Science.gov

Sample records for kaup differential gene

  1. Molecular characterization and transcriptional regulation of the renin-angiotensin system genes in Senegalese sole (Solea senegalensis Kaup, 1858): differential gene regulation by salinity.

    PubMed

    Armesto, Paula; Cousin, Xavier; Salas-Leiton, Emilio; Asensio, Esther; Manchado, Manuel; Infante, Carlos

    2015-06-01

    In this work, the complete cDNA sequence encoding angiotensinogen (agt) in the euryhaline flatfish Senegalese sole was obtained. Additionally, putative coding sequences belonging to other renin-angiotensin system (RAS) genes including renin (ren), angiotensin-converting enzyme (ace), angiotensin-converting enzyme 2 (ace2), as well as angiotensin II receptor type I (agtr1) and type II (agtr2), were also identified. In juvenile tissues, agt transcripts were mainly detected in liver, ren in kidney, ace and ace2 in intestine, agtr1 in kidney and brain, and agtr2 in liver and kidney. Expression analysis of the six RAS genes after a salinity shift revealed a clear increase of agt mRNA abundance in liver just after transferring soles to high salinity water (60 ppt) with a peak at 48 h. Moreover, gene expression analysis in gills showed transcriptional regulation of ace and agtr1 at 48 h and agtr2 at 96 h after transferring soles to 60 ppt. Incubation of larvae before mouth opening (until 3 days post hatch; dph) at low salinity (10 ppt) resulted in a coordinated transcriptional up-regulation of RAS genes. Nevertheless, no differences in mRNA abundance between salinities were observed when larvae were cultivated to low salinity after mouth opening. Whole-mount in situ hybridization (WISH) signal for agt and ace in 3 dph larvae incubated at 10 ppt and 35 ppt confirmed that the former gene was mainly expressed in liver whereas the later gene was mainly located in pharynx and posterior gut, without pronounced differences in intensity between salinities. Possible physiological significance of all these results is discussed.

  2. Molecular characterization and expression analysis of five different elongation factor 1 alpha genes in the flatfish Senegalese sole (Solea senegalensis Kaup): Differential gene expression and thyroid hormones dependence during metamorphosis

    PubMed Central

    Infante, Carlos; Asensio, Esther; Cañavate, José Pedro; Manchado, Manuel

    2008-01-01

    Background Eukaryotic elongation factor 1 alpha (eEF1A) is one of the four subunits composing eukaryotic translation elongation factor 1. It catalyzes the binding of aminoacyl-tRNA to the A-site of the ribosome in a GTP-dependent manner during protein synthesis, although it also seems to play a role in other non-translational processes. Currently, little information is still available about its expression profile and regulation during flatfish metamorphosis. With regard to this, Senegalese sole (Solea senegalensis) is a commercially important flatfish in which eEF1A gene remains to be characterized. Results The development of large-scale genomics of Senegalese sole has facilitated the identification of five different eEF1A genes, referred to as SseEF1A1, SseEF1A2, SseEF1A3, SseEF1A4, and Sse42Sp50. Main characteristics and sequence identities with other fish and mammalian eEF1As are described. Phylogenetic and tissue expression analyses allowed for the identification of SseEF1A1 and SseEF1A2 as the Senegalese sole counterparts of mammalian eEF1A1 and eEF1A2, respectively, and of Sse42Sp50 as the ortholog of Xenopus laevis and teleost 42Sp50 gene. The other two elongation factors, SseEF1A3 and SseEF1A4, represent novel genes that are mainly expressed in gills and skin. The expression profile of the five genes was also studied during larval development, revealing different behaviours. To study the possible regulation of SseEF1A gene expressions by thyroid hormones (THs), larvae were exposed to the goitrogen thiourea (TU). TU-treated larvae exhibited lower SseEF1A4 mRNA levels than untreated controls at both 11 and 15 days after treatment, whereas transcripts of the other four genes remained relatively unchanged. Moreover, addition of exogenous T4 hormone to TU-treated larvae increased significantly the steady-state levels of SseEF1A4 with respect to untreated controls, demonstrating that its expression is up-regulated by THs. Conclusion We have identified five

  3. Molecular characterization and expression analysis of five different elongation factor 1 alpha genes in the flatfish Senegalese sole (Solea senegalensis Kaup): differential gene expression and thyroid hormones dependence during metamorphosis.

    PubMed

    Infante, Carlos; Asensio, Esther; Cañavate, José Pedro; Manchado, Manuel

    2008-01-30

    Eukaryotic elongation factor 1 alpha (eEF1A) is one of the four subunits composing eukaryotic translation elongation factor 1. It catalyzes the binding of aminoacyl-tRNA to the A-site of the ribosome in a GTP-dependent manner during protein synthesis, although it also seems to play a role in other non-translational processes. Currently, little information is still available about its expression profile and regulation during flatfish metamorphosis. With regard to this, Senegalese sole (Solea senegalensis) is a commercially important flatfish in which eEF1A gene remains to be characterized. The development of large-scale genomics of Senegalese sole has facilitated the identification of five different eEF1A genes, referred to as SseEF1A1, SseEF1A2, SseEF1A3, SseEF1A4, and Sse42Sp50. Main characteristics and sequence identities with other fish and mammalian eEF1As are described. Phylogenetic and tissue expression analyses allowed for the identification of SseEF1A1 and SseEF1A2 as the Senegalese sole counterparts of mammalian eEF1A1 and eEF1A2, respectively, and of Sse42Sp50 as the ortholog of Xenopus laevis and teleost 42Sp50 gene. The other two elongation factors, SseEF1A3 and SseEF1A4, represent novel genes that are mainly expressed in gills and skin. The expression profile of the five genes was also studied during larval development, revealing different behaviours. To study the possible regulation of SseEF1A gene expressions by thyroid hormones (THs), larvae were exposed to the goitrogen thiourea (TU). TU-treated larvae exhibited lower SseEF1A4 mRNA levels than untreated controls at both 11 and 15 days after treatment, whereas transcripts of the other four genes remained relatively unchanged. Moreover, addition of exogenous T4 hormone to TU-treated larvae increased significantly the steady-state levels of SseEF1A4 with respect to untreated controls, demonstrating that its expression is up-regulated by THs. We have identified five different eEF1A genes in the

  4. Coordinated regulation of chromatophore differentiation and melanogenesis during the ontogeny of skin pigmentation of Solea senegalensis (Kaup, 1858).

    PubMed

    Darias, Maria J; Andree, Karl B; Boglino, Anaïs; Fernández, Ignacio; Estévez, Alicia; Gisbert, Enric

    2013-01-01

    Abnormal pigmentation of Senegalese sole has been described as one problem facing the full exploitation of its commercial production. To improve our understanding of flatfish pigmentation of this commercially important species we have evaluated eleven genes related to two different processes of pigmentation: melanophore differentiation, and melanin production. The temporal distribution of gene expression peaks corresponds well with changes in pigmentation patterns and the intensity of skin melanization. Several gene ratios were also examined to put in perspective possible genetic markers for the different stages of normal pigmentation development. Further, the phenotypic changes that occur during morphogenesis correspond well with the main transitions in gene expression that occur. Given the dramatic phenotypic alterations which flatfish undergo, including the asymmetric coloration that occurs between the ocular and the blind side, and the synchrony of the two processes of morphogenesis and pigmentation ontogenesis, these species constitute an interesting model for the study of pigmentation. In this study we present a first approximation towards explaining the genetic mechanisms for regulating pigmentation ontogeny in Senegalese sole, Solea senegalensis.

  5. Coordinated Regulation of Chromatophore Differentiation and Melanogenesis during the Ontogeny of Skin Pigmentation of Solea senegalensis (Kaup, 1858)

    PubMed Central

    Darias, Maria J.; Andree, Karl B.; Boglino, Anaïs; Fernández, Ignacio; Estévez, Alicia; Gisbert, Enric

    2013-01-01

    Abnormal pigmentation of Senegalese sole has been described as one problem facing the full exploitation of its commercial production. To improve our understanding of flatfish pigmentation of this commercially important species we have evaluated eleven genes related to two different processes of pigmentation: melanophore differentiation, and melanin production. The temporal distribution of gene expression peaks corresponds well with changes in pigmentation patterns and the intensity of skin melanization. Several gene ratios were also examined to put in perspective possible genetic markers for the different stages of normal pigmentation development. Further, the phenotypic changes that occur during morphogenesis correspond well with the main transitions in gene expression that occur. Given the dramatic phenotypic alterations which flatfish undergo, including the asymmetric coloration that occurs between the ocular and the blind side, and the synchrony of the two processes of morphogenesis and pigmentation ontogenesis, these species constitute an interesting model for the study of pigmentation. In this study we present a first approximation towards explaining the genetic mechanisms for regulating pigmentation ontogeny in Senegalese sole, Solea senegalensis. PMID:23671650

  6. Characterization of seven cocaine- and amphetamine-regulated transcripts (CARTs) differentially expressed in the brain and peripheral tissues of Solea senegalensis (Kaup).

    PubMed

    Bonacic, Kruno; Martínez, Almudena; Martín-Robles, Águeda J; Muñoz-Cueto, José A; Morais, Sofia

    2015-12-01

    CART (cocaine- and amphetamine-regulated transcript) is a peptide with neurotransmitter and neuroendocrine functions with several key roles, both centrally and peripherally. In mammals there is a single gene that produces two alternatively spliced variants in rat and a single transcript in human but in teleosts multiple genes have been found. In the present study we report the existence of seven transcripts in Senegalese sole and characterize their sequences and phylogenetic relationships, as well as their expression patterns in the brain and peripheral tissues, and in response to feeding. Both cart2a and cart4 showed a ubiquitous expression in the brain, while cart1a, cart1b and cart3a were similarly expressed and had higher transcript levels in the mesencephalon, followed by the diencephalon. On the other hand, cart2b showed a main expression in the olfactory bulbs, and cart3b was predominantly expressed in the spinal cord. The expression profile in peripheral tissues differed substantially between cart's, even between more recently duplicated genes. Collectively, all the tissues examined, except the muscle, express at least one of the different cart's, although the highest transcript levels were found in the brain, gonads (ovary and testis) and, in some cases, eye and kidney. Concerning the feeding response, only brain cart1a, cart2a and cart4 showed a significant postprandial regulation, although future studies are necessary to assess potential confounding effects of stress imposed by the force feeding technique employed. Senegalese sole exhibits the highest number of cart genes reported to date in a vertebrate species. Their differential expression patterns and feeding regulation suggest that multiple cart genes, resulting from at least 3 rounds of whole genome duplication, have been retained in fish genomes through subfunctionalization, or possibly even through neofunctionalization. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Relativistic DNLS and Kaup-Newell Hierarchy

    NASA Astrophysics Data System (ADS)

    Pashaev, Oktay K.; Lee, Jyh-Hao

    2017-07-01

    By the recursion operator of the Kaup-Newell hierarchy we construct the relativistic derivative NLS (RDNLS) equation and the corresponding Lax pair. In the nonrelativistic limit c → ∞ it reduces to DNLS equation and preserves integrability at any order of relativistic corrections. The compact explicit representation of the linear problem for this equation becomes possible due to notions of the q-calculus with two bases, one of which is the recursion operator, and another one is the spectral parameter.

  8. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  9. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  10. Conservation laws for Ablowitz-Kaup-Newell-Segur equation

    NASA Astrophysics Data System (ADS)

    Mothibi, Dimpho Millicent

    2016-06-01

    In this paper we study the Ablowitz-Kaup-Newell-Segur equation, which has many applications in several physical phenomena. We perform the Noether symmetries analysis for this equation. Thereafter we construct the conservation laws for those cases which admit the Noether operators.

  11. Peaked Periodic Wave Solutions to the Broer–Kaup Equation

    NASA Astrophysics Data System (ADS)

    Jiang, Bo; Bi, Qin-Sheng

    2017-01-01

    By qualitative analysis method, a sufficient condition for the existence of peaked periodic wave solutions to the Broer–Kaup equation is given. Some exact explicit expressions of peaked periodic wave solutions are also presented. Supported by National Nature Science Foundation of China under Grant No. 11102076 and Natural Science Fund for Colleges and Universities in Jiangsu Province under Grant No. 15KJB110005

  12. DNA microarray analysis of genes differentially expressed in adipocyte differentiation.

    PubMed

    Yin, Chunyan; Xiao, Yanfeng; Zhang, Wei; Xu, Erdi; Liu, Weihua; Yi, Xiaoqing; Chang, Ming

    2014-06-01

    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a greater than or equal to 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RTPCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR?2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  13. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network.

    PubMed

    Jiang, Xue; Zhang, Han; Quan, Xiongwen

    2016-01-01

    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets.

  14. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network

    PubMed Central

    Quan, Xiongwen

    2016-01-01

    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets. PMID:28042568

  15. Molecular characterization, gene expression and dependence on thyroid hormones of two type I keratin genes (sseKer1 and sseKer2) in the flatfish Senegalese sole (Solea senegalensis Kaup)

    PubMed Central

    Infante, Carlos; Manchado, Manuel; Asensio, Esther; Cañavate, José Pedro

    2007-01-01

    Background Keratins make up the largest subgroup of intermediate filaments, and, in chordates, represent the most abundant proteins in epithelial cells. They have been associated with a wide range of functions in the cell, but little information is still available about their expression profile and regulation during flatfish metamorphosis. Senegalese sole (Solea senegalensis) is a commercially important flatfish in which no keratin gene has been described yet. Results The development of large-scale genomics of Senegalese sole has facilitated the identification of two different type I keratin genes referred to as sseKer1 and sseKer2. Main characteristics and sequence identities with other fish and mammal keratins are described. Phylogenetic analyses grouped sseKer1 and sseKer2 in a significant clade with other teleost epidermal type I keratins, and have allowed for the identification of sseKer2 as a novel keratin. The expression profile of both genes was studied during larval development and in tissues using a real-time approach. sseKer1 and sseKer2 mRNA levels were significantly higher in skin than in other tissues examined. During metamorphosis, sseKer1 transcripts increased significantly at first stages, and reduced thereafter. In contrast, sseKer2 mRNA levels did not change during early metamorphosis although a significant drop at metamorphosis climax and late metamorphosis was also detected. To study the possible regulation of sseKer gene expressions by thyroid hormones (THs), larvae were exposed to the goitrogen thiourea (TU). TU-treated larvae exhibited higher sseKer1 and sseKer2 mRNA levels than untreated control at both 11 and 15 days after treatment. Moreover, addition of exogenous T4 hormone to TU-treated larvae restored or even reduced the steady-state levels with respect to the untreated control, demonstrating that expression of both genes is negatively regulated by THs. Conclusion We have identified two keratin genes, referred to as sseKer1 and sseKer2

  16. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  17. Differential gene expression during multistage carcinogenesis

    SciTech Connect

    Bowden, G.T. ); Krieg, P. )

    1991-06-01

    The use of the mouse skin multistage model of carcinogenesis has aided our understanding of critical target genes in chemical carcinogenesis. The mutagenic activation of the Harvey-ras proto-oncogene has been found to be an early event associated with the initiation of mouse skin tumors by the polycyclic aromatic hydrocarbon 7,12 dimethylbenz(a)anthracene and the pure initiator ethyl carbamate (urethane). In contrast to chemical initiation of mouse skin tumors, ionizing radiation-initiated malignant skin tumors have been shown to possess distinct non-ras transforming gene(s). Differential screening of cDNA libraries made from chemically initiated malignant skin tumors has been used to identify a number of cellular gene transcripts that are overexpressed during mouse skin tumor progression. These differentially expressed genes include {beta}-actin, ubiquitin, a hyperproliferative keratin (K6), a gene whose product is a member of a fatty acid or lipid-binding protein family, and a gene called transin or stromelysin. The overexpression of the stromelysin gene, which encodes a metalloproteinase that degrades proteins in the basement membrane, is hypothesized to play a functional role in malignant tumor cell invasion and metastasis. The authors believe that the cloning, identification, and characterization of gene sequences that are differentially expressed during tumor progression could lead to the discovery of gene products that either play functional roles in skin tumor progression or in the maintenance of various progressive tumor phenotypes.

  18. Morphological and molecular characterization of dietary-induced pseudo-albinism during post-embryonic development of Solea senegalensis (Kaup, 1858).

    PubMed

    Darias, Maria J; Andree, Karl B; Boglino, Anaïs; Rotllant, Josep; Cerdá-Reverter, José Miguel; Estévez, Alicia; Gisbert, Enric

    2013-01-01

    The appearance of the pseudo-albino phenotype was investigated in developing Senegalese sole (Solea senegalensis, Kaup 1858) larvae at morphological and molecular levels. In order to induce the development of pseudo-albinos, Senegalese sole larvae were fed Artemia enriched with high levels of arachidonic acid (ARA). The development of their skin pigmentation was compared to that of a control group fed Artemia enriched with a reference commercial product. The relative amount of skin melanophores, xanthophores and iridophores revealed that larval pigmentation developed similarly in both groups. However, results from different relative proportions, allocation patterns, shapes and sizes of skin chromatophores revealed changes in the pigmentation pattern between ARA and control groups from 33 days post hatching onwards. The new populations of chromatophores that should appear at post-metamorphosis were not formed in the ARA group. Further, spatial patterns of distribution between the already present larval xanthophores and melanophores were suggestive of short-range interaction that seemed to be implicated in the degradation of these chromatophores, leading to the appearance of the pseudo-albino phenotype. The expression profile of several key pigmentation-related genes revealed that melanophore development was promoted in pseudo-albinos without a sufficient degree of terminal differentiation, thus preventing melanogenesis. Present results suggest the potential roles of asip1 and slc24a5 genes on the down-regulation of trp1 expression, leading to defects in melanin production. Moreover, gene expression data supports the involvement of pax3, mitf and asip1 genes in the developmental disruption of the new post-metamorphic populations of melanophores, xanthophores and iridophores.

  19. Morphological and Molecular Characterization of Dietary-Induced Pseudo-Albinism during Post-Embryonic Development of Solea senegalensis (Kaup, 1858)

    PubMed Central

    Darias, Maria J.; Andree, Karl B.; Boglino, Anaïs; Rotllant, Josep; Cerdá-Reverter, José Miguel; Estévez, Alicia; Gisbert, Enric

    2013-01-01

    The appearance of the pseudo-albino phenotype was investigated in developing Senegalese sole (Solea senegalensis, Kaup 1858) larvae at morphological and molecular levels. In order to induce the development of pseudo-albinos, Senegalese sole larvae were fed Artemia enriched with high levels of arachidonic acid (ARA). The development of their skin pigmentation was compared to that of a control group fed Artemia enriched with a reference commercial product. The relative amount of skin melanophores, xanthophores and iridophores revealed that larval pigmentation developed similarly in both groups. However, results from different relative proportions, allocation patterns, shapes and sizes of skin chromatophores revealed changes in the pigmentation pattern between ARA and control groups from 33 days post hatching onwards. The new populations of chromatophores that should appear at post-metamorphosis were not formed in the ARA group. Further, spatial patterns of distribution between the already present larval xanthophores and melanophores were suggestive of short-range interaction that seemed to be implicated in the degradation of these chromatophores, leading to the appearance of the pseudo-albino phenotype. The expression profile of several key pigmentation-related genes revealed that melanophore development was promoted in pseudo-albinos without a sufficient degree of terminal differentiation, thus preventing melanogenesis. Present results suggest the potential roles of asip1 and slc24a5 genes on the down-regulation of trp1 expression, leading to defects in melanin production. Moreover, gene expression data supports the involvement of pax3, mitf and asip1 genes in the developmental disruption of the new post-metamorphic populations of melanophores, xanthophores and iridophores. PMID:23874785

  20. Bayesian modeling of differential gene expression.

    PubMed

    Lewin, Alex; Richardson, Sylvia; Marshall, Clare; Glazier, Anne; Aitman, Tim

    2006-03-01

    We present a Bayesian hierarchical model for detecting differentially expressing genes that includes simultaneous estimation of array effects, and show how to use the output for choosing lists of genes for further investigation. We give empirical evidence that expression-level dependent array effects are needed, and explore different nonlinear functions as part of our model-based approach to normalization. The model includes gene-specific variances but imposes some necessary shrinkage through a hierarchical structure. Model criticism via posterior predictive checks is discussed. Modeling the array effects (normalization) simultaneously with differential expression gives fewer false positive results. To choose a list of genes, we propose to combine various criteria (for instance, fold change and overall expression) into a single indicator variable for each gene. The posterior distribution of these variables is used to pick the list of genes, thereby taking into account uncertainty in parameter estimates. In an application to mouse knockout data, Gene Ontology annotations over- and underrepresented among the genes on the chosen list are consistent with biological expectations.

  1. Differential gene detection incorporating common expression patterns

    NASA Astrophysics Data System (ADS)

    Oba, Shigeyuki; Ishii, Shin

    2009-12-01

    In detection of differentially expressed (DE) genes between different groups of samples based on a high-throughput expression measurement system, we often use a classical statistical testing based on a simple assumption that the expression of a certain DE gene in one group is higher or lower in average than that in the other group. Based on this simple assumption, the theory of optimal discovery procedure (ODP) (Storey, 2005) provided an optimal thresholding function for DE gene detection. However, expression patterns of DE genes over samples may have such a structure that is not exactly consistent with group labels assigned to the samples. Appropriate treatment of such a structure can increase the detection ability. Namely, genes showing similar expression patterns to other biologically meaningful genes can be regarded as statistically more significant than those showing expression patterns independent of other genes, even if differences in mean expression levels are comparable. In this study, we propose a new statistical thresholding function based on a latent variable model incorporating expression patterns together with the ODP theory. The latent variable model assumes hidden common signals behind expression patterns over samples and the ODP theory is extended to involve the latent variables. When applied to several gene expression data matrices which include cluster structures or 'cancer outlier' structures, the newly-proposed thresholding functions showed prominently better detection performance of DE genes than the original ODP thresholding function did. We also demonstrate how the proposed methods behave through analyses of real breast cancer and lymphoma datasets.

  2. Tenacibaculum soleae sp. nov., isolated from diseased sole (Solea senegalensis Kaup).

    PubMed

    Piñeiro-Vidal, Maximino; Carballas, Cristina G; Gómez-Barreiro, Oscar; Riaza, Ana; Santos, Ysabel

    2008-04-01

    A novel Gram-negative, rod-shaped, gliding bacterial strain designated LL04 12.1.7T was isolated from diseased sole (Solea senegalensis Kaup) in Galicia, Spain. Colonies were yellow-pigmented with uneven edges and did not adhere to the agar. The DNA G+C content of the strain was 29.8 mol%. 16S rRNA gene sequence similarity analysis indicated that strain LL04 12.1.7T is a member of the genus Tenacibaculum in the family Flavobacteriaceae. Sequence similarities between the isolate and the type strains of other members of the genus were 96.7-94.8 %. The major fatty acids (>10 % of total fatty acids) were iso-C15 : 0 (23.1 %), iso-C15 : 0 3-OH (10.6 %), C15 : 1 omega 6c (12.2 %) and summed feature 3 (comprising C16 : 1 omega 7c and/or iso-C15 : 0 2-OH, 11.0 %). Genotypic and phenotypic data distinguished strain LL04 12.1.7T from the 11 recognized Tenacibaculum species, indicating that it represents a novel species, for which the name Tenacibaculum soleae sp. nov. is proposed. The type strain is strain LL04 12.1.7T (=CECT 7292T =NCIMB 14368T).

  3. Gene regulatory logic of dopaminergic neuron differentiation

    PubMed Central

    Flames, Nuria; Hobert, Oliver

    2009-01-01

    Dopamine signaling regulates a variety of complex behaviors and defects in dopaminergic neuron function or survival result in severe human pathologies, such as Parkinson's disease 1. The common denominator of all dopaminergic neurons is the expression of dopamine pathway genes, which code for a set of phylogenetically conserved proteins involved in dopamine synthesis and transport. Gene regulatory mechanisms that result in the activation of dopamine pathway genes and thereby ultimately determine the identity of dopaminergic neurons are poorly understood in any system studied to date 2. We show here that a simple cis-regulatory element, the DA motif, controls the expression of all dopamine pathway genes in all dopaminergic cell types in C. elegans. The DA motif is activated by the ETS transcription factor, AST-1. Loss of ast-1 results in the failure of all distinct dopaminergic neuronal subtypes to terminally differentiate. Ectopic expression of ast-1 is sufficient to activate the dopamine production pathway in some cellular contexts. Vertebrate dopaminergic pathway genes also contain phylogenetically conserved DA motifs that can be activated by the mouse ETS transcription factor Etv1/ER81 and a specific class of dopaminergic neurons fails to differentiate in mice lacking Etv1/ER81. Moreover, ectopic Etv1/ER81 expression induces dopaminergic fate marker expression in neuronal primary cultures. Mouse Etv1/ER81 can also functionally substitute for ast-1 in C.elegans. Our studies reveal an astoundingly simple and apparently conserved regulatory logic of dopaminergic neuron terminal differentiation and may provide new entry points into the diagnosis or therapy of conditions in which dopamine neurons are defective. PMID:19287374

  4. On reciprocal properties of the Caudrey-Dodd-Gibbon and Kaup-Kupershmidt hierarchies

    NASA Astrophysics Data System (ADS)

    Rogers, C.; Carillo, S.

    1987-12-01

    New hierarchies of nonlinear evolution equations are introduced which are linked by reciprocal transformations to the Caudrey-Dodd-Gibbon and Kaup-Kupershmidt sequences. Invariance under a Möbius transformation of the singularity manifold equations for these sequences leads to a novel generic invariance property of the new systems. The latter have as base members Kawamoto-type equations. Explicit auto-Bäcklund transformations for the Caudry-Dodd-Gibbon and Kaup-Kuperschmidt hierarchies are generated via a reciprocal property.

  5. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  6. Collagen gene expression during limb cartilage differentiation

    PubMed Central

    1986-01-01

    As limb mesenchymal cells differentiate into chondrocytes, they initiate the synthesis of type II collagen and cease synthesizing type I collagen. Changes in the cytoplasmic levels of type I and type II collagen mRNAs during the course of limb chondrogenesis in vivo and in vitro were examined using cloned cDNA probes. A striking increase in cytoplasmic type II collagen mRNA occurs coincident with the crucial condensation stage of chondrogenesis in vitro, in which prechondrogenic mesenchymal cells become closely juxtaposed before depositing a cartilage matrix. Thereafter, a continuous and progressive increase in the accumulation of cytoplasmic type II collagen mRNA occurs which parallels the progressive accumulation of cartilage matrix by cells. The onset of overt chondrogenesis, however, does not involve activation of the transcription of the type II collagen gene. Low levels of type II collagen mRNA are present in the cytoplasm of prechondrogenic mesenchymal cells at the earliest stages of limb development, well before the accumulation of detectable levels of type II collagen. Type I collagen gene expression during chondrogenesis is regulated, at least in part, at the translational level. Type I collagen mRNAs are present in the cytoplasm of differentiated chondrocytes, which have ceased synthesizing detectable amounts of type I collagen. PMID:3754261

  7. Reduced D-Kaup-Newell soliton hierarchies from sl(2,ℝ) and so(3,ℝ)

    NASA Astrophysics Data System (ADS)

    Ma, Wen-Xiu; Zhou, Yuan

    2016-07-01

    Two reduced D-Kaup-Newell spectral problems from sl(2,ℝ) and so(3,ℝ) are considered, and the corresponding soliton hierarchies are generated by using the zero curvature formulation. The resulting systems are shown to be bi-Hamiltonian and their hereditary recursion operators are explicitly computed.

  8. Tri-integrable coupling of the Kaup-Newell soliton hierarchy and Liouville integrability

    NASA Astrophysics Data System (ADS)

    Yu, Shuimeng; Ye, Yujian; Zhang, Jun; Song, Junquan

    2016-07-01

    Based on a matrix Lie algebra consisting of 4 × 4 block matrices, new tri-integrable coupling of the Kaup-Newell soliton hierarchy is constructed. Then, the bi-Hamiltonian structure which leads to Liouville integrability of this coupling is furnished by the variational identity.

  9. Brief isoflurane anaesthesia affects differential gene expression, gene ontology and gene networks in rat brain.

    PubMed

    Lowes, Damon A; Galley, Helen F; Moura, Alessandro P S; Webster, Nigel R

    2017-01-15

    Much is still unknown about the mechanisms of effects of even brief anaesthesia on the brain and previous studies have simply compared differential expression profiles with and without anaesthesia. We hypothesised that network analysis, in addition to the traditional differential gene expression and ontology analysis, would enable identification of the effects of anaesthesia on interactions between genes. Rats (n=10 per group) were randomised to anaesthesia with isoflurane in oxygen or oxygen only for 15min, and 6h later brains were removed. Differential gene expression and gene ontology analysis of microarray data was performed. Standard clustering techniques and principal component analysis with Bayesian rules were used along with social network analysis methods, to quantitatively model and describe the gene networks. Anaesthesia had marked effects on genes in the brain with differential regulation of 416 probe sets by at least 2 fold. Gene ontology analysis showed 23 genes were functionally related to the anaesthesia and of these, 12 were involved with neurotransmitter release, transport and secretion. Gene network analysis revealed much greater connectivity in genes from brains from anaesthetised rats compared to controls. Other importance measures were also altered after anaesthesia; median [range] closeness centrality (shortest path) was lower in anaesthetized animals (0.07 [0-0.30]) than controls (0.39 [0.30-0.53], p<0.0001) and betweenness centrality was higher (53.85 [32.56-70.00]% compared to 5.93 [0-30.65]%, p<0.0001). Simply studying the actions of individual components does not fully describe dynamic and complex systems. Network analysis allows insight into the interactions between genes after anaesthesia and suggests future targets for investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Finite Genus Solutions to the Generalised Kaup-Newell Hierarchy and Two 2+1 Dimensional Modified Korteweg-de Vries Equations

    NASA Astrophysics Data System (ADS)

    Yang, Xiao; Han, Jiayan

    2017-07-01

    A generalised Kaup-Newell (gKN) hierarchy is introduced, which starts with a system of first-order ordinary differential equations and includes the Gerdjikov-Ivanov equation. By introducing an appropriate generating function, its related Hamiltonian systems and algebraic curve are given. The Hamiltonian systems are proved to be integrable, then the gKN hierarchy is solved by Hamiltonian flows. The algebraic curve is provided with suitable genus, then based on the trace formula and Riemann-Jacobi inversion theorem, finite genus solutions of the gKN hierarchy are obtained. Besides, two 2+1 dimensional modified Korteweg-de Vries (mKdV) equations are also solved.

  11. Different level of population differentiation among human genes.

    PubMed

    Wu, Dong-Dong; Zhang, Ya-Ping

    2011-01-14

    During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  12. Bilinear form and soliton solutions for the fifth-order Kaup-Kupershmidt equation

    NASA Astrophysics Data System (ADS)

    Wang, Pan

    2017-02-01

    In this paper, multi-soliton solutions of the fifth-order Kaup-Kupershmidt (KK) equation have been derived via the auxiliary function in conjunction with the bilinear method. These solutions have not been previously obtained. Propagation and interactions of three solitons have been presented analytically. The direction of the soliton is related to the signs of the parameters aj. The distances of the solitons are related to the values of the parameters aj.

  13. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  14. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  15. Dynamic changes in gene expression during human trophoblast differentiation.

    PubMed

    Handwerger, Stuart; Aronow, Bruce

    2003-01-01

    The genetic program that directs human placental differentiation is poorly understood. In a recent study, we used DNA microarray analyses to determine genes that are dynamically regulated during human placental development in an in vitro model system in which highly purified cytotrophoblast cells aggregate spontaneously and fuse to form a multinucleated syncytium that expresses placental lactogen, human chorionic gonadotropin, and other proteins normally expressed by fully differentiated syncytiotrophoblast cells. Of the 6918 genes present on the Incyte Human GEM V microarray that we analyzed over a 9-day period, 141 were induced and 256 were downregulated by more than 2-fold. The dynamically regulated genes fell into nine distinct kinetic patterns of induction or repression, as detected by the K-means algorithm. Classifying the genes according to functional characteristics, the regulated genes could be divided into six overall categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tags and function unknown. Gene expression changes within key functional categories were tightly coupled to the morphological changes that occurred during trophoblast differentiation. Within several key gene categories (e.g., cell and tissue structure), many genes were strongly activated, while others with related function were strongly repressed. These findings suggest that trophoblast differentiation is augmented by "categorical reprogramming" in which the ability of induced genes to function is enhanced by diminished synthesis of other genes within the same category. We also observed categorical reprogramming in human decidual fibroblasts decidualized in vitro in response to progesterone, estradiol, and cyclic AMP. While there was little overlap between genes that are dynamically regulated during trophoblast differentiation versus decidualization, many of the categories

  16. Sex determining genes and sexual differentiation in a marsupial.

    PubMed

    Pask, A; Renfree, M B

    2001-11-01

    The role of genes in the differentiation of the testis and ovary has been extensively studied in the human and the mouse. Despite over a decade of investigations, the precise roles of genes and their interactions in the pathway of sex determination are still unclear. We have chosen to take a comparative look at sex determination and differentiation to gain insights into the evolution and the conserved functions of these genes. To achieve this, we have examined a wide variety of eutherian sex determining genes in a marsupial, the tammar wallaby, to determine which genes have a conserved and fundamental mammalian sex determining role. These investigations have provided many unique insights. Here, we review the recent molecular and endocrine investigations into sexual development in marsupials, and highlight how these studies have shed light on the roles of genes and hormones in mammalian sex determination and differentiation.

  17. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  18. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  19. Onset of sex differentiation: dialog between genes and cells.

    PubMed

    Merchant-Larios, H; Moreno-Mendoza, N

    2001-01-01

    During the late 1940s, Alfred Jost demonstrated that mammalian sex differentiation begins in fetal testis, producing two factors necessary for the establishment of phenotypic males. Castrated embryos prior to testis differentiation led to phenotypic female differentiation. Jost proposed the existence of a testis-determining factor (TDF), elucidated in 1990 and named SRY for humans and Sry for mice. Thereafter, an increasing list of genes expressed in the genital ridges of mouse embryos at the onset of gonad differentiation has appeared. To date, it is clear that complete understanding of the mechanisms underlying gonadal sex differentiation in mammals requires identification of key cell lineages in which gonadal-specific genes are expressed. Here, a correlation between known gene expression and gonadal morphologic changes is attempted.

  20. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  1. Differential methylation during maize leaf growth targets developmentally regulated genes.

    PubMed

    Candaele, Jasper; Demuynck, Kirin; Mosoti, Douglas; Beemster, Gerrit T S; Inzé, Dirk; Nelissen, Hilde

    2014-03-01

    DNA methylation is an important and widespread epigenetic modification in plant genomes, mediated by DNA methyltransferases (DMTs). DNA methylation is known to play a role in genome protection, regulation of gene expression, and splicing and was previously associated with major developmental reprogramming in plants, such as vernalization and transition to flowering. Here, we show that DNA methylation also controls the growth processes of cell division and cell expansion within a growing organ. The maize (Zea mays) leaf offers a great tool to study growth processes, as the cells progressively move through the spatial gradient encompassing the division zone, transition zone, elongation zone, and mature zone. Opposite to de novo DMTs, the maintenance DMTs were transcriptionally regulated throughout the growth zone of the maize leaf, concomitant with differential CCGG methylation levels in the four zones. Surprisingly, the majority of differentially methylated sequences mapped on or close to gene bodies and not to repeat-rich loci. Moreover, especially the 5' and 3' regions of genes, which show overall low methylation levels, underwent differential methylation in a developmental context. Genes involved in processes such as chromatin remodeling, cell cycle progression, and growth regulation, were differentially methylated. The presence of differential methylation located upstream of the gene anticorrelated with transcript expression, while gene body differential methylation was unrelated to the expression level. These data indicate that DNA methylation is correlated with the decision to exit mitotic cell division and to enter cell expansion, which adds a new epigenetic level to the regulation of growth processes.

  2. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  3. [Screening of differentially expressed genes during adipocyte differentiation by suppression subtractive hybridization technique].

    PubMed

    Yi, Xiao-qing; Xiao, Yan-feng; Yin, Chun-yan; Xu, Er-di

    2012-05-01

    To screening differentially expressed genes related to adipocyte differentiation. Total RNA extracted from the preadipocyte cell line SW872 was taken as the Driver and the total RNA from the differentiated adipocytes SW872 as the Tester. Suppression subtractive hybridization (SSH) was used to isolate the cDNA fragments of differentially expressed genes. The products of SSH were inserted into pGM-T vector to establish the subtractive library. The library was amplified through E.coli transformation and positive clones of the transformants were screened. Positive clones were sequenced. Nucleic acid similarity was subsequently analyzed by comparing with the data from GenBank. There were 135 white clones in the cDNA library, 64 positive clones were chosen randomly and sequenced and similarity search revealed 34 genes which expressed differentially in adipocyte differentiation. The subtracted cDNA library for differentially expressed in adipocyte differentiation has been successfully constructed and the interesting candidate genes related to adipocyte differentiation have been identified.

  4. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  5. Role of Hox genes in stem cell differentiation.

    PubMed

    Seifert, Anne; Werheid, David F; Knapp, Silvana M; Tobiasch, Edda

    2015-04-26

    Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental fate of cells. Embryonic stem cells are usually devoid of any Hox gene expression, but these transcription factors are activated in varying spatial and temporal patterns defining the development of various body regions. In the adult body, Hox genes are among others responsible for driving the differentiation of tissue stem cells towards their respective lineages in order to repair and maintain the correct function of tissues and organs. Due to their involvement in the embryonic and adult body, they have been suggested to be useable for improving stem cell differentiations in vitro and in vivo. In many studies Hox genes have been found as driving factors in stem cell differentiation towards adipogenesis, in lineages involved in bone and joint formation, mainly chondrogenesis and osteogenesis, in cardiovascular lineages including endothelial and smooth muscle cell differentiations, and in neurogenesis. As life expectancy is rising, the demand for tissue reconstruction continues to increase. Stem cells have become an increasingly popular choice for creating therapies in regenerative medicine due to their self-renewal and differentiation potential. Especially mesenchymal stem cells are used more and more frequently due to their easy handling and accessibility, combined with a low tumorgenicity and little ethical concerns. This review therefore intends to summarize to date known correlations between natural Hox gene expression patterns in body tissues and during the differentiation of various stem cells towards their respective lineages with a major focus on mesenchymal stem cell differentiations. This overview shall help to understand the complex interactions of Hox genes and differentiation processes all over the body as well as in vitro for further improvement of stem cell treatments in future regenerative

  6. Role of Hox genes in stem cell differentiation

    PubMed Central

    Seifert, Anne; Werheid, David F; Knapp, Silvana M; Tobiasch, Edda

    2015-01-01

    Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental fate of cells. Embryonic stem cells are usually devoid of any Hox gene expression, but these transcription factors are activated in varying spatial and temporal patterns defining the development of various body regions. In the adult body, Hox genes are among others responsible for driving the differentiation of tissue stem cells towards their respective lineages in order to repair and maintain the correct function of tissues and organs. Due to their involvement in the embryonic and adult body, they have been suggested to be useable for improving stem cell differentiations in vitro and in vivo. In many studies Hox genes have been found as driving factors in stem cell differentiation towards adipogenesis, in lineages involved in bone and joint formation, mainly chondrogenesis and osteogenesis, in cardiovascular lineages including endothelial and smooth muscle cell differentiations, and in neurogenesis. As life expectancy is rising, the demand for tissue reconstruction continues to increase. Stem cells have become an increasingly popular choice for creating therapies in regenerative medicine due to their self-renewal and differentiation potential. Especially mesenchymal stem cells are used more and more frequently due to their easy handling and accessibility, combined with a low tumorgenicity and little ethical concerns. This review therefore intends to summarize to date known correlations between natural Hox gene expression patterns in body tissues and during the differentiation of various stem cells towards their respective lineages with a major focus on mesenchymal stem cell differentiations. This overview shall help to understand the complex interactions of Hox genes and differentiation processes all over the body as well as in vitro for further improvement of stem cell treatments in future regenerative

  7. Altering equine corneal fibroblast differentiation through Smad gene transfer.

    PubMed

    Marlo, Todd L; Giuliano, Elizabeth A; Tripathi, Ratnakar; Sharma, Ajay; Mohan, Rajiv R

    2017-07-06

    To explore the impact of equine corneal fibroblast (ECF) to myofibroblast (ECM) differentiation by altering the expression of the Smad genes either individually or in combination. Specifically, we sought to examine the ECF differentiation after (a) silencing of Smad2, 3, and 4 profibrotic genes individually and (b) overexpression of antifibrotic Smad7 gene and in a combination with pro- and antifibrotic Smad genes. Equine corneal fibroblast primary cultures were generated as previously described. ECFs were transfected with individual plasmids which silenced gene expression of either Smad2, 3, or 4 or in combination with a plasmid overexpressing Smad7 using Lipofectamine 2000™ or Lipofectamine BLOCK-iT™. Smad-transfected clones were then exposed to TGF-β1 to induce differentiation to myofibroblasts. Immunofluorescence and qRT-PCR techniques quantified levels of ECF differentiation to ECM by measuring alpha smooth muscle actin, a known marker of ECM transdifferentiation. Silencing of individual Smad2, 3, or 4 genes or overexpression of Smad7 showed significant inhibition of ECF transdifferentiation (73-83% reduction). Silencing of Smad2 showed the greatest inhibition of ECF transdifferentiation in (a) and was therefore utilized for the combination gene transfer testing. The combination gene transfer consisting of Smad7 overexpression and Smad2 silencing attenuated ECF differentiation significantly; however, the level was not significant compared to the overexpression of Smad7 individually. Using gene transfer technology involving profibrotic Smad silencing, antifibrotic Smad overexpression or its combination is a novel strategy to control TGF-β1-mediated fibrosis in equine fibroblasts. Combination gene therapy was not better than single gene therapy in this study. © 2017 American College of Veterinary Ophthalmologists.

