between January 2011 and March 2012. A seroprevalence of 35.9% (95%cI 29.2-43.0) to the MAt was detected in the tested humans. Antibodies to serovar Lepto 175 Sarawak were most commonly detected (31.3%; 95%cI 24.9-38.3) and were detected in individuals at all four locations. the presence of skin wounds (Or 3.1), farm animals (Or 2.5) and rats (Or 11.2) were all significantly associated with seropositivity in a multivariable logistic regression model. the results of the current study are important as wildlife may act as reservoirs of leptospires for humans. Health authorities should expand disease control measures to minimise the spill-over from wildlife to humans visiting, living or working in the sampled locations. the pathogenic status of serovar Lepto 175 Sarawak also requires further investigation.
A study of palm biomass processing strategy in Sarawak
NASA Astrophysics Data System (ADS)
Lee, S. J. Y.; Ng, W. P. Q.; Law, K. H.
2017-06-01
In the past decades, palm industry is booming due to its profitable nature. An environmental concern regarding on the palm industry is the enormous amount of waste produced from palm industry. The waste produced or palm biomass is one significant renewable energy source and raw material for value-added products like fiber mats, activated carbon, dried fiber, bio-fertilizer and et cetera in Malaysia. There is a need to establish the palm biomass industry for the recovery of palm biomass for efficient utilization and waste reduction. The development of the industry is strongly depending on the two reasons, the availability and supply consistency of palm biomass as well as the availability of palm biomass processing facilities. In Malaysia, the development of palm biomass industry is lagging due to the lack of mature commercial technology and difficult logistic planning as a result of scattered locality of palm oil mill, where palm biomass is generated. Two main studies have been carried out in this research work: i) industrial study of the feasibility of decentralized and centralized palm biomass processing in Sarawak and ii) development of a systematic and optimized palm biomass processing planning for the development of palm biomass industry in Sarawak, Malaysia. Mathematical optimization technique is used in this work to model the above case scenario for biomass processing to achieve maximum economic potential and resource feasibility. An industrial study of palm biomass processing strategy in Sarawak has been carried out to evaluate the optimality of centralized processing and decentralize processing of the local biomass industry. An optimal biomass processing strategy is achieved.
River Plumes in Sunglint, Sarawak, Borneo
NASA Technical Reports Server (NTRS)
1991-01-01
The sunglint pattern along the coast of Sarawak (3.0N, 111.5E) delineates the boundry of fresh water river plumes as they flow into the South China Sea. The fresh water lens (boundry between fresh and sea water) overides the saline and more dense sea water and oils, both natural and man made, collect along the convergence zones and dampen wave action. As a result, the smoother sea surface appears bright in the sunglint pattern.
McLean, Duncan; Barrett, Robert; Loa, Peter; Thara, Rangaswamy; John, Sujit; McGrath, John; Gratten, Jake; Mowry, Bryan
2015-03-01
The symptom profile of schizophrenia can vary between ethnic groups. We explored selected symptom variables previously reported to be characteristic of schizophrenia in the Iban of Sarawak in transethnic populations from Australia, India, and Sarawak, Malaysia. We tested site differences to confirm previous research, and to explore implications of differences across populations for future investigations. We recruited schizophrenia samples in Australia (n = 609), India (n = 310) and Sarawak (n = 205) primarily for the purposes of genetic studies. We analyzed seven identified variables and their relationship to site using logistic regression, including: global delusions, bizarre delusions, thought broadcast/insertion/withdrawal delusions, global hallucinations, auditory hallucinations, disorganized behavior, and prodromal duration. We identified a distinct symptom profile in our Sarawak sample. Specifically, the Iban exhibit: low frequency of thought broadcast/insertion/withdrawal delusions, high frequency of auditory hallucinations and disorganized behavior, with a comparatively short prodrome when compared with Australian and Indian populations. Understanding between-site variation in symptom profile may complement future transethnic genetic studies, and provide important clues as to the nature of differing schizophrenia expression across ethnically distinct groups. A comprehensive approach to subtyping schizophrenia is warranted, utilizing comprehensively ascertained transethnic samples to inform both schizophrenia genetics and nosology. Copyright © 2013 Wiley Publishing Asia Pty Ltd.
Sense of Efficacy among Beginning Teachers in Sarawak
ERIC Educational Resources Information Center
Murshidi, Rahmah; Konting, Mohd Majid; Elias, Habibah; Fooi, Foo Say
2006-01-01
This study examined the level of teachers' sense of efficacy among beginning teachers in Sarawak, Malaysia. It also sought to investigate whether there is any difference in beginning teachers' sense of efficacy in relation to gender, race and types of teacher preparation program. The study was conducted by using the teacher sense of efficacy…
The Communicative Ability of Universiti Teknologi MARA Sarawak's Graduates
ERIC Educational Resources Information Center
Hassan, Sharifah Zakiah Wan; Hakim, Simon Faizal; Rahim, Mahdalela; Noyem, John Francis; Ibrahim, Sueb; Ahmad, Johnny; Jusoff, Kamaruzaman
2009-01-01
This study explores Universiti Teknologi MARA (UiTM) Sarawak graduating students' oral proficiency, focusing on grammatical accuracy. Oral proficiency in English has always been the benchmark of language proficiency, and in the context of UiTM's language teaching curriculum, efforts to enhance students' oral proficiency are implemented through…
Dehling, J Maximilian; Dehling, Matthias
2013-01-01
A new species of Philautus is described from western Sarawak. The new species was collected in lower montane forest in two national parks in Sarawak and recorded from another park. It differs from its congeners by a unique combination of morphological characters, including a long, acuminate snout, long legs, and comparatively extensive toe webbing. The advertisement call of the new species differs from all calls of other species that have been analyzed so far. Comparison of the mitochondrial 16S rRNA gene sequence corroborates its distinct specific status.
Cardiff Acne Disability Index in Sarawak, Malaysia
2012-01-01
Background Acne is considered a cosmetic nuisance in Malaysia since no insurance coverage is provided for its treatment. Its psychological impact is unknown. Objective The aim of this study is to determine the impact of acne on quality of life and its relationship with severity. Methods A cross-sectional study using the Cardiff acne disability index (CADI) and Global Acne Grading System for acne severity grading was done in three government-run dermatology clinics in Sarawak, Malaysia. Results The study cohort of 200 patients had a mean CADI score of 5.1. Most of the patients (59.5%) had mild CADI impairment, with the domain of feelings most affected. Patients with a family income <1,000 United States Dollor/month had a higher mean CADI (mean 5.5 vs. 4.4; p=0.04). Females, indigenous groups, and patients with tertiary education tended to have more severe CADI impairment (p>0.05). The correlation between CADI and mild acne severity was low (Pearson correlation coefficient=0.35; p<0.001) but became insignificant for moderate and severe acne. Conclusion Acne impairment in Sarawak was moderate and must be addressed. It should be viewed as a psychologically disabling disease requiring optimal management and resource allocation. PMID:22577265
Ahmed, Md Atique; Fong, Mun Yik; Lau, Yee Ling; Yusof, Ruhani
2016-04-26
The zoonotic malaria parasite Plasmodium knowlesi has become an emerging threat to South East Asian countries particular in Malaysia. A recent study from Sarawak (Malaysian Borneo) discovered two distinct normocyte binding protein xa (Pknbpxa) types of P. knowlesi. In the present study, the Pknbpxa of clinical isolates from Peninsular Malaysia and Sabah (Malaysian Borneo) were investigated for the presence of Pknbpxa types and natural selection force acting on the gene. Blood samples were collected from 47 clinical samples from Peninsular Malaysia (n = 35) and Sabah (Malaysian Borneo, n = 12) were used in the study. The Pknbpxa gene was successfully amplified and directly sequenced from 38 of the samples (n = 31, Peninsular Malaysia and n = 7, Sabah, Malaysian Borneo). The Pknbpxa sequences of P. knowlesi isolates from Sarawak (Malaysian Borneo) were retrieved from GenBank and included in the analysis. Polymorphism, genetic diversity and natural selection of Pknbpxa sequences were analysed using DNAsp v 5.10, MEGA5. Phylogentics of Pknbpxa sequences was analysed using MrBayes v3.2 and Splits Tree v4.13.1. The pairwise F ST indices were used to determine the genetic differentiation between the Pknbpxa types and was calculated using Arlequin 3.5.1.3. Analyses of the sequences revealed Pknbpxa dimorphism throughout Malaysia indicating co-existence of the two types (Type-1 and Type-2) of Pknbpxa. More importantly, a third type (Type 3) closely related to Type 2 Pknbpxa was also detected. This third type was found only in the isolates originating from Peninsular Malaysia. Negative natural selection was observed, suggesting functional constrains within the Pknbpxa types. This study revealed the existence of three Pknbpxa types in Malaysia. Types 1 and 2 were found not only in Malaysian Borneo (Sarawak and Sabah) but also in Peninsular Malaysia. A third type which was specific only to samples originating from Peninsular Malaysia was discovered. Further genetic
Temporal and spatial mapping of hand, foot and mouth disease in Sarawak, Malaysia.
Sham, Noraishah M; Krishnarajah, Isthrinayagy; Ibrahim, Noor Akma; Lye, Munn-Sann
2014-05-01
Hand, foot and mouth disease (HFMD) is endemic in Sarawak, Malaysia. In this study, a geographical information system (GIS) was used to investigate the relationship between the reported HFMD cases and the spatial patterns in 11 districts of Sarawak from 2006 to 2012. Within this 7-years period, the highest number of reported HFMD cases occurred in 2006, followed by 2012, 2008, 2009, 2007, 2010 and 2011, in descending order. However, while there was no significant distribution pattern or clustering in the first part of the study period (2006 to 2011) based on Moran's I statistic, spatial autocorrelation (P = 0.068) was observed in 2012.
Bilung, Lesley Maurice; Tahar, Ahmad Syatir; Yunos, Nur Emyliana; Apun, Kasing; Lim, Yvonne Ai-Lian; Nillian, Elexson; Hashim, Hashimatul Fatma
2017-01-01
Cryptosporidiosis and cyclosporiasis are caused by waterborne coccidian protozoan parasites of the genera Cryptosporidium and Cyclospora, respectively. This study was conducted to detect Cryptosporidium and Cyclospora oocysts from environmental water abstracted by drinking water treatment plants and recreational activities in Sarawak, Malaysia. Water samples (12 each) were collected from Sungai Sarawak Kanan in Bau and Sungai Sarawak Kiri in Batu Kitang, respectively. In addition, 6 water samples each were collected from Ranchan Recreational Park and UNIMAS Lake at Universiti Malaysia Sarawak, Kota Samarahan, respectively. Water physicochemical parameters were also recorded. All samples were concentrated by the iron sulfate flocculation method followed by the sucrose floatation technique. Cryptosporidium and Cyclospora were detected by modified Ziehl-Neelsen technique. Correlation of the parasites distribution with water physicochemical parameters was analysed using bivariate Pearson correlation. Based on the 24 total samples of environmental water abstracted by drinking water treatment plants, all the samples (24/24; 100%) were positive with Cryptosporidium , and only 2 samples (2/24; 8.33%) were positive with Cyclospora . Based on the 12 total samples of water for recreational activities, 4 samples (4/12; 33%) were positive with Cryptosporidium , while 2 samples (2/12; 17%) were positive with Cyclospora . Cryptosporidium oocysts were negatively correlated with dissolved oxygen (DO).
Tahar, Ahmad Syatir; Yunos, Nur Emyliana; Apun, Kasing; Nillian, Elexson; Hashim, Hashimatul Fatma
2017-01-01
Cryptosporidiosis and cyclosporiasis are caused by waterborne coccidian protozoan parasites of the genera Cryptosporidium and Cyclospora, respectively. This study was conducted to detect Cryptosporidium and Cyclospora oocysts from environmental water abstracted by drinking water treatment plants and recreational activities in Sarawak, Malaysia. Water samples (12 each) were collected from Sungai Sarawak Kanan in Bau and Sungai Sarawak Kiri in Batu Kitang, respectively. In addition, 6 water samples each were collected from Ranchan Recreational Park and UNIMAS Lake at Universiti Malaysia Sarawak, Kota Samarahan, respectively. Water physicochemical parameters were also recorded. All samples were concentrated by the iron sulfate flocculation method followed by the sucrose floatation technique. Cryptosporidium and Cyclospora were detected by modified Ziehl-Neelsen technique. Correlation of the parasites distribution with water physicochemical parameters was analysed using bivariate Pearson correlation. Based on the 24 total samples of environmental water abstracted by drinking water treatment plants, all the samples (24/24; 100%) were positive with Cryptosporidium, and only 2 samples (2/24; 8.33%) were positive with Cyclospora. Based on the 12 total samples of water for recreational activities, 4 samples (4/12; 33%) were positive with Cryptosporidium, while 2 samples (2/12; 17%) were positive with Cyclospora. Cryptosporidium oocysts were negatively correlated with dissolved oxygen (DO). PMID:29234679
Diversity in Education Using Blended Learning in Sarawak
ERIC Educational Resources Information Center
Ling, Siew-Eng; Ariffin, Siti Rahayah Bt; Rahman, Saemah Bt; Lai, Kim-Leong
2010-01-01
One of the objectives of Malaysia Ministry of Education is to provide educational opportunities for all Malaysians. Are education opportunities given fairly to all Malaysians who come from two big regions and divided by the South China Sea? The web infancy era, where the World Wide Web (WWW) is blooming fast, has changed the new millennium…
A decade of Japanese encephalitis surveillance in Sarawak, Malaysia: 1997-2006.
Wong, See C; Ooi, Mong H; Abdullah, Abdul R; Wong, See Y; Krishnan, Shekhar; Tio, Phaik H; Pek, Peng C; Lai, Boon F; Mohan, Anand; Muhi, Jamail; Kiyu, Andrew; Arif, Mohamad T; Cardosa, Mary J
2008-01-01
Japanese encephalitis virus (JEV) is an important encephalitis virus in Asia, but there are few data on Malaysia. A hospital-based surveillance system for Japanese encephalitis (JE) has been in operation in Sarawak, Malaysia, for the last 10 years. JEV is endemic in Sarawak, with cases occurring throughout the year and a seasonal peak in the last quarter (one-way anova, P < 0.0001). Ninety-two per cent of 133 cases were children aged 12 years or younger; the introduction of JE vaccination in July 2001 reduced the number of JE cases (84 in the four seasons prior to vs. 49 in the six seasons after, McNemar's test, P = 0.0001). After implementation of the programme, the mean age of infected children increased from 6.3 to 8.0 years (Student's t-test, P = 0.0037), suggesting the need for a catch-up programme.
Area Handbook Series: Singapore: A Country Study.
1989-12-01
built to house 12,000 Asian work- ers, with cinemas , hospitals, churches, and seventeen soccer fields. Above-ground tanks held enough fuel for the...the Malaysian general election in April 1964. UMNO was unable to win any seats in the Singapore election, and PAP won only one seat on the penin...of Malaya, Singapore, Sabah, and Sarawak merged to form a Malaysian National Alliance Party. The follow- ing month, the PAP and four opposition
Development of Malaysian women fertility index: Evidence from Shannon's entropy
NASA Astrophysics Data System (ADS)
Jalil, Wan Aznie Fatihah Wan Abd; Sharif, Shamshuritawati
2017-11-01
A fertility rate is a measure of the average number of children a woman will have during her childbearing years. Malaysia is now facing a population crisis and the fertility rate continues to decline. This situation will have implications for the age structure of the population where percentages of senior citizens are higher than percentages of people aged below 5 years old. Malaysia is expected to reach aging population status by the year 2035. As the aging population has a very long average life expectancy, the government needs to spend a lot on medical costs for senior citizens and need to increase budgets for pensions. The government may be required to increase tax revenues to support the growing older population. The falling fertility rate requires proper control by relevant authorities, especially through planning and implementation of strategic and effective measures. Hence, this paper aims to develop a fertility index using Shannon's entropy method. The results show that Selangor, Johor, and Sarawak are among the states with the highest values of the fertility index. On the other end of the spectrum, Terengganu, W.P. Labuan, and Perlis are ranked in the last positions according to the fertility index. The information generated from the results in this study can be used as a primary source for the government to design appropriate policies to mitigate dwindling fertility rates among Malaysian women.
Othman, Muhammad Nur Arif; Hassan, Ruhana; Harith, Mohd Nasarudin; Sah, Amir Shah Ruddin Md
2018-03-01
Red seaweed Gracilaria , one of the largest genus in Division Rhodophyta inhabits Sarawak coastal water. This study was designed to identify the species of Gracilaria using morphological approach and to assess selected water quality parameters in Gracilaria habitats. Three field samplings were carried out in Santubong and Asajaya, Sarawak from November 2013 to December 2014. Overall, three species were identified namely Gracilaria changii , G. blodgettii and G. coronopifolia , attached to net of cage culture in Santubong and root of mangrove trees in Asajaya. In addition, three different taxa of aquatic macroinvertebrates (polychaete, small crab, bivalve) and single species of red seaweed ( Acanthophora sp.) were observed in Gracilaria assemblages. An estimate of 37% to 40% of the upper part of the cage net in Santubong was covered by seaweeds and only 16% to 20% in Asajaya's mangrove. The study had provided better information on identification of Gracilaria and their habitat in Sarawak. Future work involving DNA barcoding of each species is in progress.
Othman, Muhammad Nur Arif; Hassan, Ruhana; Harith, Mohd Nasarudin; Sah, Amir Shah Ruddin Md
2018-01-01
Red seaweed Gracilaria, one of the largest genus in Division Rhodophyta inhabits Sarawak coastal water. This study was designed to identify the species of Gracilaria using morphological approach and to assess selected water quality parameters in Gracilaria habitats. Three field samplings were carried out in Santubong and Asajaya, Sarawak from November 2013 to December 2014. Overall, three species were identified namely Gracilaria changii, G. blodgettii and G. coronopifolia, attached to net of cage culture in Santubong and root of mangrove trees in Asajaya. In addition, three different taxa of aquatic macroinvertebrates (polychaete, small crab, bivalve) and single species of red seaweed (Acanthophora sp.) were observed in Gracilaria assemblages. An estimate of 37% to 40% of the upper part of the cage net in Santubong was covered by seaweeds and only 16% to 20% in Asajaya’s mangrove. The study had provided better information on identification of Gracilaria and their habitat in Sarawak. Future work involving DNA barcoding of each species is in progress. PMID:29644017
Language Use and Sustainability Status of Indigenous Languages in Sarawak, Malaysia
ERIC Educational Resources Information Center
Ting, Su-Hie; Ling, Teck-Yee
2013-01-01
The study examines the sustainability status of Sarawak indigenous languages through a survey on adolescents' language use using the Expanded Graded Intergenerational Disruption Scale (EGIDS). The specific aspects examined were: the presence of ethnic languages in relation to other languages in selected domains of language use; the adolescents'…
Porpoises Among the Whales: Small Navies in Asia and the Pacific
1994-03-01
Maverick 14 miles 300 lbs. 800+ mph Air-to-surface vessels) may decide the outcome. (U.S.) Military analysts generally maintain Silkworm 59-93 miles...Sarawak with Malaysia,* and, despite the fact into the newly formed Malaysian federation. that the two countries are ASEAN ISee also Morgan and Fryer 1985...4its constabulary and coastal-defense Fast-attack hydrofoils 5 6 Large patrol craft 18 1 roles. The Malaysian navy is only Coastal patrol craft 18
Two new Species of Simulium (Simulium) (Diptera: Simuliidae) From Mount Murud, Sarawak, Malaysia.
Takaoka, Hiroyuki; Ya'cob, Zubaidah; Sofian-Azirun, Mohd
2015-01-01
Two new species of black flies, Simulium (Simulium) murudense and Simulium (Simulium) cheedhangi, are described on the basis of females, males, pupae, and larvae collected in Mount Murud, Sarawak, Malaysia. Both species belong to the Simulium melanopus Edwards species group. S. (S.) murudense sp. nov. is distinguished from most known species by a combination of the haired basal portion of the radial vein and the darkened fore coxae, and S. (S.) cheedhangi sp. nov. is characterized in the female by having a medium-sized claw tooth and in the pupa by six somewhat inflated gill filaments. Notes are given on the S. melanopus species-group in Sarawak and Sabah. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia
Pui, Chai Fung; Apun, Kasing; Su'ut, Lela
2017-01-01
Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107) of rats, 11.6% (34/292) of soil samples, and 1.9% (6/324) of water samples. Intermediate Leptospira was present in 2.7% (8/292) of soil samples and 1.9% (6/324) of water samples. Saprophytic Leptospira was present in 10.3% (11/107) of rats, 1.4% (4/292) of soil samples, and 0.3% (1/324) of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii, intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri, respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak. PMID:28348601
Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia.
Pui, Chai Fung; Bilung, Lesley Maurice; Apun, Kasing; Su'ut, Lela
2017-01-01
Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107) of rats, 11.6% (34/292) of soil samples, and 1.9% (6/324) of water samples. Intermediate Leptospira was present in 2.7% (8/292) of soil samples and 1.9% (6/324) of water samples. Saprophytic Leptospira was present in 10.3% (11/107) of rats, 1.4% (4/292) of soil samples, and 0.3% (1/324) of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii , intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri , respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak.
Lau, Koon Weng; Chen, Chee Dhang; Lee, Han Lim; Low, Van Lun; Sofian-Azirun, Mohd
2018-05-28
The susceptibility status of Aedes albopictus (Skuse; Diptera: Culicidea) larvae collected from 13 districts in Sarawak state, Malaysia was evaluated against five insect growth regulators (IGRs) namely, methoprene, pyriproxyfen, diflubenzuron, cyromazine, and novaluron. Field populations of Ae. albopictus were susceptible to methoprene, pyriproxyfen, cyromazine and novaluron with resistance ratios (RRs) ranging from 0.19-0.38, 0.05-0.14, 0.50-0.95, and 0.75-1.00, respectively. Nevertheless, tolerance towards diflubenzuron (0.33-1.33) was observed in this study. In general, these IGRs exhibited promising results and can be used as alternative control agents against field populations of Ae. albopictus in Sarawak, Malaysia.
Environmental Education in a Region of Rapid Economic Development: The Case of Sarawak.
ERIC Educational Resources Information Center
Gough, Stephen.
1995-01-01
Discusses an innovative approach to environmental education that takes into account the interactions between cultural diversity and environmental controversy. Examines the situation in Sarawak, a State of East Malaysia, in the light of existing theoretical work. Contains 21 references. (JRH)
Wong, J S; Rahimah, N
2004-08-01
Achieving glycaemic goals in diabetics has always been a problem, especially in a developing country with inadequate facilities such as in Sarawak in Malaysia. There are no reported studies on the control of diabetes mellitus in a diabetic clinic in the primary health care setting in Sarawak. This paper describes the profile of 1031 patients treated in Klinik Kesihatan Tanah Puteh Health Centre. The mean age was 59 years, the mean BMI 27 kg/m2. There was a female preponderance and mainly type-2 diabetes. Mean HbA1c was 7.4%. Glycaemic control was optimal in 28% (HbA1c <6.5%), fair in 34% (HbA1c 6.5-7.5%) and poor in 38% (HbA1c >7.5%). Reasonable glycaemic control can be achieved in the primary health care setting in Sarawak.
Age and provenance of Triassic to Cenozoic sediments of West and Central Sarawak, Malaysia
NASA Astrophysics Data System (ADS)
Breitfeld, H. Tim; Galin, Thomson; Hall, Robert
2015-04-01
Sarawak is located on the northern edge of Sundaland in NW Borneo. West and Central Sarawak include parts of the Kuching and Sibu Zones. These contain remnants of several sedimentary basins with ages from Triassic to Cenozoic. New light mineral, heavy mineral and U-Pb detrital zircon ages show differences in provenance reflecting the tectonic evolution of the region. The oldest clastic sediments are Triassic (Sadong Formation and its deep marine equivalent Kuching Formation). They were sourced by a Triassic (Carnian to Norian) volcanic arc and reworked Paleoproterozoic detritus derived from Cathaysialand. The Upper Jurassic to Cretaceous Pedawan Formation is interpreted as forearc basin fill with distinctive zircon populations indicating subduction beneath present-day West Sarawak which initiated in the Late Jurassic. Subsequent subduction until the early Late Cretaceous formed the Schwaner Mountains magmatic arc. After collision of SW Borneo and other microcontinental fragments with Sundaland in the early Late Cretaceous, deep marine sedimentation (Pedawan Formation) ceased, and there was uplift forming the regional Pedawan-Kayan unconformity. Two episodes of extension followed and were responsible for basin development on land in West Sarawak from the latest Cretaceous onwards, probably in a pull-apart setting. The first episode is associated with sediments of the Kayan Group, deposited in the Latest Cretaceous (Maastrichtian) to Eocene, and the second episode with Upper Eocene sediments of the Ketungau Basin. Zircon ages indicate volcanic activity throughout the Early Cenozoic in NW Borneo, and inherited zircon ages indicate reworking of Triassic and Cretaceous rocks. A large deep marine basin, the Rajang Basin, was north of the Lupar Line Fault in Central Sarawak (Sibu Zone) from the Late Cretaceous to the Late Eocene. Zircons from sediments of the Rajang Basin indicate they have similar ages and provenance to contemporaneous terrestrial sediments of the Kayan
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1995-01-06
The study, conducted by Sargent & Lundy, was funded by the U.S. Trade and Development Agency on behalf of the Sarawak Electricity Supply Corporation. The purpose of the project is to determine the feasibility of an interconnection of the electric power systems of Sarawak and West Kalimantan as is being done elsewhere in the region. The report presents technical and economic evaluations and assesses the realibility of the system after the interconnection. The study is divided into three volumes. The report combines the Executive Summary (Volume 1) and the Main Report (Volume 2).
Language Choices of CEOs of Chinese Family Business in Sarawak, Malaysia
ERIC Educational Resources Information Center
Ting, Su-Hie
2017-01-01
The study investigated the language choices of Chief Executive Officers (CEOs) of Chinese family business and the factors guiding their choices. Interviews were conducted with 17 CEOs of family businesses located in Sarawak, some of whom are the sons and grandsons of the founder of the business. The results showed that all the CEOs can speak their…
A Triassic to Cretaceous Sundaland-Pacific subduction margin in West Sarawak, Borneo
NASA Astrophysics Data System (ADS)
Breitfeld, H. Tim; Hall, Robert; Galin, Thomson; Forster, Margaret A.; BouDagher-Fadel, Marcelle K.
2017-01-01
Metamorphic rocks in West Sarawak are poorly exposed and studied. They were previously assumed to be pre-Carboniferous basement but had never been dated. New 40Ar/39Ar ages from white mica in quartz-mica schists reveal metamorphism between c. 216 to 220 Ma. The metamorphic rocks are associated with Triassic acid and basic igneous rocks, which indicate widespread magmatism. New U-Pb dating of zircons from the Jagoi Granodiorite indicates Triassic magmatism at c. 208 Ma and c. 240 Ma. U-Pb dating of zircons from volcaniclastic sediments of the Sadong and Kuching Formations confirms contemporaneous volcanism. The magmatic activity is interpreted to represent a Triassic subduction margin in westernmost West Sarawak with sediments deposited in a forearc basin derived from the magmatic arc at the Sundaland-Pacific margin. West Sarawak and NW Kalimantan are underlain by continental crust that was already part of Sundaland or accreted to Sundaland in the Triassic. One metabasite sample, also previously assumed to be pre-Carboniferous basement, yielded Early Cretaceous 40Ar/39Ar ages. They are interpreted to indicate resumption of subduction which led to deposition of volcaniclastic sediments and widespread magmatism. U-Pb ages from detrital zircons in the Cretaceous Pedawan Formation are similar to those from the Schwaner granites of NW Kalimantan, and the Pedawan Formation is interpreted as part of a Cretaceous forearc basin containing material eroded from a magmatic arc that extended from Vietnam to west Borneo. The youngest U-Pb ages from zircons in a tuff layer from the uppermost part of the Pedawan Formation indicate that volcanic activity continued until c. 86 to 88 Ma when subduction terminated.
Food Consumption Patterns: Findings from the Malaysian Adult Nutrition Survey (MANS).
Norimah, A K; Safiah, M; Jamal, K; Haslinda, Siti; Zuhaida, H; Rohida, S; Fatimah, S; Norazlin, Siti; Poh, B K; Kandiah, M; Zalilah, M S; Wan Manan, W M; Fatimah, S; Azmi, M Y
2008-03-01
This study reports the food consumption patterns of adults aged 18 to 59 years in the Malaysian Adults Nutrition Survey (MANS) carried out between October 2002 and December 2003. A total of 6,742 subjects comprising 3,274 men and 3,468 women representing the northern, central , southern and east coast of Peninsular Malaysia as well as Sabah and Sarawak were interviewed. A semiquantitative food frequency questionnaire (FFQ) which consisted of 126 food items was used to evaluate the food consumption pattern (habitual food intake) of the respondents during the previous one- year period. The results demonstrate that nasi putih (cooked rice) was consumed by 97% of the population twice daily (average 2½ plates per day). Other food items consumed daily were marine fish, (one medium fish per day), green leafy vegetables (one cup per day) and sweetened condensed milk (three teaspoons per day. The mean frequencies for daily intake of rice, leafy vegetables, marine fish, local kuih, anchovy (ikan bilis) and biscuits were significantly higher among the rural compared to the urban adults. In contrast, more urban dwellers consumed chicken and eggs more frequently than their rural counterparts. More men than women consumed chicken and eggs more frequently. Malaysian adults showed a satisfactory habit of drinking plain water, with 99% drinking at least six glasses of plain water daily. Other beverages such as tea (47%), coffee (28%), chocolate-based drinks (23%) and cordial syrup (11%) were also consumed on daily basis, however, in a smaller proportion of the population. There were differences in the prevalence of daily consumption of foods when comparing urban and rural population, and also between men and women. The prevalence of daily consumption of marine fish among rural and urban adults was 51% and 34% respectively. For sweetened condensed milk, men and women consumed 43% and 28% respectively; however, more women drank full cream milk than men. Between the age groups, 21
Sentinel surveillance for human enterovirus 71 in Sarawak, Malaysia: lessons from the first 7 years.
Podin, Yuwana; Gias, Edna L M; Ong, Flora; Leong, Yee-Wei; Yee, Siew-Fung; Yusof, Mohd Apandi; Perera, David; Teo, Bibiana; Wee, Thian-Yew; Yao, Sik-Chi; Yao, Sik-King; Kiyu, Andrew; Arif, Mohd Taha; Cardosa, Mary Jane
2006-07-07
A major outbreak of human enterovirus 71-associated hand, foot and mouth disease in Sarawak in 1997 marked the beginning of a series of outbreaks in the Asia Pacific region. Some of these outbreaks had unusually high numbers of fatalities and this generated much fear and anxiety in the region. We established a sentinel surveillance programme for hand, foot and mouth disease in Sarawak, Malaysia, in March 1998, and the observations of the first 7 years are described here. Virus isolation, serotyping and genotyping were performed on throat, rectal, vesicle and other swabs. During this period Sarawak had two outbreaks of human enterovirus 71, in 2000 and 2003. The predominant strains circulating in the outbreaks of 1997, 2000 and 2003 were all from genogroup B, but the strains isolated during each outbreak were genetically distinct from each other. Human enterovirus 71 outbreaks occurred in a cyclical pattern every three years and Coxsackievirus A16 co-circulated with human enterovirus 71. Although vesicles were most likely to yield an isolate, this sample was not generally available from most cases and obtaining throat swabs was thus found to be the most efficient way to obtain virological information. Knowledge of the epidemiology of human enterovirus 71 transmission will allow public health personnel to predict when outbreaks might occur and to plan interventions in an effective manner in order to reduce the burden of disease.
Distributional changes in rainfall and river flow in Sarawak, Malaysia
NASA Astrophysics Data System (ADS)
Sa'adi, Zulfaqar; Shahid, Shamsuddin; Ismail, Tarmizi; Chung, Eun-Sung; Wang, Xiao-Jun
2017-11-01
Climate change may not change the rainfall mean, but the variability and extremes. Therefore, it is required to explore the possible distributional changes of rainfall characteristics over time. The objective of present study is to assess the distributional changes in annual and northeast monsoon rainfall (November-January) and river flow in Sarawak where small changes in rainfall or river flow variability/distribution may have severe implications on ecology and agriculture. A quantile regression-based approach was used to assess the changes of scale and location of empirical probability density function over the period 1980-2014 at 31 observational stations. The results indicate that diverse variation patterns exist at all stations for annual rainfall but mainly increasing quantile trend at the lowers, and higher quantiles for the month of January and December. The significant increase in annual rainfall is found mostly in the north and central-coastal region and monsoon month rainfalls in the interior and north of Sarawak. Trends in river flow data show that changes in rainfall distribution have affected higher quantiles of river flow in monsoon months at some of the basins and therefore more flooding. The study reveals that quantile trend can provide more information of rainfall change which may be useful for climate change mitigation and adaptation planning.
A new species of the genus Dilar Rambur (Neuroptera: Dilaridae) from Borneo
John D. Oswald; Nathan M. Schiff
2001-01-01
Dilar macleodi is described as a new species from lowland rainforest habitat in the Malaysian State of Sarawak on the island of Borneo. Diagnoses are provided to distinguish D. macleodi from the four other dilarid species that have been reported from the peninsula of Indochina or the Malay Archipelago.
ERIC Educational Resources Information Center
International Planned Parenthood Federation, London (England).
Data relating to population and family planning in eight foreign countries are presented in these situation reports. Countries included are Hong Kong, Malawi, Pakistan, Panama, Philippines, Ryukyu Islands (Okinawa), Sabah, and Sarawak. Information is provided where appropriate and available, under two topics, general background and family planning…
Bioactive compounds and antioxidant activity analysis of Malaysian pineapple cultivars
NASA Astrophysics Data System (ADS)
Chiet, Chong Hang; Zulkifli, Razauden Mohamed; Hidayat, Topik; Yaakob, Harisun
2014-03-01
Pineapple industry is one of the important agricultural sectors in Malaysia with 76 cultivars planted throughout the country. This study aims to generate useful nutritional information as well as evaluating antioxidant properties of different pineapple commercial cultivars in Malaysia. The bioactive compound content and antioxidant capacity of `Josapine', `Morris' and `Sarawak' pineapple (Ananas comosus) were studied. The pineapple varieties were collected at commercial maturity stage (20-40% yellowish of fruit peel) and the edible portion of the fruit was used as sample for evaluation. The bioactive compound of the fruit extracts were evaluated by total phenolic and tannin content assay while the antioxidant capacity was determined by ferric reducing antioxidant power (FRAP). From the results obtained, total phenolic and tannin content was highest for `Josapine' followed by `Morris' and `Sarawak'. With respect to FRAP, `Josapine' showed highest reducing capacity, followed by `Morris' and then `Sarawak' having the least value. The bioactive compounds content are positively correlated with the antioxidant capacities of the pineapple extracts. This result indicates that the total phenolics and tannin content present in the pineapples may contribute to the antioxidant capacity of the pineapples.
Sentinel surveillance for human enterovirus 71 in Sarawak, Malaysia: lessons from the first 7 years
Podin, Yuwana; Gias, Edna LM; Ong, Flora; Leong, Yee-Wei; Yee, Siew-Fung; Yusof, Mohd Apandi; Perera, David; Teo, Bibiana; Wee, Thian-Yew; Yao, Sik-Chi; Yao, Sik-King; Kiyu, Andrew; Arif, Mohd Taha; Cardosa, Mary Jane
2006-01-01
Background A major outbreak of human enterovirus 71-associated hand, foot and mouth disease in Sarawak in 1997 marked the beginning of a series of outbreaks in the Asia Pacific region. Some of these outbreaks had unusually high numbers of fatalities and this generated much fear and anxiety in the region. Methods We established a sentinel surveillance programme for hand, foot and mouth disease in Sarawak, Malaysia, in March 1998, and the observations of the first 7 years are described here. Virus isolation, serotyping and genotyping were performed on throat, rectal, vesicle and other swabs. Results During this period Sarawak had two outbreaks of human enterovirus 71, in 2000 and 2003. The predominant strains circulating in the outbreaks of 1997, 2000 and 2003 were all from genogroup B, but the strains isolated during each outbreak were genetically distinct from each other. Human enterovirus 71 outbreaks occurred in a cyclical pattern every three years and Coxsackievirus A16 co-circulated with human enterovirus 71. Although vesicles were most likely to yield an isolate, this sample was not generally available from most cases and obtaining throat swabs was thus found to be the most efficient way to obtain virological information. Conclusion Knowledge of the epidemiology of human enterovirus 71 transmission will allow public health personnel to predict when outbreaks might occur and to plan interventions in an effective manner in order to reduce the burden of disease. PMID:16827926
Enhancing Malaysian Teachers' Assessment Literacy
ERIC Educational Resources Information Center
Lian, Lim Hooi; Yew, Wun Thiam; Meng, Chew Cheng
2014-01-01
Currently, in order to reform the Malaysian education system, there have been a number of education policy initiatives launched by the Malaysian Ministry of Education (MOE). All these initiatives have encouraged and inculcated teaching and learning for creativity, critical, innovative and higher-order thinking skills rather than conceptual…
Thermal regimes of Malaysian sedimentary basins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdul Halim, M.F.
1994-07-01
Properly corrected and calibrated thermal data are important in estimating source-rock maturation, diagenetics, evolution of reservoirs, pressure regimes, and hydrodynamics. Geothermal gradient, thermal conductivity, and heat flow have been determined for the sedimentary succession penetrated by exploratory wells in Malaysia. Geothermal gradient and heat-flow maps show that the highest average values are in the Malay Basin. The values in the Sarawak basin are intermediate between those of the Malay basin and the Sabah Basin, which contains the lowest average values. Temperature data were analyzed from more than 400 wells. An important parameter that was studied in detail is the circulationmore » time. The correct circulation time is essential in determining the correct geothermal gradient of a well. It was found that the most suitable circulation time for the Sabah Basin is 20 hr, 30 hr for the Sarawak Basin and 40 hr for the Malay Basin. Values of thermal conductivity, determined from measurement and calibrated calculations, were grouped according to depositional units and cycles in each basin.« less
Rhythmic patterning in Malaysian and Singapore English.
Tan, Rachel Siew Kuang; Low, Ee-Ling
2014-06-01
Previous work on the rhythm of Malaysian English has been based on impressionistic observations. This paper utilizes acoustic analysis to measure the rhythmic patterns of Malaysian English. Recordings of the read speech and spontaneous speech of 10 Malaysian English speakers were analyzed and compared with recordings of an equivalent sample of Singaporean English speakers. Analysis was done using two rhythmic indexes, the PVI and VarcoV. It was found that although the rhythm of read speech of the Singaporean speakers was syllable-based as described by previous studies, the rhythm of the Malaysian speakers was even more syllable-based. Analysis of the syllables in specific utterances showed that Malaysian speakers did not reduce vowels as much as Singaporean speakers in cases of syllables in utterances. Results of the spontaneous speech confirmed the findings for the read speech; that is, the same rhythmic patterning was found which normally triggers vowel reductions.
The Effect of Vaccination Coverage and Climate on Japanese Encephalitis in Sarawak, Malaysia
Impoinvil, Daniel E.; Ooi, Mong How; Diggle, Peter J.; Caminade, Cyril; Cardosa, Mary Jane; Morse, Andrew P.
2013-01-01
Background Japanese encephalitis (JE) is the leading cause of viral encephalitis across Asia with approximately 70,000 cases a year and 10,000 to 15,000 deaths. Because JE incidence varies widely over time, partly due to inter-annual climate variability effects on mosquito vector abundance, it becomes more complex to assess the effects of a vaccination programme since more or less climatically favourable years could also contribute to a change in incidence post-vaccination. Therefore, the objective of this study was to quantify vaccination effect on confirmed Japanese encephalitis (JE) cases in Sarawak, Malaysia after controlling for climate variability to better understand temporal dynamics of JE virus transmission and control. Methodology/principal findings Monthly data on serologically confirmed JE cases were acquired from Sibu Hospital in Sarawak from 1997 to 2006. JE vaccine coverage (non-vaccine years vs. vaccine years) and meteorological predictor variables, including temperature, rainfall and the Southern Oscillation index (SOI) were tested for their association with JE cases using Poisson time series analysis and controlling for seasonality and long-term trend. Over the 10-years surveillance period, 133 confirmed JE cases were identified. There was an estimated 61% reduction in JE risk after the introduction of vaccination, when no account is taken of the effects of climate. This reduction is only approximately 45% when the effects of inter-annual variability in climate are controlled for in the model. The Poisson model indicated that rainfall (lag 1-month), minimum temperature (lag 6-months) and SOI (lag 6-months) were positively associated with JE cases. Conclusions/significance This study provides the first improved estimate of JE reduction through vaccination by taking account of climate inter-annual variability. Our analysis confirms that vaccination has substantially reduced JE risk in Sarawak but this benefit may be overestimated if climate effects
The effect of vaccination coverage and climate on Japanese encephalitis in Sarawak, Malaysia.
Impoinvil, Daniel E; Ooi, Mong How; Diggle, Peter J; Caminade, Cyril; Cardosa, Mary Jane; Morse, Andrew P; Baylis, Matthew; Solomon, Tom
2013-01-01
Japanese encephalitis (JE) is the leading cause of viral encephalitis across Asia with approximately 70,000 cases a year and 10,000 to 15,000 deaths. Because JE incidence varies widely over time, partly due to inter-annual climate variability effects on mosquito vector abundance, it becomes more complex to assess the effects of a vaccination programme since more or less climatically favourable years could also contribute to a change in incidence post-vaccination. Therefore, the objective of this study was to quantify vaccination effect on confirmed Japanese encephalitis (JE) cases in Sarawak, Malaysia after controlling for climate variability to better understand temporal dynamics of JE virus transmission and control. Monthly data on serologically confirmed JE cases were acquired from Sibu Hospital in Sarawak from 1997 to 2006. JE vaccine coverage (non-vaccine years vs. vaccine years) and meteorological predictor variables, including temperature, rainfall and the Southern Oscillation index (SOI) were tested for their association with JE cases using Poisson time series analysis and controlling for seasonality and long-term trend. Over the 10-years surveillance period, 133 confirmed JE cases were identified. There was an estimated 61% reduction in JE risk after the introduction of vaccination, when no account is taken of the effects of climate. This reduction is only approximately 45% when the effects of inter-annual variability in climate are controlled for in the model. The Poisson model indicated that rainfall (lag 1-month), minimum temperature (lag 6-months) and SOI (lag 6-months) were positively associated with JE cases. This study provides the first improved estimate of JE reduction through vaccination by taking account of climate inter-annual variability. Our analysis confirms that vaccination has substantially reduced JE risk in Sarawak but this benefit may be overestimated if climate effects are ignored.
ERIC Educational Resources Information Center
Heskin, Ken; Sharma, Raj; Kueh, Karen
The characteristics and attitudes of students and their reasons for enrolling were studied at a new institute of technology being established in Malaysia. The Swinburne University of Australia, in cooperation with Yayasan Sarawak, has established the Swinburne Sarawak Institute of Technology to provide industry training and trade/skills…
Malaysian Defence and E-Learning
ERIC Educational Resources Information Center
Juhary, Jowati binti
2005-01-01
This paper begins with an analysis of the changing security scenario in the Asian region, with special focus on Malaysian defence strategies and foreign policies. Beginning in the mid 1990s, the Malaysian government shifted its attention away from the counter insurgency strategies of the early decades of independence to focus on wider questions of…
Fatal occupational injuries in the Malaysian construction sector–causes and accidental agents
NASA Astrophysics Data System (ADS)
Ayob, A.; Shaari, A. A.; Zaki, M. F. M.; Munaaim, M. A. C.
2018-04-01
The construction sector is associated with various accidents and fatal injuries. These occupational accidents are caused by numerous factors, such as lack of supervision; lack of adherence to safe work technique; failure to wear personal protective equipment; and failure to comply with the safe use of tools, vehicles, and machines. Using 2013–2016 secondary data from the Department of Occupational Safety and Health and Social Security Organization, this study conducted a descriptive exploration survey to identify common fatal occupational injuries associated with the Malaysian construction sector, as well as their causes and accidental agents. Results indicated that construction, followed by manufacturing, agriculture, forestry, logging, and fishery, are the riskiest job sectors in Malaysia. The highest incidences of occupational casualties were reported in Sarawak, Johor, and Selangor. These states accounted for approximately 13.33% to 18.18% of all cases of fatal occupational accidents. In these states, the lack of safety and health regulations and poor execution of risk management increased the risk of occupational accidents. Falls from heights accounted for 46.28% of fatal occupational injuries. Furthermore, being crushed by objects, materials, or vehicles accounted for 9.09% to 17.36% of fatal occupational injuries. Substandard work environment and transportation and lifting equipment, such as scaffolds, are primary accidental agents. Results of this study could enhance the knowledge and awareness of construction workers and management of job-related injuries to decrease the incidence of fatal occupational accidents.
Hamdan, Nur Elfieyra Syazana; Ng, Yee Ling; Lee, Wei Bin; Tan, Cheng Siang; Khan, Faisal Ali Anwarali; Chong, Yee Ling
2017-01-01
Rodents belong to the order Rodentia, which consists of three families in Borneo (i.e., Muridae, Sciuridae and Hystricidae). These include rats, mice, squirrels, and porcupines. They are widespread throughout the world and considered pests that harm humans and livestock. Some rodent species are natural reservoirs of hantaviruses (Family: Bunyaviridae) that can cause zoonotic diseases in humans. Although hantavirus seropositive human sera were reported in Peninsular Malaysia in the early 1980s, information on their infection in rodent species in Malaysia is still lacking. The rodent populations in residential and forested areas in Sarawak were sampled. A total of 108 individuals from 15 species of rodents were collected in residential ( n = 44) and forested ( n = 64) areas. The species diversity of rodents in forested areas was significantly higher (H = 2.2342) compared to rodents in residential areas (H = 0.64715) ( p < 0.001 of Zar-t test based on the Shannon index). Rattus rattus and Sundamys muelleri were present at high frequencies in both localities. An enzyme-linked immunosorbent assay (ELISA) showed that hantavirus-targeting antibodies were absent from 53 tested serum samples. This is the first report of hantavirus seroprevalence surveillance in rodent populations in Sarawak, East Malaysia. The results suggested that hantavirus was not circulating in the studied rodent populations in Sarawak, or it was otherwise at a low prevalence that is below the detection threshold. It is important to remain vigilant because of the zoonotic potential of this virus and its severe disease outcome. Further studies, such as molecular detection of viral genetic materials, are needed to fully assess the risk of hantavirus infection in rodents and humans in this region of Malaysia.
Hamdan, Nur Elfieyra Syazana; Ng, Yee Ling; Lee, Wei Bin; Tan, Cheng Siang; Khan, Faisal Ali Anwarali; Chong, Yee Ling
2017-01-01
Rodents belong to the order Rodentia, which consists of three families in Borneo (i.e., Muridae, Sciuridae and Hystricidae). These include rats, mice, squirrels, and porcupines. They are widespread throughout the world and considered pests that harm humans and livestock. Some rodent species are natural reservoirs of hantaviruses (Family: Bunyaviridae) that can cause zoonotic diseases in humans. Although hantavirus seropositive human sera were reported in Peninsular Malaysia in the early 1980s, information on their infection in rodent species in Malaysia is still lacking. The rodent populations in residential and forested areas in Sarawak were sampled. A total of 108 individuals from 15 species of rodents were collected in residential (n = 44) and forested ( n = 64) areas. The species diversity of rodents in forested areas was significantly higher (H = 2.2342) compared to rodents in residential areas (H = 0.64715) (p < 0.001 of Zar-t test based on the Shannon index). Rattus rattus and Sundamys muelleri were present at high frequencies in both localities. An enzyme-linked immunosorbent assay (ELISA) showed that hantavirus-targeting antibodies were absent from 53 tested serum samples. This is the first report of hantavirus seroprevalence surveillance in rodent populations in Sarawak, East Malaysia. The results suggested that hantavirus was not circulating in the studied rodent populations in Sarawak, or it was otherwise at a low prevalence that is below the detection threshold. It is important to remain vigilant because of the zoonotic potential of this virus and its severe disease outcome. Further studies, such as molecular detection of viral genetic materials, are needed to fully assess the risk of hantavirus infection in rodents and humans in this region of Malaysia. PMID:28228923
Water quality monitoring: A comparative case study of municipal and Curtin Sarawak's lake samples
NASA Astrophysics Data System (ADS)
Anand Kumar, A.; Jaison, J.; Prabakaran, K.; Nagarajan, R.; Chan, Y. S.
2016-03-01
In this study, particle size distribution and zeta potential of the suspended particles in municipal water and lake surface water of Curtin Sarawak's lake were compared and the samples were analysed using dynamic light scattering method. High concentration of suspended particles affects the water quality as well as suppresses the aquatic photosynthetic systems. A new approach has been carried out in the current work to determine the particle size distribution and zeta potential of the suspended particles present in the water samples. The results for the lake samples showed that the particle size ranges from 180nm to 1345nm and the zeta potential values ranges from -8.58 mV to -26.1 mV. High zeta potential value was observed in the surface water samples of Curtin Sarawak's lake compared to the municipal water. The zeta potential values represent that the suspended particles are stable and chances of agglomeration is lower in lake water samples. Moreover, the effects of physico-chemical parameters on zeta potential of the water samples were also discussed.
Critical factors of implementing Industrialised Building System in Sarawak: A research on SMEs
NASA Astrophysics Data System (ADS)
Hadi, N. A.; Muhamad, W. M. N. W.; Othman, M. K. F.
2017-05-01
Industrialised Building System (IBS) have been adopted in Malaysia for over five decades and is expected to grow consistent with Malaysia's economic development. In promoting the adoption of IBS in construction projects, the government has taken several steps such as levy exemption for contractors and developers. Despite its numerous advantages and efforts pulled by the government, the implementation and adoption of IBS are still below the expected figure. Many researchers investigated readiness, setbacks and issues related to the implementation of IBS in Malaysia's construction projects. However, most of the research mainly for projects located in urban areas of West Malaysia. Therefore, this paper aims to close the gap on factors affecting the implementation of IBS for SMEs in Sarawak, where the level urbanisation is low. A semi-structured interview was conducted with 10 SME's contractors to get better insight view. The study found that logistics and infrastructure problems, a limited number of the manufacturer, lack of incentive, conventional payment methods, lack of financial supports are among critical factors affecting the implementation of IBS. Therefore, it was concluded that government plays major role in providing supports, incentives and facilitating the improvement of infrastructure to successfully implementing IBS in Sarawak.
Isa, Hasmidah Md; Kamal, Abu Hena Mustafa; Idris, Mohd Hanafi; Rosli, Zamri; Ismail, Johan
2017-01-01
Mangroves support diverse macroalgal assemblages as epibionts on their roots and tree trunks. These algae provide nutrients to the primary consumers in the aquatic food web and have been reported to be substantial contributors to marine ecosystems. The species diversity, biomass, and habitat characteristics of mangrove macroalgae were investigated at three stations in the Sibuti mangrove estuary, Sarawak, Malaysia, from November 2012 to October 2013. Three groups of macroalgae were recorded and were found to be growing on mangrove prop roots, namely Rhodophyta ( Caloglossa ogasawaraensis , Caloglossa adhaerens , Caloglossa stipitata , Bostrychia anomala, and Hypnea sp.), Chlorophyta ( Chaetomorpha minima and Chaetomorpha sp.), and Phaeophyta ( Dictyota sp.). The biomass of macroalgae was not influenced ( p >0.05) by the season in this mangrove forest habitat. The macroalgal species Hypnea sp. contributed the highest biomass at both Station 1 (210.56 mg/cm 2 ) and Station 2 (141.72 mg/cm 2 ), while the highest biomass was contributed by B. anomala (185.89 mg/cm 2 ) at Station 3. This study shows that the species distribution and assemblages of mangrove macroalgae were influenced by environmental parameters such as water nutrients, dissolved solids, and salinity in the estuarine mangrove habitats of Sibuti, Sarawak.
Divergence of iron metabolism in wild Malaysian yeast.
Lee, Hana N; Mostovoy, Yulia; Hsu, Tiffany Y; Chang, Amanda H; Brem, Rachel B
2013-12-09
Comparative genomic studies have reported widespread variation in levels of gene expression within and between species. Using these data to infer organism-level trait divergence has proven to be a key challenge in the field. We have used a wild Malaysian population of S. cerevisiae as a test bed in the search to predict and validate trait differences based on observations of regulatory variation. Malaysian yeast, when cultured in standard medium, activated regulatory programs that protect cells from the toxic effects of high iron. Malaysian yeast also showed a hyperactive regulatory response during culture in the presence of excess iron and had a unique growth defect in conditions of high iron. Molecular validation experiments pinpointed the iron metabolism factors AFT1, CCC1, and YAP5 as contributors to these molecular and cellular phenotypes; in genome-scale sequence analyses, a suite of iron toxicity response genes showed evidence for rapid protein evolution in Malaysian yeast. Our findings support a model in which iron metabolism has diverged in Malaysian yeast as a consequence of a change in selective pressure, with Malaysian alleles shifting the dynamic range of iron response to low-iron concentrations and weakening resistance to extreme iron toxicity. By dissecting the iron scarcity specialist behavior of Malaysian yeast, our work highlights the power of expression divergence as a signpost for biologically and evolutionarily relevant variation at the organismal level. Interpreting the phenotypic relevance of gene expression variation is one of the primary challenges of modern genomics.