  8. DGCA: A comprehensive R package for Differential Gene Correlation Analysis.

    PubMed

    McKenzie, Andrew T; Katsyv, Igor; Song, Won-Min; Wang, Minghui; Zhang, Bin

    2016-11-15

    Dissecting the regulatory relationships between genes is a critical step towards building accurate predictive models of biological systems. A powerful approach towards this end is to systematically study the differences in correlation between gene pairs in more than one distinct condition. In this study we develop an R package, DGCA (for Differential Gene Correlation Analysis), which offers a suite of tools for computing and analyzing differential correlations between gene pairs across multiple conditions. To minimize parametric assumptions, DGCA computes empirical p-values via permutation testing. To understand differential correlations at a systems level, DGCA performs higher-order analyses such as measuring the average difference in correlation and multiscale clustering analysis of differential correlation networks. Through a simulation study, we show that the straightforward z-score based method that DGCA employs significantly outperforms the existing alternative methods for calculating differential correlation. Application of DGCA to the TCGA RNA-seq data in breast cancer not only identifies key changes in the regulatory relationships between TP53 and PTEN and their target genes in the presence of inactivating mutations, but also reveals an immune-related differential correlation module that is specific to triple negative breast cancer (TNBC). DGCA is an R package for systematically assessing the difference in gene-gene regulatory relationships under different conditions. This user-friendly, effective, and comprehensive software tool will greatly facilitate the application of differential correlation analysis in many biological studies and thus will help identification of novel signaling pathways, biomarkers, and targets in complex biological systems and diseases.

  9. Multiple differential expression networks identify key genes in rectal cancer.

    PubMed

    Li, Ri-Heng; Zhang, Ai-Min; Li, Shuang; Li, Tian-Yang; Wang, Lian-Jing; Zhang, Hao-Ran; Li, Ping; Jia, Xiong-Jie; Zhang, Tao; Peng, Xin-Yu; Liu, Min-Di; Wang, Xu; Lang, Yan; Xue, Wei-Lan; Liu, Jing; Wang, Yan-Yan

    2016-01-01

    Rectal cancer is an important contributor to cancer mortality. The objective of this paper is to identify key genes across three phenotypes (fungating, polypoid and polypoid & small-ulcer) of rectal cancer based on multiple differential expression networks (DENs). Differential interactions and non-differential interactions were evaluated according to Spearman correlation coefficient (SCC) algorithm, and were selected to construct DENs. Topological analysis was performed for exploring hub genes in largest components of DENs. Key genes were denoted as intersections between nodes of DENs and rectal cancer associated genes from Genecards. Finally, we utilized hub genes to classify phenotypes of rectal cancer on the basis of support vector machines (SVM) methodology. We obtained 19 hub genes and total 12 common key genes of three largest components of DENs, and EGFR was the common element. The SVM results revealed that hub genes could classify phenotypes, and validated feasibility of DEN methods. We have successfully identified significant genes (such as EGFR and UBC) across fungating, polypoid and polypoid & small-ulcer phenotype of rectal cancer. They might be potential biomarkers for classification, detection and therapy of this cancer.

  10. Pomelo II: finding differentially expressed genes.

    PubMed

    Morrissey, Edward R; Diaz-Uriarte, Ramón

    2009-07-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool.

  11. Pomelo II: finding differentially expressed genes

    PubMed Central

    Morrissey, Edward R.; Diaz-Uriarte, Ramón

    2009-01-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool. PMID:19435879

  12. Repression of genes involved in melanocyte differentiation in uveal melanoma

    PubMed Central

    Bergeron, Marjorie-Allison; Champagne, Sophie; Gaudreault, Manon; Deschambeault, Alexandre

    2012-01-01

    Purpose Uveal melanoma (UM) has been the subject of intense interest due to its distinctive metastatic pattern, which involves hematogenous dissemination of cancerous cells toward the liver in 50% of patients. To search for new UM prognostic markers, the Suppressive Subtractive Hybridization (SSH) technique was used to isolate genes that are differentially expressed between UM primary tumors and normal uveal melanocytes (UVM). Methods A subtracted cDNA library was prepared using cDNA from uncultured UM primary tumors and UVM. The expression level of selected genes was further validated by cDNA microarray, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), and immunofluorescence analyses. Results One hundred-fifteen genes were identified using the SSH technique. Microarray analyses comparing the gene expression profiles of UM primary tumors to UVM validated a significant differential expression for 48% of these genes. The expression pattern of selected genes was then analyzed by semi-quantitative RT–PCR and was found to be consistent with the SSH and cDNA microarray findings. A down-regulation of genes associated with melanocyte differentiation was confirmed in UM primary tumors. Presence of undifferentiated cells in the UM was demonstrated by the expression of stem cell markers ATP-binding cassette sub-family G member 2 (ABCG2) and octamer-binding protein 4 (OCT4). Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes between UM and UVM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. In addition, deregulation of the melanocyte differentiation pathway revealed the presence of UM cells exhibiting a stem cell-like phenotype. PMID:22815634

  13. Interaction Solutions for (1+1)-Dimensional Higher-Order Broer—Kaup System

    NASA Astrophysics Data System (ADS)

    Xin, Xiang-Peng; Liu, Xi-Qiang

    2016-11-01

    The (1+1)-dimensional higher-order Broer—Kaup (HBK) system is studied by consistent tanh expansion (CTE) method in this paper. It is proved that the HBK system is CTE solvable, and some exact interaction solutions among different nonlinear excitations such as solitons, rational waves, periodic waves, corresponding images are explicitly given. Supported by National Natural Science Foundation of China under Grant Nos. 11505090, 11171041, 11405103, 11447220, Research Award Foundation for Outstanding Young Scientists of Shandong Province under Grant No. BS2015SF009

  14. Periodic Folded Wave Patterns for (2+1)-Dimensional Higher-Order Broer Kaup Equation

    NASA Astrophysics Data System (ADS)

    Huang, Wen-Hua

    2008-10-01

    A general solution including three arbitrary functions is obtained for the (2+1)-dimensional higher-order Broer Kaup equation by means of WTC truncation method. Introducing proper multiple valued functions and Jacobi elliptic functions in the seed solution, special types of periodic folded waves are derived. In long wave limit these periodic folded wave patterns may degenerate into single localized folded solitary wave excitations. The interactions of the periodic folded waves and their degenerated single folded solitary waves are investigated graphically and are found to be completely elastic.

  15. On periodic wave solutions and asymptotic behaviors to a generalized Konopelchenko-Dubrovsky-Kaup-Kupershmidt equation

    NASA Astrophysics Data System (ADS)

    Feng, Lian-Li; Tian, Shou-Fu; Yan, Hui; Wang, Li; Zhang, Tian-Tian

    2016-07-01

    In this paper, a lucid and systematic approach is proposed to systematically study the periodic-wave solutions and asymptotic behaviors of a (2 + 1) -dimensional generalized Konopelchenko-Dubrovsky-Kaup-Kupershmidt (gKDKK) equation, which can be used to describe certain situations from the fluid mechanics, ocean dynamics and plasma physics. Based on Bell's polynomials, the bilinear formalism and N -soliton solution of the gKDKK equation are derived, respectively. Furthermore, based on multidimensional Riemann theta functions, the periodic-wave solutions of the equation are also constructed. Finally, an asymptotic relation between the periodic-wave solutions and soliton solutions are strictly established under a limited procedure.

  16. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  17. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  18. Identifying gene regulatory network rewiring using latent differential graphical models

    PubMed Central

    Tian, Dechao; Gu, Quanquan; Ma, Jian

    2016-01-01

    Gene regulatory networks (GRNs) are highly dynamic among different tissue types. Identifying tissue-specific gene regulation is critically important to understand gene function in a particular cellular context. Graphical models have been used to estimate GRN from gene expression data to distinguish direct interactions from indirect associations. However, most existing methods estimate GRN for a specific cell/tissue type or in a tissue-naive way, or do not specifically focus on network rewiring between different tissues. Here, we describe a new method called Latent Differential Graphical Model (LDGM). The motivation of our method is to estimate the differential network between two tissue types directly without inferring the network for individual tissues, which has the advantage of utilizing much smaller sample size to achieve reliable differential network estimation. Our simulation results demonstrated that LDGM consistently outperforms other Gaussian graphical model based methods. We further evaluated LDGM by applying to the brain and blood gene expression data from the GTEx consortium. We also applied LDGM to identify network rewiring between cancer subtypes using the TCGA breast cancer samples. Our results suggest that LDGM is an effective method to infer differential network using high-throughput gene expression data to identify GRN dynamics among different cellular conditions. PMID:27378774

  19. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  20. Microarray analysis reveals differential gene expression in hybrid sunflower species

    PubMed Central

    LAI, ZHAO; GROSS, BRIANA L.; YIZOU; ANDREWS, JUSTEN; RIESEBERG, LOREN H.

    2008-01-01

    This paper describes the creation of a cDNA microarray for annual sunflowers and its use to elucidate patterns of gene expression in Helianthus annuus, Helianthus petiolaris, and the homoploid hybrid species Helianthus deserticola. The array comprises 3743 ESTs (expressed sequence tags) representing approximately 2897 unique genes. It has an average clone/EST identity rate of 91%, is applicable across species boundaries within the annual sunflowers, and shows patterns of gene expression that are highly reproducible according to real-time RT–PCR (reverse transcription–polymerase chain reaction) results. Overall, 12.8% of genes on the array showed statistically significant differential expression across the three species. Helianthus deserticola displayed transgressive, or extreme, expression for 58 genes, with roughly equal numbers exhibiting up- or down-regulation relative to both parental species. Transport-related proteins were strongly over-represented among the transgressively expressed genes, which makes functional sense given the extreme desert floor habitat of H. deserticola. The potential adaptive value of differential gene expression was evaluated for five genes in two populations of early generation (BC2) hybrids between the parental species grown in the H. deserticola habitat. One gene (a G protein-coupled receptor) had a significant association with fitness and maps close to a QTL controlling traits that may be adaptive in the desert habitat. PMID:16626449

  1. Dynamic Gene Regulatory Networks of Human Myeloid Differentiation.

    PubMed

    Ramirez, Ricardo N; El-Ali, Nicole C; Mager, Mikayla Anne; Wyman, Dana; Conesa, Ana; Mortazavi, Ali

    2017-03-27

    The reconstruction of gene regulatory networks underlying cell differentiation from high-throughput gene expression and chromatin data remains a challenge. Here, we derive dynamic gene regulatory networks for human myeloid differentiation using a 5-day time series of RNA-seq and ATAC-seq data. We profile HL-60 promyelocytes differentiating into macrophages, neutrophils, monocytes, and monocyte-derived macrophages. We find a rapid response in the expression of key transcription factors and lineage markers that only regulate a subset of their targets at a given time, which is followed by chromatin accessibility changes that occur later along with further gene expression changes. We observe differences between promyelocyte- and monocyte-derived macrophages at both the transcriptional and chromatin landscape level, despite using the same differentiation stimulus, which suggest that the path taken by cells in the differentiation landscape defines their end cell state. More generally, our approach of combining neighboring time points and replicates to achieve greater sequencing depth can efficiently infer footprint-based regulatory networks from long series data.

  2. Intermediate filament genes as differentiation markers in the leech Helobdella.

    PubMed

    Kuo, Dian-Han; Weisblat, David A

    2011-10-01

    The intermediate filament (IF) cytoskeleton is a general feature of differentiated cells. Its molecular components, IF proteins, constitute a large family including the evolutionarily conserved nuclear lamins and the more diverse collection of cytoplasmic intermediate filament (CIF) proteins. In vertebrates, genes encoding CIFs exhibit cell/tissue type-specific expression profiles and are thus useful as differentiation markers. The expression of invertebrate CIFs, however, is not well documented. Here, we report a whole-genome survey of IF genes and their developmental expression patterns in the leech Helobdella, a lophotrochozoan model for developmental biology research. We found that, as in vertebrates, each of the leech CIF genes is expressed in a specific set of cell/tissue types. This allows us to detect earliest points of differentiation for multiple cell types in leech development and to use CIFs as molecular markers for studying cell fate specification in leech embryos. In addition, to determine the feasibility of using CIFs as universal metazoan differentiation markers, we examined phylogenetic relationships of IF genes from various species. Our results suggest that CIFs, and thus their cell/tissue-specific expression patterns, have expanded several times independently during metazoan evolution. Moreover, comparing the expression patterns of CIF orthologs between two leech species suggests that rapid evolutionary changes in the cell or tissue specificity of CIFs have occurred among leeches. Hence, CIFs are not suitable for identifying cell or tissue homology except among very closely related species, but they are nevertheless useful species-specific differentiation markers.

  3. Endosymbiotic origin and differential loss of eukaryotic genes.

    PubMed

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Sousa, Filipa L; Lockhart, Peter J; Bryant, David; Hazkani-Covo, Einat; McInerney, James O; Landan, Giddy; Martin, William F

    2015-08-27

    Chloroplasts arose from cyanobacteria, mitochondria arose from proteobacteria. Both organelles have conserved their prokaryotic biochemistry, but their genomes are reduced, and most organelle proteins are encoded in the nucleus. Endosymbiotic theory posits that bacterial genes in eukaryotic genomes entered the eukaryotic lineage via organelle ancestors. It predicts episodic influx of prokaryotic genes into the eukaryotic lineage, with acquisition corresponding to endosymbiotic events. Eukaryotic genome sequences, however, increasingly implicate lateral gene transfer, both from prokaryotes to eukaryotes and among eukaryotes, as a source of gene content variation in eukaryotic genomes, which predicts continuous, lineage-specific acquisition of prokaryotic genes in divergent eukaryotic groups. Here we discriminate between these two alternatives by clustering and phylogenetic analysis of eukaryotic gene families having prokaryotic homologues. Our results indicate (1) that gene transfer from bacteria to eukaryotes is episodic, as revealed by gene distributions, and coincides with major evolutionary transitions at the origin of chloroplasts and mitochondria; (2) that gene inheritance in eukaryotes is vertical, as revealed by extensive topological comparison, sparse gene distributions stemming from differential loss; and (3) that continuous, lineage-specific lateral gene transfer, although it sometimes occurs, does not contribute to long-term gene content evolution in eukaryotic genomes.

  4. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  5. A study of genes involved in adipocyte differentiation.

    PubMed

    Zhu, Shunming; Cheng, Gong; Zhu, Huolan; Guan, Gongchang

    2015-01-01

    With the use of the microarray technique, genes expressed in the late phase of adipocyte differentiation were investigated. These genes play an important role in stimulating adipocyte growth and lipid droplet formation. Therefore, they contribute a great deal to the onset of obesity. With the use of SW872 adipocytes and the microarray technique, genes related to adipocyte differentiation were tested and compared with undifferentiated preadipocytes 14 days after induction. Real-time reverse transcription polymerase chain reaction (RT-PCR) was used for confirmation. More than 21,329 transcriptors were expressed and determined, of which 1326 increased and 687 decreased undifferentiated adipocytes. Among them, 21 were highly expressed by more than 10-fold. With RT-PCR, 12 were confirmed, including apelin, CIDEC, PID1, LYRM1, ADD1, PPARγ2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Furthermore, genes involved in lipid metabolism, signal transduction, DNA replication, redox status and transcription factors were determined as well. Novel genes involved in adipogenesis (e.g., apelin) were detected. A variety of genes were discovered and validated with RT-PCR at the late phase of adipocyte differentiation. This may help us better understand the onset of obesity and the potential role of adipocytes in other organs.

  6. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  7. Differential methylation of imprinted genes in growth-restricted placentas.

    PubMed

    Lambertini, Luca; Lee, Tin-Lap; Chan, Wai-Yee; Lee, Men-Jean; Diplas, Andreas; Wetmur, James; Chen, Jia

    2011-11-01

    A complex network of epigenetic factors participates in regulating the monoallelic expression of a small subset of genes (~1%) in the human genome. This phenomenon goes under the definition of genomic imprinting, a parent-of-origin effect that, when altered during early embryogenesis, may influence fetal development into adulthood. Pertubations in genomic imprinting have been associated with placental and fetal growth restrictions. We analyzed the differential DNA methylation of all known imprinted genes on 10 appropriate-for-gestational-age, clinically normal, placentas and 7 severe intrauterine growth-restricted placentas. Samples were pooled according to the diagnosis and analyzed by methylated DNA immunoprecipitation (MeDIP) on a tiling microarray platform. The distribution of the differentially methylated regions (DMRs) identified in growth-restricted placentas showed a slight tendency toward hypermethylation. Imprinted genes not expressed in placenta showed a unique DMR profile with the fewest hyper- and hypomethylated DMRs. Promoter and CpG island DMRs were sporadic and randomly distributed. The vast majority of DMR identified (~99%) were mapped in introns, showing no common sequence features. Also, by using the more advanced array data mining softwares, no significant patterns emerged. In contrast, differential methylation showed a highly significant correlation with gene length. Overall these data suggest that differential methylation changes in growth-restricted placentas occur throughout the genomic regions, encompassing genes actively expressed in the placenta. These findings warrant caution in interpreting the significance of genes carrying clustered DMRs because the distribution of DMRs in a gene may be attributed as a function of its length rather than as a specific biological role.

  8. Meta-analysis of differentially expressed genes in ankylosing spondylitis.

    PubMed

    Lee, Y H; Song, G G

    2015-05-18

    The purpose of this study was to identify differentially expressed (DE) genes and biological processes associated with changes in gene expression in ankylosing spondylitis (AS). We performed a meta-analysis using the integrative meta-analysis of expression data program on publicly available microarray AS Gene Expression Omnibus (GEO) datasets. We performed Gene Ontology (GO) enrichment analyses and pathway analysis using the Kyoto Encyclopedia of Genes and Genomes. Four GEO datasets, including 31 patients with AS and 39 controls, were available for the meta-analysis. We identified 65 genes across the studies that were consistently DE in patients with AS vs controls (23 upregulated and 42 downregulated). The upregulated gene with the largest effect size (ES; -1.2628, P = 0.020951) was integral membrane protein 2A (ITM2A), which is expressed by CD4+ T cells and plays a role in activation of T cells. The downregulated gene with the largest ES (1.2299, P = 0.040075) was mitochondrial ribosomal protein S11 (MRPS11). The most significant GO enrichment was in the respiratory electron transport chain category (P = 1.67 x 10-9). Therefore, our meta-analysis identified genes that were consistently DE as well as biological pathways associated with gene expression changes in AS.

  9. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  10. Graded Dorsal and Differential Gene Regulation in the Drosophila Embryo

    PubMed Central

    Reeves, Gregory T.; Stathopoulos, Angelike

    2009-01-01

    A gradient of Dorsal activity patterns the dorsoventral (DV) axis of the early Drosophila melanogaster embryo by controlling the expression of genes that delineate presumptive mesoderm, neuroectoderm, and dorsal ectoderm. The availability of the Drosophila melanogaster genome sequence has accelerated the study of embryonic DV patterning, enabling the use of systems-level approaches. As a result, our understanding of Dorsal-dependent gene regulation has expanded to encompass a collection of more than 50 genes and 30 cis-regulatory sequences. This information, which has been integrated into a spatiotemporal atlas of gene regulatory interactions, comprises one of the best-understood networks controlling any developmental process to date. In this article, we focus on how Dorsal controls differential gene expression and how recent studies have expanded our understanding of Drosophila embryonic development from the cis-regulatory level to that controlling morphogenesis of the embryo. PMID:20066095

  11. Differential methylation of genes and repeats in land plants.

    PubMed

    Rabinowicz, Pablo D; Citek, Robert; Budiman, Muhammad A; Nunberg, Andrew; Bedell, Joseph A; Lakey, Nathan; O'Shaughnessy, Andrew L; Nascimento, Lidia U; McCombie, W Richard; Martienssen, Robert A

    2005-10-01

    The hypomethylated fraction of plant genomes is usually enriched in genes and can be selectively cloned using methylation filtration (MF). Therefore, MF has been used as a gene enrichment technology in sorghum and maize, where gene enrichment was proportional to genome size. Here we apply MF to a broad variety of plant species spanning a wide range of genome sizes. Differential methylation of genic and non-genic sequences was observed in all species tested, from non-vascular to vascular plants, but in some cases, such as wheat and pine, a lower than expected level of enrichment was observed. Remarkably, hexaploid wheat and pine show a dramatically large number of gene-like sequences relative to other plants. In hexaploid wheat, this apparent excess of genes may reflect an abundance of methylated pseudogenes, which may thus be more prevalent in recent polyploids.

  12. Effects of HOX homeobox genes in blood cell differentiation.

    PubMed

    Magli, M C; Largman, C; Lawrence, H J

    1997-11-01

    The burgeoning number of articles concerning the role of HOX genes and hematopoiesis ensures that this will continue to be an area of very active research. It seems clear that HOX genes are expressed in stage- and lineage-specific patterns during early stages of hematopoietic development and differentiation. Several lines of evidence suggest that multiple genes of the HOXB (B2, B4, B6-B9), HOXC (C6, C8), and HOXA (A5) are involved in erythropoiesis. Similarly, a number of genes of the HOXA, HOXB, and HOXC appear to play a role in lymphoid cells. Furthermore, several genes, such as A9, A10, B3, B7, and B8, may control myelomonocytic differentiation. The question arises as to whether such a multiplicity of HOX genes reflects redundancy or indicates subtlety of the regulatory machinary. A similar complexity has been observed for hematopoietic cytokines, and the current view is that, although multiple molecules may have similar or overlapping effects, each factor has a specific function and regulatory combinations appear to play a critical role in controlling hematopoietic cell processes (99). One challenge for the future is to delineate in more detail the precise expression patterns of these genes in the many distinct subpopulations of blood cells and during fetal development. Overexpression of HOX genes in hematopoietic cells can dramatically perturb the differentiation of various cell lineages and can contribute to leukemogenesis. Future studies may involve the overexpression of alternatively spliced versions of different HOX genes or of truncated versions of HOX genes to ascertain the functional domains of the proteins that mediate the biologic effects. The findings in HOX knockout mice confirm a role for these genes in normal blood cell development. Further work in this area will require careful examination of fetal hematopoiesis and of animals bearing multiple HOX gene knockouts. Involvement of HOX genes in leukemia is just beginning to be appreciated

  13. Dynamic Gene Regulatory Networks Drive Hematopoietic Specification and Differentiation

    PubMed Central

    Goode, Debbie K.; Obier, Nadine; Vijayabaskar, M.S.; Lie-A-Ling, Michael; Lilly, Andrew J.; Hannah, Rebecca; Lichtinger, Monika; Batta, Kiran; Florkowska, Magdalena; Patel, Rahima; Challinor, Mairi; Wallace, Kirstie; Gilmour, Jane; Assi, Salam A.; Cauchy, Pierre; Hoogenkamp, Maarten; Westhead, David R.; Lacaud, Georges; Kouskoff, Valerie; Göttgens, Berthold; Bonifer, Constanze

    2016-01-01

    Summary Metazoan development involves the successive activation and silencing of specific gene expression programs and is driven by tissue-specific transcription factors programming the chromatin landscape. To understand how this process executes an entire developmental pathway, we generated global gene expression, chromatin accessibility, histone modification, and transcription factor binding data from purified embryonic stem cell-derived cells representing six sequential stages of hematopoietic specification and differentiation. Our data reveal the nature of regulatory elements driving differential gene expression and inform how transcription factor binding impacts on promoter activity. We present a dynamic core regulatory network model for hematopoietic specification and demonstrate its utility for the design of reprogramming experiments. Functional studies motivated by our genome-wide data uncovered a stage-specific role for TEAD/YAP factors in mammalian hematopoietic specification. Our study presents a powerful resource for studying hematopoiesis and demonstrates how such data advance our understanding of mammalian development. PMID:26923725

  14. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  15. Epigenetic control of skin differentiation genes by phytocannabinoids

    PubMed Central

    Pucci, Mariangela; Rapino, Cinzia; Di Francesco, Andrea; Dainese, Enrico; D'Addario, Claudio; Maccarrone, Mauro

    2013-01-01

    BACKGROUND AND PURPOSE Endocannabinoid signalling has been shown to have a role in the control of epidermal physiology, whereby anandamide is able to regulate the expression of skin differentiation genes through DNA methylation. Here, we investigated the possible epigenetic regulation of these genes by several phytocannabinoids, plant-derived cannabinoids that have the potential to be novel therapeutics for various human diseases. EXPERIMENTAL APPROACH The effects of cannabidiol, cannabigerol and cannabidivarin on the expression of skin differentiation genes keratins 1 and 10, involucrin and transglutaminase 5, as well as on DNA methylation of keratin 10 gene, were investigated in human keratinocytes (HaCaT cells). The effects of these phytocannabinoids on global DNA methylation and the activity and expression of four major DNA methyltransferases (DNMT1, 3a, 3b and 3L) were also examined. KEY RESULTS Cannabidiol and cannabigerol significantly reduced the expression of all the genes tested in differentiated HaCaT cells, by increasing DNA methylation of keratin 10 gene, but cannabidivarin was ineffective. Remarkably, cannabidiol reduced keratin 10 mRNA through a type-1 cannabinoid (CB1) receptor-dependent mechanism, whereas cannabigerol did not affect either CB1 or CB2 receptors of HaCaT cells. In addition, cannabidiol, but not cannabigerol, increased global DNA methylation levels by selectively enhancing DNMT1 expression, without affecting DNMT 3a, 3b or 3L. CONCLUSIONS AND IMPLICATIONS These findings show that the phytocannabinoids cannabidiol and cannabigerol are transcriptional repressors that can control cell proliferation and differentiation. This indicates that they (especially cannabidiol) have the potential to be lead compounds for the development of novel therapeutics for skin diseases. PMID:23869687

  16. Epigenetic control of skin differentiation genes by phytocannabinoids.

    PubMed

    Pucci, Mariangela; Rapino, Cinzia; Di Francesco, Andrea; Dainese, Enrico; D'Addario, Claudio; Maccarrone, Mauro

    2013-10-01

    Endocannabinoid signalling has been shown to have a role in the control of epidermal physiology, whereby anandamide is able to regulate the expression of skin differentiation genes through DNA methylation. Here, we investigated the possible epigenetic regulation of these genes by several phytocannabinoids, plant-derived cannabinoids that have the potential to be novel therapeutics for various human diseases. The effects of cannabidiol, cannabigerol and cannabidivarin on the expression of skin differentiation genes keratins 1 and 10, involucrin and transglutaminase 5, as well as on DNA methylation of keratin 10 gene, were investigated in human keratinocytes (HaCaT cells). The effects of these phytocannabinoids on global DNA methylation and the activity and expression of four major DNA methyltransferases (DNMT1, 3a, 3b and 3L) were also examined. Cannabidiol and cannabigerol significantly reduced the expression of all the genes tested in differentiated HaCaT cells, by increasing DNA methylation of keratin 10 gene, but cannabidivarin was ineffective. Remarkably, cannabidiol reduced keratin 10 mRNA through a type-1 cannabinoid (CB1 ) receptor-dependent mechanism, whereas cannabigerol did not affect either CB1 or CB2 receptors of HaCaT cells. In addition, cannabidiol, but not cannabigerol, increased global DNA methylation levels by selectively enhancing DNMT1 expression, without affecting DNMT 3a, 3b or 3L. These findings show that the phytocannabinoids cannabidiol and cannabigerol are transcriptional repressors that can control cell proliferation and differentiation. This indicates that they (especially cannabidiol) have the potential to be lead compounds for the development of novel therapeutics for skin diseases. © 2013 The British Pharmacological Society.

  17. Differential Gene Retention in Plastids of Common Recent Origin

    PubMed Central

    Reyes-Prieto, Adrian; Yoon, Hwan Su; Moustafa, Ahmed; Yang, Eun Chan; Andersen, Robert A.; Boo, Sung Min; Nakayama, Takuro; Ishida, Ken-ichiro; Bhattacharya, Debashish

    2010-01-01

    The cyanobacterium-derived plastids of algae and plants have supported the diversification of much of extant eukaryotic life. Inferences about early events in plastid evolution must rely on reconstructing events that occurred over a billion years ago. In contrast, the photosynthetic amoeba Paulinella chromatophora provides an exceptional model to study organelle evolution in a prokaryote–eukaryote (primary) endosymbiosis that occurred approximately 60 mya. Here we sequenced the plastid genome (0.977 Mb) from the recently described Paulinella FK01 and compared the sequence with the existing data from the sister taxon Paulinella M0880/a. Alignment of the two plastid genomes shows significant conservation of gene order and only a handful of minor gene rearrangements. Analysis of gene content reveals 66 differential gene losses that appear to be outright gene deletions rather than endosymbiotic gene transfers to the host nuclear genome. Phylogenomic analysis validates the plastid ancestor as a member of the Synechococcus–Prochlorococcus group, and the cyanobacterial provenance of all plastid genes suggests that these organelles were not targets of interphylum gene transfers after endosymbiosis. Inspection of 681 DNA alignments of protein-encoding genes shows that the vast majority have dN/dS ratios <<1, providing evidence for purifying selection. Our study demonstrates that plastid genomes in sister taxa are strongly constrained by selection but follow distinct trajectories during the earlier phases of organelle evolution. PMID:20123796

  18. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  19. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  20. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  1. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  2. Gene Sets Net Correlations Analysis (GSNCA): a multivariate differential coexpression test for gene sets

    PubMed Central

    Rahmatallah, Yasir; Emmert-Streib, Frank; Glazko, Galina

    2014-01-01

    Motivation: To date, gene set analysis approaches primarily focus on identifying differentially expressed gene sets (pathways). Methods for identifying differentially coexpressed pathways also exist but are mostly based on aggregated pairwise correlations or other pairwise measures of coexpression. Instead, we propose Gene Sets Net Correlations Analysis (GSNCA), a multivariate differential coexpression test that accounts for the complete correlation structure between genes. Results: In GSNCA, weight factors are assigned to genes in proportion to the genes’ cross-correlations (intergene correlations). The problem of finding the weight vectors is formulated as an eigenvector problem with a unique solution. GSNCA tests the null hypothesis that for a gene set there is no difference in the weight vectors of the genes between two conditions. In simulation studies and the analyses of experimental data, we demonstrate that GSNCA captures changes in the structure of genes’ cross-correlations rather than differences in the averaged pairwise correlations. Thus, GSNCA infers differences in coexpression networks, however, bypassing method-dependent steps of network inference. As an additional result from GSNCA, we define hub genes as genes with the largest weights and show that these genes correspond frequently to major and specific pathway regulators, as well as to genes that are most affected by the biological difference between two conditions. In summary, GSNCA is a new approach for the analysis of differentially coexpressed pathways that also evaluates the importance of the genes in the pathways, thus providing unique information that may result in the generation of novel biological hypotheses. Availability and implementation: Implementation of the GSNCA test in R is available upon request from the authors. Contact: YRahmatallah@uams.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24292935

  3. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  4. Differential Gene Expression in HIV-Infected Individuals Following ART

    PubMed Central

    Massanella, Marta; Singhania, Akul; Beliakova-Bethell, Nadejda; Pier, Rose; Lada, Steven; White, Cory H.; Pérez-Santiago, Josué; Blanco, Julià; Richman, Douglas D.; Little, Susan J.; Woelk, Christopher H.

    2013-01-01

    Previous studies of the effect of ART on gene expression in HIV-infected individuals have identified small numbers of modulated genes. Since these studies were underpowered or cross-sectional in design, a paired analysis of peripheral blood mononuclear cells (PBMCs), isolated before and after ART, from a robust number of HIV-infected patients (N=32) was performed. Gene expression was assayed by microarray and 4,157 differentially expressed genes (DEGs) were identified following ART using multivariate permutation tests. Pathways and Gene Ontology (GO) terms over-represented for DEGs reflected the transition from a period of active virus replication before ART to one of viral suppression (e.g., repression of JAK-STAT signaling) and possible prolonged drug exposure (e.g. oxidative phosphorylation pathway) following ART. CMYC was the DEG whose product made the greatest number of interactions at the protein level in protein interaction networks (PINs), which has implications for the increased incidence of Hodgkin’s lymphoma (HL) in HIV-infected patients. The differential expression of multiple genes was confirmed by RT-qPCR including well-known drug metabolism genes (e.g., ALOX12 and CYP2S1). Targets not confirmed by RT-qPCR (i.e., GSTM2 and RPL5) were significantly confirmed by droplet digital (ddPCR), which may represent a superior method when confirming DEGs with low fold changes. In conclusion, a paired design revealed that the number of genes modulated following ART was an order of magnitude higher than previously recognized. PMID:23933117

  5. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  6. Nonlocal Symmetry, CTE Solvability and Interaction Solutions of Whitham-Broer-Kaup Equations

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Lu, Bin

    2017-02-01

    Whitham-Broer-Kaup (WBK) equations in the shallow water small-amplitude regime is hereby under investigation. Nonlocal symmetry and Bäcklund transformation are presented via the truncated Painlevé expansion. This residual symmetry is localised to Lie point symmetry by the properly enlarged system. The finite symmetry transformation of the prolonged system is computed. Based on the CTE method, WBK equations are linearized and new analytic interaction solutions between solitary waves and cnoidal waves are given with the aid of solutions for the linear equation. Supported by the Key Foundation of Anhui Education Bureau under Grant No. KJ2013A028, the 211 Project of Anhhui University under Grant No. J18520104, Scientific Training Project for University Students, National Natural Science Foundation of China under Grant Nos. 11471015, 11571016, and Natural Science Foundation of Anhui Province under Grant No. 1408085MA02

  7. Random forests-based differential analysis of gene sets for gene expression data.

    PubMed

    Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An

    2013-04-10

    In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for

  8. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  9. Differential gene expression in auristatin PHE-treated Cryptococcus neoformans.

    PubMed

    Woyke, Tanja; Berens, Michael E; Hoelzinger, Dominique B; Pettit, George R; Winkelmann, Günther; Pettit, Robin K

    2004-02-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 micro M) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans.

  10. Differential Gene Expression in Auristatin PHE-Treated Cryptococcus neoformans

    PubMed Central

    Woyke, Tanja; Berens, Michael E.; Hoelzinger, Dominique B.; Pettit, George R.; Winkelmann, Günther; Pettit, Robin K.

    2004-01-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 μM) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans. PMID:14742210

  11. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  12. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  13. Cytokine-induced macrophage differentiation: a tale of 2 genes.

    PubMed

    Winston, B W; Krein, P M; Mowat, C; Huang, Y

    1999-12-01

    Macrophages are versatile cells found in every tissue in the body. They must perform a number of diverse cellular functions that allow them to kill invading micro-organisms and neoplastic cells as well as produce growth factors involved in wound healing. Macrophages that develop these diverse functions arise from a common precursor. By a process of selective adaptation, the common precursor monocyte/macrophage differentiates into a distinctive macrophage with a different and specific phenotype, characterized by the expression of a specific set of gene products. The local environment plays a critical role in shaping or directing the pattern or pathway of macrophage differentiation. The authors have focused on 2 specific macrophage differentiation pathways in a murine bone marrow-derived macrophage model. One pathway is believed to play a role in wound repair and is characterized by the induction of insulin-like growth factor-1 (IGF-I). The second pathway is involved in macrophage cytocidal activation and is characterized by the induction of the inducible form of nitric oxide synthase (iNOS). The pleotropic cytokine tumour necrosis factor-alpha (TNF-alpha) appears to mediate macrophage differentiation along both of these pathways. Interferon-gamma (IFN-gamma), however, appears to act as a molecular switch. In the presence of IFN-gamma, stimulation of macrophages with TNF-alpha results in macrophage differentiation along a pathway in which iNOS is expressed, whereas, in the absence of IFN-gamma, stimulation of macrophages with TNF-alpha results in differentiation along a pathway in which IGF-I is expressed. The authors focus on some of the molecular events involved in TNF-alpha and IFN-gamma signal transduction and the regulation of iNOS and IGF-I genes in macrophages.

  14. Hunting complex differential gene interaction patterns across molecular contexts

    PubMed Central

    Song, Mingzhou; Zhang, Yang; Katzaroff, Alexia J.; Edgar, Bruce A.; Buttitta, Laura

    2014-01-01

    Heterogeneity in genetic networks across different signaling molecular contexts can suggest molecular regulatory mechanisms. Here we describe a comparative chi-square analysis (CPχ2) method, considerably more flexible and effective than other alternatives, to screen large gene expression data sets for conserved and differential interactions. CPχ2 decomposes interactions across conditions to assess homogeneity and heterogeneity. Theoretically, we prove an asymptotic chi-square null distribution for the interaction heterogeneity statistic. Empirically, on synthetic yeast cell cycle data, CPχ2 achieved much higher statistical power in detecting differential networks than alternative approaches. We applied CPχ2 to Drosophila melanogaster wing gene expression arrays collected under normal conditions, and conditions with overexpressed E2F and Cabut, two transcription factor complexes that promote ectopic cell cycling. The resulting differential networks suggest a mechanism by which E2F and Cabut regulate distinct gene interactions, while still sharing a small core network. Thus, CPχ2 is sensitive in detecting network rewiring, useful in comparing related biological systems. PMID:24482443

  15. Differentially expressed genes in metastatic advanced Egyptian bladder cancer.

    PubMed

    Zekri, Abdel-Rahman N; Hassan, Zeinab Korany; Bahnassy, Abeer A; Khaled, Hussein M; El-Rouby, Mahmoud N; Haggag, Rasha M; Abu-Taleb, Fouad M

    2015-01-01

    Bladder cancer is one of the most common cancers worldwide. Gene expression profiling using microarray technologies improves the understanding of cancer biology. The aim of this study was to determine the gene expression profile in Egyptian bladder cancer patients. Samples from 29 human bladder cancers and adjacent non-neoplastic tissues were analyzed by cDNA microarray, with hierarchical clustering and multidimensional analysis. Five hundred and sixteen genes were differentially expressed of which SOS1, HDAC2, PLXNC1, GTSE1, ULK2, IRS2, ABCA12, TOP3A, HES1, and SRP68 genes were involved in 33 different pathways. The most frequently detected genes were: SOS1 in 20 different pathways; HDAC2 in 5 different pathways; IRS2 in 3 different pathways. There were 388 down-regulated genes. PLCB2 was involved in 11 different pathways, MDM2 in 9 pathways, FZD4 in 5 pathways, p15 and FGF12 in 4 pathways, POLE2 in 3 pathways, and MCM4 and POLR2E in 2 pathways. Thirty genes showed significant differences between transitional cell cancer (TCC) and squamous cell cancer (SCC) samples. Unsupervised cluster analysis of DNA microarray data revealed a clear distinction between low and high grade tumors. In addition 26 genes showed significant differences between low and high tumor stages, including fragile histidine triad, Ras and sialyltransferase 8 (alpha) and 16 showed significant differences between low and high tumor grades, like methionine adenosyl transferase II, beta. The present study identified some genes, that can be used as molecular biomarkers or target genes in Egyptian bladder cancer patients.

  16. Lie Symmetry Analysis, Analytical Solutions, and Conservation Laws of the Generalised Whitham-Broer-Kaup-Like Equations

    NASA Astrophysics Data System (ADS)

    Wang, Xiu-Bin; Tian, Shou-Fu; Qin, Chun-Yan; Zhang, Tian-Tian

    2017-03-01

    In this article, a generalised Whitham-Broer-Kaup-Like (WBKL) equations is investigated, which can describe the bidirectional propagation of long waves in shallow water. The equations can be reduced to the dispersive long wave equations, variant Boussinesq equations, Whitham-Broer-Kaup-Like equations, etc. The Lie symmetry analysis method is used to consider the vector fields and optimal system of the equations. The similarity reductions are given on the basic of the optimal system. Furthermore, the power series solutions are derived by using the power series theory. Finally, based on a new theorem of conservation laws, the conservation laws associated with symmetries of this equations are constructed with a detailed derivation.

  17. Evolution of initial discontinuities in the Riemann problem for the Kaup-Boussinesq equation with positive dispersion

    NASA Astrophysics Data System (ADS)

    Congy, T.; Ivanov, S. K.; Kamchatnov, A. M.; Pavloff, N.

    2017-08-01

    We consider the space-time evolution of initial discontinuities of depth and flow velocity for an integrable version of the shallow water Boussinesq system introduced by Kaup. We focus on a specific version of this "Kaup-Boussinesq model" for which a flat water surface is modulationally stable, we speak below of "positive dispersion" model. This model also appears as an approximation to the equations governing the dynamics of polarisation waves in two-component Bose-Einstein condensates. We describe its periodic solutions and the corresponding Whitham modulation equations. The self-similar, one-phase wave structures are composed of different building blocks, which are studied in detail. This makes it possible to establish a classification of all the possible wave configurations evolving from initial discontinuities. The analytic results are confirmed by numerical simulations.

  18. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  19. Improved detection of differentially expressed genes through incorporation of gene locations.

    PubMed

    Xiao, Guanghua; Reilly, Cavan; Khodursky, Arkady B

    2009-09-01

    In determining differential expression in cDNA microarray experiments, the expression level of an individual gene is usually assumed to be independent of the expression levels of other genes, but many recent studies have shown that a gene's expression level tends to be similar to that of its neighbors on a chromosome, and differentially expressed (DE) genes are likely to form clusters of similar transcriptional activity along the chromosome. When modeled as a one-dimensional spatial series, the expression level of genes on the same chromosome frequently exhibit significant spatial correlation, reflecting spatial patterns in transcription. By modeling these spatial correlations, we can obtain improved estimates of transcript levels. Here, we demonstrate the existence of spatial correlations in transcriptional activity in the Escherichia coli (E. coli) chromosome across more than 50 experimental conditions. Based on this finding, we propose a hierarchical Bayesian model that borrows information from neighboring genes to improve the estimation of the expression level of a given gene and hence the detection of DE genes. Furthermore, we extend the model to account for the circular structure of E. coli chromosome and the intergenetic distance between gene neighbors. The simulation studies and analysis of real data examples in E. coli and yeast Saccharomyces cerevisiae show that the proposed method outperforms the commonly used significant analysis of microarray (SAM) t-statistic in detecting DE genes.