Jahanfar, Shayesteh; Jaffar, Sharifah Halimah
2013-02-01
The National Malaysian Twin Registry was established in Royal College of Medicine, Perak, University Kuala Lumpur (UniKL) in June 2008 through a grant provided by UniKL. The general objective is to facilitate scientific research involving participation of twins and their family members in order to answer questions of health and wellbeing relevant to Malaysians. Recruitment is done via mass media, poster, and pamphlets. We now have 266 adult and 204 children twins registered. Several research projects including reproductive health study of twins and the role of co-bedding on growth and development of children are carried out. Registry holds annual activities for twins and seeks to provide health-related information for twins. We seek international collaboration.
Factors affecting commencement and cessation of betel quid chewing behaviour in Malaysian adults
2011-01-01
Background Betel quid chewing is a common habit widely practiced in Southern Asian populations. However, variations are seen in the content of a betel quid across the different countries. Factors associated with commencement and cessation of this habit has been numerously studied. Unfortunately, data on Malaysian population is non-existent. This study aims to determine the factors associated with the inception and also cessation of betel quid chewing behaviour among Malaysian adults. Method This study is part of a nationwide survey on oral mucosal lesions carried out among 11,697 adults in all fourteen states in Malaysia. The questionnaire included sociodemographic information and details on betel quid chewing habit such as duration, type and frequency. The Kaplan-Meier estimates were calculated and plotted to compare the rates for the commencement and cessation of betel quid chewing behaviour. Cox proportional hazard regression models were used to calculate the hazard rate ratios for factors related to commencement or cessation of this habit. Results Of the total subjects, 8.2% were found to be betel quid chewers. This habit was more prevalent among females and, in terms of ethnicity, among the Indians and the Indigenous people of Sabah and Sarawak. Cessation of this habit was more commonly seen among males and the Chinese. Females were found to be significantly more likely to start (p < 0.0001) and less likely to stop the quid chewing habit. Females, those over 40 years old, Indians and a history of smoking was found to significantly increase the likelihood of developing a quid chewing habit (p < 0.0001). However, those who had stopped smoking were found to be significantly more likely to promote stopping the habit (p = 0.0064). Cessation was also more likely to be seen among those who chewed less than 5 quids per day (p < 0.05) and less likely to be seen among those who included areca nut and tobacco in their quid (p < 0.0001). Conclusion Factors that influence
Estimated harvesting on jellyfish in Sarawak
NASA Astrophysics Data System (ADS)
Bujang, Noriham; Hassan, Aimi Nuraida Ali
2017-04-01
There are three species of jellyfish recorded in Sarawak which are the Lobonema smithii (white jellyfish), Rhopilema esculenta (red jellyfish) and Mastigias papua. This study focused on two particular species which are L.smithii and R.esculenta. This study was done to estimate the highest carrying capacity and the population growth rate of both species by using logistic growth model. The maximum sustainable yield for the harvesting of this species was also determined. The unknown parameters in the logistic model were estimated using center finite different method. As for the results, it was found that the carrying capacity for L.smithii and R.esculenta were 4594.9246456819 tons and 5855.9894242086 tons respectively. Whereas, the population growth rate for both L.smithii and R.esculenta were estimated at 2.1800463754 and 1.144864086 respectively. Hence, the estimated maximum sustainable yield for harvesting for L.smithii and R.esculenta were 2504.2872047638 tons and 1676.0779949431 tons per year.
Viable Blastocystis Cysts in Scottish and Malaysian Sewage Samples
Suresh, K.; Smith, H. V.; Tan, T. C.
2005-01-01
Blastocystis cysts were detected in 38% (47/123) (37 Scottish, 17 Malaysian) of sewage treatment works. Fifty percent of influents (29% Scottish, 76% Malaysian) and 28% of effluents (9% Scottish, 60% Malaysian) contained viable cysts. Viable cysts, discharged in effluent, provide further evidence for the potential for waterborne transmission of Blastocystis. PMID:16151162
Divergence of Iron Metabolism in Wild Malaysian Yeast
Lee, Hana N.; Mostovoy, Yulia; Hsu, Tiffany Y.; Chang, Amanda H.; Brem, Rachel B.
2013-01-01
Comparative genomic studies have reported widespread variation in levels of gene expression within and between species. Using these data to infer organism-level trait divergence has proven to be a key challenge in the field. We have used a wild Malaysian population of S. cerevisiae as a test bed in the search to predict and validate trait differences based on observations of regulatory variation. Malaysian yeast, when cultured in standard medium, activated regulatory programs that protect cells from the toxic effects of high iron. Malaysian yeast also showed a hyperactive regulatory response during culture in the presence of excess iron and had a unique growth defect in conditions of high iron. Molecular validation experiments pinpointed the iron metabolism factors AFT1, CCC1, and YAP5 as contributors to these molecular and cellular phenotypes; in genome-scale sequence analyses, a suite of iron toxicity response genes showed evidence for rapid protein evolution in Malaysian yeast. Our findings support a model in which iron metabolism has diverged in Malaysian yeast as a consequence of a change in selective pressure, with Malaysian alleles shifting the dynamic range of iron response to low-iron concentrations and weakening resistance to extreme iron toxicity. By dissecting the iron scarcity specialist behavior of Malaysian yeast, our work highlights the power of expression divergence as a signpost for biologically and evolutionarily relevant variation at the organismal level. Interpreting the phenotypic relevance of gene expression variation is one of the primary challenges of modern genomics. PMID:24142925
Malaysian Physicians' Evaluation of Their Training Abroad
ERIC Educational Resources Information Center
Wellington, John S.
1969-01-01
Eighteen Malaysian physicians evaluate their postgraduate training in the United Kingdom, Australia and the US in terms of its relevance to Malaysian health needs, the extent to which it is actually used, and its importance to them in teaching medical students in Malaysia. (WM)
NASA Astrophysics Data System (ADS)
Sa'adi, Zulfaqar; Shahid, Shamsuddin; Ismail, Tarmizi; Chung, Eun-Sung; Wang, Xiao-Jun
2017-11-01
This study assesses the spatial pattern of changes in rainfall extremes of Sarawak in recent years (1980-2014). The Mann-Kendall (MK) test along with modified Mann-Kendall (m-MK) test, which can discriminate multi-scale variability of unidirectional trend, was used to analyze the changes at 31 stations. Taking account of the scaling effect through eliminating the effect of autocorrelation, m-MK was employed to discriminate multi-scale variability of the unidirectional trends of the annual rainfall in Sarawak. It can confirm the significance of the MK test. The annual rainfall trend from MK test showed significant changes at 95% confidence level at five stations. The seasonal trends from MK test indicate an increasing rate of rainfall during the Northeast monsoon and a decreasing trend during the Southwest monsoon in some region of Sarawak. However, the m-MK test detected an increasing trend in annual rainfall only at one station and no significant trend in seasonal rainfall at any stations. The significant increasing trends of the 1-h maximum rainfall from the MK test are detected mainly at the stations located in the urban area giving concern to the occurrence of the flash flood. On the other hand, the m-MK test detected no significant trend in 1- and 3-h maximum rainfalls at any location. On the contrary, it detected significant trends in 6- and 72-h maximum rainfalls at a station located in the Lower Rajang basin area which is an extensive low-lying agricultural area and prone to stagnant flood. These results indicate that the trends in rainfall and rainfall extremes reported in Malaysia and surrounding region should be verified with m-MK test as most of the trends may result from scaling effect.
MH17: the Malaysian experience.
Khoo, L S; Hasmi, A H; Abdul Ghani Aziz, S A; Ibrahim, M A; Mahmood, M S
2016-04-01
A disaster is a natural or man-made (or technological) hazard resulting in an event of substantial extent causing significant physical damage or destruction, loss of life, or drastic change to the environment. It is a phenomenon that can cause damage to life and property and destroy the economic, social and cultural life of the people; and overwhelms the capacity of the community to cope with the event. The recent tragic aviation accidents in 2014 involving Malaysia Airlines flights MH370 and MH17 shocked the world in an unprecedented manner. This paper focuses on the Malaysian experience in the MH17 mission in Ukraine as well as the first ever international Disaster Victim Identification (DVI) operation for the Malaysian DVI team. The DVI operations in Hilversum, the Netherlands were well described in stages. The Netherlands' Landelijk Team Forensische Opsporing as the lead DVI team in Hilversum operated systematically, ensuring the success of the whole mission. This paper discusses the lessons learned by the Malaysian team on proper DVI structure, inter- and intra-agency cooperation, facilities planning and set up, logistics and health and safety aspects, as well as effective communication and collaboration with other international delegates. Several issues and challenges faced by the Malaysian team were also documented. In addition, the authors shared views, opinions and recommendations for a more comprehensive DVI operation in the future.
Isa, Hasmidah Md; Kamal, Abu Hena Mustafa; Idris, Mohd Hanafi; Rosli, Zamri; Ismail, Johan
2017-01-01
Mangroves support diverse macroalgal assemblages as epibionts on their roots and tree trunks. These algae provide nutrients to the primary consumers in the aquatic food web and have been reported to be substantial contributors to marine ecosystems. The species diversity, biomass, and habitat characteristics of mangrove macroalgae were investigated at three stations in the Sibuti mangrove estuary, Sarawak, Malaysia, from November 2012 to October 2013. Three groups of macroalgae were recorded and were found to be growing on mangrove prop roots, namely Rhodophyta (Caloglossa ogasawaraensis, Caloglossa adhaerens, Caloglossa stipitata, Bostrychia anomala, and Hypnea sp.), Chlorophyta (Chaetomorpha minima and Chaetomorpha sp.), and Phaeophyta (Dictyota sp.). The biomass of macroalgae was not influenced (p>0.05) by the season in this mangrove forest habitat. The macroalgal species Hypnea sp. contributed the highest biomass at both Station 1 (210.56 mg/cm2) and Station 2 (141.72 mg/cm2), while the highest biomass was contributed by B. anomala (185.89 mg/cm2) at Station 3. This study shows that the species distribution and assemblages of mangrove macroalgae were influenced by environmental parameters such as water nutrients, dissolved solids, and salinity in the estuarine mangrove habitats of Sibuti, Sarawak. PMID:28228913
Growth in Malaysian Demand for Business Education--the Australian Response.
ERIC Educational Resources Information Center
Lewis, Philip E. T.; Pratt, Graham R.
1996-01-01
Increasing Malaysian demand for business education is examined from the perspective of Australia, one of the largest suppliers to the region. Topics discussed include: origins and nature of the demand; Malaysian enrollment patterns in Australia; "twinning programs," in which a Malaysian college and a foreign university collaborate to…
Lee, P Y; Cheah, W l; Chang, C T; Siti Raudzah, G
2012-08-01
There is limited data on childhood obesity and its impact on children from diverse cultural backgrounds. This study is aimed at determining the association between obesity, self-esteem and health-related quality of life (HRQOL) among Malaysian urban primary school children of different ethnicity. A cross-sectional study was conducted involving 311 children aged 11-13 years from primary schools in Kuching, Sarawak. Self-esteem and health-related quality of life (HRQOL) were measured using the Lawrence Self-esteem Questionnaire (LAWSEQ) questionnaire and the Paediatric Quality of Life Inventory (PedsQL), respectively. Body weight and height were taken and body mass index for age calculated. The prevalence of overweight and obesity among the children were 18.2% and 15.2% respectively. Parent-proxy and child self-reported PedsQL scores were higher for normal weight children compared to thin and obese children, but lower than overweight children. At the subscale level, only parent-proxy PedsQL scores in psychosocial health and emotional component were significantly different between overweight and obese children (p=0.019, p=0.02). The Self-esteem score was significantly correlated with parent and child PedsQL scores. Although obesity was associated with lower HRQOL among children, both parent and child PedsQL scores among the overweight group were higher than that for the normal weight group. Overweight and obesity did affect quality of life and self-esteem of children in this study, particularly in the areas of psychosocial and emotional health. Policy makers and programme managers should take into consideration the impact of obesity on children and parents in designing intervention programmes.
The Malaysian Qualifications Framework. An Institutional Response to Intrinsic Weaknesses
ERIC Educational Resources Information Center
Keating, Jack
2011-01-01
This article discusses the Malaysian Qualifications Framework (MQF). An observation about the MQF is that in the particular context of developments in Malaysian education and training and its economic and social context, all roads have led to standards and quality assurance. This is the view expressed by the Malaysian Qualifications Agency (MQA)…
Historic day for Malaysian consumers.
Kaur, S R
1993-04-01
The Malaysian Medical Association, the Malaysian Dental Association, the Malaysian Pharmaceutical Society, and the Federation of Malaysian Consumer Associations have introduced and endorsed the Charter for Patient Rights. The Charter recognized that health care is a basic human right, regardless of race, religion, social status, and ability to pay. Further, consumers have the right to seek medical care in both the public and private sectors. The Charter also includes the right to a second opinion, one's own medical records, and explanation before receiving any medical treatment and concerning the risks of treatment, compensation for negligence, and adequate information. Malaysia is the second Asian country to have such a charter, South Korea being the first. The UK also has a Patients Charter. The rest of Europe is also moving to adopt such a charter. The private sector, which serves only those who can afford them, provides most health care services in developing countries. Thus, a large private sector threatens the elderly, unemployed, rural poor, and the mentally ill in these countries. The supply of these services is a marketable commodity which physicians and health care professionals own and sell. The medical community has planned, formulated, implemented, and monitored health services in most of these countries. Therefore, the private sector is a major obstacle to health for all. The Charter helps to break down the barrier by informing both physicians and their patients of their rights and responsibilities.
Noordin, R; Muhi, J; Md Idris, Z; Arifin, N; Kiyu, A
2012-03-01
The detection rates of brugian filariasis in three regions of Sarawak namely Central, North and South after three courses of mass drug administration (MDA) from year 2004 to 2006 was investigated. A recombinant BmR1 antigen-based IgG4 detection test, named Brugia Rapid and night blood smear for microfilaria (mf) detection were used. All three regions recorded a sharp fall in mf positive rates after a year post-MDA. Meanwhile Brugia Rapid positive rates declined more gradually to 3.8% and 5.6% of the pre-MDA levels in the Central and North regions, respectively. This study showed that in filariasis endemic areas in Sarawak, anti-filarial IgG4 antibodies to BmR1, as detected by the Brugia Rapid test, were positive for one to two years after mf disappearance.
ERIC Educational Resources Information Center
Lee, Eileen Yen Ee; Boutin, Michael E.
Bilingual education programs must be based on a sound understanding of the linguistic, social, psychological, and cultural factors affecting students. This paper is concerned with linguistic factors that affect the acquisition of Bahasa Malaysia (BM) pronouns by non-native speakers from Sabah and Sarawak. Properties in the personal pronoun systems…
ERIC Educational Resources Information Center
Hassan, Ruhana; Yahya, Nurhartini Kamalia; Ong, Leh Mui; Kheng, Lim Kian; Abidin, Zulkalnain Zainal; Ayob, Anuar; Jainal, Aslina Mohd
2017-01-01
Nobody knows exactly what happened during "the lost years" of the turtles in the wild, thus a green turtle headstarting project was carried out at Pantai Pandan, Lundu, Sarawak, Malaysia from June 2014 until December 2015 to shed some lights on the growth of hatchlings during a small part of their "lost years". As a consequent,…
Three-dimensional facial analyses of Indian and Malaysian women.
Kusugal, Preethi; Ruttonji, Zarir; Gowda, Roopa; Rajpurohit, Ladusingh; Lad, Pritam; Ritu
2015-01-01
Facial measurements serve as a valuable tool in the treatment planning of maxillofacial rehabilitation, orthodontic treatment, and orthognathic surgeries. The esthetic guidelines of face are still based on neoclassical canons, which were used in the ancient art. These canons are considered to be highly subjective, and there is ample evidence in the literature, which raises such questions as whether or not these canons can be applied for the modern population. This study was carried out to analyze the facial features of Indian and Malaysian women by using three-dimensional (3D) scanner and thus determine the prevalence of neoclassical facial esthetic canons in both the groups. The study was carried out on 60 women in the age range of 18-25 years, out of whom 30 were Indian and 30 Malaysian. As many as 16 facial measurements were taken by using a noncontact 3D scanner. Unpaired t-test was used for comparison of facial measurements between Indian and Malaysian females. Two-tailed Fisher exact test was used to determine the prevalence of neoclassical canons. Orbital Canon was prevalent in 80% of Malaysian women; the same was found only in 16% of Indian women (P = 0.00013). About 43% of Malaysian women exhibited orbitonasal canon (P = 0.0470) whereas nasoaural canon was prevalent in 73% of Malaysian and 33% of Indian women (P = 0.0068). Orbital, orbitonasal, and nasoaural canon were more prevalent in Malaysian women. Facial profile canon, nasooral, and nasofacial canons were not seen in either group. Though some canons provide guidelines in esthetic analyses of face, complete reliance on these canons is not justifiable.
Strategic Information Systems Planning in Malaysian Public Universities
ERIC Educational Resources Information Center
Ismail, Noor Azizi; Raja Mohd Ali, Raja Haslinda; Mat Saat, Rafeah; Hsbollah, Hafizah Mohamad
2007-01-01
Purpose: The paper's purpose is to investigate the current status, problems and benefits of strategic information systems planning implementation in Malaysian public universities. Design/methodology/approach: The study uses dual but mutually supportive strands of investigation, i.e. a questionnaire survey and interviews. Findings: Malaysian public…
Language Learning Motivation among Malaysian Pre-University Students
ERIC Educational Resources Information Center
Muftah, Muneera; Rafik-Galea, Shameem
2013-01-01
The study describes and examines Malaysian pre-university students' integrative and instrumental motivation toward learning English language. In this study, 182 non-English major students in one of the Malaysian public universities are selected to fill out a questionnaire reflecting their attitudes and motivation towards learning English. The…
Malaysian and American Students' Perceptions of Research Ethics
ERIC Educational Resources Information Center
Bowman, Laura L.; Anthonysamy, Angela
2006-01-01
Differences in perceptions of research ethics between Malaysian and American students were assessed using a questionnaire that measured perceptions of voluntary informed consent for adults and children, assessment of the risk/benefit ratio, issues of deception, and issues of privacy and confidentiality. As predicted, Malaysian students had less…
Systemic sclerosis in Sarawak: a profile of patients treated in the Sarawak General Hospital.
Teh, C L; Kuan, Y C; Wong, J S
2009-08-01
We performed a cross-sectional study of the demography, clinical and laboratory features of patients with systemic sclerosis patients followed up in our centre from 1984 to 2007. There were 23 cases with the majority of them (96%) being female. They have a mean age of 50.3 years and a mean disease duration of 6.02 (SD 5.82) years. Our patients comprised of multi-ethnic groups with predominantly Chinese (52%), Sarawak natives (35%) and Malays (13%). They have a mean lag time to diagnosis of 24.8 (SD 34.8) months. All the patients have sclerodermatous skin changes with 16(70%) having diffuse scleroderma and 7(30%) having limited scleroderma. The common clinical manifestations found in our patients were Raynaud's phenomenon (91%), sclerodactyly (65%), digital ulcers (52%) and pulmonary fibrosis (52%). There was low incidence of pulmonary hypertension (13%) and renal involvement (4%). The majority of our patients (67%) have positive ANA with 33% positive Scl-70. The majority received calcium channel blockers (87%), aspirin (48%) and low-dose prednisolone (48%). One patient developed adenocarcinoma of the lung on follow-up. This study demonstrated the rarity of systemic sclerosis in our centre with considerable lag time to diagnosis in our patients. Diffuse cutaneous systemic scleroderma is more common in our centre with rare pulmonary hypertension and renal involvement.
Fate of napropamide herbicide in selected Malaysian soils.
Sadegh-Zadeh, Fardin; Wahid, Samsuri A; Seh-Bardan, Bahi J; Othman, Radziah; Omar, Dzolkhifli
2012-01-01
This study was carried out to determine the sorption-desorption, degradation and leaching of napropamide in selected Malaysian soils. The sorption capacities of the selected Malaysian soils for napropamide were the following in descending order: Linau > Teringkap > Gunung Berinchang > Jambu > Rudua > Baging soil. The results indicate that napropamide degradation decreased with increasing soil sorption capacity. Napropamide was leached out earlier in the Baging soil than the other soils. Overall, the application of napropamide in the selected Malaysian soils would not pose a threat to the environment except in soil with low organic matter and clay content and high hydraulic conductivity, such as the Baging soil.
ERIC Educational Resources Information Center
Hong, Kian-Sam; Cheng, Julia Lee Ai; Liau, Tet-Loke
2005-01-01
The benefits of an e-learning system will not be maximised if learners do not use the system. This study was conducted with 26 postgraduate students at a faculty in Universiti Malaysia Sarawak taking an on-campus course supplemented with an e-learning system. The purpose of the study was to determine which factors were related to intention to use…
Ya'cob, Zubaidah; Takaoka, Hiroyuki; Sofian-Azirun, Mohd
2015-01-20
Simulium (Gomphostilbia) hiroyukii is described based on females, males, pupae and larvae collected in Mount Murud, Sarawak, Malaysia. This new species is assigned to the Simulium darjeelingense species-group of the subgenus Gomphostilbia, and is characterized by the darkened fore coxae and the pupal gill with eight long filaments, of which middle and dorsal triplets have elongated primary and secondary stalks, respectively.
Barrett, Robert; Loa, Peter; Jerah, Edward; Nancarrow, Derek; Chant, David; Mowry, Bryan
2005-02-01
We present results of a study of treated rates of schizophrenia among the Iban of Sarawak, Malaysia. Most Iban live in longhouses, each comprising a kindred group of up to 300 individuals. Cultural practices such as minimal intermarriage with members of adjacent ethnic groups and in-depth genealogical knowledge make them a population suitable for genetic investigation. Iban culture is conducive to a focus on symptoms and illness, and to patterns of treatment-seeking behaviour that are enthusiastic and persistent. We identified all known cases of psychotic disorder within a defined catchment area based on an exhaustive survey of available medical records. From corresponding Malaysian census data (91,056 persons), we report rates of treated schizophrenia in the Iban population, using three diagnostic systems, as well as the demographic and clinical characteristics of these individuals. The most frequent presenting complaints were insomnia and aggression. We found higher treated rates for narrowly defined schizophrenia among males, but no significant gender difference for age of onset. Estimates of treated rates to age 55 years (per 10,000) for narrow schizophrenia were 41.9 (ICD-10), 56.5 (DSM-IV), and 83 (RDC), while the rates for broad schizophrenia were 105.5, 103.2, and 107.5 respectively. Treated rates of schizophrenia were higher than the reported prevalence for many populations at risk, including many small-scale societies, although different methodological approaches may partly explain these findings. Given the cultural patterns of Iban treatment-seeking behaviour, treated rates of schizophrenia reported here may closely approximate the population prevalence of this disorder.
Practices of Management Development: A Malaysian Case Study
ERIC Educational Resources Information Center
Law, Kian Aun
2008-01-01
This paper deals with a case study of Management Development (MD) practices at Malaysian Assurance Alliance (MAA). The aim of this research is to investigate how a large Malaysian insurance corporation developed and integrated MD initiatives with current organizational needs and tasks. Attempts were made to map and categorize the MD initiatives…
Malaysian English: An Instrumental Analysis of Vowel Contrasts
ERIC Educational Resources Information Center
Pillai, Stefanie; Don, Zuraidah Mohd.; Knowles, Gerald; Tang, Jennifer
2010-01-01
This paper makes an instrumental analysis of English vowel monophthongs produced by 47 female Malaysian speakers. The focus is on the distribution of Malaysian English vowels in the vowel space, and the extent to which there is phonetic contrast between traditionally paired vowels. The results indicate that, like neighbouring varieties of English,…
Self-Access Language Learning for Malaysian University Students
ERIC Educational Resources Information Center
Tse, Andrew Yau Hau
2012-01-01
Just a few Malaysian universities offer self-access language learning activities to students. The objective of this study is to investigate if self-access learning can promote self-directed or autonomous learning in a public Malaysian technical university. Data collection is by means of interviewing the Director, lecturers, and students in a…
Lexical Borrowing from Chinese Languages in Malaysian English
ERIC Educational Resources Information Center
Imm, Tan Siew
2009-01-01
This paper explores how contact between English and Chinese has resulted in the incorporation of Chinese borrowings into the lexicon of Malaysian English (ME). Using a corpus-based approach, this study analyses a comprehensive range of borrowed features extracted from the Malaysian English Newspaper Corpus (MEN Corpus). Based on the contexts of…
Iodine deficiency disorders in Sarawak, Malaysia.
Kiyu, A; Tambi, Z; Ahmad, Y
1998-12-01
The state of Sarawak in Malaysia has a high prevalence of iodine deficiency disorders (IDD). This has been revealed through a review of goitre surveys that were carried out in the State from the early 1970s to the 1990s. The primary cause was low iodine intake. Contributory factors were low iodine content in the soil and water as well as high cassava consumption. Virtual elimination of IDD is one of the nutritional goals of the IDD prevention and control programs. The strategies adopted include the iodination of coarse salt, which is sold in the market by shopkeepers and also provided free from government health clinics; legislation requiring that salt sold in IDD-gazetted areas must be iodised; and the use of iodinators to iodise water supplied by the gravity-feed system to villages and boarding schools in rural areas. The indicators used in the monitoring and evaluation of the program include the availability of iodised salt in the market and households, iodine levels in water supply that had been fitted with iodinators, goitre volume measured by ultrasound, and urinary iodine excretion among school children.
Young Adult Literature in the Malaysian Secondary School
ERIC Educational Resources Information Center
Govindarajoo, Mallika V.; Mukundan, Jayakaran
2013-01-01
This article presents the results of a study on the experience of the Malaysian secondary school student with Young Adult Literature in the English language classroom. The study aimed to determine the extent to which the Malaysian secondary school student identified with the young adult protagonists and issues in the novels which have been…
Knowledge and beliefs of Malaysian adolescents regarding cancer.
Al-Naggar, Redhwan Ahmed; Jillson, Irene Anne; Abu-Hamad, Samir; Mumford, William; Bobryshev, Yuri V
2015-01-01
Few studies have explored the knowledge and attitudes of adolescents toward cancer prevention and treatment. This lack of research and its potential utility in the development of new educational initiatives and screening methods, or the reconstruction of existing ones, provided the impetus for this study. The primary research aim was to assess secondary school student knowledge of cancer and determine whether or not they possessed basic knowledge of cancer symptoms, risk factors, and treatments and to determine the relationship between cancer knowledge and key demographic factors. The Management and Science University conducted a cross-sectional study analyzing responses through cross-tabulation with the socio-demographic data collected. The findings of our quantitative analysis suggest that Malaysian youth generally possess a moderate knowledge about cancer. Quantitative analyses found that socioeconomic inequalities and bias in education present as important factors contributing to cancer awareness, prevention, and treatment among Malaysian adolescents. The findings indicate that Malaysian youth generally possess a moderate knowledge about cancer but the current deficiencies in initiatives directed to cancer awareness continue to hinder the improvement in prevention of cancer among Malaysian adolescents.
Plasmodium knowlesi malaria in humans is widely distributed and potentially life-threatening
Cox-Singh, Janet; Davis, Timothy M. E.; Lee, Kim-Sung; Shamsul, Sunita S. G.; Matusop, Asmad; Ratnam, Shanmuga; Rahman, Hasan A.; Conway, David J; Singh, Balbir
2008-01-01
Background Until recently, Plasmodium knowlesi malaria in humans was misdiagnosed as P. malariae. The present objectives were to determine the geographic distribution of P. knowlesi in the human population in Malaysia and to investigate four suspected fatal cases. Methods Sensitive and specific nested-PCR was used to identify all Plasmodium species present in blood from i) 960 patients with malaria hospitalized in Sarawak, Malaysian Borneo from 2001-2006, ii) 54 P. malariae archival blood-films from 15 districts in Sabah, Malaysian Borneo (2003–2005) and four districts in Pahang, Peninsular Malaysia (2004–2005), and iii) suspected knowlesi fatalities. In the four latter cases, available clinical and laboratory data were reviewed. Results P. knowlesi DNA was detected in 266 of 960 (27·7%) of the samples from Sarawak hospitals, 41 of 49 (83·7%) from Sabah and all 5 from Pahang. Only P. knowlesi DNA was detected in archival blood films from the 4 fatal cases. All were hyperparasitemic and developed marked hepatorenal dysfunction. Conclusions Human infections with P. knowlesi, commonly misidentified as the more benign P. malariae, are widely distributed across Malaysian Borneo and extend to Peninsular Malaysia. Because P. knowlesi replicates every 24 hours, rapid diagnosis and prompt effective treatment are essential. In the absence of a specific routine diagnostic test for knowlesi malaria, we recommend that patients in, or who have travelled to, South-east Asia who are ill with a ‘P. malariae’ hyperparasitemia diagnosis by microscopy should receive intensive management as appropriate for severe falciparum malaria. PMID:18171245
Solar power for energy sustainability and environmental friendliness of Curtin University Sarawak
NASA Astrophysics Data System (ADS)
Palanichamy, C.; Goh, Alvin
2016-03-01
The demand on electrical energy is rapidly increasing. Everything around us requires electrical energy either during its production or usage stage. Sustainability has become the main concern nowadays as the availability of fossil fuels is limited. As renewable energy is the path-way to energy sustainability and environmental friendly environment, this paper proposes a solar power system for Curtin University Sarawak to reduce its electricity consumption and greenhouse gas emissions. The proposed 208 kW solar system saves an energy consumption of more than 380,000 kWh per year, and a CO2 offset by 285 Tons per year
Validity of the Brunel Mood Scale for use With Malaysian Athletes.
Lan, Mohamad Faizal; Lane, Andrew M; Roy, Jolly; Hanin, Nik Azma
2012-01-01
The aim of the present study was to investigate the factorial validity of the Brunel Mood Scale for use with Malaysian athletes. Athletes (N = 1485 athletes) competing at the Malaysian Games completed the Brunel of Mood Scale (BRUMS). Confirmatory Factor Analysis (CFA) results indicated a Confirmatory Fit Index (CFI) of .90 and Root Mean Squared Error of Approximation (RMSEA) was 0.05. The CFI was below the 0.95 criterion for acceptability and the RMSEA value was within the limits for acceptability suggested by Hu and Bentler, 1999. We suggest that results provide some support for validity of the BRUMS for use with Malaysian athletes. Given the large sample size used in the present study, descriptive statistics could be used as normative data for Malaysian athletes. Key pointsFindings from the present study lend support to the validity of the BRUMS for use with Malaysian athletes.Given the size of the sample used in the present study, we suggest descriptive data be used as the normative data for researchers using the scale with Malaysian athletes.It is suggested that future research investigate the effects of cultural differences on emotional states experienced by athletes before, during and post-competition.
Chigger (Acarina:Trombiculidae) surveys of the west coast beaches of Sabah and Sarawak.
Dohany, A L; Phang, O W; Rapmund, G
1977-06-01
Leptotrombidium (Leptotrombidium) arenicola Traub, a vector of scrub typhus, had previously been found to occur in the coastal vegetation behind the edge of open sand along the beaches of Peninsular Malaysia. Surveys of the west coast beaches of Sabah and Sarawak were conducted to determine if this species occurs in similar habitat in East Malaysia on the island of Borneo. Leptotrombidium (L.) arenicola was not collected from the eighteen sites studied. Of the 11,982 mite larvae collected, 55 per cent were L.(L.) deliense (Walch), a well-known, widespread vector of scrub typhus.
Malaysian registered nurses' professional learning.
Chiu, Lee H
2006-01-01
Findings of a study of the impact of professional learning on Malaysian registered nurses are reported. The offshore delivery post-registration nursing degree programme is a formal aspect of professional learning, which enables Malaysian registered nurses to upgrade their hospital-based training or diploma of nursing qualification to a degree. Using a qualitative case study approach, data were collected from twelve programme graduates, through individual and focus group interviews. The programme promoted their personal professional growth and enhanced their professional development. It increased self-confidence, knowledge, self-fulfillment, critical thinking ability, interpersonal skills, interest in research and research utilisation, and life-long learning. There was evidence of career mobility and a raised awareness of their professional role and responsibility.
Seaweed composition from Bintulu coast of Sarawak, Malaysia.
Zawawi, Mohd Hafizbillah; Idris, Mohd Hanafi; Kamal, Abu Hena Mustafa; King, Wong Sing
2014-08-01
Species composition of seaweed and distribution were investigated in the coastal waters of Bintulu, Sarawak. The seaweed samples were collected during low tide between May 2011 and May 2012 from the six different stations. In total 54 species of seaweeds were identified from study areas of Bintulu coastal waters. Among them, 23 species were from Rhodophyta with 11 families, 15 species were from Phaeophyta with 2 families and 16 species were from Chlorophyta with 10 families: Seventeen species of seaweeds were recorded from the Tanjung Batu, while 23 species from Pantai Telekom, 14 species from Golden Beach, 26 species from Kuala Similajau, 12 species from Kuala Nyalau and 21 species from Batu Mandi. Seaweeds abundance was high in rocky substrate and Rhodophyta (11 families and 23 species) was the common and highest group of seaweeds in this coastal areas. Present study recorded high diversified seaweed species at the rocky shore area compare to reef area.
NASA Astrophysics Data System (ADS)
Yunus, A. I. A.; Muhammad, W. M. N. W.; Saaid, M. N. F.
2018-04-01
Standard form of contract is normally being used in Malaysia construction industry in establishing legal relation between contracting parties. Generally, most of Malaysia federal government construction project used PWD203A which is a standard form of contract to be used where Bills of Quantities Form Part of the Contract and it is issued by Public Works Department (PWD/JKR). On the other hand in Sarawak, the largest state in Malaysia, the state government has issued their own standard form of contract namely JKR Sarawak Form of Contract 2006. Even both forms have been used widely in construction industry; there is still lack of understanding on both forms. The aim of this paper is to identify significant provision on both forms of contract. Document analysis has been adopted in conducting an in-depth review on both forms. It is found that, both forms of contracts have differences and similarities on several provisions specifically matters to definitions and general; execution of the works; payments, completion and final account; and delay, dispute resolution and determination.
Validity of the Brunel Mood Scale for use With Malaysian Athletes
Lan, Mohamad Faizal; Lane, Andrew M.; Roy, Jolly; Hanin, Nik Azma
2012-01-01
The aim of the present study was to investigate the factorial validity of the Brunel Mood Scale for use with Malaysian athletes. Athletes (N = 1485 athletes) competing at the Malaysian Games completed the Brunel of Mood Scale (BRUMS). Confirmatory Factor Analysis (CFA) results indicated a Confirmatory Fit Index (CFI) of .90 and Root Mean Squared Error of Approximation (RMSEA) was 0.05. The CFI was below the 0.95 criterion for acceptability and the RMSEA value was within the limits for acceptability suggested by Hu and Bentler, 1999. We suggest that results provide some support for validity of the BRUMS for use with Malaysian athletes. Given the large sample size used in the present study, descriptive statistics could be used as normative data for Malaysian athletes. Key points Findings from the present study lend support to the validity of the BRUMS for use with Malaysian athletes. Given the size of the sample used in the present study, we suggest descriptive data be used as the normative data for researchers using the scale with Malaysian athletes. It is suggested that future research investigate the effects of cultural differences on emotional states experienced by athletes before, during and post-competition. PMID:24149128
ERIC Educational Resources Information Center
International Planned Parenthood Federation, London (England).
Data relating to population and family planning in fourteen foreign countries are presented in these situation reports. Countries included are Australia, Burundi, Cambodia, Mexico, Montserrat, Nicaragua, Papua and New Guines, Republic of Vietnam, Sabah, Sarawak, Sierra Leone, Tahiti (French Polynesia), and Tonga. Information is provided under two…
Are Malaysian Children Achieving Dietary Guideline Recommendations?
Koo, Hui Chin; Poh, Bee Koon; Lee, Shoo Thien; Chong, Kar Hau; Bragt, Marjolijn C E; Abd Talib, Ruzita
2016-07-01
A large body of epidemiological data has demonstrated that diet quality follows a sociodemographic gradient. Little is known, however, about food group intake patterns among Malaysian children. This study aimed to assess consumption pattern of 7 food groups, including cereals/grains, legumes, fruits, vegetables, fish, meat/poultry, and milk/dairy products, among children 7 to 12 years of age. A total of 1773 children who participated in SEANUTS Malaysia and who completed the Food Frequency Questionnaire were included in this study. A greater proportion of children aged 10 to 12 years have an inadequate intake of cereals/grains, meat/poultry, legumes, and milk/dairy products compared with children 7 to 9 years old. With the exception of meat/poultry, food consumption of Malaysian children did not meet Malaysian Dietary Guidelines recommendations for the other 6 food groups, irrespective of sociodemographic backgrounds. Efforts are needed to promote healthy and balanced dietary habits, particularly for foods that fall short of recommended intake level. © 2016 APJPH.
A scientometrics and social network analysis of Malaysian research in physics
NASA Astrophysics Data System (ADS)
Tan, H. X.; Ujum, E. A.; Ratnavelu, K.
2014-03-01
This conference proceeding presents an empirical assessment on the domestic publication output and structure of scientific collaboration of Malaysian authors for the field of physics. Journal articles with Malaysian addresses for the subject area "Physics" and other sub-discipline of physics were retrieved from the Thomson Reuters Web of Knowledge database spanning the years 1980 to 2011. A scientometrics and social network analysis of the Malaysian physics field was conducted to examine the publication growth and distribution of domestic collaborative publications; the giant component analysis; and the degree, closeness, and betweenness centralisation scores for the domestic co-authorship networks. Using these methods, we are able to gain insights on the evolution of collaboration and scientometric dimensions of Malaysian research in physics over time.
Rashwan, Hesham; Lubis, Syarif Husin; Ni, Kiat Aun
2011-01-01
Cervical cancer is the third most common cancer in women in peninsular Malaysia and very prevalent worldwide. HPV vaccination and routine Pap smear testing are the best preventive measures. The objective of this study was to determine the knowledge level of secondary school students from Sarawak, East Malaysia regarding cervical cancer and its prevention. Multistage random sampling with various methods in each step was employed to select the sample of 76 students. Results showed that 61.8% had poor knowledge level of cervical cancer and its prevention. There were 60.5% of students who were aware of cervical cancer with Chinese and form four students showing significantly the highest awareness (p<0.05). The main source of cervical cancer information was from their parents (25.9%). HPV vaccination acceptance among students was 22.3% and an association was found between knowledge of cervical cancer with race and HPV vaccination acceptance (p<0.05). In conclusion, the students had poor knowledge level of cervical cancer, its prevention and HPV vaccination acceptance. More efforts should be made to improve cervical cancer knowledge and awareness of the public especially secondary school students in Sarawak. This in turn will enhance the practice of prevention against cervical cancer among students.
Similar taste-nutrient relationships in commonly consumed Dutch and Malaysian foods.
Teo, Pey Sze; van Langeveld, Astrid W B; Pol, Korrie; Siebelink, Els; de Graaf, Cees; Yan, See Wan; Mars, Monica
2018-06-01
Three recent studies showed that taste intensity signals nutrient content. However, current data reflects only the food patterns in Western societies. No study has yet been performed in Asian culture. The Malaysian cuisine represents a mixture of Malay, Chinese and Indian foods. This study aimed to investigate the associations between taste intensity and nutrient content in commonly consumed Dutch (NL) and Malaysian (MY) foods. Perceived intensities of sweetness, sourness, bitterness, umami, saltiness and fat sensation were assessed for 469 Dutch and 423 Malaysian commonly consumed foods representing about 83% and 88% of an individual's average daily energy intake in each respective country. We used a trained Dutch (n = 15) and Malaysian panel (n = 20) with quantitative sensory Spectrum™ 100-point rating scales and reference solutions, R1 (13-point), R2 (33-point) and R3 (67-point). Dutch and Malaysian foods had relatively low mean sourness and bitterness (
The Quest for Strategic Malaysian Quality National Primary School Leaders
ERIC Educational Resources Information Center
Ali, Hairuddin Mohd
2012-01-01
Purpose: The purpose of this paper is to investigate the nine-point strategic leadership characteristics of Malaysian Quality National Primary School Leaders (QNPSL) and to indicate the implications of these findings for the current educational management and leadership practices in their quest for Malaysian quality education.…
Assessing Quality of Working Life Among Malaysian Workers.
Sulaiman, Nur Suffia; Choo, Wan Yuen; Mat Yassim, Abdul Rahim; Van Laar, Darren; Chinna, Karuthan; Majid, Hazreen Abdul
2015-11-01
The Work-Related Quality of Life Scale-2 (WRQLS-2) has been used to measure quality of working life (QOWL) in the United Kingdom. In this study, the scale was translated and normalized into Malay. The scale was translated using the back-translation method, pretesting, and pilot testing. It was conducted among health care and office workers. It was tested in 3 stages; confirmatory factor analysis at stages 1 and 3 and exploratory factor analysis at stage 2. The Malaysian WRQLS-2 had 5 factors: "General Well-Being," "Job and Career Satisfaction," "Employee Engagement," "Home-Work Interface," and "Stress at Work." The scale showed good convergent and construct validity and also reliability. Perception of good QOWL may differ because of cultural influences and varying work environments. The validated Malaysian WRQLS-2 can be used to determine the QOWL of Malaysian office and health care workers. © 2015 APJPH.
Traditional Postpartum Practices Among Malaysian Mothers: A Review.
Fadzil, Fariza; Shamsuddin, Khadijah; Wan Puteh, Sharifa Ezat
2016-07-01
To briefly describe the postpartum practices among the three major ethnic groups in Malaysia and to identify commonalities in their traditional postpartum beliefs and practices. This narrative review collated information on traditional postpartum practices among Malaysian mothers through a literature search for published research papers on traditional postpartum practices in Malaysia. This review shows that Malaysian mothers have certain postpartum practices that they considered to be important for preventing future ill health. Despite the perceived differences in intra-ethnic postpartum practices, most Malaysian mothers, although from different ethnicities, share similarities in their postpartum regimens and practices in terms of beliefs and adherence to food taboos, use of traditional postpartum massage and traditional herbs, and acknowledgment of the role of older female family members in postpartum care. Health care providers should be aware of multiethnic traditional postpartum practices and use the commonalities in these practices as part of their postpartum care regimen.
Public acceptance of nuclear power among Malaysian students
NASA Astrophysics Data System (ADS)
Muhamad Pauzi, Anas; Saad, Juniza Md; Arif Abu Bakar, Asyraf; Hannan Damahuri, Abdul; Syukri, Nur Syamim Mohd
2018-01-01
Malaysian government’s aim to include nuclear energy for electricity generation has triggered various reactions from all especially the public. The objective of this study is to have a better understanding on the knowledge, sources of information of nuclear power and sources of energy chosen by Malaysian in 20 years’ time. Besides that, we want to examine the level of acceptance and perception of Malaysian towards nuclear energy and we want to identify the correlation between public perceptions with the acceptance towards nuclear power in Malaysia, and also to study the differences between perception and acceptance of nuclear power with gender and educational level. For this research methodology, the research questions are given orally or through paper-pencil and also social networking site such as Facebook or through electronic media application such as WhatsApp and Google docs. The data were analysed using a SPSS version 22.0 (Statistical Package for the Social Sciences). Results showed that more than 50% of the respondents have the knowledge of nuclear energy. A part of from that, only 39 % are confident government can afford to build NPP in Malaysia and 41 % disagree nuclear energy is the best option for future energy. From analysis using SPSS 22 we estimate negative perception will give a negative acceptance in term of support towards the use of nuclear energy in power generation in Malaysia. There are also slight correlation that the higher the level of education of Malaysian, the more negative the perception of Malaysian in accepting nuclear energy as source of power in Malaysia. Therefore in shaping a positive acceptance of NPP in Malaysia, the authorities need to educate the people with the knowledge of nuclear in order to overcome the negative perception towards nuclear power.
A Career Success Model for Academics at Malaysian Research Universities
ERIC Educational Resources Information Center
Abu Said, Al-Mansor; Mohd Rasdi, Roziah; Abu Samah, Bahaman; Silong, Abu Daud; Sulaiman, Suzaimah
2015-01-01
Purpose: The purpose of this paper is to develop a career success model for academics at the Malaysian research universities. Design/methodology/approach: Self-administered and online surveys were used for data collection among 325 academics from Malaysian research universities. Findings: Based on the analysis of structural equation modeling, the…
The Malaysian English Language Competency Dilemma: Recovering Lost Grounds through MUET.
ERIC Educational Resources Information Center
Chan, Swee Heng; Wong, Bee Eng
2002-01-01
Provides insights into the Malaysian English language policy, required standards, and testing in language use in Malaysian tertiary institutions. Gives information about backwash effects in particular about institutional programs related to the teaching of English as a Second Language. (Author/VWL)
Long-term Quaternary uplift rates inferred from limestone caves in Sarawak, Malaysia
NASA Astrophysics Data System (ADS)
Farrant, Andrew R.; Smart, Peter L.; Whitaker, Fiona F.; Tarling, Donald H.
1995-04-01
The rate of long-term (2 m.y.) base-level lowering estimated in an extensive sequence of limestone caves in Sarawak, Malaysia, from uranium series, electron spin resonance, and paleomagnetic dating is 0.19 +0.03/-0.04 m/ka. This rate has remained constant over at least the last 700 ka, as shown by comparison of the number and spacing of wall notches formed during phases of interstadial and interglacial aggradation with peaks in the deep-sea oxygen isotope curve. It is argued that base-level lowering occurs in response to epirogenic uplift of the more resistant limestones due to regional denudation of the softer shales, and to flexural isostacy associated with high rates of offshore sedimentation.
"All Abroad": Malaysians' Reasons for Seeking an Overseas-Based Doctorate
ERIC Educational Resources Information Center
Tagg, Brendon
2014-01-01
This article examines the process by which nine junior Malaysian academics came to complete doctoral degrees in non-Malaysian universities. It expands the scope and refines the focus of an existing study that considered international students' experiences in New Zealand. Part of the motivation for the current study was the researcher's recognition…
Chang, Ching Thon; Esterman, Adrain
2007-01-01
Delayed diagnosis of tuberculosis (TB) can lead to an increased period of infectivity in the community, a delay in treatment and a severe form of the disease. The objective of this study was to determine the length of delay, and factors linking the delay from the onset of symptoms of pulmonary tuberculosis (PTB) until the commencement of treatment in Sarawak, Malaysia. An institution based cross-sectional study was conducted in 10 TB clinics in randomly selected divisions in Sarawak from June 2003 to May 2004. Delay was analyzed from two perspectives: (1) period between the onset of TB symptoms to any first medical consultation (patients' delay); and (2) period between the first medical consultation to the diagnosis of TB (diagnosis delay). Patients were interviewed on diagnosis or within the admission period using a semi-structured questionnaire. A total of 316 new smear-positive PTB patients participated in the study. The median patient interval was 30 days. Gender was found to be significantly associated with patient delay. The median diagnosis interval was 22 days. Respondents' incomes, health-care professional first consulted and actions taken by the health-care providers during the first consultation were significantly associated with diagnosis delay. The medium treatment interval was 0 days. Both patients and health providers played a role in delaying TB diagnosis. Females appeared to have longer delay. Respondents living above the poverty line had diagnosis delay as they made more visits to GPs or different government clinics without proper investigations for TB. A mechanism is needed to increase all health-care providers' suspicion of TB so that proper investigations can be done during first consultation.
Clinical characteristics of basal cell carcinoma in a tertiary hospital in Sarawak, Malaysia.
Yap, Felix Boon Bin
2010-02-01
Basal cell carcinoma (BCC) is the most common skin cancer among Orientals. Data on this malignancy is lacking in Malaysia, prompting a retrospective study to determine the clinical characteristics in the skin clinic, Sarawak General Hospital between 2000 and 2008. Demographic data and clinical features of 64 histopathologically proven BCC from 43 patients were retrieved. Statistical analysis was performed comparing the clinical characteristics based on the region of involvement and gender. The mean age of presentation was 60.9 years. Male to female ratio was 1.05. Majority of the patients were Chinese (44.2%) followed by Malays (32.6%), Bidayuhs (14.0%) and Ibans (6.9%). Nodular BCC accounted for 95.3% of cases while 4.7% were superficial BCC. All the nodular BCC were pigmented. Ulceration was noted in 18%. There were 82.8% of BCC on the head and neck region and 17.2% on the trunk and limb region. BCC on the latter region were larger (mean 35.0 cf. 14.4 mm, p < 0.001) and ulcerated (45.5% cf. 11.3%, p = 0.01). Superficial BCC were also more frequently encountered in this region (18.2% cf. 1.9%, p = 0.02). Compared to women, men had larger BCC (mean 21.1 cf. 13.3 mm, p = 0.03) and kept them for a longer duration (mean 21.6 cf. 13.3 months, p = 0.04). Clinical characteristics of BCC in Sarawak were similar to other Asian studies. Additionally, BCC on the trunk and limbs and in men were larger, ulcerative and long standing warranting better efforts for earlier detection.
NASA Astrophysics Data System (ADS)
Krishnan, M. V. Ninu; Prasanna, M. V.; Vijith, H.
2018-05-01
Effect of climate change in a region can be characterised by the analysis of rainfall trends. In the present research, monthly rainfall trends at Limbang River Basin (LRB) in Sarawak, Malaysia for a period of 45 years (1970-2015) were characterised through the non-parametric Mann-Kendall and Spearman's Rho tests and relative seasonality index. Statistically processed monthly rainfall of 12 well distributed rain gauging stations in LRB shows almost equal amount of rainfall in all months. Mann-Kendall and Spearman's Rho tests revealed a specific pattern of rainfall trend with a definite boundary marked in the months of January and August with positive trends in all stations. Among the stations, Limbang DID, Long Napir and Ukong showed positive (increasing) trends in all months with a maximum increase of 4.06 mm/year (p = 0.01) in November. All other stations showed varying trends (both increasing and decreasing). Significant (p = 0.05) decreasing trend was noticed in Ulu Medalam and Setuan during September (- 1.67 and - 1.79 mm/year) and October (- 1.59 and - 1.68 mm/year) in Mann-Kendall and Spearman's Rho tests. Spatial pattern of monthly rainfall trends showed two clusters of increasing rainfalls (maximas) in upper and lower part of the river basin separated with a dominant decreasing rainfall corridor. The results indicate a generally increasing trend of rainfall in Sarawak, Borneo.
Malaysian Editorials on the "Allah" Issue: A Critical Discourse Study
ERIC Educational Resources Information Center
Sankar, Lokasundari Vijaya
2013-01-01
This article examines the coverage in three Malaysian newspapers on an issue popularly known as the "Allah" issue. In 2009, the Catholic Church took the Malaysian government to court over the right to use the word "Allah". In a landmark court decision, the Church was given the right to use the word "Allah" in the…
Malaysian nurses' evaluation of transnational higher education courses.
Arunasalam, Nirmala
The internationalisation of higher education has led some UK and Australian universities to deliver transnational higher education (TNHE) post-registration top-up nursing degree courses in Malaysia. These are bridging courses that allow registered nurses to upgrade their diploma qualifications to degree level. What is not sufficiently explored in the literature is nurses' evaluation of these courses and the impact of TNHE qualifications. A hermeneutic phenomenology approach was used to explore the views of 18 Malaysian nurses from one Australian and two UK TNHE universities. Semi-structured interviews were conducted to enable the Malaysian nurses to evaluate the courses. Data were analysed by thematic analysis. Findings showed a gap between Malaysian and Western teaching and learning outlook, professional values and clinical practices. The data give important insights at a time when the aim of Malaysia's investment in TNHE courses is to attain a graduate workforce with changed mindsets and enhanced patient care.