  20. Altered patterns of gene duplication and differential gene gain and loss in fungal pathogens

    PubMed Central

    Powell, Amy J; Conant, Gavin C; Brown, Douglas E; Carbone, Ignazio; Dean, Ralph A

    2008-01-01

    Background Duplication, followed by fixation or random loss of novel genes, contributes to genome evolution. Particular outcomes of duplication events are possibly associated with pathogenic life histories in fungi. To date, differential gene gain and loss have not been studied at genomic scales in fungal pathogens, despite this phenomenon's known importance in virulence in bacteria and viruses. Results To determine if patterns of gene duplication differed between pathogens and non-pathogens, we identified gene families across nine euascomycete and two basidiomycete species. Gene family size distributions were fit to power laws to compare gene duplication trends in pathogens versus non-pathogens. Fungal phytopathogens showed globally altered patterns of gene duplication, as indicated by differences in gene family size distribution. We also identified sixteen examples of gene family expansion and five instances of gene family contraction in pathogenic lineages. Expanded gene families included those predicted to be important in melanin biosynthesis, host cell wall degradation and transport functions. Contracted families included those encoding genes involved in toxin production, genes with oxidoreductase activity, as well as subunits of the vacuolar ATPase complex. Surveys of the functional distribution of gene duplicates indicated that pathogens show enrichment for gene duplicates associated with receptor and hydrolase activities, while euascomycete pathogens appeared to have not only these differences, but also significantly more duplicates associated with regulatory and carbohydrate binding functions. Conclusion Differences in the overall levels of gene duplication in phytopathogenic species versus non-pathogenic relatives implicate gene inventory flux as an important virulence-associated process in fungi. We hypothesize that the observed patterns of gene duplicate enrichment, gene family expansion and contraction reflect adaptation within pathogenic life

  1. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  2. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  3. Uncertainty of GHz-band Whole-body Average SARs in Infants based on their Kaup Indices

    NASA Astrophysics Data System (ADS)

    Miwa, Hironobu; Hirata, Akimasa; Fujiwara, Osamu; Nagaoka, Tomoaki; Watanabe, Soichi

    We previously showed that a strong correlation exists between the absorption cross section and the body surface area of a human for 0.3-2GHz far field exposure, and proposed a formula for estimating whole-body-average specific absorption rates (WBA-SARs) in terms of height and weight. In this study, to evaluate variability in the WBA-SARs in infants based on their physique, we derived a new formula including Kaup indices of infants, which are being used to check their growth, and thereby estimated the WBA-SARs in infants with respect to their age from 0 month to three years. As a result, we found that under the same height/weight, the smaller the Kaup indices are, the larger the WBA-SARs become, and that the variability in the WBA-SARs is around 15% at the same age. To validate these findings, using the FDTD method, we simulated the GHz-band WBA-SARs in numerical human models corresponding to infants with age of 0, 1, 3, 6 and 9 months, which were obtained by scaling down the anatomically based Japanese three-year child model developed by NICT (National Institute of Information and Communications Technology). Results show that the FDTD-simulated WBA-SARs are smaller by 20% compared to those estimated for infants having the median height and the Kaup index of 0.5 percentiles, which provide conservative WBA-SARs.

  4. Wilms' tumor (WT1) gene expression in rat decidual differentiation.

    PubMed

    Zhou, J; Rauscher, F J; Bondy, C

    1993-09-01

    The Wilm's tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract, where it is thought to play a role in the differentiation of these tissues. We have used immunocytochemistry and in situ hybridization to study WT1 expression in the rat uterus during normal development and pregnancy from 0 to 20 days post coitum (p.c.). WT1 mRNA was abundant in uterine stroma from juvenile rats, but was much less abundant in uterine tissue from sexually mature rats; WT1 expression is not affected by ovariectomy or by treatment with estradiol or estradiol plus progesterone. WT1 gene was highly expressed, however, in the endometrial cells of early pregnancy. On day 6 p.c. WT1 mRNA was detected in anti-mesometrial decidual cells, and WT1 immunoreactivity was concentrated in the nuclei of these cells. All cells of fully-developed deciduoma at 7-8 days p.c. demonstrated WT1 expression. WT1 was not detected in trophoblast/placental tissues but remained abundant in the decidua basalis until parturition. The expression of WT1 was compared with insulin-like growth factor-II (IGF-II) and its receptor in the decidual since it has been shown that IGF-II gene transcription is repressed by WT1 in vitro. However, no spatiotemporal correlation in the expression of these three genes was found in differentiation of the rat decidua. In summary, these data suggest a role for WT1 in decidualization, since its expression is activated during the differentiation of uterine stromal cells into decidual cells.

  5. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  6. Pheromone-regulated genes required for yeast mating differentiation.

    PubMed

    Erdman, S; Lin, L; Malczynski, M; Snyder, M

    1998-02-09

    Yeast cells mate by an inducible pathway that involves agglutination, mating projection formation, cell fusion, and nuclear fusion. To obtain insight into the mating differentiation of Saccharomyces cerevisiae, we carried out a large-scale transposon tagging screen to identify genes whose expression is regulated by mating pheromone. 91,200 transformants containing random lacZ insertions were screened for beta-galactosidase (beta-gal) expression in the presence and absence of alpha factor, and 189 strains containing pheromone-regulated lacZ insertions were identified. Transposon insertion alleles corresponding to 20 genes that are novel or had not previously been known to be pheromone regulated were examined for effects on the mating process. Mutations in four novel genes, FIG1, FIG2, KAR5/ FIG3, and FIG4 were found to cause mating defects. Three of the proteins encoded by these genes, Fig1p, Fig2p, and Fig4p, are dispensible for cell polarization in uniform concentrations of mating pheromone, but are required for normal cell polarization in mating mixtures, conditions that involve cell-cell communication. Fig1p and Fig2p are also important for cell fusion and conjugation bridge shape, respectively. The fourth protein, Kar5p/Fig3p, is required for nuclear fusion. Fig1p and Fig2p are likely to act at the cell surface as Fig1:: beta-gal and Fig2::beta-gal fusion proteins localize to the periphery of mating cells. Fig4p is a member of a family of eukaryotic proteins that contain a domain homologous to the yeast Sac1p. Our results indicate that a variety of novel genes are expressed specifically during mating differentiation to mediate proper cell morphogenesis, cell fusion, and other steps of the mating process.

  7. Candidate egg case silk genes for the spider Argiope argentata from differential gene expression analyses.

    PubMed

    Chaw, R C; Arensburger, P; Clarke, T H; Ayoub, N A; Hayashi, C Y

    2016-12-01

    Orb-web weaving spiders produce a variety of task-specific silks from specialized silk glands. The genetics underlying the synthesis of specific silk types are largely unknown, and transcriptome analysis could be a powerful approach for identifying candidate genes. However, de novo assembly and expression profiling of silk glands with RNA-sequencing (RNAseq) are problematic because the few known gene transcripts for silk proteins are extremely long and highly repetitive. To identify candidate genes for tubuliform (egg case) silk synthesis by the orb-weaver Argiope argentata (Araneidae), we estimated transcript abundance using two sequencing methods: RNAseq reads from throughout the length of mRNA molecules, and 3' digital gene expression reads from the 3' region of mRNA molecules. Both analyses identified similar sets of genes as differentially expressed when comparing tubuliform and nonsilk gland tissue. However, incompletely assembled silk gene transcripts were identified as differentially expressed because of RNAseq read alignments to highly repetitive regions, confounding interpretation of RNAseq results. Homologues of egg case silk protein (ECP) genes were upregulated in tubuliform glands. This discovery is the first description of ECP homologues in an araneid. We also propose additional candidate genes involved in synthesis of tubuliform or other silk types. © 2016 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society.

  8. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  9. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  10. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  11. Statistical ensemble of gene regulatory networks of macrophage differentiation.

    PubMed

    Castiglione, Filippo; Tieri, Paolo; Palma, Alessandro; Jarrah, Abdul Salam

    2016-12-22

    Macrophages cover a major role in the immune system, being the most plastic cell yielding several key immune functions. Here we derived a minimalistic gene regulatory network model for the differentiation of macrophages into the two phenotypes M1 (pro-) and M2 (anti-inflammatory). To test the model, we simulated a large number of such networks as in a statistical ensemble. In other words, to enable the inter-cellular crosstalk required to obtain an immune activation in which the macrophage plays its role, the simulated networks are not taken in isolation but combined with other cellular agents, thus setting up a discrete minimalistic model of the immune system at the microscopic/intracellular (i.e., genetic regulation) and mesoscopic/intercellular scale. We show that within the mesoscopic level description of cellular interaction and cooperation, the gene regulatory logic is coherent and contributes to the overall dynamics of the ensembles that shows, statistically, the expected behaviour.

  12. Evolution of tuf genes: ancient duplication, differential loss and gene conversion.

    PubMed

    Lathe, W C; Bork, P

    2001-08-03

    The tuf gene of eubacteria, encoding the EF-tu elongation factor, was duplicated early in the evolution of the taxon. Phylogenetic and genomic location analysis of 20 complete eubacterial genomes suggests that this ancient duplication has been differentially lost and maintained in eubacteria.

  13. DNA methylation and differential gene regulation in photoreceptor cell death.

    PubMed

    Farinelli, P; Perera, A; Arango-Gonzalez, B; Trifunovic, D; Wagner, M; Carell, T; Biel, M; Zrenner, E; Michalakis, S; Paquet-Durand, F; Ekström, P A R

    2014-12-04

    Retinitis pigmentosa (RP) defines a group of inherited degenerative retinal diseases causing progressive loss of photoreceptors. To this day, RP is still untreatable and rational treatment development will require a thorough understanding of the underlying cell death mechanisms. Methylation of the DNA base cytosine by DNA methyltransferases (DNMTs) is an important epigenetic factor regulating gene expression, cell differentiation, cell death, and survival. Previous studies suggested an involvement of epigenetic mechanisms in RP, and in this study, increased cytosine methylation was detected in dying photoreceptors in the rd1, rd2, P23H, and S334ter rodent models for RP. Ultrastructural analysis of photoreceptor nuclear morphology in the rd1 mouse model for RP revealed a severely altered chromatin structure during retinal degeneration that coincided with an increased expression of the DNMT isozyme DNMT3a. To identify disease-specific differentially methylated DNA regions (DMRs) on a genomic level, we immunoprecipitated methylated DNA fragments and subsequently analyzed them with a targeted microarray. Genome-wide comparison of DMRs between rd1 and wild-type retina revealed hypermethylation of genes involved in cell death and survival as well as cell morphology and nervous system development. When correlating DMRs with gene expression data, we found that hypermethylation occurred alongside transcriptional repression. Consistently, motif analysis showed that binding sites of several important transcription factors for retinal physiology were hypermethylated in the mutant model, which also correlated with transcriptional silencing of their respective target genes. Finally, inhibition of DNMTs in rd1 organotypic retinal explants using decitabine resulted in a substantial reduction of photoreceptor cell death, suggesting inhibition of DNA methylation as a potential novel treatment in RP.

  14. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  15. Differential Shannon entropy and differential coefficient of variation: alternatives and augmentations to differential expression in the search for disease-related genes.

    PubMed

    Wang, Kai; Phillips, Charles A; Rogers, Gary L; Barrenas, Fredrik; Benson, Mikael; Langston, Michael A

    2014-01-01

    Differential expression has been a standard tool for analysing case-control transcriptomic data since the advent of microarray technology. It has proved invaluable in characterising the molecular mechanisms of disease. Nevertheless, the expression profile of a gene across samples can be perturbed in ways that leave the expression level unaltered, while a biological effect is nonetheless present. This paper describes and analyses differential Shannon entropy and differential coefficient of variation, two alternate techniques for identifying genes of interest. Ontological analysis across 16 human disease datasets demonstrates that these alternatives are effective at identifying disease-related genes not found by mere differential expression alone. Because the two alternate techniques are based on somewhat different mathematical formulations, they tend to produce somewhat different gene lists. Moreover, each may pinpoint genes completely overlooked by the other. Thus, measures of entropy and variation can be used to replace or better yet augment standard differential expression computations.

  16. Identification of genes differentially expressed in menstrual breakdown and repair.

    PubMed

    Paiva, Premila; Lockhart, Michelle G; Girling, Jane E; Olshansky, Moshe; Woodrow, Nicole; Marino, Jennifer L; Hickey, Martha; Rogers, Peter A W

    2016-12-01

    Does the changing molecular profile of the endometrium during menstruation correlate with the histological profile of menstruation. We identified several genes not previously associated with menstruation; on Day 2 of menstruation (early-menstruation), processes related to inflammation are predominantly up-regulated and on Day 4 (late-menstruation), the endometrium is predominantly repairing and regenerating. Menstruation is induced by progesterone withdrawal at the end of the menstrual cycle and involves endometrial tissue breakdown, regeneration and repair. Perturbations in the regulation of menstruation may result in menstrual disorders including abnormal uterine bleeding. Endometrial samples were collected by Pipelle biopsy on Days 2 (n = 9), 3 (n = 9) or 4 (n = 6) of menstruation. RNA was extracted from endometrial biopsies and analysed by genome wide expression Illumina Sentrix Human HT12 arrays. Data were analysed using 'Remove Unwanted Variation-inverse (RUV-inv)'. Ingenuity pathway analysis (IPA) and the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 were used to identify canonical pathways, upstream regulators and functional gene clusters enriched between Days 2, 3 and 4 of menstruation. Selected individual genes were validated by quantitative PCR. Overall, 1753 genes were differentially expressed in one or more comparisons. Significant canonical pathways, gene clusters and upstream regulators enriched during menstrual bleeding included those associated with immune cell trafficking, inflammation, cell cycle regulation, extracellular remodelling and the complement and coagulation cascade. We provide the first evidence for a role for glutathione-mediated detoxification (glutathione-S-transferase mu 1 and 2; GSTM1 and GSTM2) during menstruation. The largest number of differentially expressed genes was between Days 2 and 4 of menstruation (n = 1176). We identified several genes not previously associated with menstruation

  17. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  18. Genomic differentiation among wild cyanophages despite widespread horizontal gene transfer

    DOE PAGES

    Gregory, Ann C.; Solonenko, Sergei A.; Ignacio-Espinoza, J. Cesar; ...

    2016-11-16

    Genetic recombination is a driving force in genome evolution. Among viruses it has a dual role. For genomes with higher fitness, it maintains genome integrity in the face of high mutation rates. Conversely, for genomes with lower fitness, it provides immediate access to sequence space that cannot be reached by mutation alone. Understanding how recombination impacts the cohesion and dissolution of individual whole genomes within viral sequence space is poorly understood across double-stranded DNA bacteriophages (a.k.a phages) due to the challenges of obtaining appropriately scaled genomic datasets. Here in this study we explore the role of recombination in both maintainingmore » and differentiating whole genomes of 142 wild double-stranded DNA marine cyanophages. Phylogenomic analysis across the 51 core genes revealed ten lineages, six of which were well represented. These phylogenomic lineages represent discrete genotypic populations based on comparisons of intra- and inter- lineage shared gene content, genome-wide average nucleotide identity, as well as detected gaps in the distribution of pairwise differences between genomes. McDonald-Kreitman selection tests identified putative niche-differentiating genes under positive selection that differed across the six well-represented genotypic populations and that may have driven initial divergence. Concurrent with patterns of recombination of discrete populations, recombination analyses of both genic and intergenic regions largely revealed decreased genetic exchange across individual genomes between relative to within populations. Lastly, these findings suggest that discrete double-stranded DNA marine cyanophage populations occur in nature and are maintained by patterns of recombination akin to those observed in bacteria, archaea and in sexual eukaryotes.« less

  19. Genomic differentiation among wild cyanophages despite widespread horizontal gene transfer

    SciTech Connect

    Gregory, Ann C.; Solonenko, Sergei A.; Ignacio-Espinoza, J. Cesar; LaButti, Kurt; Copeland, Alex; Sudek, Sebastian; Maitland, Ashley; Chittick, Lauren; dos Santos, Filipa; Weitz, Joshua S.; Worden, Alexandra Z.; Woyke, Tanja; Sullivan, Matthew B.

    2016-11-16

    Genetic recombination is a driving force in genome evolution. Among viruses it has a dual role. For genomes with higher fitness, it maintains genome integrity in the face of high mutation rates. Conversely, for genomes with lower fitness, it provides immediate access to sequence space that cannot be reached by mutation alone. Understanding how recombination impacts the cohesion and dissolution of individual whole genomes within viral sequence space is poorly understood across double-stranded DNA bacteriophages (a.k.a phages) due to the challenges of obtaining appropriately scaled genomic datasets. Here in this study we explore the role of recombination in both maintaining and differentiating whole genomes of 142 wild double-stranded DNA marine cyanophages. Phylogenomic analysis across the 51 core genes revealed ten lineages, six of which were well represented. These phylogenomic lineages represent discrete genotypic populations based on comparisons of intra- and inter- lineage shared gene content, genome-wide average nucleotide identity, as well as detected gaps in the distribution of pairwise differences between genomes. McDonald-Kreitman selection tests identified putative niche-differentiating genes under positive selection that differed across the six well-represented genotypic populations and that may have driven initial divergence. Concurrent with patterns of recombination of discrete populations, recombination analyses of both genic and intergenic regions largely revealed decreased genetic exchange across individual genomes between relative to within populations. Lastly, these findings suggest that discrete double-stranded DNA marine cyanophage populations occur in nature and are maintained by patterns of recombination akin to those observed in bacteria, archaea and in sexual eukaryotes.

  20. Differential Gene Susceptibility to Sperm DNA Damage: Analysis of Developmental Key Genes in Trout

    PubMed Central

    González-Rojo, Silvia; Fernández-Díez, Cristina; Guerra, Susana M.; Robles, Vanesa; Herraez, Maria Paz

    2014-01-01

    Sperm chromatin in mammals is packaged in different blocks associated to protamines (PDNA), histones (HDNA), or nuclear matrix proteins. Differential packaging has been related to early or late transcription and also to differential susceptibility to genotoxic damage. Genes located in the more accessible HDNA could be more susceptible to injuries than those located in PDNA, being potential biomarkers of paternal DNA damage. Fish sperm chromatin organization is much diversified, some species lacking protamines and some others totally depleted of histones. Analyzing genotoxic damage in a species homogeneously compacted with some sperm nuclear basic protein type, could help in deciphering the clues of differential susceptibility to damage. In the present study we analyzed in rainbow trout the differential susceptibility of nine genes to UV irradiation and H2O2 treatment. The absence of histones in the sperm nuclei was confirmed by Western blot. The chromatin fractionation in sensitive and resistant regions to PvuII (presumably HDNA-like and PDNA-like, respectively) revealed that the nine genes locate in the same resistant region. The number of lesions promoted was quantified using a qPCR approach. Location of 8-hydroxyguanosine (8-OHdG) was analyzed by immunocytochemistry and confocal microscopy. UV irradiation promoted similar number of lesions in all the analyzed genes and a homogenous distribution of 8-OHdG within the nuclei. 8-OHdG was located in the peripheral area of the nucleus after H2O2 treatment, which promoted a significantly higher number of lesions in developmental-related genes (8.76–10.95 lesions/10 kb) than in rDNA genes (1.05–1.67 lesions/10 kb). We showed for the first time, that differential susceptibility to damage is dependent on the genotoxic mechanism and relies on positional differences between genes. Sensitive genes were also analyzed in cryopreserved sperm showing a lower number of lesions than the previous treatments and a predominant

  1. Differential toxicity and venom gland gene expression in Centruroides vittatus.

    PubMed

    McElroy, Thomas; McReynolds, C Neal; Gulledge, Alyssa; Knight, Kelci R; Smith, Whitney E; Albrecht, Eric A

    2017-01-01

    Variation in venom toxicity and composition exists in many species. In this study, venom potency and venom gland gene expression was evaluated in Centruroides vittatus, size class I-II (immature) and size class IV (adults/penultimate instars) size classes. Venom toxicity was evaluated by probit analysis and returned ED50 values of 50.1 μg/g for class IV compared to 134.2 μg/g for class I-II 24 hours post injection, suggesting size class IV was 2.7 fold more potent. Next generation sequencing (NGS and qPCR were used to characterize venom gland gene expression. NGS data was assembled into 36,795 contigs, and annotated using BLASTx with UNIPROT. EdgeR analysis of the sequences showed statistically significant differential expression in transcripts associated with sodium and potassium channel modulation. Sodium channel modulator expression generally favored size class IV; in contrast, potassium channel modulators were favored in size class I-II expression. Real-time quantitative PCR of 14 venom toxin transcripts detected relative expression ratios that paralleled NGS data and identified potential family members or splice variants for several sodium channel modulators. Our data suggests ontogenetic differences in venom potency and venom related genes expression exist between size classes I-II and IV.

  2. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  3. Immunohistochemical diagnosis of tenacibaculosis in paraffin-embedded tissues of Senegalese sole Solea senegalensis Kaup, 1858.

    PubMed

    Faílde, L D; Bermúdez, R; Losada, A P; Riaza, A; Santos, Y; Quiroga, M I

    2014-11-01

    A sensitive and specific immunohistochemical technique was developed to improve the diagnosis of tenacibaculosis and to better understand its pathogenesis. Senegalese sole Solea senegalensis Kaup, 1858 were inoculated subcutaneously with a bacterial suspension of Tenacibaculum maritimum, and samples were taken at different hours post-inoculation. Sections from different organs were used as positive controls. In addition, a total of 128 field samples from different organs collected from tenacibaculosis outbreaks were used. Tenacibaculum maritimum antigens were detected in several organs of experimentally infected Senegalese sole and in at least one of the tissues from fish suffering from natural tenacibaculosis previously confirmed by culture and PCR-based methods. In fish collected during outbreaks, a strong positive reaction was detected in ulcerative skin areas. Moreover, bacterial antigen was identified inside scale pockets and in sites of the skin with mild lesion. In kidney and spleen, evident immunostaining of bacterial antigen was detected in both naturally and experimentally infected fish. Besides, the presence of T. maritimum in the intestinal tract without associated histological changes suggests that this organ may act as a reservoir for T. maritimum. The results of this study confirm the usefulness of IHC for the diagnosis of tenacibaculosis in paraffin-embedded tissues.

  4. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia.

    PubMed

    Terenina, Elena; Fabre, Stephane; Bonnet, Agnès; Monniaux, Danielle; Robert-Granié, Christèle; SanCristobal, Magali; Sarry, Julien; Vignoles, Florence; Gondret, Florence; Monget, Philippe; Tosser-Klopp, Gwenola

    2017-02-01

    Ovarian folliculogenesis corresponds to the development of follicles leading to either ovulation or degeneration, this latter process being called atresia. Even if atresia involves apoptosis, its mechanism is not well understood. The objective of this study was to analyze global gene expression in pig granulosa cells of ovarian follicles during atresia. The transcriptome analysis was performed on a 9,216 cDNA microarray to identify gene networks and candidate genes involved in pig ovarian follicular atresia. We found 1,684 significantly regulated genes to be differentially regulated between small healthy follicles and small atretic follicles. Among them, 287 genes had a fold-change higher than two between the two follicle groups. Eleven genes (DKK3, GADD45A, CAMTA2, CCDC80, DAPK2, ECSIT, MSMB, NUPR1, RUNX2, SAMD4A, and ZNF628) having a fold-change higher than five between groups could likely serve as markers of follicular atresia. Moreover, automatic confrontation of deregulated genes with literature data highlighted 93 genes as regulatory candidates of pig granulosa cell atresia. Among these genes known to be inhibitors of apoptosis, stimulators of apoptosis, or tumor suppressors INHBB, HNF4, CLU, different interleukins (IL5, IL24), TNF-associated receptor (TNFR1), and cytochrome-c oxidase (COX) were suggested as playing an important role in porcine atresia. The present study also enlists key upstream regulators in follicle atresia based on our results and on a literature review. The novel gene candidates and gene networks identified in the current study lead to a better understanding of the molecular regulation of ovarian follicular atresia. Copyright © 2017 the American Physiological Society.

  5. Differential transformation of mammary epithelial cells by Wnt genes.

    PubMed Central

    Wong, G T; Gavin, B J; McMahon, A P

    1994-01-01

    The mouse Wnt family includes at least 10 genes that encode structurally related secreted glycoproteins. Wnt-1 and Wnt-3 were originally identified as oncogenes activated by the insertion of mouse mammary tumor virus in virus-induced mammary adenocarcinomas, although they are not expressed in the normal mammary gland. However, five other Wnt genes are differentially expressed during development of adult mammary tissue, suggesting that they may play distinct roles in various phases of mammary gland growth and development. Induction of transformation by Wnt-1 and Wnt-3 may be due to interference with these normal regulatory events; however, there is no direct evidence for this hypothesis. We have tested Wnt family members for the ability to induce transformation of cultured mammary cells. The results demonstrate that the Wnt gene family can be divided into three groups depending on their ability to induce morphological transformation and altered growth characteristics of the C57MG mammary epithelial cell line. Wnt-1, Wnt-3A, and Wnt-7A were highly transforming and induced colonies which formed and shed balls of cells. Wnt-2, Wnt-5B, and Wnt-7B also induced transformation but with a lower frequency and an apparent decrease in saturation density. In contrast, Wnt-6 and two other family members which are normally expressed in C57MG cells, Wnt-4 and Wnt-5A, failed to induce transformation. These data demonstrate that the Wnt genes have distinct effects on cell growth and should not be regarded as functionally equivalent. Images PMID:8065359

  6. Screening key genes associated with congenital heart defects in Down syndrome based on differential expression network.

    PubMed

    Yu, Shan; Yi, Huani; Wang, Zhimin; Dong, Juan

    2015-01-01

    Down syndrome (DS) is the most common viable chromosomal disorder with intellectual impairment and several other developmental abnormalities. Forty to fifty percent of newborns with DS have some form of congenital heart defects (CHD). The genome of CHD in DS has already been obtained, but the underlying genomic or gene expression variation that contributes to the manifestation of a CHD in DS is still unknown. This study was aimed to analyze key genes of patients with CHD in DS. Differential expression network (DEN) approach was employed to analyze the dyeregulated genes and pathways in this study. First, the differentially expressed genes (DEGs) between CHD in DS and normal subjects were screened based on the microarray expression data. Next, the differential interactions were identified using spearman correlation coefficients of edges in different conditions. The DEN was then constructed combining both DEGs and differential interactions, and HUB genes were gained by degree centrality analysis of DEN. Meanwhile, disease genes included in the DEN were also ascertained. When analyzing gene expression values in different conditions, no DEGs were identified. While, a total of 984 gene pairs with significant differential expression were identified. Finally, the DEN was constructed only using differential edges in our study. In this network, eight HUB genes were identified, and thereinto four genes (UBC, APP, HUWE1 and SRC) were both HUB genes and disease genes. DEN approach should be taken as a useful complement to traditional differential genes methods. We provide several potential underlying biomarkers for CHD in DS.

  7. CT gene modulate differential expression of chitinase gene under variant habitats in Vibrio cholerae

    PubMed Central

    Verma, Yogendra Kumar; Verma, Mahendra Kumar

    2013-01-01

    Objective To investigate the interrelation of cholera toxin gene (CT gene) in expression of chitinase gene under different pH conditions among pathogenic and Non-pathogenic strains of Vibrio cholera (V. cholera). Methods The chitinase assay well diffusion method and calorimetric chitinase assay were performed. Further, time depended chitinase activity among pathogenic and nonpathogenic strain was evaluated with control as Escherichia coli. The expressed protein in variant environment was purified by cascade of chromatographic techniques. The partially purified protein was analyzed by SDS-PAGE in both the strain of V. cholera. Results The results have shown differential expression of chitinase gene among vibrio in time depended chitinase activity, purification of expressed protein and SDS-PAGE analysis. Conclusions From the current study, two conclusions came in picture, habitat is prime factor that regulation of chitin gene expression among many bacterial strains, second, moreover among the vibrio pathogenic strains (CT+) expression of chitinase gene is more precisely regulated by CT gene rather than external environments while in non-pathogenic strain ( CT-) completely absent.

  8. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  9. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia

    PubMed Central

    Ge, Yubin; Dombkowski, Alan A.; LaFiura, Katherine M.; Tatman, Dana; Yedidi, Ravikiran S.; Stout, Mark L.; Buck, Steven A.; Massey, Gita; Becton, David L.; Weinstein, Howard J.; Ravindranath, Yaddanapudi; Matherly, Larry H.; Taub, Jeffrey W.

    2006-01-01

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins. PMID:16249385

  10. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae)

    PubMed Central

    Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061

  11. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia.

    PubMed

    Ge, Yubin; Dombkowski, Alan A; LaFiura, Katherine M; Tatman, Dana; Yedidi, Ravikiran S; Stout, Mark L; Buck, Steven A; Massey, Gita; Becton, David L; Weinstein, Howard J; Ravindranath, Yaddanapudi; Matherly, Larry H; Taub, Jeffrey W

    2006-02-15

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins.

  12. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae).

    PubMed

    Behringer, David; Zimmermann, Heike; Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  13. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    PubMed

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  14. Microarray analysis of differentially expressed genes in preeclamptic and normal placental tissues.

    PubMed

    Ma, K; Lian, Y; Zhou, S; Hu, R; Xiong, Y; Ting, P; Xiong, Y; Li, X; Wang, X

    2014-01-01

    To detect the candidate genes for preeclampsia (PE). The gene expression profiles in preeclamptic and normal placental tissues were analyzed using cDNA microarray approach and the altered expression of important genes were further confirmed by real-time RT-PCR (reverse transcription polymerase chain reaction) technique. Total RNA was extracted from placental tissues of three cases with severe PE and from three cases with normal pregnancy. After scanning, differentially expressed genes were detected by software. In two experiments (the fluorescent labels were exchanged), a total of 111 differentially expressed genes were detected. In placental tissue ofpreeclamptic pregnancy, 68 differentially expressed genes were up-regulated, and 44 differentially expressed genes were down-regulated. Of these genes, 16 highly differentially expressed genes were confirmed by real-time fluorescent quantitative RT-PCR, and the result showed that the ratio of gene expression differences was comparable to that detected by cDNA microarray. The results of bioinformatic analysis showed that encoding products of differentially expressed genes were correlated to infiltration of placenta trophoblastic cells, immunomodulatory factors, pregnancy-associated plasma protein, signal transduction pathway, and cell adhesion. Further studies on the biological function and regulating mechanism of these genes will provide new clues for better understanding of etiology and pathogenesis of PE.

  15. Differential gene expression analysis of Paracoccidioides brasiliensis during keratinocyte infection.

    PubMed

    Peres da Silva, Roberta; Matsumoto, Marcelo Teruyuki; Braz, Jaqueline Derissi; Voltan, Aline Raquel; de Oliveira, Haroldo Cesar; Soares, Christiane Pienna; Mendes Giannini, Maria José Soares

    2011-03-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, one of the most important systemic fungal diseases in Latin America. This initiates in lung tissue and can subsequently disseminate to other tissues. Clinical manifestations range from localized forms to disseminated disease that can progress to lethality, probably depending on the relationships among the virulence of the fungus, the immune response and the ability to interact with the surface structures and invade epithelial cells and mononuclear cells of the host. It is generally regarded as a multifocal disease, with oral lesions as the prominent feature. The aim of this study was to evaluate P. brasiliensis yeast infection in normal oral keratinocytes (NOKs). The differential expression of mRNAs and proteins was also determined when the fungus was placed in contact with the cell in order to characterize differentially expressed genes and proteins during P. brasiliensis infection. After contact with NOKs, the fungus appeared to induce alterations in the cells, which showed cellular extensions and cavitations, probably resulting from changes in the actin cytoskeleton seen at 5 and 8 h after infection. Levels of protein expression were higher after reisolation of the fungus from infected NOK culture compared with culture of the fungus in medium. The analysis identified transcripts related to 19 proteins involved in different biological processes. Transcripts were found with multiple functions including induction of cytokines, protein metabolism, alternative carbon metabolism, zinc transport and the stress response during contact with NOKs. The proteins found suggested that the yeast was in a stress situation, as indicated by the presence of RDS1. Nevertheless, the yeast seemed to be proliferating and metabolically active, as shown by the presence of a proteasome, short-chain acetylator, glucosamine-6-phosphate isomerase and ADP/ATP carrier transcripts. Additionally, metabolic pathways may

  16. The APOE Gene is Differentially Methylated in Alzheimer's Disease.

    PubMed

    Foraker, Jessica; Millard, Steven P; Leong, Lesley; Thomson, Zachary; Chen, Sunny; Keene, C Dirk; Bekris, Lynn M; Yu, Chang-En

    2015-01-01

    The ɛ4 allele of the human apolipoprotein E gene (APOE) is a well-proven genetic risk factor for the late onset form of Alzheimer's disease (AD). However, the biological mechanisms through which the ɛ4 allele contributes to disease pathophysiology are incompletely understood. The three common alleles of APOE, ɛ2, ɛ3 and ɛ4, are defined by two single nucleotide polymorphisms (SNPs) that reside in the coding region of exon 4, which overlaps with a well-defined CpG island (CGI). Both SNPs change not only the protein codon but also the quantity of CpG dinucleotides, primary sites for DNA methylation. Thus, we hypothesize that the presence of an ɛ4 allele changes the DNA methylation landscape of the APOE CGI and that such epigenetic alteration contributes to AD susceptibility. To explore the relationship between APOE genotype, AD risk, and DNA methylation of the APOE CGI, we applied bisulfite pyrosequencing and evaluated methylation profiles of postmortem brain from 15 AD and 10 control subjects. We observed a tissue-specific decrease in DNA methylation with AD and identified two AD-specific differentially methylated regions (DMRs), which were also associated with APOE genotype. We further demonstrated that one DMR was completely un-methylated in a sub-population of genomes, possibly due to a subset of brain cells carrying deviated APOE methylation profiles. These data suggest that the APOE CGI is differentially methylated in AD brain in a tissue- and APOE-genotype-specific manner. Such epigenetic alteration might contribute to neural cell dysfunction in AD brain.

  17. Differential gene expression in anterior and posterior annulus fibrosus.

    PubMed

    Koerner, John D; Markova, Dessislava Z; Yadla, Sanjay; Mendelis, Joseph; Hilibrand, Alan; Vaccaro, Alexander R; Risbud, Makarand V; Albert, Todd J; Anderson, D Greg; Kepler, Christopher K

    2014-11-01

    Laboratory study. To evaluate the differential gene expression of cytokines and growth factors in anterior versus posterior annulus fibrosus (AF) intervertebral disc (IVD) specimens. Histological analysis has demonstrated regional differences in vascular and neural ingrowth in the IVD, and similar differences may exist for cytokine and growth factor expression in patients with degenerative disc disease (DDD). Regional expression of these cytokines may also be related to the pain experienced in DDD. IVD tissue was obtained from patients undergoing anterior lumbar interbody fusion surgery for back pain with radiological evidence of disc degeneration. For a control group, the discs of patients undergoing anterior lumbar discectomy for degenerative scoliosis were obtained as well. The tissue was carefully removed and separated into anterior and posterior AF. After tissue processing, an antibody array was completed to determine expression levels of 42 cytokines and growth factors. Nine discs from 7 patients with DDD and 5 discs from 2 patients with scoliosis were analyzed. In the DDD group, there were 10 cytokines and growth factors with significantly increased expression in the posterior AF versus the anterior AF ([interleukin] IL-4, IL-5, IL-6, M-CSF, MDC, tumor necrosis factor β, EGF, IGF-1, angiogenin, leptin). In the scoliosis group, only angiogenin and PDGF-BB demonstrated increased expression in the posterior AF. No cytokines or growth factors had increased expression in the anterior AF compared with posterior AF. The posterior AF expresses increased levels of cytokines and growth factors compared with the anterior AF in patients with DDD. This differential expression may be important for targeting treatment of painful IVDs. N/A.

  18. Gene duplication, population genomics, and species-level differentiation within a tropical mountain shrub.

    PubMed

    Mastretta-Yanes, Alicia; Zamudio, Sergio; Jorgensen, Tove H; Arrigo, Nils; Alvarez, Nadir; Piñero, Daniel; Emerson, Brent C

    2014-09-14

    Gene duplication leads to paralogy, which complicates the de novo assembly of genotyping-by-sequencing (GBS) data. The issue of paralogous genes is exacerbated in plants, because they are particularly prone to gene duplication events. Paralogs are normally filtered from GBS data before undertaking population genomics or phylogenetic analyses. However, gene duplication plays an important role in the functional diversification of genes and it can also lead to the formation of postzygotic barriers. Using populations and closely related species of a tropical mountain shrub, we examine 1) the genomic differentiation produced by putative orthologs, and 2) the distribution of recent gene duplication among lineages and geography. We find high differentiation among populations from isolated mountain peaks and species-level differentiation within what is morphologically described as a single species. The inferred distribution of paralogs among populations is congruent with taxonomy and shows that GBS could be used to examine recent gene duplication as a source of genomic differentiation of nonmodel species.

  19. Gene amplification during differentiation of mammalian neural stem cells in vitro and in vivo.

    PubMed

    Fischer, Ulrike; Backes, Christina; Raslan, Abdulrahman; Keller, Andreas; Meier, Carola; Meese, Eckart

    2015-03-30

    In development of amphibians and flies, gene amplification is one of mechanisms to increase gene expression. In mammalian cells, gene amplification seems to be restricted to tumorigenesis and acquiring of drug-resistance in cancer cells. Here, we report a complex gene amplification pattern in mouse neural progenitor cells during differentiation with approximately 10% of the genome involved. Half of the amplified mouse chromosome regions overlap with amplified regions previously reported in human neural progenitor cells, indicating conserved mechanisms during differentiation. Using fluorescence in situ hybridization, we verified the amplification in single cells of primary mouse mesencephalon E14 (embryonic stage) neurosphere cells during differentiation. In vivo we confirmed gene amplifications of the TRP53 gene in cryosections from mouse embryos at stage E11.5. Gene amplification is not only a cancer-related mechanism but is also conserved in evolution, occurring during differentiation of mammalian neural stem cells.

  20. Exact solutions and maximal dimension of invariant subspaces of time fractional coupled nonlinear partial differential equations

    NASA Astrophysics Data System (ADS)

    Sahadevan, R.; Prakash, P.

    2017-01-01

    We show how invariant subspace method can be extended to time fractional coupled nonlinear partial differential equations and construct their exact solutions. Effectiveness of the method has been illustrated through time fractional Hunter-Saxton equation, time fractional coupled nonlinear diffusion system, time fractional coupled Boussinesq equation and time fractional Whitman-Broer-Kaup system. Also we explain how maximal dimension of the time fractional coupled nonlinear partial differential equations can be estimated.

  1. Incorporating prior biological knowledge for network-based differential gene expression analysis using differentially weighted graphical LASSO.

    PubMed

    Zuo, Yiming; Cui, Yi; Yu, Guoqiang; Li, Ruijiang; Ressom, Habtom W

    2017-02-10

    Conventional differential gene expression analysis by methods such as student's t-test, SAM, and Empirical Bayes often searches for statistically significant genes without considering the interactions among them. Network-based approaches provide a natural way to study these interactions and to investigate the rewiring interactions in disease versus control groups. In this paper, we apply weighted graphical LASSO (wgLASSO) algorithm to integrate a data-driven network model with prior biological knowledge (i.e., protein-protein interactions) for biological network inference. We propose a novel differentially weighted graphical LASSO (dwgLASSO) algorithm that builds group-specific networks and perform network-based differential gene expression analysis to select biomarker candidates by considering their topological differences between the groups. Through simulation, we showed that wgLASSO can achieve better performance in building biologically relevant networks than purely data-driven models (e.g., neighbor selection, graphical LASSO), even when only a moderate level of information is available as prior biological knowledge. We evaluated the performance of dwgLASSO for survival time prediction using two microarray breast cancer datasets previously reported by Bild et al. and van de Vijver et al. Compared with the top 10 significant genes selected by conventional differential gene expression analysis method, the top 10 significant genes selected by dwgLASSO in the dataset from Bild et al. led to a significantly improved survival time prediction in the independent dataset from van de Vijver et al. Among the 10 genes selected by dwgLASSO, UBE2S, SALL2, XBP1 and KIAA0922 have been confirmed by literature survey to be highly relevant in breast cancer biomarker discovery study. Additionally, we tested dwgLASSO on TCGA RNA-seq data acquired from patients with hepatocellular carcinoma (HCC) on tumors samples and their corresponding non-tumorous liver tissues. Improved

  2. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji

    2016-01-01

    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  3. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells.

    PubMed

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji; Furue, Miho K

    2016-12-15

    Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines.

  4. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  5. Divergent fructokinase genes are differentially expressed in tomato.

    PubMed Central

    Kanayama, Y; Dai, N; Granot, D; Petreikov, M; Schaffer, A; Bennett, A B

    1997-01-01

    Two cDNA clones (Frk1 and Frk2) encoding fructokinase (EC 2.7.1.4) were isolated from tomato (Lycopersicon esculentum). The Frk2 cDNA encoded a deduced protein of 328 amino acids that was more than 90% identical with a previously characterized potato (Solanum tuberosum) fructokinase. In contrast, the Frk1 cDNA encoded a deduced protein of 347 amino acids that shared only 55% amino acid identity with Frk2. Both deduced proteins possessed and ATP-binding motif and putative substrate recognition site sequences identified in bacterial fructokinases. The Frk1 cDNA was expressed in a mutant yeast (Saccharomyces cerevisiae) line, which lacks the ability to phosphorylate glucose and fructose and is unable to grow on glucose or fructose. Mutant cells expressing Frk1 were complemented to grow on fructose but not glucose, indicating that Frk1 phosphorylates fructose but not glucose, and this activity was verified in extracts of transformed yeast. The mRNA corresponding to Frk2 accumulated to high levels in young, developing tomato fruit, whereas the Frk1 mRNA accumulated to higher levels late in fruit development. The results indicate that fructokinase in tomato is encoded by two divergent genes, which exhibit a differential pattern of expression during fruit development. PMID:9112782

  6. Local differentiation in the presence of gene flow in the citril finch Serinus citrinella

    PubMed Central

    Senar, Juan Carlos; Borras, Antoni; Cabrera, Josep; Cabrera, Toni; Björklund, Mats

    2005-01-01

    It is well known theoretically that gene flow can impede genetic differentiation between populations. In this study, we show that in a highly mobile bird species, where dispersal is well documented, there is a strong genetic and morphological differentiation over a very short geographical scale (less than 5 km). Allocation tests revealed that birds caught in one area were assigned genetically to the same area with a very high probability, in spite of current gene flow. Populations were also morphologically differentiated. The results suggest that the relationship between gene flow and differentiation can be rather complicated and non-intuitive. PMID:17148333

  7. Differentiation phenotypes of pancreatic islet beta- and alpha-cells are closely related with homeotic genes and a group of differentially expressed genes.