Yin, Zi-Wei; Li, Li-Zhen
2014-01-01
A new genus and species of the subtribe Batrisina from western Sarawak, Bryantinus matangus gen. et sp. n., is described, illustrated, and compared with related taxa. In addition, examination of a small series of batrisine material from Thailand revealed a new country record for Cerochusa cilioceps Yin & Nomura, which was previously known only from the island of Hainan in southern China. PMID:25409318
Managerial Coaches, Are They Ready? The Case of Malaysian Telecommunications Industry
ERIC Educational Resources Information Center
Chong, Chin Wei; Yuen, Yee Yen; Tan, Booi Chen; Zarim, Zainal Abu; Hamid, Norhasniza Abdul
2016-01-01
Purpose: This paper aims to identify the key competencies managerial coaches have and examine the significant competencies that affect coaching effectiveness in the Malaysian telecommunications industry. Design/Methodology/Approach: The unit of analysis was individual managerial coaches who were working in the Malaysian telecommunications…
Wijayanto, Titis; Wakabayashi, Hitoshi; Lee, Joo-Young; Hashiguchi, Nobuko; Saat, Mohamed; Tochihara, Yutaka
2011-07-01
The objective of this study was to investigate thermoregulatory responses to heat in tropical (Malaysian) and temperate (Japanese) natives, during 60 min of passive heating. Ten Japanese (mean ages: 20.8 ± 0.9 years) and ten Malaysian males (mean ages: 22.3 ± 1.6 years) with matched morphological characteristics and physical fitness participated in this study. Passive heating was induced through leg immersion in hot water (42°C) for 60 min under conditions of 28°C air temperature and 50% RH. Local sweat rate on the forehead and thigh were significantly lower in Malaysians during leg immersion, but no significant differences in total sweat rate were observed between Malaysians (86.3 ± 11.8 g m(-2) h(-1)) and Japanese (83.2 ± 6.4 g m(-2) h(-1)) after leg immersion. In addition, Malaysians displayed a smaller rise in rectal temperature (0.3 ± 0.1°C) than Japanese (0.7 ± 0.1°C) during leg immersion, with a greater increase in hand skin temperature. Skin blood flow was significantly lower on the forehead and forearm in Malaysians during leg immersion. No significant different in mean skin temperature during leg immersion was observed between the two groups. These findings indicated that regional differences in body sweating distribution might exist between Malaysians and Japanese during heat exposure, with more uniform distribution of local sweat rate over the whole body among tropical Malaysians. Altogether, Malaysians appear to display enhanced efficiency of thermal sweating and thermoregulatory responses in dissipating heat loss during heat loading. Thermoregulatory differences between tropical and temperate natives in this study can be interpreted as a result of heat adaptations to physiological function.
Hamli, Hadi; Idris, Mohd Hanafi; Rajaee, Amy Halimah; Kamal, Abu Hena Mustafa
2015-12-01
A study of the reproductive cycle of the hard clam, Meretrix lyrata, was documented based on histological observation and Gonad Index (GI). Samples were taken from estuarine waters of the Buntal River in Sarawak, Malaysia. The gonad of M. lyrata started to develop in September 2013. Gametogenesis continued to develop until the maturation and spawning stage from February to April 2014. The GI pattern for a one-year cycle showed a significant correlation with chlorophyll a. The corresponding GI with chlorophyll a suggested that the development of the reproductive cycle of M. lyrata required a high amount of food to increase gametogenesis.
SmartG: Spontaneous Malaysian Augmented Reality Tourist Guide
NASA Astrophysics Data System (ADS)
Kasinathan, Vinothini; Mustapha, Aida; Subramaniam, Tanabalan
2016-11-01
In effort to attract higher tourist expenditure along with higher tourist arrivals, this paper proposes a travel application called the SmartG, acronym for Spontaneous Malaysian Augmented Reality Tourist Guide, which operates by making recommendations to user based on the travel objective and individual budget constraints. The applications relies on augmented reality technology, whereby a three dimensional model is presented to the user based on input from real world environment. User testing returned a favorable feedback on the concept of using augmented reality in promoting Malaysian tourism.
Determinants for grading Malaysian rice
NASA Astrophysics Data System (ADS)
ChePa, Noraziah; Yusoff, Nooraini; Ahmad, Norhayati
2016-08-01
Due to un-uniformity of rice grading practices in Malaysia, zones which actively producing rice in Malaysia are using their own way of grading rice. Rice grading is important in determining rice quality and its subsequent price in the market. It is an important process applied in the rice production industry with the purpose of ensuring that the rice produced for the market meets the quality requirements of consumer. Two important aspects that need to be considered in determining rice grades are grading technique and determinants to be used for grading (usually referred as rice attributes). This article proposes the list of determinants to be used in grading Malaysian rice. Determinants were explored through combination of extensive literature review and series of interview with the domain experts and practitioners. The proposed determinants are believed to be beneficial to BERNAS in improving the current Malaysian rice grading process.
Performance of Malaysian Medical Journals
Abrizah, Abdullah
2016-01-01
Indexation status matters for scholarly journal prestige and trust. The performance of Malaysian medical journals at the international level is gauged through the global citation databases, and at the national level through MyCite, a national citation indexing system. The performance indicators include journals publication productivity, the citations they garner, and their scores on other bibliometric indices such as journal impact factor (IF), and h-index. There is a growing consciousness amongst journal editorials to improve quality and increase chances of getting indexed in MyCite. Although it is now possible to gauge journal performance within Malaysia, through MyCite, the government and public are concerned about journal performance in international databases. Knowing the performance of journals in MyCite will help the editors and publishers to improve the quality and visibility of Malaysian journals and strategise to bring their journal to the international level of indexation. PMID:27547108
Wang, Jichun; Luo, Enjie; Hirai, Makoto; Arai, Meiji; Abdul-Manan, Eas; Mohamed-Isa, Zaleha; Hidayah, Ni; Matsuoka, Hiroyuki
2008-10-01
The Malaysian people consist of several ethnic groups including the Malay, the Chinese, the Indian and the Orang Asli (aboriginal Malaysians). We collected blood samples from outpatients of 2 hospitals in the State of Selangor and identified 27 glucose-6-phosphate dehydrogenase (G6PD)-deficient subjects among these ethnic groups. In the Malay, G6PD Viangchan (871GA, 1311CT, IVS11 nt93TC) and G6PD Mahidol (487GA) types, which are common in Cambodia and Myanmar, respectively, were detected. The Malay also had both subtypes of G6PD Mediterranean:the Mediterranean subtype (563CT, 1311CT, IVS11 nt93TC) and the Indo-Pakistan subtype (563CT, 1311C, IVS11 nt93T). In Malaysians of Chinese background, G6PD Kaiping (1388GA), G6PD Canton (1376GT) and G6PD Gaohe (95AG), which are common in China, were detected. Indian Malaysians possessed G6PD Mediterranean (Indo-Pakistan subtype) and G6PD Namoru (208TC), a few cases of which had been reported in Vanuatu and many in India. Our findings indicate that G6PD Namoru occurs in India and flows to Malaysia up to Vanuatu. We also discovered 5 G6PD-deficient cases with 2 nucleotide substitutions of 1311CT and IVS11 nt93TC, but without amino-acid substitution in the G6PD molecule. These results indicate that the Malaysian people have incorporated many ancestors in terms of G6PD variants.
Electrolyte profile of Malaysian mothers' milk.
Alaudeen, S; Muslim, N; Faridah, K; Azman, A; Arshat, H
1988-12-01
The influence of socioeconomic status (ethnicity, income and parity) on electrolyte composition (sodium and potassium) in human milk is little known. We have thus quantitatively analyzed approximately 700 samples of milk (1-90 days postpartum) obtained from healthy Malaysian mothers' (Malay, Chinese and Indians) of full term infants. Results show that the mean concentration (mmol/l) of sodium is highest (48.2+or-1.7, Mean+or-SEM) in the Malaysian mothers' colostrum and this value decreased by 30% in their transitional milk and remained constant throughout subsequent days of lactation (mature milk). Ethnically, it is found that the level of sodium in colostrum of Malay and Chinese mothers were similar while the Indian mothers' colostrum showed apparently higher value (52.7+or-3.4 mmol/l) that is statistically insignificant. The transitional milk of all 3 ethnic groups studied exhibited similar levels of sodium. On subsequent days of lactation (mature milk) the Malay mothers exhibited lowest concentration (25.9+or-2.6 mmol/l) of sodium that is significantly (P0.05) different from that of Chinese and Indian mothers. Income and parity do not significantly affect the sodium level in Malaysian mothers' milk during all stages of lactation studied. The level of potassium, however did not change significantly with days of lactation. Like sodium, potassium too was not influenced by income and parity. (Author's).
Electrolyte profile of Malaysian mothers' milk.
Shaikh Alaudeen; Nor Muslim; Kamarul Faridah; Ali Azman; Hamid Arshat
1988-12-01
The influence of socioeconomic status (ethnicity, income, and parity) on electrolyte composition (sodium and potassium) in human milk is little known. The authors have thus quantitatively analyzed approximately 700 samples of milk (1-90 days postpartum) obtained from healthy Malaysian mothers (Malay, Chinese, and Indians) of full-term infants. Results show that the mean concentration (mmol/1) of sodium is highest 48.2 +/- 1.7; mean +/- SEM) in the Malaysian mothers' colostrum and this value decreased by 30% in their transitional milk and remained constant throughout subsequent days of lactation. Ethnically, it is found that the level of sodium in colostrum of Malay and Chinese mothers was similar but the Indian mothers' colostrum showed apparently higher value (52.7 +/- 3.4 mmpl/1) that is statistically insignificant. The transitional milk of all 3 ethnic groups studied exhibited similar levels of sodium. On subsequent days of lactation (mature milk) the Malay mothers exhibited the lowest concentration (25.9 +/- 2.6 mmol/1) of sodium that is significantly (p .05) different from that of Chinese and Indian mothers. Income and parity do not significantly affect the sodium level in Malaysian mothers' milk during all stages of lactation studied. The level of potassium, however, did not change significantly with days of lactation. Like sodium, potassium too was not influenced by income and parity.
ERP and Knowledge Management Integration: The Case of Malaysian Business Firms
ERIC Educational Resources Information Center
Supramaniam, Mahadevan; Kuppusamy, Mudiarasan
2010-01-01
In order to compete in a global environment, Malaysian business firms need to improve their products and services through best practices. This paper aims to investigate the critical success factors to adopt Enterprise Resource Planning (ERP) with knowledge management (KM) strategies among Malaysian business firms. In order to achieve the research…
Online Activities of Urban Malaysian Adolescents: Report of a Pilot Study
ERIC Educational Resources Information Center
Tan, Kok Eng; Yen Abdullah, Melissa Ng Lee; Guan Saw, Kim
2012-01-01
The literacy practices of many communities today show new ways of meaning making in the contemporary, technological and digital culture. A number of Malaysian adolescents belong to this culture. This pilot study reports the preliminary findings of a larger study aimed at describing the online activities of Malaysian adolescents. Fifty-four…
Barriers to Seeking School Counselling: Malaysian Chinese School Students' Perspectives
ERIC Educational Resources Information Center
Chen, Kai Shen; Kok, Jin Kuan
2017-01-01
School counselling services have always been unpopular among Malaysian students. Many researchers have studied what prevents students from seeking mental health services. However, there is a lack of study on the barriers to seeking help in the context of Malaysian school counselling services. Using a sample of Chinese high school students (N =…
Comparison of features and outcomes of perforated peptic ulcer between Malaysians and foreigners.
Kugan, V; Mahadevan, D T; Kandasami, P
2016-02-01
Perforated peptic ulcers (PPU) present as serious surgical emergencies that carry high mortality and morbidity. Foreigners with PPU are also managed in our hospital setting. Their inclusion significantly alters the trend and pattern of PPU seen in Malaysia. To compare per-operative and post-operative features and outcomes of perforated peptic ulcers between Malaysians and foreigners. This was an analytical crosssectional study. All patients who underwent repair of perforated peptic ulcer disease during a 6-year period were included. 50 consecutive patients' records with perforated peptic ulcer were analysed. Data were collected from operation theatre database and hospital medical records. Chi square and t test were performed using SPSS statistical software. Total of 50 patients, of which 30 were Malaysians and 20 were foreigners. The mean age of Malaysian patients was 58.3 ± 15.2 years whereas the mean age for foreign patients was 30.3 ± 6.7 years, with foreign patients being significantly younger than local patients. Foreigners had significantly smaller ulcers with only 5% of them having ulcers more than 1cm while 36.7% of Malaysian patients had ulcers more than 1cm. Post-operative complications are significantly higher in Malaysian patients (p<0.05) with 40% of Malaysian patients and 10% of foreign patients developing post-operative complications. Foreign patients are younger with significantly smaller perforated ulcers and better post-operative outcomes.
Malaysian growth centiles for children under six years old.
Bong, Yiibonn; Shariff, Asma Ahmad; Mohamed, Abdul Majid; Merican, Amir Feisal
2015-03-01
Growth references are useful for the screening, assessment and monitoring of individual children as well as for evaluating various growth promoting interventions that could possibly affect a child in early life. To determine the growth centiles of Malaysian children and to establish contemporary cross-sectional growth reference charts for height and weight from birth to 6 years of age based on a representative sample of children from Malaysia. Gender- and age-specific centile curves for height and weight were derived using the Cole's LMS method. Data for this study were retrieved from Malaysian government health clinics using a two-stage stratified random sampling technique. Assessment of nutritional status was done with the SD scores (Z-scores) of WHO 2006 standards. Boys were found to be taller and heavier than girls in this study. The median length of Malaysian children was higher than the WHO 2006 standards and CDC 2000 reference. The overall prevalence of stunting and underweight were 8.3% and 9.3%, respectively. This study presents the first large-scale initiative for local reference charts. The growth reference would enable the growth assessment of a Malaysian child compared to the average growth of children in the country. It is suggested that the use of WHO 2006 Child Growth Standards should be complemented with local reference charts for a more wholesome growth assessment.
Grace Kho, Woei Feng; Cheah, Whye Lian; Hazmi, Helmy
2018-03-01
Hypertension is a health issue affecting adolescents. Accumulating evidence affirms that elevated blood pressure begins in childhood and tracks into adulthood. This cross-sectional study was conducted to determine the prevalence of elevated blood pressure and its predictors among secondary school students in Sarawak, Malaysia. A total of 2,461 secondary school students aged 12-17 years from 19 schools in Sarawak participated in the study. Questionnaire was used to obtain socio-demographic data, parental history of hypertension, and self-reported physical activity. Anthropometric and blood pressure measurements were taken. Data was entered and analysed using SPSS version 23.0. The prevalence of adolescents with elevated blood pressure, overweight, central obesity, and overfat were 30.1%, 24.3%, 13.5%, and 6.7%, respectively. Multivariate logistic regression demonstrated the predictors significantly associated with elevated blood pressure among respondents: overweight (adjusted odds ratio=3.144), being male (adjusted odds ratio=3.073), being Chinese (adjusted odds ratio=2.321) or Iban (adjusted odds ratio=1.578), central obesity (adjusted odds ratio=2.145), being overfat (adjusted odds ratio=1.885), and being an older adolescent (adjusted odds ratio=1.109). Parental history of hypertension, locality, and physical activity showed no significant associations. The obesity epidemic must be tackled at community and school levels by health education and regulation of school canteen foods. Copyright© by the National Institute of Public Health, Prague 2018.
Hamli, Hadi; Idris, Mohd Hanafi; Rajaee, Amy Halimah; Kamal, Abu Hena Mustafa
2015-01-01
A study of the reproductive cycle of the hard clam, Meretrix lyrata, was documented based on histological observation and Gonad Index (GI). Samples were taken from estuarine waters of the Buntal River in Sarawak, Malaysia. The gonad of M. lyrata started to develop in September 2013. Gametogenesis continued to develop until the maturation and spawning stage from February to April 2014. The GI pattern for a one-year cycle showed a significant correlation with chlorophyll a. The corresponding GI with chlorophyll a suggested that the development of the reproductive cycle of M. lyrata required a high amount of food to increase gametogenesis. PMID:26868710
Space Shuttle radar investigations of Indonesia
NASA Technical Reports Server (NTRS)
Ford, J. P.; Sabins, F. F., Jr.
1986-01-01
A preliminary interpretation of structure and lithology from selected Shuttle Imaging Radar-B (SIR-B) images of Borneo, collected in October 1984, is presented. The SIR-B images, obtained at depression angles that ranged from 40 to 50 deg, were interpreted by using the approaches suggested by Sabins (1983). On the basis of radar signatures, six terrain categories; coastal and alluvial plains, and carbonate, clastic, volcanic, and melange, rocks, were defined in east, central, and south Kalimantan, and in the Malaysian state of Sarawak.
Inclusion in Malaysian Integrated Preschools
ERIC Educational Resources Information Center
Sukumaran, Sailajah; Loveridge, Judith; Green, Vanessa A.
2015-01-01
Inclusive education has been introduced through a number of policy developments in Malaysia over the last 10 years but there is little research investigating the extent and nature of inclusive education for preschoolers with special educational needs (SEN). This study surveyed both regular and special education teachers in Malaysian integrated…
Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak).
Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin
2010-12-01
There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presence of the Sunda colugo throughout Malaysia. The various ethnic groups of Malaysia adopted 37 different vernacular names to describe the Sunda colugo. This baseline data can be useful for the management authorities in conducting periodic monitoring and will enhance our knowledge of the population dynamics of the Sunda colugo in Malaysia.
Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak)
Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin
2010-01-01
There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presence of the Sunda colugo throughout Malaysia. The various ethnic groups of Malaysia adopted 37 different vernacular names to describe the Sunda colugo. This baseline data can be useful for the management authorities in conducting periodic monitoring and will enhance our knowledge of the population dynamics of the Sunda colugo in Malaysia. PMID:24575200
ERIC Educational Resources Information Center
Minton, Gianna; Poh, Anna Norliza Zulkifli; Ngeian, Jenny; Peter, Cindy; Tuen, Andrew Alek
2012-01-01
Community workshops were held in coastal locations in Sarawak to raise awareness of cetacean conservation. Interviews were conducted up to 2 years later in four "workshop communities" as well as four villages where workshops were not conducted. Comparison of responses between respondents who had attended workshops (n = 127) versus those…
Innovation value chain capability in Malaysian-owned company: A theoretical framework
NASA Astrophysics Data System (ADS)
Abidin, Norkisme Zainal; Suradi, Nur Riza Mohd
2014-09-01
Good quality products or services are no longer adequate to guarantee the sustainability of a company in the present competitive business. Prior research has developed various innovation models with the hope to better understand the innovativeness of the company. Due to countless definitions, indicators, factors, parameter and approaches in the study of innovation, it is difficult to ensure which one will best suit the Malaysian-owned company innovativeness. This paper aims to provide a theoretical background to support the framework of the innovation value chain capability in Malaysian-owned Company. The theoretical framework was based on the literature reviews, expert interviews and focus group study. The framework will be used to predict and assess the innovation value chain capability in Malaysian-owned company.
Teachers' Knowledge and Understanding of the Malaysian School-Based Oral English Assessment
ERIC Educational Resources Information Center
Sidhu, Gurnam Kaur; Fook, Chan Yuen; Mohamad, Azleena
2011-01-01
Purpose: The paper sought to investigate TESL teachers' knowledge and understanding of the Malaysian School Based Oral English Assessment (SBOEA) after five years into its implementation in upper secondary ESL classrooms in Malaysian public schools Method: The descriptive study involved a total of 80 TESL trained teachers from the 19 schools…
A comparison of hand-arm vibration syndrome between Malaysian and Japanese workers.
Su, Anselm Ting; Fukumoto, Jin; Darus, Azlan; Hoe, Victor C W; Miyai, Nobuyuki; Isahak, Marzuki; Takemura, Shigeki; Bulgiba, Awang; Yoshimasu, Kouichi; Maeda, Setsuo; Miyashita, Kazuhisa
2013-01-01
The aim of this study was to investigate the clinical characteristics of HAVS in a tropical environment in comparison with a temperate environment. We conducted a series medical examinations among the forestry, construction and automobile industry workers in Malaysia adopting the compulsory medical examination procedure used by Wakayama Medical University for Japanese vibratory tools workers. We matched the duration of vibration exposure and compared our results against the Japanese workers. We also compared the results of the Malaysian tree fellers against a group of symptomatic Japanese tree fellers diagnosed with HAVS. Malaysian subjects reported a similar prevalence of finger tingling, numbness and dullness (Malaysian=25.0%, Japanese=21.5%, p=0.444) but had a lower finger skin temperature (FST) and higher vibrotactile perception threshold (VPT) values as compared with the Japanese workers. No white finger was reported in Malaysian subjects. The FST and VPT of the Malaysian tree fellers were at least as bad as the Japanese tree fellers despite a shorter duration (mean difference=20.12 years, 95%CI=14.50, 25.40) of vibration exposure. Although the vascular disorder does not manifest clinically in the tropical environment, the severity of HAVS can be as bad as in the temperate environment with predominantly neurological disorder. Hence, it is essential to formulate national legislation for the control of the occupational vibration exposure.
Khan, Nusrat N; Yahya, Badi'ah; Abu Bakar, Abd Kadir; Ho, Roger C
2015-05-01
The Malaysian Mental Health Act 2001 did not come into effect until the Mental Health Regulations 2010 came into force. The Act provides a framework for the delivery of comprehensive care, treatment, control, protection and rehabilitation of those with mental disorders. The Act governs the establishment of private and government psychiatric hospitals, psychiatric nursing homes and community mental health centres. This paper outlines the provisions of the Act and the Regulations.
Teachers' Perception of Mobile Edutainment for Special Needs Learners: The Malaysian Case
ERIC Educational Resources Information Center
Mohd Yusof, Anuar; Daniel, Esther Gnanamalar Sarojini; Low, Wah Yun; Ab. Aziz, Kamarulzaman
2014-01-01
Study of Malaysian adoption of mobile learning (m-learning) is still in the early stages. However, there are numerous researchers in the country exploring the potential and application of m-learning in the Malaysian education system, including special education. A key question is whether teachers are prepared to incorporate mobile technology as…
Radiological emergency: Malaysian preparedness and response.
Yusof, Mohd Abd Wahab; Ali, Hamrah Mohd
2011-07-01
Planning and preparation in advance for radiological emergencies can help to minimise potential public health and environmental threats if and when an actual emergency occurs. During the planning process, emergency response organisations think through how they would respond to each type of incident and the resources that will be needed. In Malaysia, planning, preparation for and response to radiological emergencies involve many parties. In the event of a radiological emergency and if it is considered a disaster, the National Security Council, the Atomic Energy Licensing Board and the Malaysian Nuclear Agency (Nuclear Malaysia) will work together with other federal agencies, state and local governments, first responders and international organisations to monitor the situation, contain the release, and clean up the contaminated site. Throughout the response, these agencies use their protective action guidelines. This paper discusses Malaysian preparedness for, and response to, any potential radiological emergency.
Factors Affecting Hypertension among the Malaysian Elderly
Eshkoor, Sima Ataollahi; Hamid, Tengku Aizan; Shahar, Suzana; Ng, Chee Kyun; Mun, Chan Yoke
2016-01-01
Hypertension is a common chronic disease in the elderly. This study aimed to determine the effects of age, ethnicity, gender, education, marital status, nutritional parameters, and blood elements on the risk of high blood pressure in the Malaysian elderly. This research was conducted on a group of 2322 non-institutionalized Malaysian elderly. The hierarchy binary logistic regression analysis was applied to estimate the risk of hypertension in respondents. Approximately, 45.61% of subjects had hypertension. The findings indicated that the female gender (Odds ratio (OR) = 1.54), an increase in body weight (OR = 1.61), and an increase in the blood levels of albumin (OR = 1.51), glucose (OR = 1.92), and triglycerides (OR = 1.27) significantly increased the risk of hypertension in subjects (p < 0.05). Conversely, an increase in both dietary carbohydrates (OR = 0.74), and blood cholesterol level (OR = 0.42) significantly reduced the risk of hypertension in samples (p < 0.05). Furthermore, the results showed that ethnicity was a non-relevant factor to increase the risk of hypertension in subjects. It was concluded that female gender, an increase in body weight, and an increase in the blood levels of glucose, triglycerides, and albumin enhanced the risk of high blood pressure in the Malaysian elderly. In addition, an increase in both dietary carbohydrates and blood cholesterol level decreased hypertension in subjects. PMID:29367559
Belongingness in the workplace: a study of Malaysian nurses' experiences.
Mohamed, Z; Newton, J M; McKenna, L
2014-03-01
The need to belong has been proposed as the most basic need for human psychological well-being. Lack of belongingness has been associated with stress, anxiety and lack of esteem. Social and psychological functioning in the workplace has been linked to nurses' interconnection with others and their perceptions of belongingness. To explore factors contributing to Malaysian nurses' sense of belonging in the workplace. A descriptive questionnaire survey of registered nurses (n = 437) working in two Malaysian hospitals was conducted in 2011. Previously validated questionnaires translated into the Malay language were used. Data were analysed using SPSS 19.0. Nurses enhanced their sense of belonging through acceptance, 'fitting in', respect and group harmony. There were no specific demographic factors contributing to the nurses' perceptions. The findings suggest that these priorities for belongingness were contextually influenced by factors such as elements of Malaysian culture, the nature of nurses' teamwork and stereotypical values on the nursing profession. Data were collected in only two hospitals. Experiences of nurses in other hospitals and areas of Malaysia may not be similar. The influence of Malaysian culture in this study raises issues about utilization of a measurement scale developed in Western cultures, which may not directly accord with cultural values of an Eastern ethnicity. Aspects of belongingness in Malaysian nurses reflect those of nurses elsewhere. However, there are specific cultural influences at play. Therefore, development of a measurement scale based on Eastern culture would help in increasing understanding of workplace practices among these groups. Workplaces that perpetuate an environment that is not conducive to generating a sense of belonging may have an untoward impact on care delivery. Healthcare policies need to ensure patient care has a focus on engaging practitioners within multidisciplinary teams. © 2013 International Council of
ENTEROAGGREGATIVE ESCHERICHIA COLI O104 FROM THAI AND IMPORTED MALAYSIAN RAW BEEF.
Wameadesa, Nureesan; Sae-lim, Aphisara; Hayeebilan, Fadeeya; Rattanachuay, Pattamarat; Sukhumungoon, Pharanai
2017-03-01
Local Thai and imported Malaysian beef in southern Thailand area carry several Shiga toxin-producing Escherichia coli (STEC) serotypes. STEC O104 is an important pathogen capable of causing outbreaks with considerable morbidity and mortality. This study investigated the presence of E. coli O104 from local Thai and imported Malaysian beef obtained from markets in Hat Yai City, Songkhla Province during August 2015 - February 2016. Thirty-one E. coli O104 strains were isolated from 12 beef samples (16% and 23% Thai and imported Malaysian, respectively). Thirty strains possessed aggA (coding for a major component of AAF/I fimbriae), a gene associated with enteroaggregative E. coli (EAEC) pathotype, and all strains carried fimH (encoding Type 1 fimbriae). Thirty strains belonged to phylogenetic group B1 and one strain (from Malaysian beef) to group A. Agglutination of yeast cells was observed among 29 E. coli O104 strains. Investigation of stx2 phage occupancy loci demonstrated that sbcB was occupied in 12 strains. Antimicrobial susceptibility assay revealed that 7 strains were resistant to at least one antimicrobial agent and two were multi-drug resistant. One strain carried extended spectrum β-lactamase gene blaCTX-M and three carried blaTEM. PFGE-generated DNA profiling showed identical DNA pattern between that of one EAEC O104 strain from Thai beef and another from Malaysian beef, indicating that these two strains originated from the same clone. This is the first report in Thailand describing the presence of EAEC O104 from both Thai and imported Malaysian beef and their transfer between both countries. Thorough surveillance of this pathogen in fresh meats and vegetables should help to prevent any possible outbreak of E. coli O104.
ERIC Educational Resources Information Center
Bajunid, Ibrahim Ahmad
2011-01-01
This paper addresses the contemporary development and reform challenges in tertiary education in Malaysia in both national and global contexts. The critical role exercised by the Malaysian Qualifications Agency in driving strategic change in higher education cultures, both in public and private universities is described and analysed. The paper…
Mustafa, Ayman G; Allouh, Mohammed Z; Mustafa, Intisar G; Hoja, Ibrahim M
2013-07-01
The study aims to investigate anatomy learning styles and strategies of Jordanian and Malaysian medical students at the Jordan University of Science and Technology. The study is a cross-sectional questionnaire-based study. Students' responses for the questionnaire were numerically coded, and the results were analyzed to reveal statistically significant differences between Jordanian and Malaysian students. The results showed that Jordanian medical students were less interested in using cadavers in learning anatomy than Malaysian medical students. However, similar to their Malaysian counterparts, they prefer to employ other tools to learn anatomy like plastinated models and Internet-based resources. In addition to the aforementioned tools, Malaysian students were more interested in using cross-sectional images and making their own revision cards. Both Jordanian and Malaysian medical students were more interested in learning anatomy through clinical cases, and by system rather than by region. Moreover, it was revealed that Jordanian medical students learn anatomy more efficiently when they formulate a general view of a particular topic. Both Jordanian and Malaysian medical students also relied on reciting definitions and memorizing facts to learn anatomy. The study also reported significant differences between Jordanian and Malaysian students' perspectives on learning anatomy. The findings of the study suggest that Jordanian and Malaysian medical students posses different cultures of learning. Jordanian anatomy instructors need to consider these different learning cultures when they prepare their instructional methods and teaching materials to fulfill the educational needs of their culturally diverse students.
Predictors and prevalence of successful aging among older Malaysians.
Hamid, Tengku Aizan; Momtaz, Yadollah Abolfathi; Ibrahim, Rahimah
2012-01-01
Successful aging is an important and worldwide concept in gerontology. However, until recently, there has been very little known about successful aging in Malaysia. This study was designed to describe the prevalence and correlates of successful aging among older Malaysians. Data for this study were obtained from the national survey 'The Mental Health and Quality of Life of Older Malaysians'. For this study, successful aging was defined based on a multidimensional model, encompassing the avoidance of chronic disease and physical functioning difficulty, and maintenance of good psychocognitive functioning. The prevalence of successful aging among older Malaysians was calculated at 13.8% (CI: 12.6-15.1). Results of multiple logistic regression analysis showed that age, educational attainment, household income, and ethnicity were significantly associated with successful aging. Results of this study show that successful agers were more likely to be among the younger age, ethnic Chinese, and those with a higher education level and household income, after adjusting for all other variables in the model. Copyright © 2011 S. Karger AG, Basel.
NASA Astrophysics Data System (ADS)
Kon, Cynthia Mui Lian; Labadin, Jane
2016-06-01
Malaria is a critical infection caused by parasites which are spread to humans through mosquito bites. Approximately half of the world's population is in peril of getting infected by malaria. Mosquito-borne diseases have a standard behavior where they are transmitted in the same manner, only through vector mosquito. Taking this into account, a generic spatial-temporal model for transmission of multiple mosquito-borne diseases had been formulated. Our interest is to reproduce the actual cases of different mosquito-borne diseases using the generic model and then predict future cases so as to improve control and target measures competently. In this paper, we utilize notified weekly malaria cases in four districts in Sarawak, Malaysia, namely Kapit, Song, Belaga and Marudi. The actual cases for 36 weeks, which is from week 39 in 2012 to week 22 in 2013, are compared with simulations of the generic spatial-temporal transmission mosquito-borne diseases model. We observe that the simulation results display corresponding result to the actual malaria cases in the four districts.
Khan, Nusrat N.; Yahya, Badi’ah; Abu Bakar, Abd Kadir; Ho, Roger C.
2015-01-01
The Malaysian Mental Health Act 2001 did not come into effect until the Mental Health Regulations 2010 came into force. The Act provides a framework for the delivery of comprehensive care, treatment, control, protection and rehabilitation of those with mental disorders. The Act governs the establishment of private and government psychiatric hospitals, psychiatric nursing homes and community mental health centres. This paper outlines the provisions of the Act and the Regulations. PMID:29093848
Review on Malaysian Rail Transit Operation and Management System: Issues and Solution in Integration
NASA Astrophysics Data System (ADS)
Masirin, Mohd Idrus Mohd; Salin, Aminah Mohd; Zainorabidin, Adnan; Martin, David; Samsuddin, Norshakina
2017-08-01
In any context, operation and management of transportation systems are key issues which may affect both life quality and economic development. In large urban agglomerations, an efficient public transportation system may help abate the negative externalities of private car use such as congestion, air and noise pollution, accident and fuel consumption, without excessively penalizing user travel times or zone accessibility. Thus, this study is conducted to appraise the Malaysian rural rail transit operation and management system, which are considered important as there are many issues and solution in integration of the services that need to be tackled more conscientiously. The purpose of this paper is to describe some of the most important issues on integration of services and rail transit system in Malaysian and how to solve or reduce these problems and conflicts. In this paper, it consists of the historical development of rail transit construction in Malaysia. This paper also attempts to identify the important issues related to rail transit services and integration in Malaysian rural rail operation and management system. Comparison is also conducted with other countries such as UK, France, and Japan. Finally, a critical analysis is presented in this paper by looking at the possible application for future Malaysian rail transit operation system and management, especially focusing on enhancing the quality of Malaysian rural rail transit. In conclusion, this paper is expected to successfully review and appraise the existing Malaysian rural rail transit operation and management system pertaining to issues & solution in integration. It is also hoped that reformation or transformation of present service delivery quality of the rail transit operation and management will enable Malaysia to succeed in transforming Malaysian transportation system to greater heights.
Entrepreneurship Education Programs in Malaysian Polytechnics
ERIC Educational Resources Information Center
Othman, Norasmah; Nasrudin, Norfadhilah
2016-01-01
Purpose: The purpose of this paper is to evaluate students' views on the on-the-campus entrepreneurship programs in Malaysian polytechnics. Participation in the entrepreneurship programs is able to stimulate an interest in entrepreneurship, and improve the knowledge, skills, and entrepreneurial experience of its students.…
Emotional Health and Self-esteem Among Adolescents in Malaysian Orphanages.
Mohammadzadeh, Marjan; Awang, Hamidin; Kadir Shahar, Hayati; Ismail, Suriani
2018-01-01
This study aimed to assess the prevalence and risk factors of depression, anxiety, stress and low self-esteem among institutional Malaysian adolescents. This cross-sectional descriptive study included 287 adolescents aged 12-18 years living in six selected orphan homes. Study's instruments included Socio-demographic questionnaire, validated Malay version of Depression Anxiety Stress Scale-21 and Rosenberg Self-Esteem Scale. The findings revealed that 85.2, 80.1 and 84.7% of participants had depression, anxiety and stress respectively. Females were more likely to be depressed. Furthermore, anxiety was significantly associated with race and age but no significant associations between stress and the demographic factors were found. The study also showed that 70.8% of males and 69.2% of females had low self-esteem and the self-esteem was associated with depression, anxiety and stress.Therefore, mental health problems are very common among adolescents in Malaysian orphanages. Results reveal the urgency of immediate actions to reduce the mental health problems among Malaysian institutional adolescents.
Management of heatstroke in Malaysian pilgrims in Saudi Arabia.
Merican, M I
1989-09-01
Heat stroke is hardly seen in Malaysia. However, it occurs commonly in Saudi Arabia during the Haj season. Many Malaysian pilgrims are affected every year and some die. Having faced this environmental hazard for eight years, the Malaysian Medical Mission, sent each year to look after our pilgrims, modified its treatment strategy in 1988 and successfully decreased the overall morbidity and mortality of affected patients without the use of sophisticated equipment. A brief account of the management of 17 cases seen in 1988 is given. Only one died following treatment. The rest recovered fully without any residual neurological deficit or other complications.
Growth curves for school children from Kuching, Sarawak: a methodological development.
Bong, Yii Bonn; Shariff, Asma Ahmad; Mohamed, Abdul Majid; Merican, Amir Feisal
2015-03-01
In this article, the authors propose reference curves for height and weight for school children in the Kuching area, Sarawak. The school children were from primary to secondary schools (aged 6.5 to 17 years old) and comprised both genders. Anthropometric measurements and demographic information for 3081 school-aged children were collected (1440 boys and 1641 girls). Fitted line plots and percentiles for height and weight (3rd, 10th, 25th, 50th, 75th, 90th, and 97th percentiles) were obtained. The height of school boys and school girls were almost similar at the start of their school-going age. For school girls, height and weight values stabilized when they reached 16 or 17 years old but kept increasing for school boys. School boys were taller than school girls as they entered adolescence. Height differences between school boys and school girls became significantly wider as they grew older. Chinese school children were taller and heavier than those of other ethnic groups. © 2012 APJPH.
Muslim refugees in Southeast Asia, the Malaysian response.
Dorall, R F
1988-01-01
This article surveys the arrivals of Muslim refugees from countries in Southeast Asia who have not only come to Malaysia for political refuge, but who have also stayed on, in many instances integrating into the local Muslim community. The author concludes that Burmese, Thai, and Filipino Muslim refugee-cum-migrants, and the estimated 500,000 illegal Indonesian migrant workers in East and Peninsular Malaysia make the presence of economic migrants in Malaysia's towns and rural sectors a far more pressing concern to Malaysians than that posed by the arrival of genuine political refugees. Only the Indonesians present in Malaysia are consistently termed by all parties as illegal migrants and some of them have been subjected to well-publicized deportation by the Malaysian immigration authorities. Sympathy for fellow-Muslims in distress explains Malaysia's open-door policy to Muslim refugees. The Koran specifically enjoins Muslims to assist Muslim refugees who have been persecuted by others. However, the necessity to maintain regional political and military alliances, principally as a bulwark against Communism, and the Malay--Non-Malay, Muslim--Non-Muslim dichotomy in Malaysia which almost evenly divides Malaysia's 16 million population into mutually antagonistic halves, results in any overt public policy in favor of Malays and Muslims to be immediately denounced by the other half of the population as a move against the Non-Malays and Non-Muslims. Without political and media attention, the refugees live wherever they can find work, as do hundreds of thousands of mainly Indonesian illegal migrant workers. They surreptitiously get their children admitted to public schools, and through bribery, can even get Malaysian identification papers. Malaysia is a relatively tranquil haven for Malaysia's Muslim refugees compared to their homelands, but their continued stay remains dependent on the ever-present struggle for more equitable sharing of political and economic power between
ERIC Educational Resources Information Center
Faryadi, Qais
2007-01-01
This analysis discusses the constructivist paradigm of teaching Arabic as a foreign language in Malaysian settings. This review examines the role of interactive multimedia in enhancing the chalk and talk methods of teaching Arabic in Malaysian schools. This paper also investigates the importance of Arabic Language in Malaysia. Furthermore, the…
Chew, Keng Sheng; Ghani, Zuhailah Abdul
2014-08-01
Family presence (FP) during resuscitation is an increasingly favoured trend, as it affords many benefits to the critically ill patient's family members. However, a previously conducted study showed that only 15.8% of surveyed Malaysian healthcare staff supported FP during resuscitation. This cross-sectional study used a bilingual self-administered questionnaire to examine the attitudes and perceptions of the general Malaysian public toward the presence of family members during resuscitation of their loved ones. The questionnaires were randomly distributed to Malaysians in three different states and in the federal territory of Kuala Lumpur. Out of a total of 190 survey forms distributed, 184 responses were included for analysis. Of the 184 respondents, 140 (76.1%) indicated that they favoured FP during resuscitation. The most common reason cited was that FP during resuscitation provides family members with the assurance that everything possible had been done for their loved ones (n = 157, 85.3%). Respondents who had terminal illnesses were more likely to favour FP during resuscitation than those who did not, and this was statistically significant (95.0% vs. 73.8%; p = 0.04). FP during resuscitation was favoured by a higher percentage of the general Malaysian public as compared to Malaysian healthcare staff. This could be due to differences in concerns regarding the resuscitation process between members of the public and healthcare staff.
Ng, Peter K L; Grinang, Jongkar
2014-03-04
A new species of cave crab, Stygothelphusa antu new species, is described from limestone formations in Temurang, Sarawak, Malaysia. The new species is the most highly adapted to a cavericolous lifestyle among the four known species of Stygothelphusa, having a pale body pigmentation, reduced eyes and elongated pereopods. In contrast, the other three species have normal eyes that almost completely fill the orbits. The new species also differs from its congeners by a number of carapace, pereopod and gonopod characters.
Abdollahi, Abbas; Talib, Mansor Abu; Yaacob, Siti Nor; Ismail, Zanariah
2016-04-01
Recent evidence suggests that suicidal ideation has increased among Malaysian college students over the past two decades; therefore, it is essential to increase our knowledge concerning the etiology of suicidal ideation among Malaysian college students. This study was conducted to examine the relationships between problem-solving skills, hopelessness, and suicidal ideation among Malaysian college students. The participants included 500 undergraduate students from two Malaysian public universities who completed the self-report questionnaires. Structural equation modeling estimated that college students with poor problem-solving confidence, external personal control of emotion, and avoiding style were more likely to report suicidal ideation. Hopelessness partially mediated the relationship between problem-solving skills and suicidal ideation. These findings reinforce the importance of poor problem-solving skills and hopelessness as risk factors for suicidal ideation among college students.
Phenolic acid composition and antioxidant properties of Malaysian honeys.
Khalil, M I; Alam, N; Moniruzzaman, M; Sulaiman, S A; Gan, S H
2011-08-01
The phenolic acid and flavonoid contents of Malaysian Tualang, Gelam, and Borneo tropical honeys were compared to those of Manuka honey. Ferric reducing/antioxidant power assay (FRAP) and the 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical-scavenging activities were also quantified. All honey extracts exhibited high phenolic contents (15.21 ± 0.51- 42.23 ± 0.64 mg/kg), flavonoid contents (11.52 ± 0.27- 25.31 ± 0.37 mg/kg), FRAP values (892.15 ± 4.97- 363.38 ± 10.57 μM Fe[II]/kg), and high IC₅₀ of DPPH radical-scavenging activities (5.24 ± 0.40- 17.51 ± 0.51 mg/mL). Total of 6 phenolic acids (gallic, syringic, benzoic, trans-cinnamic, p-coumaric, and caffeic acids) and 5 flavonoids (catechin, kaempferol, naringenin, luteolin, and apigenin) were identified. Among the Malaysian honey samples, Tualang honey had the highest contents of phenolics, and flavonoids, and DPPH radical-scavenging activities. We conclude that among Malaysian honey samples, Tualang honey is the richest in phenolic acids, and flavonoid compounds, which have strong free radical-scavenging activities. © 2011 Institute of Food Technologists®
Yong, Geng-Yi; Pan, Shin-Wei; Humayun Akhter, Faisal; Law, Thomas Ngo-Hieng; Toh, Teck-Hock
2016-01-01
To study the demographic characteristics of ocular trauma in Central Sarawak and identify the determinant factors of poor visual outcome. A retrospective study of ocular trauma cases presenting at the referral hospital in 2013. Patients were identified and recruited from hospital records. Those presenting for follow-up review were excluded. Case records were retrieved and reviewed after recruitment. We studied 168 patients with 179 ocular injuries, of which 44% were work related. Compared with non-work-related cases, work-related cases were more likely to be male [odds ratio (OR), 19.7; 95% confidence interval (CI), 2.6-150.9] and foreign (OR, 18.0; 95% CI, 2.3-142.0). Open globe injuries constituted a higher percentage of impaired visual acuity (VA) during the first visit: 84.6% compared with 18.1% for closed globe injuries (OR, 25.0; 95% CI, 5.3-118.4; P < 0.001). Of the open globe injuries, 61.5% worsened or showed no improvement in VA after 3 months compared with closed globe injuries (28.9%) (OR, 3.9; 95% CI, 1.2-12.7; P = 0.015). Of cases presenting 7 or more days after trauma, 76.9% worsened or showed no improvement in VA after 3 months compared with those presenting in less than 7 days (27.7%) (OR, 8.7; 95% CI, 2.3-33.0; P < 0.001). Among those with work-related injuries, 23.1% had used eye protective devices (EPDs). Ocular injuries in Central Sarawak were predominantly work related, occurring at industrial premises, and involving males and foreigners. Both open globe injuries and a delay in seeking treatment resulted in significantly poorer visual outcomes.
Reflecting on Malaysian Teacher Trainees' Journals
ERIC Educational Resources Information Center
Yaacob, Aizan; Walters, Lynne Masel; Ali, Ruzlan Md; Abdullah, Sarimah Shaik; Walters, Timothy
2014-01-01
Purpose: In this study, 37 English Language Teaching (ELT) teacher trainees from a Malaysian university conducted an action-research project to determine whether journals kept during their fieldwork in primary schools located in an area close to the university allowed them to reflect on their beliefs and behaviors in the classroom. Methodology:…
Transporting GOLDEN RICE to Malaysian Classrooms
ERIC Educational Resources Information Center
Naidu, Shashi
2007-01-01
This article evaluates the effectiveness of using a simulation in an English for Academic Purposes (EAP) class at a university in the United States and discusses the integration of simulations into the Malaysian curriculum. A new approach is needed in Malaysia wherein language learners are given maximum exposure to the language. The article…
Malaysian Children's Attitudes towards Learning Music
ERIC Educational Resources Information Center
Ghazali, Ghaziah Mohd.; McPherson, Gary E.
2009-01-01
A sample of 1060 Malaysian children were surveyed in order to examine differences in their motivation to study music in school and to learn a musical instrument outside of school. Adopting the expectancy-value motivation theory, the children were asked questions concerning their perception of music as being important, useful, interesting,…
Yeo, Tiong Chia; Naming, Margarita; Manurung, Rita
2014-03-01
The Sarawak Biodiversity Centre (SBC) is a state government agency which regulates research and promotes the sustainable use of biodiversity. It has a program on documentation of traditional knowledge (TK) and is well-equipped with facilities for natural product research. SBC maintains a Natural Product Library (NPL) consisting of local plant and microbial extracts for bioprospecting. The NPL is a core discovery platform for screening of bioactive compounds by researchers through a formal agreement with clear benefit sharing obligations. SBC aims to develop partnerships with leading institutions and the industries to explore the benefits of biodiversity.
Lessons from the Bone Chapter of the Malaysian Aging Men Study
Chin, Kok-Yong; Wan Ngah, Wan Zurinah; Ima-Nirwana, Soelaiman
2016-01-01
Male osteoporosis in Malaysia is a largely neglected problem. Therefore, a bone health study in men using quantitative ultrasonometry was launched as part of the Malaysian Aging Men Study in 2009–2012. This review aimed to summarize the findings of the aforementioned bone health study. The study examined the bone health of Chinese and Malaysian men aged 20 years and above living in Kuala Lumpur using a quantitative ultrasound device. Participants answered a questionnaire on their demographic details and physical activity status. Body anthropometry of the participants was measured and their blood collected for biochemical analysis. Results showed that a significant proportion of the Malaysian Chinese and Malay men had suboptimal bone health indicated by calcaneal speed of sound and vitamin D status. Age-related decline of the calcaneal speed of sound in these men was gradual and biphasic without ethnic difference. Body anthropometry such as height, weight, body mass index, and body fat percentage contributed to the variation of the calcaneal speed of sound in Malaysian men. Age-related changes in testosterone, insulin-like growth factor 1, and thyroid stimulating hormone also influenced the calcaneal speed of sound in these men. This study serves as a reminder that male osteoporosis in Malaysia should be an issue of concern. It is also a basis for a more comprehensive study on bone health in men in the future. PMID:27231930
Lessons from the Bone Chapter of the Malaysian Aging Men Study.
Chin, Kok-Yong; Wan Ngah, Wan Zurinah; Ima-Nirwana, Soelaiman
2016-05-25
Male osteoporosis in Malaysia is a largely neglected problem. Therefore, a bone health study in men using quantitative ultrasonometry was launched as part of the Malaysian Aging Men Study in 2009-2012. This review aimed to summarize the findings of the aforementioned bone health study. The study examined the bone health of Chinese and Malaysian men aged 20 years and above living in Kuala Lumpur using a quantitative ultrasound device. Participants answered a questionnaire on their demographic details and physical activity status. Body anthropometry of the participants was measured and their blood collected for biochemical analysis. Results showed that a significant proportion of the Malaysian Chinese and Malay men had suboptimal bone health indicated by calcaneal speed of sound and vitamin D status. Age-related decline of the calcaneal speed of sound in these men was gradual and biphasic without ethnic difference. Body anthropometry such as height, weight, body mass index, and body fat percentage contributed to the variation of the calcaneal speed of sound in Malaysian men. Age-related changes in testosterone, insulin-like growth factor 1, and thyroid stimulating hormone also influenced the calcaneal speed of sound in these men. This study serves as a reminder that male osteoporosis in Malaysia should be an issue of concern. It is also a basis for a more comprehensive study on bone health in men in the future.
Terrestrial Gamma Radiation Dose Rate of West Sarawak
NASA Astrophysics Data System (ADS)
Izham, A.; Ramli, A. T.; Saridan Wan Hassan, W. M.; Idris, H. N.; Basri, N. A.
2017-10-01
A study of terrestrial gamma radiation (TGR) dose rate was conducted in west of Sarawak, covering Kuching, Samarahan, Serian, Sri Aman, and Betong divisions to construct a baseline TGR dose rate level data of the areas. The total area covered was 20,259.2 km2, where in-situ measurements of TGR dose rate were taken using NaI(Tl) scintillation detector Ludlum 19 micro R meter NaI(Tl) approximately 1 meter above ground level. Twenty-nine soil samples were taken across the 5 divisions covering 26 pairings of 9 geological formations and 7 soil types. A hyperpure Germanium detector was then used to find the samples' 238U, 232Th, and 40K radionuclides concentrations producing a correction factor Cf = 0.544. A total of239 measured data were corrected with Cf resulting in a mean Dm of 47 ± 1 nGy h-1, with a range between 5 nGy h-1 - 103 nGy h-1. A multiple regression analysis was conducted between geological means and soil types means against the corrected TGR dose rate Dm, generating Dg,s= 0.847Dg+ 0.637Ds- 22.313 prediction model with a normalized Beta equation of Dg,s= 0.605Dg+ 0.395Ds. The model has an 84.6% acceptance of Whitney- Mann test null hypothesis when tested against the corrected TGR dose rates.
Joanne, Sylvia; Vythilingam, Indra; Teoh, Boon-Teong; Leong, Cherng-Shii; Tan, Kim-Kee; Wong, Meng-Li; Yugavathy, Nava; AbuBakar, Sazaly
2017-09-01
To determine the susceptibility status of Aedes albopictus with and without Wolbachia to the four dengue virus serotypes. Two newly colonised colonies of Ae. albopictus from the wild were used for the study. One colony was naturally infected with Wolbachia while in the other Wolbachia was removed by tetracycline treatment. Both colonies were orally infected with dengue virus-infected fresh blood meal. Dengue virus load was measured using quantitative RT-PCR at four-time intervals in the salivary glands, midguts and ovaries. Wolbachia did not significantly affect Malaysian Ae. albopictus dengue infection or the dissemination rate for all four dengue virus serotypes. Malaysian Ae. albopictus had the highest replication kinetics for DENV-1 and the highest salivary gland and midgut infection rate for DENV-4. Wolbachia, which naturally exists in Malaysian Ae. albopictus, does not significantly affect dengue virus replication. Malaysian Ae. albopictus is susceptible to dengue virus infections and capable of transmitting dengue virus, especially DENV-1 and DENV-4. Removal of Wolbachia from Malaysian Ae. albopictus would not reduce their susceptibility status. © 2017 John Wiley & Sons Ltd.
Malaysian youth and their sexual health concerns.
Pau, V
1995-01-01
Malaysian youth have an urgent unmet need for sex education programs to increase their access to accurate information. Such programs must be designed by young people themselves and exciting enough to sustain interest. Conservatism on the part of the older generation, as well as misconceptions that sex education programs encourage sexual activity, are major obstacles. Although topics on reproduction and contraception may be a part of a school-based life skills curriculum, many teachers are unable or unwilling to present this material. The Government of Malaysia is urged to incorporate sex education into the formal educational curriculum as a subject in its own right and to train teachers to present this material. Also necessary is development of youth-oriented educational materials such as comics, cartoons, tapes, and videos. Finally, establishment in every Malaysian state of multi-service youth centers offering reproductive health services, recreation, education, and career guidance is recommended.
ERIC Educational Resources Information Center
Dickerson, Claire; Jarvis, Joy; Levy, Roger; Thomas, Kit
2017-01-01
This article presents Malaysian student teachers' reports of using an action, reflection and modelling (ARM) pedagogical approach during their placements in Malaysian primary schools. The ARM approach was designed to support the implementation of the Malaysian primary school mathematics curriculum, which involved changing classroom practice in…
Apalasamy, Yamunah Devi; Ming, Moy Foong; Rampal, Sanjay; Bulgiba, Awang; Mohamed, Zahurin
2015-03-01
Recent findings have shown that the rs1042714 (Gln27Glu) single-nucleotide polymorphism (SNP) on the β2-adrenoceptor gene may predispose to obesity. The findings from other studies carried on different populations, however, have been inconsistent. The authors investigated the association between the rs1042714 SNP with obesity-related parameters. DNA of 672 Malaysian Malays was analyzed using real-time polymerase chain reaction. Univariate and multivariate linear regression analyses revealed significant associations between rs1042714 and diastolic blood pressure in the pooled Malaysian Malay subjects under additive and recessive models. After gender stratification, however, a significant association was found between the rs1042714 and triglyceride and the rs1042714 and log-transformed high-density lipoprotein cholesterol levels in Malaysian Malay men. No significant association was found between the SNP and log-transformed body mass index. This polymorphism may have an important role in the development of obesity-related traits in Malaysian Malays. Gender is an effect modifier for the effect of the rs1042714 polymorphism on obesity-related traits in Malaysian Malays. © 2011 APJPH.
NASA Astrophysics Data System (ADS)
Othman, A. H.; Omar, K. M.; Din, A. H. M.; Som, Z. A. M.; Yahaya, N. A. Z.; Pa'suya, M. F.
2016-06-01
The GOCE satellite mission has significantly contributed to various applications such as solid earth physics, oceanography and geodesy. Some substantial applications of geodesy are to improve the gravity field knowledge and the precise geoid modelling towards realising global height unification. This paper aims to evaluate GOCE geoid model based on the recent GOCE Global Geopotential Model (GGM), as well as EGM2008, using GPS levelling data over East Malaysia, i.e. Sabah and Sarawak. The satellite GGMs selected in this study are the GOCE GGM models which include GOCE04S, TIM_R5 and SPW_R4, and the EGM2008 model. To assess these models, the geoid heights from these GGMs are compared to the local geometric geoid height. The GGM geoid heights was derived using EGMLAB1 software and the geometric geoid height was computed by available GPS levelling information obtained from the Department Survey and Mapping Malaysia. Generally, the GOCE models performed better than EGM2008 over East Malaysia and the best fit GOCE model for this region is the TIM_R5 model. The TIM_R5 GOCE model demonstrated the lowest R.M.S. of ± 16.5 cm over Sarawak, comparatively. For further improvement, this model should be combined with the local gravity data for optimum geoid modelling over East Malaysia.
2013-01-01
Background In 1998, Malaysia experienced its first chikungunya virus (CHIKV) outbreak in the suburban areas followed by another two in 2006 (rural areas) and 2008 (urban areas), respectively. Nevertheless, there is still a lack of documented data regarding the magnitude of CHIKV exposure in the Malaysian population. The aim of this study was to determine the extent of chikungunya virus infection in healthy Malaysian adults residing in outbreak-free locations. Methods A cross sectional study of chikungunya (CHIK) seroprevalence was carried out in 2009 amongst The Malaysian Cohort participants living in four states (Kuala Lumpur, Selangor, Pahang and Negeri Sembilan). A total of 945 participants were randomly identified for the study. Potential risk factors for CHIK infection were determined via questionnaires, and IgG antibodies against CHIK were detected by an enzyme-linked immunosorbent assay. Logistic regression identified risk factors associated with CHIK seropositivity, while geographical information system was used for visual and spatial analysis. Results From the 945 serum samples tested, 5.9% was positive for CHIK IgG. Being male, Malay, rural occupancy and Negeri Sembilan residency were identified as univariate predictors for CHIK seropositivity, while multivariate analysis identified being male and rural occupancy as risk factors. Conclusions This study provided evidence that CHIK is slowly emerging in Malaysia. Although the current baseline seroprevalence is low in this country, increasing number of CHIK cases reported to the Malaysia Ministry of Health imply the possibility of CHIK virus becoming endemic in Malaysia. PMID:23379541
Abdel Aziz, Manal H; Badr El Dine, Fatma M M; Saeed, Nourhan M M
2016-11-01
Identification of sex and ethnicity has always been a challenge in the fields of forensic medicine and criminal investigations. Fingerprinting and DNA comparisons are probably the most common techniques used in this context. However, since they cannot always be used, it is necessary to apply different and less known techniques such as lip prints. Is to study the pattern of lip print in Egyptian and Malaysian populations and its relation to sex and populations difference. Also, to develop equations for sex and populations detection using lip print pattern by different populations (Egyptian and Malaysian). The sample comprised of 120 adults volunteers divided into two ethnic groups; sixty adult Egyptians (30 males and 30 females) and sixty adult Malaysians (30 males and 30 females). The lip prints were collected on a white paper. Each lip print was divided into four compartments and were classified and scored according to Suzuki and Tsuchihashi classification. Data were statistically analyzed. The results showed that type III lip print pattern (intersected grooves) was the predominant type in both the Egyptian and Malaysian populations. Type II and III were the most frequent in Egyptian males (28.3% each), while in Egyptian females type III pattern was predominant (46.7%). As regards Malaysian males, type III lip print pattern was the predominant one (41.7%), while type II lip print pattern was predominant (30.8%) in Malaysian females. Statistical analysis of different quadrants showed significant differences between males and females in the Egyptian population in the third and fourth quadrants. On the other hand, significant differences were detected only in the second quadrant between Malaysian males and females. Also, a statistically significant difference was present in the second quadrant between Egyptian and Malaysian males. Using the regression analysis, four regression equations were obtained. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal
Telemedicine and medical informatics in the multimedia super corridor: the Malaysian vision.
Abidi, S S; Goh, A; Yusoff, Z
1998-01-01
The practice of medicine, with its wide range of environmental conditions and complex dependencies, has long been used as a test bed for various advanced technologies. Telemedicine, as conceptualised within the Multimedia Super Corridor (MSC) context, is seen as the application of several relatively mature technologiesartificial intelligence (AI), multimedia communication and information systems (IS) amongst othersso as to benefit a large cross-section of the Malaysian population. We will discuss in general terms the Malaysian vision on the comprehensive MSC telemedicine solution, its functionality and associated operational conditions. In particular, this paper focuses on the conceptualisation of one key telemedical component i.e. the Lifetime Health Plan (LHP) system, which is eventually intended to be a distributed multi-module application for the periodic monitoring and generation of health-care advisories for upwards of 20 million Malaysians.
Characterizing the genetic risk for Type 2 diabetes in a Malaysian multi-ethnic cohort.
Abdullah, N; Abdul Murad, N A; Attia, J; Oldmeadow, C; Mohd Haniff, E A; Syafruddin, S E; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G
2015-10-01
To characterize the association with Type 2 diabetes of known Type 2 diabetes risk variants in people in Malaysia of Malay, Chinese and Indian ancestry who participated in the Malaysian Cohort project. We genotyped 1604 people of Malay ancestry (722 cases, 882 controls), 1654 of Chinese ancestry (819 cases, 835 controls) and 1728 of Indian ancestry (851 cases, 877 controls). First, 62 candidate single-nucleotide polymorphisms previously associated with Type 2 diabetes were assessed for association via logistic regression within ancestral groups and then across ancestral groups using a meta-analysis. Second, estimated odds ratios were assessed for excess directional concordance with previously studied populations. Third, a genetic risk score aggregating allele dosage across the candidate single-nucleotide polymorphisms was tested for association within and across ancestral groups. After Bonferroni correction, seven individual single-nucleotide polymorphisms were associated with Type 2 diabetes in the combined Malaysian sample. We observed a highly significant excess in concordance of effect directions between Malaysian and previously studied populations. The genetic risk score was strongly associated with Type 2 diabetes in all Malaysian groups, explaining from 1.0 to 1.7% of total Type 2 diabetes risk variance. This study suggests there is substantial overlap of the genetic risk alleles underlying Type 2 diabetes in Malaysian and other populations. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.
NASA Astrophysics Data System (ADS)
Togunwa, Olayinka S.; Abdullah, Wan H.
2017-08-01
The Neogene strata of the onshore West Baram Province of NW Borneo contain organic rich rock formations particularly within the Sarawak basin. This basin is a proven prolific oil and gas province, thus has been a subject of great interest to characterise the nature of the organic source input and depositional environment conditions as well as thermal maturation. This study is performed on outcrop samples of Lambir, Miri and Tukau formations, which are of stratigraphic equivalence to the petroleum bearing cycles of the offshore West Baram delta province in Sarawak. The investigated mudstone samples are organic rich with a total organic carbon (TOC) content of more than 1.0 wt.%. The integration of elemental and molecular analyses indicates that there is no significant variation in the source input between these formations. The investigated biomarkers parameters achieved from acyclic isoprenoids, terpanes and steranes biomarkers of a saturated hydrocarbon biomarkers revealed that these sediments contain high contribution of land plants with minor marine organic matter input that was deposited and preserved under relatively oxic to suboxic conditions. This is further supported by low total sulphur (TS), high TOC/TN ratios, source and redox sensitive trace elements (V, Ni, Cr, Co and Mo) concentrations and their ratios, which suggest terrigenous source input deposited under oxic to suboxic conditions. Based on the analysed biomarker thermal maturity indicators, it may be deduced that the studied sediments are yet to enter the maturity stage for hydrocarbon generation, which is also supported by measured vitrinite reflectance values of 0.39-0.48% Ro.
Chin, Fee Wai; Chan, Soon Choy; Abdul Rahman, Sabariah; Noor Akmal, Sharifah; Rosli, Rozita
2016-01-01
The cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6) is an enzyme that is predominantly involved in the metabolism of tamoxifen. Genetic polymorphisms of the CYP2D6 gene may contribute to inter-individual variability in tamoxifen metabolism, which leads to the differences in clinical response to tamoxifen among breast cancer patients. In Malaysia, the knowledge on CYP2D6 genetic polymorphisms as well as metabolizer status in Malaysian breast cancer patients remains unknown. Hence, this study aimed to comprehensively identify CYP2D6 genetic polymorphisms among 80 Malaysian breast cancer patients. The genetic polymorphisms of all the 9 exons of CYP2D6 gene were identified using high-resolution melting analysis and confirmed by DNA sequencing. Seven CYP2D6 alleles consisting of CYP2D6*1, CYP2D6*2, CYP2D6*4, CYP2D6*10, CYP2D6*39, CYP2D6*49, and CYP2D6*75 were identified in this study. Among these alleles, CYP2D6*10 is the most common allele in both Malaysian Malay (54.8%) and Chinese (71.4%) breast cancer patients, whereas CYP2D6*4 in Malaysian Indian (28.6%) breast cancer patients. In relation to CYP2D6 genotype, CYP2D6*10/*10 is more frequently observed in both Malaysian Malay (28.9%) and Chinese (57.1%) breast cancer patients, whereas CYP2D6*4/*10 is more frequently observed in Malaysian Indian (42.8%) breast cancer patients. In terms of CYP2D6 phenotype, 61.5% of Malaysian Malay breast cancer patients are predicted as extensive metabolizers in which they are most likely to respond well to tamoxifen therapy. However, 57.1% of Chinese as well as Indian breast cancer patients are predicted as intermediate metabolizers and they are less likely to gain optimal benefit from the tamoxifen therapy. This is the first report of CYP2D6 genetic polymorphisms and phenotypes in Malaysian breast cancer patients for different ethnicities. These data may aid clinicians in selecting an optimal drug therapy for Malaysian breast cancer patients, hence improve the
ERIC Educational Resources Information Center
Mohd Daud, Norzaidi; Zakaria, Halimi
2017-01-01
Purpose: The purpose of this paper is to investigate the impact of antecedent factors on collaborative technologies usage among academic researchers in Malaysian research universities. Design/methodology/approach: Data analysis was conducted on data collected from 156 academic researchers from five Malaysian research universities. This study…
Telemedicine in the Malaysian Multimedia Super Corridor: towards personalized lifetime health plans.
Abidi, S S; Yusoff, Z
1999-01-01
The Malaysian Telemedicine initiative advocates a paradigm shift in healthcare delivery patterns by way of implementing a person-centred and wellness-focused healthcare system. This paper introduces the Malaysian Telemedicine vision, its functionality and associated operational conditions. In particular, we focus on the conceptualisation of one key Telemedicine component i.e. the Lifetime Health Plan (LHP) system--a distributed multimodule application for the periodic monitoring and generation of health-care advisories for all Malaysians. In line with the LHP project, we present an innovative healthcare delivery info-structure--LifePlan--that aims to provide life-long, pro-active, personalised, wellness-oriented healthcare services to assist individuals to manage and interpret their health needs. Functionally, LifePlan based healthcare services are delivered over the WWW, packaged as Personalised Lifetime Health Plans that allow individuals to both monitor their health status and to guide them in healthcare planning.
Educational Transition of East Malaysian Distance Learners.
ERIC Educational Resources Information Center
Saw, K. G.; Awang, M. N.; Idrus, R. M.; Atan, H.; Azli, N. A.; Jaafar, I.; Rahman, Z. A.; Latiff, Z. A.
1999-01-01
Describes results of a study of the changing perceptions of East Malaysian distance learners studying at the Universiti Sains Malaysia. Highlights include students' perceptions of their study skills; and the impact of their studies on other areas of their life, including social obligations, recreation, families, health, finances, work, and…
The impact of derivatives on Malaysian stock market
NASA Astrophysics Data System (ADS)
Malim, M. R.; Halim, F. A.; Murad, A.; Maad, H. A.; Annuar, N. F. M.
2017-09-01
The essential of derivatives has been discovered by researchers over recent decade. However, the conclusions made regarding the impact of derivatives on stock market volatility remains debatable. The main objective of this study is to examine the impact of derivatives on Malaysian stock market volatility by exploring FTSE Bursa Malaysia Kuala Lumpur Composite Index Futures (BMD FKLI) using FBM KLCI as the underlying asset. Generalized Autoregressive Conditional Heteroskedasticity (GARCH) (1, 1) model was employed to realize the objective. The results have shown that the introduction of futures trading has decreased the volatility of Malaysian stock market. The volatility increased vigorously during the Asian financial crisis compared to the Global financial crisis. However, the role of futures as a risk transfer is agreed as it could improve the market by decreasing the volatility in the spot market.
Malaysian Students' Motivation towards Physics Learning
ERIC Educational Resources Information Center
Saleh, Salmiza
2014-01-01
The purpose of this survey study was to examine the level of Malaysian students' motivation with regards to the learning of Physics at the secondary school level, and its influencing factors. The study was carried out on 337 Form Four students who took Physics as a subject, from six schools in a northern state of Malaysia--three from urban areas,…
Ethical Issues in the Malaysian Education System
ERIC Educational Resources Information Center
Kenayathulla, Husaina Banu
2015-01-01
Malaysia is a multi-ethnic country in which the government gives preferential treatment in education, employment, and ownership to its majority ethnic group: Bumiputera. However, affirmative action policies in the current Malaysian context should work according to John Rawls' Theory of Justice by being based on income rather than ethnicity.…
The factors that influence job satisfaction among royal Malaysian customs department employee
NASA Astrophysics Data System (ADS)
Ammar Shafi, Muhammad; Saifullah Rusiman, Mohd; Nor, Maria Elena; Khamis, Azme; Nabilah Syuhada Abdullah, Siti; Syafiq Azmi, Mohd; Sakinah Zainal Abidin, Munirah; Ali, Maselan
2018-04-01
This research aims to spot the factors that influence job satisfaction among Royal Malaysian Customs Department employees. Primary data was used in this research and it was collected from the employees who work in five different departments at Royal Malaysian Customs Department Tower Johor. Those departments were customs department, Internal Taxes, Technical Services, Management and Prevention. The research used stratified random sampling to collect the sample and Structural Equation Modelling (SEM) to measure the relationship between variables using AMOS software. About 127 employees are selected as the respondents from five departments to represent the sample. The result showed that ‘Organizational Commitment’ (p-value = 0.001) has significant and direct effect toward job satisfaction compared to the ‘Stress Condition’ (p-value = 0.819) and ‘Motivation’ factor (p-value = 0.978). It was also concluded that ‘Organizational Commitment’ was the most influential factor toward job satisfaction among Royal Malaysian Customs Department employees at Tower Custom Johor, Johor Bahru.
Zulkifly, Nuranis-Raihan; Wahab, Roswanira Abd; Layang, Elizabeth; Ismail, Dzulkiflee; Desa, Wan Nur Syuhaila Mat; Hisham, Salina; Mahat, Naji A
2018-01-01
Handprints and dismembered hands are commonly found during crime scene investigations and disaster victim identifications, respectively. It has been indicated that the accuracy of handprint and hand measurements for estimating stature maybe population specific. Since Iban is the largest ethnic population in Sarawak, Malaysia and because the application of anthropometry of hand and handprint within this population as well as other populations within the Southeast Asian countries remain unreported, this present study that investigated the reliability and accuracy of these two anthropometric aspects acquires forensic significance. Upon measuring the height, 21 measurements were recorded on each hand and the corresponding handprint of 50 male and 52 female consented adult Iban subjects. Using univariate statistics as well as simple and multiple regression analyses, interpretation of the measurements examined here was attempted. Results revealed that lengths of hand and handprint are the more reliable traits for estimating stature in both the male and female Iban subjects (p < 0.05) with correlation strength ranging from 0.60 to 0.76. Comparable to the established skeletal standards for hand, the stature prediction accuracy using hand and handprint measurements investigated in this research ranged between 4.29 and 5.78 cm. Hence, this research provided the first forensic standard for estimation of stature among the Iban population in Sarawak that may prove useful for crime scene investigations and disaster victim identifications in Malaysia. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Defining Malaysian Knowledge Society: Results from the Delphi Technique
NASA Astrophysics Data System (ADS)
Hamid, Norsiah Abdul; Zaman, Halimah Badioze
This paper outlines the findings of research where the central idea is to define the term Knowledge Society (KS) in Malaysian context. The research focuses on three important dimensions, namely knowledge, ICT and human capital. This study adopts a modified Delphi technique to seek the important dimensions that can contribute to the development of Malaysian's KS. The Delphi technique involved ten experts in a five-round iterative and controlled feedback procedure to obtain consensus on the important dimensions and to verify the proposed definition of KS. The finding shows that all three dimensions proposed initially scored high and moderate consensus. Round One (R1) proposed an initial definition of KS and required comments and inputs from the panel. These inputs were then used to develop items for a R2 questionnaire. In R2, 56 out of 73 items scored high consensus and in R3, 63 out of 90 items scored high. R4 was conducted to re-rate the new items, in which 8 out of 17 items scored high. Other items scored moderate consensus and no item scored low or no consensus in all rounds. The final round (R5) was employed to verify the final definition of KS. Findings and discovery of this study are significant to the definition of KS and the development of a framework in the Malaysian context.
Malaysian public perception towards nuclear power energy-related issues
NASA Astrophysics Data System (ADS)
Misnon, Fauzan Amin; Hu, Yeoh Siong; Rahman, Irman Abd.; Yasir, Muhamad Samudi
2017-01-01
Malaysia had considered nuclear energy as an option for future electricity generation during the 9th Malaysia Development Plan. Since 2009, Malaysia had implemented a number of important preparatory steps towards this goal, including the establishment of Nuclear Power Corporation of Malaysia (MNPC) as first Nuclear Energy Programme Implementing Organization (NEPIO) in Malaysia. In light of the establishment of MNPC, the National Nuclear Policy was formulated in 2010 and a new comprehensive nuclear law to replace the existing Atomic Energy Licensing Act (Act 304) is currently in the pipeline. Internationally, public acceptance is generally used to gauge the acceptance of nuclear energy by the public whenever a government decides to engage in nuclear energy. A public survey was conducted in between 14 March 2016 to 10 May 2016 focusing on the Malaysian public acceptance and perception towards the implementation of nuclear energy in Malaysia. The methodology of this research was aim on finding an overview of the general knowledge, public-relation recommendation, perception and acceptance of Malaysian towards the nuclear power development program. The combination of information gathered from this study can be interpreted as an indication of the complexity surrounding the development of nuclear energy and its relationship with the unique background of Malaysian demography. This paper will focus mainly on energy-related section in the survey in comparison with nuclear energy.
NASA Astrophysics Data System (ADS)
Tan, J. K.; Abas, N.
2017-07-01
Complaints on issues and matters related to connection charges have been very common for electricity supply utility companies around the world including Sarawak Energy Berhad. In order to identify the areas that can be improved, a mixed method of exploratory research involving qualitative and quantitative methods have been designed and undertaken rather than a single method of survey. This will ensure a more comprehensive and detailed understanding of the issues from various target groups. The method is designed under three phases, employing Modified Delphi Technique for phase 1 through a series of stake holder engagements, online and offline survey questionnaires to be filled by internal wiring contractors for phase 2 whilst under phase 3, case studies shall be carried out on the issues identified from phase 1 and phase 2 of the study. This paper presented the findings from the Modified Delphi Technique. The findings revealed that there are areas of improvement for Sarawak Energy Berhad connection guidelines in term of differentiation of dedicated and shared assets which leads to unfairness to the connecting customers, inconsistency and non-transparent in charging. The findings of Modified Delphi Technique shall be used for implementation of phase 2 and phase 3 of the study.
For the Well-Being of Malaysian Children.
ERIC Educational Resources Information Center
Sanders, Eleonora, Ed.; And Others
Intended for use by adult education teachers of all kinds, social workers, physicians, nurses, and parents, this publication contains 16 short papers concerning the well-being of Malaysian children in particular and of all children in general. Covered by the papers are issues such as responsible parenthood; the nutritional need and status of…
ERIC Educational Resources Information Center
Pawanteh, Latiffah; Rahim, Samsudin A.
2000-01-01
Examines the Internet usage pattern of Malaysian adolescents based on a survey of 1,404 adolescents between the ages of 13-16 and focus group discussions. Finds the daily realities of media savvy Malaysian youths are an integration of on-line and off-line relationships, events, information, memberships, chats and online shopping. (RS)
ERIC Educational Resources Information Center
Wilhelm, Kim Hughes
A study investigated the application of Geert Hofstede's theory of cultural dimensions in management to the situation of Malaysian (n=8) and American (n=4) instructors in implementing a new English-as-a-Second-Language curriculum in Malaysia. American and Malaysian cultures are compared on four dimensions: social differentiation by gender; desire…
ERIC Educational Resources Information Center
International Planned Parenthood Federation, London (England).
Data relating to population and family planning in 21 foreign countries are presented in these situation reports. Countries included are Austria, Cameroon, Canada, Czechoslovakia, Denmark, Egypt, France, German Federal Republic, Greece, Hungary, Irish Republic, Jamaica, Malta, Norway, Sabah, Sarawak, Spain, Tahiti, Tonga, Turkey, and United…
Antibacterial activity of selected Malaysian honey
2013-01-01
Background Antibacterial activity of honey is mainly dependent on a combination of its peroxide activity and non-peroxide components. This study aims to investigate antibacterial activity of five varieties of Malaysian honey (three monofloral; acacia, gelam and pineapple, and two polyfloral; kelulut and tualang) against Staphylococcus aureus, Bacillus cereus, Escherichia coli, and Pseudomonas aeruginosa. Methods Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) were performed for semi-quantitative evaluation. Agar well diffusion assay was used to investigate peroxide and non-peroxide activities of honey. Results The results showed that gelam honey possessed lowest MIC value against S. aureus with 5% (w/v) MIC and MBC of 6.25% (w/v). Highest MIC values were shown by pineapple honey against E. coli and P. aeruginosa as well as acacia honey against E. coli with 25% (w/v) MIC and 50% (w/v) MBC values. Agar inhibition assay showed kelulut honey to possess highest total antibacterial activity against S. aureus with 26.49 equivalent phenol concentrations (EPC) and non-peroxide activity of 25.74 EPC. Lowest antibacterial activity was observed in acacia honey against E. coli with total activity of 7.85 EPC and non-peroxide activity of 7.59 EPC. There were no significant differences (p > 0.05) between the total antibacterial activities and non-peroxide activities of Malaysian honey. The intraspecific correlation between MIC and EPC of E. coli (r = -0.8559) was high while that between MIC and EPC of P. aeruginosa was observed to be moderate (r = -0.6469). S. aureus recorded a smaller correlation towards the opposite direction (r = 0.5045). In contrast, B.cereus showed a very low intraspecific correlation between MIC and EPC (r = -0.1482). Conclusions Malaysian honey, namely gelam, kelulut and tualang, have high antibacterial potency derived from total and non-peroxide activities, which implies that both peroxide and other
Antibacterial activity of selected Malaysian honey.
Zainol, Mohd Izwan; Mohd Yusoff, Kamaruddin; Mohd Yusof, Mohd Yasim
2013-06-10
Antibacterial activity of honey is mainly dependent on a combination of its peroxide activity and non-peroxide components. This study aims to investigate antibacterial activity of five varieties of Malaysian honey (three monofloral; acacia, gelam and pineapple, and two polyfloral; kelulut and tualang) against Staphylococcus aureus, Bacillus cereus, Escherichia coli, and Pseudomonas aeruginosa. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) were performed for semi-quantitative evaluation. Agar well diffusion assay was used to investigate peroxide and non-peroxide activities of honey. The results showed that gelam honey possessed lowest MIC value against S. aureus with 5% (w/v) MIC and MBC of 6.25% (w/v). Highest MIC values were shown by pineapple honey against E. coli and P. aeruginosa as well as acacia honey against E. coli with 25% (w/v) MIC and 50% (w/v) MBC values. Agar inhibition assay showed kelulut honey to possess highest total antibacterial activity against S. aureus with 26.49 equivalent phenol concentrations (EPC) and non-peroxide activity of 25.74 EPC. Lowest antibacterial activity was observed in acacia honey against E. coli with total activity of 7.85 EPC and non-peroxide activity of 7.59 EPC. There were no significant differences (p > 0.05) between the total antibacterial activities and non-peroxide activities of Malaysian honey. The intraspecific correlation between MIC and EPC of E. coli (r = -0.8559) was high while that between MIC and EPC of P. aeruginosa was observed to be moderate (r = -0.6469). S. aureus recorded a smaller correlation towards the opposite direction (r = 0.5045). In contrast, B.cereus showed a very low intraspecific correlation between MIC and EPC (r = -0.1482). Malaysian honey, namely gelam, kelulut and tualang, have high antibacterial potency derived from total and non-peroxide activities, which implies that both peroxide and other constituents are mutually important as contributing factors
You Look Familiar: How Malaysian Chinese Recognize Faces
Tan, Chrystalle B. Y.; Stephen, Ian D.; Whitehead, Ross; Sheppard, Elizabeth
2012-01-01
East Asian and white Western observers employ different eye movement strategies for a variety of visual processing tasks, including face processing. Recent eye tracking studies on face recognition found that East Asians tend to integrate information holistically by focusing on the nose while white Westerners perceive faces featurally by moving between the eyes and mouth. The current study examines the eye movement strategy that Malaysian Chinese participants employ when recognizing East Asian, white Western, and African faces. Rather than adopting the Eastern or Western fixation pattern, Malaysian Chinese participants use a mixed strategy by focusing on the eyes and nose more than the mouth. The combination of Eastern and Western strategies proved advantageous in participants' ability to recognize East Asian and white Western faces, suggesting that individuals learn to use fixation patterns that are optimized for recognizing the faces with which they are more familiar. PMID:22253762
Jasmin, R; Sockalingam, S; Cheah, T E; Goh, K J
2013-08-01
Ethnic differences in systemic lupus erythematosus (SLE) have been previously described in the multiethnic Malaysian population. However, there have since been many demographic and socioeconomic changes in the country. The aim of this study is to re-examine the clinical and immunological profiles of Malaysian SLE patients of different ethnic backgrounds. Consecutive follow-up patients at the University Malaya Medical Centre (UMMC) from July 2010 until March 2011 were included in the study. The most common clinical manifestations were malar rash (61.3%), arthritis (52.3%), haematological disease (51.6%), oral ulcers (51%) and renal disease (40.6%). Ethnic Indians had fewer malar and discoid rashes but were at higher risk of arthritis, serositis, renal and neuropsychiatric disease compared to Malays and Chinese Malaysians. Antiphospholipid syndrome (APS) was less common in Chinese. A longer duration of SLE correlated with a lower SLEDAI score. Overall, the spectrum disease expression was similar to the earlier Malaysian study but the frequency of the more severe disease manifestations, viz. renal, haematological, neuropsychiatric involvements and serositis, were lower. This study further emphasises differences primarily between ethnic Indians and the other races in Malaysia.
Spirituality Moderates Hopelessness, Depression, and Suicidal Behavior among Malaysian Adolescents.
Talib, Mansor Abu; Abdollahi, Abbas
2017-06-01
Suicide is an important public health problem for adolescents, and it is essential to increase our knowledge concerning the etiology of suicide among adolescent students. Therefore, this study was designed to examine the associations between hopelessness, depression, spirituality, and suicidal behavior, and to examine spirituality as a moderator between hopelessness, depression, and suicidal behavior among 1376 Malaysian adolescent students. The participants completed measures of depression, hopelessness, daily spiritual experience, and suicidal behavior. Structural equation modeling indicated that adolescent students high in hopelessness and depression, but also high in spirituality, had less suicidal behavior than others. These findings reinforce the importance of spirituality as a protective factor against hopelessness, depression, and suicidal behavior among Malaysian adolescent students.
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays.
Apalasamy, Y D; Ming, M F; Rampal, S; Bulgiba, A; Mohamed, Z
2012-12-01
The common variants in the fat mass- and obesity-associated (FTO) gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese) Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D' = 1.0). In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays.
NASA Astrophysics Data System (ADS)
Yaakob, Mazri; Ali, Wan Nur Athirah Wan; Radzuan, Kamaruddin
2016-08-01
Building Information Modeling (BIM) is defined as existing from the earliest concept to demolition and it involves creating and using an intelligent 3D model to inform and communicate project decisions. This research aims to identify the critical success factors (CSFs) of BIM implementation in Malaysian construction industry. A literature review was done to explore previous BIM studies on definitions and history of BIM, construction issues, application of BIM in construction projects as well as benefits of BIM. A series of interviews with multidisciplinary Malaysian construction experts will be conducted purposely for data collection process guided by the research design and methodology approach of this study. The analysis of qualitative data from the process will be combined with criteria identified in the literature review in order to identify the CSFs. Finally, the CSFs of BIM implementation will be validated by further Malaysian industrialists during a workshop. The validated CSFs can be used as a term of reference for both Malaysian practitioners and academics towards measuring BIM effectiveness level in their organizations.
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays
Apalasamy, Y.D.; Ming, M.F.; Rampal, S.; Bulgiba, A.; Mohamed, Z.
2012-01-01
The common variants in the fat mass- and obesity-associated (FTO) gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese) Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D' = 1.0). In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays. PMID:22911346
Academic Productivity as Perceived by Malaysian Academics
ERIC Educational Resources Information Center
Hassan, Aminuddin; Tymms, Peter; Ismail, Habsah
2008-01-01
The purpose of this research is to explore the perspectives of Malaysian academics in relation to academic productivity and some factors affecting it. A large scale online questionnaire was used to gather information from six public universities. The most productive role in the eyes of the academics was found to be teaching, with research and…
Eclectic Model in the Malaysian Education System
ERIC Educational Resources Information Center
Othman, Nooraini; Mohamad, Khairul Azmi; Ilmuwan, Yayasan
2011-01-01
The present work aims at analysing the adoption of eclectic model in the Malaysian education system. The analysis is specifically looked from the angle of Islam and the Muslims. Malaysia has a long history of education system developments, from pre to post independence of the country. From what was initially traditional, modernity later came to…
Jamil, Norsyarizan; Ismail, Wan Nurainie Wan; Abidin, Siti Shamimi; Amaran, Mazdan Ali; Hazali, Ratnawati
2017-01-01
A survey on termite species composition was conducted in Samunsam Wildlife Sanctuary, Sarawak in February 2015. Overall 19 species of termite belonging to 13 genera and 8 subfamilies was found in the sanctuary. It was recorded the subfamily of Termitinae had the highest number of species (6 species, equal to 31.58% of total species), followed by Nasutermitinae (3 species, 15.79%), Macrotermitinae, Amitermitinae, Rhinotermitinae, Coptotermitinae, (2 species, 10.53% respectively), and Heterotermitinae, Termitogetoninae (1 species, 5.26% respectively). Since this rapid survey is the first termite assemblage representation in Samunsam Wildlife Sanctuary, the preliminary result may serve as the baseline data for termite composition in the area. Therefore, a whole coverage for the area within this sanctuary would definitely increase the number of termite species found in the sanctuary. PMID:28890771
Jamil, Norsyarizan; Ismail, Wan Nurainie Wan; Abidin, Siti Shamimi; Amaran, Mazdan Ali; Hazali, Ratnawati
2017-07-01
A survey on termite species composition was conducted in Samunsam Wildlife Sanctuary, Sarawak in February 2015. Overall 19 species of termite belonging to 13 genera and 8 subfamilies was found in the sanctuary. It was recorded the subfamily of Termitinae had the highest number of species (6 species, equal to 31.58% of total species), followed by Nasutermitinae (3 species, 15.79%), Macrotermitinae, Amitermitinae, Rhinotermitinae, Coptotermitinae, (2 species, 10.53% respectively), and Heterotermitinae, Termitogetoninae (1 species, 5.26% respectively). Since this rapid survey is the first termite assemblage representation in Samunsam Wildlife Sanctuary, the preliminary result may serve as the baseline data for termite composition in the area. Therefore, a whole coverage for the area within this sanctuary would definitely increase the number of termite species found in the sanctuary.
Collaborative and Cooperative Learning in Malaysian Mathematics Education
ERIC Educational Resources Information Center
Hossain, Md. Anowar; Tarmizi, Rohani Ahmad; Ayud, Ahmad Fauzi Mohd
2012-01-01
Collaborative and cooperative learning studies are well recognized in Malaysian mathematics education research. Cooperative learning is used to serve various ability students taking into consideration of their level of understanding, learning styles, sociological backgrounds that develop students' academic achievement and skills, and breeze the…
Libs-PCA based discrimination of Malaysian coins
NASA Astrophysics Data System (ADS)
Mustapha Imam, Auwal; Safwan Aziz, M.; Chaudhary, Kashif; Rizvi, Zuhaib; Ali, Jalil
2018-05-01
The investigations of currency coins dated back to many centuries. Many researchers developed an interest in the investigation of the coin’s weight, size, physical feature and elemental composition. Laser-induced breakdown spectroscopy (LIBS) has the novelty of analytical analyses of various samples. It has the ability for the elemental composition determination of samples of solid (including metals), liquid and/or gases. Malaysia as a country uses Ringgit as a currency, among which are coins of 10, 20 and 50 cents. These coins are in series of release from the Malaysian Central Bank from time to time. There are currently in circulation old and new coins of 5, 10, 20 and 50 cents coins. These coins differ in their physical features and are may be different also in their elemental composition. This paper presents the investigation of the differences in elemental composition between the old and new Malaysian coins of 10, 20 and 50 cents. Principal component analysis (PCA) was used to perform the discrimination between the coins from the LIBS spectra.
NASA Astrophysics Data System (ADS)
Breitfeld, H. T.; Galin, T.; Hall, R.
2014-12-01
Sarawak is located on the northern edge of Sundaland in NW Borneo. Five sedimentary basins are distinguished with ages from Triassic to Cenozoic. New light mineral, heavy mineral and U-Pb detrital zircon ages show differences in provenance reflecting the tectonic evolution of the region. The oldest clastic sediments are Triassic of the Sadong-Kuching Basin and were sourced by a Carnian to Norian volcanic arc and erosion of Cathaysian rocks containing zircons of Paleoproterozoic age. Sandstones of the Upper Jurassic to Cretaceous Bau-Pedawan Basin have distinctive zircon populations indicating a major change of tectonic setting, including initiation of subduction below present-day West Sarawak in the Late Jurassic. A wide range of inherited zircon ages indicates various Cathaysian fragments as major source areas and the arrival of the SW Borneo Block following subduction beneath the Schwaner Mountains in the early Late Cretaceous. After collision of the SW Borneo Block and the microcontinental fragments with Sundaland in the early Late Cretaceous, deep marine sedimentation (Pedawan Formation) ceased, and there was uplift forming the regional Pedawan-Kayan unconformity. Two episodes of extension were responsible for basin development on land from the latest Cretaceous onwards, probably in a strike-slip setting. The first episode formed the Kayan Basin in the Latest Cretaceous (Maastrichtian) to Early Paleocene, and the second formed the Ketungau Basin and the Penrissen Sandstone in the Middle to Late Eocene. Zircons indicate nearby volcanic activity throughout the Early Cenozoic in NW Borneo. Inherited zircon ages indicate an alternation between Borneo and Tin Belt source rocks. A large deep marine basin, the Rajang Basin, formed north of the Lupar Line fault. Zircons from sediments of the Rajang Basin indicate they are of similar age and provenance as the contemporaneous terrestrial sediments to the south suggesting a narrow steep continental Sundaland margin at the
Oral health quality-of-life among undergraduate Malaysian dental students.
Harsh, P; Arunima, C; Manoj, K
2012-06-01
To assess the oral health quality of life among Malaysian dental students using the Oral Impacts on Daily Performance (OIDP) scale. Malaysian dental students of Melaka Manipal Medical College, Manipal campus, Manipal University, Manipal answered a structured questionnaire recording the demographic characteristics, behavioral characteristics and eight items of OIDP. The mean OIDP ADD and OIDP SC scores were respectively, 4.10 (sd = 5.16, range 8 - 40) and 2. 3 (sd = 2.3, range 0-8). A total of 50%, 32.9% and 28.6% of the dental students confirmed difficulties with eating, cleaning teeth and sleeping and relaxing, respectively. Statistically significant relationships were observed between OIDP (ultimate oral impact) and a count of non-clinical oral health indicators representing the second (intermediate) levels of oral impact. Logistic regression analysis revealed that dental students who were dissatisfied with their oral health had greater oral impact than their counterparts. The odds ratios for satisfaction with oral health, dental visits and frequency of brushing teeth were respectively 1.74 (0.58-5.32), 0.59 (0.11-3.24) and 1.33 (0.41-4.30). The study reports the Oral Impact on Daily Performance among Malaysian dental students and provides evidence of importance of social and behavioral characteristics in shaping dental students response.
Grinang, Jongkar; Ng, Peter K L
2015-04-10
Four new species of semiterrestrial gecarcinucid crabs are described from limestone and sandstone habitats in southwestern Sarawak, Malaysia: Terrathelphusa aglaia n. sp., T. cerina n. sp., T. kundong n. sp., and T. mas n. sp. The taxonomy of T. kuchingensis (Nobili, 1901) is discussed, its precise identity ascertained from fresh material, and its actual distribution determined. This increases the number of Terrathelphusa species in Borneo to eight.
ERIC Educational Resources Information Center
Quisenberry, Nancy L.
Methods of working with foreign students, especially those from Malaysia, have been modified at Southern Illinois University. Problems have arisen in dealing with two different groups of Malaysian students: recent graduates from secondary schools, and graduates of Malaysian teacher training colleges. The first group comprises very young students,…
Oral cancer awareness and its determinants among a selected Malaysian population.
Ghani, Wan Maria Nabillah; Doss, Jennifer Geraldine; Jamaluddin, Marhazlinda; Kamaruzaman, Dinan; Zain, Rosnah Binti
2013-01-01
To assess oral cancer awareness, its associated factors and related sources of information among a selected group of Malaysians. A cross-sectional survey was conducted on all Malaysian ethnic groups aged ≥15 years old at eight strategically chosen shopping malls within a two week time period. Data were analysed using chi-square tests and multiple logistic regression. Significance level was set at α<0.05. Most (84.2%) respondents had heard of oral cancer. Smoking was the most (92.4%) recognized high risk habit. Similar levels of awareness were seen for unhealed ulcers (57.3%) and red/white patches (58.0%) as signs of oral cancer. Age, gender, ethnicity, marital status, education, occupation and income were significantly associated with oral cancer awareness (p<0.05). There was a general lack of awareness regarding the risk habits, early signs and symptoms, and the benefits of detecting this disease at an early stage. Mass media and health campaigns were the main sources of information about oral cancer. In our Malaysian population, gender and age were significantly associated with the awareness of early signs and symptoms and prevention of oral cancer, respectively.
Measuring and explaining multi-directional inefficiency in the Malaysian dairy industry.
Mohd Suhaimi, Nurul Aisyah Binti; de Mey, Yann; Oude Lansink, Alfons
2017-01-01
The purpose of this paper is to measure the technical inefficiency of dairy farms and subsequently investigate the factors affecting technical inefficiency in the Malaysian dairy industry. This study uses multi-directional efficiency analysis to measure the technical inefficiency scores on a sample of 200 farm observations and single-bootstrap truncated regression model to define factors affecting technical inefficiency. Managerial and program inefficiency scores are presented for intensive and semi-intensive production systems. The results reveal marked differences in the inefficiency scores across inputs and between production systems. Intensive systems generally have lowest managerial and program inefficiency scores in the Malaysian dairy farming sector. Policy makers could use this information to advise dairy farmers to convert their farming system to the intensive system. The results suggest that the Malaysian Government should redefine its policy for providing farm finance and should target young farmers when designing training and extension programs in order to improve the performance of the dairy sector. The existing literature on Southeast Asian dairy farming has neither focused on investigating input-specific efficiency nor on comparing managerial and program efficiency. This paper aims to fill this gap.
ERIC Educational Resources Information Center
Granhemat, Mehdi; Abdullah, Ain Nadzimah
2017-01-01
This study examined the relationships between gender, ethnicity, ethnic identity, and language choices of Malaysian multilingual youths in the family domain of language use. Five hundred undergraduate students who belonged to different Malaysian ethnic groups were selected as participants of the study. The participant aged between 17 to 25 years…
Soil carbon stocks in Sarawak, Malaysia.
Padmanabhan, E; Eswaran, H; Reich, P F
2013-11-01
The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO2, CH4, and N2O have an anthropic source and of these CO2 is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m(-2) m(-1)), while Oxisols and Ultisols rate second (about 10-15 kg m(-2) m(-1)). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m(-2) m(-1). Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. Copyright © 2013 Elsevier B.V. All rights reserved.
Malaysian Private Education Quality: Application of SERVQUAL Model
ERIC Educational Resources Information Center
Vaz, Anthony; Mansori, Shaheen
2013-01-01
Intense competition among existing private education providers and the Malaysian government's relaxation of regulations for allowing international universities to open off shore campuses in Malaysia, have forced companies in the education industry to develop strategies which can help them to make their existing students satisfied and keep them…
Readiness towards Entrepreneurship Education: Students and Malaysian Universities
ERIC Educational Resources Information Center
Othman, Norasmah; Hashim, Norashidah; Wahid, Hariyaty Ab
2012-01-01
Purpose: The purpose of this paper is to observe the readiness of students and the internal environment of Malaysian public universities in the implementation of entrepreneurship education. Design/methodology/approach: The authors employed a quantitative approach and the main instrument used to gauge the entrepreneurship readiness among students…
The Use of Children's Literature in Malaysian Kindergartens.
ERIC Educational Resources Information Center
Cheng, Karen Kow Yip
This paper discusses the use of storytelling as a pedagogic tool in Malaysian kindergartens. By listening to stories, the children learn to tell stories that involve communicating meaning. This is an effective learning technique, because stories and storytelling feed the children's imaginations, hone their listening skills, extend their…
Thien, Lei Mee; Ong, Mei Yean
2015-01-01
This paper attempts to identify the extent to which the affective characteristics of Malaysian and Singaporean students' attainment compared to the OECD average in Programme for International Student Assessment (PISA) 2012, and examine the influence of students' affective characteristics, gender, and their socioeconomic status on mathematics performance at both student and school levels. Sample consisted of 5197 and 5546 15-year-old Malaysian and Singaporean students. Data were analysed using hierarchical linear modelling approach with HLM 7.0 software. Results showed that the Index of economic, social, and cultural status (ESCS), mathematics self-efficacy, and mathematics anxiety have significant effects on mathematics performance in Malaysia and Singapore at the student level. Proportion of boys at the school level has no significant effects on mathematics performance for both Malaysian and Singaporean students. ESCS mean at the school level has positive and significant effects on mathematics performance in Malaysia, but not in Singapore. Limitations, implications, and future studies were discussed.
Cardiopulmonary fitness in a sample of Malaysian population.
Singh, R; Singh, H J; Sirisinghe, R G
1989-01-01
Lung capacity and maximum oxygen uptake (VO2max) were measured directly in 167 healthy males, from all the main races in Malaysia. Their ages ranged from 13 to 59 years. They were divided into five age groups (A to E), ranging from the second to the sixth decade. Lung capacities were determined using a dry spirometer and VO2max was taken as the maximum rate of oxygen consumption during exhaustive exercise on a cycle ergometer. Mean forced vital capacity (FVC) was 3.3 +/- 0.5 l and it correlated negatively with age. Mean VO2max was 3.2 +/- 0.2 l.min-1 (56.8 +/- 3.5 ml.kg-1.min-1) in Group A (13-19 years) compared to 1.7 +/- 0.2 l.min-1 (28.9 +/- 2.9 ml.kg-1.min-1) in Group E (50-59 years). Regression analysis revealed an age-related decline in VO2max of 0.77 ml.kg-1.min-1.year-1. Multiple regression of the data gave the following equations for the prediction of an individual's VO2max: VO2max (l.min-1) = 1.99 + 0.035 (weight)-0.04 (age), VO2max (ml.kg-1.min-1) = 67.7-0.77 (age), where age is in years, weight in kg. In terms of VO2max as an index of cardiopulmonary performance. Malaysians have a relatively lower capacity when related to the Swedish norms or even to those of some Chilean workers. Malaysians were, however, within the average norms of the American Heart Association's recommendations. Age-related decline in VO2max was also somewhat higher in the Malaysians.
NASA Astrophysics Data System (ADS)
Sa'adi, Zulfaqar; Shahid, Shamsuddin; Chung, Eun-Sung; Ismail, Tarmizi bin
2017-11-01
This study assesses the possible changes in rainfall patterns of Sarawak in Borneo Island due to climate change through statistical downscaling of General Circulation Models (GCM) projections. Available in-situ observed rainfall data were used to downscale the future rainfall from ensembles of 20 GCMs of Coupled Model Intercomparison Project phase 5 (CMIP5) for four Representative Concentration Pathways (RCP) scenarios, namely, RCP2.6, RCP4.5, RCP6.0 and RCP8.5. Model Output Statistics (MOS) based downscaling models were developed using two data mining approaches known as Random Forest (RF) and Support Vector Machine (SVM). The SVM was found to downscale all GCMs with normalized mean square error (NMSE) of 48.2-75.2 and skill score (SS) of 0.94-0.98 during validation. The results show that the future projection of the annual rainfalls is increasing and decreasing on the region-based and catchment-based basis due to the influence of the monsoon season affecting the coast of Sarawak. The ensemble mean of GCMs projections reveals the increased and decreased mean of annual precipitations at 33 stations with the rate of 0.1% to 19.6% and one station with the rate of - 7.9% to - 3.1%, respectively under all RCP scenarios. The remaining 15 stations showed inconsistency neither increasing nor decreasing at the rate of - 5.6% to 5.2%, but mainly showing a trend of decreasing rainfall during the first period (2010-2039) followed by increasing rainfall for the period of 2070-2099.
Prescribing Roles in the Employability of Malaysian Graduates
ERIC Educational Resources Information Center
Yoong, David; Don, Zuraidah Mohd; Foroutan, Maryam
2017-01-01
In order to address the problems of graduate employability in Malaysia, the Malaysian Government produced in 2012, the "National Graduate Employability Blueprint" 2012-2017. In addition to setting out in detail the government's philosophy and vision, the blueprint identifies key players who are expected to play crucial roles in making…
Listen to the Voices of Unwed Teenage Mothers in Malaysian Shelter Homes: An Explorative Study
Saim, Nor Jana; Dufåker, Mona; Eriksson, Malin; Ghazinour, Mehdi
2013-01-01
This qualitative research aims to explore the daily life experiences of Malaysian unwed teenage mothers in shelter homes. The research is based on the thematic analysis of interviews with seventeen respondents aged from 12 to 18 years. Eight sub-themes described the experience of the unwed teenage mothers in the shelter home and led to three overall themes: rules and regulations, relationship with the staff and relationship with the other girls at the shelter home. The findings indicated that the shelter homes involved were not fulfilling the standard of the Malaysian national laws and United Nations Convention on the Rights of the Child. We strongly suggest that the authorities provide a clear guideline concerning the implementation of Malaysian national laws and United Nations Convention on the Rights of the Child. PMID:23985103
Transcultural Diabetes Nutrition Algorithm: A Malaysian Application
Hamdy, Osama; Chin Chia, Yook; Lin Lim, Shueh; Kumari Natkunam, Santha; Yeong Tan, Ming; Sulaiman, Ridzoni; Nisak, Barakatun; Chee, Winnie Siew Swee; Marchetti, Albert; Hegazi, Refaat A.; Mechanick, Jeffrey I.
2013-01-01
Glycemic control among patients with prediabetes and type 2 diabetes mellitus (T2D) in Malaysia is suboptimal, especially after the continuous worsening over the past decade. Improved glycemic control may be achieved through a comprehensive management strategy that includes medical nutrition therapy (MNT). Evidence-based recommendations for diabetes-specific therapeutic diets are available internationally. However, Asian patients with T2D, including Malaysians, have unique disease characteristics and risk factors, as well as cultural and lifestyle dissimilarities, which may render international guidelines and recommendations less applicable and/or difficult to implement. With these thoughts in mind, a transcultural Diabetes Nutrition Algorithm (tDNA) was developed by an international task force of diabetes and nutrition experts through the restructuring of international guidelines for the nutritional management of prediabetes and T2D to account for cultural differences in lifestyle, diet, and genetic factors. The initial evidence-based global tDNA template was designed for simplicity, flexibility, and cultural modification. This paper reports the Malaysian adaptation of the tDNA, which takes into account the epidemiologic, physiologic, cultural, and lifestyle factors unique to Malaysia, as well as the local guidelines recommendations. PMID:24385984
Transcultural diabetes nutrition algorithm: a malaysian application.
Hussein, Zanariah; Hamdy, Osama; Chin Chia, Yook; Lin Lim, Shueh; Kumari Natkunam, Santha; Hussain, Husni; Yeong Tan, Ming; Sulaiman, Ridzoni; Nisak, Barakatun; Chee, Winnie Siew Swee; Marchetti, Albert; Hegazi, Refaat A; Mechanick, Jeffrey I
2013-01-01
Glycemic control among patients with prediabetes and type 2 diabetes mellitus (T2D) in Malaysia is suboptimal, especially after the continuous worsening over the past decade. Improved glycemic control may be achieved through a comprehensive management strategy that includes medical nutrition therapy (MNT). Evidence-based recommendations for diabetes-specific therapeutic diets are available internationally. However, Asian patients with T2D, including Malaysians, have unique disease characteristics and risk factors, as well as cultural and lifestyle dissimilarities, which may render international guidelines and recommendations less applicable and/or difficult to implement. With these thoughts in mind, a transcultural Diabetes Nutrition Algorithm (tDNA) was developed by an international task force of diabetes and nutrition experts through the restructuring of international guidelines for the nutritional management of prediabetes and T2D to account for cultural differences in lifestyle, diet, and genetic factors. The initial evidence-based global tDNA template was designed for simplicity, flexibility, and cultural modification. This paper reports the Malaysian adaptation of the tDNA, which takes into account the epidemiologic, physiologic, cultural, and lifestyle factors unique to Malaysia, as well as the local guidelines recommendations.
Anti-gout Potential of Malaysian Medicinal Plants.
Abu Bakar, Fazleen I; Abu Bakar, Mohd F; Rahmat, Asmah; Abdullah, Norazlin; Sabran, Siti F; Endrini, Susi
2018-01-01
Gout is a type of arthritis that causes painful inflammation in one or more joints. In gout, elevation of uric acid in the blood triggers the formation of crystals, causing joint pain. Malaysia is a mega-biodiversity country that is rich in medicinal plants species. Therefore, its flora might offer promising therapies for gout. This article aims to systematically review the anti-gout potential of Malaysian medicinal plants. Articles on gout published from 2000 to 2017 were identified using PubMed, Scopus, ScienceDirect, and Google Scholar with the following keyword search terms: "gout," "medicinal plants," "Malaysia," "epidemiology," " in vitro," and " in vivo ." In this study, 85 plants were identified as possessing anti-gout activity. These plants had higher percentages of xanthine oxidase inhibitory activity (>85%); specifically, the Momordica charantia, Chrysanthemum indicum, Cinnamomum cassia, Kaempferia galanga, Artemisia vulgaris , and Morinda elliptica had the highest values, due to their diverse natural bioactive compounds, which include flavonoids, phenolics, tannin, coumarins, luteolin, and apigenin. This review summarizes the anti-gout potential of Malaysian medicinal plants but the mechanisms, active compounds, pharmacokinetics, bioavailability, and safety of the plants still remain to be elucidated.
The menopausal experience among indigenous women of Sarawak, Malaysia.
Syed Alwi, S A R; Lee, P Y; Awi, I; Mallik, P S; Md Haizal, M N
2009-12-01
To document the common menopausal symptoms and quality of life in indigenous women of Sarawak in Malaysia. A face-to-face interview using the Menopause-specific Quality of Life questionnaire was conducted with 276 indigenous Sarawakian women aged 40-65 years to determine the mean age of menopause and common symptoms (divided into vasomotor, psychosocial, physical and sexual domains) associated with menopause. The mean age at menopause of postmenopausal women was 50.78 +/- 2.47 years (range 47.3-58.2 years). The most common symptoms reported were aching in muscles and joints (82.6%), lack of energy (77.5%) and low backache (77.2%). The typical menopausal symptoms of hot flushes, night sweats, sweating and vaginal dryness were experienced by 42.4%, 34.8%, 29.7% and 49.3%, respectively of the women studied. Perimenopausal women (n = 114) experienced the most physical and psychosocial symptoms, while postmenopausal women (n = 102) experienced most sexual symptoms. Perimenopausal and postmenopausal women were reported to suffer more than premenopausal women (p < 0.001) within the four domains of symptoms (vasomotor, psychosocial, physical and sexual). The menopausal symptoms in this study correspond to those in other studies on Asian women but the prevalence of typical and classical menopausal symptoms was lower compared to studies on Caucasian women. The perimenopausal women had the most significant decrease in quality of life, followed by postmenopausal women and premenopausal women. Vasomotor symptoms had a predominant influence on the quality of life.