    PubMed

    Mizusawa, Noriko; Hasegawa, Tomoko; Ohigashi, Izumi; Tanaka-Kosugi, Chisato; Harada, Nagakatsu; Itakura, Mitsuo; Yoshimoto, Katsuhiko

    2004-04-28

    To identify the genes that determine differentiation phenotypes, we compared gene expression of pancreatic islet beta- and alpha-cells, which are derived from the common precursor and secrete insulin and glucagon, respectively. The expression levels of homeotic genes including Hox genes known to determine region specificity in the antero-posterior (AP) body axis, tissue-specific homeobox genes, and other 8,734 genes were compared in a beta- and alpha-cell line of MIN6 and alpha TC1.6. The expression of homeotic genes were surveyed with reverse transcription-polymerase chain reaction (RT-PCR) using degenerate primers corresponding to invariant amino acid sequences within the homeodomain and subsequently with specific primers. Expression of Hoxc6, Hoxc9, Hoxc10, Pdx1, Cdx2, Gbx2, Pax4, and Hlxb9 genes in MIN6 was higher than those in alpha TC1.6, while expression of Hoxa2, Hoxa3, Hoxa5, Hoxa6, Hoxa7, Hoxa9, Hoxa10, Hoxa13, Hoxb3, Hoxb5, Hoxb6, Hoxb13, Hoxb8, and Brain4 genes in alpha TC1.6 was higher than those in MIN6. Out of 8,734 mouse genes screened with high-density mouse cDNA microarrays for MIN6- and alpha TC1.6-derived cDNA, 58 and 25 genes were differentially over- and under-expressed in MIN6, respectively. GLUTag, which is derived from a large bowel tumor and expresses the proglucagon gene, showed a comparatively similar expression profile to that of alpha TC1.6 in both homeotic and other genes analyzed in cDNA microarray. Our results are consistent with the interpretation that not only the tissue-specific homeotic genes, but also Hox genes are related to differentiation phenotypes of pancreatic beta- and alpha-cells rather than their regional specification of the body in vertebrates.

  8. A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes

    PubMed Central

    Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

    2015-01-01

    In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data. PMID:26201006

  9. Comprehensive DNA Methylation and Gene Expression Profiling in Differentiating Human Adipocytes.

    PubMed

    van den Dungen, Myrthe W; Murk, Albertinka J; Kok, Dieuwertje E; Steegenga, Wilma T

    2016-12-01

    Insight into the processes controlling adipogenesis is important in the battle against the obesity epidemic and its related disorders. The transcriptional regulatory cascade involved in adipocyte differentiation has been extensively studied, however, the mechanisms driving the transcription activation are still poorly understood. In this study, we explored the involvement of DNA methylation in transcriptional regulation during adipocyte differentiation of primary human mesenchymal stem cells (hMSCs). Genome-wide changes in DNA methylation were measured using the Illumina 450K BeadChip. In addition, expression of 84 adipogenic genes was determined, of which 43 genes showed significant expression changes during the differentiation process. Among these 43 differentially expressed genes, differentially methylated regions (DMRs) were detected in only three genes. By comparing genome-wide DNA methylation profiles in undifferentiated and differentiated adipocytes 793 significant DMRs were detected. Pathway analysis revealed the adipogenesis pathway as the most statistically significant, although only a small number of genes were differentially methylated. Genome-wide DNA methylation changes for single probes were most often located in intergenic regions, and underrepresented close to the transcription start site. In conclusion, DNA methylation remained relatively stable during adipocyte differentiation, implying that changes in DNA methylation are not the underlying mechanism regulating gene expression during adipocyte differentiation. J. Cell. Biochem. 117: 2707-2718, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Characterization of Differentially Expressed Genes Involved in Pathways Associated with Gastric Cancer

    PubMed Central

    Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhang, Jun; Li, Chen; Zhu, Zhenggang; Liu, Bingya

    2015-01-01

    To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR) value was < 0.01, P-value was <0.01 and the fold change (FC) was >2. Subsequently, Gene Ontology (GO) categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease. PMID:25928635

  11. Unravelling personalized dysfunctional gene network of complex diseases based on differential network model.

    PubMed

    Yu, Xiangtian; Zeng, Tao; Wang, Xiangdong; Li, Guojun; Chen, Luonan

    2015-06-13

    In the conventional analysis of complex diseases, the control and case samples are assumed to be of great purity. However, due to the heterogeneity of disease samples, many disease genes are even not always consistently up-/down-regulated, leading to be under-estimated. This problem will seriously influence effective personalized diagnosis or treatment. The expression variance and expression covariance can address such a problem in a network manner. But, these analyses always require multiple samples rather than one sample, which is generally not available in clinical practice for each individual. To extract the common and specific network characteristics for individual patients in this paper, a novel differential network model, e.g. personalized dysfunctional gene network, is proposed to integrate those genes with different features, such as genes with the differential gene expression (DEG), genes with the differential expression variance (DEVG) and gene-pairs with the differential expression covariance (DECG) simultaneously, to construct personalized dysfunctional networks. This model uses a new statistic-like measurement on differential information, i.e., a differential score (DEVC), to reconstruct the differential expression network between groups of normal and diseased samples; and further quantitatively evaluate different feature genes in the patient-specific network for each individual. This DEVC-based differential expression network (DEVC-net) has been applied to the study of complex diseases for prostate cancer and diabetes. (1) Characterizing the global expression change between normal and diseased samples, the differential gene networks of those diseases were found to have a new bi-coloured topological structure, where their non hub-centred sub-networks are mainly composed of genes/proteins controlling various biological processes. (2) The differential expression variance/covariance rather than differential expression is new informative sources, and can

  12. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  13. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  14. Fat accumulation in differentiated brown adipocytes is linked with expression of Hox genes.

    PubMed

    Singh, Smita; Rajput, Yudhishthir S; Barui, Amit K; Sharma, Rajan; Datta, Tirtha K

    2016-03-01

    Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes.

  15. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  16. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  17. Genome-wide gene amplification during differentiation of neural progenitor cells in vitro.

    PubMed

    Fischer, Ulrike; Keller, Andreas; Voss, Meike; Backes, Christina; Welter, Cornelius; Meese, Eckart

    2012-01-01

    DNA sequence amplification is a phenomenon that occurs predictably at defined stages during normal development in some organisms. Developmental gene amplification was first described in amphibians during gametogenesis and has not yet been described in humans. To date gene amplification in humans is a hallmark of many tumors. We used array-CGH (comparative genomic hybridization) and FISH (fluorescence in situ hybridization) to discover gene amplifications during in vitro differentiation of human neural progenitor cells. Here we report a complex gene amplification pattern two and five days after induction of differentiation of human neural progenitor cells. We identified several amplified genes in neural progenitor cells that are known to be amplified in malignant tumors. There is also a striking overlap of amplified chromosomal regions between differentiating neural progenitor cells and malignant tumor cells derived from astrocytes. Gene amplifications in normal human cells as physiological process has not been reported yet and may bear resemblance to developmental gene amplifications in amphibians and insects.

  18. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes

    PubMed Central

    Seo, Minseok; Shin, Su-kyung; Kwon, Eun-Young; Kim, Sung-Eun; Bae, Yun-Jung; Lee, Seungyeoun; Sung, Mi-Kyung; Choi, Myung-Sook; Park, Taesung

    2016-01-01

    Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs) among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs). However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods. Through analysis of

  19. Melanoma differentiation associated gene-7 (mda-7): a novel anti-tumor gene for cancer gene therapy.

    PubMed Central

    Mhashilkar, A. M.; Schrock, R. D.; Hindi, M.; Liao, J.; Sieger, K.; Kourouma, F.; Zou-Yang, X. H.; Onishi, E.; Takh, O.; Vedvick, T. S.; Fanger, G.; Stewart, L.; Watson, G. J.; Snary, D.; Fisher, P. B.; Saeki, T.; Roth, J. A.; Ramesh, R.; Chada, S.

    2001-01-01

    BACKGROUND: The mda-7 gene (melanoma differentiation associated gene-7) is a novel tumor suppressor gene. The anti-proliferative activity of MDA-7 has been previously reported. In this report, we analyze the anti-tumor efficacy of Ad-mda7 in a broad spectrum of cancer lines. MATERIALS AND METHODS: Ad-mda7-transduced cancer or normal cell lines were assayed for cell proliferation (tritiated thymidine incorporation assay, Alamar blue assay, and trypan-blue exclusion assay), apoptosis (TUNEL, and Annexin V staining visualized by fluorescent microscopy or FACs analysis), and cell cycle regulation (Propidium Iodide staining and FACs analysis). RESULTS: Ad-mda7 treatment of tumor cells resulted in growth inhibition and apoptosis in a temporal and dose-dependent manner. The anti-tumor effects were independent of the genomic status of p53, RB, p16, ras, bax, and caspase 3 in these cells. In addition, normal cell lines did not show inhibition of proliferation or apoptotic response to Ad-mda7. Moreover, Ad-mda7-transduced cancer cells secreted a soluble form of MDA-7 protein. Thus, Ad-mda7 may represent a novel gene-therapeutic agent for the treatment of a variety of cancers. CONCLUSIONS: The potent and selective killing activity of Ad-mda7 in cancer cells but not in normal cells makes this vector a potential candidate for cancer gene therapy. PMID:11471572

  20. RNAi Knockdown of Ape1 Gene in the Differentiation of Mouse Embryonic Stem Cells.

    PubMed

    Zou, Gang-Ming; Yu, Jieqing; LeBron, Cynthia; Fu, Yumei

    2017-01-01

    Murine embryonic stem cells (ES) are pluripotent cells and have the potential to become a wide variety of specialized cell types. Mouse ES cell differentiation can be regarded as a valuable biological tool that has led to major advances in our understanding of cell and developmental biology. In vitro differentiation of mouse ES cells can be directed to a specific lineage formation, such as hematopoietic lineage, by appropriate cytokine and/or growth factor stimulation. To study specific gene function in early developmental events, gene knockout approaches have been traditionally used, however, this is a time-consuming and expensive approach. Recently, we have shown that siRNA is an effective strategy to knock down target gene expression, such as Ape1, during ES cell differentiation, and consequently, one can alter cell fates in ES-derived differentiated cells. This approach will be applicable to test the function of a wide variety of gene products using the ES cell differentiation system.

  1. Differential expression of genes related to gain and intake in the liver of beef cattle

    USDA-ARS?s Scientific Manuscript database

    Background: To better understand which genes play a role in cattle feed intake and gain, we evaluated differential expression of genes related to gain and intake in the liver of crossbred beef steers. Based on past transcriptomics studies on cattle liver, we hypothesized that genes related to metabo...

  2. Identification of differentially expressed genes induced by beet curly top virus infection in sugarbeet

    USDA-ARS?s Scientific Manuscript database

    Resistance to beet curly top virus (BCTV) trait is crucial in Western USA. There is sparse public knowledge of genes regulating resistance. This research focused on gene expression profiling of resistance to the three BCTV strains: Cal/Logan (Cal), Worland (Wor), and severe. Differential gene exp...

  3. Comprehensive Gene Expression Analysis of Human Embryonic Stem Cells during Differentiation into Neural Cells

    PubMed Central

    Fathi, Ali; Hatami, Maryam; Hajihosseini, Vahid; Fattahi, Faranak; Kiani, Sahar; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2011-01-01

    Global gene expression analysis of human embryonic stem cells (hESCs) that differentiate into neural cells would help to further define the molecular mechanisms involved in neurogenesis in humans. We performed a comprehensive transcripteome analysis of hESC differentiation at three different stages: early neural differentiation, neural ectoderm, and differentiated neurons. We identified and validated time-dependent gene expression patterns and showed that the gene expression patterns reflect early ESC differentiation. Sets of genes are induced in primary ectodermal lineages and then in differentiated neurons, constituting consecutive waves of known and novel genes. Pathway analysis revealed dynamic expression patterns of members of several signaling pathways, including NOTCH, mTOR and Toll like receptors (TLR), during neural differentiation. An interaction network analysis revealed that the TGFβ family of genes, including LEFTY1, ID1 and ID2, are possible key players in the proliferation and maintenance of neural ectoderm. Collectively, these results enhance our understanding of the molecular dynamics underlying neural commitment and differentiation. PMID:21829537

  4. Differentially correlated genes in co-expression networks control phenotype transitions.

    PubMed

    Thomas, Lina D; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Co-expression networks are a tool widely used for analysis of "Big Data" in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as "bottlenecks" rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we showed that they play

  5. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  6. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes

    PubMed Central

    Premzl, Marko

    2015-01-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed. PMID:25941635

  7. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes.

    PubMed

    Premzl, Marko

    2015-06-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed.

  8. Joint analysis of differential gene expression in multiple studies using correlation motifs

    PubMed Central

    Wei, Yingying; Tenzen, Toyoaki; Ji, Hongkai

    2015-01-01

    The standard methods for detecting differential gene expression are mostly designed for analyzing a single gene expression experiment. When data from multiple related gene expression studies are available, separately analyzing each study is not ideal as it may fail to detect important genes with consistent but relatively weak differential signals in multiple studies. Jointly modeling all data allows one to borrow information across studies to improve the analysis. However, a simple concordance model, in which each gene is assumed to be differential in either all studies or none of the studies, is incapable of handling genes with study-specific differential expression. In contrast, a model that naively enumerates and analyzes all possible differential patterns across studies can deal with study-specificity and allow information pooling, but the complexity of its parameter space grows exponentially as the number of studies increases. Here, we propose a correlation motif approach to address this dilemma. This approach searches for a small number of latent probability vectors called correlation motifs to capture the major correlation patterns among multiple studies. The motifs provide the basis for sharing information among studies and genes. The approach has flexibility to handle all possible study-specific differential patterns. It improves detection of differential expression and overcomes the barrier of exponential model complexity. PMID:25143368

  9. A Cbx8-Containing Polycomb Complex Facilitates the Transition to Gene Activation during ES Cell Differentiation

    PubMed Central

    Malinverni, Roberto; Valero, Vanesa; Buschbeck, Marcus

    2014-01-01

    Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq). Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs. PMID:25500566

  10. Reciprocal gene replacements reveal unique functions for Phox2 genes during neural differentiation

    PubMed Central

    Coppola, Eva; Pattyn, Alexandre; Guthrie, Sarah C; Goridis, Christo; Studer, Michèle

    2005-01-01

    The paralogous paired-like homeobox genes Phox2a and Phox2b are involved in the development of specific neural subtypes in the central and peripheral nervous systems. The different phenotypes of Phox2 knockout mutants, together with their asynchronous onset of expression, prompted us to generate two knock-in mutant mice, in which Phox2a is replaced by the Phox2b coding sequence, and vice versa. Our results indicate that Phox2a and Phox2b are not functionally equivalent, as only Phox2b can fulfill the role of Phox2a in the structures that depend on both genes. Furthermore, we demonstrate unique roles of Phox2 genes in the differentiation of specific motor neurons. Whereas the oculomotor and the trochlear neurons require Phox2a for their proper development, the migration of the facial branchiomotor neurons depends on Phox2b. Therefore, our analysis strongly indicates that biochemical differences between the proteins rather than temporal regulation of their expression account for the specific function of each paralogue. PMID:16319924

  11. Gene expression profiling of bone marrow mesenchymal stem cells from Osteogenesis Imperfecta patients during osteoblast differentiation.

    PubMed

    Kaneto, Carla Martins; Pereira Lima, Patrícia S; Prata, Karen Lima; Dos Santos, Jane Lima; de Pina Neto, João Monteiro; Panepucci, Rodrigo Alexandre; Noushmehr, Houtan; Covas, Dimas Tadeu; de Paula, Francisco José Alburquerque; Silva, Wilson Araújo

    2017-06-01

    Mesenchymal stem cells (MSCs) are precursors present in adult bone marrow that are able to differentiate into osteoblasts, adipocytes and chondroblasts that have gained great importance as a source for cell therapy. Recently, a number of studies involving the analysis of gene expression of undifferentiated MSCs and of MSCs in the differentiation into multiple lineage processes were observed but there is no information concerning the gene expression of MSCs from Osteogenesis Imperfecta (OI) patients. Osteogenesis Imperfecta is characterized as a genetic disorder in which a generalized osteopenia leads to excessive bone fragility and severe bone deformities. The aim of this study was to analyze gene expression profile during osteogenic differentiation from BMMSCs (Bone Marrow Mesenchymal Stem Cells) obtained from patients with Osteogenesis Imperfecta and from control subjects. Bone marrow samples were collected from three normal subjects and five patients with OI. Mononuclear cells were isolated for obtaining mesenchymal cells that had been expanded until osteogenic differentiation was induced. RNA was harvested at seven time points during the osteogenic differentiation period (D0, D+1, D+2, D+7, D+12, D+17 and D+21). Gene expression analysis was performed by the microarray technique and identified several differentially expressed genes. Some important genes for osteoblast differentiation had lower expression in OI patients, suggesting a smaller commitment of these patient's MSCs with the osteogenic lineage. Other genes also had their differential expression confirmed by RT-qPCR. An increase in the expression of genes related to adipocytes was observed, suggesting an increase of adipogenic differentiation at the expense osteogenic differentiation. Copyright © 2017. Published by Elsevier Masson SAS.

  12. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  13. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  14. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns

    PubMed Central

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St. John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α-ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns. PMID:28900542

  15. Comparative Transcriptomic Analyses of Differentially Expressed Genes in Transgenic Melatonin Biosynthesis Ovine HIOMT Gene in Switchgrass

    PubMed Central

    Yuan, Shan; Guan, Cong; Liu, Sijia; Huang, Yanhua; Tian, Danyang; Cui, Xin; Zhang, Yunwei; Yang, Fuyu

    2016-01-01

    Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405, and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. Two hundred and seventy-five upregulated and 130 downregulated unigenes were detected in transgenic oHIOMT line comparing with control, including the significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3) genes, which were potentially correlated with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc.) were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc.) were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants. PMID:27877177

  16. A role for the Drosophila neurogenic genes in mesoderm differentiation.

    PubMed

    Corbin, V; Michelson, A M; Abmayr, S M; Neel, V; Alcamo, E; Maniatis, T; Young, M W

    1991-10-18

    The neurogenic genes of Drosophila have long been known to regulate cell fate decisions in the developing ectoderm. In this paper we show that these genes also control mesoderm development. Embryonic cells that express the muscle-specific gene nautilus are overproduced in each of seven neurogenic mutants (Notch, Delta, Enhancer of split, big brain, mastermind, neuralized, and almondex), at the apparent expense of neighboring, nonexpressing mesodermal cells. The mesodermal defect does not appear to be a simple consequence of associated neural hypertrophy, suggesting that the neurogenic genes may function similarly and independently in establishing cell fates in both ectoderm and mesoderm. Altered patterns of beta 3-tubulin and myosin heavy chain gene expression in the mutants indicate a role for the neurogenic genes in development of most visceral and somatic muscles. We propose that the signal produced by the neurogenic genes is a general one, effective in both ectoderm and mesoderm.

  17. Viral oncogenes, proto-oncogenes and homoeotic genes related to cell proliferation and differentiation.

    PubMed

    Antohi, S; Antohi-Talle, O

    1987-01-01

    Molecular studies on viral oncogenes and their products have led to the discovery of physiological proto-oncogenes, involved in the control of cell proliferation and gene activation. Other genetic and molecular investigations, initiated in Drosophila melanogaster and continued in different multicellular eukaryotes, have made evident the homoeotic genes, which are directly correlated with cell specialization, in the complex processes of differentiation and morphogenesis. Both gene classes are conserved to a high extent during evolution. They are involved in the eukaryotic mechanisms of differentiation control and proto-oncogenes, in particular, are related to malignant transformation. Some available data suggest a certain extent of relatedness between the gene products of both gene classes. A differentiation trigger model, including retroviral transposition, homoeotic genes and proto-oncogenes is discussed.

  18. Divergence and differential expression of soybean actin genes.

    PubMed Central

    Hightower, R C; Meagher, R B

    1985-01-01

    DNA sequence analysis as well as genomic blotting experiments using cloned soybean actin DNA sequences as probes show that large sequence heterogeneity exists among members of the soybean actin multigene family. This heterogeneity suggested that the members of this family might be diverged in function and/or regulation. Five of the six soybean actin gene family members examined are shown to be significantly more diverged from one another than members of other known actin gene families. This high level of divergence was utilized in the preparation of actin gene-specific probes in the analysis of the complexity and expression of these members of the soybean actin gene family. Hybridization studies indicate that the six soybean actin genes fall into three classes with a pair of genes in each class. These six genes account for all but two actin gene fragments detected in the soybean genome. We have compared the relative steady state mRNA levels of these classes of soybean actin genes in three organs of soybean. We find that actin genes SAc6 and SAc7 are most highly expressed accounting for 80% of all actin mRNA with respect to the six soybean actin genes examined. Actin genes SAc3 and SAc1 are expressed at intermediate and low levels respectively; and SAc2 and SAc4 are expressed at barely detectable levels. Four of the six soybean actin genes appear to be expressed at the same level in root, shoot and hypocotyl. SAc3 and SAc7 genes appear to be more highly expressed in shoot and 2,4-dichlorophenoxyacetic acid-induced hypocotyl than in root and hypocotyl.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:2410251

  19. Effects of Sample Size on Differential Gene Expression, Rank Order and Prediction Accuracy of a Gene Signature

    PubMed Central

    Stretch, Cynthia; Khan, Sheehan; Asgarian, Nasimeh; Eisner, Roman; Vaisipour, Saman; Damaraju, Sambasivarao; Graham, Kathryn; Bathe, Oliver F.; Steed, Helen; Greiner, Russell; Baracos, Vickie E.

    2013-01-01

    Top differentially expressed gene lists are often inconsistent between studies and it has been suggested that small sample sizes contribute to lack of reproducibility and poor prediction accuracy in discriminative models. We considered sex differences (69♂, 65♀) in 134 human skeletal muscle biopsies using DNA microarray. The full dataset and subsamples (n = 10 (5♂, 5♀) to n = 120 (60♂, 60♀)) thereof were used to assess the effect of sample size on the differential expression of single genes, gene rank order and prediction accuracy. Using our full dataset (n = 134), we identified 717 differentially expressed transcripts (p<0.0001) and we were able predict sex with ∼90% accuracy, both within our dataset and on external datasets. Both p-values and rank order of top differentially expressed genes became more variable using smaller subsamples. For example, at n = 10 (5♂, 5♀), no gene was considered differentially expressed at p<0.0001 and prediction accuracy was ∼50% (no better than chance). We found that sample size clearly affects microarray analysis results; small sample sizes result in unstable gene lists and poor prediction accuracy. We anticipate this will apply to other phenotypes, in addition to sex. PMID:23755224

  20. Six family genes control the proliferation and differentiation of muscle satellite cells

    SciTech Connect

    Yajima, Hiroshi; Motohashi, Norio; Ono, Yusuke; Sato, Shigeru; Ikeda, Keiko; Masuda, Satoru; Yada, Erica; Kanesaki, Hironori; Miyagoe-Suzuki, Yuko; Takeda, Shin'ichi; Kawakami, Kiyoshi

    2010-10-15

    Muscle satellite cells are essential for muscle growth and regeneration and their morphology, behavior and gene expression have been extensively studied. However, the mechanisms involved in their proliferation and differentiation remain elusive. Six1 and Six4 proteins were expressed in the nuclei of myofibers of adult mice and the numbers of myoblasts positive for Six1 and Six4 increased during regeneration of skeletal muscles. Six1 and Six4 were expressed in quiescent, activated and differentiated muscle satellite cells isolated from adult skeletal muscle. Overexpression of Six4 and Six5 repressed the proliferation and differentiation of satellite cells. Conversely, knockdown of Six5 resulted in augmented proliferation, and that of Six4 inhibited differentiation. Muscle satellite cells isolated from Six4{sup +/-}Six5{sup -/-} mice proliferated to higher cell density though their differentiation was not altered. Meanwhile, overproduction of Six1 repressed proliferation and promoted differentiation of satellite cells. In addition, Six4 and Six5 repressed, while Six1 activated myogenin expression, suggesting that the differential regulation of myogenin expression is responsible for the differential effects of Six genes. The results indicated the involvement of Six genes in the behavior of satellite cells and identified Six genes as potential target for manipulation of proliferation and differentiation of muscle satellite cells for therapeutic applications.

  1. Blue genes: An integrative laboratory to differentiate genetic transformation from gene mutation for underclassmen.

    PubMed

    Militello, Kevin T; Chang, Ming-Mei; Simon, Robert D; Lazatin, Justine C

    2016-01-01

    The ability of students to understand the relationship between genotype and phenotype, and the mechanisms by which genotypes and phenotypes can change is essential for students studying genetics. To this end, we have developed a four-week laboratory called Blue Genes, which is designed to help novice students discriminate between two mechanisms by which the genetic material can be altered: genetic transformation and gene mutation. In the first week of the laboratory, students incubate a plasmid DNA with calcium chloride-treated Escherichia coli JM109 cells and observe a phenotype change from ampicillin sensitive to ampicillin resistant and from white color to blue color on plates containing 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) and isopropyl β-D-thiogalactopyranoside (IPTG). Over the course of the next three weeks, students use a battery of approaches including plasmid DNA isolation experiments, restriction maps, and PCR to differentiate between mutation and transformation. The students ultimately come to the conclusion that the changes in phenotypes are due to genetic transformation and not mutation based on the evidence generated over the four-week period. Pre-laboratory tests and post-laboratory tests indicate that this set of exercises is successful in helping students differentiate between transformation and mutation. The laboratory is designed for underclassmen and is a good prerequisite for an apprentice-based research opportunity, although it is not designed as a class based research experience. Potential modifications and future directions of the laboratory based upon student experiences and assessment are presented.

  2. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central

    2010-01-01

    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  3. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I

    2014-01-01

    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  4. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J

    1989-01-01

    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  5. Reconstructing differentially co-expressed gene modules and regulatory networks of soybean cells

    PubMed Central

    2012-01-01

    Background Current experimental evidence indicates that functionally related genes show coordinated expression in order to perform their cellular functions. In this way, the cell transcriptional machinery can respond optimally to internal or external stimuli. This provides a research opportunity to identify and study co-expressed gene modules whose transcription is controlled by shared gene regulatory networks. Results We developed and integrated a set of computational methods of differential gene expression analysis, gene clustering, gene network inference, gene function prediction, and DNA motif identification to automatically identify differentially co-expressed gene modules, reconstruct their regulatory networks, and validate their correctness. We tested the methods using microarray data derived from soybean cells grown under various stress conditions. Our methods were able to identify 42 coherent gene modules within which average gene expression correlation coefficients are greater than 0.8 and reconstruct their putative regulatory networks. A total of 32 modules and their regulatory networks were further validated by the coherence of predicted gene functions and the consistency of putative transcription factor binding motifs. Approximately half of the 32 modules were partially supported by the literature, which demonstrates that the bioinformatic methods used can help elucidate the molecular responses of soybean cells upon various environmental stresses. Conclusions The bioinformatics methods and genome-wide data sources for gene expression, clustering, regulation, and function analysis were integrated seamlessly into one modular protocol to systematically analyze and infer modules and networks from only differential expression genes in soybean cells grown under stress conditions. Our approach appears to effectively reduce the complexity of the problem, and is sufficiently robust and accurate to generate a rather complete and detailed view of putative soybean

  6. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon.

    PubMed

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation.

  7. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon

    PubMed Central

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S.

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation. PMID:26950546

  8. Node-based learning of differential networks from multi-platform gene expression data.

    PubMed

    Ou-Yang, Le; Zhang, Xiao-Fei; Wu, Min; Li, Xiao-Li

    2017-06-01

    Recovering gene regulatory networks and exploring the network rewiring between two different disease states are important for revealing the mechanisms behind disease progression. The advent of high-throughput experimental techniques has enabled the possibility of inferring gene regulatory networks and differential networks using computational methods. However, most of existing differential network analysis methods are designed for single-platform data analysis and assume that differences between networks are driven by individual edges. Therefore, they cannot take into account the common information shared across different data platforms and may fail in identifying driver genes that lead to the change of network. In this study, we develop a node-based multi-view differential network analysis model to simultaneously estimate multiple gene regulatory networks and their differences from multi-platform gene expression data. Our model can leverage the strength across multiple data platforms to improve the accuracy of network inference and differential network estimation. Simulation studies demonstrate that our model can obtain more accurate estimations of gene regulatory networks and differential networks than other existing state-of-the-art models. We apply our model on TCGA ovarian cancer samples to identify network rewiring associated with drug resistance. We observe from our experiments that the hub nodes of our identified differential networks include known drug resistance-related genes and potential targets that are useful to improve the treatment of drug resistant tumors. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Redescription of Urophycis brasiliensis (Kaup 1858), a senior synonym of Urophycis latus Miranda Ribeiro 1903 (Gadiformes: Phycidae).

    PubMed

    Lemes, Paola C R; Loeb, Marina V; Santificetur, César; Melo, Marcelo R S

    2016-02-29

    Urophycis Gill 1864 is a genus of demersal fish composed by eight valid species with anti-tropical distributions in the western Atlantic. Only two species occur in the South Atlantic: U. brasiliensis (Kaup 1858) and U. mystacea Miranda Ribeiro 1903. These species have similar ranges from southeastern Brazil to northern Argentina, but U. brasiliensis occurs in more shallow waters than U. mystacea. Both species are important fishery resources in southern Brazil and Uruguay. Herein, we redescribe U. brasiliensis based on comparison of types and additional specimens, including the description of the Sagitta otolith, formerly place U. latus Miranda Ribeiro 1903 as a junior synonym of U. brasiliensis, and provide an updated map of distribution.

  10. Fission and Fusion in the New Localized Structures to the Integrable (2 + 1)-Dimensional Higher-Order Broer Kaup System

    NASA Astrophysics Data System (ADS)

    Yomba, Emmanuel; Peng, Yan-Ze

    2006-01-01

    By means of the Weiss Tabor Carnevale (WTC) truncation method and the general variable separation approach (GVSA), analytical investigation of the integrable (2+1)-dimensional higher-order Broer Kaup (HBK) system shows, due to the possibility of selecting three arbitrary func.tions, the existence of interacting coherent excitations such as dromions, solitons, periodic solitons, etc. The interaction between some of the localized solutions are elastic because they pass through each other and preserve their shapes and velocities, the only change being the phase shift. However, as for some soliton models, completely non-elastic interactions have been found in this model. These non-elastic interactions are characterized by the fact that, at a specific time, one soliton may fission to two or more solitons; or on the contrary, two or more solitons will fuse to one soliton.

  11. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    USDA-ARS?s Scientific Manuscript database

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  12. Data mining in networks of differentially expressed genes during sow pregnancy.

    PubMed

    Wang, Ligang; Zhang, Longchao; Li, Yong; Li, Wen; Luo, Weizhen; Cheng, Duxue; Yan, Hua; Ma, Xiaojun; Liu, Xin; Song, Xin; Liang, Jing; Zhao, Kebin; Wang, Lixian

    2012-01-01

    Small to moderate gains in Pig fertility can mean large returns in overall efficiency, and developing methods to improve it is highly desirable. High fertility rates depend on completion of successful pregnancies. To understand the molecular signals associated with pregnancy in sows, expression profiling experiments were conducted to identify differentially expressed genes in ovary and myometrium at different pregnancy periods using the Affymetrix Porcine GeneChip(TM). A total of 974, 1800, 335 and 710 differentially expressed transcripts were identified in the myometrium during early pregnancy (EP) and late pregnancy (LP), and in the ovary during EP and LP, respectively. Self-Organizing Map (SOM) clusters indicated the differentially expressed genes belonged to 7 different functional groups. Based on BLASTX searches and Gene Ontology (GO) classifications, 129 unique genes closely related to pregnancy showed differential expression patterns. GO analysis also indicated that there were 21 different molecular function categories, 20 different biological process categories, and 8 different cellular component categories of genes differentially expressed during sow pregnancy. Gene regulatory network reconstruction provided us with an interaction model of known genes such as insulin-like growth factor 2 (IGF2) gene, estrogen receptor (ESR) gene, retinol-binding protein-4 (RBP4) gene, and several unknown candidate genes related to reproduction. Several pitch point genes were selected for association study with reproduction traits. For instance, DPPA5 g.363 T>C was found to associate with litter born weight at later parities in Beijing Black pigs significantly (p < 0.05). Overall, this study contributes to elucidating the mechanism underlying pregnancy processes, which maybe provide valuable information for pig reproduction improvement.

  13. Identification and expression profiling analysis of goose melanoma differentiation associated gene 5 (MDA5) gene.

    PubMed

    Wei, L M; Jiao, P R; Song, Y F; Han, F; Cao, L; Yang, F; Ren, T; Liao, M

    2013-10-01

    Melanoma differentiation associated gene 5 (MDA5) is an important cytoplasmic receptor that recognizes long molecules of viral double-stranded RNA and single-stranded RNA with 5' triphosphate and mediates type I interferon secretion. In this study, the full-length MDA5 gene in the goose was identified and characterized. The cDNA of goose MDA5 was 3,306 bp in length with an open reading frame of 3,018 bp, which encoded a polypeptide of 1,005 amino acids. The deduced amino acid sequence contained 6 main structure domains including 2 caspase activation and recruitment domains, one DExD/H-box helicase domain, one type III restriction enzyme domain, one helicase conserved C-terminal domain, and one RIG-I C-terminal domain. Quantitative real-time PCR analysis indicated that goose MDA5 mRNA was constitutively expressed in all sampled tissues. It was highly expressed in the jejunum, trachea, ileum, colon, and kidney, and lowly expressed in the muscular stomach, glandular stomach, and muscle. A significant increase in the transcription of MDA5 was detected in the brain, spleen, and lungs of geese after infection with H5N1 highly pathogenic avian influenza virus compared with uninfected tissues. These findings indicated that goose MDA5 was an important receptor, involved in the antiviral innate immune defense to H5N1 highly pathogenic avian influenza virus in geese.

  14. The Wilms’ Tumor Suppressor Gene (wt1) Product Regulates Dax-1 Gene Expression during Gonadal Differentiation

    PubMed Central

    Kim, Jungho; Prawitt, Dirk; Bardeesy, Nabeel; Torban, Elena; Vicaner, Caroline; Goodyer, Paul; Zabel, Bernard; Pelletier, Jerry

    1999-01-01

    Gonadal differentiation is dependent upon a molecular cascade responsible for ovarian or testicular development from the bipotential gonadal ridge. Genetic analysis has implicated a number of gene products essential for this process, which include Sry, WT1, SF-1, and DAX-1. We have sought to better define the role of WT1 in this process by identifying downstream targets of WT1 during normal gonadal development. We have noticed that in the developing murine gonadal ridge, wt1 expression precedes expression of Dax-1, a nuclear receptor gene. We document here that the spatial distribution profiles of both proteins in the developing gonad overlap. We also demonstrate that WT1 can activate the Dax-1 promoter. Footprinting analysis, transient transfections, promoter mutagenesis, and mobility shift assays suggest that WT1 regulates Dax-1 via GC-rich binding sites found upstream of the Dax-1 TATA box. We show that two WT1-interacting proteins, the product of a Denys-Drash syndrome allele of wt1 and prostate apoptosis response-4 protein, inhibit WT1-mediated transactivation of Dax-1. In addition, we demonstrate that WT1 can activate the endogenous Dax-1 promoter. Our results indicate that the WT1–DAX-1 pathway is an early event in the process of mammalian sex determination. PMID:10022915

  15. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  16. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.

    PubMed

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  17. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression

    PubMed Central

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree. PMID:26147807

  18. Identification of differentially expressed genes and signalling pathways in bark of Hevea brasiliensis seedlings associated with secondary laticifer differentiation using gene expression microarray.

    PubMed

    Loh, Swee Cheng; Thottathil, Gincy P; Othman, Ahmad Sofiman

    2016-10-01

    The natural rubber of Para rubber tree, Hevea brasiliensis, is the main crop involved in industrial rubber production due to its superior quality. The Hevea bark is commercially exploited to obtain latex, which is produced from the articulated secondary laticifer. The laticifer is well defined in the aspect of morphology; however, only some genes associated with its development have been reported. We successfully induced secondary laticifer in the jasmonic acid (JA)-treated and linolenic acid (LA)-treated Hevea bark but secondary laticifer is not observed in the ethephon (ET)-treated and untreated Hevea bark. In this study, we analysed 27,195 gene models using NimbleGen microarrays based on the Hevea draft genome. 491 filtered differentially expressed (FDE) transcripts that are common to both JA- and LA-treated bark samples but not ET-treated bark samples were identified. In the Eukaryotic Orthologous Group (KOG) analysis, 491 FDE transcripts belong to different functional categories that reflect the diverse processes and pathways involved in laticifer differentiation. In the Kyoto Encyclopedia of Genes and Genomes (KEGG) and KOG analysis, the profile of the FDE transcripts suggest that JA- and LA-treated bark samples have a sufficient molecular basis for secondary laticifer differentiation, especially regarding secondary metabolites metabolism. FDE genes in this category are from the cytochrome (CYP) P450 family, ATP-binding cassette (ABC) transporter family, short-chain dehydrogenase/reductase (SDR) family, or cinnamyl alcohol dehydrogenase (CAD) family. The data includes many genes involved in cell division, cell wall synthesis, and cell differentiation. The most abundant transcript in FDE list was SDR65C, reflecting its importance in laticifer differentiation. Using the Basic Local Alignment Search Tool (BLAST) as part of annotation and functional prediction, several characterised as well as uncharacterized transcription factors and genes were found in the

  19. Application of community phylogenetic approaches to understand gene expression: differential exploration of venom gene space in predatory marine gastropods.

    PubMed

    Chang, Dan; Duda, Thomas F

    2014-06-05

    Predatory marine gastropods of the genus Conus exhibit substantial variation in venom composition both within and among species. Apart from mechanisms associated with extensive turnover of gene families and rapid evolution of genes that encode venom components ('conotoxins'), the evolution of distinct conotoxin expression patterns is an additional source of variation that may drive interspecific differences in the utilization of species' 'venom gene space'. To determine the evolution of expression patterns of venom genes of Conus species, we evaluated the expression of A-superfamily conotoxin genes of a set of closely related Conus species by comparing recovered transcripts of A-superfamily genes that were previously identified from the genomes of these species. We modified community phylogenetics approaches to incorporate phylogenetic history and disparity of genes and their expression profiles to determine patterns of venom gene space utilization. Less than half of the A-superfamily gene repertoire of these species is expressed, and only a few orthologous genes are coexpressed among species. Species exhibit substantially distinct expression strategies, with some expressing sets of closely related loci ('under-dispersed' expression of available genes) while others express sets of more disparate genes ('over-dispersed' expression). In addition, expressed genes show higher dN/dS values than either unexpressed or ancestral genes; this implies that expression exposes genes to selection and facilitates rapid evolution of these genes. Few recent lineage-specific gene duplicates are expressed simultaneously, suggesting that expression divergence among redundant gene copies may be established shortly after gene duplication. Our study demonstrates that venom gene space is explored differentially by Conus species, a process that effectively permits the independent and rapid evolution of venoms in these species.

  20. Quantitative set analysis for gene expression: a method to quantify gene set differential expression including gene-gene correlations.

    PubMed

    Yaari, Gur; Bolen, Christopher R; Thakar, Juilee; Kleinstein, Steven H

    2013-10-01

    Enrichment analysis of gene sets is a popular approach that provides a functional interpretation of genome-wide expression data. Existing tests are affected by inter-gene correlations, resulting in a high Type I error. The most widely used test, Gene Set Enrichment Analysis, relies on computationally intensive permutations of sample labels to generate a null distribution that preserves gene-gene correlations. A more recent approach, CAMERA, attempts to correct for these correlations by estimating a variance inflation factor directly from the data. Although these methods generate P-values for detecting gene set activity, they are unable to produce confidence intervals or allow for post hoc comparisons. We have developed a new computational framework for Quantitative Set Analysis of Gene Expression (QuSAGE). QuSAGE accounts for inter-gene correlations, improves the estimation of the variance inflation factor and, rather than evaluating the deviation from a null hypothesis with a P-value, it quantifies gene-set activity with a complete probability density function. From this probability density function, P-values and confidence intervals can be extracted and post hoc analysis can be carried out while maintaining statistical traceability. Compared with Gene Set Enrichment Analysis and CAMERA, QuSAGE exhibits better sensitivity and specificity on real data profiling the response to interferon therapy (in chronic Hepatitis C virus patients) and Influenza A virus infection. QuSAGE is available as an R package, which includes the core functions for the method as well as functions to plot and visualize the results.

  1. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    PubMed

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  2. Adaptations to Endosymbiosis in a Cnidarian-Dinoflagellate Association: Differential Gene Expression and Specific Gene Duplications

    PubMed Central

    Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-01-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K–dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  3. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  4. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  5. Differential gene expression analysis of ovarian cancer in a population isolate.