Modeling Environmental Literacy of Malaysian Pre-University Students
ERIC Educational Resources Information Center
Shamuganathan, Sheila; Karpudewan, Mageswary
2015-01-01
In this study attempt was made to model the environmental literacy of Malaysian pre-university students enrolled in a matriculation college. Students enrolled in the matriculation colleges in Malaysia are the top notch students in the country. Environmental literacy of this group is perceived important because in the future these students will be…
Sociolinguistic Competence and Malaysian Students' English Language Proficiency
ERIC Educational Resources Information Center
Muniandy, Mohan K.; Nair, Gopala Krishnan Sekharan; Shanmugam, Shashi Kumar Krishnan; Ahmad, Irma; Noor, Norashikin Binte Mohamed
2010-01-01
This paper aims to highlight the importance of teaching sociolinguistic competence to ESL learners in Malaysian schools. Sociolinguistic competence is the knowledge of socio cultural rules of language and of discourse. This type of competence requires an understanding of the socio context in which language is used. It is proposed that carefully…
Managing CD-ROM Service in Malaysian Academic Libraries.
ERIC Educational Resources Information Center
Majid, Shaheen
1998-01-01
Explores the management of CD-ROM service in Malaysian academic libraries and marketing strategies used to popularize it. Findings revealed that these libraries use a variety of marketing and promotional channels, some of which need improvement; the libraries need to strengthen their end-user education programs to suit users with different levels…
ERIC Educational Resources Information Center
Montesino, Max U.
2007-01-01
This paper looks at the net societal balance of post-independence affirmative action policies in Malaysia. Social imbalances prompted the country to implement affirmative policies to uplift the majority natives (Malays, Indigenous people of Sabah and Sarawak, etc.). These policies were reluctantly accepted by the immigrant communities (Chinese,…
Song, Beng-Kah; Chuah, Tse-Seng; Tam, Sheh May; Olsen, Kenneth M
2014-10-01
Weedy rice is a close relative of domesticated rice (Oryza sativa) that competes aggressively with the crop and limits rice productivity worldwide. Most genetic studies of weedy rice have focused on populations in regions where no reproductively compatible wild Oryza species occur (North America, Europe and northern Asia). Here, we examined the population genetics of weedy rice in Malaysia, where wild rice (O. rufipogon) can be found growing in close proximity to cultivated and weedy rice. Using 375 accessions and a combined analysis of 24 neutral SSR loci and two rice domestication genes (sh4, controlling seed shattering, and Bh4, controlling hull colour), we addressed the following questions: (i) What is the relationship of Malaysian weedy rice to domesticated and wild rice, and to weedy rice strains in the USA? (ii) To what extent does the presence of O. rufipogon influence the genetic and phenotypic diversity of Malaysian weeds? (iii) What do the distributions of sh4 and Bh4 alleles and associated phenotypes reveal about the origin and contemporary evolution of Malaysian weedy rice? Our results reveal the following: independent evolutionary origins for Malaysian weeds and US strains, despite their very close phenotypic resemblance; wild-to-weed gene flow in Malaysian weed populations, including apparent adaptive introgression of seed-shattering alleles; and a prominent role for modern Malaysian cultivars in the origin and recent proliferation of Malaysian weeds. These findings suggest that the genetic complexity and adaptability of weedy crop relatives can be profoundly influenced by proximity to reproductively compatible wild and domesticated populations. © 2014 John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Farashaiyan, Atieh; Amirkhiz, Seyed Yasin Yazdi
2011-01-01
This paper reports on a study that was carried out to describe and compare the apology strategies utilized by Iranian EFL and Malaysian ESL learners in confronting identical apology situations. For this purpose, data were elicited from 15 Iranian and 15 Malaysian students through a "Discourse completion tasks" questionnaire. The…
Understanding the Perception of Islamic Medicine Among the Malaysian Muslim Community.
Ahmad, Khadher; Ariffin, Mohd Farhan Md; Deraman, Fauzi; Ariffin, Sedek; Abdullah, Mustaffa; Razzak, Monika Munirah Abd; Yusoff, M Y Zulkifli Mohd; Achour, Meguellati
2017-10-26
This study was conducted to identify and describe the patients' perceptions of Islamic medicine based on gender, age, marital, educational level and working status among the Malaysian Muslim population. A nationwide interviewer-administered questionnaire survey was conducted in 2013. An open-ended questionnaire pertaining to Islamic medicine was used to increase the probability of capturing maximum data. This survey implemented a multistage design, stratified by state, proportionate to the size of the state population and was representative of the Malaysian population. Post-survey classification of results was performed accordingly. Complex data analysis was carried out using SPSS 16.0. The discussion was identified and categorised into various sections. The paper concludes that Islamic medicine has a major influence in the Malaysian Muslim community compared to other alternatives. Further, its potential for growth and importance especially for treating spiritual ailments cannot be denied. The respondents indicated that two factors motivate Islamic medicine in Malaysia: (1) the Muslim community opts for alternative healing because of their dissatisfaction with conventional methods; (2) Islamic medicine focuses only on healing spiritual-related problems. The average perception of respondents is that the function of Islamic medicine in healing physical diseases is undervalued and that it is not suitable to replace the functions of modern health institutions.
Hand grip strength in the adult Malaysian population.
Kamarul, T; Ahmad, T S; Loh, W Y C
2006-08-01
To measure the hand grip strength of Malaysians aged 18 to 65 years. Between January and April 2003, 412 subjects (200 women and 212 men) were recruited from staff, students, and visitors of the University of Malaya Medical Centre. Socioeconomic, general health, and lifestyle data were collected from each subject using a standard questionnaire. Weight and height were measured prior to testing. Standardised positioning and instructions based on several hand grip protocols were used. Data were collected using the LIDO kinetic work set. 93% of the subjects were right-hand dominant and 7% were left-hand dominant. Hand grip strength was significantly correlated with hand dominance, gender, occupation, height, and weight, but not body mass index. No significant differences in grip strength were noted with regard to race or level of income. Men were stronger than women in all age-groups, with a ratio of 1.75:1. In both right- and left-hand dominant groups, the dominant hand was consistently stronger than the non-dominant side, with a ratio of 1.12:1 in the right-hand dominant group and 1.05:1 in the left-hand dominant group. The strongest hand grip strength in the right-hand dominant group occurred in the age-group of 25 to 34 years; in the left-hand dominant group it was in the age-group of 18 to 24 years. In western populations, the mean grip strength can be as much as 1.5 times greater than in the Malaysian population. Data derived from western populations cannot be applied to a comparable Malaysian population. Gender, hand dominance, age, occupation, weight, and height must be considered when establishing normal values for grip strength.
Bangsa Malaysia and Recent Malaysian English Language Policies
ERIC Educational Resources Information Center
Ridge, Brian
2004-01-01
This paper analyses Malaysia's English language policies, especially since the mid 1990s, in the light of more recent claims for a united Malaysian nation (under the banner of "bangsa Malaysia") and in the context of English language and its potential for Malaysia to forge more of an externalised identity. It examines the impact of…
Exploring the clean development mechanism: Malaysian case study.
Pedersen, Anne
2008-02-01
During 2006 the CDM market in Malaysia became established and by December 2007 a total of 20 Malaysian projects had registered with the CDM Executive Board. The Kyoto Protocol defines the Annex 1 countries, as countries that are obliged to reduce their greenhouse gas (GHG) emissions and the clean development mechanism (CDM) allows Annex 1 countries to develop projects, which contribute to emission reduction, in non-Annex 1 (developing) countries. Currently, two projects have been corrected due to request for review and there is one project for which review is requested. Two projects have been rejected by the Executive Board. The broad knowledge of CDM in Malaysia and the number of successful projects are partly due to the well-functioning CDM institutional framework in Malaysia. As an illustration this article focuses on a Malaysian-Danish project and describes the implementation of CDM in Malaysia and refers to this specific project. The project was registered with the CDM Executive Board in May 2007 and is a methane avoidance project in which methane is captured from a landfill and used to generate electricity.
The supportive care needs for prostate cancer patients in Sarawak.
Cheah, Whye Lian; Ling, Ngok Chuo; Chang, Kam Hock
2016-02-01
This cross-sectional study aimed to determine the prevalence of unmet supportive care needs among prostate cancer patients. The cross-sectional study was conducted among all prostate cancer patients at the Sarawak General Hospital. Interview was done using the Supportive Care Needs Survey-Short Form (SCNS-SF) and the Health Service Utilization Questionnaires (HSUQ). Data were analysed using Statistical Package for the Social Sciences (SPSS) 20. A total of ninety-five patients participated, with majority were aged 65 and above and of primary educational level. The two most frequently reported unmet supportive care needs were "informed about cancer which is under control or diminishing" and "informed about things you can do to help yourself to get well" under the domain Health System and Information. Respondents who were older (65 years and above) had significant lower unmet needs in psychology (P<0.01), and sexuality compared to the younger group below 65 years (P<0.01). Except for physical and daily living, respondents with primary school level had significant lower unmet needs in all domains compared to secondary school level. Respondents with known stages of cancer had higher unmet needs in all domains compared to those who did not know. Healthcare providers should provide more responsive, emotionally sensitive and client-centered care to patients with prostate cancer, particularly in the area of Health System and Information, and psychological support.
Waist circumference percentile curves for Malaysian children and adolescents aged 6.0-16.9 years.
Poh, Bee Koon; Jannah, Ahmad Nurul; Chong, Lai Khuen; Ruzita, Abd Talib; Ismail, Mohd Noor; McCarthy, David
2011-08-01
The prevalence of obesity is increasing rapidly and abdominal obesity especially is known to be a risk factor for metabolic syndrome and other non-communicable diseases. Waist circumference percentile curves are useful tools which can help to identify abdominal obesity among the childhood and adolescent populations. To develop age- and sex-specific waist circumference (WC) percentile curves for multi-ethnic Malaysian children and adolescents aged 6.0-16.9 years. Subjects and methods. A total of 16,203 participants comprising 8,093 boys and 8,110 girls recruited from all regions of Malaysia were involved in this study. Height, weight, WC were measured and BMI calculated. Smoothed WC percentile curves and values for the 3rd, 5th, 10th, 25th, 50th, 75th, 90th, 95th and 97th percentiles were constructed using the LMS Method. WC was found to increase with age in both sexes, but boys had higher WC values at every age and percentile. Z-scores generated using the UK reference data shows that Chinese children had the highest WC compared to Malays, Indians and other ethnicities. Comparisons with other studies indicate that at the 50th percentile, Malaysian curves did not differ from the UK, Hong Kong and Turkish curves, but at the 90th percentile, Malaysian curves were higher compared with other countries, starting at 10 years of age. The 90th percentile was adopted as the cut-off point to indicate abdominal obesity in Malaysian children and adolescents. These curves represent the first WC percentiles reported for Malaysian children, and they can serve as a reference for future studies.
ADHD bifactor model based on parent and teacher ratings of Malaysian children.
Gomez, Rapson
2014-04-01
The study used confirmatory factor analysis to ascertain support for the bifactor model of the Attention Deficit/Hyperactivity Disorder (ADHD) symptoms, based on parent and teacher ratings for a group of Malaysian children. Malaysian parents and teachers completed ratings of ADHD and Opposition Defiant Disorder (ODD) symptoms for 934 children. For both sets of ratings, the findings indicating good fit for the bifactor model, and the factors in this model showed differential associations with ODD, thereby supporting the internal and external validity of this model. The theoretical and clinical implications of the findings are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Cheong, Jadeera Phaik Geok; Khoo, Selina; Razman, Rizal
2016-01-01
This study analyzed newspaper coverage of the 2012 London Paralympic Games by 8 Malaysian newspapers. Articles and photographs from 4 English-language and 4 Malay-language newspapers were examined from August 28 (1 day before the Games) to September 10, 2012 (1 day after the Games closing). Tables, graphs, letters, fact boxes, and lists of events were excluded from analysis. A total of 132 articles and 131 photographs were analyzed. Content analysis of the newspaper articles revealed that most (62.8%) of the articles contained positive reference to the athletes with a disability. There were equal numbers (39.1%) of action and static shots of athletes. More articles and photographs of Malaysian (58%) than non-Malaysian (42%) athletes with a disability were identified. Only 14.9% of the articles and photographs were related to female athletes with a disability.
Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.
Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng
2012-01-01
SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.
Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview
Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng
2012-01-01
SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582
Student Mobility through Linked Programmes: A Malaysian Case-Study.
ERIC Educational Resources Information Center
Ghani, Zainal
This report on student mobility in linked programs of higher education details the Malaysian experience involving such programs, their development, quality maintenance, and benefits. Chapter 1 briefly describes the educational system and development of universities in Malaysia. Chapter 2 explores the different factors that have influenced…
Predictors of Academics' Career Advancement at Malaysian Private Universities
ERIC Educational Resources Information Center
Arokiasamy, Lawrence; Ismail, Maimunah; Ahmad, Aminah; Othman, Jamilah
2011-01-01
Purpose: This paper aims to examine the influence of individual and organizational variables on the career advancement of academics in Malaysian private universities. Design/methodology/approach: A correlation study was conducted in six private universities. Data were collected using a structured self-administered questionnaire. The dependent…
Malaysian Students in U.S. Colleges and Universities.
ERIC Educational Resources Information Center
Boyd, Alan W., Ed.; Noss, Elaine M., Ed.
This publication is a response to the need for better understanding of the Malaysian student population studying U.S. institutions of higher education. Part 1 is an introduction to Malaysia, with two articles giving background information. The first is a history of Malaysia and the development of its education system, by Fatimah Hamid-Don of Ohio…
Review on the Risk Assessment of Heavy Metals in Malaysian Clams.
Hossen, Md Faruk; Hamdan, Sinin; Rahman, Md Rezaur
2015-01-01
The current review discusses the levels of six heavy metals in different clam species from 34 sites of Malaysian coasts. The concentrations (µg/g dry weight) of these heavy metals ranged around 0.18-8.51, 0.13-17.20, 2.17-7.80, 0.84-36.00, 24.13-368.00, and 177.82-1912.00 for Cd, Pb, Ni, Cu, Zn, and Fe, respectively. It was observed that the concentrations of metals slightly depend on different clam species but mostly depend on site locations. According to Malaysian Food Regulation (1985), about 30% and more than 50% sites are safe from Cd and Pb contamination, respectively, and also the clam species from the other populations studied were safe for consumption.
Malaysian Journal of Medical Sciences’ Publishing Report (2014–2015)
Zulkapli, Nour Azimah; Sobi, Suhana; Mohd Zubaidi, Nor Azlina; Abdullah, Jafri Malin
2016-01-01
The Malaysian Journal of Medical Sciences (MJMS) has conducted a simple analysis of its scholarly publication, based on the auto-generated data compiled from ScholarOne Manuscripts™, an innovative, web-based, submission and peer-review workflow solution for scholarly publishers. The performance of the MJMS from 2014–2015 is reported on in this editorial, with a focus on the pattern of manuscript submission, geographical contributors and the acceptance-rejection rate. The total number of manuscript submissions has increased from 264 in 2014, to 272 in 2015. Malaysians are the main contributors to the MJMS. The total number of manuscript rejections following the review process was 79 (29.9%) in 2014, increasing to 92 (33.8%) the following year, in accordance with the exacting quality control criteria applied by the journal’s editor to the submitted manuscripts. PMID:27660539
Anti-gout Potential of Malaysian Medicinal Plants
Abu Bakar, Fazleen I.; Abu Bakar, Mohd F.; Rahmat, Asmah; Abdullah, Norazlin; Sabran, Siti F.; Endrini, Susi
2018-01-01
Gout is a type of arthritis that causes painful inflammation in one or more joints. In gout, elevation of uric acid in the blood triggers the formation of crystals, causing joint pain. Malaysia is a mega-biodiversity country that is rich in medicinal plants species. Therefore, its flora might offer promising therapies for gout. This article aims to systematically review the anti-gout potential of Malaysian medicinal plants. Articles on gout published from 2000 to 2017 were identified using PubMed, Scopus, ScienceDirect, and Google Scholar with the following keyword search terms: “gout,” “medicinal plants,” “Malaysia,” “epidemiology,” “in vitro,” and “in vivo.” In this study, 85 plants were identified as possessing anti-gout activity. These plants had higher percentages of xanthine oxidase inhibitory activity (>85%); specifically, the Momordica charantia, Chrysanthemum indicum, Cinnamomum cassia, Kaempferia galanga, Artemisia vulgaris, and Morinda elliptica had the highest values, due to their diverse natural bioactive compounds, which include flavonoids, phenolics, tannin, coumarins, luteolin, and apigenin. This review summarizes the anti-gout potential of Malaysian medicinal plants but the mechanisms, active compounds, pharmacokinetics, bioavailability, and safety of the plants still remain to be elucidated. PMID:29628890
Improving Malaysian cocoa quality through the use of dehumidified air under mild drying conditions.
Hii, Ching L; Law, Chung L; Cloke, Michael; Sharif, Suzannah
2011-01-30
Various studies have been conducted in the past to improve the quality of Malaysian cocoa beans. However, the processing methods still remain crude and lack technological advancement. In terms of drying, no previous study has attempted to apply advanced drying technology to improve bean quality. This paper presents the first attempt to improve the quality of cocoa beans through heat pump drying using constant air (28.6 and 40.4 °C) and stepwise (step-up 30.7-43.6-56.9 °C and step-down 54.9-43.9 °C) drying profiles. Comparison was made against hot air drying at 55.9 °C. Product quality assessment showed significant improvement in the quality of Malaysian cocoa beans. Quality was found to be better in terms of lower acidity (higher pH) and higher degree of browning (cut test) for cocoa beans dried using the step-up profile. All heat pump-dried samples showed flavour quality comparable to that of Ghanaian and better than that of Malaysian and Indonesian commercial samples. Step-up-dried samples showed the best flavour profile with high level of cocoa flavour, low in sourness and not excessive in bitterness and astringency. Dried cocoa samples from the step-up drying profile showed the best overall quality as compared with commercial samples from Malaysia, Indonesia and Ghana. The improvement of Malaysian cocoa bean quality is thus achievable through heat pump drying. 2010 Society of Chemical Industry.
NASA Astrophysics Data System (ADS)
Zainol, M. R. R. M. A.; Kamaruddin, M. A.; Zawawi, M. H.; Wahab, K. A.
2017-11-01
Smooth Particle Hydrodynamic is the three-dimensional (3D) model. In this research work, three cases and one validation have been simulate using DualSPHysics. Study area of this research work was at Sarawak Barrage. The cases have different water level at the downstream. This study actually to simulate riverbed erosion and scouring properties by using multi-phases cases which use sand as sediment and water. The velocity and the scouring profile have been recorded as the result and shown in the result chapter. The result of the validation is acceptable where the scouring profile and the velocity were slightly different between laboratory experiment and simulation. Hence, it can be concluded that the simulation by using SPH can be used as the alternative to simulate the real cases.
Chie, Qiu Ting; Tam, Cai Lian; Bonn, Gregory; Wong, Chee Piau; Dang, Hoang Minh; Khairuddin, Rozainee
2015-01-01
In recent years, there have been increasing accounts of illegal substance abuse among university students and professional groups in Malaysia. This study looks at university students’ perceptions about this phenomenon. Students from Malaysian universities were asked for their impressions about drug availability and abuse, as well as factors contributing to drug abuse and relapse. The questionnaire also inquired into their knowledge and views regarding government versus private rehabilitation centers, as well as their exposure to, and views about, school-based drug-prevention education. Participants were 460 university students from five Malaysian states: Penang, Selangor, Kuala Lumpur, Sabah, and Sarawak. Results showed gender differences in perceptions of relapse prevention strategies, as well as factors leading to drug abuse and relapse. Students also believed that drug education would be more effective if initiated between the ages of 11 and 12 years, which is slightly older than the common age of first exposure, and provided suggestions for improving existing programs. Implications of student perceptions for the improvement of current interventions and educational programs are discussed. PMID:25999867
Susceptibility of human Plasmodium knowlesi infections to anti-malarials
2013-01-01
Background Evidence suggests that Plasmodium knowlesi malaria in Sarawak, Malaysian Borneo remains zoonotic, meaning anti-malarial drug resistance is unlikely to have developed in the absence of drug selection pressure. Therefore, adequate response to available anti-malarial treatments is assumed. Methods Here the ex vivo sensitivity of human P. knowlesi isolates in Malaysian Borneo were studied, using a WHO schizont maturation assay modified to accommodate the quotidian life cycle of this parasite. The in vitro sensitivities of P. knowlesi H strain adapted from a primate infection to in vitro culture (by measuring the production of Plasmodium lactate dehydrogenase) were also examined together with some assays using Plasmodium falciparum and Plasmodium vivax. Results Plasmodium knowlesi is uniformly highly sensitive to artemisinins, variably and moderately sensitive to chloroquine, and less sensitive to mefloquine. Conclusions Taken together with reports of clinical failures when P. knowlesi is treated with mefloquine, the data suggest that caution is required if using mefloquine in prevention or treatment of P. knowlesi infections, until further studies are undertaken. PMID:24245918
2015-06-01
of the author and do not reflect the official policy or position of the Department of Defense or the U.S. Government . IRB Protocol number ____N...maximum 200 words) The government of Malaysia decided to establish a new dedicated agency for law enforcement in the Malaysian Maritime Zone, in...CONFRONTING A NEW AGENCY: THE CASE OF THE MALAYSIAN MARITIME ENFORCEMENT AGENCY ABSTRACT The government of Malaysia decided to establish a
Quality of Life of Older Malaysians Living Alone
ERIC Educational Resources Information Center
Yahaya, Nurizan; Abdullah, Siti Suhailah; Momtaz, Yadollah Abolfathi; Hamid, Tengku Aizan
2010-01-01
According to the 2000 census report, about 7% of the 1.4 million people 60 years and over in Malaysia live alone. This study investigated socioeconomic factors affecting the quality of life of this vulnerable population. Data from a subsample of the study on Mental Health and Quality of Life of Older Malaysians were used in this paper. About 10%…
Competencies Acquisition through Self-Directed Learning among Malaysian Managers
ERIC Educational Resources Information Center
Hashim, Junaidah
2008-01-01
Purpose: The purpose of this paper is to examine how Malaysian managers acquire job competencies through self-directed learning activities at their workplace. Specifically it aims to investigate what types of job competencies are required for the managers, how they learn to acquire those competencies, and whether the managers have the…
Confidence in Teaching Mathematics among Malaysian Pre-Service Teachers
ERIC Educational Resources Information Center
Yunus, Aida Suraya Md.; Hamzah, Ramlah; Ismail, Habsah; Husain, Sharifah Kartini Said; Ismail, Mat Rofa
2006-01-01
This study focuses on the confidence level of mathematics education students in teaching school mathematics. Respondents were 165 final year students from four Malaysian universities. It was found that the respondents showed a strong foundation in mathematics upon entrance to the university. In spite of their strong background in school…
Quality Malaysian English Language Teachers: Examining a Policy Strategy
ERIC Educational Resources Information Center
Kepol, Napisah
2017-01-01
Purpose: The purpose of this paper is to examine and discuss one of the strategies in the latest Malaysian language education policy "Memartabatkan Bahasa Malaysia Memperkukuh Bahasa Inggeris" (MBMMBI) (To Uphold Bahasa Malaysia and to Strengthen the English Language). The strategy in focus is aimed at improving the quality of English…
Dropout Prevention Initiatives for Malaysian Indigenous Orang Asli Children
ERIC Educational Resources Information Center
Nor, Sharifah Md; Roslan, Samsilah; Mohamed, Aminuddin; Hassan, Kamaruddin Hj. Abu; Ali, Mohamad Azhar Mat; Manaf, Jaimah Abdul
2011-01-01
This paper discusses dropout prevention initiatives by the Malaysian government for the disadvantaged indigenous Orang Asli people in the rural villages of Peninsular Malaysia. The roles of the Ministry of Education (MOE) as well as the Institutes of Teacher Education (ITEs) are highlighted pertaining to efforts at improving the quality of…
Undergraduate education in special needs dentistry in Malaysian and Australian dental schools.
Ahmad, Mas S; Razak, Ishak A; Borromeo, Gelsomina L
2014-08-01
Meeting the oral health care needs of the growing population of people with special health care needs (SHCN) starts with dental students' acquisition of sound knowledge and development of clinical competence at the predoctoral level. The aim of this study was to review the level of undergraduate education in Special Needs Dentistry (SND) in Malaysian and Australian dental schools. The deans of all six Malaysian public dental schools and eight of nine Australian dental schools participated in a postal survey on current undergraduate didactic and clinical training in SND at their institutions. The results showed the number of dental schools in Malaysia with teaching in SND as a specific discipline was relatively low compared to that of Australia. However, a high percentage of Malaysian and Australian dental schools reported incorporating teaching of SND into pediatric dentistry (83.3 percent vs. 75 percent), oral medicine/oral pathology (66.7 percent vs. 75 percent), and oral surgery (66.7 percent vs. 25 percent). Most respondents said their school delivered SND clinical training in dental school clinics, hospital-based settings, and residential aged care facilities. Respondents in both countries viewed lack of faculty expertise as the greatest barrier to providing SND education. The study provides valuable information that can direct SND curriculum development in the two countries.
Review on the Risk Assessment of Heavy Metals in Malaysian Clams
Hamdan, Sinin; Rahman, Md. Rezaur
2015-01-01
The current review discusses the levels of six heavy metals in different clam species from 34 sites of Malaysian coasts. The concentrations (µg/g dry weight) of these heavy metals ranged around 0.18–8.51, 0.13–17.20, 2.17–7.80, 0.84–36.00, 24.13–368.00, and 177.82–1912.00 for Cd, Pb, Ni, Cu, Zn, and Fe, respectively. It was observed that the concentrations of metals slightly depend on different clam species but mostly depend on site locations. According to Malaysian Food Regulation (1985), about 30% and more than 50% sites are safe from Cd and Pb contamination, respectively, and also the clam species from the other populations studied were safe for consumption. PMID:26060840
Complementary and Alternative Medicine (CAM) use by Malaysian oncology patients.
Farooqui, Maryam; Hassali, Mohamed Azmi; Abdul Shatar, Aishah Knight; Shafie, Asrul Akmal; Seang, Tan Boon; Farooqui, Muhammad Aslam
2012-05-01
The current study sought to evaluate Malaysian oncology patients' decision making about the use of Complementary and Alternative Medicine (CAM) for the management of their care. Patients were interviewed across three major Malaysian ethnic groups, Malay, Chinese and Indian. Thematic content analysis identified four central themes: Conceptualizing CAM, the decision making process; rationale given for selecting or rejecting CAM and barriers to CAM use. Participants generally used the term 'traditional medicine', referred to locally as 'ubat kampung', meaning medicine derived from 'local traditions'. Mixed reactions were shown concerning the effectiveness of CAM to cure cancer and the slow progression of CAM results and treatment costs were cited as major barriers to CAM use. Concerns regarding safety and efficacy of CAM in ameliorating cancer as well as potential interactions with conventional therapies highlighted the importance of patients' knowledge about cancer treatments. Copyright © 2011 Elsevier Ltd. All rights reserved.
Masud, Muhammad Mehedi; Junsheng, Ha; Akhtar, Rulia; Al-Amin, Abul Quasem; Kari, Fatimah Binti
2015-02-01
This paper estimates Malaysian farmers' willingness to pay (WTP) for a planned adaptation programme for addressing climate issues in the Malaysian agricultural sector. We used the contingent valuation method (CVM) for a monetary valuation of farmers' preferences for a planned adaptation programme by ascertaining the value attached to address climatic issues in the Malaysian agricultural sector. Structured questionnaires were distributed among the sampled farmers. The study found that 74 % of respondents were willing to pay for a planned adaptation programme and that several socioeconomic and motivation factors have greater influence on their WTP. This paper clearly specifies the steps needed for all institutional bodies to better address issues in climate change. The outcomes of this paper will support policy makers to better design an efficient adaptation framework for adapting to the adverse impacts of climate change.
Predictors of Self-Regulated Learning in Malaysian Smart Schools
ERIC Educational Resources Information Center
Yen, Ng Lee; Bakar, Kamariah Abu; Roslan, Samsilah; Luan, Wong Su; Abd Rahman, Petri Zabariah Mega
2005-01-01
This study sought to uncover the predictors of self-regulated learning in Malaysian smart schools. The sample consisted of 409 students, from six randomly chosen smart schools. A quantitative correlational research design was employed and the data were collected through survey method. Six factors were examined in relation to the predictors of…
A perspective study on green cleaning for Malaysian public hospital
NASA Astrophysics Data System (ADS)
Ramli, N. A.; Zawawi, E. M.; Arif, N. R. M.; Mahbob, N. S.; Sulaiman, Z.; Zainol, N. N.
2018-02-01
Cleaning being a major contributor to the operations and maintenance expenditure and also Indoor Environmental Quality (IEQ) issues. Improper and ineffective cleaning can harm the environment and poses greatest risk to health. The use of traditional cleaning products presents a variety of human health and ecological concerns; and may contribute to poor IEQ. As an effort to reduce the issue of operations and maintenance costs and IEQ issues in a building, it is important to establish a green cleaning programme to ensure that the buildings are cleaned in a green way. Numbers of scholars has pointed out the factors which had prevented the green cleaning implementation in hospital buildings. Nonetheless, the significance of these factors has yet to be practically explored in the Malaysian context. Hence, the aim of the paper is to identify the most critical factor that prevents the implementation of green cleaning in Malaysian hospital building. A questionnaire survey and personal communication (i.e. interview) was conducted which involved two groups of respondents. They are the hospital maintenance staff (Cleansing Service Department) and cleaning contractors. Frequency and criticality index calculations have been used to rank these factors according to the level of importance. The result showed that an “unclear components and requirements of green cleaning” indicated as the most critical factor that prevent the implementation of green cleaning in Malaysian hospital building. In the concern for a successful implementation of green cleaning, it is hope that the findings of these studies can be enlightenment to the cleaning contractors as well as the hospital maintenance management team in Malaysia.
Self-perceived mental well-being amongst Malaysian dentists.
Ab-Murat, Norintan; Mason, Lydia; Kadir, Rahimah Abdul; Yusoff, Noriah
2018-06-01
To assess Malaysian dentists' perceptions of their mental well-being. A self-administered questionnaire was developed based on a conceptual framework of mental health and well-being model. Two aspects were assessed, namely the physiological (two domains) and the psychological (six domains). Participants were asked to rate their experiences of the aforementioned aspects using a 5-point Likert scale ranging from all the time to never. The response rate was 81%. Most of the dentists (61.7%) perceived having positive mental well-being. Under the physiological aspect, most respondents reported that they were 'generally happy' (93.3%), but about 30% stated they were 'stressed physically and emotionally'. Of the six domains under the psychological aspect, positive well-being was observed in the 'sense of coherence' and 'behavioural stress' domains. Participants who were above 40 years old, married and had children reported having a more positive mental well-being when compared with their counterparts. Overall, most Malaysian dentists perceived having a positive mental well-being. It is crucial, however, to closely monitor and initiate early interventions for those with negative symptoms to ensure the safe practice of dentistry.
Male fetuses are associated with increased risk for cesarean delivery in Malaysian nulliparae.
Viegas, Osborn A C; Lee, Pei Sue; Lim, Keng Joo; Ravichandran, Jeganathan
2008-01-01
The association between fetal sex and outcome of pregnancy and labor has been well documented in western populations. However, no studies in Malaysia or other developing countries have examined the effect of fetal sex on such outcomes.The main objective of this study was to determine the influence of fetal sex on the outcome of labor at term in a cohort of Malaysian nulliparae.A retrospective observational study was designed using data from 4644 Malaysian nulliparae who gave birth consecutively to singleton male babies at Hospital Sultanah Aminah, Johor Bahru, after normal full-term pregnancies.The results of this study indicate that mothers giving birth to male infants have a greater risk of requiring cesarean delivery because male babies are heavier and have statistically significantly greater head circumference (P < .001). These findings concur with those obtained in western populations and suggest that the differences in outcome observed are biological, not dictated by race, ethnicity, or environmental conditions. Such information could help in the antenatal assessment of Malaysian patients and stimulate more comprehensive studies of the mechanisms involved in this sex-based difference in outcomes. Reasons for such differences are proposed.
Apalasamy, Yamunah Devi; Ming, Moy Foong; Rampal, Sanjay; Bulgiba, Awang; Mohamed, Zahurin
2013-01-01
Melanocortin-4 receptor (MC4R) is an important regulator of body weight and energy intake. Genetic polymorphisms of the MC4R gene have been found to be linked to obesity in many recent studies across the globe. This study aimed to examine the effects of MC4R polymorphisms on obesity parameters, Linkage disequilibrium (LD) pattern and haplotypes in Malaysian Malays. The study subjects were 652 Malaysian Malays. Genomic DNA was extracted from buccal swabs. Genotyping was performed using Sequenom MassARRAY® iPLEX platform. Anthropometric and blood lipid profiles were measured. MC4R rs571312 SNP was associated with logBMI (p = 0.008) and systolic blood pressure (p = 0.005), while MC4R rs2229616 SNP was associated with total cholesterol (TC) levels (p = 0.016). The MC4R rs7227255 SNP did not show any association with obesity parameters. The strength of LD of the MC4R gene region is low and the haplotypes were not associated with obesity in Malaysian Malays.
Wan Hassan, Wan Nurazreena; Yusof, Zamros Yuzadi Mohd; Makhbul, Mohd Zambri Mohamed; Shahidan, Siti Safuraa Zahirah; Mohd Ali, Siti Farhana; Burhanudin, Rashidah; Gere, Maria Jirom
2017-03-21
The Malay version of the Psychosocial Impact of Dental Aesthetics Questionnaire has been validated for use by Malaysian adolescents. Although Malay is their national language, English is widely used as the lingua franca among Malaysians of different ethnicities. This study aimed to validate an English version of the PIDAQ adapted for use by Malaysian adolescents to optimize data capture from adolescents who prefer English as the medium for communication. The published English version of PIDAQ was pilot tested on 12- to 17-year-old adolescents, resulting in a few modifications to suit the Malaysian variety of English. Psychometric properties were tested on 393 adolescents who attended orthodontic practices and selected schools. Malocclusion was assessed using the Malocclusion Index, an aggregation of Perception of Occlusion Scale and the Aesthetic Component of the Index of Orthodontic Treatment Need, by the subjects (MI-S) and investigators (MI-D). Data were analysed for internal consistency and age-associated invariance, discriminant, construct and criterion validities, reproducibility and floor and ceiling effects using AMOS v.20 and SPSS v.20. The item Don't like own teeth on video of the Aesthetic Concern (AC) subscale was not relevant to a large proportion of participants (11.7%). Therefore, it was removed and the Malaysian English PIDAQ was analysed based on 22 items instead of 23 items. Confirmatory factor analysis showed good fit statistics (comparative fit index: 0.902, root-mean-square error of approximation: 0.066). Internal consistency was good for the Dental Self-Confidence, Social Impact and Psychological Impact subscales (Cronbach's alpha: 0.70-0.95) but lower (0.52-0.62) though acceptable for the AC subscale as it consisted of only 2 items. The reproducibility test was acceptable (intra-class correlations: 0.53-0.78). For all PIDAQ subscales, the MI-S and MI-D scores of those with severe malocclusion differed significantly from those with no or
Students' Entrepreneurial Inclination at a Malaysian Polytechnic: A Preliminary Investigation
ERIC Educational Resources Information Center
Yasin, Ahmad Yasruddin Md; Mahmood, Nik Abdul Aziz Nik; Jaafar, Nik Azyyati Nik
2011-01-01
This paper reports preliminary results of an ongoing project to examine students' inclination towards entrepreneurship at a Malaysian polytechnic. The study used a self-administered questionnaire to explore the influence of entrepreneurial intent, perceived behavioral control, self-efficacy, perceived barriers, perceived support factors and…
Yang, Xiaohong R; Devi, Beena C R; Sung, Hyuna; Guida, Jennifer; Mucaki, Eliseos J; Xiao, Yanzi; Best, Ana; Garland, Lisa; Xie, Yi; Hu, Nan; Rodriguez-Herrera, Maria; Wang, Chaoyu; Jones, Kristine; Luo, Wen; Hicks, Belynda; Tang, Tieng Swee; Moitra, Karobi; Rogan, Peter K; Dean, Michael
2017-10-01
To characterize the spectrum of germline mutations in BRCA1, BRCA2, and PALB2 in population-based unselected breast cancer cases in an Asian population. Germline DNA from 467 breast cancer patients in Sarawak General Hospital, Malaysia, where 93% of the breast cancer patients in Sarawak are treated, was sequenced for the entire coding region of BRCA1; BRCA2; PALB2; Exons 6, 7, and 8 of TP53; and Exons 7 and 8 of PTEN. Pathogenic variants included known pathogenic variants in ClinVar, loss of function variants, and variants that disrupt splice site. We found 27 pathogenic variants (11 BRCA1, 10 BRCA2, 4 PALB2, and 2 TP53) in 34 patients, which gave a prevalence of germline mutations of 2.8, 3.23, and 0.86% for BRCA1, BRCA2, and PALB2, respectively. Compared to mutation non-carriers, BRCA1 mutation carriers were more likely to have an earlier age at onset, triple-negative subtype, and lower body mass index, whereas BRCA2 mutation carriers were more likely to have a positive family history. Mutation carrier cases had worse survival compared to non-carriers; however, the association was mostly driven by stage and tumor subtype. We also identified 19 variants of unknown significance, and some of them were predicted to alter splicing or transcription factor binding sites. Our data provide insight into the genetics of breast cancer in this understudied group and suggest the need for modifying genetic testing guidelines for this population with a much younger age at diagnosis and more limited resources compared with Caucasian populations.
Earth observations taken from Space Shuttle Columbia during STS-93 mission
1999-07-25
STS093-708-062 (23-27 July 1999) --- The STS-93 astronauts took this picture of the Island of Borneo, which is divided among Indonesia, Malaysia and Brunei. The Rajang River meets the South China Sea in the northwestern portion of the Malaysian state of Sarawak. Smoke from both large and small fires is blowing north by the prevailing summer winds. Notice the contrast of dark colored rainforest with the lighter clearings where the largest fires are burning. According to NASA scientists studying the STS-93 photo collection, the sediment plumes along the coast are mostly shoreline erosional materials caught up in longshore currents. The Saribas River can be seen at the bottom.
Dosimetry audits and intercomparisons in radiotherapy: A Malaysian profile
NASA Astrophysics Data System (ADS)
M. Noor, Noramaliza; Nisbet, A.; Hussein, M.; Chu S, Sarene; Kadni, T.; Abdullah, N.; Bradley, D. A.
2017-11-01
Quality audits and intercomparisons are important in ensuring control of processes in any system of endeavour. Present interest is in control of dosimetry in teletherapy, there being a need to assess the extent to which there is consistent radiation dose delivery to the patient. In this study we review significant factors that impact upon radiotherapy dosimetry, focusing upon the example situation of radiotherapy delivery in Malaysia, examining existing literature in support of such efforts. A number of recommendations are made to provide for increased quality assurance and control. In addition to this study, the first level of intercomparison audit i.e. measuring beam output under reference conditions at eight selected Malaysian radiotherapy centres is checked; use being made of 9 μm core diameter Ge-doped silica fibres (Ge-9 μm). The results of Malaysian Secondary Standard Dosimetry Laboratory (SSDL) participation in the IAEA/WHO TLD postal dose audit services during the period between 2011 and 2015 will also been discussed. In conclusion, following review of the development of dosimetry audits and the conduct of one such exercise in Malaysia, it is apparent that regular periodic radiotherapy audits and intercomparison programmes should be strongly supported and implemented worldwide. The programmes to-date demonstrate these to be a good indicator of errors and of consistency between centres. A total of ei+ght beams have been checked in eight Malaysian radiotherapy centres. One out of the eight beams checked produced an unacceptable deviation; this was found to be due to unfamiliarity with the irradiation procedures. Prior to a repeat measurement, the mean ratio of measured to quoted dose was found to be 0.99 with standard deviation of 3%. Subsequent to the repeat measurement, the mean distribution was 1.00, and the standard deviation was 1.3%.
Teachers' Perceptions of E-Learning in Malaysian Secondary Schools
ERIC Educational Resources Information Center
Cheok, Mei Lick; Wong, Su Luan; Ayub, Ahmad Fauzi; Mahmud, Rosnaini
2017-01-01
Malaysian teachers are constantly challenged with many new technologies that are believed to enable them to perform their job better. In 2013, they have been given access to an online learning space known as the FROG VLE. However, initial evidence has shown poor adoption of the e-learning. As schools are becoming increasingly disconnected from…
Apalasamy, Y D; Moy, F M; Rampal, S; Bulgiba, A; Mohamed, Z
2014-07-04
A genome-wide association study showed that the tagging single nucleotide polymorphism (SNP) rs7566605 in the insulin-induced gene 2 (INSIG2) was associated with obesity. Attempts to replicate this result in different populations have produced inconsistent findings. We aimed to study the association between the rs7566605 SNP with obesity and other metabolic parameters in Malaysian Malays. Anthropometric and obesity-related metabolic parameters and DNA samples were collected. We genotyped the rs7566605 polymorphism in 672 subjects using real-time polymerase chain reaction. No significant associations were found between the rs7566605 tagging SNP of INSIG2 with obesity or other metabolic parameters in the Malaysian Malay population. The INSIG2 rs7566605 SNP may not play a role in the development of obesity-related metabolic traits in Malaysian Malays.
Current state of web accessibility of Malaysian ministries websites
NASA Astrophysics Data System (ADS)
Ahmi, Aidi; Mohamad, Rosli
2016-08-01
Despite the fact that Malaysian public institutions have progressed considerably on website and portal usage, web accessibility has been reported as one of the issues deserves special attention. Consistent with the government moves to promote an effective use of web and portal, it is essential for the government institutions to ensure compliance with established standards and guidelines on web accessibility. This paper evaluates accessibility of 25 Malaysian ministries websites using automated tools i.e. WAVE and Achecker. Both tools are designed to objectively evaluate web accessibility in conformance with Web Content Accessibility Guidelines 2.0 (WCAG 2.0) and United States Rehabilitation Act 1973 (Section 508). The findings reported somewhat low compliance to web accessibility standard amongst the ministries. Further enhancement is needed in the aspect of input elements such as label and checkbox to be associated with text as well as image-related elements. This findings could be used as a mechanism for webmasters to locate and rectify errors pertaining to the web accessibility and to ensure equal access of the web information and services to all citizen.
Nagarajan, R; Jonathan, M P; Roy, Priyadarsi D; Wai-Hwa, L; Prasanna, M V; Sarkar, S K; Navarrete-López, M
2013-08-15
Forty-three sediment samples were collected from the beaches of Miri City, Sarawak, Malaysia to identify the enrichment of partially leached trace metals (PLTMs) from six different tourist beaches. The samples were analyzed for PLTMs Fe, Mn, Cr, Co, Cu, Ni, Pb, Sr and Zn. The concentration pattern suggest that the southern side of the study area is enriched with Fe (1821-6097 μg g(-1)), Mn (11.57-90.22 μg g(-1)), Cr (51.50-311 μg g(-1)), Ni (18-51 μg g(-1)), Pb (8.81-84.05 μg g(-1)), Sr (25.95-140.49 μg g(-1)) and Zn (12.46-35.04 μg g(-1)). Compared to the eco-toxicological values, Cr>Effects range low (ERL), Lowest effect level (LEL), Severe effect level (SEL); Cu>Unpolluted sediments, ERL, LEL; Pb>Unpolluted sediments and Ni>ERL and LEL. Comparative results with other regions indicate that Co, Cr, Cu, Ni and Zn are higher, indicating an external input rather than natural process. Copyright © 2013 Elsevier Ltd. All rights reserved.
Understanding the breast cancer experience: a qualitative study of Malaysian women.
Yusuf, Azlina; Ab Hadi, Imi Sairi; Mahamood, Zainal; Ahmad, Zulkifli; Keng, Soon Lean
2013-01-01
Breast cancer is the most common and leading cause of cancer mortality among Malaysian women. Despite good survival rates, the diagnosis of cancer still invokes the feeling of stress, fear and uncertainty. Because very little is known about the experiences of Malaysian women with breast cancer, a qualitative study using semi- structured interviews to explore the lived experience of newly diagnosed breast cancer. Using a purposive sampling method, 20 Malaysian women newly diagnosed with breast cancer, including Malays (n=10) and Chinese (n=10) were recruited in two main public hospitals in Kelantan. Similarities and divergence in women's experience were identified through thematic analysis of interview transcripts. Three themes emerged from the data: uncertainty experience of the illness, transition process and fatalistic view of breast cancer. In many ways, these findings were parallel with previous studies, suggesting that the experience of breast cancer is to a certain extent similar among women newly diagnosed with breast cancer. This study adds to the sparse literature concerning the experience of illness following breast cancer diagnosis among the Malays and Chinese. More importantly, this study addressed areas that were previously lacking, specifically in depth information on breast cancer experience from a developing country with a multi-ethnic population. The results of this investigation provide preliminary information to healthcare professionals on the impact of illness and cultural influence on survivorship to plan for appropriate education and supportive programme in order to meet the needs of breast cancer women more effectively.
Gomez, Rapson
2014-04-01
The study examined the measurement equivalence for teacher ratings across Malaysian Malay, Chinese and Indian children. Malaysian teachers completed ratings of the ODD symptoms for 574 Malay, 247 Chinese and 98 Indian children. The results supported the equivalences for the configural, metric, and error variances models, and the equivalences for ODD latent variances and mean scores. Together, these findings suggest good support for measurement and structural equivalences of the ODD symptoms across these ethnic groups. The theoretical and clinical implications of the findings for cross-cultural equivalence of the ODD symptoms are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Perceptions of Web Site Design Characteristics: A Malaysian/Australian Comparison.
ERIC Educational Resources Information Center
Fink, Dieter; Laupase, Ricky
2000-01-01
Compares the perceptions of Malaysians and Australians for four Web site design characteristics--atmospherics, news stories, signs, and products and services--as part of the integrated Internet marketing model. Hypothesizes that the predominant culture is not generalized to another culture, discusses validity and reliability, and suggest further…
ERIC Educational Resources Information Center
Teo, Timothy
2010-01-01
Purpose: The purpose of this paper is to assess the cross-cultural validity of the technology acceptance measure for pre-service teachers (TAMPST) on a Malaysian sample. Design/methodology/approach: A total of 193 pre-service teachers from a Malaysian university completed a survey questionnaire measuring their responses to five constructs in the…
Das, Indraneil; Min, Pui Yong; Hsu, Wayne W; Hertwig, Stefan T; Haas, Alexander
2014-04-07
A new brightly-coloured (olive and red) species of microhylid frog of the genus Calluella Stoliczka 1872 is described from the upper elevations of Gunung Penrissen and the Matang Range, Sarawak, East Malaysia (Borneo). Calluella capsa, new species, is diagnosable in showing the following combination of characters: SVL up to 36.0 mm; dorsum weakly granular; a faint dermal fold across forehead; toe tips obtuse; webbing on toes basal; lateral fringes on toes present; outer metatarsal tubercle present; and dorsum greyish-olive, with red spots; half of venter bright red, the rest with large white and dark areas. The new species is the eighth species of Calluella to be described, and the fourth known from Borneo. A preliminary phylogeny of Calluella and its relatives is presented, and the new taxon compared with congeners from Malaysia and other parts of south-east Asia.
Testing a 1-D Analytical Salt Intrusion Model and the Predictive Equation in Malaysian Estuaries
NASA Astrophysics Data System (ADS)
Gisen, Jacqueline Isabella; Savenije, Hubert H. G.
2013-04-01
Little is known about the salt intrusion behaviour in Malaysian estuaries. Study on this topic sometimes requires large amounts of data especially if a 2-D or 3-D numerical models are used for analysis. In poor data environments, 1-D analytical models are more appropriate. For this reason, a fully analytical 1-D salt intrusion model, based on the theory of Savenije in 2005, was tested in three Malaysian estuaries (Bernam, Selangor and Muar) because it is simple and requires minimal data. In order to achieve that, site surveys were conducted in these estuaries during the dry season (June-August) at spring tide by moving boat technique. Data of cross-sections, water levels and salinity were collected, and then analysed with the salt intrusion model. This paper demonstrates a good fit between the simulated and observed salinity distribution for all three estuaries. Additionally, the calibrated Van der Burgh's coefficient K, Dispersion coefficient D0, and salt intrusion length L, for the estuaries also displayed a reasonable correlations with those calculated from the predictive equations. This indicates that not only is the salt intrusion model valid for the case studies in Malaysia but also the predictive model. Furthermore, the results from this study describe the current state of the estuaries with which the Malaysian water authority in Malaysia can make decisions on limiting water abstraction or dredging. Keywords: salt intrusion, Malaysian estuaries, discharge, predictive model, dispersion
Post Fukushima tsunami simulations for Malaysian coasts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koh, Hock Lye, E-mail: kohhl@ucsiuniversity.edu.my; Teh, Su Yean, E-mail: syteh@usm.my; Abas, Mohd Rosaidi Che
The recent recurrences of mega tsunamis in the Asian region have rekindled concern regarding potential tsunamis that could inflict severe damage to affected coastal facilities and communities. The 11 March 2011 Fukushima tsunami that crippled nuclear power plants in Northern Japan has further raised the level of caution. The recent discovery of petroleum reserves in the coastal water surrounding Malaysia further ignites the concern regarding tsunami hazards to petroleum facilities located along affected coasts. Working in a group, federal government agencies seek to understand the dynamics of tsunami and their impacts under the coordination of the Malaysian National Centre formore » Tsunami Research, Malaysian Meteorological Department. Knowledge regarding the generation, propagation and runup of tsunami would provide the scientific basis to address safety issues. An in-house tsunami simulation models known as TUNA has been developed by the authors to assess tsunami hazards along affected beaches so that mitigation measures could be put in place. Capacity building on tsunami simulation plays a critical role in the development of tsunami resilience. This paper aims to first provide a simple introduction to tsunami simulation towards the achievement of tsunami simulation capacity building. The paper will also present several scenarios of tsunami dangers along affected Malaysia coastal regions via TUNA simulations to highlight tsunami threats. The choice of tsunami generation parameters reflects the concern following the Fukushima tsunami.« less
Hertwig, Stefan T; Min, Pui Yong; Haas, Alexander; Das, Indraneil
2014-06-10
A new species of stream toad of the genus Ansonia is described from Gunung Murud, Pulong Tau National Park, of northern Sarawak, Malaysia, Borneo. Ansonia vidua, sp. nov., is morphologically distinguished from its Bornean congeners by the following combination of characters: medium size (SVL of adult females 33.5-34.4 mm); body uniformly black-brown in life; absence of a visible pattern on dorsum or limbs; presence of two low interorbital ridges; shagreened skin on dorsum, sides and upper surfaces of the limbs with numerous homogeneously small, rounded warts; first finger shorter than second; reduced webbing between the toes and an absence of a sharp tarsal ridge. Uncorrected genetic distances between related taxa of > 4.3% in 16S rRNA gene support its status as a hitherto undescribed species.
TNFSF4 polymorphisms are associated with systemic lupus erythematosus in the Malaysian population.
Chua, K H; Ooh, Y Y; Chai, H C
2016-10-01
Tumour necrosis factor superfamily 4 (TNFSF4) gene has been reported to be associated with systemic lupus erythematosus (SLE) susceptibility due to its encoding for OX40L protein that can increase autoantibody production and cause imbalance of T-cell proliferation. The purpose of this study was to investigate the association of TNFSF4 rs2205960, rs1234315, rs8446748 and rs704840 with SLE in the Malaysian population. A total of 476 patients with SLE and 509 healthy controls were recruited. Real-time polymerase chain reaction (PCR) was applied to genotype the selected single nucleotide polymorphisms (SNPs). Allelic and genotypic frequencies of each SNP were calculated for each ethnic group, and association test was performed using logistic regression. The overall association of each SNP in Malaysian patients with SLE was determined with meta-analysis. The frequency of minor T allele of TNFSF4 rs2205960 was significant in Chinese and Indian patients with SLE, with P values of 0.05 (OR = 1.27, 95% CI: 1.00-1.61) and 0.004 (OR = 3.16, 95% CI: 1.41-7.05), respectively. Significant association of minor G allele of rs704840 with SLE was also observed in Chinese (P = 0.03, OR = 1.26, 95% CI: 1.02-1.56). However, after Bonferroni correction, only T allele of rs2205960 remained significantly associated with Indian cohort. Overall, minor G allele of rs704840 showed significant association with SLE in the Malaysian population with P values of 0.05 (OR = 1.20, 95% CI: 1.00-1.43). We suggested TNFSF4 rs704840 could be the potential SLE risk factors in the Malaysian population. © 2016 John Wiley & Sons Ltd.
Transforming Sustainability Development Education in Malaysian Schools through Greening Activities
ERIC Educational Resources Information Center
Hanifah, Mahat; Shaharudin, Idrus; Mohmadisa, Hashim; Nasir, Nayan; Yazid, Saleh
2015-01-01
This article aims to evaluate the practice of sustainability among Malaysian Secondary Schools involved in the Sustainable Schools Program Environmental Award (SLAAS). The research attempts to identify the SLAAS effects on teachers' and students' behaviors after direct involvement with the activities of the program. The cluster sampling technique…
Factors Affecting School Choice: What Do Malaysian Chinese Parents Want?
ERIC Educational Resources Information Center
Siah, Poh Chua; Christina Ong, Sook Beng; Tan, Swee Mee; Sim, Chzia Poaw; Xian Thoo, Raphael Yi
2018-01-01
Aiming to explore factors affecting Malaysian Chinese parents in sending their children to either national secondary schools or Chinese independent schools, 494 parents were surveyed using a questionnaire. Results showed that parents who sent their children to Chinese independent schools have different priorities compared to those who sent theirs…
Samah, Syamimi; Neoh, Chin Fen; Wong, Yuet Yen; Hassali, Mohamed Azmi; Shafie, Asrul Akmal; Lim, Siong Meng; Ramasamy, Kalavathy; Mat Nasir, Nafiza; Han, Yung Wen; Burroughs, Thomas
2017-11-01
Quality of life (QoL) assessment provides valuable outcome to support clinical decision-making, particularly for patients with chronic diseases that are incurable. A brief, 15-item diabetes-specific tool [i.e. Diabetes Quality of Life-Brief Clinical Inventory (DQoL-BCI)] is known to be developed in English and validated for use in clinical practice. This simplified tool, however, is not readily available for use in the Malaysian setting. To translate the DQoL-BCI into a Malaysian version and to assess its construct validity (factorial validity, convergent validity and discriminant validity), reliability (internal consistency) and floor and ceiling effects among the Malaysian diabetic population. A forward-backward translation, involving professional translators and experts with vast experience in translation of patient reported outcome measures, was conducted. A total of 202 patients with Type 2 diabetes mellitus (T2DM) who fulfilled the inclusion criteria were invited to complete the translated DQoL-BCI. Data were analysed using SPSS for exploratory factor analysis (EFA), convergent and discriminant validity, reliability and test-retest, and AMOS software for confirmatory factor analysis (CFA). Findings from EFA indicated that the 4-factor structure of the Malaysian version of DQoL-BCI was optimal and explained 50.9% of the variance; CFA confirmed the 4-factor model fit. There was negative, moderate correlation between the scores of DQoL-BCI (Malaysian version) and EQ-5D-3L utility score (r = -0.329, p = 0.003). Patients with higher glycated haemoglobin levels (p = 0.008), diabetes macrovascular (p = 0.017) and microvascular (p = 0.013) complications reported poorer QoL. Cronbach's alpha coefficient and intraclass coefficient correlations (range) obtained were 0.703 and 0.86 (0.734-0.934), indicating good reliability and stability of the translated DQoL-BCI. This study had validated the linguistic and psychometric properties of DQoL-BCI (Malaysian
Midlife crisis perceptions, experiences, help-seeking, and needs among multi-ethnic malaysian women.
Wong, Li Ping; Awang, Halimah; Jani, Rohana
2012-01-01
In the present study, researchers explored attitudes toward midlife crises, experience with midlife crises, help-seeking, and needs among multi-ethnic Malaysian women. A total of 14 focus group discussions were conducted with 89 Malaysian women of different ages and socioeconomic backgrounds. Women expressed concern over physical aging and decline in their physical functional health. Having a midlife crisis was frequently reported. Issues that were frequently reported to trigger a midlife crisis, such as empty nest syndrome, impact of aging on sexual and reproductive function, extended parenthood, caring for aging or ill parents, and career challenges were noted by the study participants (listed here in order of most to least frequently reporting of these themes across the group discussions). Overall, these issues were associated with attitudes about aging. A comparatively less open attitude toward sexual attitudes and help-seeking for sexual problems were found among the Malay and Indian women. This may imply that intervention to increase positive attitudes concerning both sexuality and help-seeking intentions should be culturally specific. The use of religious coping for comfort and consolation was frequently reported; therefore, those providing midlife crisis prevention and intervention programs should consider involving faith-based interventions in the Malaysian setting.
Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects
Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran
2016-01-01
Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Results Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. Conclusions DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects. PMID:27111895
Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects.
Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Al-Absi, Boshra; Muniandy, Sekaran
2016-01-01
Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects.
Morphology of distal radius curvatures: a CT-based study on the Malaysian Malay population
Singh, Taran Singh Pall; Sadagatullah, Abdul Nawfar; Yusof, Abdul Halim
2015-01-01
INTRODUCTION The purpose of this study was to examine the differing curves of the volar distal radius of healthy Malaysian Malays, so as to obtain detailed morphological information that will further the understanding of volar plate osteosynthesis in Malaysian Malays. METHODS Computed tomography with three-dimensional reconstruction was performed on the wrists of 16 healthy Malaysian Malay volunteers. Profile measurements were made using a software program. A novel parameter, the pronator quadratus curve angle, was explored and introduced in this study. Interclass correlation coefficients were calculated to assess the level of agreement between the data collected by the principal investigator and that collected by an independent radiologist. RESULTS The mean ± standard deviation of the arc radii on the radial aspect was 17.50° ± 5.40°, while the median (interquartile range [IQR]) of the arc radii on the ulnar aspect was 25.27° (IQR 5.80°). The mean ± standard deviation of the curvature of the pronator quadratus line was 40.52° ± 2.48°. The arc radii on the radial aspect was significantly lower than the arc radii on the ulnar aspect (p = 0.001). Different radial and ulnar arcs were observed in 56.25% of the radii; the arc was deeper on the ulnar aspect in 93.75% of the radii. CONCLUSION Based on the findings of this study, the likelihood of achieving anatomical reduction with uniformly curved, fixed-angle volar plates is questionable. Changes in the design of these implants may be needed to optimise their usage in the Malaysian Malay population. PMID:25814075
Determining Factors of Students' Satisfaction with Malaysian Skills Training Institutes
ERIC Educational Resources Information Center
Ibrahim, Mohd Zuhdi; Ab Rahman, Mohd Nizam; Yasin, Ruhizan M.
2014-01-01
The purpose of this study is to examine students' perception of quality of service offered in Malaysian skills training institutes and how it influences overall satisfaction. This study employed a questionnaire survey involving seven skills training institutes in Klang Valley, Malaysia. From 600 questionnaires distributed, 419 were returned (69.8…
Malaysian University Students' Attitudes to Academic Dishonesty and Business Ethics
ERIC Educational Resources Information Center
Ahmad, Zauwiyah; Simun, Maimun; Mohammad, Junaini
2008-01-01
Academic dishonesty is believed to have predictive ability for subsequent behaviours in the workplace. This study adds to the literature by investigating Malaysian business students' attitudes to academic dishonesty and their attitudes to ethics issues in business. This study also explores the association between these two constructs. The form of…
Moral Education in a Multicultural Context: The Malaysian Primary Curriculum.
ERIC Educational Resources Information Center
Banks, Ellen C.
In Malaysia, the national moral education curriculums are designed to develop the values that Malaysians of diverse cultures share or that the government wishes to develop as shared values to bring about religious and ethnic harmony. Moral education for Muslims is incorporated into in-school religious education, while a separate, essentially…
Malaysian Education Index (MEI): An Online Indexing and Repository System
ERIC Educational Resources Information Center
Kabilan, Muhammad Kamarul; Ismail, Hairul Nizam; Yaakub, Rohizani; Yusof, Najeemah Mohd; Idros, Sharifah Noraidah Syed; Umar, Irfan Naufal; Arshad, Muhammad Rafie Mohd.; Idrus, Rosnah; Rahman, Habsah Abdul
2010-01-01
This "Project Sheet" describes an on-going project that is being carried out by a group of educational researchers, computer science researchers and librarians from Universiti Sains Malaysia, Penang. The Malaysian Education Index (MEI) has two main functions--(1) Online Indexing System, and (2) Online Repository System. In this brief…
NASA Astrophysics Data System (ADS)
Hafiidz, J. Mohd; Arifin, K.; Aiyub, K.; Razman, M. R.; Samsurijan, M. S.; Syakir, M. I.
2017-09-01
Construction industry is an important sector that contributes to the development of economy and socioeconomy in Malaysia. It is a vital component in achieving the developed country status. However, fatalities in the Malaysian construction industry are a critical problem. Number of fatalities in this industry is the highest compared to other industries registered in Malaysia under the investigation of Department of Occupational Safety and Health (DOSH). Worksite element (worksite conditions, poor site management, construction tasks, and equipment & materials) was identified as one category of causes of occupational accidents and illnesses in Malaysian construction industry. The main objective of this study is to understand the perception of local construction personnel in terms of worksite element as causes of occupational accidents and illnesses in Malaysian residential construction industry. 13 housing projects that were registered with Ministry of Urban Wellbeing, Housing and Local Government and being permitted to perform construction work in 2012 were selected in Pulau Pinang to be studied using questionnaire survey. Worksite condition and poor site management was perceived as the most significant with the mean values of 3.68 and 3.61 respectively.
Sports Involvement and Academic Achievement: A Study of Malaysian University Athletes
ERIC Educational Resources Information Center
Chuan, Chun Cheng; Yusof, Aminuddin; Shah, Parilah Mohd
2013-01-01
Factors that influence the academic achievement of Malaysian university athletes were investigated using 156 field hockey players from several universities. The relationship between team subculture, parental influence, the learning environment, support systems, financial aid, training factors, academic assistance, socialization, and stress level…
Antibiotics for URTI and UTI -- prescribing in Malaysian primary care settings.
Teng, Cheong Lieng; Tong, Seng Fah; Khoo, Ee Ming; Lee, Verna; Zailinawati, Abu Hassan; Mimi, Omar; Chen, Wei Seng; Nordin, Salleh
2011-05-01
Overprescription of antibiotics is a continuing problem in primary care. This study aims to assess the antibiotic prescribing rates and antibiotic choices for upper respiratory tract infections (URTI) and urinary tract infections (UTI) in Malaysian primary care. Antibiotic prescribing data for URTI and UTI was extracted from a morbidity survey of randomly selected primary care clinics in Malaysia. Analysis was performed of 1,163 URTI and 105 UTI encounters. Antibiotic prescribing rates for URTI and UTI were 33.8% and 57.1% respectively. Antibiotic prescribing rates were higher in private clinics compared to public clinics for URTI, but not for UTI. In URTI encounters, the majority of antibiotics prescribed were penicillins and macrolides, but penicillin V was notably underused. In UTI encounters, the antibiotics prescribed were predominantly penicillins or cotrimoxazole. Greater effort is needed to bring about evidence based antibiotic prescribing in Malaysian primary care, especially for URTIs in private clinics.
ERIC Educational Resources Information Center
Shibahara, Rika
2017-01-01
This study examines Malaysian learners' reflections on the discourses of the Asia-Pacific War in Malaysia and Japan after engaging in "Memories of War" project. The project, which was implemented in an advanced Japanese-as-a-Foreign-Language (JFL) class at a Malaysian university, aimed to improve learners' ability to grasp power…
Investigation of Malaysian Higher Education Quality Culture and Workforce Performance
ERIC Educational Resources Information Center
Ali, Hairuddin Mohd; Musah, Mohammed Borhandden
2012-01-01
Purpose: The purpose of this study is to examine the relationship between the quality culture and workforce performance in the Malaysian higher education sector. The study also aims to test and validate the psychometric properties of the quality culture and workforce performance instruments used in the study. Design/methodology/approach: A total…
NASA Astrophysics Data System (ADS)
Nizarul, O.; Hermana, M.; Bashir, Y.; Ghosh, D. P.
2016-02-01
In delineating complex subsurface geological feature, broad band of frequencies are needed to unveil the often hidden features of hydrocarbon basin such as thin bedding. The ability to resolve thin geological horizon on seismic data is recognized to be a fundamental importance for hydrocarbon exploration, seismic interpretation and reserve prediction. For thin bedding, high frequency content is needed to enable tuning, which can be done by applying the band width extension technique. This paper shows an application of Short Time Fourier Transform Half Cepstrum (STFTHC) method, a frequency bandwidth expansion technique for non-stationary seismic signal in increasing the temporal resolution to uncover thin beds and improve characterization of the basin. A wedge model and synthetic seismic data is used to quantify the algorithm as well as real data from Sarawak basin were used to show the effectiveness of this method in enhancing the resolution.
Mood and Performance in Young Malaysian Karateka
Wong, Rebecca S. K.; Thung, Jin Seng; Pieter, Willy
2006-01-01
In an attempt to test the conceptual model by Lane and Terry, the purposes of this study were 1) to assess mood states in non-depressed and depressed young karate athletes; 2) to assess mood states in relation to performance in young karate athletes. The participants were recruited from the 2004 Malaysian Games (72 males, 19.20 ± 1.16 years; 37 females, 18.78 ± 0.88 years). The athletes were divided into winners (medalists) and losers. The Brunel Mood Scale (BRUMS) was administered prior to the start of competition. MANOVA was employed to treat the data, while Pearson correlations were calculated for mood states in each depressed mood group and by gender. In terms of non-depressed and depressed mood, tension in the females was higher in the depressed group (5.61 ± 3.02 vs. 3.11 ± 1.90, p = 0.026, eta2 = 0.133), as was fatigue (3.64 ± 2.61 vs. 0.89 ± 1.69, p = 0.006, eta2 = 0.199). Tension in the males was higher in the depressed group (4.41 ± 2.52 vs. 1.50 ± 1.55, p < 0.001, eta2 = 0.215), as was anger (1.43 ± 1.88 vs. 0.25 ± 1.00, p = 0.019, eta2 = 0.076). The highest associations among mood subscales were between anger and depression (r = 0.57), and between depression and fatigue ( r = 0.55) in depressed males. The female winning karateka scored higher on anger (3.08 ± 2.96 vs. 1.29 ± 2.24, p = 0.046, eta2 = 0.109). The highest correlations between mood dimensions in depressed females were between depression and anger (r = 0.85) and between depression and confusion (r = 0.85). Contrary to previous research on the influence of depression on anger, only the female winners scored higher on anger. Several negative mood dimensions were higher in both male and female depressed groups, lending some support to the conceptual model advanced by Lane and Terry. Key Points To date, there is no information about the relationship between mood and martial arts performance in Malaysian athletes. There might be cultural differences in the way Malaysian athletes
Munretnam, Khamsigan; Alex, Livy; Ramzi, Nurul Hanis; Chahil, Jagdish Kaur; Kavitha, I S; Hashim, Nikman Adli Nor; Lye, Say Hean; Velapasamy, Sharmila; Ler, Lian Wee
2014-01-01
There is growing global interest to stratify men into different levels of risk to developing prostate cancer, thus it is important to identify common genetic variants that confer the risk. Although many studies have identified more than a dozen common genetic variants which are highly associated with prostate cancer, none have been done in Malaysian population. To determine the association of such variants in Malaysian men with prostate cancer, we evaluated a panel of 768 SNPs found previously associated with various cancers which also included the prostate specific SNPs in a population based case control study (51 case subjects with prostate cancer and 51 control subjects) in Malaysian men of Malay, Chinese and Indian ethnicity. We identified 21 SNPs significantly associated with prostate cancer. Among these, 12 SNPs were strongly associated with increased risk of prostate cancer while remaining nine SNPs were associated with reduced risk. However, data analysis based on ethnic stratification led to only five SNPs in Malays and 3 SNPs in Chinese which remained significant. This could be due to small sample size in each ethnic group. Significant non-genetic risk factors were also identified for their association with prostate cancer. Our study is the first to investigate the involvement of multiple variants towards susceptibility for PC in Malaysian men using genotyping approach. Identified SNPs and non-genetic risk factors have a significant association with prostate cancer.
Healthy eating index and breast cancer risk among Malaysian women.
Shahril, Mohd Razif; Sulaiman, Suhaina; Shaharudin, Soraya Hanie; Akmal, Sharifah Noor
2013-07-01
Healthy Eating Index-2005 (HEI-2005), an index-based dietary pattern, has been shown to predict the risk of chronic diseases among Americans. This study aims to examine the ability of HEI-2005 in predicting the probability for risk of premenopausal and postmenopausal breast cancer among Malaysian women. Data from a case-control nutritional epidemiology study among 764 participants including 382 breast cancer cases and 382 healthy women were extracted and scored. Multivariate odds ratios (OR) with 95% confidence intervals (CI) were used to evaluate the relationship between the risk of breast cancer and quartiles (Q) of HEI-2005 total scores and its component, whereas the risk prediction ability of HEI-2005 was investigated using diagnostics analysis. The results of this study showed that there is a significant reduction in the risk of breast cancer, with a higher HEI-2005 total score among premenopausal women (OR Q1 vs. Q4=0.34, 95% CI; 0.15-0.76) and postmenopausal women (OR Q1 vs. Q4=0.20, 95% CI; 0.06-0.63). However, HEI-2005 has a sensitivity of 56-60%, a specificity of 55-60%, and a positive predictive value and negative predictive value of 57-58%, which indicates a moderate ability to predict the risk of breast cancer according to menopausal status. The breast cancer incidence observed poorly agrees with risk outcomes from HEI-2005 as shown by low κ statistics (κ=0.15). In conclusion, although the total HEI-2005 scores were associated with a risk of breast cancer among Malaysian women, the ability of HEI-2005 to predict risk is poor as indicated by the diagnostic analysis. A local index-based dietary pattern, which is disease specific, is required to predict the risk of breast cancer among Malaysian women for early prevention.
Karin, Benjamin R; Das, Indraneil; Bauer, Aaron M
2016-03-22
We describe two new species of skinks from Gunung Penrissen, Sarawak, Malaysia, in northern Borneo, Tytthoscincus batupanggah sp. nov. and T. leproauricularis sp. nov. Morphological and molecular analyses both corroborate the two new species as unique compared to all other Tytthoscincus and additional Sphenomorphus that are candidates for taxonomic placement in the genus Tytthoscincus. Despite their phenotypic similarity and sympatric distribution, a molecular analysis shows that the new species are not sister taxa and exhibit a deep genetic divergence between each of their respective sister taxa. We discuss how historical climatic and geographic processes may have led to the co-distribution of two relatively distantly related phenotypically similar species. In light of these discoveries, we also emphasize the importance of conserving primary montane tropical rainforest for maintaining species diversity.
Development of demi-span equations for predicting height among the Malaysian elderly.
Ngoh, H J; Sakinah, H; Harsa Amylia, M S
2012-08-01
This study aimed to develop demi-span equations for predicting height in the Malaysian elderly and to explore the applicability of previous published demi-span equations derived from adult populations to the elderly. A cross-sectional study was conducted on Malaysian elderly aged 60 years and older. Subjects were residents of eight shelter homes in Peninsular Malaysia; 204 men and 124 women of Malay, Chinese and Indian ethnicity were included. Measurements of weight, height and demi-span were obtained using standard procedures. Statistical analyses were performed using SPSS version 18.0. The demi-span equations obtained were as follows: Men: Height (cm) = 67.51 + (1.29 x demi-span) - (0.12 x age) + 4.13; Women: Height (cm) = 67.51 + (1.29 x demi-span) - (0.12 x age). Height predicted from these new equations demonstrated good agreement with measured height and no significant differences were found between the mean values of predicted and measured heights in either gender (p>0.05). However, the heights predicted from previous published adult-derived demi-span equations failed to yield good agreement with the measured height of the elderly; significant over-estimation and underestimation of heights tended to occur (p>0.05). The new demi-span equations allow prediction of height with sufficient accuracy in the Malaysian elderly. However, further validation on other elderly samples is needed. Also, we recommend caution when using adult-derived demi-span equations to predict height in elderly people.
Moral Values and Science Teaching: A Malaysian School Curriculum Initiative
NASA Astrophysics Data System (ADS)
Tan, Sok Khim
Implicit in teaching science has been the teaching of a set of values. However, its presence has remained unacknowledged because of assumptions made that its products are value-free and that work of science involves positive values. Malaysian schools have introduced a set of noble values to be taught as a subject called moral education while at the same time expecting all subjects, including the sciences to actively inculcate these noble values in their lessons. A search for values related to science included studies from science education curriculums, studies by scientists and philosophers of science, feminist and Indian critics of science. These values could be categorized into four categories representing epistemological values, supporting values, societal and moral values and power-oriented values. While some categories compliment each other, others are in contention. This paper argues for the inclusion of societal and moral values in the science classrooms. A compassionate scientist should be a reality. The task for Malaysian science educators is to find a way to raise awareness of these values.
Devi, B C R; Tang, T S; Corbex, M
2007-07-01
The registry of the Oncology Departmental in Sarawak General Hospital showed that 79% of nasopharyngeal, 77% of breast and 70% of cervix cancer patients were diagnosed at an advanced stage (stages III and IV) for year 1993. Hence, a low cost Early Cancer Surveillance Program was started in 1994, with the intent of downstaging these three most common cancers in Sarawak. The program consisted of (i) training health staff in hospital and rural clinics to improve their skills in early cancer detection, (ii) raising public awareness through pamphlets, posters and sensitization by health staff. Data analysis revealed that the program achieved downstaging in two of the cancers. Breast cancer in stage III and IV was reduced from 60% (1994) to 35% (1998) (P < 0.0001) and cervical cancer in stage III and IV from 60% (1994) to 26% (1998) (P < 0.0001). No reduction was observed for nasopharyngeal cancer at 88% (1994) to 91% (1998). The overall cost of this program was
Teh, C H; Lim, K K; Chan, Y Y; Lim, K H; Azahadi, O; Hamizatul Akmar, A H; Ummi Nadiah, Y; Syafinaz, M S; Kee, C C; Yeo, P S; Fadhli, Y
2014-05-01
Despite the health-enhancing benefits of physical activity, a large segment of the Malaysian population does not engage in regular physical activity at the recommended level. This study aimed to determine physical activity patterns and the associated sociodemographic correlates of physical activity. Data on physical activity were obtained from the National Health and Morbidity Survey (NHMS) 2011, a nationally representative, population-based cross-sectional study. A two-stage stratified sampling method was used to select a representative sample of Malaysian adults aged 16 years and above. A total of 19,145 adults aged 16 years and above were recruited, and face-to-face interviews were conducted using the International Physical Activity Questionnaire (IPAQ), short version. The correlates for physical activity were identified using multivariate analysis. In this study, 64.3% (95%CI: 63.1-65.5) of Malaysian adults aged 16 and above were physically active, but overall physical activity levels decreased with advancing age. Men, rural residents, 'other' ethnic groups, and married women were more likely to demonstrate higher levels of physical activity. Approximately 65% of Malaysian adults were physically active. However, it is recommended that health promotions for active lifestyles should be targeted to the least active segments, which constitute more than a quarter of the Malaysian population. Copyright © 2013 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Perception of masculinity amongst young Malaysian men: a qualitative study of university students.
Fazli Khalaf, Zahra; Low, Wah Yun; Ghorbani, Behzad; Merghati Khoei, Effat
2013-11-11
Perception of Masculinity plays an important role in men's lifestyles and health behaviors. Although, the importance of masculinity has been widely discussed in men's health literature, very little is known about the meanings of masculinity in the Malaysian setting. This research aimed to explore the meanings of masculinity among Malaysian university men. This qualitative study utilized in-depth interviews with 34 young Malaysian university men, aged 20-30 years from three main ethnic groups in Malaysia (Malay, Chinese and Indian). Thematic analysis approach was used to extract data. NVIVO v8 qualitative software was used for data management. From the data collected several concepts emerged that reflected the meanings of masculinity from the participants' view points. These meanings were associated with a combination of traditional and non-traditional norms that generally benefit men who behave according to culturally dominant role expectations. These included: "Having a good body shape", "being respected", "having success with women", "being a family man", and "having financial independence". Socio-cultural factors, such as family environment, religion, public media and popular life style patterns helped to shape and reinforce the meanings of masculinities among university men. This study revealed that the university context provided a particular culture for construction and reinforcement of the meanings of masculinities, which should be considered by the educators to help in development of healthy masculinities.
Malaysian and Thai smokers' beliefs about the harmfulness of 'light' and menthol cigarettes.
King, B; Yong, H-H; Borland, R; Omar, M; Ahmad, A A; Sirirassamee, B; Hamann, S; O'Connor, R J; Bansal-Travers, M; Elton-Marshall, T; Lee, W B; Hammond, D; Thrasher, J
2010-12-01
This study explored the extent to which Malaysian and Thai smokers believe "light" and menthol cigarettes are less harmful than "regular" cigarettes and the correlates of these beliefs. The study used data from wave 1 of the International Tobacco Control Southeast Asia Survey. 2006 adult smokers (95.3% male) from Malaysia and 2000 adult smokers (94.5% male) from Thailand were interviewed face to face in 2005. 29% of Malaysian respondents reported currently smoking light cigarettes and 14% menthols, with 19% agreeing that lights are less harmful and 16% agreeing that menthols are less harmful. 38% of Thai respondents reported currently smoking light cigarettes and 19% menthols, with 46% agreeing that lights are less harmful and 35% agreeing that menthols are less harmful. Malaysian smokers reporting current use of light or menthol cigarettes were more likely to believe that they are less harmful. Reported use of lights did not relate to beliefs for Thai respondents. The belief that light and/or menthol cigarettes are less harmful was strongly related to the belief that they have smoother smoke. The experience of smoother smoke is likely to produce some level of belief in reduced harm, regardless of how brands are labelled and whether or not Federal Trade Commission FTC/International Organisation for Standardisation tar, nicotine and carbon monoxide yield figures are used.
The Lidcombe Program of early stuttering intervention for Malaysian families: Four case studies.
Vong, Etain; Wilson, Linda; Lincoln, Michelle
2016-09-01
This study investigated the outcomes of implementing the Lidcombe Program, an evidence-based early intervention for stuttering, with four preschool children in Malaysia. Early stuttering intervention is currently underdeveloped in Malaysia, where stuttering treatment is often more assertion-based than evidence-based. Therefore, introducing an evidence-based early stuttering intervention is an important milestone for Malaysian preschoolers who stutter. The participants ranged from 3 years 3 months to 4 years 9 months at the start of the study. Beyond-clinic speech samples were obtained at 1 month and 1 week pretreatment and immediately post-Stage 1, and at 1 month, 3 months, 6 months and 12 months post-Stage 1. Two participants, who were bilingual, achieved near-zero levels of stuttering at 12 months posttreatment. Near zero levels of stuttering were also present in their untreated languages. One participant withdrew due to reasons not connected with the research or treatment. The remaining participant, who presented with severe stuttering, completed Stage 1 but had some relapse in Stage 2 and demonstrated mild stuttering 12 months post-Stage 1. The outcomes were achieved without the need to significantly adapt Lidcombe Program procedures to Malaysian culture. Further research to continue evaluation of the Lidcombe Program with Malaysian families and to estimate proportion of those who will respond is warranted. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Anuwar, Muhammad Hafidz; Jaffar, Maheran Mohd
2017-08-01
This paper provides an overview for the assessment of credit risk specific to the banks. In finance, risk is a term to reflect the potential of financial loss. The risk of default on loan may increase when a company does not make a payment on that loan when the time comes. Hence, this framework analyses the KMV-Merton model to estimate the probabilities of default for Malaysian listed companies. In this way, banks can verify the ability of companies to meet their loan commitments in order to overcome bad investments and financial losses. This model has been applied to all Malaysian listed companies in Bursa Malaysia for estimating the credit default probabilities of companies and compare with the rating given by the rating agency, which is RAM Holdings Berhad to conform to reality. Then, the significance of this study is a credit risk grade is proposed by using the KMV-Merton model for the Malaysian listed companies.
Distribution of Articles in Written Composition among Malaysian ESL Learners
ERIC Educational Resources Information Center
Rahim, Mia Emily Abdul; Rahim, Emma Marini Abdul; Ning, Chia Han
2013-01-01
The study aimed to investigate the distribution patterns of the English grammar articles (a, an, and the) as well as the distributions of their colligation patterns in written compositions of English among Malaysian ESL learners. This paper reports the results of a corpus-based study on articles used by these learners. The method used in this…
The Scholarship of Teaching and Learning: Challenges for Malaysian Academics
ERIC Educational Resources Information Center
Harland, Tony; Raja Hussain, Raja Maznah; Bakar, Aishah Abu
2014-01-01
This paper explores the adoption of the scholarship of teaching and learning (SoTL) by 10 Malaysian university academics. SoTL was part of a pioneering sector-wide initiative for improving teaching and learning. The qualitative study showed that there had been no true learning phase for SoTL because academics had high expectations of rapid success…
Khan, Aqeel; Hamdan, Abdul Rahim; Ahmad, Roslee; Mustaffa, Mohamed Sharif; Mahalle, Salwa
2016-02-01
This study examined whether productive coping styles and social support were significant mediators of the relationship between academic stress and suicidal ideation. The survey was performed on a sample of 300 Malaysian and 300 Indian college students. The participants completed psychological assessments of productive coping styles, social support, academic stress, and suicidal ideation. Significant cultural and demographic differences emerged. Indian students reported higher suicidal ideation and academic stress than did Malaysian students, and Malaysian students received more social support and had better problem-solving coping styles than did Indian students. Overall, students who were male, non-religious, and from low-income families reported more academic stress and more suicidal ideation. Productive coping styles and overall social support strongly affected the relationship between academic stress and suicidal ideation among both countries' participants.
Growth and reproductive performance of sambar deer in Sabal Forest Reserve of Sarawak, Malaysia.
Dahlan, Ismail; Dawend, Jiwan
2013-10-01
We examined the growth, reproduction, rutting behavior, and health status of sambar deer (Cervus unicolor brookei) in secondary Acacia mangium plantation. The data were collected over 11 years from a breeding herd of 21 stags and 33 hinds in Sabal Forest Reserve, Sarawak, Malaysia. Brody's growth model of the pooled data is Y t = 148.56 (1 - 0.98e(-0.023t)), which estimates that maximum weights of adults are 184 and 115 kg for males and females respectively. Sambar deer are nonseasonal breeders with the breeding peak in February. Although the earliest age at which a female reached sexual maturity was 11 months, the mean age was 23 ± 7 months. Mean age of first fawning was 32 ± 8 months. Mean gestation period was 259 ± 12 days (n = 82). Stags shed antlers mostly between March and July. Velvet hardens at 103 ± 27 days (n = 23), and velvet harvesting is best at 7-9 weeks when antler length is 25-30 cm. Sambar deer are suitable as a farm species in forest plantations and have a vast potential to uplift rural living standards.
ERIC Educational Resources Information Center
Voon, Shi Jing; Pearson, Emma
2011-01-01
This pilot study was designed to shed light on Malaysian-Chinese parents' beliefs about ethnic identity and cultural maintenance in children's socialisation following migration. Three Malaysian-Chinese families residing in Sydney, Australia, with at least one child within the early childhood age range of 4-8 years, participated in the study.…
The Applicability of Course Experience Questionnaire for a Malaysian University Context
ERIC Educational Resources Information Center
Thien, Lei Mee; Ong, Mei Yean
2016-01-01
Purpose: The purpose of this study is to examine the applicability of Course Experience Questionnaire (CEQ) in a Malaysian university context. Design/methodology/approach: The CEQ was translated into Malay language using rigorous cross-cultural adaptation procedures. The Malay version CEQ was administered to 190 undergraduate students in one…
Haerian, Batoul Sadat; Sha'ari, Hidayati Mohd; Fong, Choong Yi; Tan, Hui Jan; Wong, Sau Wei; Ong, Lai Choo; Raymond, Azman Ali; Tan, Chong Tin; Mohamed, Zahurin
2015-01-15
Neuroinflammation can damage the brain and plays a critical role in the pathophysiology of epilepsy. Tissue inhibitor of metalloproteinase 4 (TIMP4) is an inflammation-induced apoptosis and matrix turnover factor involved in several neuronal disorders and inflammatory diseases. Evidence has shown linkage disequilibrium between rs3755724 (-55C/T) of this gene with synapsin 2 (SYN2) rs3773364 and peroxisome proliferator-activated G receptor (PPARG) rs2920502 loci, which contribute to epilepsy in Caucasians. The aim of this study was to examine the association of these loci alone or their haplotypes with the risk of epilepsy in the Malaysian population. Genomic DNA of 1241 Malaysian Chinese, Indian, and Malay subjects (670 patients with epilepsy and 571 healthy individuals) was genotyped for the candidate loci by using the Sequenom MassArray method. Allele and genotype association of rs3755724 with susceptibility to epilepsy was significant in the Malaysian Chinese with focal epilepsy under codominant and dominant models (C vs. T: 1.5 (1.1-2.0), p=0.02; CT vs. TT: 1.8 (1.2-2.8), p=0.007 and 1.8 (1.2-2.7), p=0.006, respectively). The T allele and the TT genotype were more common in patients than in controls. No significant association was found between rs2920502 and rs3773364-rs3755724-rs2920502 haplotypes for susceptibility to epilepsy in each ethnicity. This study provides evidence that the promoter TIMP4 rs3755724 is a new focal epilepsy susceptibility variant that is plausibly involved in inflammation-induced seizures in Malaysian Chinese. Copyright © 2014 Elsevier B.V. All rights reserved.
Awadh, Ammar Ihsan; Hassali, Mohamed Azmi; Al-lela, Omer Qutaiba; Bux, Siti Halimah; Elkalmi, Ramadan M; Hadi, Hazrina
2014-10-27
Parents are the main decision makers for their children vaccinations. This fact makes parents' immunization knowledge and practices as predictor factors for immunization uptake and timeliness. The aim of this pilot study was to develop a reliable and valid instrument in Malaysian language to measure immunization knowledge and practice (KP) of Malaysian parents. A cross-sectional prospective pilot survey was conducted among 88 Malaysian parents who attended public health facilities that provide vaccinations. Translated immunization KP questionnaires (Bahasa Melayu version) were used. Descriptive statistics were applied, face and content validity were assessed, and internal consistency, test-retest reliability, and construct validity were determined. The mean ± standard deviation (SD) of the knowledge scores was 7.36 ± 2.29 and for practice scores was 7.13 ± 2.20. Good internal consistency was found for knowledge and practice items (Cronbach's alpha = 0.757 and 0.743 respectively); the test-retest reliability value was 0.740 (p = 0.014). A panel of three specialist pharmacists who are experts in this field judged the face and content validity of the final questionnaire. Parents with up-to-date immunized children had significantly better knowledge and practice scores than parents who did not (p < 0.001 and p = 0.001 respectively), suggesting a good construct validity. A significant difference was found in knowledge and practice scores among parents' age (p = 0.006 and p = 0.029 respectively) and place of living (p = 0.037 and p = 0.043). The parents' knowledge level was positively associated with their practice toward immunization (Spearman's rank correlation coefficient 0.310, p = 0.003). The pilot study concluded that the Bahasa Melayu version of the immunization KP questionnaire has good reliability and validity for measuring the knowledge and practices of Malaysian parents and therefore this version can be used in
Tang, Sui-Yan; Hara, Shintaro; Melling, Lulie; Goh, Kah-Joo; Hashidoko, Yasuyuki
2010-01-01
Root-associating bacteria of the nipa palm (Nypa fruticans), preferring brackish-water affected mud in Sarawak, Malaysia, were investigated. In a comparison of rhizobacterial microbiota between the nipa and the sago (Metroxylon sagu) palm, it was found that the nipa palm possessed a group of Burkholderia vietnamiensis as its main active nitrogen-fixing endophytic bacterium. Acetylene reduction by the various isolates of B. vietnamiensis was constant (44 to 68 nmol h(-1) in ethylene production rate) in soft gel medium containing 0.2% sucrose as sole carbon source, and the bacterium also showed motility and biofilm-forming capacity. This is the first report of endophytic nitrogen-fixing bacteria from nipa palm.
Development of multi-dimensional body image scale for malaysian female adolescents
Taib, Mohd Nasir Mohd; Shariff, Zalilah Mohd; Khor, Geok Lin
2008-01-01
The present study was conducted to develop a Multi-dimensional Body Image Scale for Malaysian female adolescents. Data were collected among 328 female adolescents from a secondary school in Kuantan district, state of Pahang, Malaysia by using a self-administered questionnaire and anthropometric measurements. The self-administered questionnaire comprised multiple measures of body image, Eating Attitude Test (EAT-26; Garner & Garfinkel, 1979) and Rosenberg Self-esteem Inventory (Rosenberg, 1965). The 152 items from selected multiple measures of body image were examined through factor analysis and for internal consistency. Correlations between Multi-dimensional Body Image Scale and body mass index (BMI), risk of eating disorders and self-esteem were assessed for construct validity. A seven factor model of a 62-item Multi-dimensional Body Image Scale for Malaysian female adolescents with construct validity and good internal consistency was developed. The scale encompasses 1) preoccupation with thinness and dieting behavior, 2) appearance and body satisfaction, 3) body importance, 4) muscle increasing behavior, 5) extreme dieting behavior, 6) appearance importance, and 7) perception of size and shape dimensions. Besides, a multidimensional body image composite score was proposed to screen negative body image risk in female adolescents. The result found body image was correlated with BMI, risk of eating disorders and self-esteem in female adolescents. In short, the present study supports a multi-dimensional concept for body image and provides a new insight into its multi-dimensionality in Malaysian female adolescents with preliminary validity and reliability of the scale. The Multi-dimensional Body Image Scale can be used to identify female adolescents who are potentially at risk of developing body image disturbance through future intervention programs. PMID:20126371
Development of multi-dimensional body image scale for malaysian female adolescents.
Chin, Yit Siew; Taib, Mohd Nasir Mohd; Shariff, Zalilah Mohd; Khor, Geok Lin
2008-01-01
The present study was conducted to develop a Multi-dimensional Body Image Scale for Malaysian female adolescents. Data were collected among 328 female adolescents from a secondary school in Kuantan district, state of Pahang, Malaysia by using a self-administered questionnaire and anthropometric measurements. The self-administered questionnaire comprised multiple measures of body image, Eating Attitude Test (EAT-26; Garner & Garfinkel, 1979) and Rosenberg Self-esteem Inventory (Rosenberg, 1965). The 152 items from selected multiple measures of body image were examined through factor analysis and for internal consistency. Correlations between Multi-dimensional Body Image Scale and body mass index (BMI), risk of eating disorders and self-esteem were assessed for construct validity. A seven factor model of a 62-item Multi-dimensional Body Image Scale for Malaysian female adolescents with construct validity and good internal consistency was developed. The scale encompasses 1) preoccupation with thinness and dieting behavior, 2) appearance and body satisfaction, 3) body importance, 4) muscle increasing behavior, 5) extreme dieting behavior, 6) appearance importance, and 7) perception of size and shape dimensions. Besides, a multidimensional body image composite score was proposed to screen negative body image risk in female adolescents. The result found body image was correlated with BMI, risk of eating disorders and self-esteem in female adolescents. In short, the present study supports a multi-dimensional concept for body image and provides a new insight into its multi-dimensionality in Malaysian female adolescents with preliminary validity and reliability of the scale. The Multi-dimensional Body Image Scale can be used to identify female adolescents who are potentially at risk of developing body image disturbance through future intervention programs.
Gomez, Rapson; Hafetz, Nina; Gomez, Rashika Miranjani
2013-08-01
This study examined the prevalence rate of Oppositional Defiant Disorder (ODD) in Malaysian primary school children. In all 934 Malaysian parents and teachers completed ratings of their children using a scale comprising DSM-IV-TR ODD symptoms. Results showed rates of 3.10%, 3.85%, 7.49% and 0.64% for parent, teacher, parent or teacher ("or-rule"), and parent and teacher ("and-rule") ratings, respectively. When the functional impairment criterion was not considered, the rate reported by parents was higher at 13.28%. The theoretical, diagnostic and cultural implications of the findings are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Prevention practices of vaginitis among Malaysian women and its associated factors.
Wan Muda, Wan Mahfuzah; Wong, Li Ping; Tay, Sun Tee
2018-03-12
Information on vaginal-related issues among Malaysian women is very limited. This study aimed to explore factors associated with preventive practices of vaginitis among Malaysian women. A cross-sectional computer-assisted telephone interview survey of a representative sample of multi-racial Malaysian women aged 18-50 years old was conducted from January to April 2014. Women from 1446 households responded to the survey and nearly one-third (32.1%) reported to have experienced vaginitis. In multivariate analyses, respondents in the urban locality were more likely to practice vaginitis prevention (OR = 1.40, 95% CI = 1.06-1.84) compared with those in the rural areas. Respondents who perceived low susceptibility to vaginitis were less likely to practice vaginitis prevention (OR = 0.72, 95% CI = 0.57-0.91) compared with responders who highly perceive susceptibility. Respondents who had no formal education were less likely to practice vaginitis prevention (OR = 0.16, 95% CI = 0.05-0.48) compared with those with tertiary education. This study showed that comprehensive education and health programmes need to focus on women with a low educational level, living in rural areas and women with low perceived susceptibility to vaginitis. Impact statement What is already known on this subject? Little is known about vaginitis issues among women in Malaysia. This study provides information regarding vaginitis among Malaysian women by looking at the factors associated with prevention practices. What do the results of this study add? From our study, factors associated with prevention practices were found to be educational level, locality, and perceived susceptibility of vaginitis. Those who perform fewer vaginitis prevention practices were women with a low educational level and those who live in rural areas. From the Health Belief Model, women with a low perceived susceptibility of vaginitis were less likely to carry out vaginitis prevention practices. What are
Tan, Min Pau; Jamsari, Amirul Firdaus Jamaluddin; Siti Azizah, Mohd Nor
2012-01-01
A phylogeographic study of an economically important freshwater fish, the striped snakehead, Channa striata in Sundaland was carried out using data from mtDNA ND5 gene target to elucidate genetic patterning. Templates obtained from a total of 280 individuals representing 24 sampling sites revealed 27 putative haplotypes. Three distinct genetic lineages were apparent; 1)northwest Peninsular Malaysia, 2)southern Peninsular, east Peninsular, Sumatra and SW (western Sarawak) and 3) central west Peninsular and Malaysian Borneo (except SW). Genetic structuring between lineages showed a significant signature of natural geographical barriers that have been acting as effective dividers between these populations. However, genetic propinquity between the SW and southern Peninsular and east Peninsular Malaysia populations was taken as evidence of ancient river connectivity between these regions during the Pleistocene epoch. Alternatively, close genetic relationship between central west Peninsular Malaysia and Malaysian Borneo populations implied anthropogenic activities. Further, haplotype sharing between the east Peninsular Malaysia and Sumatra populations revealed extraordinary migration ability of C. striata (>500 km) through ancient connectivity. These results provide interesting insights into the historical and contemporary landscape arrangement in shaping genetic patterns of freshwater species in Sundaland. PMID:23284881
Predictors of Workplace Deviant Behaviour: HRD Agenda for Malaysian Support Personnel
ERIC Educational Resources Information Center
Alias, Mazni; Rasdi, Roziah Mohd; Ismail, Maimunah; Samah, Bahaman Abu
2013-01-01
Purpose: The purpose of this paper is to develop a theoretical model of the determinants of workplace deviant behaviour among support personnel in Malaysian Public Service organisations. Design/methodology/approach: This study is based on reviews of past studies on workplace deviant behaviour. To conduct the literature review, several keywords…
Shyam, Sangeetha; Wai, Tony Ng Kock; Arshad, Fatimah
2012-01-01
This paper outlines the methodology to add glycaemic index (GI) and glycaemic load (GL) functionality to food DietPLUS, a Microsoft Excel-based Malaysian food composition database and diet intake calculator. Locally determined GI values and published international GI databases were used as the source of GI values. Previously published methodology for GI value assignment was modified to add GI and GL calculators to the database. Two popular local low GI foods were added to the DietPLUS database, bringing up the total number of foods in the database to 838 foods. Overall, in relation to the 539 major carbohydrate foods in the Malaysian Food Composition Database, 243 (45%) food items had local Malaysian values or were directly matched to International GI database and another 180 (33%) of the foods were linked to closely-related foods in the GI databases used. The mean ± SD dietary GI and GL of the dietary intake of 63 women with previous gestational diabetes mellitus, calculated using DietPLUS version3 were, 62 ± 6 and 142 ± 45, respectively. These values were comparable to those reported from other local studies. DietPLUS version3, a simple Microsoft Excel-based programme aids calculation of diet GI and GL for Malaysian diets based on food records.
Joginder Singh, Susheel; Iacono, Teresa; Gray, Kylie M
2011-10-01
The aim of this study was to explore the assessment, intervention, and family-centred practices of Malaysian and Australian speech-language pathologists (SLPs) when working with children with developmental disabilities who are pre-symbolic. A questionnaire was developed for the study, which was completed by 65 SLPs from Malaysia and 157 SLPs from Australia. Data reduction techniques were used prior to comparison of responses across questionnaire items. Results indicated that SLPs relied mostly on informal assessments. Malaysian and Australian SLPs differed significantly in terms of obtaining information from outside the clinic to inform assessment. When providing intervention, SLPs focused mostly on improving children's pre-verbal skills. A third of Australian SLPs listed the introduction of some form of symbolic communication as an early intervention goal, compared to only a small percentage of Malaysian SLPs. Regarding family involvement, SLPs most often involved mothers, with fathers and siblings being involved to a lesser extent. Overall, it appeared that practices of Malaysian SLPs had been influenced by developments in research, although there were some areas of service delivery that continued to rely on traditional models. Factors leading to similarities and differences in practice of SLPs from both countries as well as clinical and research implications of the study are discussed.
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
MyGfL: A Lifelong Learning Platform for Malaysian Society
ERIC Educational Resources Information Center
Arabee Abdul Salam, Zailan; Mansur, Azmi
2006-01-01
MyGfL which stands for Malaysian Grid for Learning is a One-Stop-Center for quality assured online learning content, tools and services with the aim to promote and support the lifelong learning agenda in Malaysia. It is a platform that enables anyone to learn, unlearn and relearn from anywhere at anytime through any web browser so as to accelerate…
Sex differences on the Multitalent Perception Inventory among Malaysian students.
Palaniappan, Ananda Kumar
2007-12-01
Malaysian high school students, 142 boys and 154 girls (M age= 13.3 yr., SD = 0.3) were compared on a talent measure, the Khatena-Morse Multitalent Perception Inventory. Boys obtained significantly higher means on the overall score of Versatility and the talent areas of Artistry, Creative Imagination, Initiative, and Leadership. Further replications involving other age groups and nationalities are recommended.
Cross-linguistic transfer of phonological skills: a Malaysian perspective.
Gomez, Caroline; Reason, Rea
2002-01-01
This study examined the phonological and reading performance in English of Malaysian children whose home language was Bahasa Malaysia (BM). A sample of 69 Malaysian Standard Two pupils (aged 7-8 years) was selected for the study. Since commencing school at the age of 6 years, the children had been learning to read in BM and had subsequently also been learning to read in English for some 12 months. The study was part of a larger scale research programme that fully recognized the limitations of tests that had not been developed and standardized in Malaysia. Nevertheless, as a first step to developing such tests, a comparison with existing norms for the Phonological Assessment Battery (PhAB) and the Wechsler Objective Reading Dimension (WORD) was undertaken in relation to information about the children's L1 and L2 language competencies. Results showed that the children's performance on PhAB was at least comparable to the UK norms while, not surprisingly, they fared less well on WORD. The results are discussed in terms of L1 and L2 transfer, whereby the transparency of written BM and the structured way in which reading is taught in BM facilitates performance on phonological tasks in English. This has implications for identifying children with phonologically based reading difficulties.
Articulation of Medium of Instruction Politics in the Malaysian Chinese Press
ERIC Educational Resources Information Center
Samuel, Moses; Khan, Mahmud Hasan; Ng, Lee Luan; Cheang, Kin Wai
2014-01-01
In postcolonial multilingual societies, matters of education are deeply rooted in the discourse of ethnicity. In Malaysia, the interface between ethnicity and education is reflected in recent debates on the choice of medium of instruction (MOI). In 2002, the Malaysian government introduced English as MOI by replacing Malay, the national language,…
The Study of Government-University Relationship in Malaysian Higher Education System
ERIC Educational Resources Information Center
Ahmad, Abd Rahman; Farley, Alan; Naidoo, Moonsamy
2012-01-01
Recently the Agency Theory is extensively used in the study of government-university relationship in higher education system. The theory expounds the main concept of information asymmetry and goal conflict in the relationship. In this paper these two concepts are used to explain efforts undertaken by the Malaysian Federal Government to improve the…
Academic and Social Media Practices of Arabic Language among Malaysian Students
ERIC Educational Resources Information Center
Ismail, Wail; Zailani, Muhammad Azhar; Awad, Zakaria Alcheikh Mahmoud; Hussin, Zaharah; Faisal, Mohd; Saad, Rahimi
2017-01-01
Nowadays, more and more countries are paying attention to graduates' language skill and sending their students abroad to learn languages. As an Islamic country, Malaysia has sent many students to learn Arabic language and Islamic knowledge. This paper aims at examining the level of practice of Arabic language among Malaysian students in Jordanian…
A Malaysian experience with animal disease.
Little, P B
1979-01-01
The report summarizes a one year period of investigation of death losses in West Malaysian livestock. Lesions and etiological agents are mentioned for cattle, sheep, goats, swine, poultry and companion animals as well as some miscellaneous species. Special observations related to a common paramphistome induced hepatic biliary infestation in cattle, a serious malignant head catarrh outbreak in which possible cattle to cow aerosol transmission occurred. Trismus observed in some cattle with malignant head catarrh was associated with arteriolitis and ganglioneuritis of the V cranial nerve. Parasitic, bacterial, viral toxic and neoplastic diseases are recorded in the various species. The occurrence of fatal chronic fluorosis in laboratory guinea pigs and cerebral nematodiasis in a Thoroughbred racehorse are documented.
Ng, Peter K L
2014-03-04
The identity of the common lowland freshwater crab in western Sarawak, Borneo, East Malaysia, Parathelphusa oxygona Nobili, 1901 (family Gecarcinucidae), is clarified. The species is redescribed and figured, and its taxonomy discussed. Specimens from western Kalimantan, Borneo, Indonesia, which have been referred to P. oxygona are here referred to a new species, Parathelphusa nobilii. The new species can be differentiated from congeners by its relatively more swollen branchial regions of the carapace, wider and lower external orbital tooth, relatively more slender male abdomen and a straight male first gonopod.
Eating patterns and prevalence of obesity. Lessons learned from the Malaysian Food Barometer.
Fournier, T; Tibère, L; Laporte, C; Mognard, E; Ismail, M N; Sharif, S P; Poulain, J-P
2016-12-01
The Malaysian society is experiencing and coping with a fast modernization process, which is characterized by a rapid urbanization and rural exodus, an important reduction of the size of households, and the emergence of a new middle class. The Malaysian Food Barometer launched in 2013 has provided better understanding how these macro issues have affected the lifestyles and especially the food habits of the Malaysians. The country has indeed undergone a transition period from under-nutrition to over-nutrition in a few decades, with the prevalence of overweight and obesity having markedly and rapidly increased. A quantitative survey (n = 2000), elaborated from a qualitative preliminary phase, was carried out with the aim of analyzing the transformation of food habits at the national level. The present article focuses on the BMI issue in Malaysia, and investigates its relationships with the socio-demographic variables of the population, as well as their eating patterns. The mean BMI is 23.64 kg/m 2 , with 9.5% of the sample being obese, and 22% overweight. Strong statistical associations have been identified between BMI and independent variables such as size of the living area, ethnicity, level of education, gender, and age. Contrary to general believe, overweight and obesity were neither associated with the number of food intakes taken per day (including snacks) nor with the frequency of eating out. Nonetheless, obesity is over-represented in people who have dissonant eating behaviors, i.e. who declare having fewer food intakes a day (food norms) than they do actually (food practices). This process testifies that the Malaysians are experiencing a "food transition", which is linked with socio-economic development. Copyright © 2016 Elsevier Ltd. All rights reserved.
Deris, Zakuan Zainy; Hasan, Habsah; Sulaiman, Siti Amrah; Wahab, Mohd Suhaimi Ab; Naing, Nyi Nyi; Othman, Nor Hayati
2010-01-01
Respiratory symptoms including cough, runny nose, sore throat, and fever are the most common clinical manifestations faced by hajj pilgrims in Mecca. The aim of the study was to determine the prevalence of respiratory symptoms among Malaysian hajj pilgrims and the effect of a few protective measures taken by hajj pilgrims to reduce respiratory symptoms. A cross-sectional study was conducted by distributing survey forms to Malaysian hajj pilgrims at transit center before flying back to Malaysia. The recruitment of respondents to the survey was on a voluntary basis. A total of 387 survey forms were available for analysis. The mean age was 50.4 +/- 11.0 years. The common respiratory symptoms among Malaysian hajj pilgrims were: cough 91.5%, runny nose 79.3%, fever 59.2%, and sore throat 57.1%. The prevalence of hajj pilgrims with triad of cough, subjective fever, and sore throat were 40.1%. The symptoms lasted less than 2 weeks in the majority of cases. Only 3.6% did not suffer from any of these symptoms. Seventy-two percent of hajj pilgrims received influenza vaccination before departure and 72.9% wore facemasks. Influenza vaccination was not associated with any of respiratory symptoms but it was significantly associated with longer duration of sore throat. Wearing masks was significantly associated with sore throat and longer duration of sore throat and fever. The prevalence of respiratory symptoms was high among Malaysian hajj pilgrims and the current protective measures seemed inadequate to reduce it. Beside standardization of the term used in hajj studies, more collaborative effort should be taken to reduce respiratory symptoms. The hajj authority should prepare for the challenge of pandemic influenza by providing more healthcare facilities and implementation of more strict measures to reduce the transmission of pandemic influenza strain among hajj pilgrims.