    PubMed

    Grazio, D; Pichler, I; Fuchsberger, C; Zolezzi, F; Guarnieri, P; Heidegger, H; Scherer, A; Engl, B; Messini, S; Egarter-Vigl, E; Pramstaller, P P

    2008-01-01

    Gene expression products represent candidate biomarkers with the potential for early screening and therapy of patients with ovarian serous carcinoma. The present study, using patients that originate from the population isolate of South Tyrol, Italy, substantiates the feasibility of differential gene expression analysis in a genetically isolated population for the identification of potential markers of ovarian cancer. Gene expression profiles of fresh-frozen ovarian serous papillary carcinoma samples were analyzed and compared to normal ovarian control tissues using oligonucleotide microarrays complementary to 14,500 human genes. Supervised analysis of gene expression profiling data identified 225 genes that are down-regulated and 635 that are up-regulated in malignant compared to normal ovarian tissues. Class-prediction analysis identified 40 differentially expressed genes for further investigation as potential classifiers for ovarian cancer, including 20 novel candidates. Our findings provide a glimpse into the potential of population isolate genomics in oncological research.

  6. [Identification and application of marker genes for differential diagnosis of chronic fatigue syndrome].

    PubMed

    Kawai, Tomoko; Rokutan, Kazuhito

    2007-06-01

    Chronic fatigue syndrome (CFS) is a complex disease and has no laboratory biomarkers, which makes diagnosis of CFS difficult. Several research groups challenged to identify genes specific for CFS; however, there are no overlaps between studies. The U.S. Centers for Disease Control and Prevention reported remarkable gene expression profiles of a large scale cohort study recruited 227 people. Reported genes were mostly different from the previously reported genes, again featuring the complexity of CFS. Separately, we identified 9 genes that were significantly and differentially expressed between CFS patients and healthy subjects using an original microarray. The changes in expression of 9 genes were confirmed by quantitative PCR. We also demonstrated the usefulness of 9 genes for differential diagnosis of CFS.

  7. Differential Coexpression Analysis Reveals Extensive Rewiring of Arabidopsis Gene Coexpression in Response to Pseudomonas syringae Infection

    PubMed Central

    Jiang, Zhenhong; Dong, Xiaobao; Li, Zhi-Gang; He, Fei; Zhang, Ziding

    2016-01-01

    Plant defense responses to pathogens involve massive transcriptional reprogramming. Recently, differential coexpression analysis has been developed to study the rewiring of gene networks through microarray data, which is becoming an important complement to traditional differential expression analysis. Using time-series microarray data of Arabidopsis thaliana infected with Pseudomonas syringae, we analyzed Arabidopsis defense responses to P. syringae through differential coexpression analysis. Overall, we found that differential coexpression was a common phenomenon of plant immunity. Genes that were frequently involved in differential coexpression tend to be related to plant immune responses. Importantly, many of those genes have similar average expression levels between normal plant growth and pathogen infection but have different coexpression partners. By integrating the Arabidopsis regulatory network into our analysis, we identified several transcription factors that may be regulators of differential coexpression during plant immune responses. We also observed extensive differential coexpression between genes within the same metabolic pathways. Several metabolic pathways, such as photosynthesis light reactions, exhibited significant changes in expression correlation between normal growth and pathogen infection. Taken together, differential coexpression analysis provides a new strategy for analyzing transcriptional data related to plant defense responses and new insights into the understanding of plant-pathogen interactions. PMID:27721457

  8. Differential Coexpression Analysis Reveals Extensive Rewiring of Arabidopsis Gene Coexpression in Response to Pseudomonas syringae Infection.

    PubMed

    Jiang, Zhenhong; Dong, Xiaobao; Li, Zhi-Gang; He, Fei; Zhang, Ziding

    2016-10-10

    Plant defense responses to pathogens involve massive transcriptional reprogramming. Recently, differential coexpression analysis has been developed to study the rewiring of gene networks through microarray data, which is becoming an important complement to traditional differential expression analysis. Using time-series microarray data of Arabidopsis thaliana infected with Pseudomonas syringae, we analyzed Arabidopsis defense responses to P. syringae through differential coexpression analysis. Overall, we found that differential coexpression was a common phenomenon of plant immunity. Genes that were frequently involved in differential coexpression tend to be related to plant immune responses. Importantly, many of those genes have similar average expression levels between normal plant growth and pathogen infection but have different coexpression partners. By integrating the Arabidopsis regulatory network into our analysis, we identified several transcription factors that may be regulators of differential coexpression during plant immune responses. We also observed extensive differential coexpression between genes within the same metabolic pathways. Several metabolic pathways, such as photosynthesis light reactions, exhibited significant changes in expression correlation between normal growth and pathogen infection. Taken together, differential coexpression analysis provides a new strategy for analyzing transcriptional data related to plant defense responses and new insights into the understanding of plant-pathogen interactions.

  9. Gene expression profiling data of Schizosaccharomyces pombe under nitrosative stress using differential display

    PubMed Central

    Biswas, Pranjal; Majumdar, Uddalak; Ghosh, Sanjay

    2015-01-01

    Excess production of nitric oxide (NO) and reactive nitrogen intermediates (RNIs) causes nitrosative stress on cells. Schizosaccharomyces pombe was used as a model to study nitrosative stress response. In the present data article, we have used differential display to identify the differentially expressed genes in the fission yeast under nitrosative stress conditions. We have used pure NO donor compound detaNONOate at final concentrations of 0.1 mM and 1 mM to treat the cells for 15 min alongside control before studying their gene expression profiles. At both the treated conditions, we identified genes which were commonly repressed while several genes were induced upon both 0.1 mM and 1 mM treatments. The differentially expressed genes were further analyzed in DAVID and categorized into several different pathways. PMID:26858975

  10. Differential Methylation during Maize Leaf Growth Targets Developmentally Regulated Genes1[C][W][OPEN

    PubMed Central

    Candaele, Jasper; Demuynck, Kirin; Mosoti, Douglas; Beemster, Gerrit T.S.; Inzé, Dirk; Nelissen, Hilde

    2014-01-01

    DNA methylation is an important and widespread epigenetic modification in plant genomes, mediated by DNA methyltransferases (DMTs). DNA methylation is known to play a role in genome protection, regulation of gene expression, and splicing and was previously associated with major developmental reprogramming in plants, such as vernalization and transition to flowering. Here, we show that DNA methylation also controls the growth processes of cell division and cell expansion within a growing organ. The maize (Zea mays) leaf offers a great tool to study growth processes, as the cells progressively move through the spatial gradient encompassing the division zone, transition zone, elongation zone, and mature zone. Opposite to de novo DMTs, the maintenance DMTs were transcriptionally regulated throughout the growth zone of the maize leaf, concomitant with differential CCGG methylation levels in the four zones. Surprisingly, the majority of differentially methylated sequences mapped on or close to gene bodies and not to repeat-rich loci. Moreover, especially the 5′ and 3′ regions of genes, which show overall low methylation levels, underwent differential methylation in a developmental context. Genes involved in processes such as chromatin remodeling, cell cycle progression, and growth regulation, were differentially methylated. The presence of differential methylation located upstream of the gene anticorrelated with transcript expression, while gene body differential methylation was unrelated to the expression level. These data indicate that DNA methylation is correlated with the decision to exit mitotic cell division and to enter cell expansion, which adds a new epigenetic level to the regulation of growth processes. PMID:24488968

  11. Differential Gene Expression in the Human Brain Is Associated with Conserved, but Not Accelerated, Noncoding Sequences

    PubMed Central

    Meyer, Kyle A.; Marques-Bonet, Tomas

    2017-01-01

    Previous studies have found that genes which are differentially expressed within the developing human brain disproportionately neighbor conserved noncoding sequences (CNSs) that have an elevated substitution rate in humans and in other species. One explanation for this general association of differential expression with accelerated CNSs is that genes with pre-existing patterns of differential expression have been preferentially targeted by species-specific regulatory changes. Here we provide support for an alternative explanation: genes that neighbor a greater number of CNSs have a higher probability of differential expression and a higher probability of neighboring a CNS with lineage-specific acceleration. Thus, neighboring an accelerated element from any species signals that a gene likely neighbors many CNSs. We extend the analyses beyond the prenatal time points considered in previous studies to demonstrate that this association persists across developmental and adult periods. Examining differential expression between non-neural tissues suggests that the relationship between the number of CNSs a gene neighbors and its differential expression status may be particularly strong for expression differences among brain regions. In addition, by considering this relationship, we highlight a recently defined set of putative human-specific gain-of-function sequences that, even after adjusting for the number of CNSs neighbored by genes, shows a positive relationship with upregulation in the brain compared with other tissues examined. PMID:28204568

  12. Differential distribution improves gene selection stability and has competitive classification performance for patient survival.

    PubMed

    Strbenac, Dario; Mann, Graham J; Yang, Jean Y H; Ormerod, John T

    2016-07-27

    A consistent difference in average expression level, often referred to as differential expression (DE), has long been used to identify genes useful for classification. However, recent cancer studies have shown that when transcription factors or epigenetic signals become deregulated, a change in expression variability (DV) of target genes is frequently observed. This suggests that assessing the importance of genes by either differential expression or variability alone potentially misses sets of important biomarkers that could lead to improved predictions and treatments. Here, we describe a new approach for assessing the importance of genes based on differential distribution (DD), which combines information from differential expression and differential variability into a unified metric. We show that feature ranking and selection stability based on DD can perform two to three times better than DE or DV alone, and that DD yields equivalent error rates to DE and DV. Finally, assessing genes via differential distribution produces a complementary set of selected genes to DE and DV, potentially opening up new categories of biomarkers. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.

    PubMed

    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu

    2015-06-15

    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  14. Transcriptome-Wide Differential Gene Expression in Bicyclus anynana Butterflies: Female Vision-Related Genes Are More Plastic.

    PubMed

    Macias-Muñoz, Aide; Smith, Gilbert; Monteiro, Antónia; Briscoe, Adriana D

    2016-01-01

    Vision is energetically costly to maintain. Consequently, over time many cave-adapted species downregulate the expression of vision genes or even lose their eyes and associated eye genes entirely. Alternatively, organisms that live in fluctuating environments, with different requirements for vision at different times, may evolve phenotypic plasticity for expression of vision genes. Here, we use a global transcriptomic and candidate gene approach to compare gene expression in the heads of a polyphenic butterfly. Bicyclus anynana have two seasonal forms that display sexual dimorphism and plasticity in eye morphology, and female-specific plasticity in opsin gene expression. Nonchoosy dry season females downregulate opsin expression, consistent with the high physiological cost of vision. To identify other genes associated with sexually dimorphic and seasonally plastic differences in vision, we analyzed RNA-sequencing data from whole head tissues. We identified two eye development genes (klarsicht and warts homologs) and an eye pigment biosynthesis gene (henna) differentially expressed between seasonal forms. By comparing sex-specific expression across seasonal forms, we found that klarsicht, warts, henna, and another eye development gene (domeless) were plastic in a female-specific manner. In a male-only analysis, white (w) was differentially expressed between seasonal forms. Reverse transcription polymerase chain reaction confirmed that warts and white are expressed in eyes only, whereas klarsicht, henna and domeless are expressed in both eyes and brain. We find that differential expression of eye development and eye pigment genes is associated with divergent eye phenotypes in B. anynana seasonal forms, and that there is a larger effect of season on female vision-related genes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. The nuclear protein-coding gene ANKRD23 negatively regulates myoblast differentiation.

    PubMed

    Wang, Xiaojing; Zeng, Rui; Xu, Haiyang; Xu, Zaiyan; Zuo, Bo

    2017-09-20

    Muscle fiber formation is a complex process and subject to fine regulation of a variety of protein-coding genes and non-coding RNA. In this study, we identified a nuclear protein-coding gene ANKRD23 which was highly expressed in muscle. Quantitative real-time PCR, western blotting and immunofluorescence were used to detect the expression change of myoblast differentiation marker genes after knockdown and overexpression of ANKRD23. The results showed that the expression of myoblast differentiation marker genes were increased by interference and reduced by ANKRD23 overexpression, indicating that ANKRD23 played a negative role in the myoblast differentiation. Interestingly, we discovered a long non-coding RNA-AK004293 which was overlapped with the 3'UTR of ANKRD23 gene. Then we detected the effect of AK004293 on the expression of ANKRD23 and myoblast differentiation marker genes in C2C12 myoblasts. The results showed that AK004293 had no significant effect on the expression of myoblast differentiation maker genes and ANKRD23. In conclusion, our results established the foundation for further studies about the regulation mechanism of ANKRD23 in muscle development. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Differential Gene Expression in Chemically Induced Mouse Lung Adenomas1

    PubMed Central

    Yao, Ruisheng; Wang, Yian; Lubet, Ronald A; You, Ming

    2003-01-01

    Abstract Because of similarities in histopathology and tumor progression stages between mouse and human lung adenocarcinomas, the mouse lung tumor model with lung adenomas as the endpoint has been used extensively to evaluate the efficacy of putative lung cancer chemopreventive agents. In this study, a competitive cDNA library screening (CCLS) was employed to determine changes in the expression of mRNA in chemically induced lung adenomas compared with paired normal lung tissues. A total of 2555 clones having altered expression in tumors were observed following competitive hybridization between normal lung and lung adenomas after primary screening of over 160,000 clones from a mouse lung cDNA library. Among the 755 clones confirmed by dot blot hybridization, 240 clones were underexpressed, whereas 515 clones were overexpressed in tumors. Sixty-five clones with the most frequently altered expression in six individual tumors were confirmed by semiquantitative RT-PCR. When examining the 58 known genes, 39 clones had increased expression and 19 had decreased expression, whereas the 7 novel genes showed overexpression. A high percentage (>60%) of overexpressed or underexpressed genes was observed in at least two or three of the lesions. Reproducibly overexpressed genes included ERK-1, JAK-1, surfactant proteins A, B, and C, NFAT1, α-1 protease inhibitor, helix-loop-helix ubiquitous kinase (CHUK), α-adaptin, α-1 PI2, thioether S-methyltransferase, and CYP2C40. Reproducibly underexpressed genes included paroxanase, ALDH II, CC10, von Ebner salivary gland protein, and α- and β-globin. In addition, CCLS identified several novel genes or genes not previously associated with lung carcinogenesis, including a hypothetical protein (FLJ11240) and a guanine nucleotide exchange factor homologue. This study shows the efficacy of this methodology for identifying genes with altered expression. These genes may prove to be helpful in our understanding of the genetic basis of lung

  17. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses.

    PubMed

    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu

    2016-11-01

    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  18. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.

    PubMed

    Manku, Gurpreet; Culty, Martine

    2015-01-01

    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  19. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    PubMed

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P < 0.005), as predicted by computer-based simulations. Conversely, RELN 5'UTR sequences boost reporter gene expression above control levels in neuronal SN56 and N2A cell lines, but 12- and 13-repeat alleles still yield 50-60% less luciferase activity compared to the more common 8- and 10-repeat alleles (P < 0.0001). RELN "long" GGC alleles significantly blunt gene expression and may, through this effect, confer vulnerability to human disorders, such as schizophrenia and autism.

  20. Applying Attractor Dynamics to Infer Gene Regulatory Interactions Involved in Cellular Differentiation.

    PubMed

    Ghaffarizadeh, Ahmadreza; Podgorski, Gregory J; Flann, Nicholas S

    2017-02-27

    The dynamics of gene regulatory networks (GRNs) guide cellular differentiation. Determining the ways regulatory genes control expression of their targets is essential to understand and control cellular differentiation. The way a regulatory gene controls its target can be expressed as a gene regulatory function. Manual derivation of these regulatory functions is slow, error-prone and difficult to update as new information arises. Automating this process is a significant challenge and the subject of intensive effort. This work presents a novel approach to discovering biologically plausible gene regulatory interactions that control cellular differentiation. This method integrates known cell type expression data, genetic interactions, and knowledge of the effects of gene knockouts to determine likely GRN regulatory functions. We employ a genetic algorithm to search for candidate GRNs that use a set of transcription factors that control differentiation within a lineage. Nested canalyzing functions are used to constrain the search space to biologically plausible networks. The method identifies an ensemble of GRNs whose dynamics reproduce the gene expression pattern for each cell type within a particular lineage. The method's effectiveness was tested by inferring consensus GRNs for myeloid and pancreatic cell differentiation and comparing the predicted gene regulatory interactions to manually derived interactions. We identified many regulatory interactions reported in the literature and also found differences from published reports. These discrepancies suggest areas for biological studies of myeloid and pancreatic differentiation. We also performed a study that used defined synthetic networks to evaluate the accuracy of the automated search method and found that the search algorithm was able to discover the regulatory interactions in these defined networks with high accuracy. We suggest that the GRN functions derived from the methods described here can be used to fill

  1. Meta-Analysis of Differential Connectivity in Gene Co-Expression Networks in Multiple Sclerosis

    PubMed Central

    Creanza, Teresa Maria; Liguori, Maria; Liuni, Sabino; Nuzziello, Nicoletta; Ancona, Nicola

    2016-01-01

    Differential gene expression analyses to investigate multiple sclerosis (MS) molecular pathogenesis cannot detect genes harboring genetic and/or epigenetic modifications that change the gene functions without affecting their expression. Differential co-expression network approaches may capture changes in functional interactions resulting from these alterations. We re-analyzed 595 mRNA arrays from publicly available datasets by studying changes in gene co-expression networks in MS and in response to interferon (IFN)-β treatment. Interestingly, MS networks show a reduced connectivity relative to the healthy condition, and the treatment activates the transcription of genes and increases their connectivity in MS patients. Importantly, the analysis of changes in gene connectivity in MS patients provides new evidence of association for genes already implicated in MS by single-nucleotide polymorphism studies and that do not show differential expression. This is the case of amiloride-sensitive cation channel 1 neuronal (ACCN1) that shows a reduced number of interacting partners in MS networks, and it is known for its role in synaptic transmission and central nervous system (CNS) development. Furthermore, our study confirms a deregulation of the vitamin D system: among the transcription factors that potentially regulate the deregulated genes, we find TCF3 and SP1 that are both involved in vitamin D3-induced p27Kip1 expression. Unveiling differential network properties allows us to gain systems-level insights into disease mechanisms and may suggest putative targets for the treatment. PMID:27314336

  2. Evaluation of New Biomarker Genes for Differentiating Haemophilus influenzae from Haemophilus haemolyticus

    PubMed Central

    Anderson, Raydel D.; Wang, Xin; Katz, Lee S.; Vuong, Jeni T.; Bell, Melissa E.; Juni, Billie A.; Lowther, Sara A.; Lynfield, Ruth; MacNeil, Jessica R.; Mayer, Leonard W.

    2012-01-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus. PMID:22301020

  3. Evaluation of new biomarker genes for differentiating Haemophilus influenzae from Haemophilus haemolyticus.

    PubMed

    Theodore, M Jordan; Anderson, Raydel D; Wang, Xin; Katz, Lee S; Vuong, Jeni T; Bell, Melissa E; Juni, Billie A; Lowther, Sara A; Lynfield, Ruth; MacNeil, Jessica R; Mayer, Leonard W

    2012-04-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus.

  4. A Microarray Analysis for Differential Gene Expression in the Soybean Genome Using Bioconductor and R

    USDA-ARS?s Scientific Manuscript database

    This paper describes specific procedures for conducting quality assessment of Affymetrix GeneChip® soybean genome data and performing analyses to determine differential gene expression using the open-source R language and environment in conjunction with the open-source Bioconductor package. Procedu...

  5. EVE (external variance estimation) increases statistical power for detecting differentially expressed genes.

    PubMed

    Wille, Anja; Gruissem, Wilhelm; Bühlmann, Peter; Hennig, Lars

    2007-11-01

    Accurately identifying differentially expressed genes from microarray data is not a trivial task, partly because of poor variance estimates of gene expression signals. Here, after analyzing 380 replicated microarray experiments, we found that probesets have typical, distinct variances that can be estimated based on a large number of microarray experiments. These probeset-specific variances depend at least in part on the function of the probed gene: genes for ribosomal or structural proteins often have a small variance, while genes implicated in stress responses often have large variances. We used these variance estimates to develop a statistical test for differentially expressed genes called EVE (external variance estimation). The EVE algorithm performs better than the t-test and LIMMA on some real-world data, where external information from appropriate databases is available. Thus, EVE helps to maximize the information gained from a typical microarray experiment. Nonetheless, only a large number of replicates will guarantee to identify nearly all truly differentially expressed genes. However, our simulation studies suggest that even limited numbers of replicates will usually result in good coverage of strongly differentially expressed genes.

  6. Differential gene expression profiling of vocal fold polyps and Reinke's edema by complementary DNA microarray.

    PubMed

    Duflo, Suzy M; Thibeault, Susan L; Li, Wenhua; Smith, Marshall E; Schade, Goetz; Hess, Markus M

    2006-09-01

    Our purpose was to determine whether complementary DNA (cDNA) microarray analysis (MA) can establish distinct gene expression profiles for 2 phenotypically similar vocal fold lesions: Reinke's edema (RE) and polyps. Established transcript profiles can provide insight into the molecular and cellular processes involved in these diseases. Eleven RE specimens and 17 polyps were analyzed with MA for 8,745 genes. Further MA profiling was attempted within each lesion group to identify molecular markers for reflux exposure and smoking. Prediction analysis was used to predict lesion classification for 2 unclassified samples. A real-time polymerase chain reaction was performed to corroborate MA transcript levels for selected significant genes. Sixty-five genes were found to differentiate RE and polyps (p = .0088). For RE, 19 genes were differentiated for reflux exposure (p = .016). No genes were found to differentiate smokers from nonsmokers. For polyps, no genes were found to differentiate for reflux (p = .16) and smoking (p = .565). Categorization of unclassified lesions was possible with a minimum of 13 genes. We demonstrate the feasibility of benign lesion classification based on MA. Microarray analysis is useful not only for improving diagnosis and classification of such lesions, but also for potentially generating prognostic indicators and targets for therapy.

  7. A new gene regulatory network model based on BP algorithm for interrogating differentially expressed genes of Sea Urchin.

    PubMed

    Liu, Longlong; Zhao, Tingting; Ma, Meng; Wang, Yan

    2016-01-01

    Computer science and mathematical theories are combined to analyze the complex interactions among genes, which are simplified to a network to establish a theoretical model for the analysis of the structure, module and dynamic properties. In contrast, traditional model of gene regulatory networks often lack an effective method for solving gene expression data because of high durational and spatial complexity. In this paper, we propose a new model for constructing gene regulatory networks using back propagation (BP) neural network based on predictive function and network topology. Combined with complex nonlinear mapping and self-learning, the BP neural network was mapped into a complex network. Network characteristics were obtained from the parameters of the average path length, average clustering coefficient, average degree, modularity, and map's density to simulate the real gene network by an artificial network. Through the statistical analysis and comparison of network parameters of Sea Urchin mRNA microarray data under different temperatures, the value of network parameters was observed. Differentially expressed Sea Urchin genes associated with temperature were determined by calculating the difference in the degree of each gene from different networks. The new model we developed is suitable to simulate gene regulatory network and has capability of determining differentially expressed genes.

  8. Positions of pluripotency genes and hepatocyte-specific genes in the nucleus before and after mouse ES cell differentiation.

    PubMed

    Udagawa, K; Ohyama, T

    2014-03-24

    Spatial positioning of genes in the cell nucleus plays an important role in the regulation of genomic functions. Evidence for changes in gene positioning associated with transcriptional activity has been reported. However, our understanding of this phenomenon is still quite limited. We examined how pluripotency genes and hepatocyte-specific genes behave during the differentiation of mouse embryonic stem (ES) cells into hepatocytes, by targeting the loci of the Klf4, Nanog, Oct4, Sox2, Cyp7α1, Pck1, Tat, and Tdo2 genes, and using three-dimensional fluorescence in situ hybridization analyses. We found that each gene has a distinctly inherent localization profile in the ES cell nucleus. During differentiation, the Klf4, Nanog, Oct4, Cyp7α1, Pck1, and Tat loci shifted toward the nuclear center, while the Sox2 and Tdo2 loci shifted toward the periphery. The Klf4, Nanog, Oct4, and Tdo2 seem to prefer the outer regions, rather than the inner regions, when they are active. We also found that the radial positioning of the focused genes in the hepatocyte cell nucleus was highly correlated with the local GC content and the gene density of the surrounding region, but not with gene activity.

  9. Phenotypic differentiation of Streptococcus pyogenes populations is induced by recombination-driven gene-specific sweeps

    PubMed Central

    Bao, Yun-Juan; Shapiro, B. Jesse; Lee, Shaun W.; Ploplis, Victoria A.; Castellino, Francis J.

    2016-01-01

    Genomic recombination plays an important role in driving adaptive evolution and population differentiation in bacteria. However, controversy exists as to the effects of recombination on population diversity and differentiation, i.e., recombination is frequent enough to sweep through the population at selected gene loci (gene-specific sweeps), or the recombination rate is low without interfering genome-wide selective sweeps. Observations supporting either view are sparse. Pathogenic bacteria causing infectious diseases are promising candidates to provide observations of recombination. However, phenotype-associated differentiations are usually vague among them due to diverse disease manifestations. Here we report a population genomic study of the group A Streptococcus pyogenes (GAS), a human pathogen with highly recombining genomes. By employing a genome-wide association study on single nucleotide polymorphisms (SNPs), we demonstrate a phenotypic differentiation of GAS, represented by separate clustering of two sublineages associated with niche-specific infections, i.e., skin infection and pharyngitis-induced acute rheumatic fever. By quantifying SNPs associated with the differentiation in a statistical and phylogenetic context, we propose that the phenotype-associated differentiation arose through recombination-driven gene-specific sweeps, rather than genome-wide sweeps. Our work provides a novel paradigm of phenotype-associated differentiation induced by gene-specific sweeps in a human pathogen and has implications for understanding of driving forces of bacterial evolution. PMID:27821851

  10. Chromatin signatures in multipotent human hematopoietic stem cells indicate the fate of bivalent genes during differentiation.

    PubMed

    Cui, Kairong; Zang, Chongzhi; Roh, Tae-Young; Schones, Dustin E; Childs, Richard W; Peng, Weiqun; Zhao, Keji

    2009-01-09

    Histone modifications have been implicated in stem cell maintenance and differentiation. We have analyzed genome-wide changes in gene expression and histone modifications during differentiation of multipotent human primary hematopoietic stem cells/progenitor cells (HSCs/HPCs) into erythrocyte precursors. Our data indicate that H3K4me1, H3K9me1, and H3K27me1 associate with enhancers of differentiation genes prior to their activation and correlate with basal expression, suggesting that these monomethylations are involved in the maintenance of activation potential required for differentiation. In addition, although the majority of genes associated with both H3K4me3 and H3K27me3 in HSCs/HPCs become silent and lose H3K4me3 after differentiation, those that lose H3K27me3 and become activated after differentiation are associated with increased levels of H2A.Z, H3K4me1, H3K9me1, H4K20me1, and RNA polymerase II in HSCs/HPCs. Thus, our data suggest that gene expression changes during differentiation are programmed by chromatin modifications present at the HSC/HPC stage and provide a resource for enhancer and promoter identification.

  11. Identifying differential networks based on multi-platform gene expression data.

    PubMed

    Ou-Yang, Le; Yan, Hong; Zhang, Xiao-Fei

    2016-12-20

    Exploring how the structure of a gene regulatory network differs between two different disease states is fundamental for understanding the biological mechanisms behind disease development and progression. Recently, with rapid advances in microarray technologies, gene expression profiles of the same patients can be collected from multiple microarray platforms. However, previous differential network analysis methods were usually developed based on a single type of platform, which could not utilize the common information shared across different platforms. In this study, we introduce a multi-view differential network analysis model to infer the differential network between two different patient groups based on gene expression profiles collected from multiple platforms. Unlike previous differential network analysis models that need to analyze each platform separately, our model can draw support from multiple data platforms to jointly estimate the differential networks and produce more accurate and reliable results. Our simulation studies demonstrate that our method consistently outperforms other available differential network analysis methods. We also applied our method to identify network rewiring associated with platinum resistance using TCGA ovarian cancer samples. The experimental results demonstrate that the hub genes in our identified differential networks on the PI3K/AKT/mTOR pathway play an important role in drug resistance.

  12. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.

    PubMed

    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul

    2009-03-15

    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  13. The PLETHORA Gene Regulatory Network Guides Growth and Cell Differentiation in Arabidopsis Roots[OPEN

    PubMed Central

    Sanchez-Perez, Gabino F.; Rutjens, Bas; Gorte, Maartje; Prasad, Kalika; Bao, Dongping; Timmermans-Hereijgers, Johanna L.P.M.; Maeo, Kenichiro; Nakamura, Kenzo; Shimotohno, Akie; Pencik, Ales; van Heesch, Sebastiaan; de Bruijn, Ewart; Cuppen, Edwin; Willemsen, Viola

    2016-01-01

    Organ formation in animals and plants relies on precise control of cell state transitions to turn stem cell daughters into fully differentiated cells. In plants, cells cannot rearrange due to shared cell walls. Thus, differentiation progression and the accompanying cell expansion must be tightly coordinated across tissues. PLETHORA (PLT) transcription factor gradients are unique in their ability to guide the progression of cell differentiation at different positions in the growing Arabidopsis thaliana root, which contrasts with well-described transcription factor gradients in animals specifying distinct cell fates within an essentially static context. To understand the output of the PLT gradient, we studied the gene set transcriptionally controlled by PLTs. Our work reveals how the PLT gradient can regulate cell state by region-specific induction of cell proliferation genes and repression of differentiation. Moreover, PLT targets include major patterning genes and autoregulatory feedback components, enforcing their role as master regulators of organ development. PMID:27920338

  14. Forced expression of Hnf4a induces hepatic gene activation through directed differentiation.

    PubMed

    Yahoo, Neda; Pournasr, Behshad; Rostamzadeh, Jalal; Fathi, Fardin

    2016-08-05

    Embryonic stem (ES) cells are capable of unlimited self-renewal and have a diverse differentiation potential. These unique features make ES cells as an attractive source for developmental biology studies. Having the mature hepatocyte in the lab with functional activities is valuable in drug discovery studies. Overexpression of hepatocyte lineage-specific transcription factors (TFs) becomes a promising approach in pluripotent cell differentiation toward liver cells. Many studies generate transgenic ES cell lines to examine the effects of specific TFs overexpression in cell differentiation. In the present report, we have addressed whether a suspension or adherent model of differentiation is an appropriate way to study the role of Hnf4a overexpression. We generated ES cells that carried a doxycycline (Dox)-inducible Hnf4a using lentiviral vectors. The transduced cells were subjected to induced Hnf4a overexpression through both spontaneous and directed differentiation methods. Gene expression analysis showed substantially increased expression of hepatic gene markers, particularly Ttr and endogenous Hnf4a, in transduced cells differentiated by the directed approach. These results demonstrated that forced expression of TFs during directed differentiation would be an appropriate way to study relevant gene activation and the effects of overexpression in the context of hepatic differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Zebrafish sex determination and differentiation: Involvement of FTZ-F1 genes

    PubMed Central

    von Hofsten, Jonas; Olsson, Per-Erik

    2005-01-01

    Sex determination is the process deciding the sex of a developing embryo. This is usually determined genetically; however it is a delicate process, which in many cases can be influenced by environmental factors. The mechanisms controlling zebrafish sex determination and differentiation are not known. To date no sex linked genes have been identified in zebrafish and no sex chromosomes have been identified. However, a number of genes, as presented here, have been linked to the process of sex determination or differentiation in zebrafish. The zebrafish FTZ-F1 genes are of central interest as they are involved in regulating interrenal development and thereby steroid biosynthesis, as well as that they show expression patterns congruent with reproductive tissue differentiation and function. Zebrafish can be sex reversed by exposure to estrogens, suggesting that the estrogen levels are crucial during sex differentiation. The Cyp19 gene product aromatase converts testosterone into 17 beta-estradiol, and when inhibited leads to male to female sex reversal. FTZ-F1 genes are strongly linked to steroid biosynthesis and the regulatory region of Cyp19 contains binding sites for FTZ-F1 genes, further linking FTZ-F1 to this process. The role of FTZ-F1 and other candidates for zebrafish sex determination and differentiation is in focus of this review. PMID:16281973

  16. Live-Cell, Temporal Gene Expression Analysis of Osteogenic Differentiation in Adipose-Derived Stem Cells

    PubMed Central

    Desai, Hetal V.; Voruganti, Indu S.; Jayasuriya, Chathuraka; Chen, Qian

    2014-01-01

    Adipose-derived stem cells (ASCs) are a widely investigated type of mesenchymal stem cells with great potential for musculoskeletal regeneration. However, the use of ASCs is complicated by their cellular heterogeneity, which exists at both the population and single-cell levels. This study demonstrates a live-cell assay to investigate gene expression in ASCs undergoing osteogenesis using fluorescently tagged DNA hybridization probes called molecular beacons. A molecular beacon was designed to target the mRNA sequence for alkaline phosphatase (ALPL), a gene characteristically expressed during early osteogenesis. The percentage of cells expressing this gene in a population was monitored daily to quantify the uniformity of the differentiation process. Differentiating ASC populations were repeatedly measured in a nondestructive fashion over a 10-day period to obtain temporal gene expression data. Results showed consistent expression patterns for the investigated osteogenic genes in response to induction medium. Peak signal level, indicating when the most cells expressed ALPL at once, was observed on days 3–5. The differentiation response of sample populations was generally uniform when assessed on a well-by-well basis over time. The expression of alkaline phosphatase is consistent with previous studies of osteogenic differentiation, suggesting that molecular beacons are a viable means of monitoring the spatiotemporal gene expression of live, differentiating ASCs. PMID:24367991

  17. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    PubMed

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  18. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  19. Identification of stable reference genes in differentiating human pluripotent stem cells.

    PubMed

    Holmgren, Gustav; Ghosheh, Nidal; Zeng, Xianmin; Bogestål, Yalda; Sartipy, Peter; Synnergren, Jane

    2015-06-01

    Reference genes, often referred to as housekeeping genes (HKGs), are frequently used to normalize gene expression data based on the assumption that they are expressed at a constant level in the cells. However, several studies have shown that there may be a large variability in the gene expression levels of HKGs in various cell types. In a previous study, employing human embryonic stem cells (hESCs) subjected to spontaneous differentiation, we observed that the expression of commonly used HKG varied to a degree that rendered them inappropriate to use as reference genes under those experimental settings. Here we present a substantially extended study of the HKG signature in human pluripotent stem cells (hPSC), including nine global gene expression datasets from both hESC and human induced pluripotent stem cells, obtained during directed differentiation toward endoderm-, mesoderm-, and ectoderm derivatives. Sets of stably expressed genes were compiled, and a handful of genes (e.g., EID2, ZNF324B, CAPN10, and RABEP2) were identified as generally applicable reference genes in hPSCs across all cell lines and experimental conditions. The stability in gene expression profiles was confirmed by reverse transcription quantitative PCR analysis. Taken together, the current results suggest that differentiating hPSCs have a distinct HKG signature, which in some aspects is different from somatic cell types, and underscore the necessity to validate the stability of reference genes under the actual experimental setup used. In addition, the novel putative HKGs identified in this study can preferentially be used for normalization of gene expression data obtained from differentiating hPSCs.

  20. Differential gene expression patterns between smokers and non-smokers: cause or consequence?

    PubMed

    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I

    2017-03-01

    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  1. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  2. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  3. Balancing Type One and Two Errors in Multiple Testing for Differential Expression of Genes

    PubMed Central

    Gordon, Alexander; Chen, Linlin; Glazko, Galina; Yakovlev, Andrei

    2009-01-01

    A new procedure is proposed to balance type I and II errors in significance testing for differential expression of individual genes. Suppose that a collection, ℱk, of k lists of selected genes is available, each of them approximating by their content the true set of differentially expressed genes. For example, such sets can be generated by a subsampling counterpart of the delete-d-jackknife method controlling the per-comparison error rate for each subsample. A final list of candidate genes, denoted by S*, is composed in such a way that its contents be closest in some sense to all the sets thus generated. To measure “closeness” of gene lists, we introduce an asymmetric distance between sets with its asymmetry arising from a generally unequal assignment of the relative costs of type I and type II errors committed in the course of gene selection. The optimal set S* is defined as a minimizer of the average asymmetric distance from an arbitrary set S to all sets in the collection ℱk. The minimization problem can be solved explicitly, leading to a frequency criterion for the inclusion of each gene in the final set. The proposed method is tested by resampling from real microarray gene expression data with artificially introduced shifts in expression levels of pre-defined genes, thereby mimicking their differential expression. PMID:20161303

  4. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  5. Epigenetic Modifications Unlock the Milk Protein Gene Loci during Mouse Mammary Gland Development and Differentiation

    PubMed Central

    Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Hernandez, Joseph; Potluri, Vani; Wang, Liguo; Li, Wei; Lemay, Danielle G.

    2013-01-01

    Background Unlike other tissues, development and differentiation of the mammary gland occur mostly after birth. The roles of systemic hormones and local growth factors important for this development and functional differentiation are well-studied. In other tissues, it has been shown that chromatin organization plays a key role in transcriptional regulation and underlies epigenetic regulation during development and differentiation. However, the role of chromatin organization in mammary gland development and differentiation is less well-defined. Here, we have studied the changes in chromatin organization at the milk protein gene loci (casein, whey acidic protein, and others) in the mouse mammary gland before and after functional differentiation. Methodology/Principal Findings Distal regulatory elements within the casein gene cluster and whey acidic protein gene region have an open chromatin organization after pubertal development, while proximal promoters only gain open-chromatin marks during pregnancy in conjunction with the major induction of their expression. In contrast, other milk protein genes, such as alpha-lactalbumin, already have an open chromatin organization in the mature virgin gland. Changes in chromatin organization in the casein gene cluster region that are present after puberty persisted after lactation has ceased, while the changes which occurred during pregnancy at the gene promoters were not maintained. In general, mammary gland expressed genes and their regulatory elements exhibit developmental stage- and tissue-specific chromatin organization. Conclusions/Significance A progressive gain of epigenetic marks indicative of open/active chromatin on genes marking functional differentiation accompanies the development of the mammary gland. These results support a model in which a chromatin organization is established during pubertal development that is then poised to respond to the systemic hormonal signals of pregnancy and lactation to achieve the

  6. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    PubMed

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  7. CEDER: Accurate detection of differentially expressed genes by combining significance of exons using RNA-Seq

    PubMed Central

    Wan, Lin; Sun, Fengzhu

    2012-01-01

    RNA-Seq is widely used in transcriptome studies, and the detection of differentially expressed genes (DEGs) between two classes of individuals, e.g. cases vs controls, using RNA-Seq is of fundamental importance. Many statistical methods for DEG detection based on RNA-Seq data have been developed and most of them are based on the read counts mapped to individual genes. On the other hand, genes are composed of exons and the distribution of reads for the different exons can be heterogeneous. We hypothesize that the detection accuracy of differentially expressed genes can be increased by analyzing individual exons within a gene and then combining the results of the exons. We therefore developed a novel program, termed CEDER, to accurately detect DGEs by combining the significance of the exons. CEDER first tests for differentially expressed exons yielding a p-value for each, and then gives a score indicating the potential for a gene to be differentially expressed by integrating the p-values of the exons in the gene. We showed that CEDER can significantly increase the accuracy of existing methods for detecting DEGs on two benchmark RNA-Seq datasets and simulated datasets. PMID:22641709

  8. Gene differential coexpression analysis based on biweight correlation and maximum clique.

    PubMed

    Zheng, Chun-Hou; Yuan, Lin; Sha, Wen; Sun, Zhan-Li

    2014-01-01

    Differential coexpression analysis usually requires the definition of 'distance' or 'similarity' between measured datasets. Until now, the most common choice is Pearson correlation coefficient. However, Pearson correlation coefficient is sensitive to outliers. Biweight midcorrelation is considered to be a good alternative to Pearson correlation since it is more robust to outliers. In this paper, we introduce to use Biweight Midcorrelation to measure 'similarity' between gene expression profiles, and provide a new approach for gene differential coexpression analysis. Firstly, we calculate the biweight midcorrelation coefficients between all gene pairs. Then, we filter out non-informative correlation pairs using the 'half-thresholding' strategy and calculate the differential coexpression value of gene, The experimental results on simulated data show that the new approach performed better than three previously published differential coexpression analysis (DCEA) methods. Moreover, we use the maximum clique analysis to gene subset included genes identified by our approach and previously reported T2D-related genes, many additional discoveries can be found through our method.

  9. Gene Duplication, Population Genomics, and Species-Level Differentiation within a Tropical Mountain Shrub

    PubMed Central

    Mastretta-Yanes, Alicia; Zamudio, Sergio; Jorgensen, Tove H.; Arrigo, Nils; Alvarez, Nadir; Piñero, Daniel; Emerson, Brent C.

    2014-01-01

    Gene duplication leads to paralogy, which complicates the de novo assembly of genotyping-by-sequencing (GBS) data. The issue of paralogous genes is exacerbated in plants, because they are particularly prone to gene duplication events. Paralogs are normally filtered from GBS data before undertaking population genomics or phylogenetic analyses. However, gene duplication plays an important role in the functional diversification of genes and it can also lead to the formation of postzygotic barriers. Using populations and closely related species of a tropical mountain shrub, we examine 1) the genomic differentiation produced by putative orthologs, and 2) the distribution of recent gene duplication among lineages and geography. We find high differentiation among populations from isolated mountain peaks and species-level differentiation within what is morphologically described as a single species. The inferred distribution of paralogs among populations is congruent with taxonomy and shows that GBS could be used to examine recent gene duplication as a source of genomic differentiation of nonmodel species. PMID:25223767

  10. EMDomics: a robust and powerful method for the identification of genes differentially expressed between heterogeneous classes.