The Impact of the Malaysian Minimum Cigarette Price Law: Findings from the ITC Malaysia Survey
Liber, Alex C.; Ross, Hana; Omar, Maizurah; Chaloupka, Frank J.
2015-01-01
Objectives Study the effects of the 2011 Malaysian minimum price law (MPL) on prices of licit and illicit cigarette brands. Identify barriers to the MPL achieving positive public health effects. Methods The International Tobacco Control Project's Southeast Asia survey collected information on Malaysian smokers' cigarette purchases (n=7,520) in five survey waves between 2005 and 2012. Consumption-weighted comparisons of proportions tests and adjusted Wald tests were used to evaluate changes over time in violation rates of the inflation-adjusted MPL, the proportion of illicit cigarette purchases, and mean prices. Results After the passage of the MPL, the proportion of licit brand cigarette purchases that were below the inflation-adjusted 2011 minimum price level fell substantially (before 3.9%, after 1.8%, p=0.002), while violation of the MPL for illicit brand cigarette purchases was unchanged (before 89.8%, after 91.9%, p=0.496). At the same time, the mean real price of licit cigarettes rose (p=0.006) while the mean real price of illicit cigarettes remained unchanged (p=0.134). The proportion of illicit cigarette purchases rose as well (before 13.4%, after 16.5%, p=0.041). Discussion The MPL appears not to have meaningfully changed cigarette prices in Malaysia, as licit brand prices remained well above and illicit brand prices remained well below the minimum price level before and after MPL's implementation. The increasing proportion of illicit cigarettes on the market may have undermined any positive health effects of the Malaysian MPL. The illicit cigarette trade must be addressed before a full evaluation of the Malaysian MPL's impact on public health can take place. The authors encourage the continued use of specific excise tax increases to reliably increase the price and decrease the consumption of cigarettes in Malaysia and elsewhere. PMID:25808666
Baharudin, Azli; Zainuddin, Ahmad Ali; Manickam, Mala A; Ambak, Rashidah; Ahmad, Mohamad Hasnan; Naidu, Balkish Mahadir; Cheong, Siew Man; Ying, Chan Ying; Saad, Hazizi Abu; Ahmad, Noor Ani
2014-09-01
The importance of physical activity to health is well recognized. Good health habits should begin from a young age. This article aims to explore physical activity among Malaysian school adolescents and factors associated with it. Data from the Malaysian School-Based Nutrition Survey (MSNS), comprising a nationally representative sample of school-going children aged 10 to 17 years, were used. The overall prevalence of physically inactive adolescents was 57.3%. Age in years (adjusted odds ratio = 1.2; 95% confidence interval = 1.16-1.23), gender - females (adjusted odds ratio = 2.9; 95% confidence interval = 2.66-3.10), afternoon school session, breakfast consumption (no breakfast and irregular breakfast), body mass index status (obese and underweight), and body weight perception (underweight perceivers) were significant factors associated with physical inactivity among Malaysian adolescents. Thus, there is evidence that programs to promote physical activity in this group should consider the combination of the aforementioned factors at the household, school, and community levels. © 2014 APJPH.
Perception of masculinity amongst young Malaysian men: a qualitative study of university students
2013-01-01
Background Perception of Masculinity plays an important role in men’s lifestyles and health behaviors. Although, the importance of masculinity has been widely discussed in men’s health literature, very little is known about the meanings of masculinity in the Malaysian setting. This research aimed to explore the meanings of masculinity among Malaysian university men. Methods This qualitative study utilized in-depth interviews with 34 young Malaysian university men, aged 20–30 years from three main ethnic groups in Malaysia (Malay, Chinese and Indian). Thematic analysis approach was used to extract data. NVIVO v8 qualitative software was used for data management. Results From the data collected several concepts emerged that reflected the meanings of masculinity from the participants’ view points. These meanings were associated with a combination of traditional and non-traditional norms that generally benefit men who behave according to culturally dominant role expectations. These included: “Having a good body shape”, “being respected”, “having success with women”, “being a family man”, and “having financial independence”. Socio-cultural factors, such as family environment, religion, public media and popular life style patterns helped to shape and reinforce the meanings of masculinities among university men. Conclusions This study revealed that the university context provided a particular culture for construction and reinforcement of the meanings of masculinities, which should be considered by the educators to help in development of healthy masculinities. PMID:24215138
NASA Astrophysics Data System (ADS)
Zahari, R.; Ariffin, M. H.; Othman, N.
2018-02-01
Free Trade Agreements as implemented by Malaysian government calls out local businesses such as landscape architecture consultant firm to explore internationally and strengthen their performance to compete locally. Performance of landscape architecture firm as a design firm depends entirely on creativity of the subordinates in the firm. Past research has neglected studying the influence of a leader’s capitals on subordinates’ creativity, especially in Malaysian landscape architecture firms. The aim of this research is to investigate the influence of subordinates’ perceptions of the leader’s Bourdieu capitals towards promoting subordinate’s creative behaviours in Malaysian Landscape Architecture firms. The sample chosen for this research are subordinates in registered landscape architecture firm. Data was collected using qualitative semi-structured interviews with 13 respondents and analysed using Qualitative Category Coding. Aspects of the leader’s social capital (i.e. knowledge acquisition, problem solving, motivation boosting), human capital (guidance, demotivating leadership, experiential knowledge, knowledge acquisition), and emotional capital (chemistry with leader, respect, knowledge acquisition, trust, understanding, self-inflicted demotivation) that influence subordinates’ creativity were uncovered from the data. The main finding is that the leader’s capitals promote the subordinate landscape architects or assistant landscape architect to be more creative based on three main things, first is knowledge acquisition, motivation, and ability for the leader to influence through positive relationship. The finding contributes to a new way of understanding the leader’s characteristics that influence subordinates’ creativity.
Returning home to work: Malaysian students who studied medicine overseas.
Chur-Hansen, Anna
2004-06-01
International students' medical training often includes an elective placement in their home country to prepare them for practice on graduation. Seven Malaysian students in their final year of medicine were interviewed pre- and post-graduation and asked to reflect on whether they felt adequately prepared for working in Malaysia. These seven international students, who studied medicine in Australia, all returned to Malaysia for six weeks for their elective, and the interviews canvassed their perceptions of this experience, along with their thoughts on how well their training in Australia had prepared them for working in their country of origin. The interview data were qualitatively analysed, and case studies were constructed. Main themes were identified and tabulated. Students voiced similar concerns about how ready they were for working at home. These included a lack of practical skills relative to their Malaysian-trained counterparts, language difficulties, medical communication skill incompatibilities across cultures, expectations to perform complex or unfamiliar tasks with minimal supervision and substantial burdens of responsibility with long working hours. These students did not feel greatly prepared for their return home to practise medicine. The elective placement was not well utilized by the majority of students in this study.
Applications of building information model (BIM) in Malaysian construction industry
NASA Astrophysics Data System (ADS)
Tahir, M. M.; Haron, N. A.; Alias, A. H.; Al-Jumaa, A. T.; Muhammad, I. B.; Harun, A. N.
2017-12-01
Since the introduction of BIM in Malaysia in 2009, the technology adoption rate is slow when compared to other countries of the world. Most of the construction companies in Malaysia have an insight on the BIM concept but are yet to implement it in the management of their construction projects. By the year 2020, the Malaysian government will make BIM mandatory, this makes it important to carry out research on the possible applications of the technology. A qualitative method of enquiry was used for this study in Klang Valley using semistructured interview. The responses received were analysed using Principal component analysis (PCA). The result of the analysis showed that “quantity take-off and estimation”, “clash detection and coordination”, “integration and collaboration of stakeholders”, and “design and visualisation” as the main applications of BIM in Malaysia presently. The implication of this findings is that the Malaysian construction industry productivity is likely to increase to meet the demand of the population through the implementations of BIM. More also, BIM technology is regarded as the future of construction industry, which makes it very important for the industry.
How Common are Noise Sources on the Crash Arc of Malaysian Flight 370
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fenimore, Edward E.; Kunkle, Thomas David; Stead, Richard J.
2014-10-21
Malaysian Flight 370 disappeared nearly without a trace. Besides some communication handshakes to the INMASAT satellite, the Comprehensive Test Ban Treaty monitoring system could have heard the aircraft crash into the southern Indian Ocean. One noise event from Cape Leeuwin has been suggested by Stead as the crash and occurs within the crash location suggested by Kunkle at el. We analyze the hydrophone data from Cape Leeuwin to understand how common such noise events are on the arc of possible locations where Malaysian Flight 370 might have crashed. Few other noise sources were found on the arc. The noise eventmore » found by Stead is the strongest. No noise events are seen within the Australian Transportation Safety Board (ATSB) new search location until the 10 th strongest event, an event which is very close to the noise level.« less
NASA Astrophysics Data System (ADS)
Tan, J. K.; Abas, N.
2017-07-01
Managing electricity breakdown is vital since an outage causes economic losses for customers and the utility companies. However, electricity breakdown is unavoidable due to some internal or external factors beyond our control. Electricity breakdown on overhead lines tend occur more frequently because it is prone to external disturbances such as animal, overgrown vegetation and defective pole top accessories. In Sarawak Energy Berhad (SEB), majority of the network are composed of overhead lines and hence, is more prone to failure. Conventional method of equipment inspection and fault finding are not effective to quickly identify the root cause of failure. SEB has engaged the use of corona discharge camera as condition-based monitoring equipment to carry out condition based inspection on the line in order to diagnose the condition of the lines prior to failure. Experimental testing has been carried out to determine the correlation between the corona discharge count and the level of defect on line insulator. The result shall be tabulated and will be used as reference for future scanning and diagnostic on any defect on the lines.
Khalili, V; Shokri, H; Khosravi, A R; Akim, A; Amri Saroukolaei, S
2016-06-01
The purposes of this study were to purify and compare the concentration ratios of heat shock protein 90 (Hsp90) in clinical isolates of Candida albicans (C. albicans) obtained from Malaysian and Iranian patients and infected mice. Hsp90 was extracted using glass beads and ultracentrifugation from yeast cells and purified by ion exchange chromatography (DEAE-cellulose) and followed by affinity chromatography (hydroxyapatite). Purity of Hsp90 was controlled by SDS-PAGE and its identification was realized by immunoblotting test. The graphs of ion exchange and affinity chromatography showed one peak in all C. albicans isolates obtained from both Malaysian and Iranian samples, infected mice and under high-thermal (42°C) and low-thermal (25°C) shock. In immunoblotting, the location of Hsp90 fragments was obtained around 47, 75 and 82kDa. The least average concentration ratios of Hsp90 were 0.350 and 0.240mg/g for Malaysian and Iranian isolates at 25°C, respectively, while the highest average concentration ratios of Hsp90 were 3.05 and 2.600mg/g for Malaysian and Iranian isolates at 42°C, respectively. There were differences in the ratio amount of Hsp90 between Malaysian isolates (1.01±0.07mg/g) and mice kidneys (1.23±0.28mg/g) as well as between Iranian isolates (0.70±0.19mg/g) and mice kidneys (1.00±0.28mg/g) (P<0.05). The results showed differences in all situations tested including Iranian and Malaysian isolates, samples treated with temperatures (25°C or 42°C) and before and after infecting the mice (37°C), indicating higher virulent nature of this yeast species in high temperature in human and animal models. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Dietary and blood folate status of Malaysian women of childbearing age.
Khor, Geok Lin; Duraisamy, G; Loh, Su Peng; Green, Timothy
2006-01-01
The protective role of folic acid taken during the periconceptual period in reducing the occurrence of neural tube defects (NTD) has been well documented by epidemiological evidence, randomized controlled trials and intervention studies. Much of the evidence is derived from western populations while similar data on Asian subjects is relatively nascent. Baseline data on folate status of Malaysian women is lacking, while NTD prevalence is estimated as 10 per 10,000 births. This study was conducted with the objective of determining the dietary and blood folate status of Malaysian women of childbearing age. A total of 399 women comprising 140 Malay, 131 Chinese and 128 Indian subjects were recruited from universities and worksites in the suburbs of Kuala Lumpur. Inclusion criteria were that the subjects were not pregnant or breastfeeding, not taking folic acid supplements, not habitual drinkers or smokers. Based on a 24-hour recall, the median intake level for folate was 66 microg (15.7-207.8 microg), which amounts to 16.5% of the Malaysian Recommended Nutrient Intakes level. The median (5-95th percentiles) values for plasma and red cell folate (RBC) concentrations were 11 (4-33) nmol/L and 633 (303-1209) nmol/L respectively. Overall, nearly 15.1% showed plasma folate deficiency (< 6.8 nmol/L), with Indian subjects having the highest prevalence (21.5%). Overall prevalence of RBC folate deficiency (<363 nmol/L) was 9.3%, and an almost similar level prevailed for each ethnic group. Only 15.2% had RBC concentration exceeding 906 nmol/L, which is associated with a very low risk of NTD. The result of this study point to the need for intervention strategies to improve the blood folate status of women of childbearing age, so that they have adequate protection against the occurrence of NTD at birth.
Design of a Motivational Scaffold for the Malaysian e-Learning Environment
ERIC Educational Resources Information Center
Alias, Nor Aziah
2012-01-01
With a structure that provides control and choice over time, place, and pace, e-learning has emerged as a viable mode for working adults who wish to upgrade their knowledge. However, such flexibility provides leeway for these adults to procrastinate and for their motivation to dwindle. After all, many adults, especially Malaysian adults, are used…
Gender Identity and Career Aspiration to Top Management of Malaysian Graduate Students
ERIC Educational Resources Information Center
Karami, Roya; Ismail, Maimunah; Sail, Rahim Md.
2011-01-01
This article examines the relationship between gender identity and career aspirations of a group of Iranian international postgraduate students studying at a Malaysian public university. This study uses the Farmer's Achievement Motivation Theory and Astin's Sociopsychological Model of Career Choice as theoretical framework. The data were collected…
ERIC Educational Resources Information Center
Alghail, Ali Abdullah Ali; Mahfoodh, Omer Hassan Ali
2016-01-01
This study examines how international graduate students in a Malaysian public university perceive and overcome academic reading difficulties. The target population included all graduate students from Yemen, an Arab country, studying at Universiti Sains Malaysia. Data were collected using questionnaires, focus group interviews, and journal writing.…
Promoting Snack Time Interactions of Children with Autism in a Malaysian Preschool
ERIC Educational Resources Information Center
Lee, Soo Hoon; Lee, Lay Wah
2015-01-01
The purpose of this study was to examine the effects of a comprehensive social skills intervention package combining peer-mediated strategies and environmental arrangements on the peer interactions of three children with autism in a Malaysian preschool. Following baseline, nine typically developing children participated in social initiation…
NASA Astrophysics Data System (ADS)
Hafiz Mohd Hazir, Mohd; Muda, Tuan Mohamad Tuan
2016-06-01
The Malaysian rubber industry, especially in the upstream sector, is much dependent on smallholders to produce latex or cup lumps. Identification and monitoring of rubber smallholders are essential tasks when it comes to the Malaysian rubber industry's sustainability. The authorised agencies who support the rubber smallholders can do better planning, arranging, and managing. This paper introduces a method of calculating the total number of smallholders as well as identifying the location of their planted rubber area. The scope of this study only focused on land owners as rubber smallholders in the selected study area of Negeri Sembilan. The land use map provided by the Department of Agriculture Malaysia gave information on distribution of rubber area in Malaysia, while the cadastral map from the Department of Survey and Mapping Malaysia was specifically used for identifying land owners of each rubber parcel or rubber lot. Both data were analyzed and processed with ArcGIS software to extract the information, and the results were then compared to the Malaysian Rubber Board smallholders database.
Malaysian and Thai smokers’ beliefs about the harmfulness of ‘light’ and menthol cigarettes
King, B; Yong, H-H; Borland, R; Omar, M; Ahmad, A A; Sirirassamee, B; Hamann, S; O’Connor, R J; Bansal-Travers, M; Elton-Marshall, T; Lee, W B; Hammond, D; Thrasher, J
2015-01-01
Objective This study explored the extent to which Malaysian and Thai smokers believe “light” and menthol cigarettes are less harmful than “regular” cigarettes and the correlates of these beliefs. Methods The study used data from wave 1 of the International Tobacco Control Southeast Asia Survey. 2006 adult smokers (95.3% male) from Malaysia and 2000 adult smokers (94.5% male) from Thailand were interviewed face to face in 2005. Results 29% of Malaysian respondents reported currently smoking light cigarettes and 14% menthols, with 19% agreeing that lights are less harmful and 16% agreeing that menthols are less harmful. 38% of Thai respondents reported currently smoking light cigarettes and 19% menthols, with 46% agreeing that lights are less harmful and 35% agreeing that menthols are less harmful. Malaysian smokers reporting current use of light or menthol cigarettes were more likely to believe that they are less harmful. Reported use of lights did not relate to beliefs for Thai respondents. The belief that light and/or menthol cigarettes are less harmful was strongly related to the belief that they have smoother smoke. Conclusions The experience of smoother smoke is likely to produce some level of belief in reduced harm, regardless of how brands are labelled and whether or not Federal Trade Commission FTC/International Organisation for Standardisation tar, nicotine and carbon monoxide yield figures are used. PMID:20852322
Ponnusamy, Vellapandian; Grove, J. Robert
2014-01-01
Factors relevant to the working alliance between athletes and sport psychology consultants were investigated in a sample of elite Malaysian athletes (n = 217). The athletes represented a variety of team and individual sports, and they provided information about the perceived importance of seven consultant characteristics/behaviors as well as seven program delivery options. At a full-sample level, general preferences were expressed for consultants to lead a physically active lifestyle, regularly attend training sessions and competitions, and have prior experience as an athlete or coach. General preferences were also expressed for program content to be determined by the coach or consultant, and for regular, small doses of mental skills training to be delivered in a face-to-face context throughout the year. At a sub-group level, team sport athletes had stronger preferences than individual sport athletes for program delivery on a group/team basis, while individual sport athletes had stronger preferences than team sport athletes for having a role in determining program content. Findings are discussed in relation to dominant value themes within Malaysian society and the reinforcement of these themes within specific sport subcultures. Key points Consultant characteristics and program delivery methods have an impact on the effectiveness of sport psychology services. Preferred consultant characteristics and preferred methods of delivery may be affected by cultural and subcultural values. Elite Malaysian athletes prefer consultants to lead a physically active lifestyle; to regularly attend training/competition; and to have prior experience as an athlete or coach. Elite Malaysian athletes also prefer that the coach or consultant determine program content, and that mental skills training take place in a face-to-face context throughout the year. PMID:25177193
Ponnusamy, Vellapandian; Grove, J Robert
2014-09-01
Factors relevant to the working alliance between athletes and sport psychology consultants were investigated in a sample of elite Malaysian athletes (n = 217). The athletes represented a variety of team and individual sports, and they provided information about the perceived importance of seven consultant characteristics/behaviors as well as seven program delivery options. At a full-sample level, general preferences were expressed for consultants to lead a physically active lifestyle, regularly attend training sessions and competitions, and have prior experience as an athlete or coach. General preferences were also expressed for program content to be determined by the coach or consultant, and for regular, small doses of mental skills training to be delivered in a face-to-face context throughout the year. At a sub-group level, team sport athletes had stronger preferences than individual sport athletes for program delivery on a group/team basis, while individual sport athletes had stronger preferences than team sport athletes for having a role in determining program content. Findings are discussed in relation to dominant value themes within Malaysian society and the reinforcement of these themes within specific sport subcultures. Key pointsConsultant characteristics and program delivery methods have an impact on the effectiveness of sport psychology services.Preferred consultant characteristics and preferred methods of delivery may be affected by cultural and subcultural values.Elite Malaysian athletes prefer consultants to lead a physically active lifestyle; to regularly attend training/competition; and to have prior experience as an athlete or coach.Elite Malaysian athletes also prefer that the coach or consultant determine program content, and that mental skills training take place in a face-to-face context throughout the year.
Assessment of atmospheric impacts of biomass open burning in Kalimantan, Borneo during 2004
NASA Astrophysics Data System (ADS)
Mahmud, Mastura
2013-10-01
Biomass burning from the combustion of agricultural wastes and forest materials is one of the major sources of air pollution. The objective of the study is to investigate the major contribution of the biomass open burning events in the island of Borneo, Indonesia to the degradation of air quality in equatorial Southeast Asia. A total of 10173 active fire counts were detected by the MODIS Aqua satellite during August 2004, and consequently, elevated the PM10 concentration levels at six air quality stations in the state of Sarawak, in east Malaysia, which is located in northwestern Borneo. The PM10 concentrations measured on a daily basis were above the 50 μg m-3 criteria as stipulated by the World Health Organization Air Quality Guidelines for most of the month, and exceeded the 24-h Recommended Malaysian Air Quality Guidelines of 150 μg m-3 on three separate periods from the 13th to the 30th August 2004. The average correlation between the ground level PM10 concentrations and the satellite derived aerosol optical depth (AOD) of 0.3 at several ground level air quality stations, implied the moderate relationship between the aerosols over the depth of the entire column of atmosphere and the ground level suspended particulate matter. Multiple regression for meteorological parameters such as rainfall, windspeed, visibility, mean temperature, relative humidity at two stations in Sarawak and active fire counts that were located near the centre of fire activities were only able to explain for 61% of the total variation in the AOD. The trajectory analysis of the low level mesoscale meteorological conditions simulated by the TAPM model illustrated the influence of the sea and land breezes within the lowest part of the planetary boundary layer, embedded within the prevailing monsoonal southwesterlies, in circulating the aged and new air particles within Sarawak.
Folate content and availability in Malaysian cooked foods.
Chew, S C; Khor, G L; Loh, S P
2012-12-01
Data on folate availability of Malaysian cooked foods would be useful for estimation of dietary folate intake; however such information is scarce. A total of 53 samples of frequently consumed foods in Malaysia were selected from the Nutrient Composition of Malaysian Foods. Folate content was determined using HPLC method hyphenated with a stainless steel C18 column and ultraviolet detector (lambda = 280 nm). The index of folate availability was defined as the proportion of folate identified as monoglutamyl derivatives from the total folate content. Total folate content of different food samples varied from 30-95 microg/100g fresh weight. Among rice-based dishes, the highest and the lowest total folate was in coconut milk rice (nasi lemak) and ghee rice (nasi minyak), respectively. In noodle dishes, fried rice noodle (kuey teow goreng) and curry noodle (mee kari) had the highest folate contents. The highest index of folate availability was in a flat rice noodle dish (kuey teow bandung) (12.13%), while the lowest was in a festival cake (kuih bakul) (0.13%). Folate content was found to be negatively related to its availability. This study determined folate content and folate availability in commonly consumed cooked foods in Malaysia. The uptake of folate from foods with high folate content may not be necessarily high as folate absorption also depends on the capacity of intestinal deconjugation and the presence of high fibre in the foods.
Perceived sources of stress among Malaysian dental students.
Babar, Muneer G; Hasan, Syed S; Ooi, Yong J; Ahmed, Syed I; Wong, Pei S; Ahmad, Siti F; Mnm-Rosdy, Nik M; Malik, Normaliza A
2015-05-02
The study objectives were to identify the stress levels and to explore the impact of students' year of study and gender on the perceived sources of stress among Malaysian dental students. This was a cross-sectional study involving dental students from year one to year five from private and public universities in Malaysia. The study was formally approved by the Research and Ethics Committee, International Medical University Malaysia. Dental Environment Stress (DES) questionnaire was used for data collection and the gathered data were analyzed using SPSS® version 18. The Kruskal-Wallis and the Mann-Whitney U tests were used to compare stress items across various academic years and universities. A total of five hundred and twenty nine (529) students participated in this study. Fear of failing the course at the end of year exams (mean stress level=5.57); concerns regarding completion of clinical work (mean=5.30); and examination results and grades (mean=5.27) were found as top stressors among dental students. Female students had higher stress scores than males with respect to personal issues, academic performance, educational environment and learning of clinical skills. Students from public universities had higher stress scores than their counterparts from private universities. The Malaysian dental students reported higher levels of stress. Present study identified stressors affecting dental students' academic life, and highlights the importance of stress management programs and other measures to minimize the impact of stress on both academic and personal lives of the students.
Zainal Badari, Shamsul A; Arcot, Jayashree; Haron, Sharifah A; Paim, Laily; Sulaiman, Norhasmah; Masud, Jariah
2012-01-01
Food variety scores (FVS) and dietary diversity scores (DDS) were estimated based on foods consumed weekly by 285 Malaysian households using a food frequency questionnaire. The scoring system of FVS and DDS was based on a scale of 0-7 and 0-6 respectively. The mean household FVS and DDS was 164.1 ± 93 and 6 ± 0.4. The age of respondents (husbands or wives; p < .01), sex (p < .05), and household food expenditure (p < .01) had a significant influence on both FVS and DDS. The food-intake pattern of Malaysian households showed that their typical diets had high protein and energy-based foods.
Psychological traits underlying different killing methods among Malaysian male murderers.
Kamaluddin, Mohammad Rahim; Shariff, Nadiah Syariani; Nurfarliza, Siti; Othman, Azizah; Ismail, Khaidzir H; Mat Saat, Geshina Ayu
2014-04-01
Murder is the most notorious crime that violates religious, social and cultural norms. Examining the types and number of different killing methods that used are pivotal in a murder case. However, the psychological traits underlying specific and multiple killing methods are still understudied. The present study attempts to fill this gap in knowledge by identifying the underlying psychological traits of different killing methods among Malaysian murderers. The study adapted an observational cross-sectional methodology using a guided self-administered questionnaire for data collection. The sampling frame consisted of 71 Malaysian male murderers from 11 Malaysian prisons who were selected using purposive sampling method. The participants were also asked to provide the types and number of different killing methods used to kill their respective victims. An independent sample t-test was performed to establish the mean score difference of psychological traits between the murderers who used single and multiple types of killing methods. Kruskal-Wallis tests were carried out to ascertain the psychological trait differences between specific types of killing methods. The results suggest that specific psychological traits underlie the type and number of different killing methods used during murder. The majority (88.7%) of murderers used a single method of killing. Multiple methods of killing was evident in 'premeditated' murder compared to 'passion' murder, and revenge was a common motive. Examples of multiple methods are combinations of stabbing and strangulation or slashing and physical force. An exception was premeditated murder committed with shooting, when it was usually a single method, attributed to the high lethality of firearms. Shooting was also notable when the motive was financial gain or related to drug dealing. Murderers who used multiple killing methods were more aggressive and sadistic than those who used a single killing method. Those who used multiple methods or
Investigating the Use of Web 2.0 Technology by Malaysian Students
ERIC Educational Resources Information Center
Zakaria, Mohd Hafiz; Watson, Jason; Edwards, Sylvia L.
2010-01-01
Purpose: Many research have uncovered the use of Web 2.0 technology by students from various countries. Yet, limited studies have been done from the context of developing country such as Malaysia. This paper aims to highlight the development of a survey instrument that captured the use of Web 2.0 applications by Malaysian students for learning.…
The Emerging Roles of Coaches in the Malaysian Dual Training System
ERIC Educational Resources Information Center
Othman, Ahmad; Abdullah, Nor Hazana; Sulaiman, Mohamad; Shamsuddin, Alina
2011-01-01
This paper discusses the new task of industry personnel as coaches in the National Dual Training System (NDTS), a newly introduced training initiative for producing k-workers in Malaysia. The decision to introduce this initiative was made by the Malaysian Cabinet on the 19th May 2004 with the hope that it will resolve the issue of skilled workers…
Indo-Pacific Humpback Dolphins in Borneo: A Review of Current Knowledge with Emphasis on Sarawak.
Minton, Gianna; Zulkifli Poh, Anna Norliza; Peter, Cindy; Porter, Lindsay; Kreb, Danielle
2016-01-01
Indo-Pacific humpback dolphins (Sousa chinensis) are documented from various locations along Borneo's coast, including three sites in Sarawak, Malaysia, three sites in Sabah, Malaysia, three locations in Kalimantan, Indonesia and the limited coastal waters of the Sultanate of Brunei. Observations in all these areas indicate a similar external morphology, which seems to fall somewhere between that documented for Chinese populations known as S. chinensis, and that of Sousa sahulensis in Australia and Papua New Guinea. Sightings occur in shallow nearshore waters, often near estuaries and river mouths, and associations with Irrawaddy dolphins (Orcaella brevirostris) are frequently documented. Population estimates exist for only two locations and sightings information throughout Borneo indicates that frequency of occurrence is rare and group size is usually small. Threats from fisheries by-catch and coastal development are present in many locations and there are concerns over the ability of these small and fragmented populations to survive. The conservation and taxonomic status of humpback dolphins in Borneo remain unclear, and there are intriguing questions as to where these populations fit in our evolving understanding of the taxonomy of the genus. © 2016 Elsevier Ltd. All rights reserved.
Perceived Use of Inquiry Teaching by a Sample of Malaysian Biology Teachers.
ERIC Educational Resources Information Center
Ismail, Nor Asma; Rubba, Peter A.
1981-01-01
Determined degree to which Malaysian biology teachers (N=26) perceived they understood and used inquiry teaching. Data indicated that these teachers perceived they had a moderate amount of knowledge about inquiry and occasionally used the 21 inquiry-related behaviors assessed by "A Generic Problem Solving (Inquiry) Model" (Hungerford,…
Malaysian Journal of Medical Sciences Striving towards Visibility
GHAZLI, Nur Farahin; ABDULLAH, Jafri Malin
2013-01-01
The Malaysian Journal of Medical Sciences has in its 25 years “Silver Jubilee” achieved another milestone of being visible to the biomedical community when it was accepted in PubMed. The journal aim to increase its readership so as to increase impact in the biomedical field amongst its Asian readers despite having a high rejection rate. This was done to maintain quality of the manuscripts published over the years. PubMed listing should enable more manuscripts to be cited as its the leading biomedical journal for the Asian community. PMID:24043990
NASA Astrophysics Data System (ADS)
Phang, K. Y.; Lau, S. W.
2017-06-01
As one of the world’s largest palm oil producers and exporters, Malaysia is committed to sustainable management of this industry to address the emerging environmental challenges. This descriptive study aims to evaluate the oil palm planters’ opinions regarding the usage of biomass wastes from palm oil mills and its impact on sustainable development of oil palm plantations in Sarawak. 253 planters across Sarawak were approached for their opinions about the usage of empty fruit bunch (EFB), palm oil mill effluent (POME), mesocarp fibre (MF), and palm kernel shell (PKS). This study revealed that the planters had generally higher agreement on the beneficial application of EFB and POME in oil palm plantations. This could be seen from the higher means of agreement rating of 3.64 - 4.22 for EFB and POME, compared with the rating of 3.19 - 3.41 for MF and PKS in the 5-point Likert scale (with 5 being the strongest agreement). Besides, 94.7 percent of the planters’ companies were found to comply with the Environmental Impact Assessment (EIA) requirements where nearly 38 percent carried out the EIA practice twice a year. Therefore high means of agreement were correlated to the compliance of environmental regulations, recording a Likert rating of 3.89 to 4.31. Lastly, the usage of EFB and POME also gained higher Likert scale point of 3.76 to 4.17 against MF and PKS of 3.34 to 3.49 in the evaluation of the impact of sustainability in oil palm plantations. The planters agreed that the usage of EFB and POME has reduced the environmental impact and improved the sustainable development, and its application has been improved and increased by research and development. However the planters were uncertain of the impact of usage of biomass wastes with respect to the contribution to social responsibility and company image in terms of transparency in waste management.
Karin, Benjamin R; Freitas, Elyse S; Shonleben, Samuel; Grismer, L Lee; Bauer, Aaron M; Das, Indraneil
2018-01-12
We collected two specimens of an undescribed species of Lygosoma from pitfall traps in an urban rainforest in Kuching and from the base of a forested hill in western Sarawak, East Malaysia. The new species is diagnosable from all south-east Asian congeners by morphological characters, and most closely resembles Lygosoma herberti from the Thai-Malay Peninsula. The new species shows substantial molecular divergence from its closest relatives in two protein-coding genes, one mitochondrial (ND1) and one nuclear (R35) that we sequenced for several south-east Asian congeners. We describe the new species on the basis of this distinct morphology and genetic divergence. It is the third species of Lygosoma known from Borneo, and highlights the continuing rise in lizard species diversity on the island. In addition, the discovery of this species from a small urban rainforest underscores the importance of preserving intact rainforest areas of any size in maintaining species diversity.
Distribution of Major and Trace Elements in a Tropical Hydroelectric Reservoir in Sarawak, Malaysia.
Sim, Siong Fong; Ling, Teck Yee; Nyanti, Lee; Ean Lee, Terri Zhuan; Mohd Irwan Lu, Nurul Aida Lu; Bakeh, Tomy
2014-01-01
This paper reports the metals content in water, sediment, macroalgae, aquatic plant, and fish of Batang Ai Hydroelectric Reservoir in Sarawak, Malaysia. The samples were acid digested and subjected to atomic absorption spectrometry analysis for Na, K, Mn, Cr, Ni, Zn, Mg, Fe, Sn, Al, Ca, As, Se, and Hg. The total Hg content was analysed on the mercury analyser. Results showed that metals in water, sediment, macroalgae, aquatic plant, and fish are distinguishable, with sediment and biota samples more susceptible to metal accumulation. The distributions of heavy metals in water specifically Se, Sn, and As could have associated with the input of fish feed, boating, and construction activities. The accumulation of heavy metals in sediment, macroalgae, and aquatic plant on the other hand might be largely influenced by the redox conditions in the aquatic environment. According to the contamination factor and the geoaccumulation index, sediment in Batang Ai Reservoir possesses low risk of contamination. The average metal contents in sediment and river water are consistently lower than the literature values reported and well below the limit of various guidelines. For fishes, trace element Hg was detected; however, the concentration was below the permissible level suggested by the Food and Agriculture Organization.
Distribution of Major and Trace Elements in a Tropical Hydroelectric Reservoir in Sarawak, Malaysia
Nyanti, Lee; Ean Lee, Terri Zhuan; Mohd Irwan Lu, Nurul Aida Lu
2014-01-01
This paper reports the metals content in water, sediment, macroalgae, aquatic plant, and fish of Batang Ai Hydroelectric Reservoir in Sarawak, Malaysia. The samples were acid digested and subjected to atomic absorption spectrometry analysis for Na, K, Mn, Cr, Ni, Zn, Mg, Fe, Sn, Al, Ca, As, Se, and Hg. The total Hg content was analysed on the mercury analyser. Results showed that metals in water, sediment, macroalgae, aquatic plant, and fish are distinguishable, with sediment and biota samples more susceptible to metal accumulation. The distributions of heavy metals in water specifically Se, Sn, and As could have associated with the input of fish feed, boating, and construction activities. The accumulation of heavy metals in sediment, macroalgae, and aquatic plant on the other hand might be largely influenced by the redox conditions in the aquatic environment. According to the contamination factor and the geoaccumulation index, sediment in Batang Ai Reservoir possesses low risk of contamination. The average metal contents in sediment and river water are consistently lower than the literature values reported and well below the limit of various guidelines. For fishes, trace element Hg was detected; however, the concentration was below the permissible level suggested by the Food and Agriculture Organization. PMID:27437493
Long-term disturbance dynamics and resilience of tropical peat swamp forests
Cole, Lydia E S; Bhagwat, Shonil A; Willis, Katherine J
2015-01-01
1. The coastal peat swamp forests of Sarawak, Malaysian Borneo, are undergoing rapid conversion, predominantly into oil palm plantations. This wetland ecosystem is assumed to have experienced insignificant disturbance in the past, persisting under a single ecologically-stable regime. However, there is limited knowledge of the past disturbance regime, long-term functioning and fundamentally the resilience of this ecosystem to changing natural and anthropogenic perturbations through time. 2. In this study, long-term ecological data sets from three degraded peatlands in Sarawak were collected to shed light on peat swamp forest dynamics. Fossil pollen and charcoal were counted in each sedimentary sequence to reconstruct vegetation and investigate responses to past environmental disturbance, both natural and anthropogenic. 3. Results demonstrate that peat swamp forest taxa have dominated these vegetation profiles throughout the last c. 2000-year period despite the presence of various drivers of disturbance. Evidence for episodes of climatic variability, predominantly linked to ENSO events, and wildfires is present throughout. However, in the last c. 500 years, burning and indicators of human disturbance have elevated beyond past levels at these sites, concurrent with a reduction in peat swamp forest pollen. 4. Two key insights have been gained through this palaeoecological analysis: (i) peat swamp forest vegetation has demonstrated resilience to disturbance caused by burning and climatic variability in Sarawak in the late Holocene, however (ii) coincident with increased fire combined with human impact c. 500 years ago, these communities started to decline. 5. Synthesis. Sarawak's coastal peat swamps have demonstrated resilience to past natural disturbances, with forest vegetation persisting through episodes of fire and climatic variability. However, palaeoecological data presented here suggest that recent, anthropogenic disturbances are of a greater magnitude, causing
Long-term disturbance dynamics and resilience of tropical peat swamp forests.
Cole, Lydia E S; Bhagwat, Shonil A; Willis, Katherine J
2015-01-01
1. The coastal peat swamp forests of Sarawak, Malaysian Borneo, are undergoing rapid conversion, predominantly into oil palm plantations. This wetland ecosystem is assumed to have experienced insignificant disturbance in the past, persisting under a single ecologically-stable regime. However, there is limited knowledge of the past disturbance regime, long-term functioning and fundamentally the resilience of this ecosystem to changing natural and anthropogenic perturbations through time. 2. In this study, long-term ecological data sets from three degraded peatlands in Sarawak were collected to shed light on peat swamp forest dynamics. Fossil pollen and charcoal were counted in each sedimentary sequence to reconstruct vegetation and investigate responses to past environmental disturbance, both natural and anthropogenic. 3. Results demonstrate that peat swamp forest taxa have dominated these vegetation profiles throughout the last c . 2000-year period despite the presence of various drivers of disturbance. Evidence for episodes of climatic variability, predominantly linked to ENSO events, and wildfires is present throughout. However, in the last c . 500 years, burning and indicators of human disturbance have elevated beyond past levels at these sites, concurrent with a reduction in peat swamp forest pollen. 4. Two key insights have been gained through this palaeoecological analysis: (i) peat swamp forest vegetation has demonstrated resilience to disturbance caused by burning and climatic variability in Sarawak in the late Holocene, however (ii) coincident with increased fire combined with human impact c . 500 years ago, these communities started to decline. 5. Synthesis . Sarawak's coastal peat swamps have demonstrated resilience to past natural disturbances, with forest vegetation persisting through episodes of fire and climatic variability. However, palaeoecological data presented here suggest that recent, anthropogenic disturbances are of a greater magnitude
Aging gracefully: a comparative study of Japanese and Malaysian women aged 65-75.
Kok, Jin Kuan; Yap, Yuet Ngor
2014-12-01
Longer lives and extended retirement have created a 'young old age' stage of life. How people spend their "young old age" has become increasingly important. This research aims to investigate the different ageing experiences of Japanese and Malaysian women and the activities they engaged in their "young old age". In-depth interviews were conducted to collect data and an adapted grounded theory approach was used for data analysis. Findings reveal many common characteristics for both groups of research participants. The emerging themes show that Japanese and Malaysian Chinese have different life missions evident in their daily activities, one passing on culture and the other passing on family values and life experience. They also differ in their choice of living arrangement (independent versus dependent/interdependent), attitudes to life (fighting versus accepting) and activities in which to engage (aesthetic pursuits versus family oriented activities). Copyright © 2014 Elsevier Inc. All rights reserved.
Ting, Hua-Nong; Chia, See-Yan; Manap, Hany Hazfiza; Ho, Ai-Hui; Tiu, Kian-Yean; Abdul Hamid, Badrulzaman
2012-07-01
The study is going to investigate the fundamental frequency (F(0)) and perturbation measures of sustained vowels in 360 native Malaysian Malay children aged between 7 and 12 years using acoustical analysis. Praat software (Boersma and Weenink, University of Amsterdam, The Netherlands) was used to analyze the F(0) and perturbation measures of the sustained vowels. Statistical analyses were conducted to determine the significant differences in F(0) and perturbation measures across the vowels, sex, and age groups. The mean F(0) of Malaysian Malay male and female children were reported at 240±34.88 and 254.48±23.35Hz, respectively. The jitter (Jitt), relative average perturbation (RAP), five-point period perturbation quotient (PPQ5), shimmer (Shim), and 11-point amplitude perturbation quotient (APQ11) of Malaysian male children were reported at 0.43±0.26%, 0.25±0.16%, 0.26±0.15%, 2.48±1.61%, and 1.75±1.04%, respectively. As for female children, the Jitt, RAP, PPQ5, Shim, and APQ11 were reported at 0.42±0.22%, 0.25±0.14%, 0.25±0.13%, 2.47±1.53%, and 1.75±1.10%, respectively. No significant differences in F(0) were reported across the Malay vowels for both males and females. Malay females had significantly higher F(0) than that in Malay males at the age of 8, 10, and 12 years. Malaysian Malay children underwent the nonsystematic decrement in F(0) across the age groups. Significant differences in F(0) were found across the age groups. Significant differences in perturbation measures were observed across the vowels in certain age groups of Malay males and females. Generally, no significant differences in perturbation measures between the sex were observed in all the age groups and vowels. No significant differences in all the perturbation measures across the age groups were reported in both Malaysian Malay male and female children. Copyright © 2012 The Voice Foundation. Published by Mosby, Inc. All rights reserved.
Malaysian University Students' Attitudes towards Six Varieties of Accented Speech in English
ERIC Educational Resources Information Center
Ahmed, Zainab Thamer; Abdullah, Ain Nadzimah; Heng, Chan Swee
2014-01-01
Previous language attitude studies indicated that in many countries all over the world, English language learners perceived native accents, either American or British, more positively than the non-native accents such as the Japanese, Korean, and Austrian accents. However, in Malaysia it is still unclear which accent Malaysian learners of English…
The Influence of AQ on the Academic Achievement among Malaysian Polytechnic Students
ERIC Educational Resources Information Center
Matore, Mohd Effendi Ewan Mohd; Khairani, Ahmad Zamri; Razak, Nordin Abd
2015-01-01
This study aimed to examine the influence of Adversity Quotient (AQ) on the academic achievement among Malaysian polytechnic students. A total of 1,845 students from five polytechnics in Malaysia participated in this study and these polytechnic was selected from five different zones, namely Nouthern, Southern, Eastern, Western and Borneo. The…
Connoisseurship Evaluation in Digital Painting among Art Teachers in Malaysian Secondary School
ERIC Educational Resources Information Center
Samah, Azimah A.; Hussin, Zaharah; Putih, Abu Talib
2016-01-01
Connoisseurship evaluation is a form of evaluation and educational inquiry having qualitative characteristics. In this study, these skills are seen among Malaysian art teachers in secondary schools. Quality assessment depends on the evaluator who has the ability of some aspects. Among these are qualitative nuances experiences as well as ability to…
The Distinctiveness and Effectiveness of Science Teaching in the Malaysian "Smart School"
ERIC Educational Resources Information Center
Ong, Eng Tek; Ruthven, Kenneth
2010-01-01
A recent reform initiative in the Malaysian educational system has sought to develop "Smart schools", intended to better prepare students for adult life in a developing economy and to increase the flow of young people prepared for scientific and technological careers. The study reported in this paper examined lower-secondary science…
Factors Related to Urinary Incontinence among the Malaysian Elderly.
Eshkoor, S A; Hamid, T A; Shahar, S; Mun, C Y
2017-01-01
Urinary incontinence is a prevalent condition in the elderly that is the spontaneous leakage of urine. It is an age-related problem and increases especially in people aged above 65 years. It can cause many psychological, behavioral, biological, economic and social effects. The treatment of urinary incontinence can reduce morbidity and mortality. Thus, this study aimed to determine the effects of variables including age, ethnicity, gender, education, marital status, body weight, blood elements and nutritional parameters on urinary incontinence among the Malaysian elderly. The study was on 2322 non-institutionalized Malaysian elderly. The hierarchy logistic regression analysis was applied to estimate the risk of independent variables for urinary incontinence among respondents. The findings indicated that approximately 3.80% of subjects had urinary incontinence. In addition, constipation was found a significant factor that increased the risk of urinary incontinence in samples (p=0.006; OR=3.77). The increase in dietary monounsaturated fat (p=0.038; OR=0.59) and plasma triglyceride levels (p=0.029; OR=0.56) significantly reduced the risk of incontinence in subjects. Many of suspected variables including socio-demographic factors, diseases, nutritional minerals, blood components and body weight were non-relevant factors to urinary incontinence in respondents. Constipation increased the risk of urinary incontinence in subjects, and increase in dietary monounsaturated fat and plasma triglyceride levels decreased the risk.
Yu, Foo Qing; Murugiah, Muthu Kumar; Khan, Amer Hayat; Mehmood, Tahir
2015-01-01
Barriers to health seeking constitute a challenging issue in the treatment of breast cancer. The current meta- synthesis aimed to explore common barriers to health seeking among Malaysian breast cancer patients. From the systematic search, nine studies were found meeting the inclusion criteria. Data extraction revealed that health behavior towards breast cancer among Malaysia women was influenced by knowledge, psychological, sociocultural and medical system factors. In terms of knowledge, most of the Malaysian patients were observed to have cursory information and the reliance on the information provided by media was limiting. Among psychological factors, stress and sense of denial were some of the common factors leading to delay in treatment seeking. Family member's advice, cultural beliefs towards traditional care were some of the common sociocultural factors hindering immediate access to advanced medical diagnosis and care. Lastly, the delay in referral was one of the most common health system-related problems highlighted in most of the studies. In conclusion, there is an immediate need to improve the knowledge and understanding of Malaysian women towards breast cancer. Mass media should liaise with the cancer specialists to disseminate accurate and up-to-date information for the readers and audience, helping in modification of cultural beliefs that hinder timing health seeking. However, such intervention will not improve or rectify the health system related barriers to treatment seeking. Therefore, there is an immediate need for resource adjustment and training programs among health professional to improve their competency and professionalism required to develop an efficient health system.
Arunasalam, Nirmala
2018-06-07
The interpretive paradigm and hermeneutic phenomenological design are the most popular methods used in international cross-cultural research in healthcare, nurse education and nursing practice. Their inherent appeal is that they help researchers to explore experiences. The ethnographic principle of cultural interpretation can also be used to provide meaning, clarity and insight. To examine the use of hermeneutic phenomenology and the ethnographic principle of cultural interpretation in a research study conducted with Malaysian nurses on part-time, transnational, post-registration, top-up nursing degree programmes provided by one Australian and two UK universities. To enable the researcher to undertake international cross-cultural research and illuminate Malaysian nurses' views for the reader, cultural aspects need to be considered, as they will influence the information participants provide. Useful strategies that western researchers can adopt to co-create research texts with interviewees are outlined. The paradigm and research designs used in the study revealed the views and experiences of Malaysian nurses. Hermeneutic phenomenology enabled the exploration of participants' experiences, and the ethnographic principle of cultural interpretation enabled the researcher's reflexivity to provide emic and etic views for the reader. This paper adds to the discussion of the paradigms and research designs used for international, cross-cultural research in Asia. It identifies the influence participants' cultural values have on their confidence and level of disclosure with western researchers. ©2018 RCN Publishing Company Ltd. All rights reserved. Not to be copied, transmitted or recorded in any way, in whole or part, without prior permission of the publishers.
ERIC Educational Resources Information Center
Bajunid, Ibrahim Ahmad
2001-01-01
Describes efforts by Malaysian society to transform itself using technology into an information-rich knowledge society founded on positive universal values. Locates contemporary educational development within the framework of four government-driven initiatives that provide the direction and resources for educational change. Discusses issues…
Dental age estimation of growing children by measurement of open apices: A Malaysian formula
Cugati, Navaneetha; Kumaresan, Ramesh; Srinivasan, Balamanikanda; Karthikeyan, Priyadarshini
2015-01-01
Background: Age estimation is of prime importance in forensic science and clinical dentistry. Age estimation based on teeth development is one reliable approach. Many radiographic methods are proposed on the Western population for estimating dental age, and a similar assessment was found to be inadequate in Malaysian population. Hence, this study aims at formulating a regression model for dental age estimation in Malaysian children population using Cameriere's method. Materials and Methods: Orthopantomographs of 421 Malaysian children aged between 5 and 16 years involving all the three ethnic origins were digitalized and analyzed using Cameriere's method of age estimation. The subjects’ age was modeled as a function of the morphological variables, gender (g), ethnicity, sum of normalized open apices (s), number of tooth with completed root formation (N0) and the first-order interaction between s and N0. Results: The variables that contributed significantly to the fit were included in the regression model, yielding the following formula: Age = 11.368-0.345g + 0.553No -1.096s - 0.380s.No, where g is a variable, 1 for males and 2 for females. The equation explained 87.1% of total deviance. Conclusion: The results obtained insist on reframing the original Cameriere's formula to suit the population of the nation specifically. Further studies are to be conducted to evaluate the applicability of this formula on a larger sample size. PMID:26816464
The prevalence of tongue lesions in Malaysian dental outpatients from the Klang Valley area.
Koay, C L; Lim, J A; Siar, C H
2011-03-01
To determine the prevalence of tongue lesions in Malaysian dental outpatients from the Klang Valley area. A cross sectional study was conducted on 600 Malaysian outpatients (257 men, 343 women, mean age, 37.7 years) attending the Primary Dental Care Unit at the Faculty of Dentistry, University of Malaya. Demographic and medical data were recorded for all respondents. One hundred eighty-one patients (30.2%) (81 men, 100 women, mean age 42.0 years) were diagnosed with at least one tongue lesion (n = 207) at the time of examination. Of these, 24 patients (4%) had two or more tongue lesions present synchronously. Seven different lesions were diagnosed: fissured tongue (13.8%), crenated tongue (7.8%), pigmented tongue (6.2%), geographic tongue (2.2%), ankyloglossia (1.7%), hairy tongue (1.0%) and median rhomboid glossitis (0.2%). Their racial prevalences were Malays (n = 65, 10.8%), Indians (n = 62, 10.3%), Chinese (n = 53, 8.8%) and other race (n = 1, 0.2%). A significant relationship was observed between crenated tongue and race; between four types of tongue lesions (fissured tongue, geographic tongue, crenated tongue and pigmented tongue) and age; and between fissured tongue and gender (P < 0.05). Distribution characteristics of tongue lesions in Malaysians are important as local reference data in the daily clinical practice. © 2010 John Wiley & Sons A/S.
Predictors of Parenting Stress among Malaysian Mothers of Children with Down Syndrome
ERIC Educational Resources Information Center
Norizan, A.; Shamsuddin, K.
2010-01-01
Background: Having children with intellectual disability can be stressful for most parents. Currently there are very few studies focusing on parenting stress among mothers of children with Down syndrome (DS) in Asia. The present study examined the level of parenting stress experienced by Malaysian mothers of children with DS and evaluated the…
The Benefits of Headship Mentoring: An Analysis of Malaysian Novice Headteachers' Perceptions
ERIC Educational Resources Information Center
Tahir, Lokman; Haruzuan Mohd Said, Mohd Nihra; Daud, Khadijah; Vazhathodi, Shafeeq H.; Khan, Aqeel
2016-01-01
In this article we examine the mentoring program for novice headteachers and what they perceive as its purposes, as well as the constraints to successfully implementing it in Malaysian schools. Using a survey research design we analysed responses from 200 newly appointed headteachers from two state departments of education, and interviewed six…
Malaysian aviation technologist promotion to managerial role: an empirical overview
NASA Astrophysics Data System (ADS)
Liew, C. L.; Abu Talib, A. R.; Jacobs, R. L.
2016-10-01
The Malaysian aviation industry has continued to march forward. With a turnover of RM23.7 billion in 2013, it is expected to grow higher especially after the Malaysian national aerospace blueprint was launched in 2015. The aviation related organizations currently have a workforce of approximately 13500. These organizations need to be managed by competent managers who have a strong background of technologist. Aviation technologist is one of the key components in the aviation maintenance industry as they are the future managers charged with the responsibility to ensure continuation of the organization's objectives and culture. The technologist role and manager's role are somehow different. The promotion of technologist to managerial roles is quite common but whether the technologist is able to take up managerial role effectively is yet to be fully understood. It is quite common that there was insufficient training for the technologist before being promoted to take up management roles. The purpose of this paper is to give an overview of the role of technologists and managers in professional services industries such as MRO and to understand that there is a need within the industry to re-look into the perspective of a proper training to prepare them to take up management roles effectively.
Practice of Sealants and Preventive Resin Restorations Among Malaysian Dentists.