    PubMed

    Nabavi, Sheida; Schmolze, Daniel; Maitituoheti, Mayinuer; Malladi, Sadhika; Beck, Andrew H

    2016-02-15

    A major goal of biomedical research is to identify molecular features associated with a biological or clinical class of interest. Differential expression analysis has long been used for this purpose; however, conventional methods perform poorly when applied to data with high within class heterogeneity. To address this challenge, we developed EMDomics, a new method that uses the Earth mover's distance to measure the overall difference between the distributions of a gene's expression in two classes of samples and uses permutations to obtain q-values for each gene. We applied EMDomics to the challenging problem of identifying genes associated with drug resistance in ovarian cancer. We also used simulated data to evaluate the performance of EMDomics, in terms of sensitivity and specificity for identifying differentially expressed gene in classes with high within class heterogeneity. In both the simulated and real biological data, EMDomics outperformed competing approaches for the identification of differentially expressed genes, and EMDomics was significantly more powerful than conventional methods for the identification of drug resistance-associated gene sets. EMDomics represents a new approach for the identification of genes differentially expressed between heterogeneous classes and has utility in a wide range of complex biomedical conditions in which sample classes show within class heterogeneity. The R package is available at http://www.bioconductor.org/packages/release/bioc/html/EMDomics.html. © The Author 2015. Published by Oxford University Press.

  11. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-01-01

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  12. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.

    PubMed

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-03-04

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  13. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.

    PubMed

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong

    2016-09-20

    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  14. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.

    PubMed

    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios

    2012-09-01

    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  15. DNA methylation dynamics during intestinal stem cell differentiation reveals enhancers driving gene expression in the villus

    PubMed Central

    2013-01-01

    Background DNA methylation is of pivotal importance during development. Previous genome-wide studies identified numerous differentially methylated regions upon differentiation of stem cells, many of them associated with transcriptional start sites. Results We present the first genome-wide, single-base-resolution view into DNA methylation dynamics during differentiation of a mammalian epithelial stem cell: the mouse small intestinal Lgr5+ stem cell. Very little change was observed at transcriptional start sites and our data suggest that differentiation-related genes are already primed for expression in the stem cell. Genome-wide, only 50 differentially methylated regions were identified. Almost all of these loci represent enhancers driving gene expression in the differentiated part of the small intestine. Finally, we show that binding of the transcription factor Tcf4 correlates with hypo-methylation and demonstrate that Tcf4 is one of the factors contributing to formation of differentially methylated regions. Conclusions Our results reveal limited DNA methylation dynamics during small intestine stem cell differentiation and an impact of transcription factor binding on shaping the DNA methylation landscape during differentiation of stem cells in vivo. PMID:23714178

  16. The Antiaging Gene Klotho Regulates Proliferation and Differentiation of Adipose-Derived Stem Cells

    PubMed Central

    Fan, Jun; Sun, Zhongjie

    2017-01-01

    Klotho was originally discovered as an aging-suppressor gene. The purpose of this study was to investigate whether secreted Klotho (SKL) affects the proliferation and differentiation of adipose-derived stem cells (ADSCs). RT-PCR and Western blot analysis showed that short-form Klotho was expressed in mouse ADSCs. The Klotho gene mutation KL(−/−) significantly decreased proliferation of ADSCs and expression of pluripotent transcription factors (Nanog, Sox-2, and Oct-4) in mice. The adipogenic differentiation of ADSCs was also decreased in KL(−/−) mice. Incubation with Klotho-deficient medium decreased ADSC proliferation, pluripotent transcription factor levels, and adipogenic differentiation, which is similar to what was found in KL(−/−) mice. These results indicate that Klotho deficiency suppresses ADSC proliferation and differentiation. Interestingly, treatment with recombinant SKL protein rescued the Klotho deficiency-induced impairment in ADSC proliferation and adipogenic differentiation. SKL also regulated ADSCs’ differentiation to other cell lineages (osteoblasts, myofibroblasts), indicating that SKL maintains stemness of ADSCs. It is intriguing that overexpression of SKL significantly increased PPAR-γ expression and lipid formation in ADSCs following adipogenic induction, indicating enhanced adipogenic differentiation. Overexpression of SKL inhibited expression of TGFβ1 and its downstream signaling mediator Smad2/3. This study demonstrates, for the first time, that SKL is essential to the maintenance of normal proliferation and differentiation in ADSCs. Klotho regulates adipogenic differentiation in ADSCs, likely via inhibition of TGFβ1 and activation of PPAR-γ. PMID:26865060

  17. Differential Expression of Genes of the Calvin-Benson Cycle and its Related Genes During Leaf Development in Rice.

    PubMed

    Yamaoka, Chihiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    To understand how the machinery for photosynthetic carbon assimilation is formed and maintained during leaf development, changes in the mRNA levels of the Calvin-Benson cycle enzymes, ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activase and two key enzymes for sucrose synthesis were determined in rice (Oryza sativa L.). According to the patterns of changes in the mRNA levels, these genes were categorized into three groups. Group 1 included most of the genes involved in the carboxylation and reduction phases of the Calvin-Benson cycle, as well as three genes in the regeneration phase. The mRNA levels increased and reached maxima during leaf expansion and then rapidly declined, although there were some variations in the residual mRNA levels in senescent leaves. Group 2 included a number of genes involved in the regeneration phase, one gene in the reduction phase of the Calvin-Benson cycle and one gene in sucrose synthesis. The mRNA levels increased and almost reached maxima before full expansion and then gradually declined. Group 3 included Rubisco activase, one gene involved in the regeneration phase and one gene in sucrose synthesis. The overall pattern was similar to that in group 2 genes except that the mRNA levels reached maxima after the stage of full expansion. Thus, genes of the Calvin-Benson cycle and its related genes were differentially expressed during leaf development in rice, suggesting that such differential gene expression is necessary for formation and maintenance of the machinery of photosynthetic carbon assimilation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  18. Differential retention of gene functions in a secondary metabolite cluster

    USDA-ARS?s Scientific Manuscript database

    In fungi, distribution of secondary metabolite (SM) gene clusters is often associated with host- or environment-specific benefits provided by the SMs. In the plant pathogen Alternaria brassicicola (Dothideomycetes), the DEP cluster confers an ability to synthesize the SM depudecin, a histone deacety...

  19. Stress response in tardigrades: differential gene expression of molecular chaperones.

    PubMed

    Reuner, Andy; Hengherr, Steffen; Mali, Brahim; Förster, Frank; Arndt, Detlev; Reinhardt, Richard; Dandekar, Thomas; Frohme, Marcus; Brümmer, Franz; Schill, Ralph O

    2010-07-01

    Semi-terrestrial tardigrades exhibit a remarkable tolerance to desiccation by entering a state called anhydrobiosis. In this state, they show a strong resistance against several kinds of physical extremes. Because of the probable importance of stress proteins during the phases of dehydration and rehydration, the relative abundance of transcripts coding for two alpha-crystallin heat-shock proteins (Mt-sHsp17.2 and Mt-sHsp19.5), as well for the heat-shock proteins Mt-sHsp10, Mt-Hsp60, Mt-Hsp70 and Mt-Hsp90, were analysed in active and anhydrobiotic tardigrades of the species Milnesium tardigradum. They were also analysed in the transitional stage (I) of dehydration, the transitional stage (II) of rehydration and in heat-shocked specimens. A variable pattern of expression was detected, with most candidates being downregulated. Gene transcripts of one Mt-hsp70 isoform in the transitional stage I and Mt-hsp90 in the anhydrobiotic stage were significantly upregulated. A high gene expression (778.6-fold) was found for the small alpha-crystallin heat-shock protein gene Mt-sHsp17.2 after heat shock. We discuss the limited role of the stress-gene expression in the transitional stages between the active and anhydrobiotic tardigrades and other mechanisms which allow tardigrades to survive desiccation.

  20. Differential loss of embryonic globin genes during the radiation of placental mammals

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Storz, Jay F.

    2008-01-01

    The differential gain and loss of genes from homologous gene families represents an important source of functional variation among the genomes of different species. Differences in gene content between species are primarily attributable to lineage-specific gene gains via duplication and lineage-specific losses via deletion or inactivation. Here, we use a comparative genomic approach to investigate this process of gene turnover in the β-globin gene family of placental mammals. By analyzing genomic sequence data from representatives of each of the main superordinal clades of placental mammals, we were able to reconstruct pathways of gene family evolution during the basal radiation of this physiologically and morphologically diverse vertebrate group. Our analysis revealed that an initial expansion of the nonadult portion of the β-globin gene cluster in the ancestor of placental mammals was followed by the differential loss and retention of ancestral gene lineages, thereby generating variation in the complement of embryonic globin genes among contemporary species. The sorting of ε-, γ-, and η-globin gene lineages among the basal clades of placental mammals has produced species differences in the functional types of hemoglobin isoforms that can be synthesized during the course of embryonic development. PMID:18755893

  1. Differentiating mechanisms of toxicity using global gene expression analysis in Saccharomyces cerevisiae.

    PubMed

    Caba, Ebru; Dickinson, Donna A; Warnes, Gregory R; Aubrecht, Jiri

    2005-08-04

    Genotoxic stress triggers a variety of biological responses including the transcriptional activation of genes regulating DNA repair, cell survival and cell death. Genomic approaches, which monitor gene expressions across large numbers of genes, can serve as a powerful tool for exploring mechanisms of toxicity. Here, using five different agents, we investigated whether the analysis of genome-wide expression profiles in Saccharomyces cerevisiae could provide insights into mechanisms of genotoxicity versus cytotoxicity. To differentiate the genotoxic stress-associated expression signatures from that of a general cytotoxic stress, we compared gene expression profiles following the treatment with DNA-reactive (cisplatin, MMS, bleomycin) and DNA non-reactive (ethanol and sodium chloride) compounds. Although each of the tested chemicals produced a distinct gene expression profile, we were able to identify a gene expression signature consisting of a relatively small number of biologically relevant genes capable of differentiating genotoxic and cytotoxic stress. The gene set includes such upregulated genes as HUG1, ECM4 and previously uncharacterized gene, YLR297W in the genotoxic and GAP1, CGR1 in the cytotoxic group. Our results indicate the potential of gene expression profile analysis for elucidating mechanism of action of genotoxic agents.

  2. MRI reporter genes: applications for imaging of cell survival, proliferation, migration and differentiation.

    PubMed

    Vandsburger, Moriel H; Radoul, Marina; Cohen, Batya; Neeman, Michal

    2013-07-01

    Molecular imaging strives to detect molecular events at the level of the whole organism. In some cases, the molecule of interest can be detected either directly or with targeted contrast media. However many genes and proteins and particularly those located in intracellular compartments are not accessible for targeted agents. The transcriptional regulation of these genes can nevertheless be detected, although indirectly, using reporter gene encoding for readily detectable proteins. Such reporter proteins can be expressed in the tissue of interest by genetically introducing the reporter gene in the target cells. Imaging of reporter genes has become a powerful tool in modern biomedical research. Typically, expression of fluorescent and bioluminescent proteins and the reaction product of expressed enzymes and exogenous substrates were examined using in vitro histological methods and in vivo whole body imaging methods. Recent advances in MRI reporter gene methods raised the possibility that MRI could become a powerful tool for concomitant high-resolution anatomical and functional imaging and for imaging of reporter gene activity. An immediate application of MRI reporter gene methods was by monitoring gene expression patterns in gene therapy and in vivo imaging of the survival, proliferation, migration and differentiation of pluripotent and multipotent cells used in cell-based regenerative therapies for cancer, myocardial infarction and neural degeneration. In this review, we characterized a variety of MRI reporter gene methods based on their applicability to report cell survival/proliferation, migration and differentiation. In particular, we discussed which methods were best suited for translation to clinical use in regenerative therapies.

  3. [Differential expression of genes that encode glycolysis enzymes in kidney and lung cancer in humans].

    PubMed

    Oparina, N Yu; Snezhkina, A V; Sadritdinova, A F; Veselovskii, V A; Dmitriev, A A; Senchenko, V N; Mel'nikova, N V; Speranskaya, A S; Darii, M V; Stepanov, O A; Barkhatov, I M; Kudryavtseva, A V

    2013-07-01

    Glycolysis is a main catabolic pathway of glucose metabolism, accompanied by ATP synthesis. More than 30 enzymes are involved in glycolysis, and genes that encode them can be considered housekeeping genes due to the high conservatism and evolutionary antiquity of the process. We studied the expression of these genes in kidney papillary cancer and planocellular lung cancer via the bioinformatic analysis of transcriptome database and method of quantitative real time PCR. Quantitative analysis of mRNA level demonstrated that only a part ofgenes that encode glycolysis enzymes maintain relatively stable mRNA level, including the HK1, ADPGK, GPI, PGK1, and PKM2 genes in kidney papillary cancer and the ADPGK, ALDOA, GAPDH, PGK1, BPGM, ENO1, and PKM2 genes in planocellular lung cancer. The frequent increase in the mRNA expression of PFKP, ALDOA, and GAPDH genes in kidney cancer, as well as the GPI gene in lung cancer, were detected for the first time by real time PCR. For other genes, their differential expression was demonstrated; the cases of both a decrease and increase in the mRNA level were detected. Thus, several genes that can be used as control genes in transcriptome analysis by real time PCR in kidney and lung cancer, as well as a number of differentially expressed genes that can be potential oncomarkers, were identified.

  4. Differential loss of embryonic globin genes during the radiation of placental mammals.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Storz, Jay F

    2008-09-02

    The differential gain and loss of genes from homologous gene families represents an important source of functional variation among the genomes of different species. Differences in gene content between species are primarily attributable to lineage-specific gene gains via duplication and lineage-specific losses via deletion or inactivation. Here, we use a comparative genomic approach to investigate this process of gene turnover in the beta-globin gene family of placental mammals. By analyzing genomic sequence data from representatives of each of the main superordinal clades of placental mammals, we were able to reconstruct pathways of gene family evolution during the basal radiation of this physiologically and morphologically diverse vertebrate group. Our analysis revealed that an initial expansion of the nonadult portion of the beta-globin gene cluster in the ancestor of placental mammals was followed by the differential loss and retention of ancestral gene lineages, thereby generating variation in the complement of embryonic globin genes among contemporary species. The sorting of epsilon-, gamma-, and eta-globin gene lineages among the basal clades of placental mammals has produced species differences in the functional types of hemoglobin isoforms that can be synthesized during the course of embryonic development.

  5. Transcriptome Analysis of Differentially Expressed Genes Relevant to Variegation in Peach Flowers

    PubMed Central

    Yu, Faxin; Li, Shuxian; Yin, Tongming

    2014-01-01

    Background Variegation in flower color is commonly observed in many plant species and also occurs on ornamental peaches (Prunus persica f. versicolor [Sieb.] Voss). Variegated plants are highly valuable in the floricultural market. To gain a global perspective on genes differentially expressed in variegated peach flowers, we performed large-scale transcriptome sequencing of white and red petals separately collected from a variegated peach tree. Results A total of 1,556,597 high-quality reads were obtained, with an average read length of 445 bp. The ESTs were assembled into 16,530 contigs and 42,050 singletons. The resulting unigenes covered about 60% of total predicted genes in the peach genome. These unigenes were further subjected to functional annotation and biochemical pathway analysis. Digital expression analysis identified a total of 514 genes differentially expressed between red and white flower petals. Since peach flower coloration is determined by the expression and regulation of structural genes relevant to flavonoid biosynthesis, a detailed examination detected four key structural genes, including C4H, CHS, CHI and F3H, expressed at a significantly higher level in red than in white petal. Except for the structural genes, we also detected 11 differentially expressed regulatory genes relating to flavonoid biosynthesis. Using the differentially expressed structural genes as the test objects, we validated the digital expression results by using quantitative real-time PCR, and the differential expression of C4H, CHS and F3H were confirmed. Conclusion In this study, we generated a large EST collection from flower petals of a variegated peach. By digital expression analysis, we identified an informative list of candidate genes associated with variegation in peach flowers, which offered a unique opportunity to uncover the genetic mechanisms underlying flower color variegation. PMID:24603808

  6. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.

    PubMed

    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang

    2008-05-01

    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  7. Sequential changes at differentiation gene promoters as they become active in a stem cell lineage

    PubMed Central

    Chen, Xin; Lu, Chenggang; Prado, Jose Rafael Morillo; Eun, Suk Ho; Fuller, Margaret T.

    2011-01-01

    Transcriptional silencing of terminal differentiation genes by the Polycomb group (PcG) machinery is emerging as a key feature of precursor cells in stem cell lineages. How, then, is this epigenetic silencing reversed for proper cellular differentiation? Here, we investigate how the developmental program reverses local PcG action to allow expression of terminal differentiation genes in the Drosophila male germline stem cell (GSC) lineage. We find that the silenced state, set up in precursor cells, is relieved through developmentally regulated sequential events at promoters once cells commit to spermatocyte differentiation. The programmed events include global downregulation of Polycomb repressive complex 2 (PRC2) components, recruitment of hypophosphorylated RNA polymerase II (Pol II) to promoters, as well as the expression and action of testis-specific homologs of TATA-binding protein-associated factors (tTAFs). In addition, action of the testis-specific meiotic arrest complex (tMAC), a tissue-specific version of the MIP/dREAM complex, is required both for recruitment of tTAFs to target differentiation genes and for proper cell type-specific localization of PRC1 components and tTAFs within the spermatocyte nucleolus. Together, the action of the tMAC and tTAF cell type-specific chromatin and transcription machinery leads to loss of Polycomb and release of stalled Pol II from the terminal differentiation gene promoters, allowing robust transcription. PMID:21610025

  8. Gluten affects epithelial differentiation-associated genes in small intestinal mucosa of coeliac patients.

    PubMed

    Juuti-Uusitalo, K; Mäki, M; Kainulainen, H; Isola, J; Kaukinen, K

    2007-11-01

    In coeliac disease gluten induces an immunological reaction in genetically susceptible patients, and influences on epithelial cell proliferation and differentiation in the small-bowel mucosa. Our aim was to find novel genes which operate similarly in epithelial proliferation and differentiation in an epithelial cell differentiation model and in coeliac disease patient small-bowel mucosal biopsy samples. The combination of cDNA microarray data originating from a three-dimensional T84 epithelial cell differentiation model and small-bowel mucosal biopsy samples from untreated and treated coeliac disease patients and healthy controls resulted in 30 genes whose mRNA expression was similarly affected. Nine of 30 were located directly or indirectly in the receptor tyrosine kinase pathway starting from the epithelial growth factor receptor. Removal of gluten from the diet resulted in a reversion in the expression of 29 of the 30 genes in the small-bowel mucosal biopsy samples. Further characterization by blotting and labelling revealed increased epidermal growth factor receptor and beta-catenin protein expression in the small-bowel mucosal epithelium in untreated coeliac disease patients compared to healthy controls and treated coeliac patients. We found 30 genes whose mRNA expression was affected similarly in the epithelial cell differentiation model and in the coeliac disease patient small-bowel mucosal biopsy samples. In particular, those genes involved in the epithelial growth factor-mediated signalling pathways may be involved in epithelial cell differentiation and coeliac disease pathogenesis. The epithelial cell differentiation model is a useful tool for studying gene expression changes in the crypt-villus axis.

  9. Extent of differential allelic expression of candidate breast cancer genes is similar in blood and breast.

    PubMed

    Maia, Ana-Teresa; Spiteri, Inmaculada; Lee, Alvin J X; O'Reilly, Martin; Jones, Linda; Caldas, Carlos; Ponder, Bruce A J

    2009-01-01

    Normal gene expression variation is thought to play a central role in inter-individual variation and susceptibility to disease. Regulatory polymorphisms in cis-acting elements result in the unequal expression of alleles. Differential allelic expression (DAE) in heterozygote individuals could be used to develop a new approach to discover regulatory breast cancer susceptibility loci. As access to large numbers of fresh breast tissue to perform such studies is difficult, a suitable surrogate test tissue must be identified for future studies. We measured differential allelic expression of 12 candidate genes possibly related to breast cancer susceptibility (BRCA1, BRCA2, C1qA, CCND3, EMSY, GPX1, GPX4, MLH3, MTHFR, NBS1, TP53 and TRXR2) in breast tissue (n = 40) and fresh blood (n = 170) of healthy individuals and EBV-transformed lymphoblastoid cells (n = 19). Differential allelic expression ratios were determined by Taqman assay. Ratio distributions were compared using t-test and Wilcoxon rank sum test, for mean ratios and variances respectively. We show that differential allelic expression is common among these 12 candidate genes and is comparable between breast and blood (fresh and transformed lymphoblasts) in a significant proportion of them. We found that eight out of nine genes with DAE in breast and fresh blood were comparable, as were 10 out of 11 genes between breast and transformed lymphoblasts. Our findings support the use of differential allelic expression in blood as a surrogate for breast tissue in future studies on predisposition to breast cancer.

  10. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    PubMed

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  11. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.

    2011-01-01

    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  12. Differential gene expression profiles of peripheral blood mononuclear cells in childhood asthma.

    PubMed

    Kong, Qian; Li, Wen-Jing; Huang, Hua-Rong; Zhong, Ying-Qiang; Fang, Jian-Pei

    2015-05-01

    Asthma is a common childhood disease with strong genetic components. This study compared whole-genome expression differences between asthmatic young children and healthy controls to identify gene signatures of childhood asthma. Total RNA extracted from peripheral blood mononuclear cells (PBMC) was subjected to microarray analysis. QRT-PCR was performed to verify the microarray results. Classification and functional characterization of differential genes were illustrated by hierarchical clustering and gene ontology analysis. Multiple logistic regression (MLR) analysis, receiver operating characteristic (ROC) curve analysis, and discriminate power were used to scan asthma-specific diagnostic markers. For fold-change>2 and p < 0.05, there were 758 named differential genes. The results of QRT-PCR confirmed successfully the array data. Hierarchical clustering divided 29 highly possible genes into seven categories and the genes in the same cluster were likely to possess similar expression patterns or functions. Gene ontology analysis presented that differential genes primarily enriched in immune response, response to stress or stimulus, and regulation of apoptosis in biological process. MLR and ROC curve analysis revealed that the combination of ADAM33, Smad7, and LIGHT possessed excellent discriminating power. The combination of ADAM33, Smad7, and LIGHT would be a reliable and useful childhood asthma model for prediction and diagnosis.

  13. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  14. Gene expression profiling reveals epithelial mesenchymal transition (EMT) genes can selectively differentiate eribulin sensitive breast cancer cells.

    PubMed

    Dezső, Zoltán; Oestreicher, Judith; Weaver, Amy; Santiago, Stephanie; Agoulnik, Sergei; Chow, Jesse; Oda, Yoshiya; Funahashi, Yasuhiro

    2014-01-01

    Eribulin mesylate is a synthetic macrocyclic ketone analog of the marine sponge natural product halichondrin B. Eribulin is a mechanistically unique inhibitor of microtubule dynamics. In this study, we investigated whether selective signal pathways were associated with eribulin activity compared to paclitaxel, which stabilizes microtubules, based on gene expression profiling of cell line panels of breast, endometrial, and ovarian cancer in vitro. We determined the sets of genes that were differentially altered between eribulin and paclitaxel treatment in breast, endometrial, and ovarian cancer cell line panels. Our unsupervised clustering analyses revealed that expression profiles of gene sets altered with treatments were correlated with the in vitro antiproliferative activities of the drugs. Several tubulin isotypes had significantly lower expression in cell lines treated with eribulin compared to paclitaxel. Pathway enrichment analyses of gene sets revealed that the common pathways altered between treatments in the 3 cancer panels were related to cytoskeleton remodeling and cell cycle regulation. The epithelial-mesenchymal transition (EMT) pathway was enriched in genes with significantly altered expression between the two drugs for breast and endometrial cancers, but not for ovarian cancer. Expression of genes from the EMT pathway correlated with eribulin sensitivity in breast cancer and with paclitaxel sensitivity in endometrial cancer. Alteration of expression profiles of EMT genes between sensitive and resistant cell lines allowed us to predict drug sensitivity for breast and endometrial cancers. Gene expression analysis showed that gene sets that were altered between eribulin and paclitaxel correlated with drug in vitro antiproliferative activities in breast and endometrial cancer cell line panels. Among the panels, breast cancer provided the strongest differentiation between eribulin and paclitaxel sensitivities based on gene expression. In addition, EMT

  15. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    PubMed

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing

  16. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION.

    PubMed

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J; Alexander, Warren S; Smyth, Gordon K

    2016-06-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  17. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION

    PubMed Central

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J.; Alexander, Warren S.; Smyth, Gordon K.

    2017-01-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  18. The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis

    PubMed Central

    Eichenberger, Patrick; Fujita, Masaya; Jensen, Shane T; Conlon, Erin M; Rudner, David Z; Wang, Stephanie T; Ferguson, Caitlin; Haga, Koki; Sato, Tsutomu; Liu, Jun S

    2004-01-01

    Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: σE, σK, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The σE factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the σE regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of σK . Next, σK activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by σK while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

  19. An Orthologous Epigenetic Gene Expression Signature Derived from Differentiating Embryonic Stem Cells Identifies Regulators of Cardiogenesis.

    PubMed

    Busser, Brian W; Lin, Yongshun; Yang, Yanqin; Zhu, Jun; Chen, Guokai; Michelson, Alan M

    2015-01-01

    Here we used predictive gene expression signatures within a multi-species framework to identify the genes that underlie cardiac cell fate decisions in differentiating embryonic stem cells. We show that the overlapping orthologous mouse and human genes are the most accurate candidate cardiogenic genes as these genes identified the most conserved developmental pathways that characterize the cardiac lineage. An RNAi-based screen of the candidate genes in Drosophila uncovered numerous novel cardiogenic genes. shRNA knockdown combined with transcriptome profiling of the newly-identified transcription factors zinc finger protein 503 and zinc finger E-box binding homeobox 2 and the well-known cardiac regulatory factor NK2 homeobox 5 revealed that zinc finger E-box binding homeobox 2 activates terminal differentiation genes required for cardiomyocyte structure and function whereas zinc finger protein 503 and NK2 homeobox 5 are required for specification of the cardiac lineage. We further demonstrated that an essential role of NK2 homeobox 5 and zinc finger protein 503 in specification of the cardiac lineage is the repression of gene expression programs characteristic of alternative cell fates. Collectively, these results show that orthologous gene expression signatures can be used to identify conserved cardiogenic pathways.

  20. Genes of Both Parental Origins Are Differentially Involved in Early Embryogenesis of a Tobacco Interspecies Hybrid

    PubMed Central

    Xin, Hai-Ping; Zhao, Jing; Li, Shi-Sheng; Qu, Liang-Huan; Ma, Li-Gang; Scholten, Stefan; Sun, Meng-Xiang

    2011-01-01

    Background In animals, early embryonic development is largely dependent on maternal transcripts synthesized during gametogenesis. However, in higher plants, the extent of maternal control over zygote development and early embryogenesis is not fully understood yet. Nothing is known about the activity of the parental genomes during seed formation of interspecies hybrids. Methodology/Principal Findings Here, we report that an interspecies hybridization system between SR1 (Nicotiana tabacum) and Hamayan (N. rustica) has been successfully established. Based on the system we selected 58 genes that have polymorphic sites between SR1 and Hamayan, and analyzed the allele-specific expression of 28 genes in their hybrid zygotes (Hamayan x SR1). Finally the allele-specific expressions of 8 genes in hybrid zygotes were repeatedly confirmed. Among them, 4 genes were of paternal origin, 1 gene was of maternal origin and 3 genes were of biparental origin. These results revealed obvious biparental involvement and differentially contribution of parental-origin genes to zygote development in the interspecies hybrid. We further detected the expression pattern of the genes at 8-celled embryo stage found that the involvement of the parental-origin genes may change at different stages of embryogenesis. Conclusions/Significance We reveal that genes of both parental origins are differentially involved in early embryogenesis of a tobacco interspecies hybrid and functions in a developmental stage-dependent manner. This finding may open a window to seek for the possible molecular mechanism of hybrid vigor. PMID:21829711

  1. Fully Bayesian mixture model for differential gene expression: simulations and model checks.

    PubMed

    Lewin, Alex; Bochkina, Natalia; Richardson, Sylvia

    2007-01-01

    We present a Bayesian hierarchical model for detecting differentially expressed genes using a mixture prior on the parameters representing differential effects. We formulate an easily interpretable 3-component mixture to classify genes as over-expressed, under-expressed and non-differentially expressed, and model gene variances as exchangeable to allow for variability between genes. We show how the proportion of differentially expressed genes, and the mixture parameters, can be estimated in a fully Bayesian way, extending previous approaches where this proportion was fixed and empirically estimated. Good estimates of the false discovery rates are also obtained. Different parametric families for the mixture components can lead to quite different classifications of genes for a given data set. Using Affymetrix data from a knock out and wildtype mice experiment, we show how predictive model checks can be used to guide the choice between possible mixture priors. These checks show that extending the mixture model to allow extra variability around zero instead of the usual point mass null fits the data better. A software package for R is available.

  2. DNA Methylation Profiling Reveals Correlation of Differential Methylation Patterns with Gene Expression in Human Epilepsy.

    PubMed

    Wang, Liang; Fu, Xinwei; Peng, Xi; Xiao, Zheng; Li, Zhonggui; Chen, Guojun; Wang, Xuefeng

    2016-05-01

    DNA methylation plays important roles in regulating gene expression and has been reported to be related with epilepsy. This study aimed to define differential DNA methylation patterns in drug-refractory epilepsy patients and to investigate the role of DNA methylation in human epilepsy. We performed DNA methylation profiling in brain tissues from epileptic and control patients via methylated-cytosine DNA immunoprecipitation microarray chip. Differentially methylated loci were validated by bisulfite sequencing PCR, and the messenger RNA (mRNA) levels of candidate genes were evaluated by reverse transcriptase PCR. We found 224 genes that showed differential DNA methylation between epileptic patients and controls. Among the seven candidate genes, three genes (TUBB2B, ATPGD1, and HTR6) showed relative transcriptional regulation by DNA methylation. TUBB2B and ATPGD1 exhibited hypermethylation and decreased mRNA levels, whereas HTR6 displayed hypomethylation and increased mRNA levels in the epileptic samples. Our findings suggest that certain genes become differentially regulated by DNA methylation in human epilepsy.

  3. Umbilical cord mesenchymal stem cells: role of regulatory genes in their differentiation to osteoblasts.

    PubMed

    Ciavarella, Sabino; Dammacco, Franco; De Matteo, Monica; Loverro, Giuseppe; Silvestris, Franco

    2009-10-01

    Umbilical cord (UC) mesenchymal stem cells (MSCs) are being currently investigated as an alternative to bone marrow (BM) MSCs for bone repair and regeneration. Here, we describe the gene regulation of their differentiation to osteogenic, adipogenic, and chondrogenic precursors and demonstrate their tendency to differentiate toward the osteoblast lineage. Fibroblast-like cells from the Warthon's Jelly were cultured with dedicated media to obtain osteogenic-, adipogenic-, and chondrogenic-differentiated cells. After induction, a typical fibroblast-like shape with condensed fibers of F-actin was early noted in osteogenic-induced UC-MSCs, whereas those differentiating to adipocytes were flat with minor cytoskeleton relevance. Real-time PCR measured the transcription of master genes of the three lineages, thus revealing a remarkable up-regulation of Runx2 in osteogenic-induced cells with respect to both PPARg and SOX9 for adipogenic- and chondrogenic-differentiating UC-MSCs. However, TAZ, a coactivator of the nuclear transcription of Runx2 previously detected in BM-MSCs, was expressed in osteogenic- and, at lower magnitude, in adipogenic-induced cells, in keeping with its role in the reciprocal control of the differentiation between osteogenic- and adipogenic-induced cells. Its differential role in these cells was confirmed by its accumulation as protein product in the nuclei to activate Runx2 in osteogenic-differentiating UC-MSCs. These data emphasize the predominant expression by UC-MSCs of genes engaged in the osteogenic differentiation and their tendency to differentiate into osteoblasts, being similar in this respect to BM-MSCs. They may, thus, constitute a promising option for bone remodeling in regenerative medicine.

  4. Gene expression profiling of human neural progenitor cells following the serum-induced astrocyte differentiation.

    PubMed

    Obayashi, Shinya; Tabunoki, Hiroko; Kim, Seung U; Satoh, Jun-ichi

    2009-05-01

    Neural stem cells (NSC) with self-renewal and multipotent properties could provide an ideal cell source for transplantation to treat spinal cord injury, stroke, and neurodegenerative diseases. However, the majority of transplanted NSC and neural progenitor cells (NPC) differentiate into astrocytes in vivo under pathological environments in the central nervous system, which potentially cause reactive gliosis. Because the serum is a potent inducer of astrocyte differentiation of rodent NPC in culture, we studied the effect of the serum on gene expression profile of cultured human NPC to identify the gene signature of astrocyte differentiation of human NPC. Human NPC spheres maintained in the serum-free culture medium were exposed to 10% fetal bovine serum (FBS) for 72 h, and processed for analyzing on a Whole Human Genome Microarray of 41,000 genes, and the microarray data were validated by real-time RT-PCR. The serum elevated the levels of expression of 45 genes, including ID1, ID2, ID3, CTGF, TGFA, METRN, GFAP, CRYAB and CSPG3, whereas it reduced the expression of 23 genes, such as DLL1, DLL3, PDGFRA, SOX4, CSPG4, GAS1 and HES5. Thus, the serum-induced astrocyte differentiation of human NPC is characterized by a counteraction of ID family genes on Delta family genes. Coimmunoprecipitation analysis identified ID1 as a direct binding partner of a proneural basic helix-loop-helix (bHLH) transcription factor MASH1. Luciferase assay indicated that activation of the DLL1 promoter by MASH1 was counteracted by ID1. Bone morphogenetic protein 4 (BMP4) elevated the levels of ID1 and GFAP expression in NPC under the serum-free culture conditions. Because the serum contains BMP4, these results suggest that the serum factor(s), most probably BMP4, induces astrocyte differentiation by upregulating the expression of ID family genes that repress the proneural bHLH protein-mediated Delta expression in human NPC.

  5. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  6. Climate niche differentiation between two passerines despite ongoing gene flow.

    PubMed

    Shaner, Pei-Jen L; Tsao, Tzu-Hsuan; Lin, Rong-Chien; Liang, Wei; Yeh, Chia-Fen; Yang, Xiao-Jun; Lei, Fu-Min; Zhou, Fang; Yang, Can-Chao; Hung, Le Manh; Hsu, Yu-Cheng; Li, Shou-Hsien

    2015-05-01

    Niche evolution underpins the generation and maintenance of biological diversity, but niche conservatism, in which niches remain little changed over time in closely related taxa, and the role of ecology in niche evolution are continually debated. To test whether climate niches are conserved in two closely related passerines in East Asia - the vinous-throated (Paradoxornis webbianus) and ashy-throated (P. alphonsianus) parrotbills - we established their potential allopatric and sympatric regions using ecological niche models and compared differences in their climate niches using niche overlap indices in background tests and multivariate statistical analyses. We also used polymorphism data on 44 nuclear genes to infer their divergence demography. We found that these two parrotbills occupy different climate niches, in both their allopatric and potential sympatric regions. Because the potential sympatric region is the area predicted to be suitable for both parrotbills based on the ecological niche models, it can serve as a natural common garden. Therefore, their observed niche differences in this potential sympatry were not simply rendered by phenotypic plasticity and probably had a genetic basis. Our genetic analyses revealed that the two parrotbills are not evolutionarily independent for the most recent part of their divergence history. The two parrotbills diverged c. 856,000 years ago and have had substantial gene flow since a presumed secondary contact c. 290,000 years ago. This study provides an empirical case demonstrating that climate niches may not be homogenized in nascent species in spite of substantial, ongoing gene flow, which in turn suggests a role for ecology in promoting and maintaining diversification among incipient species.

  7. FOXO1A differentially regulates genes of decidualization.

    PubMed

    Buzzio, Oscar L; Lu, Zhenxiao; Miller, Curt D; Unterman, Terry G; Kim, J Julie

    2006-08-01

    The forkhead box O1A (FOXO1A) has been identified as one gene that is up-regulated early in the decidualization process. To further investigate the role of FOXO1A during this process, six genes, IGFBP1, PRL, TIMP3, LAMB1, CNR1, and DCN, shown to be up-regulated during decidualization, were chosen as potential targets of FOXO1A action. Treatment of human endometrial stromal cells with hormones (estradiol and medroxyprogesterone acetate) plus dibutyryl cAMP (H+dbcAMP) for 48 h increased expression of IGFBP1, PRL, TIMP3, CNR1, and DCN but not LAMB1, as measured by real-time PCR. Silencing of FOXO1A using small interfering RNA oligonucleotides decreased IGFBP1 and DCN levels and increased CNR1, TIMP3, and PRL levels. LAMB1 was not affected. When FOXO1A was overexpressed in human endometrial stromal cells, expression of IGFBP1, DCN, and PRL increased, whereas levels of TIMP3 and CNR1 decreased. Addition of H+dbcAMP caused an increased expression of IGFBP1, PRL, and DCN beyond that of FOXO1A alone. TIMP3 and CNR1 levels decreased even further in response to H+dbcAMP compared with FOXO1A alone. LAMB1, which was unresponsive to FOXO1A, decreased when H+dbcAMP was added. Overexpressing FOXO1A also caused a change in cell shape, in that the stromal fibroblasts acquired a rounded, epithelioid appearance. Finally, reporter studies showed that cotransfection of FOXO1A significantly increased PRL promoter activity but not TIMP3 promoter activity. Addition of H+dbcAMP resulted in a significant increase in PRL promoter activity and a significant decrease in TIMP3 promoter activity. In summary, this study demonstrates the versatile nature of FOXO1A in the regulation of a number of decidualization-specific genes.

  8. Replicon-dependent differentiation of symbiosis-related genes in Sinorhizobium strains nodulating Glycine max.

    PubMed

    Guo, Hui Juan; Wang, En Tao; Zhang, Xing Xing; Li, Qin Qin; Zhang, Yan Ming; Tian, Chang Fu; Chen, Wen Xin

    2014-02-01

    In order to investigate the genetic differentiation of Sinorhizobium strains nodulating Glycine max and related microevolutionary mechanisms, three housekeeping genes (SMc00019, truA, and thrA) and 16 symbiosis-related genes on the chromosome (7 genes), pSymA (6 genes), and pSymB (3 genes) were analyzed. Five distinct species were identified among the test strains by calculating the average nucleotide identity (ANI) of SMc00019-truA-thrA: Sinorhizobium fredii, Sinorhizobium sojae, Sinorhizobium sp. I, Sinorhizobium sp. II, and Sinorhizobium sp. III. These species assignments were also supported by population genetics and phylogenetic analyses of housekeeping genes and symbiosis-related genes on the chromosome and pSymB. Different levels of genetic differentiation were observed among these species or different replicons. S. sojae was the most divergent from the other test species and was characterized by its low intraspecies diversity and limited geographic distribution. Intergenic recombination dominated the evolution of 19 genes from different replicons. Intraspecies recombination happened frequently in housekeeping genes and symbiosis-related genes on the chromosome and pSymB, whereas pSymA genes showed a clear pattern of lateral-transfer events between different species. Moreover, pSymA genes were characterized by a lower level of polymorphism and recombination than those on the chromosome and pSymB. Taken together, genes from different replicons of rhizobia might be involved in the establishment of symbiosis with legumes, but these symbiosis-related genes might have evolved differently according to their corresponding replicons.

  9. Replicon-Dependent Differentiation of Symbiosis-Related Genes in Sinorhizobium Strains Nodulating Glycine max

    PubMed Central

    Guo, Hui Juan; Wang, En Tao; Zhang, Xing Xing; Li, Qin Qin; Zhang, Yan Ming; Chen, Wen Xin

    2014-01-01

    In order to investigate the genetic differentiation of Sinorhizobium strains nodulating Glycine max and related microevolutionary mechanisms, three housekeeping genes (SMc00019, truA, and thrA) and 16 symbiosis-related genes on the chromosome (7 genes), pSymA (6 genes), and pSymB (3 genes) were analyzed. Five distinct species were identified among the test strains by calculating the average nucleotide identity (ANI) of SMc00019-truA-thrA: Sinorhizobium fredii, Sinorhizobium sojae, Sinorhizobium sp. I, Sinorhizobium sp. II, and Sinorhizobium sp. III. These species assignments were also supported by population genetics and phylogenetic analyses of housekeeping genes and symbiosis-related genes on the chromosome and pSymB. Different levels of genetic differentiation were observed among these species or different replicons. S. sojae was the most divergent from the other test species and was characterized by its low intraspecies diversity and limited geographic distribution. Intergenic recombination dominated the evolution of 19 genes from different replicons. Intraspecies recombination happened frequently in housekeeping genes and symbiosis-related genes on the chromosome and pSymB, whereas pSymA genes showed a clear pattern of lateral-transfer events between different species. Moreover, pSymA genes were characterized by a lower level of polymorphism and recombination than those on the chromosome and pSymB. Taken together, genes from different replicons of rhizobia might be involved in the establishment of symbiosis with legumes, but these symbiosis-related genes might have evolved differently according to their corresponding replicons. PMID:24317084

  10. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  11. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C

    2001-01-01

    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11461082

  12. Global Regulation of Differential Gene Expression by c-Abl/Arg Oncogenic Kinases.

    PubMed

    Dong, Qincai; Li, Chenggong; Qu, Xiuhua; Cao, Cheng; Liu, Xuan

    2017-05-30

    BACKGROUND Studies have found that c-Abl oncogenic kinases may regulate gene transcription by RNA polymerase II phosphorylation or by direct regulation of specific transcription factors or coactivators. However, the global regulation of differential gene expression by c-Abl/Arg is largely unknown. In this study, differentially expressed genes (DEGs) regulated by c-Abl/Arg were identified, and related cellular functions and associated pathways were investigated. MATERIAL AND METHODS RNA obtained from wild-type and c-Abl/Arg gene-silenced MCF-7 cells was analyzed by RNA-Seq. DEGs were identified using edgeR software and partially validated by qRT-PCR. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were used to explore the potential functions of these DEGs. RESULTS A total of 1,034 DEGs were significantly regulated by c-Abl/Arg (399 were up-regulated and 635 were down-regulated after c-Abl/Arg double knockdown). GO and KEGG analyses showed that the DEGs were primarily involved in cellular metabolic processes, neurodegenerative disease, the metabolic process and signaling pathway of cAMP, angiogenesis, and cell proliferation. CONCLUSIONS Our data collectively support the hypothesis that c-Abl/Arg regulate differential gene expression, providing new insights into the biological functions of c-Abl and Arg.