Chin, Zhe W; Chong, Wai S; Mani, Shani A
2016-01-01
To assess the knowledge, attitude and utilisation regarding fissure sealants (FS) and preventive resin restorations (PRR) among Malaysian dentists. A questionnaire consisting of 35 questions was distributed by mail or an online survey to 425 registered dentists selected according to place of work by stratified random sampling. One hundred fifty-three dentists responded to the survey. A positive attitude towards FS and PRR was noted among most Malaysian dentists. About half of the respondents used FS/PRR occasionally (48.4%), while few (13.7%) applied them routinely. The majority of the dentists agreed that minimally invasive dentistry is important and FS are effective in caries prevention, using them on high caries-risk individuals. Most of the dentists used pumice or paste to clean teeth before placing FS/PRR. A significant number of dentists used a bonding agent prior to placing FS. Although only 57.5% dentists were aware of guidelines for FS use, most dentists agreed that guidelines are important. Although there was a positive attitude towards FS/PRR, few dentists applied them routinely. Some of the steps undertaken for placement of FS and PRR were outdated. Updating local guidelines for dentists to ensure uniform practice of FS and PRR is justified.
Mitigating delay and non-payment in the Malaysian construction industry
NASA Astrophysics Data System (ADS)
Mohamad, N.; Suman, A. S.; Harun, H.; Hashim, H.
2018-02-01
Construction industry is one of the industries that have contributed towards the rapid growth of development and economics in Malaysia. However, the industry is inundated with delay and non-payment issues between the two parties in contract that is the clients and contractors Even though there are contractual and administrative provisions in the standard forms of contract in Malaysia regarding payments, delay and non-payment issues still occur between them. The aim of the study is to develop measures to mitigate delay and non-payment issues between contractors and clients in the Malaysian construction industry. Questionnaire survey was conducted with clients and contractors in Klang Valley. Results from data analysis identified significant measures to mitigate delay and non-payment issues between contractors and clients which include contractors should submit their progress work invoicing with adequate documents; contractors should follow up constantly with client regarding payment; proper understanding of requirements with regards to payment; mutual discussion of problems with client to address problems in a timely manner and proper use of payment provisions in the standard form of contract. This study is significant to contractors and clients and to other construction players in order to reduce and minimise delay and non-payment issues for the growth of economy in the Malaysian construction industry.
Chew, Boon-How; Lee, Ping-Yein; Cheong, Ai-Theng; Ismail, Mastura; Shariff-Ghazali, Sazlina; Goh, Pik-Pin
2016-10-01
A persistent and increasing prevalence of diagnosed and undiagnosed diabetes mellitus has recently been reported in the National Health and Morbidity Survey 2015. This commentary recapitulates the relevant and valuable lessons in the Malaysian national diabetes registries to inform the healthcare stakeholders and policy makers on potential areas of clinical practice improvement and future researches. Under performance of the process measures and sub-optimal control of HbA1c, blood pressure and lipids profile were prevalent (<40% achieved treatment targets). Although these had improved slightly from 2009 to 2012, diabetes co-morbidities (hypertension and dyslipidaemia) and complications had also increased. Prevalence of insulin use had doubled, and lipid lowering agent use had increased about 50% in 2012 compared to 2009. We identified six clinical areas for urgent attention and improvement, and three potential areas for future research. Copyright © 2016 Primary Care Diabetes Europe. Published by Elsevier Ltd. All rights reserved.
Ng, Wen-Jie; Ken, Khai-Wei; Kumar, Roshani-Vijaya; Gunasagaran, Hemamalani; Chandramogan, Vanaysha; Lee, Ying-Yee
2014-01-01
Different researches on therapeutic effects of honey have been conducted in different regions; however the study on the potential antibacterial activity of Malaysian honey is still limited. In this study, antibacterial activities of different monofloral honey samples were tested against several common human pathogenic bacteria. The well-diffusion method, minimum inhibitory concentrations (MIC) and minimum bactericidal concentration (MBC) techniques were employed to investigate the putative antibacterial activity of Malaysian monofloral honey from Koompassia excelsa (Becc.) Taub (Tualang), Melaleuca cajuputi Powell (Gelam) and Durio zibethinus Murr. (Durian). Honey samples were tested against Staphylococcus aureus ATCC6518 and ATCC25923, Staphylococcus epidermidis ATCC12228, Enterococcus faecium LMG16192, Enterococcus faecalis LMG16216 and ATCC29212, Escherichia coli ATCC25922, Salmonella enterica serovar Typhimurium ATCC14028 and Klebsiella pneumoniae ATCC13883. Marked variations were observed in the antibacterial activity of these honey samples. Durian honey failed to produce substantial antibacterial activity, whereas Tualang and Gelam honey showed a spectrum of antibacterial activity with their growth inhibitory effects against all of the tested bacterial species including vancomycin-resistant enterococci (VRE). Present findings suggested Gelam honey possesses highest antibacterial effect among the tested Malaysian honey samples.
Suicidal ideation among Malaysian adolescents.
Ahmad, NoorAni; Cheong, Siew Man; Ibrahim, Nurashikin; Rosman, Azriman
2014-09-01
Adolescence is the time of greatest risk for the first onset of suicidal behaviors. This study aimed to identify the risk and protective factors associated with suicidal ideation among Malaysian adolescents. Data from the 2012 Malaysia Global School-based Student Health Survey, a nationwide study using a 2-stage cluster sampling design, were analyzed. The survey used a self-administered validated bilingual questionnaire and the Depression Anxiety and Stress Scale. The prevalence of suicidal ideation was 7.9%. Analysis revealed that suicidal ideation was positively associated with depression, anxiety, stress, substance use, being bullied, and being abused at home, either physically or verbally. In addition, suicidal ideation was significantly higher among females and among the Indians and Chinese. Having close friends and married parents were strongly protective against suicidal ideation. Understanding the risk and protective factors is important in providing comprehensive management for suicidal ideation. © 2014 APJPH.
Jinggut, Tajang; Yule, Catherine M; Boyero, Luz
2012-10-15
In common with most of Borneo, the Bakun region of Sarawak is currently subject to heavy deforestation mainly due to logging and, to a lesser extent, traditional slash-and-burn farming practices. This has the potential to affect stream ecosystems, which are integrators of environmental change in the surrounding terrestrial landscape. This study evaluated the effects of both types of deforestation by using functional and structural indicators (leaf litter decomposition rates and associated detritivores or 'shredders', respectively) to compare a fundamental ecosystem process, leaf litter decomposition, within logged, farmed and pristine streams. Slash-and-burn agricultural practices increased the overall rate of decomposition despite a decrease in shredder species richness (but not shredder abundance) due to increased microbial decomposition. In contrast, decomposition by microbes and invertebrates was slowed down in the logged streams, where shredders were less abundant and less species rich. This study suggests that shredder communities are less affected by traditional agricultural farming practices, while modern mechanized deforestation has an adverse effect on both shredder communities and leaf breakdown. Copyright © 2012 Elsevier B.V. All rights reserved.
Johan, N A; Khamis, M F; Abdul Jamal, N Sk; Ahmad, B; Mahanani, E S
2012-07-01
This study aimed to assess the variability of the lower third molar (tooth 38 and 48) development in Northeast Malaysian population with respect to the side of dentition, to generate age prediction models and to compare the outcome with other studies. A total of 1080 orthopantomograms of Northeast Malaysian population aged between 14 and 25 years (540 males and 540 females) from the Hospital Universiti Sains Malaysia's archive which met the inclusion and exclusion criteria were selected and the maturity stages of tooth 38 and 48 were scored using Demirjian's stages (A-H). The findings showed a wide variation of the development of lower third molars in the Northeast Malaysian population. The roots developed earlier in males than in females. The development of the dentition on opposite sides of the mandible was synchronously in females and males. A multiple regression analysis shows that 71.1% of variance in age was explained by sex and developmental stage of tooth 48. An age prediction model was generated from the regression analysis: [Age = 7.117 + 1.907*(stage of tooth 48) - 0.432*(sex)] with mean prediction errors between -0.17 to 3.14 years. The obtained data in the current study are useful for references and determining age of unidentified human remains for identification investigation.
ERIC Educational Resources Information Center
Rahmat, Nurhazlini; Min, Lau Sing; Sungif, Nur Atiqah Md.; Yusup, Farah Nabillah Mior
2015-01-01
In the Malaysian education system, English has always played an important role. In acknowledging its importance, Malaysian University English Test (MUET) has been introduced to enable continued emphasis on this role. MUET has been made compulsory for those who wish to pursue a first degree programme in local universities. This study aims to…
Perceived sources of stress among Malaysian dental students
Hasan, Syed S.; Ooi, Yong J.; Ahmed, Syed I.; Wong, Pei S.; Ahmad, Siti F.; MNM-Rosdy, Nik M.; Malik, Normaliza A.
2015-01-01
Objectives The study objectives were to identify the stress levels and to explore the impact of students' year of study and gender on the perceived sources of stress among Malaysian dental students. Methods This was a cross-sectional study involving dental students from year one to year five from private and public universities in Malaysia. The study was formally approved by the Research and Ethics Committee, International Medical University Malaysia. Dental Environment Stress (DES) questionnaire was used for data collection and the gathered data were analyzed using SPSS® version 18. The Kruskal-Wallis and the Mann-Whitney U tests were used to compare stress items across various academic years and universities. Results A total of five hundred and twenty nine (529) students participated in this study. Fear of failing the course at the end of year exams (mean stress level=5.57); concerns regarding completion of clinical work (mean=5.30); and examination results and grades (mean=5.27) were found as top stressors among dental students. Female students had higher stress scores than males with respect to personal issues, academic performance, educational environment and learning of clinical skills. Students from public universities had higher stress scores than their counterparts from private universities. Conclusion The Malaysian dental students reported higher levels of stress. Present study identified stressors affecting dental students' academic life, and highlights the importance of stress management programs and other measures to minimize the impact of stress on both academic and personal lives of the students. PMID:25935506
Fitness level and body composition indices: cross-sectional study among Malaysian adolescent
2014-01-01
Background The importance of fitness level on the well-being of children and adolescent has long been recognised. The aim of this study was to investigate the fitness level of school-going Malaysian adolescent, and its association with body composition indices. Methods 1071 healthy secondary school students participated in the fitness assessment for the Malaysian Health and Adolescents Longitudinal Research Team (MyHEART) study. Body composition indices such as body mass index for age, waist circumference and waist height ratio were measured. Fitness level was assessed with Modified Harvard Step Test. Physical Fitness Score was calculated using total time of step test exercise and resting heart rates. Fitness levels were divided into 3 categories - unacceptable, marginally acceptable, and acceptable. Partial correlation analysis was used to determine the association between fitness score and body composition, by controlling age, gender, locality, ethnicity, smoking status and sexual maturation. Multiple regression analysis was conducted to determine which body composition was the strongest predictor for fitness. Results 43.3% of the participants were categorised into the unacceptable fitness group, 47.1% were considered marginally acceptable, and 9.6% were acceptable. There was a significant moderate inverse association (p < 0.001) between body composition with fitness score (r = -0.360, -0.413 and -0.403 for body mass index for age, waist circumference and waist height ratio, respectively). Waist circumference was the strongest and significant predictor for fitness (ß = -0.318, p = 0.002). Conclusion Only 9.6% of the students were fit. There was also an inverse association between body composition and fitness score among apparently healthy adolescents, with waist circumference indicated as the strongest predictor. The low fitness level among the Malaysian adolescent should necessitate the value of healthy lifestyle starting at a young age. PMID:25436933
Fitness level and body composition indices: cross-sectional study among Malaysian adolescent.
Hanifah, Redzal Abu; Majid, Hazreen Abdul; Jalaludin, Muhammad Yazid; Al-Sadat, Nabilla; Murray, Liam J; Cantwell, Marie; Su, Tin Tin; Nahar, Azmi Mohamed
2014-01-01
The importance of fitness level on the well-being of children and adolescent has long been recognised. The aim of this study was to investigate the fitness level of school-going Malaysian adolescent, and its association with body composition indices. 1071 healthy secondary school students participated in the fitness assessment for the Malaysian Health and Adolescents Longitudinal Research Team (MyHEART) study. Body composition indices such as body mass index for age, waist circumference and waist height ratio were measured. Fitness level was assessed with Modified Harvard Step Test. Physical Fitness Score was calculated using total time of step test exercise and resting heart rates. Fitness levels were divided into 3 categories - unacceptable, marginally acceptable, and acceptable. Partial correlation analysis was used to determine the association between fitness score and body composition, by controlling age, gender, locality, ethnicity, smoking status and sexual maturation. Multiple regression analysis was conducted to determine which body composition was the strongest predictor for fitness. 43.3% of the participants were categorised into the unacceptable fitness group, 47.1% were considered marginally acceptable, and 9.6% were acceptable. There was a significant moderate inverse association (p < 0.001) between body composition with fitness score (r = -0.360, -0.413 and -0.403 for body mass index for age, waist circumference and waist height ratio, respectively). Waist circumference was the strongest and significant predictor for fitness (ß = -0.318, p = 0.002). Only 9.6% of the students were fit. There was also an inverse association between body composition and fitness score among apparently healthy adolescents, with waist circumference indicated as the strongest predictor. The low fitness level among the Malaysian adolescent should necessitate the value of healthy lifestyle starting at a young age.
The burden of hypoxic-ischaemic encephalopathy in Malaysian neonatal intensive care units.
Boo, Nem-Yun; Cheah, Irene Guat-Sim
2016-08-01
This study aimed to determine the incidence of hypoxic-ischaemic encephalopathy (HIE) and predictors of HIE mortality in Malaysian neonatal intensive care units (NICUs). This was a retrospective study of data from 37 NICUs in the Malaysian National Neonatal Registry in 2012. All newborns with gestational age ≥ 36 weeks, without major congenital malformations and fulfilling the criteria of HIE were included. There were 285,454 live births in these hospitals. HIE was reported in 919 newborns and 768 of them were inborn, with a HIE incidence of 2.59 per 1,000 live births/hospital (95% confidence interval [CI] 2.03, 3.14). A total of 144 (15.7%) affected newborns died. Logistic regression analysis showed that the significant predictors of death were: chest compression at birth (adjusted odds ratio [OR] 2.27, 95% CI 1.27, 4.05; p = 0.003), being outborn (adjusted OR 2.65, 95% CI 1.36, 5.13; p = 0.004), meconium aspiration syndrome (MAS) (adjusted OR 2.16, 95% CI 1.05, 4.47; p = 0.038), persistent pulmonary hypertension of the newborn (PPHN) (adjusted OR 4.39, 95% CI 1.85, 10.43; p = 0.001), sepsis (adjusted OR 4.46, 95% CI 1.38, 14.40; p = 0.013), pneumothorax (adjusted OR 4.77, 95% CI 1.76, 12.95; p = 0.002) and severe HIE (adjusted OR 42.41, 95% CI 18.55, 96.96; p < 0.0001). The incidence of HIE in Malaysian NICUs was similar to that reported in developed countries. Affected newborns with severe grade of HIE, chest compression at birth, MAS, PPHN, sepsis or pneumothorax, and those who were outborn were more likely to die before discharge. Copyright: © Singapore Medical Association.
The burden of hypoxic-ischaemic encephalopathy in Malaysian neonatal intensive care units
Boo, Nem-Yun; Cheah, Irene Guat-Sim
2016-01-01
INTRODUCTION This study aimed to determine the incidence of hypoxic-ischaemic encephalopathy (HIE) and predictors of HIE mortality in Malaysian neonatal intensive care units (NICUs). METHODS This was a retrospective study of data from 37 NICUs in the Malaysian National Neonatal Registry in 2012. All newborns with gestational age ≥ 36 weeks, without major congenital malformations and fulfilling the criteria of HIE were included. RESULTS There were 285,454 live births in these hospitals. HIE was reported in 919 newborns and 768 of them were inborn, with a HIE incidence of 2.59 per 1,000 live births/hospital (95% confidence interval [CI] 2.03, 3.14). A total of 144 (15.7%) affected newborns died. Logistic regression analysis showed that the significant predictors of death were: chest compression at birth (adjusted odds ratio [OR] 2.27, 95% CI 1.27, 4.05; p = 0.003), being outborn (adjusted OR 2.65, 95% CI 1.36, 5.13; p = 0.004), meconium aspiration syndrome (MAS) (adjusted OR 2.16, 95% CI 1.05, 4.47; p = 0.038), persistent pulmonary hypertension of the newborn (PPHN) (adjusted OR 4.39, 95% CI 1.85, 10.43; p = 0.001), sepsis (adjusted OR 4.46, 95% CI 1.38, 14.40; p = 0.013), pneumothorax (adjusted OR 4.77, 95% CI 1.76, 12.95; p = 0.002) and severe HIE (adjusted OR 42.41, 95% CI 18.55, 96.96; p < 0.0001). CONCLUSION The incidence of HIE in Malaysian NICUs was similar to that reported in developed countries. Affected newborns with severe grade of HIE, chest compression at birth, MAS, PPHN, sepsis or pneumothorax, and those who were outborn were more likely to die before discharge. PMID:27549510
Barbour, Abdelahhad; Philip, Koshy
2014-01-01
Salivaricins are bacteriocins produced by Streptococcus salivarius, some strains of which can have significant probiotic effects. S. salivarius strains were isolated from Malaysian subjects showing variable antimicrobial activity, metabolic profile, antibiotic susceptibility and lantibiotic production. In this study we report new S. salivarius strains isolated from Malaysian subjects with potential as probiotics. Safety assessment of these strains included their antibiotic susceptibility and metabolic profiles. Genome sequencing using Illumina's MiSeq system was performed for both strains NU10 and YU10 and demonstrating the absence of any known streptococcal virulence determinants indicating that these strains are safe for subsequent use as probiotics. Strain NU10 was found to harbour genes encoding salivaricins A and 9 while strain YU10 was shown to harbour genes encoding salivaricins A3, G32, streptin and slnA1 lantibiotic-like protein. Strain GT2 was shown to harbour genes encoding a large non-lantibiotic bacteriocin (salivaricin-MPS). A new medium for maximum biomass production buffered with 2-(N-morpholino)ethanesulfonic acid (MES) was developed and showed better biomass accumulation compared with other commercial media. Furthermore, we extracted and purified salivaricin 9 (by strain NU10) and salivaricin G32 (by strain YU10) from S. salivarius cells grown aerobically in this medium. In addition to bacteriocin production, S. salivarius strains produced levan-sucrase which was detected by a specific ESI-LC-MS/MS method which indicates additional health benefits from the developed strains. The current study established the bacteriocin, levan-sucrase production and basic safety features of S. salivarius strains isolated from healthy Malaysian subjects demonstrating their potential for use as probiotics. A new bacteriocin-production medium was developed with potential scale up application for pharmaceuticals and probiotics from S. salivarius generating different
Plasma isoflavones in Malaysian men according to vegetarianism and by age.
Hod, Rafidah; Kouidhi, Wided; Ali Mohd, Mustafa; Husain, Ruby
2016-01-01
Epidemiological studies indicate lower prevalences of breast and prostate cancers and cardiovascular disease in Southeast Asia where vegetarianism is popular and diets are traditionally high in phytoestrogens. This study assessed plasma isoflavones in vegetarian and non-vegetarian Malaysian men according to age. Daidzein, genistein, equol (a daidzein metabolite), formononetin, biochanin A, estrone, estradiol and testosterone were measured by validated liquid chromatography tandem mass spectrometry (LCMSMS). Plasma isoflavone and sex hormone concentrations were measured in 225 subjects according to age (18-34, 35-44 and 45-67 years old). In all age groups, vegetarians had a higher concentration of circulating isoflavones compared with non-vegetarians especially in the 45-67 year age group where all isoflavones except equol, were significantly higher in vegetarians compared with omnivores. By contrast, the 18-34 year group had a significantly higher concentration of daidzein in vegetarians and significantly higher testosterone and estrone concentrations compared with non-vegetarians. In this age group there were weak correlations between estrone, estradiol and testosterone with some of the isoflavones. This human study provides the first Malaysian data for the phytoestrogen status of vegetarian and nonvegetarian men.
The Approaches to Teaching Inventory: A Preliminary Validation of the Malaysian Translation
ERIC Educational Resources Information Center
Goh, Pauline Swee Choo; Wong, Kung Teck; Hamzah, Mohd Sahandri Gani
2014-01-01
The purpose of this study was to evaluate a Malaysian translation of the 22-item Approaches to Teaching Inventory for application in higher education. The Approaches to Teaching Inventory was a quantitative measure used by teachers of higher education to gauge their own teaching approaches that had been psychometrically assessed and widely used in…
School-Based Assessment in Malaysian Schools: The Concerns of the English Teachers
ERIC Educational Resources Information Center
Majid, Faizah A.
2011-01-01
The Malaysian government has proposed to implement SBA (school-based assessment) in public schools with an attempt to replace the current public examinations. However, as SBA has yet to be in full swing, relatively little is known about the concerns of the teachers who would directly be involved in implementing SBA. This paper presents the…
Language Choice and Language Policies in Filipino-Malaysian Families in Multilingual Malaysia
ERIC Educational Resources Information Center
Dumanig, Francisco Perlas; David, Maya Khemlani; Shanmuganathan, Thilagavathi
2013-01-01
Personal, social, cultural, economic, and political factors influence the language/s used by family members in the home domain. This study examines how family language policies are planned and developed in Filipino-Malaysian families in Malaysia. The language used at home in such mixed or exogamous marriages is also influenced by the ethnicity of…
ERIC Educational Resources Information Center
Leong, Kwan Eu; Meng, Chew Cheng; Rahim, Suzieleez Syrene Abdul
2015-01-01
This article seeks to present findings from the analysis of the TEDS-M reports on the mathematical content knowledge (MCK) and pedagogical content knowledge (PCK) of the pre-service teachers in Malaysia. The main objective of this study was to investigate the level of teaching knowledge attained by the Malaysian pre-service primary and secondary…
The impact of the Malaysian minimum cigarette price law: findings from the ITC Malaysia Survey.
Liber, Alex C; Ross, Hana; Omar, Maizurah; Chaloupka, Frank J
2015-07-01
Study the effects of the 2011 Malaysian minimum price law (MPL) on prices of licit and illicit cigarette brands. Identify barriers to the MPL achieving positive public health effects. The International Tobacco Control Project's Southeast Asia survey collected information on Malaysian smokers' cigarette purchases (n=7520) in five survey waves between 2005 and 2012. Consumption-weighted comparisons of proportions tests and adjusted Wald tests were used to evaluate changes over time in violation rates of the inflation-adjusted MPL, the proportion of illicit cigarette purchases and mean prices. After the passage of the MPL, the proportion of licit brand cigarette purchases that were below the inflation-adjusted 2011 minimum price level fell substantially (before 3.9%, after 1.8%, p=0.002), while violation of the MPL for illicit brand cigarette purchases was unchanged (before 89.8%, after 91.9%, p=0.496). At the same time, the mean real price of licit cigarettes rose (p=0.006), while the mean real price of illicit cigarettes remained unchanged (p=0.134). The proportion of illicit cigarette purchases rose as well (before 13.4%, after 16.5%, p=0.041). The MPL appears not to have meaningfully changed cigarette prices in Malaysia, as licit brand prices remained well above and illicit brand prices remained well below the minimum price level before and after MPL's implementation. The increasing proportion of illicit cigarettes on the market may have undermined any positive health effects of the Malaysian MPL. The illicit cigarette trade must be addressed before a full evaluation of the Malaysian MPL's impact on public health can take place. The authors encourage the continued use of specific excise tax increases to reliably increase the price and decrease the consumption of cigarettes in Malaysia and elsewhere. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
NASA Astrophysics Data System (ADS)
Breitfeld, H. Tim; Hall, Robert; Galin, Thomson; BouDagher-Fadel, Marcelle K.
2018-07-01
The Kuching Zone in West Sarawak consists of two different sedimentary basins, the Kayan and Ketungau Basins. The sedimentary successions in the basins are part of the Kuching Supergroup that extends into Kalimantan. The uppermost Cretaceous (Maastrichtian) to Lower Eocene Kayan Group forms the sedimentary deposits directly above a major unconformity, the Pedawan Unconformity, which marks the cessation of subduction-related magmatism beneath SW Borneo and the Schwaner Mountains, due to termination of the Paleo-Pacific subduction. The successions consist of the Kayan and Penrissen Sandstones and are dominated by fluvial channels, alluvial fans and floodplain deposits with some deltaic to tidally-influenced sections in the Kayan Sandstone. In the late Early or early Middle Eocene, sedimentation in this basin ceased and a new basin, the Ketungau Basin, developed to the east. This change is marked by the Kayan Unconformity. Sedimentation resumed in the Middle Eocene (Lutetian) with the marginal marine, tidal to deltaic Ngili Sandstone and Silantek Formation. Upsequence, the Silantek Formation is dominated by floodplain and subsidiary fluvial deposits. The Bako-Mintu Sandstone, a potential lateral equivalent of the Silantek Formation, is formed of major fluvial channels. The top of the Ketungau Group in West Sarawak is formed by the fluvially-dominated Tutoop Sandstone. This shows a transition of the Ketungau Group in time towards terrestrial/fluvially-dominated deposits. Paleocurrent measurements show river systems were complex, but reveal a dominant southern source. This suggests uplift of southern Borneo initiated in the region of the present-day Schwaner Mountains from the latest Cretaceous onwards. Additional sources were local sources in the West Borneo province, Mesozoic melanges to the east and potentially the Malay Peninsula. The Ketungau Group also includes reworked deposits of the Kayan Group. The sediments of the Kuching Supergroup are predominantly
Gomez, Rapson
2009-03-01
This study used the mean and covariance structures analysis approach to examine the equality or invariance of ratings of the 18 ADHD symptoms. 783 Australian and 928 Malaysian parents provided ratings for an ADHD rating scale. Invariance was tested across these groups (Comparison 1), and North European Australian (n = 623) and Malay Malaysian (n = 571, Comparison 2) groups. Results indicate support for form and item factor loading invariance; more than half the total number of symptoms showed item intercept invariance, and 14 symptoms showed invariance for error variances. There was invariance for both the factor variances and the covariance, and the latent mean scores for hyperactivity/impulsivity. For inattention latent scores, the Malaysian (Comparison 1) and Malay Malaysian (Comparison 2) groups had higher scores. These results indicate fairly good support for invariance for parent ratings of the ADHD symptoms across the groups compared.
Health care reform and changes: the Malaysian experience.
Merican, Mohd Ismail; bin Yon, Rohaizat
2002-01-01
Health care reform is an intentional, sustained and systematic process of structural change to one or more health subsystems to improve efficiency, effectiveness, patient choices and equity. Health care all over the world is continuously reforming with time. Health care reform has become an increasingly important agenda for policy change in both developed and developing countries including Malaysia. This paper provides an overview of the Malaysian health care system, its achievements, and issues and challenges leading to ongoing reform towards a more efficient and equitable health care system that possess a better quality of life for the population.
Rajoo, Yamuna; Ambu, Stephen; Lim, Yvonne Ai Lian; Rajoo, Komalaveni; Tey, Siew Chang; Lu, Chan Woon; Ngui, Romano
2017-01-01
Intestinal parasitic infections (IPIs) have been recognized as one of the most significant causes of illness among disadvantaged communities. Many studies have been conducted on the prevalence of IPIs in Malaysia. However, these studies mostly focused on the indigenous groups in Peninsular Malaysia. The present study was conducted to provide the current baseline data on prevalence of IPIs, anaemia, malnutrition and associated risk factors among the indigenous communities in Sarawak, situation at northwest Borneo island of Malaysia. A cross sectional study was conducted among the longhouses communities. Stool samples were obtained and examined for the presence of IPIs using microscopy technique. Haemoglobin measurement was done using a portable haemoglobin analyzer. Malnutrition (i.e., stunting, underweight and wasting) was assessed using the WHO Anthro software. Statistical analysis was carried out using SPSS software. A total of 341participants took part in this study. The overall prevalence of IPIs was 57.5%. Multivariate analysis indicated that the absence of toilets (OR = 1.6; 95% CI = 1.1-2.7; p = 0.002) and close contact with animals (OR = 1.8; 95% CI = 1.3-2.9; p = 0.027) as significant predictors for IPIs. The incidence of anaemia was 36.4%. The incidence of underweight, wasting and stunting were 22.2%, 5.6% and 35.4%, respectively. Multivariate analysis demonstrated that low level of parental education attainment (OR = 1.9; 95% CI = 1.2-3.0; p = 0.006) was identified as significant predictor for anaemia. The incidence of wasting was significantly associated with mild anaemia (OR = 1.2; 95% CI = 0.9-1.7; p = 0.024). Low household income was identified as significant predictor for stunting (OR = 2.1; 95% CI = 9.8-22.2; p = 0.001) and underweight (OR = 1.9; 95% CI = 5.6-18.7; p = 0.037), respectively. Essentially, the present study highlighted that intestinal parasitic infections, anaemia and malnutrition are still prevalent among rural indigenous community
Rajoo, Yamuna; Ambu, Stephen; Lim, Yvonne Ai Lian; Rajoo, Komalaveni; Tey, Siew Chang; Lu, Chan Woon; Ngui, Romano
2017-01-01
Intestinal parasitic infections (IPIs) have been recognized as one of the most significant causes of illness among disadvantaged communities. Many studies have been conducted on the prevalence of IPIs in Malaysia. However, these studies mostly focused on the indigenous groups in Peninsular Malaysia. The present study was conducted to provide the current baseline data on prevalence of IPIs, anaemia, malnutrition and associated risk factors among the indigenous communities in Sarawak, situation at northwest Borneo island of Malaysia. A cross sectional study was conducted among the longhouses communities. Stool samples were obtained and examined for the presence of IPIs using microscopy technique. Haemoglobin measurement was done using a portable haemoglobin analyzer. Malnutrition (i.e., stunting, underweight and wasting) was assessed using the WHO Anthro software. Statistical analysis was carried out using SPSS software. A total of 341participants took part in this study. The overall prevalence of IPIs was 57.5%. Multivariate analysis indicated that the absence of toilets (OR = 1.6; 95% CI = 1.1–2.7; p = 0.002) and close contact with animals (OR = 1.8; 95% CI = 1.3–2.9; p = 0.027) as significant predictors for IPIs. The incidence of anaemia was 36.4%. The incidence of underweight, wasting and stunting were 22.2%, 5.6% and 35.4%, respectively. Multivariate analysis demonstrated that low level of parental education attainment (OR = 1.9; 95% CI = 1.2–3.0; p = 0.006) was identified as significant predictor for anaemia. The incidence of wasting was significantly associated with mild anaemia (OR = 1.2; 95% CI = 0.9–1.7; p = 0.024). Low household income was identified as significant predictor for stunting (OR = 2.1; 95% CI = 9.8–22.2; p = 0.001) and underweight (OR = 1.9; 95% CI = 5.6–18.7; p = 0.037), respectively. Essentially, the present study highlighted that intestinal parasitic infections, anaemia and malnutrition are still prevalent among rural indigenous
Procrastination and the 2 x 2 Achievement Goal Framework in Malaysian Undergraduate Students
ERIC Educational Resources Information Center
Ganesan, Rajalakshmi; Mamat, Norul Hidayah Bt; Mellor, David; Rizzuto, Laura; Kolar, Christina
2014-01-01
The present study investigated academic procrastination in the context of the 2 x 2 goal achievement theoretical framework within a population of 450 Malaysian undergraduate students, aged 18 to 25 years. Participants completed the Achievement Goal Questionnaire and the Tuckman Procrastination Test. Approach dimensions of both the mastery and…
Academic Promotion in Malaysian Public Universities: A Critical Look at Issues and Challenges
ERIC Educational Resources Information Center
Azman, Norzaini; Che Omar, Ibrahim; Yunus, Aida Suraya Md; Zain, Ahmad Nurulazam Md
2016-01-01
The expansion and transformation of Malaysian universities have generated major changes in the nature of academic employment and the structure of academic promotion in higher education institutions. These changes have considerable implications, in particular for the policy and practice of academic promotion in the public universities. We argue…
Malaysian Secondary School Students' Knowledge and Interest in Biotechnology: A Case Study
ERIC Educational Resources Information Center
Gelamdin, Rashidah Begum; Daniel, Esther Gnanamalar Sarojini
2016-01-01
This paper investigates the level of knowledge and interest in biotechnology education of Malaysian secondary school students. The research was based on a questionnaire adapted from the instruments developed by Prokop et al. and Kidman. Six schools in the Klang Valley were involved in the research and with participation by a total of 427 Grade 11…
Validation of an ESL Writing Test in a Malaysian Secondary School Context
ERIC Educational Resources Information Center
Zainal, Azlin
2012-01-01
The present study was conducted with a twofold purpose. First, I aim to apply the socio-cognitive framework by Shaw and Weir (2007) in order to validate a summative writing test used in a Malaysian ESL secondary school context. Secondly, by applying the framework I also aim to illustrate practical ways in which teachers can gather validity…
Organ donation among Malaysian Muslims: the role of mosques.
Tumin, Makmor; Raja Ariffin, Raja Noriza; Mohd Satar, NurulHuda; Abdullah, Nawi; Wan Md Adnan, Wan Ahmad Hafiz; Ismail, Ahmad Zuhdi; Che Soh, Mazlan
2015-04-13
Malaysia, a country of Muslim majority, is suffering from a severe organ shortage due to the lack of donors. Mosques are the main gateways into the Muslim community. Hence, it is imperative to explore their role in facilitating organ donation. A self-administered survey was conducted between October and December 2013. We distributed 700 pilot-tested questionnaires to 82 mosques in Kuala Lumpur and its suburbs. The respondents were stratified into 2 groups: the mosque committees and the Muslim Jama'ah (individuals who come regularly to mosque for prayer). Data collected from a survey on 653 Malaysian Muslims reveals that the main factors that hamper organ donation-related activities at the mosques in Malaysia are the lack of experts and financial resources. The level of autonomy of the mosque is also another main issue. The respondents believe that talks and dialogues are the best methods for organ donation campaigns at the mosques. Conclusions We argue that if the mosques are to play a role in imparting knowledge on organ donation, there should be ample opportunity for the mosque committee to choose the content of religious talks held in their community. The mosques in Malaysia are not sufficiently facilitated to channel the information on organ donation to the Muslim community. Providing financial support and expert campaigners are expected to increase organ donation-related activities at the mosques and subsequently could increase awareness regarding organ donations among Malaysian Muslims.
Lewison, Grant; Kumar, Sameer; Wong, Chan-Yuan; Roe, Philip; Webber, Richard
Malaysia has three main ethnic communities: Chinese, Indians and Malays. At independence in 1957, the Chinese dominated commercial life, and this led to ethnic tensions and finally riots. As a result in 1969 Malaysia introduced a "New Economic Policy" (NEP) to promote Malays in all areas of activity, and in particular to assist them to obtain basic and higher education. We examined the scientific outputs from Malaysia between 1982 and 2014 and classified the names of Malaysian researchers into one of these three groups and two others. There was a major increase in Malay participation in research, which has risen from 20 % of researchers in 1982-1984 to 65 % in 2012-2014, with corresponding declines in the percentages of Chinese and Indian authors, although their absolute numbers have increased because Malaysian scientific output has increased so rapidly in the last 10 years. The huge increase in Malay researchers contrasts with their presence in the Malaysian population which has remained stable at about 50 % since 1969.
Yap, Roseline Wai Kuan; Shidoji, Yoshihiro; Hon, Wei Min; Masaki, Motofumi
2012-01-01
Dietary pattern and genetic predisposition of each population have different impacts on lifestyle-related chronic diseases. This study was conducted to evaluate the association and interaction between dietary patterns and VEGFR2 or KDR gene polymorphisms on physical and biochemical risk factors of cardiovascular disease in two Asian populations (179 Chinese Malaysian and 136 Japanese adults). Dietary patterns were constructed from food frequency questionnaire using factor analysis. Genotyping of rs1870377 and rs2071559 was performed by real-time PCR using TaqMan probes. Physical measurements: body mass index, systolic and diastolic blood pressures and biochemical parameters: glycated hemoglobin A1c and blood lipids (total cholesterol, triglycerides, LDL-cholesterol, HDL-cholesterol and total cholesterol/HDL-C ratio) were measured. Two dietary patterns were extracted for: Japanese ('Japanese diet' and 'Western diet') and Chinese Malaysians ('Balanced diet'; and 'Meat, rice and noodles diet'). In Japanese, 'Western Diet' and rs2071559 were associated with LDL-C and HDL-C, respectively. In Chinese Malaysians, 'Meat, rice and noodles diet' was asso-ciated with triglycerides, HDL-C and total cholesterol/HDL ratio while rs1870377 and rs2071559 were associated with total cholesterol and/or LDL-C. The interaction between 'Western Diet' and rs2071559 in Japanese and 'Meat, rice and noodles diet' and rs1870377 in Malaysians had significant effects on blood lipids after adjusting for confounders. The association and interaction of dietary patterns and VEGFR2 gene polymorphisms on blood lipids differ between Chinese Malaysian and Japanese subjects by either decreasing or increasing the risk of cardiovascular disease.
Yong, Hua-Hie; Savvas, Steven; Borland, Ron; Thrasher, James; Sirirassamee, Buppha; Omar, Maizurah
2012-01-01
Purpose This paper prospectively examined two kinds of social normative beliefs about smoking, secular versus religious norms, to determine their relative importance in influencing quitting behaviour among Muslim Malaysian and Buddhist Thai smokers. Methods Data come from 2166 Muslim Malaysian and 2463 Buddhist Thai adult smokers who participated in the first three waves of the International Tobacco Control Southeast Asia project. Respondents were followed up about 18 months later with replenishment. Respondents were asked at baseline about whether their society disapproved of smoking and whether their religion discouraged smoking and those recontacted at follow-up were asked about their quitting activity. Results Majority of both religious groups perceived that their religion discouraged smoking (78% Muslim Malaysians and 86% Buddhist Thais) but considerably more Buddhist Thais than Muslim Malaysians perceived that their society disapproved of smoking (80% versus 25%). Among Muslim Malaysians, religious, but not societal, norms had an independent effect on quit attempts. By contrast, among the Buddhist Thais, while both normative beliefs had an independent positive effect on quit attempts, the effect was greater for societal norms. The two kinds of normative beliefs, however, were unrelated to quit success among those who tried. Conclusions The findings suggest that religious norms about smoking may play a greater role than secular norms in driving behaviour change in an environment like Malaysia where tobacco control has been relatively weak until more recently but in the context of a strong tobacco control environment like Thailand, secular norms about smoking becomes the dominant force. PMID:22302214
ERIC Educational Resources Information Center
Mohammadipour, Mohammad; Rashid, Sabariah Md; Rafik-Galea, Shameem; Thai, Yap Ngee
2018-01-01
Emotions are an indispensable part of second language learning. The aim of this study is to determine the relationship between the use of language learning strategies and positive emotions. The present study adopted a sequential mixed methods design. The participants were 300 Malaysian ESL undergraduates selected through stratified random sampling…
Perceptions of International Students on Service Quality Delivery in a Malaysian Public University
ERIC Educational Resources Information Center
Njie, Baboucarr; Asimiran, Soaib; Baki, Roselan
2012-01-01
Purpose: The purpose of this study is to explore the perceptions of international students of service quality delivery (SQD) in a Malaysian public university. Design/methodology/approach: The study was limited to the University's immediate physical environment and its associated human and systems-based services. The physical environment in this…
ERIC Educational Resources Information Center
Jan, Muhammad Tahir; Ammari, Djihane
2016-01-01
This paper mainly aims to identify the impact of online advertising on students' decision-making and their choice of higher education institutions. Data for this study were collected from 350 students from various Malaysian universities using self-administered questionnaires. The acquired data went through an exhaustive process to ensure that it…
Teachers' Perceptions of the Standard-Based English Language Curriculum in Malaysian Primary Schools
ERIC Educational Resources Information Center
Sulaiman, Suriati; Sulaiman, Tajularipin; Rahim, Suzieleez Syrene Abdul
2017-01-01
Standard-based English language curriculum (SBELC) was fairly a new curriculum in Malaysian primary schools. The implementation of SBELC is a phenomenon affecting all teachers and pupils in primary education. Since curriculum implementation occurs mostly in the classroom and teachers are the key players in the implementation process, the initial…
Knowledge Management in Malaysian School Education: Do the Smart Schools Do It Better?
ERIC Educational Resources Information Center
Awang, Marinah; Ismail, Ramlee; Flett, Peter; Curry, Adrienne
2011-01-01
Purpose: The purpose of this paper is to shed light on changes in the Malaysian education system, with particular reference to the development of Smart Schools, and to evaluate progress with respect to knowledge management in school education. Design/methodology/approach: The research is designed around questionnaires based on a knowledge…
ERIC Educational Resources Information Center
Ghasemy, Majid; Hussin, Sufean Bin; Megat Daud, Megat Ahmad Kamaluddin Bin; Abdul Razak, Ahmad Zabidi Bin; Maah, Mohd Jamil Bin
2017-01-01
This study was undertaken to determine the extent to which leadership capabilities and managerial competencies explain leadership performance in Malaysian Higher Education context. Data were collected from academic leaders in 25 public and private universities and colleges using a few previously developed scales in Malaysian context. Next, the…
Romli, Muhammad Hibatullah; Mackenzie, Lynette; Lovarini, Meryl; Tan, Maw Pin
2016-01-01
Objective The relationship between home hazards and falls in older Malaysian people is not yet fully understood. No tools to evaluate the Malaysian home environment currently exist. Therefore, this study aimed to pilot the Home Falls and Accidents Screening Tool (HOME FAST) to identify hazards in Malaysian homes, to evaluate the feasibility of using the HOME FAST in the Malaysian Elders Longitudinal Research (MELoR) study and to gather preliminary data about the experience of falls among a small sample of Malaysian older people. Design A cross-sectional pilot study was conducted. Setting An urban setting in Kuala Lumpur. Participants 26 older people aged 60 and over were recruited from the control group of a related research project in Malaysia, in addition to older people known to the researchers. Primary outcome measure The HOME FAST was applied with the baseline survey for the MELoR study via a face-to-face interview and observation of the home by research staff. Results The majority of the participants were female, of Malay or Chinese ethnicity and living with others in a double-storeyed house. Falls were reported in the previous year by 19% and 80% of falls occurred at home. Gender and fear of falling had the strongest associations with home hazards. Most hazards were detected in the bathroom area. A small number of errors were detected in the HOME FAST ratings by researchers. Conclusions The HOME FAST is feasible as a research and clinical tool for the Malaysian context and is appropriate for use in the MELoR study. Home hazards were prevalent in the homes of older people and further research with the larger MELoR sample is needed to confirm the validity of using the HOME FAST in Malaysia. Training in the use of the HOME FAST is needed to ensure accurate use by researchers. PMID:27531736
ERIC Educational Resources Information Center
Musah, Mohammed Borhandden; Ali, Hairuddin Mohd; al-Hudawi, Shafeeq Hussain Vazhathodi; Tahir, Lokman Mohd; Binti Daud, Khadijah; Bin Said, Hamdan; Kamil, Naail Mohammed
2016-01-01
Purpose: This study aims to investigate whether organisational climate (OC) predicts academic staff performance at Malaysian higher education institutions (HEIs). The study equally aims at validating the psychometric properties of OC and workforce performance (WFP) constructs. Design/methodology/approach: Survey questionnaires were administered to…
Zalilah, M S; Mirnalini, K; Safiah, M Y; Tahir, A; Siti Haslinda, M D; Siti Rohana, D; Khairul Zarina, M Y; Hasyami, S Mohd; Normah, H; Fatimah, A Siti
2008-03-01
Meal and snack patterns are associated with energy and nutrient intakes and consequently health and nutritional status. The aim of this paper is to describe the percentage of daily energy intake from meals and afternoon snack among Malaysian adults. The study included a representative sample of adults aged 18-59 years (n=7349) from a nationwide Food Consumption Survey conducted by the Ministry of Health. Information on dietary intake was obtained using a one day 24-hour diet recall (24-HDR). Dietary data on 6886 adults were analysed using Nutritionist ProTM and statistical analysis was carried out using the SPSS 13.0. The median percentage of daily energy intake is reported only for adults consuming meals and afternoon tea and by socio-demographic characteristics as well as body mass index (BMI) status. More than 80% of Malaysian adults consumed morning meals, lunch and dinner and 54% reported having afternoon tea. The median percentage of energy intake from morning meals, lunch, dinner and afternoon tea was 29.9%, 30.5%, 32.4% and 17%, respectively. There were variations in the median percentage of energy from meals and snacks according to the socio-demographic variables and BMI status. It is important to understand the eating patterns of Malaysians as the information can assist in efforts to address obesity and diet-related chronic diseases among adults.
Vitamin D status in Malaysian men and its associated factors.
Chin, Kok-Yong; Ima-Nirwana, Soelaiman; Ibrahim, Suraya; Mohamed, Isa Naina; Wan Ngah, Wan Zurinah
2014-11-26
Vitamin D insufficiency is a global health problem. The data on vitamin D status in Malaysian men is insufficient. This study aimed to investigate vitamin D status among Chinese and Malay men in Malaysia and its associating factors. A cross-sectional study was conducted on 383 men aged 20 years and above, residing in Klang Valley, Malaysia. Their age, ethnicity, body anthropometry and calcaneal speed of sound (SOS) were recorded. Their fasting blood was collected for serum 25-hydroxyvitamin D (25(OH)D), intact parathyroid (PTH), total calcium and inorganic phosphate assays. Vitamin D deficiency was defined as a serum 25(OH)D level <30 nmol/L and insufficiency as a serum 25(OH)D level between 30 and 50 nmol/L. The overall prevalence of vitamin D deficiency was 0.5%, and insufficiency was 22.7%. Vitamin D deficiency and insufficiency were more prevalent in the Malays compared to the Chinese. Being Chinese, older in age, having lower body mass index (BMI) and a high physical activity status were associated significantly with a higher serum 25(OH)D level (p < 0.05). The serum PTH level was inversely associated with the serum 25(OH)D level (p < 0.05). As a conclusion, a significant proportion of Malaysian men have vitamin D insufficiency, although deficiency is uncommon. Steps should be taken to correct the vitamin D status of these men.
Teaching Mathematics in Two Languages: A Teaching Dilemma of Malaysian Chinese Primary Schools
ERIC Educational Resources Information Center
Lim, Chap Sam; Presmeg, Norma
2011-01-01
This paper discusses a teaching dilemma faced by mathematics teachers in the Malaysian Chinese primary schools in coping with the latest changes in language policy. In 2003, Malaysia launched a new language policy of teaching mathematics using English as the language of instruction in all schools. However, due to the complex sociocultural demands…
Train-the-Trainers: Implementing Outcomes-Based Teaching and Learning in Malaysian Higher Education
ERIC Educational Resources Information Center
Biggs, John; Tang, Catherine
2011-01-01
The decision by the Minister of Higher Education, that Malaysian post-secondary institutions should move to outcomes-based teaching and learning (OBTL), involves a change in teaching in over 1,000 institutions. This massive changeover would be accomplished using the "Train-the-Trainers" model in a series of workshops. We are proud to…
A Malaysian Experience with Animal Disease
Little, P. B.
1979-01-01
The report summarizes a one year period of investigation of death losses in West Malaysian livestock. Lesions and etiological agents are mentioned for cattle, sheep, goats, swine, poultry and companion animals as well as some miscellaneous species. Special observations related to a common paramphistome induced hepatic biliary infestation in cattle, a serious malignant head catarrh outbreak in which possible cattle to cow aerosol transmission occurred. Trismus observed in some cattle with malignant head catarrh was associated with arteriolitis and ganglioneuritis of the V cranial nerve. Parasitic, bacterial, viral toxic and neoplastic diseases are recorded in the various species. The occurrence of fatal chronic fluorosis in laboratory guinea pigs and cerebral nematodiasis in a Thoroughbred racehorse are documented. ImagesFigure 1.FIGURE 2.FIGURE 3.FIGURE 4.FIGURE 5.FIGURE 6.FIGURE 7.FIGURE 8.FIGURE 9.FIGURE 10.FIGURE 11. PMID:761153
Characteristic of root decomposition in a tropical rainforest in Sarawak, Malaysi
NASA Astrophysics Data System (ADS)
Ohashi, Mizue; Makita, Naoki; Katayam, Ayumi; Kume, Tomonori; Matsumoto, Kazuho; Khoon Kho, L.
2016-04-01
Woody roots play a significant role in forest carbon cycling, as up to 60 percent of tree photosynthetic production can be allocated to belowground. Root decay is one of the main processes of soil C dynamics and potentially relates to soil C sequestration. However, much less attention has been paid for root litter decomposition compared to the studies of leaf litter because roots are hidden from view. Previous studies have revealed that physico-chemical quality of roots, climate, and soil organisms affect root decomposition significantly. However, patterns and mechanisms of root decomposition are still poorly understood because of the high variability of root properties, field environment and potential decomposers. For example, root size would be a factor controlling decomposition rates, but general understanding of the difference between coarse and fine root decompositions is still lacking. Also, it is known that root decomposition is performed by soil animals, fungi and bacteria, but their relative importance is poorly understood. In this study, therefore, we aimed to characterize the root decomposition in a tropical rainforest in Sarawak, Malaysia, and clarify the impact of soil living organisms and root sizes on root litter decomposition. We buried soil cores with fine and coarse root litter bags in soil in Lambir Hills National Park. Three different types of soil cores that are covered by 1.5 cm plastic mesh, root-impermeable sheet (50um) and fungi-impermeable sheet (1um) were prepared. The soil cores were buried in February 2013 and collected 4 times, 134 days, 226 days, 786 days and 1151 days after the installation. We found that nearly 80 percent of the coarse root litter was decomposed after two years, whereas only 60 percent of the fine root litter was decomposed. Our results also showed significantly different ratio of decomposition between different cores, suggesting the different contribution of soil living organisms to decomposition process.
Musa, Ahmad S
2016-03-01
This study reported the differences in factor structure of the Spiritual Well-Being Scale (SWBS) among Jordanian Arab and Malaysian Muslim participants and further examined its validity and reliability. A convenience sample of 553 Jordanian Arab and 183 Malaysian Malay Muslim university students was recruited from governmental universities in northern Jordan. The findings of this study revealed that this scale consists of two factors for the Jordanian Arab group, representing the "Religious Well-Being" and the "Existential Well-Being" subscales, and consists of three factors for the Malaysian group, representing the "Affiliation/Meaning and Purpose," "Positive Existential Well-Being/God Caring and Love," and "Alienation/Despair" subscales. In conclusion, the factor structure of the SWBS for both groups in this study was psychometrically sound with evidence of acceptable to good validity and reliability. Furthermore, this study supported the multidimensional nature of the SWBS and the earlier notion that ethnicity shapes responses to this scale. © The Author(s) 2014.
NASA Astrophysics Data System (ADS)
Tajudin, Nor'ain Mohd.; Saad, Noor Shah; Rahman, Nurulhuda Abd; Yahaya, Asmayati; Alimon, Hasimah; Dollah, Mohd. Uzi; Abd Karim, Mohd. Mustaman
2012-05-01
The objectives of this quantitative survey research were (1) to establish the level of scientific reasoning (SR) skills among science, mathematics and engineering (SME) undergraduates in Malaysian Institute of Higher Learning (IHL); (b) to identify the types of instructional methods in teaching SME at universities; and (c) to map instructional methods employed to the level of SR skills among the undergraduates. There were six universities according to zone involved in this study using the stratification random sampling technique. For each university, the faculties that involved were faculties which have degree students in science, mathematics and engineering programme. A total of 975 students were participated in this study. There were two instruments used in this study namely, the Lawson Scientific Reasoning Skills Test and the Lecturers' Teaching Style Survey. The descriptive statistics and the inferential statistics such as mean, t-test and Pearson correlation were used to analyze the data. Findings of the study showed that most students had concrete level of scientific reasoning skills where the overall mean was 3.23. The expert and delegator were dominant lecturers' teaching styles according to students' perception. In addition, there was no correlation between lecturers' teaching style and the level of scientific reasoning skills. Thus, this study cannot map the dominant lecturers' teaching style to the level of scientific reasoning skills of Science, Mathematics and Engineering undergraduates in Malaysian Public Institute of Higher Learning. Nevertheless, this study gave some indications that the expert and delegator teaching styles were not contributed to the development of students' scientific reasoning skills. This study can be used as a baseline for Science, Mathematics and Engineering undergraduates' level of scientific reasoning skills in Malaysian Public Institute of Higher Learning. Overall, this study also opens an endless source of other
ERIC Educational Resources Information Center
Leow, Fui Theng; Neo, Mai
2015-01-01
Today, ICT, web resources and multimedia contents have become prevalent in Malaysian university classrooms; hence, the learning approaches need to be redesigned for enabling students to use these technologies in co-constructing new meaning. This study analyses student's perception and their peer interaction in the constructivist-collaborative…
ERIC Educational Resources Information Center
Pandian, Ambigapathy; Baboo, Shanthi Balraj; Mahfoodh, Omer Hassan Ali
2016-01-01
In response to the emphasis on the benefits of enhanced multicultural educational experiences of international students in higher education, this study examined international students' perceptions of the influence of multiculturalism on the study programs in Malaysian public universities. Both quantitative and qualitative data were collected. The…