  13. Inhibition of human primary megakaryocyte differentiation by anagrelide: a gene expression profiling analysis.

    PubMed

    Sakurai, Kazuki; Fujiwara, Tohru; Hasegawa, Shin; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Yamada-Fujiwara, Minami; Ichinohasama, Ryo; Harigae, Hideo

    2016-08-01

    Anagrelide is a treatment option for patients with essential thrombocythemia. Although the clinical efficacy of anagrelide has been established, there is limited knowledge of the molecular mechanism underlying its effect. Here, we evaluated the effect of anagrelide on primary megakaryocytic progenitors from cord blood-derived CD34-positive cells. Anagrelide treatment reduced the expression of megakaryocytic markers (CD41 and CD61). Microarray analysis was performed to characterize gene profiles altered by exposure to anagrelide. The analysis demonstrated upregulation and downregulation (>2-fold) of eight and 34 genes, respectively, in anagrelide-treated megakaryocyte progenitors. This included genes encoding prototypical megakaryocytic proteins, such as PPBP, PF4, and GP6. Gene ontology analysis of genes suppressed by anagrelide treatment revealed significant enrichment of genes involved in platelet activation and degranulation. Expression levels of transcription factors involved in megakaryocyte commitment/differentiation were further evaluated by quantitative RT-PCR, demonstrating significant downregulation of FLI1 and TAL1 in anagrelide-treated megakaryocyte progenitors. Knockdown of TAL1 in primary megakaryocyte progenitors confirmed significant downregulation of FLI1 and megakaryocytic genes. Anagrelide had no significant effect on the surface expression of erythroid markers or on the expression of transcription factors involved in erythroid commitment/differentiation. In conclusion, anagrelide suppresses megakaryocytic differentiation, partly through decreasing the expression of megakaryocytic transcription factors.

  14. Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

    PubMed

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2017-08-22

    Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

  15. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  16. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum.

    PubMed

    Oppert, Brenda; Guedes, Raul N C; Aikins, Michael J; Perkin, Lindsey; Chen, Zhaorigetu; Phillips, Thomas W; Zhu, Kun Yan; Opit, George P; Hoon, Kelly; Sun, Yongming; Meredith, Gavin; Bramlett, Kelli; Hernandez, Natalie Supunpong; Sanderson, Brian; Taylor, Madison W; Dhingra, Dalia; Blakey, Brandon; Lorenzen, Marcé; Adedipe, Folukemi; Arthur, Frank

    2015-11-18

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in stored product pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-Seq to compare gene expression in phosphine-resistant and susceptible laboratory populations of the red flour beetle, Tribolium castaneum. Each population was evaluated as either phosphine-exposed or no phosphine (untreated controls) in triplicate biological replicates (12 samples total). Pairwise analysis indicated there were eight genes differentially expressed between susceptible and resistant insects not exposed to phosphine (i.e., basal expression) or those exposed to phopshine (>8-fold expression and 90 % C.I.). However, 214 genes were differentially expressed among all four treatment groups at a statistically significant level (ANOVA, p < 0.05). Increased expression of 44 cytochrome P450 genes was found in resistant vs. susceptible insects, and phosphine exposure resulted in additional increases of 21 of these genes, five of which were significant among all treatment groups (p < 0.05). Expression of two genes encoding anti-diruetic peptide was 2- to 8-fold reduced in phosphine-resistant insects, and when exposed to phosphine, expression was further reduced 36- to 500-fold compared to susceptible. Phosphine-resistant insects also displayed differential expression of cuticle, carbohydrate, protease, transporter, and many mitochondrial genes, among others. Gene ontology terms associated with mitochondrial functions (oxidation biological processes, monooxygenase and catalytic molecular functions, and iron, heme, and tetrapyyrole binding) were enriched in the significantly differentially expressed dataset. Sequence polymorphism was found in transcripts encoding a known phosphine resistance gene, dihydrolipoamide dehydrogenase, in both susceptible and resistant

  17. Transcriptome Profiling Identifies Differentially Expressed Genes in Postnatal Developing Pituitary Gland of Miniature Pig

    PubMed Central

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development. PMID:24282060

  18. Transcriptome profiling identifies differentially expressed genes in postnatal developing pituitary gland of miniature pig.

    PubMed

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development.

  19. Differential co-expression analysis reveals a novel prognostic gene module in ovarian cancer.

    PubMed

    Gov, Esra; Arga, Kazim Yalcin

    2017-07-10

    Ovarian cancer is one of the most significant disease among gynecological disorders that women suffered from over the centuries. However, disease-specific and effective biomarkers were still not available, since studies have focused on individual genes associated with ovarian cancer, ignoring the interactions and associations among the gene products. Here, ovarian cancer differential co-expression networks were reconstructed via meta-analysis of gene expression data and co-expressed gene modules were identified in epithelial cells from ovarian tumor and healthy ovarian surface epithelial samples to propose ovarian cancer associated genes and their interactions. We propose a novel, highly interconnected, differentially co-expressed, and co-regulated gene module in ovarian cancer consisting of 84 prognostic genes. Furthermore, the specificity of the module to ovarian cancer was shown through analyses of datasets in nine other cancers. These observations underscore the importance of transcriptome based systems biomarkers research in deciphering the elusive pathophysiology of ovarian cancer, and here, we present reciprocal interplay between candidate ovarian cancer genes and their transcriptional regulatory dynamics. The corresponding gene module might provide new insights on ovarian cancer prognosis and treatment strategies that continue to place a significant burden on global health.

  20. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    PubMed

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  1. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes.

    PubMed

    Gierz, Sarah L; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral's daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions.

  2. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes

    PubMed Central

    Gierz, Sarah L.; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral’s daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions. PMID:28293249

  3. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development.

  4. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  5. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    SciTech Connect

    Robinson, Claire; Kolb, Andreas F.

    2009-02-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A {beta}-galactosidase reporter gene was inserted in place of the {beta}-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the {beta}-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal {beta}-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the {beta}-casein gene.

  6. Identification of differentially expressed genes in Chrysanthemum nankingense (Asteraceae) under heat stress by RNA Seq.

    PubMed

    Sun, Jing; Ren, Liping; Cheng, Yue; Gao, Jiaojiao; Dong, Bin; Chen, Sumei; Chen, Fadi; Jiang, Jiafu

    2014-11-15

    The RNA-Seq platform was used to characterize the high-temperature stress response of Chrysanthemum nankingense. A set of 54,668 differentially expressed unigenes was identified. After a threshold of ratio change ≥ 2 and a q-value of <0.05 were applied, the number of differentially transcribed genes was reduced to 3955, of which 765 were up-regulated and 3190 were down-regulated in response to heat stress. The differentially transcribed genes were predicted to participate in 26 biological processes, 4 cellular components, and 13 molecular functions. Among the most differentially expressed genes between the two libraries were well-recognized high-temperature responsive protein families, such as heat shock factors and heat shock proteins, various transcription factor families, and a number of RNA metabolism-related genes. Overall, the RNA-Seq analyses revealed a high degree of transcriptional complexity in early heat stress response. Some of these high-temperature responsive C. nankingense genes may prove useful in efforts to improve thermotolerance of commercial chrysanthemum. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. NetDiff – Bayesian model selection for differential gene regulatory network inference

    PubMed Central

    Thorne, Thomas

    2016-01-01

    Differential networks allow us to better understand the changes in cellular processes that are exhibited in conditions of interest, identifying variations in gene regulation or protein interaction between, for example, cases and controls, or in response to external stimuli. Here we present a novel methodology for the inference of differential gene regulatory networks from gene expression microarray data. Specifically we apply a Bayesian model selection approach to compare models of conserved and varying network structure, and use Gaussian graphical models to represent the network structures. We apply a variational inference approach to the learning of Gaussian graphical models of gene regulatory networks, that enables us to perform Bayesian model selection that is significantly more computationally efficient than Markov Chain Monte Carlo approaches. Our method is demonstrated to be more robust than independent analysis of data from multiple conditions when applied to synthetic network data, generating fewer false positive predictions of differential edges. We demonstrate the utility of our approach on real world gene expression microarray data by applying it to existing data from amyotrophic lateral sclerosis cases with and without mutations in C9orf72, and controls, where we are able to identify differential network interactions for further investigation. PMID:27982083

  8. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.

    2014-01-01

    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  9. NetDiff - Bayesian model selection for differential gene regulatory network inference.

    PubMed

    Thorne, Thomas

    2016-12-16

    Differential networks allow us to better understand the changes in cellular processes that are exhibited in conditions of interest, identifying variations in gene regulation or protein interaction between, for example, cases and controls, or in response to external stimuli. Here we present a novel methodology for the inference of differential gene regulatory networks from gene expression microarray data. Specifically we apply a Bayesian model selection approach to compare models of conserved and varying network structure, and use Gaussian graphical models to represent the network structures. We apply a variational inference approach to the learning of Gaussian graphical models of gene regulatory networks, that enables us to perform Bayesian model selection that is significantly more computationally efficient than Markov Chain Monte Carlo approaches. Our method is demonstrated to be more robust than independent analysis of data from multiple conditions when applied to synthetic network data, generating fewer false positive predictions of differential edges. We demonstrate the utility of our approach on real world gene expression microarray data by applying it to existing data from amyotrophic lateral sclerosis cases with and without mutations in C9orf72, and controls, where we are able to identify differential network interactions for further investigation.

  10. An independent validation of a gene expression signature to differentiate malignant melanoma from benign melanocytic nevi

    PubMed Central

    Flake, Darl D.; Busam, Klaus; Cockerell, Clay; Helm, Klaus; McNiff, Jennifer; Reed, Jon; Tschen, Jaime; Kim, Jinah; Barnhill, Raymond; Elenitsas, Rosalie; Prieto, Victor G.; Nelson, Jonathan; Kimbrell, Hillary; Kolquist, Kathryn A.; Brown, Krystal L.; Warf, M. Bryan; Roa, Benjamin B.; Wenstrup, Richard J.

    2016-01-01

    BACKGROUND Recently, a 23‐gene signature was developed to produce a melanoma diagnostic score capable of differentiating malignant and benign melanocytic lesions. The primary objective of this study was to independently assess the ability of the gene signature to differentiate melanoma from benign nevi in clinically relevant lesions. METHODS A set of 1400 melanocytic lesions was selected from samples prospectively submitted for gene expression testing at a clinical laboratory. Each sample was tested and subjected to an independent histopathologic evaluation by 3 experienced dermatopathologists. A primary diagnosis (benign or malignant) was assigned to each sample, and diagnostic concordance among the 3 dermatopathologists was required for inclusion in analyses. The sensitivity and specificity of the score in differentiating benign and malignant melanocytic lesions were calculated to assess the association between the score and the pathologic diagnosis. RESULTS The gene expression signature differentiated benign nevi from malignant melanoma with a sensitivity of 91.5% and a specificity of 92.5%. CONCLUSIONS These results reflect the performance of the gene signature in a diverse array of samples encountered in routine clinical practice. Cancer 2017;123:617–628. © 2016 American Cancer Society. PMID:27768230

  11. Expression of the HMGI(Y) gene products in human neuroblastic tumours correlates with differentiation status

    PubMed Central

    Giannini, G; Kim, C J; Marcotullio, L Di; Manfioletti, G; Cardinali, B; Cerignoli, F; Ristori, E; Zani, M; Frati, L; Screpanti, I; Gulino, A

    2000-01-01

    HMGI and HMGY are splicing variants of the HMGI(Y) gene and together with HMGI-C, belong to a family of DNA binding proteins involved in maintaining active chromatin conformation and in the regulation of gene transcription. The expression of the HMGI(Y) gene is maximal during embryonic development, declines in adult differentiated tissues and is reactivated in most transformed cells in vitro and in many human cancers in vivo. The HMGI(Y) genomic locus is frequently rearranged in mesenchymal tumours, suggesting a biological role for HMGI(Y) gene products in tumour biology. HMGIs are both target and modulators of retinoic acid activity. In fact, HMGI(Y) gene expression is differentially regulated by retinoic acid in retinoid-sensitive and -resistant neuroblastoma cells, while HMGI-C participates in conferring retinoic acid resistance in some neuroblastoma cells. In this paper we show that HMGI and HMGY isoforms are equally regulated by retinoic acid in neuroblastoma cell lines at both RNA and protein levels. More importantly our immunohistochemical analysis shows that, although HMGI(Y) is expressed in all neuroblastic tumours, consistently higher levels are observed in less differentiated neuroblastomas compared to more differentiated ganglioneuromas, indicating that HMGI(Y) expression should be evaluated as a potential diagnostic and prognostic marker in neuroblastic tumours. © 2000 Cancer Research Campaign http://www.bjcancer.com PMID:11076660

  12. Mining differential top-k co-expression patterns from time course comparative gene expression datasets

    PubMed Central

    2013-01-01

    Background Frequent pattern mining analysis applied on microarray dataset appears to be a promising strategy for identifying relationships between gene expression levels. Unfortunately, too many itemsets (co-expressed genes) are identified by this analysis method since it does not consider the importance of each gene within biological processes to a cellular response and does not take into account temporal properties under biological treatment-control matched conditions in a microarray dataset. Results We propose a method termed TIIM (Top-k Impactful Itemsets Miner), which only requires specifying a user-defined number k to explore the top k itemsets with the most significantly differentially co-expressed genes between 2 conditions in a time course. To give genes different weights, a table with impact degrees for each gene was constructed based on the number of neighboring genes that are differently expressed in the dataset within gene regulatory networks. Finally, the resulting top-k impactful itemsets were manually evaluated using previous literature and analyzed by a Gene Ontology enrichment method. Conclusions In this study, the proposed method was evaluated in 2 publicly available time course microarray datasets with 2 different experimental conditions. Both datasets identified potential itemsets with co-expressed genes evaluated from the literature and showed higher accuracies compared to the 2 corresponding control methods: i) performing TIIM without considering the gene expression differentiation between 2 different experimental conditions and impact degrees, and ii) performing TIIM with a constant impact degree for each gene. Our proposed method found that several new gene regulations involved in these itemsets were useful for biologists and provided further insights into the mechanisms underpinning biological processes. The Java source code and other related materials used in this study are available at

  13. Genome-wide p63-regulated gene expression in differentiating epidermal keratinocytes

    PubMed Central

    Oti, Martin; Kouwenhoven, Evelyn N.; Zhou, Huiqing

    2015-01-01

    The transcription factor p63 is a key regulator in epidermal keratinocyte proliferation and differentiation. However, the role of p63 in gene regulation during these processes is not well understood. To investigate this, we recently generated genome-wide profiles of gene expression, p63 binding sites and active regulatory regions with the H3K27ac histone mark (Kouwenhoven et al., 2015). We showed that only a subset of p63 binding sites are active in keratinocytes, and that differentiation-associated gene expression dynamics correlate with the activity of p63 binding sites rather than with their occurrence per se. Here we describe in detail the generation and processing of the ChIP-seq and RNA-seq datasets used in this study. These data sets are deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE59827. PMID:26484246

  14. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus

    PubMed Central

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-01-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus. PMID:27853123

  15. Differentially expressed genes under simulated microgravity in fruiting bodies of the fungus Pleurotus ostreatus.

    PubMed

    Miyazaki, Yasumasa; Sunagawa, Masahide; Higashibata, Akira; Ishioka, Noriaki; Babasaki, Katsuhiko; Yamazaki, Takashi

    2010-06-01

    In response to a change in the direction of gravity, morphogenetic changes of fruiting bodies of fungi are usually observed as gravitropism. Although gravitropism in higher fungi has been studied for over 100 years, there is no convincing evidence regarding the graviperception mechanism in mushrooms. To understand gravitropism in mushrooms, we isolated differentially expressed genes in Pleurotus ostreatus (oyster mushroom) fruiting bodies developed under three-dimensional clinostat-simulated microgravity. Subtractive hybridization, cDNA representational difference analysis was used for gene analysis and resulted in the isolation of 36 individual genes (17 upregulated and 19 downregulated) under clinorotation. The phenotype of fruiting bodies developed under simulated microgravity vividly depicted the gravitropism in mushrooms. Our results suggest that the differentially expressed genes responding to gravitational change are involved in several potential cellular mechanisms during fruiting body formation of P. ostreatus.

  16. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.

    PubMed

    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry

    2010-01-01

    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  17. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  18. Global gene expression profiling reveals genes expressed differentially in cattle with high and low residual feed intake.

    PubMed

    Chen, Y; Gondro, C; Quinn, K; Herd, R M; Parnell, P F; Vanselow, B

    2011-10-01

    Feed efficiency is an economically important trait in beef production. It can be measured as residual feed intake. This is the difference between actual feed intake recorded over a test period and the expected feed intake of an animal based on its size and growth rate. DNA-based marker-assisted selection would help beef breeders to accelerate genetic improvement for feed efficiency by reducing the generation interval and would obviate the high cost of measuring residual feed intake. Although numbers of quantitative trait loci and candidate genes have been identified with the advance of molecular genetics, our understanding of the physiological mechanisms and the nature of genes underlying residual feed intake is limited. The aim of the study was to use global gene expression profiling by microarray to identify genes that are differentially expressed in cattle, using lines genetically selected for low and high residual feed intake, and to uncover candidate genes for residual feed intake. A long-oligo microarray with 24 000 probes was used to profile the liver transcriptome of 44 cattle selected for high or low residual feed intake. One hundred and sixty-one unique genes were identified as being differentially expressed between animals with high and low residual feed intake. These genes were involved in seven gene networks affecting cellular growth and proliferation, cellular assembly and organization, cell signalling, drug metabolism, protein synthesis, lipid metabolism, and carbohydrate metabolism. Analysis of functional data using a transcriptional approach allows a better understanding of the underlying biological processes involved in residual feed intake and also allows the identification of candidate genes for marker-assisted selection. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

  19. Phorbaketal A inhibits adipogenic differentiation through the suppression of PPARγ-mediated gene transcription by TAZ.

    PubMed

    Byun, Mi Ran; Lee, Cham Han; Hwang, Jun-Ha; Kim, A Rum; Moon, Sung Ah; Sung, Mi Kyung; Roh, Jung-Rae; Hwang, Eun Sook; Hong, Jeong-Ho

    2013-10-15

    Obesity causes several metabolic diseases, including diabetes. Adipogenic differentiation is an important event for fat formation in obesity. Natural compounds that inhibit adipogenic differentiation are frequently screened to develop therapeutic drugs for treating obesity. Here we investigated the effects of phorbaketal A, a natural marine compound, on adipogenic differentiation of mesenchymal stem cells. Phorbaketal A significantly inhibited adipogenic differentiation as indicated by less fat droplets and decreased expression of adipogenic marker genes. The expression of TAZ (transcriptional coactivator with PDZ-binding motif), an inhibitor of adipogenic differentiation, significantly increased during adipogenic differentiation in the presence of phorbaketal A. Phorbaketal A increased the interaction of TAZ and PPARγ to suppress PPARγ (peroxisome proliferator-activated receptor γ) target gene expression. TAZ-depleted cells showed higher adipogenic potential than that of control cells even in the presence of phorbaketal A. During cellular signaling induced by phorbaketal A, ERK (extracellular signal-regulated kinase) played an important role in adipogenic suppression; an inhibitor of ERK blocked phorbaketal A-induced adipogenic suppression. Thus, the results show that phorbaketal A inhibits adipocyte differentiation through TAZ.

  20. Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression.

    PubMed

    Lee, Mon-Juan; Chen, Yuhsin; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chiang, Lan-Hsin; Chen, Tzu-Yu; Wang, Gwo-Jaw

    2013-12-01

    Polyamines are naturally occurring organic polycations that are ubiquitous in all organisms, and are essential for cell proliferation and differentiation. Although polyamines are involved in various cellular processes, their roles in stem cell differentiation are relatively unexplored. In this study, we found that exogenous polyamines, putrescine, spermidine, and spermine, promoted osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) without inducing cell death or apoptosis. Alkaline phosphatase (ALP) activity and the mRNA level of osteogenic genes, including Runx2, ALP, osteopontin, and osteocalcin, were up-regulated by exogenous polyamines. When hBMSCs were cultured at high cell density favoring adipocyte formation, exogenous polyamines resulted in down-regulation of adipogenic genes such as PPARγ, aP2, and adipsin. Extracellular matrix mineralization, a marker for osteoblast maturation, was enhanced in the presence of exogenous polyamines, while lipid accumulation, an indication of adipogenic differentiation, was attenuated. Exogenous polyamines increased the mRNA expression of polyamine-modulated factor 1 (PMF-1) and its downstream effector, spermidine/spermine N(1)-acetyltransferase (SSAT), while that of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was suppressed. These results lead to possible connections between polyamine metabolism and osteogenic differentiation pathways. To summarize, this study provides evidence for the involvement of polyamines in osteogenic differentiation of hBMSCs, and is the first to demonstrate that osteogenic and adipogenic differentiation are reciprocally regulated by exogenous polyamines.

  1. Isolation of Regulated Genes of the Cyanobacterium Synechocystis sp. Strain PCC 6803 by Differential Display†

    PubMed Central

    Bhaya, Devaki; Vaulot, Daniel; Amin, Pinky; Takahashi, Akiko Watanabe; Grossman, Arthur R.

    2000-01-01

    Global identification of differentially regulated genes in prokaryotes is constrained because the mRNA does not have a 3′ polyadenylation extension; this precludes specific separation of mRNA from rRNA and tRNA and synthesis of cDNAs from the entire mRNA population. Knowledge of the entire genome sequence of Synechocystis sp. strain PCC 6803 has enabled us to develop a differential display procedure that takes advantage of a short palindromic sequence that is dispersed throughout the Synechocystis sp. strain PCC 6803 genome. This sequence, designated the HIP (highly iterated palindrome) element, occurs in approximately half of the Synechocystis sp. strain PCC 6803 genes but is absent in rRNA and tRNA genes. To determine the feasibility of exploiting the HIP element, alone or in combination with specific primer subsets, for analyzing differential gene expression, we used HIP-based primers to identify light intensity-regulated genes. Several gene fragments, including those encoding ribosomal proteins and phycobiliprotein subunits, were differentially amplified from RNA templates derived from cells grown in low light or exposed to high light for 3 h. One novel finding was that expression of certain genes of the pho regulon, which are under the control of environmental phosphate levels, were markedly elevated in high light. High-light activation of pho regulon genes correlated with elevated growth rates that occur when the cells are transferred from low to high light. These results suggest that in high light, the rate of growth of Synechocystis sp. strain PCC 6803 exceeds its capacity to assimilate phosphate, which, in turn, may trigger a phosphate starvation response and activation of the pho regulon. PMID:11004166

  2. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.

    PubMed

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2013-12-01

    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  3. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    PubMed Central

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  4. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  5. Microarray analysis of differentially expressed genes engaged in fruit development between Prunus mume and Prunus armeniaca.

    PubMed

    Li, Xiaoying; Korir, Nicholas Kibet; Liu, Lili; Shangguan, Lingfei; Wang, Yuzhu; Han, Jian; Chen, Ming; Fang, Jinggui

    2012-11-15

    Microarray analysis is a technique that can be employed to provide expression profiles of single genes and new insights to elucidate the biological mechanisms responsible for fruit development. To evaluate expression of genes mostly engaged in fruit development between Prunus mume and Prunus armeniaca, we first identified differentially expressed transcripts along the entire fruit life cycle by using microarrays spotted with 10,641 ESTs collected from P. mume and other Prunus EST sequences. A total of 1418 ESTs were selected after quality control of microarray spots and analysis for differential gene expression patterns during fruit development of P. mume and P. Armeniaca. From these, 707 up-regulated and 711 down-regulated genes showing more than two-fold differences in expression level were annotated by GO based on biological processes, molecular functions and cellular components. These differentially expressed genes were found to be involved in several important pathways of carbohydrate, galactose, and starch and sucrose metabolism as well as in biosynthesis of other secondary metabolites via KEGG. This could provide detailed information on the fruit quality differences during development and ripening of these two species. With the results obtained, we provide a practical database for comprehensive understanding of molecular events during fruit development and also lay a theoretical foundation for the cloning of genes regulating in a series of important rate-limiting enzymes involved in vital metabolic pathways during fruit development. Copyright © 2012 Elsevier GmbH. All rights reserved.

  6. Differential gene expression in human abdominal aortic aneurysm and aortic occlusive disease

    PubMed Central

    Moran, Corey S.; Schreurs, Charlotte; Lindeman, Jan H. N.; Walker, Philip J.; Nataatmadja, Maria; West, Malcolm; Holdt, Lesca M.; Hinterseher, Irene; Pilarsky, Christian; Golledge, Jonathan

    2015-01-01

    Abdominal aortic aneurysm (AAA) and aortic occlusive disease (AOD) represent common causes of morbidity and mortality in elderly populations which were previously believed to have common aetiologies. The aim of this study was to assess the gene expression in human AAA and AOD. We performed microarrays using aortic specimen obtained from 20 patients with small AAAs (≤ 55mm), 29 patients with large AAAs (> 55mm), 9 AOD patients, and 10 control aortic specimens obtained from organ donors. Some differentially expressed genes were validated by quantitative-PCR (qRT-PCR)/immunohistochemistry. We identified 840 and 1,014 differentially expressed genes in small and large AAAs, respectively. Immune-related pathways including cytokine-cytokine receptor interaction and T-cell-receptor signalling were upregulated in both small and large AAAs. Examples of validated genes included CTLA4 (2.01-fold upregulated in small AAA, P = 0.002), NKTR (2.37-and 2.66-fold upregulated in small and large AAA with P = 0.041 and P = 0.015, respectively), and CD8A (2.57-fold upregulated in large AAA, P = 0.004). 1,765 differentially expressed genes were identified in AOD. Pathways upregulated in AOD included metabolic and oxidative phosphorylation categories. The UCP2 gene was downregulated in AOD (3.73-fold downregulated, validated P = 0.017). In conclusion, the AAA and AOD transcriptomes were very different suggesting that AAA and AOD have distinct pathogenic mechanisms. PMID:25944698

  7. Investigatory and analytical approaches to differential gene expression profiling in mantle cell lymphoma.

    PubMed

    Zhu, Ying; Hollmén, Jaakko; Räty, Riikka; Aalto, Yan; Nagy, Balint; Elonen, Erkki; Kere, Juha; Mannila, Heikki; Franssila, Kaarle; Knuutila, Sakari

    2002-12-01

    Mantle cell lymphoma (MCL) is a non-Hodgkin's lymphoma of B-cell lineage. The blastoid variant of MCL, characterized by high mitotic rate, is clinically more aggressive than common MCL. We used the cDNA array technology to examine the gene expression profiles of both blastoid variant and common MCL. The data was analysed by regression analysis, principal component analysis and the naive Bayes' classifier. Eight genes were identified as differentially deregulated between the two groups. Oncogenes CMYC, BCL2 and PIM1 were upregulated more frequently in the blastoid variant than in common MCL. This implied that the gp130-mediated signal transducer and activator of transcription 3 (STAT3) signalling pathway was involved in the blastoid variant transformation of MCL. Other differentially deregulated genes were TOP1, CD23, CD45, CD70 and NFATC. By using the eight differentially deregulated genes, we created a classifier to distinguish the blastoid variant from common MCL with high accuracy. We also identified 18 genes that were deregulated in both groups. Among them, BCL1, CALLA/CD10 and GRN were suggested to be oncogenes. The products of RGS1, RGS2, ANX2 and CD44H were suggested to promote tumour metastasis. CD66D was suggested to be a tumour suppressor gene.

  8. In Vitro Study of Putative Genomic Biomarkers of Nephrotoxicity Through Differential Gene Expression Using Gentamicin.

    PubMed

    Silva, Sarah Cristina Teixeira; de Almeida, Leonardo Augusto; Soares, Stellamaris; Grossi, Marina Felipe; Valente, Anete Maria Santana; Tagliati, Carlos Alberto

    2017-04-03

    Drug-induced nephrotoxicity is one of the most frequently observed effects in long-term pharmacotherapy. The effects of nephrotoxicity are commonly discovered later due to a lack of sensitivity in in vivo methods. Therefore, researchers have tried to develop in vitro alternative methods for early identification of toxicity. In this study, LLC-PK1 cells were exposed to gentamicin through MTT and trypan blue assay. Concentrations of 4 (low), 8 (medium), and 12 (high) mM, were used to evaluate differential gene expression. A panel of genes was selected based on gene expression changes. The search for sequences of mRNA encoding proteins previously associated with kidney damage was conducted in the databases of the National Center for Biotechnology Information (USA). RNA was extracted from the cells, and RT-qPCR was performed to evaluate differential expression profiles of the selected genes. Among the eleven analyzed genes, four proved to be differentially up-regulated in cells exposed to gentamicin: HAVcr1, caspase3, ICAM-1, and EXOC6. According to this study's results, we suggest that these genes play an important role in the mechanism of in vitro neprotoxicity caused by gentamicin and can be used as early in vitro biomarkers to identify nephrotoxicity when developing safer drugs.

  9. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.)

    PubMed Central

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M.; Liu, Liwang

    2016-01-01

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish. PMID:26902837

  10. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.).

    PubMed

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M; Liu, Liwang

    2016-02-23

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish.

  11. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display.

    PubMed

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-29

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant-pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew.

  12. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display

    PubMed Central

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-01

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant–pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew. PMID:26840302

  13. N=2 supersymmetric a=4-Korteweg-de Vries hierarchy derived via Gardner's deformation of Kaup-Boussinesq equation

    SciTech Connect

    Hussin, V.; Kiselev, A. V.; Krutov, A. O.; Wolf, T.

    2010-08-15

    We consider the problem of constructing Gardner's deformations for the N=2 supersymmetric a=4-Korteweg-de Vries (SKdV) equation; such deformations yield recurrence relations between the super-Hamiltonians of the hierarchy. We prove the nonexistence of supersymmetry-invariant deformations that retract to Gardner's formulas for the Korteweg-de Vries (KdV) with equation under the component reduction. At the same time, we propose a two-step scheme for the recursive production of the integrals of motion for the N=2, a=4-SKdV. First, we find a new Gardner's deformation of the Kaup-Boussinesq equation, which is contained in the bosonic limit of the superhierarchy. This yields the recurrence relation between the Hamiltonians of the limit, whence we determine the bosonic super-Hamiltonians of the full N=2, a=4-SKdV hierarchy. Our method is applicable toward the solution of Gardner's deformation problems for other supersymmetric KdV-type systems.

  14. New insight on vertebral anomalies in cultured Senegalese sole (Solea senegalensis, Kaup) at early stages of development.

    PubMed

    de Azevedo, A M; Losada, A P; Ferreiro, I; Riaza, A; Vázquez, S; Quiroga, M I

    2017-08-01

    Senegalese sole (Solea senegalensis, Kaup) is a promising flatfish species in aquaculture. However, skeletal anomalies are still a great concern in sole farming. Investigation of this issue is crucial to improving larval quality and optimizing production. The aim of this study was to thoroughly assess anomalies in the rachis of reared sole at early developmental stages. Sole (n = 507) were sampled at 31 or 32 days after hatching (dah). The specimens were stained with alcian blue and alizarin red and evaluated for the detection of vertebral deformities. Most fish presented 9:34:3 vertebrae in abdominal, caudal and caudal complex regions, respectively. Remarkably, all specimens showed at least one spinal anomaly. Alterations of neural/haemal elements, as well as deformities of hypurals, parhypural and epural, were recurrent. Vertebral body anomalies and/or vertebral column deviations were identified in 52% of the individuals. Vertebral deformations and fusions were common, especially in caudal complex. 'Minor' anomalies were predominant, and some of the detected disorders might be a result of non-/low-pathological processes. These results contribute a new insight into the main skeletal anomalies affecting cultured sole larvae. Further research is required to determine their impact on fish welfare and external appearances at commercial stages. © 2016 John Wiley & Sons Ltd.

  15. Integrative meta-analysis of differentially expressed genes in osteoarthritis using microarray technology.

    PubMed

    Wang, Xi; Ning, Yujie; Guo, Xiong

    2015-09-01

    The aim of the present study was to identify differentially expressed (DE) genes in patients with osteoarthritis (OA), and biological processes associated with changes in gene expression that occur in this disease. Using the INMEX (integrative meta‑analysis of expression data) software tool, a meta‑analysis of publicly available microarray Gene Expression Omnibus (GEO) datasets of OA was performed. Gene ontology (GO) enrichment analysis was performed in order to detect enriched functional attributes based on gene‑associated GO terms. Three GEO datasets, containing 137 patients with OA and 52 healthy controls, were included in the meta‑analysis. The analysis identified 85 genes that were consistently differentially expressed in OA (30 genes were upregulated and 55 genes were downregulated). The upregulated gene with the lowest P‑value (P=5.36E‑07) was S‑phase kinase‑associated protein 2, E3 ubiquitin protein ligase (SKP2). The downregulated gene with the lowest P‑value (P=4.42E‑09) was Proline rich 5 like (PRR5L). Among the 210 GO terms that were associated with the set of DE genes, the most significant two enrichments were observed in the GO categories of 'Immune response', with a P‑value of 0.000129438, and 'Immune effectors process', with a P‑value of 0.000288619. The current meta‑analysis identified genes that were consistently DE in OA, in addition to biological pathways associated with changes in gene expression that occur during OA, which may provide insight into the molecular mechanisms underlying the pathogenesis of this disease.

  16. Cooperative Stimulation of Megakaryocytic Differentiation by Gfi1b Gene Targets Kindlin3 and Talin1

    PubMed Central

    Singh, Divya; Upadhyay, Ghanshyam; Sengupta, Ananya; Biplob, Mohammed A.; Chakyayil, Shaleen; George, Tiji; Saleque, Shireen

    2016-01-01

    Understanding the production and differentiation of megakaryocytes from progenitors is crucial for realizing the biology and functions of these vital cells. Previous gene ablation studies demonstrated the essential role of the transcriptional repressor Gfi1b (growth factor independence 1b) in the generation of both erythroid and megakaryocytic cells. However, our recent work has demonstrated the down-regulation of this factor during megakaryocytic differentiation. In this study we identify two new gene targets of Gfi1b, the cytoskeletal proteins Kindlin3 and Talin1, and demonstrate the inverse expression and functions of these cytoskeletal targets relative to Gfi1b, during megakaryocytic differentiation. Both kindlin3 and talin1 promoters exhibit dose dependent Gfi1b and LSD1 (lysine specific demethylase 1; a Gfi1b cofactor) enrichment in megakaryocytes and repression in non-hematopoietic cells. Accordingly the expression of these genes is elevated in gfi1b mutant and LSD1 inhibited hematopoietic cells, while during megakaryocytic differentiation, declining Gfi1b levels fostered the reciprocal upregulation of these cytoskeletal factors. Concordantly, manipulation of Kindlin3 and Talin1 expression demonstrated positive correlation with megakaryocytic differentiation with over-expression stimulating, and inhibition diminishing, this process. Co-operativity between these factors and integrins in promoting differentiation was further underscored by physical interactions between them and integrinβ3/CD61 and by stimulation of differentiation by the Talin1 head domain, which is necessary and sufficient for integrin activation. Therefore this study demonstrates the significance of Gfi1b regulated Kindlin3-Talin1 expression in driving megakaryocytic differentiation and highlights the contribution of cytoskeletal agents in the developmental progression of these platelet progenitors. PMID:27768697

  17. Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

    PubMed Central

    Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

    2011-01-01

    Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

  18. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    PubMed

    Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

    2011-01-01

    Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  19. Profile of Inflammation-associated genes during Hepatic Differentiation of Human Pluripotent Stem Cells.

    PubMed

    Ignatius Irudayam, Joseph; Contreras, Deisy; Spurka, Lindsay; Ren, Songyang; Kanagavel, Vidhya; Ramaiah, Arunachalam; Annamalai, Alagappan; French, Samuel W; Klein, Andrew S; Funari, Vincent; Arumugaswami, Vaithilingaraja

    2015-12-01

    Expression of genes associated with inflammation was analyzed during differentiation of human pluripotent stem cells (PSCs) to hepatic cells. Messenger RNA transcript profiles of differentiated endoderm (day 5), hepatoblast (day 15) and hepatocyte-like cells (day 21) were obtained by RNA sequencing analysis. When compared to endoderm cells an immature cell type, the hepatic cells (days 15 and 21) had significantly higher expression of acute phase protein genes including complement factors, coagulation factors, serum amyloid A and serpins. Furthermore, hepatic phase of cells expressed proinflammatory cytokines IL18 and IL32 as well as cytokine receptors IL18R1, IL1R1, IL1RAP, IL2RG, IL6R, IL6ST and IL10RB. These cells also produced CCL14, CCL15, and CXCL- 1, 2, 3, 16 and 17 chemokines. Endoderm cells had higher levels of chemokine receptors, CXCR4 and CXCR7, than that of hepatic cells. Sirtuin family of genes involved in aging, inflammation and metabolism were differentially regulated in endoderm and hepatic phase cells. Ligands and receptors of the tumor necrosis factor (TNF) family as well as downstream signaling factors TRAF2, TRAF4, FADD, NFKB1 and NFKBIB were differentially expressed during hepatic differentiation.

  20. Profile of Inflammation-associated genes during Hepatic Differentiation of Human Pluripotent Stem Cells

    PubMed Central

    Ignatius Irudayam, Joseph; Contreras, Deisy; Spurka, Lindsay; Ren, Songyang; Kanagavel, Vidhya; Ramaiah, Arunachalam; Annamalai, Alagappan; French, Samuel W.; Klein, Andrew S.; Funari, Vincent; Arumugaswami, Vaithilingaraja

    2015-01-01

    Expression of genes associated with inflammation was analyzed during differentiation of human pluripotent stem cells (PSCs) to hepatic cells. Messenger RNA transcript profiles of differentiated endoderm (day 5), hepatoblast (day 15) and hepatocyte-like cells (day 21) were obtained by RNA sequencing analysis. When compared to endoderm cells an immature cell type, the hepatic cells (days 15 and 21) had significantly higher expression of acute phase protein genes including complement factors, coagulation factors, serum amyloid A and serpins. Furthermore, hepatic phase of cells expressed proinflammatory cytokines IL18 and IL32 as well as cytokine receptors IL18R1, IL1R1, IL1RAP, IL2RG, IL6R, IL6ST and IL10RB. These cells also produced CCL14, CCL15, and CXCL- 1, 2, 3, 16 and 17 chemokines. Endoderm cells had higher levels of chemokine receptors, CXCR4 and CXCR7, than that of hepatic cells. Sirtuin family of genes involved in aging, inflammation and metabolism were differentially regulated in endoderm and hepatic phase cells. Ligands and receptors of the tumor necrosis factor (TNF) family as well as downstream signaling factors TRAF2, TRAF4, FADD, NFKB1 and NFKBIB were differentially expressed during hepatic differentiation. PMID:26702414

  1. The Populus homeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth.

    PubMed

    Du, Juan; Mansfield, Shawn D; Groover, Andrew T

    2009-12-01

    The stem cells of the vascular cambium divide to produce daughter cells, which in turn divide before undergoing differentiation during the radial growth of woody stems. The genetic regulation of these developmental events is poorly understood, however. We report here the cloning and functional characterization of a Populus class-I KNOX homeobox gene, ARBORKNOX2 (ARK2), which we show influences terminal cell differentiation and cell wall properties during secondary growth. In the early stages of secondary growth, ARK2 is expressed broadly in the cambial zone and in terminally differentiating cell types, before becoming progressively restricted to the cambium. ARK2 overexpression and synthetic miRNA-suppression transgenics reveal positive correlations between ARK2 expression level and the timing of cambium formation, the width of the cambial zone and inhibition of cambial daughter cell differentiation. These phenotypes in turn correlate with changes in the expression of genes affecting transcription, cell division, auxin and cell wall synthesis. Notably, wood properties associated with secondary cell wall synthesis are negatively associated with ARK2 expression, including lignin and cellulose content. Together, our results suggest that ARK2 functions primarily to regulate a complex suite of genes that together influence cell differentiation during secondary growth. We propose that ARK2 may represent a co-evolved transcriptional module that influences complex, adaptive wood properties.

  2. Regulation of adipocyte differentiation and gene expression-crosstalk between TGFβ and wnt signaling pathways.

    PubMed

    Lu, Hang; Ward, Meliza G; Adeola, Olayiwola; Ajuwon, Kolapo M

    2013-09-01

    Obesity results in reduced differentiation potential of adipocytes leading to adipose tissue insulin resistance. Elevated proinflammatory cytokines from adipose tissue in obesity, such as TNFα have been implicated in the reduced adipocyte differentiation. Other mediators of reduced adipocyte differentiation include TGFβ and wnt proteins. Although some overlap exists in the signaling cascades of the wnt and TGFβ pathways it is unknown if TGFβ or wnt proteins reciprocally induce the expression of each other to maximize their biological effects in adipocytes. Therefore, we investigated the possible involvement of TGFβ signaling in wnt induced gene expression and vice versa in 3T3-L1 adipocyte. Effect of TGFβ and Wnt pathways on differentiation was studied in preadipocytes induced to differentiate in the presence of Wnt3a or TGFβ1 and their inhibitors (FZ8-CRD and SB431542, respectively). Regulation of intracellular signaling and gene expression was also studied in mature adipocytes. Our results show that both TGFβ1 and Wnt3a lead to increased accumulation of β-catenin, phosphorylation of AKT and p44/42 MAPK. However, differences were found in the pattern of gene expression induced by the two proteins suggesting that distinct, but complex, signaling pathways are activated by TGFβ and wnt proteins to independently regulate adipocyte function.

  3. Analysis on differential expressed genes of ovarian tissue between high- and low-yield laying hen.

    PubMed

    Chen, Wei; Song, Ling-Jun; Zeng, Yong-Qing; Yang, Yun; Wang, Hui

    2013-01-01

    In order to elucidate molecular genetic mechanism of laying hen reproduction at the transcriptional level and the structure of significantly differential genes, the mRNA differential display and reverse northern dot-blot were used to detect the differential expression of genes in the ovary tissue of low-yield laying hens and high-yield laying hens in the present study. Sixteen 32-week-old CAU-pink laying hens divided into two groups were used and the laying performance was measured. The results showed that only the egg numbers were significantly different between the two groups; and from 15 primer pairs, a total of 336 bands were displayed of which 59 cDNA bands were found to be differentially expressed in both high-yield and low-yield laying hen. The sequence analysis indicated that the expression of such bands as H-AP5, H-P5, and H-P4 was significantly potentiated in high-yield laying hen using primer pairs AP5/HT11G, P5/HT11G and P4/HT11G and these transcripts had high homology (98%) to HoxDb, HoxCa, and HoxBa, respectively. The differentially expressed gene fragments may be relevant to the progression of the high-yield hens to the egg-laying stage. And further study is required to elucidate the molecular function to improve the productivity of laying hens.

  4. Adipose Gene Expression Prior to Weight Loss Can Differentiate and Weakly Predict Dietary Responders

    PubMed Central

    Mutch, David M.; Temanni, M. Ramzi; Henegar, Corneliu; Combes, Florence; Pelloux, Véronique; Holst, Claus; Sørensen, Thorkild I. A.; Astrup, Arne; Martinez, J. Alfredo; Saris, Wim H. M.; Viguerie, Nathalie; Langin, Dominique; Zucker, Jean-Daniel; Clément, Karine

    2007-01-01

    Background The ability to identify obese individuals who will successfully lose weight in response to dietary intervention will revolutionize disease management. Therefore, we asked whether it is possible to identify subjects who will lose weight during dietary intervention using only a single gene expression snapshot. Methodology/Principal Findings The present study involved 54 female subjects from the Nutrient-Gene Interactions in Human Obesity-Implications for Dietary Guidelines (NUGENOB) trial to determine whether subcutaneous adipose tissue gene expression could be used to predict weight loss prior to the 10-week consumption of a low-fat hypocaloric diet. Using several statistical tests revealed that the gene expression profiles of responders (8–12 kgs weight loss) could always be differentiated from non-responders (<4 kgs weight loss). We also assessed whether this differentiation was sufficient for prediction. Using a bottom-up (i.e. black-box) approach, standard class prediction algorithms were able to predict dietary responders with up to 61.1%±8.1% accuracy. Using a top-down approach (i.e. using differentially expressed genes to build a classifier) improved prediction accuracy to 80.9%±2.2%. Conclusion Adipose gene expression profiling prior to the consumption of a low-fat diet is able to differentiate responders from non-responders as well as serve as a weak predictor of subjects destined to lose weight. While the degree of prediction accuracy currently achieved with a gene expression snapshot is perhaps insufficient for clinical use, this work reveals that the comprehensive molecular signature of adipose tissue paves the way for the future of personalized nutrition. PMID:18094752

  5. Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development

    PubMed Central

    Chittka, A; Volff, JN; Wizenmann, A

    2009-01-01

    Background During the development of the central nervous system (CNS), patterning processes along the dorsoventral (DV) axis of the neural tube generate different neuronal subtypes. As development progresses these neurons are arranged into functional units with varying cytoarchitecture, such as laminae or nuclei for efficient relaying of information. Early in development ventral and dorsal regions are similar in size and structure. Different proliferation rates and cell migration patterns are likely to result in the formation of laminae or nuclei, eventually. However, the underlying molecular mechanisms that establish these different structural arrangements are not well understood. We undertook a differential display polymerase chain reaction (DD-PCR) screen to identify genes with distinct expression patterns between dorsal and ventral regions of the chick midbrain in order to identify genes which regulate the sculpturing of such divergent neuronal organisation. We focused on the DV axis of the early chick midbrain since mesencephalic alar plate and basal plate develop into laminae and nuclei, respectively. Results We identified 53 differentially expressed bands in our initial screen. Twenty-six of these could be assigned to specific genes and we could unambiguously show the differential expression of five of the isolated cDNAs in vivo by in situ mRNA expression analysis. Additionally, we verified differential levels of expression of a selected number of genes by using reverse transcriptase (RT) PCR method with gene-specific primers. One of these genes, QR1, has been previously cloned and we present here a detailed study of its early developmental time course and pattern of expression providing some insights into its possible function. Our phylogenetic analysis of QR1 shows that it is the chick orthologue of Sparc-like 1/Hevin/Mast9 gene in mice, rats, dogs and humans, a protein involved in cell adhesion. Conclusion This study reveals some possible networks, which

  6. Identification and analysis of differentially expressed genes in differentiating xylem of Chinese fir (Cunninghamia lanceolata) by suppression subtractive hybridization.

    PubMed

    Wang, Guifeng; Gao, Yan; Yang, Liwei; Shi, Jisen

    2007-12-01

    Wood is an important raw material for global industries with rapidly increasing demand. To isolate the genes differentially expressed during xylogenesis of Chinese fir (Cunninghamia lanceolata (Lamb.) Hook.), we used a novel system. Forward and reverse subtracted cDNA libraries were constructed using the suppression subtractive hybridization method; for the forward library we used cDNA from the mutant Dugansha as the tester and cDNA from the wild-type clone Jurong 0 as the driver, and for the reverse library we used Jurong 0 cDNA as the tester and Dugansha cDNA as the driver. Transcriptional profiling was performed using a macroarray with 4 digoxigenin-labeled probes. We obtained 618 and 409 clones from the forward and the reverse subtracted library, respectively. A total of 405 unique expressed sequence tags (ESTs) were obtained. Forty percent of the ESTs exhibited homologies with proteins of known function and fell into 4 major classes: metabolism, cell wall biogenesis and remodeling, signal transduction, and stress. Real-time PCR was performed to confirm the results. The expression levels of 11 selected ESTs were consistent with both macroarray and real-time PCR results. The systematic analysis of genes involved in wood formation in Chinese fir provides valuable insights into the molecular mechanisms involved in xylem differentiation and is an important resource for forest research that can be directed toward understanding the genetic control of wood formation and future endeavors to modify wood and fiber properties for industrial use.

  7. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  8. Introduction of novel splice variants for CASC18 gene and its relation to the neural differentiation.

    PubMed

    Mehravar, Majid; Jafarzadeh, Meisam; Kay, Maryam; Najafi, Hadi; Hosseini, Fahimeh; Mowla, Seyed Javad; Soltani, Bahram M

    2017-03-01

    CASC18 along with APPL2, OCC-1 and NUAK1 flanking genes are located in 12q23.3 locus which is known as a potential cancer predisposition locus. Only an uncharacterized EST was initially reported for CASC18 and it was crucial to find its full length sequence and function. In an attempt to search for the CASC18's full-length gene sequence, other related ESTs were bioinformatically collected and four novel splice variants (designated as; CASC18-A, -B, -C and -D) were deduced and some were experimentally validated. Two transcription start sites and two alternative polyadenylation sites were deduced for CASC18 gene, using EST data mining and RACE method. CASC18-A and CASC18-D were exclusively expressed in neural cell lines and CASC18-D expression level was gradually increased during the NT2 differentiation to the neuron-like cells. Consistently, overexpression of CASC18-D variant in NT2 cells resulted in remarkable up-regulation of PAX6 neural differentiation marker, suggesting a crucial role of this variant in neural differentiation. Here, we introduced seven novel transcription variants for human CASC18 gene in which CASC18-D has the potential of being used as a neural cell differentiation marker. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.

    PubMed

    Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W

    2011-09-01

    Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.

  10. Differentially expressed genes in heads and tails of Angelica sinensis diels: Focusing on ferulic acid metabolism.

    PubMed

    Yang, Jie; Li, Wei-Hong; An, Rong; Wang, Yi-Li; Xu, Yan; Chen, Jie; Wang, Xiao-Fang; Zhang, Xiao-Bo; Li, Jing; Ding, Wei-Jun

    2017-10-01

    To explore the scientific connotation of the discrepant pharmaceutical activities between the head and tail of Angelica sinensis diels (AS), an important herb extensively utilized in Chinese medicine, by the approach of transcriptome sequencing. Ten samples of AS were randomly collected in Min County, Gansu Province of China. Transcriptome sequencing of AS was accomplished in a commercial ILLumina HiSeq-2000 platform. The transcriptome of each head and tail of AS were fixed in a gene chip, and detected under the procedure of Illumina HiSeq-2000. Differentially expressed unigenes between the heads and tails of AS were selected by Shanghai Biotechnology Corporation (SBC) online analysis system, based on Gene Ontology, Kyoto Encyclopedia of Genes and Genomes and relevant bioinformatic database. Totally 63,585 unigenes were obtained from AS by high-throughput sequencing platform. Among which 3359 unigenes were identified as differentially expressed unigenes between the heads and tails of AS by SBC analysis system scanning. Of which 15 differentially expressed unigenes participate in the metabolic regulation of phenylpropanoid biosynthesis (PB) pathway and ferulic acid metabolites, in response to the distinguished pharmaceutical actions of the heads and tails of AS. Different content of ferulic acid in the heads and tails of AS is related to the differentially expressed genes, particularly involved in the PB pathway.

  11. The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium.

    PubMed

    Katoh-Kurasawa, Mariko; Santhanam, Balaji; Shaulsky, Gad

    2016-03-09

    The GATA transcription factor GtaG is conserved in Dictyostelids and essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG(-) phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype as well as Dd-STATa target-genes, including extra cellular matrix genes. We show that GtaG may be involved in the production of two culmination-signaling molecules, cyclic di-GMP and the spore differentiation factor SDF-1 and that addition of c-di-GMP rescues the gtaG(-) culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells.

  12. Microarray profile of differentially expressed genes in a monkey model of allergic asthma

    PubMed Central

    Zou, Jun; Young, Simon; Zhu, Feng; Gheyas, Ferdous; Skeans, Susan; Wan, Yuntao; Wang, Luquan; Ding, Wei; Billah, Motasim; McClanahan, Terri; Coffman, Robert L; Egan, Robert; Umland, Shelby

    2002-01-01

    Background Inhalation of Ascaris suum antigen by allergic monkeys causes an immediate bronchoconstriction and delayed allergic reaction, including a pulmonary inflammatory infiltrate. To identify genes involved in this process, the gene-expression pattern of allergic monkey lungs was profiled by microarrays. Monkeys were challenged by inhalation of A. suum antigen or given interleukin-4 (IL-4) treatment; lung tissue was collected at 4, 18 or 24 h after antigen challenge or 24 h after IL-4. Each challenged monkey lung was compared to a pool of normal, unchallenged monkey lungs. Results Of the approximately 40,000 cDNAs represented on the microarray, expression levels of 169 changed by more than 2.5-fold in at least one of the pairwise probe comparisons; these cDNAs encoded 149 genes, of which two thirds are known genes. The largest number of regulated genes was observed 4 h after challenge. Confirmation of differential expression in the original tissue was obtained for 95% of a set of these genes using real-time PCR. Cluster analysis revealed at least five groups of genes with unique expression patterns. One cluster contained genes for several chemokine mediators including eotaxin, PARC, MCP-1 and MCP-3. Genes involved in tissue remodeling and antioxidant responses were also identified as regulated by antigen and IL-4 or by antigen only. Conclusion This study provides a large-scale profile of gene expression in the primate lung following allergen or IL-4 challenge. It shows that microarrays, with real-time PCR, are a powerful tool for identifying and validating differentially expressed genes in a disease model. PMID:12049661

  13. MRI Reporter Genes: Application to Imaging of Cell Survival, Proliferation, Migration, and Differentiation

    PubMed Central

    Vandsburger, Moriel H; Radoul, Marina; Cohen, Batya; Neeman, Michal

    2013-01-01

    Molecular imaging strives to detect molecular events at the level of the whole organism. In some cases, the molecule of interest can be detected either directly, or through the use of targeted contrast media. However many genes and proteins, and particularly those located in intracellular compartments, are not accessible for targeted agents. The transcriptional regulation of these genes can never the less be detected, though indirectly, through the use of reporter genes encoding for readily detectable proteins. Such reporter proteins can be expressed in the tissue of interest by genetically introducing the reporter gene in the target cells. Imaging of reporter genes has become a powerful tool in modern biomedical research. Typically, expression of fluorescent or bioluminescent proteins, or the reaction product of expressed enzymes and exogenous substrates, are examined using in vitro histological methods, or in vivo whole body imaging methods. Recent advances in MRI reporter gene methods raise the possibility that MRI could become a powerful tool for concomitant high resolution anatomical and functional imaging and for imaging of reporter gene activity. An immediate application of MRI reporter gene methods is for monitoring gene expression patterns in gene therapy and for in vivo imaging of the survival, proliferation, migration, and differentiation of pluripotent or multipotent cells used in cell based regenerative therapies for cancer, myocardial infarction, and neural degeneration. In this review, we characterize the variety of MRI reporter gene methods based on their applicability to report cell survival/proliferation, cell migration, and cell differentiation. In particular, we discuss which methods are best suited for translation to clinical use in regenerative therapies. PMID:23225197

  14. KeyGenes, a Tool to Probe Tissue Differentiation Using a Human Fetal Transcriptional Atlas

    PubMed Central

    Roost, Matthias S.; van Iperen, Liesbeth; Ariyurek, Yavuz; Buermans, Henk P.; Arindrarto, Wibowo; Devalla, Harsha D.; Passier, Robert; Mummery, Christine L.; Carlotti, Françoise; de Koning, Eelco J.P.; van Zwet, Erik W.; Goeman, Jelle J.; Chuva de Sousa Lopes, Susana M.

    2015-01-01

    Summary Differentiated derivatives of human pluripotent stem cells in culture are generally phenotypically immature compared to their adult counterparts. Their identity is often difficult to determine with certainty because little is known about their human fetal equivalents in vivo. Cellular identity and signaling pathways directing differentiation are usually determined by extrapolating information from either human adult tissue or model organisms, assuming conservation with humans. To resolve this, we generated a collection of human fetal transcriptional profiles at different developmental stages. Moreover, we developed an algorithm, KeyGenes, which uses this dataset to quantify the extent to which next-generation sequencing or microarray data resemble specific cell or tissue types in the human fetus. Using KeyGenes combined with the human fetal atlas, we identified multiple cell and tissue samples unambiguously on a limited set of features. We thus provide a flexible and expandable platform to monitor and evaluate the efficiency of differentiation in vitro. PMID:26028532

  15. Evidence for regulation of cartilage differentiation by the homeobox gene Hoxc-8

    PubMed Central

    Yueh, Y. Gloria; Gardner, David P.; Kappen, Claudia

    1998-01-01

    Homeobox genes of the Hox class are required for proper patterning of skeletal elements, but how they regulate the differentiation of specific tissues is unclear. We show here that overexpression of a Hoxc-8 transgene causes cartilage defects whose severity depends on transgene dosage. The abnormal cartilage is characterized by an accumulation of proliferating chondrocytes and reduced maturation. Since Hoxc-8 is normally expressed in chondrocytes, these results suggest that Hoxc-8 continues to regulate skeletal development well beyond pattern formation in a tissue-specific manner, presumably by controlling the progression of cells along the chondrocyte differentiation pathway. The comparison to Hoxd-4 and Isl-1 indicates that this role in chondrogenesis is specific to proteins of the Hox class. Their capacity for regulation of cartilage differentiation suggests that Hox genes could also be involved in human chondrodysplasias or other cartilage disorders. PMID:9707582

  16. p38 Mitogen-Activated Protein Kinase Pathway Regulates Genes during Proliferation and Differentiation in Oligodendrocytes

    PubMed Central

    Haines, Jeffery D.; Fulton, Debra L.; Richard, Stephane; Almazan, Guillermina

    2015-01-01

    We have previously shown that p38 mitogen-activated protein kinase (p38 MAPK) is important for oligodendrocyte (OLG) differentiation and myelination. However, the precise cellular mechanisms by which p38 regulates OLG differentiation remain largely unknown. To determine whether p38 functions in part through transcriptional events in regulating OLG identity, we performed microarray analysis on differentiating oligodendrocyte progenitors (OLPs) treated with a p38 inhibitor. Consistent with a role in OLG differentiation, pharmacological inhibition of p38 down-regulated the transcription of genes that are involved in myelin biogenesis, transcriptional control and cell cycle. Proliferation assays showed that OLPs treated with the p38 inhibitor retained a proliferative capacity which could be induced upon application of mitogens demonstrating that after two days of p38-inhibition OLGs remained poised to continue mitosis. Together, our results suggest that the p38 pathway regulates gene transcription which can coordinate OLG differentiation. Our microarray dataset will provide a useful resource for future studies investigating the molecular mechanisms by which p38 regulates oligodendrocyte differentiation and myelination. PMID:26714323

  17. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  18. Identification of an IL-4-Inducible Gene Expressed in Differentiating Lymphocytes and Male Germ Cells

    PubMed Central

    Nabavi, Nasrin; Grusby, Michael J.; Finn, Patricia W.; Wolgemuth, Debra J.; Glimcher, Laurie H.

    1990-01-01

    Interleukin 4 (IL-4) is a cytokine that is involved in the differentiation of B and T lymphocytes. In this report, we describe the identification of a novel gene, N.52, which was cloned from the murine pre-B cell line R8205 grown in the presence of IL-4 for 48 hr. Although N.52 expression is detectable at low levels in unstimulated R8205 cells, the level of N.52 dramatically increases after only .4 hr exposure to IL-4 and remains at a high .level up to 48 hr. Although N.52 expression is low or absent in normal spleen B and T cells, its expression can be induced by the differentiation signals delivered by LPS in B cells and by Con A in T-cell hybrids. While N.52 mRNA is absent in all highly differentiated organs, it is detectable in stem cell harboring lymphoid tissues such as bone marrow, fetal liver, and thymus. Furthermore, N.52 mRNA is expressed at strikingly high levels in the testis, specifically in differentiating male germ cells. It is induced by differentiation signals triggered by the combination of cyclic AMP and retinoic acid in teratocarcinoma F9 cells. Taken together, these data suggest that N.52 is a developmentally regulated gene whose expression in cells of the immune and reproductive systems may be controlled by stimuli that induce differentiation. PMID:2136202

  19. Differential gene expression profiling and biological process analysis in proximal nerve segments after sciatic nerve transection.

    PubMed

    Li, Shiying; Liu, Qianqian; Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h-14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective.

  20. Exercise training alters DNA methylation patterns in genes related to muscle growth and differentiation in mice.

    PubMed

    Kanzleiter, Timo; Jähnert, Markus; Schulze, Gunnar; Selbig, Joachim; Hallahan, Nicole; Schwenk, Robert Wolfgang; Schürmann, Annette

    2015-05-15

    The adaptive response of skeletal muscle to exercise training is tightly controlled and therefore requires transcriptional regulation. DNA methylation is an epigenetic mechanism known to modulate gene expression, but its contribution to exercise-induced adaptations in skeletal muscle is not well studied. Here, we describe a genome-wide analysis of DNA methylation in muscle of trained mice (n = 3). Compared with sedentary controls, 2,762 genes exhibited differentially methylated CpGs (P < 0.05, meth diff >5%, coverage >10) in their putative promoter regions. Alignment with gene expression data (n = 6) revealed 200 genes with a negative correlation between methylation and expression changes in response to exercise training. The majority of these genes were related to muscle growth and differentiation, and a minor fraction involved in metabolic regulation. Among the candidates were genes that regulate the expression of myogenic regulatory factors (Plexin A2) as well as genes that participate in muscle hypertrophy (Igfbp4) and motor neuron innervation (Dok7). Interestingly, a transcription factor binding site enrichment study discovered significantly enriched occurrence of CpG methylation in the binding sites of the myogenic regulatory factors MyoD and myogenin. These findings suggest that DNA methylation is involved in the regulation of muscle adaptation to regular exercise training. Copyright © 2015 the American Physiological Society.

  1. Differential Gene Expression Profiling and Biological Process Analysis in Proximal Nerve Segments after Sciatic Nerve Transection

    PubMed Central

    Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h–14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective. PMID:23437294

  2. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  3. Stem Leydig cell differentiation: gene expression during development of the adult rat population of Leydig cells.

    PubMed

    Stanley, Erin L; Johnston, Daniel S; Fan, Jinjiang; Papadopoulos, Vassilios; Chen, Haolin; Ge, Ren-Shan; Zirkin, Barry R; Jelinsky, Scott A

    2011-12-01

    Leydig cells are the testosterone-producing cells in the adult male. Adult Leydig cells (ALCs) develop from stem Leydig cells (SLCs) through at least two intermediate cells, progenitor Leydig cells (PLCs) and immature Leydig cells (ILCs). Microarray gene expression was used to identify the transcriptional changes that occur with the differentiation of SLCs to PLCs and, thus, with the entry of SLCs into the Leydig cell lineage; to comprehensively examine differentiation through the development of ALCs; and to relate the pattern of gene expression in SLCs to that in a well-established stem cell, bone marrow stem cells (BSCs). We show that the pattern of gene expression by SLCs was more similar to the expression by BSCs, an established stem cell outside the male reproductive tract, than to any of the cells in the Leydig cell developmental lineage. These results indicated that the SLCs have many of the molecular characteristics of other stem cells. Pathway analysis indicated that development of Leydig cells from SLCs to PLCs was associated with decreased expression of genes related to adhesion and increased expression of genes related to steroidogenesis. Gene expression changes between PLCs and ILCs and between ILCs and ALCs were relatively minimal, suggesting that these cells are highly similar. In contrast, gene expression changes between SLCs and ALCs were quite distinct.

  4. Differential gene expression identified in Uigur women cervical squamous cell carcinoma by suppression subtractive hybridization.

    PubMed

    Pan, Z; Chen, S; Pan, X; Wang, Z; Han, H; Zheng, W; Wang, X; Li, F; Qu, S; Shao, R

    2010-01-01

    Cervical cancer is one of the most common gynecological cancers worldwide. Over the past decade, much progress has been made in understanding the genetic changes associated with the development and progression of cervical cancer. However, the precise mechanisms of cervical carcinogenesis in Uigur women remain unclear. To screen differential gene expression in squamous cell carcinoma (SCC) of the cervix in Uigur women, suppressive subtractive hybridization (SSH) was performed on the cervical squamous cell carcinoma and corresponding normal cervical tissues of a Uigur patient. Thus we were be able to find the genes that are related with cervical tumors of Uigur women. A total of 300 samples were subject to DNA sequencing analysis and 46 genes were found to express differentially in tumors compared with normal tissues. Of the 46 genes, 24 genes were up-regulated whereas 22 genes were down-regulated in cervical tumors. The expression profiles of 5 of the 46 genes were further confirmed in 15 other Uigur patients by semi-quantitative reverse-transcription polymerase chain reaction. Our results revealed that ACADVL, CEBPB, IFITM1 and DNAJC9 are involved in cervical carcinogenesis.

  5. Differentially expressed genes in the fat body of Bombyx mori in response to phoxim insecticide.

    PubMed

    Gu, Z Y; Li, F C; Wang, B B; Xu, K Z; Ni, M; Zhang, H; Shen, W D; Li, B

    2015-01-01

    The silkworm, Bombyx mori, is an economically important insect. However, poisoning of silkworms by organophosphate pesticides causes tremendous loss to the sericulture. The fat body is the major tissue involved in detoxification and produces antimicrobial peptides and regulates hormones. In this study, a microarray system comprising 22,987 oligonucluotide 70-mer probes was employed to examine differentially expressed genes in the fat body of B. mori exposed to phoxim insecticide. The results showed that a total of 774 genes were differentially expressed upon phoxim exposure, including 500 up-regulated genes and 274 down-regulated genes. The expression levels of eight detoxification-related genes were up-regulated upon phoxim exposure, including six cytochrome P450s and two glutathione-S-transferases. It was firstly found that eight antimicrobial peptide genes were down-regulated, which might provide important references for studying the larvae of B. mori become more susceptible to microbial infections after phoxim treatment. In addition, we firstly detected the expression level of metamorphosis-related genes after phoxim exposure, which may lead to impacted reproduction. Our results may facilitate the overall understanding of the molecular mechanism of multiple pathways following exposure to phoxim insecticide in the fat body of B. mori. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    PubMed

    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei

    2013-01-01

    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  7. Differential expression and interaction of host factors augment HIV-1 gene expression in neonatal mononuclear cells

    SciTech Connect

    Sundaravaradan, Vasudha; Mehta, Roshni; Harris, David T.; Zack, Jerome A.; Ahmad, Nafees

    2010-04-25

    We have previously shown a higher level of HIV-1 replication and gene expression in neonatal (cord) blood mononuclear cells (CBMC) compared with adult blood cells (PBMC), which could be due to differential expression of host factors. We performed the gene expression profile of CBMC and PBMC and found that 8013 genes were expressed at higher levels in CBMC than PBMC and 8028 genes in PBMC than CBMC, including 1181 and 1414 genes upregulated after HIV-1 infection in CBMC and PBMC, respectively. Several transcription factors (NF-kappaB, E2F, HAT-1, TFIIE, Cdk9, Cyclin T1), signal transducers (STAT3, STAT5A) and cytokines (IL-1beta, IL-6, IL-10) were upregulated in CBMC than PBMC, which are known to influence HIV-1 replication. In addition, a repressor of HIV-1 transcription, YY1, was down regulated in CBMC than PBMC and several matrix metalloproteinase (MMP-7, -12, -14) were significantly upregulated in HIV-1 infected CBMC than PBMC. Furthermore, we show that CBMC nuclear extracts interacted with a higher extent to HIV-1 LTR cis-acting sequences, including NF-kappaB, NFAT, AP1 and NF-IL6 compared with PBMC nuclear extracts and retroviral based short hairpin RNA (shRNA) for STAT3 and IL-6 down regulated their own and HIV-1 gene expression, signifying that these factors influenced differential HIV-1 gene expression in CBMC than PBMC.

  8. Low-level arsenite activates the transcription of genes involved in adipose differentiation.

    PubMed

    Salazard, B; Bellon, L; Jean, S; Maraninchi, M; El-Yazidi, C; Orsière, T; Margotat, A; Botta, A; Bergé-Lefranc, J-L

    2004-11-01

    In this study we analyzed gene expression in 3T3-F442A pre-adipocyte cells that differentiate in the presence of micro-molar arsenate concentration. Two concentrations of arsenite (As2O3, 0.25 micromol/L and 0.5 micromol/L) were applied for three days with and without insulin (170 nmol/L) and gene expressions were evaluated by quantitative RT-PCR. The genes included genes of oxidative-stress responses: heme-oxygenase-1 (HO1) and the hypoxia inducible factor 1a (HIF1alpha), genes of cell-cycle: c-jun and Kruppel like factor 5 (KLF5), and genes that play important roles in adipose determination: a peroxisome proliferator-activated receptor (PPARgamma) and a CCAAT/ enhancer binding protein (C/EBPalpha). Arsenite induced the expression of HO1, HIF1alpha, KLF5, PPARgamma and C/EBPalpha. These results suggest that under condition of oxidative stress arsenite induces genes that are required for adipose differentiation.

  9. Expression patterns of TEL genes in Poaceae suggest a conserved association with cell differentiation.

    PubMed

    Paquet, Nicolas; Bernadet, Marie; Morin, Halima; Traas, Jan; Dron, Michel; Charon, Celine

    2005-06-01

    Poaceae species present a conserved distichous phyllotaxy (leaf position along the stem) and share common properties with respect to leaf initiation. The goal of this work was to determine if these common traits imply common genes. Therefore, homologues of the maize TERMINAL EAR1 gene in Poaceae were studied. This gene encodes an RNA-binding motif (RRM) protein, that is suggested to regulate leaf initiation. Using degenerate primers, one unique tel (terminal ear1-like) gene from seven Poaceae members, covering almost all the phylogenetic tree of the family, was identified by PCR. These genes present a very high degree of similarity, a much conserved exon-intron structure, and the three RRMs and TEL characteristic motifs. The evolution of tel sequences in Poaceae strongly correlates with the known phylogenetic tree of this family. RT-PCR gene expression analyses show conserved tel expression in the shoot apex in all species, suggesting functional orthology between these genes. In addition, in situ hybridization experiments with specific antisense probes show tel transcript accumulation in all differentiating cells of the leaf, from the recruitment of leaf founder cells to leaf margins cells. Tel expression is not restricted to initiating leaves as it is also found in pro-vascular tissues, root meristems, and immature inflorescences. Therefore, these results suggest that TEL is not only associated with leaf initiation but more generally with cell differentiation in Poaceae.

  10. Melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24): Novel gene therapeutic for metastatic melanoma

    SciTech Connect

    Fisher, Paul B. Sarkar, Devanand; Lebedeva, Irina V.; Emdad, Luni; Gupta, Pankaj; Sauane, Moira; Su Zaozhong; Grant, Steven; Dent, Paul; Curiel, David T.; Senzer, Neil; Nemunaitis, John

    2007-11-01

    A potentially less toxic approach for cancer therapy comprises induction of tumor cells to lose growth potential irreversibly and terminally differentiate. Combining this scheme termed 'differentiation therapy of cancer' with subtraction hybridization to human melanoma cells resulted in the cloning of melanoma differentiation associated (mda) genes displaying elevated expression as a consequence of induction of terminal differentiation. One originally novel gene, mda-7, was found to display elevated expression in normal melanocytes and nevi with progressive loss of expression as a consequence of melanoma development and progression to metastasis. Based on structure, biochemical properties and chromosomal location, mda-7 has now been reclassified as interleukin (IL)-24, a member of the expanding IL-10 family of cytokines. In vitro cell culture and in vivo animal studies indicate that mda-7/IL-24 selectively induces programmed cell death (apoptosis) in multiple human cancers (including melanomas), without harming normal cells, and promotes profound anti-tumor activity in nude mice containing human tumor xenografts. Based on these remarkable properties, a Phase I clinical trial was conducted to test the safety of administration of mda-7/IL-24 by a replication incompetent adenovirus (Ad.mda-7; INGN 241) in patients with advanced solid cancers including melanoma. mda-7/IL-24 was found to be safe and to promote significant clinical activity, particularly in the context of patients with metastatic melanoma. These results provide an impetus for further clinical studies and document a central paradigm of cancer therapy, namely translation of basic science from the 'bench to the bedside.'.

  11. Identification of genes encoding critical factors regulating B-cell terminal differentiation in torafugu (Takifugu rubripes).

    PubMed

    Ohtani, Maki; Miyadai, Toshiaki; Hiroishi, Shingo

    2006-03-01

    Many transcription factors, and associated co-factors, are involved in the regulation of B-cell terminal differentiation in mammals. In the teleost and cartilaginous fish, although evidence has strongly suggested the existence of B-cell like lymphocytes, the mechanism of terminal differentiation of B-cells remains to be elucidated. In the present study, we searched for the nucleotide and amino acid sequences similar to the critical regulatory factors facilitating the terminal differentiation of B-cells using the fugu BLAST server. We cloned the following cDNAs from Takifugu rubripes: (1) B-lymphocyte-induced maturation protein-1 (Blimp-1), which plays a major role in promoting plasma cell differentiation by repressing the transcription of many genes that participate in maintaining the differentiation of mature B-cells; (2) Bcl-6, which facilitates germinal center formation and represses Blimp-1 expression; (3) X-box binding protein-1 (XBP-1), which operates Ig secretion by activating transcription of the ER-stress responsible genes; (4) Pax-5, which suppresses XBP-1 and enhances the expression of activation-induced cytidine deaminase (AID), an inducer of somatic hypermutation and class-switch recombination of the immunoglobulin gene; and (5) TLE-3, one of the Groucho family proteins, a co-factor for Blimp-1. We also identified other co-factors and many target genes of Blimp-1 by in silico and/or cDNA cloning. These finding indicates that the basal process of B-cell terminal differentiation in fish is controlled by factors identical to those in mammals.

  12. Differentiation in neutral genes and a candidate gene in the pied flycatcher: using biological archives to track global climate change.

    PubMed

    Kuhn, Kerstin; Schwenk, Klaus; Both, Christiaan; Canal, David; Johansson, Ulf S; van der Mije, Steven; Töpfer, Till; Päckert, Martin

    2013-11-01

    Global climate change is one of the major driving forces for adaptive shifts in migration and breeding phenology and possibly impacts demographic changes if a species fails to adapt sufficiently. In Western Europe, pied flycatchers (Ficedula hypoleuca) have insufficiently adapted their breeding phenology to the ongoing advance of food peaks within their breeding area and consequently suffered local population declines. We address the question whether this population decline led to a loss of genetic variation, using two neutral marker sets (mitochondrial control region and microsatellites), and one potentially selectively non-neutral marker (avian Clock gene). We report temporal changes in genetic diversity in extant populations and biological archives over more than a century, using samples from sites differing in the extent of climate change. Comparing genetic differentiation over this period revealed that only the recent Dutch population, which underwent population declines, showed slightly lower genetic variation than the historic Dutch population. As that loss of variation was only moderate and not observed in all markers, current gene flow across Western and Central European populations might have compensated local loss of variation over the last decades. A comparison of genetic differentiation in neutral loci versus the Clock gene locus provided evidence for stabilizing selection. Furthermore, in all genetic markers, we found a greater genetic differentiation in space than in time. This pattern suggests that local adaptation or historic processes might have a stronger effect on the population structure and genetic variation in the pied flycatcher than recent global climate changes.

  13. Interpreting Patterns of Gene Expression with Self-Organizing Maps: Methods and Application to Hematopoietic Differentiation

    NASA Astrophysics Data System (ADS)

    Tamayo, Pablo; Slonim, Donna; Mesirov, Jill; Zhu, Qing; Kitareewan, Sutisak; Dmitrovsky, Ethan; Lander, Eric S.; Golub, Todd R.

    1999-03-01

    Array technologies have made it straightforward to monitor simultaneously the expression pattern of thousands of genes. The challenge now is to interpret such massive data sets. The first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of self-organizing maps, a type of mathematical cluster analysis that is particularly well suited for recognizing and classifying features in complex, multidimensional data. The method has been implemented in a publicly available computer package, GENECLUSTER, that performs the analytical calculations and provides easy data visualization. To illustrate the value of such analysis, the approach is applied to hematopoietic differentiation in four well studied models (HL-60, U937, Jurkat, and NB4 cells). Expression patterns of some 6,000 human genes were assayed, and an online database was created. GENECLUSTER was used to organize the genes into biologically relevant clusters that suggest novel hypotheses about hematopoietic differentiation--for example, highlighting certain genes and pathways involved in "differentiation therapy" used in the treatment of acute promyelocytic leukemia.

  14. Genome-wide assessment of differential effector gene use in embryogenesis.

    PubMed

    Barsi, Julius C; Tu, Qiang; Calestani, Cristina; Davidson, Eric H

    2015-11-15

    Six different populations of cells were isolated by fluorescence-activated cell sorting from disaggregated late blastula- and gastrula-stage sea urchin embryos according to the regulatory states expressed in these cells, as reported by recombineered bacterial artificial chromosomes producing fluorochromes. Transcriptomes recovered from these embryonic cell populations revealed striking, early differential expression of large cohorts of effector genes. The six cell populations were presumptive pigment cells, presumptive neurogenic cells, presumptive skeletogenic cells, cells from the stomodeal region of the oral ectoderm, ciliated band cells and cells from the endoderm/ectoderm boundary that will give rise both to hindgut and to border ectoderm. Transcriptome analysis revealed that each of these domains specifically expressed several hundred effector genes at significant levels. Annotation indicated the qualitative individuality of the functional nature of each cell population, even though they were isolated from embryos only 1-2 days old. In no case was more than a tiny fraction of the transcripts enriched in one population also enriched in any other of the six populations studied. As was particularly clear in the cases of the presumptive pigment, neurogenic and skeletogenic cells, all three of which represent precociously differentiating cell types of this embryo, most specifically expressed genes of given cell types are not significantly expressed at all in the other cell types. Thus, at the effector gene level, a dramatic, cell type-specific pattern of differential gene regulation is established well before any significant embryonic morphogenesis has occurred.

  15. Cryptococcus neoformans Differential Gene Expression Detected In Vitro and In Vivo with Green Fluorescent Protein

    PubMed Central

    del Poeta, Maurizio; Toffaletti, Dena L.; Rude, Thomas H.; Sparks, Sara D.; Heitman, Joseph; Perfect, John R.

    1999-01-01

    Synthetic green fluorescent protein (GFP) was used as a reporter to detect differential gene expression in the pathogenic fungus Cryptococcus neoformans. Promoters from the C. neoformans actin, GAL7, or mating-type alpha pheromone (MFα1) genes were fused to GFP, and the resulting reporter genes were used to assess gene expression in serotype A C. neoformans. Yeast cells containing an integrated pACT::GFP construct demonstrated that the actin promoter was expressed during vegetative growth on yeast extract-peptone-dextrose medium. In contrast, yeast cells containing the inducible GAL7::GFP or MFα1::GFP reporter genes expressed significant GFP activity only during growth on galactose medium or V-8 agar, respectively. These findings demonstrated that the GAL7 and MFα1 promoters from a serotype D C. neoformans strain function when introduced into a serotype A strain. Because the MFα1 promoter is induced by nutrient deprivation and the MATα locus containing the MFα1 gene has been linked with virulence, yeast cells containing the pMFα1::GFP reporter gene were analyzed for GFP expression in the central nervous system (CNS) of immunosuppressed rabbits. In fact, significant GFP expression from the MFα1::GFP reporter gene was detected after the first week of a CNS infection. These findings suggest that there are temporal, host-specific cues that regulate gene expression during infection and that the MFα1 gene is induced during the proliferative stage of a CNS infection. In conclusion, GFP can be used as an effective and sensitive reporter to monitor specific C. neoformans gene expression in vitro, and GFP reporter constructs can be used as an approach to identify a novel gene(s) or to characterize known genes whose expression is regulated during infection. PMID:10085022

  16. Pdx1 level defines pancreatic gene expression pattern and cell lineage differentiation.

    PubMed

    Wang, H; Maechler, P; Ritz-Laser, B; Hagenfeldt, K A; Ishihara, H; Philippe, J; Wollheim, C B

    2001-07-06

    The absence of Pdx1 and the expression of brain-4 distinguish alpha-cells from other pancreatic endocrine cell lineages. To define the transcription factor responsible for pancreatic cell differentiation, we employed the reverse tetracycline-dependent transactivator system in INS-I cell-derived subclones INSralphabeta and INSrbeta to achieve tightly controlled and conditional expression of wild type Pdx1 or its dominant-negative mutant, as well as brain-4. INSralphabeta cells express not only insulin but also glucagon and brain-4, while INSrbeta cells express only insulin. Overexpression of Pdx1 eliminated glucagon mRNA and protein in INSralphabeta cells and promoted the expression of beta-cell-specific genes in INSrbeta cells. Induction of dominant-negative Pdx1 in INSralphabeta cells resulted in differentiation of insulin-producing beta-cells into glucagon-containing alpha-cells without altering brain4 expression. Loss of Pdx1 function alone in INSrbeta cells, which do not express endogenous brain-4 and glucagon, was also sufficient to abolish the expression of genes restricted to beta-cells and to cause alpha-cell differentiation. In contrast, induction of brain-4 in INSrbeta cells initiated detectable expression of glucagon but did not affect beta-cell-specific gene expression. In conclusion, Pdx1 confers the expression of pancreatic beta-cell-specific genes, such as genes encoding insulin, islet amyloid polypeptide, Glut2, and Nkx6.1. Pdx1 defines pancreatic cell lineage differentiation. Loss of Pdx1 function rather than expression of brain4 is a prerequisite for alpha-cell differentiation.

  17. Analysis of differentially co-expressed genes based on microarray data of hepatocellular carcinoma.

    PubMed

    Wang, Y; Jiang, T; Li, Z; Lu, L; Zhang, R; Zhang, D; Wang, X; Tan, J

    2017-01-01

    Hepatocellular carcinoma (HCC) is the third leading cause of cancer related death worldwide. Although great progress in diagnosis and management of HCC have been made, the exact molecular mechanisms remain poorly understood. The study aims to identify potential biomarkers for HCC progression, mainly at transcription level. In this study, chip data GSE 29721 was utilized, which contains 10 HCC samples and 10 normal adjacent tissue samples. Differentially expressed genes (DEGs) between two sample types were selected by t-test method. Following, the differentially co-expressed genes (DCGs) and differentially co-expressed Links (DCLs) were identified by DCGL package in R with the threshold of q < 0.25. Afterwards, pathway enrichment analysis of the DCGs was carried out by DAVID. Then, DCLs were mapped to TRANSFAC database to reveal associations between relevant transcriptional factors (TFs) and their target genes. Quantitative real-time RT-PCR was performed for TFs or genes of interest. As a result, a total of 388 DCGs and 35,771 DCLs were obtained. The predominant pathways enriched by these genes were Cytokine-cytokine receptor interaction, ECM-receptor interaction and TGF-β signaling pathway. Three TF-target interactions, LEF1-NCAM1, EGR1-FN1 and FOS-MT2A were predicted. Compared with control, expressions of the TF genes EGR1, FOS and ETS2 were all up-regulated in the HCC cell line, HepG2; while LEF1 was down-regulated. Except NCAM1, all the target genes were up-regulated in HepG2. Our findings suggest these TFs and genes might play important roles in the pathogenesis of HCC and may be used as therapeutic targets for HCC management.

  18. A Single Enhancer Regulating the Differential Expression of Duplicated Red-Sensitive Opsin Genes in Zebrafish

    PubMed Central

    Tsujimura, Taro; Hosoya, Tomohiro; Kawamura, Shoji

    2010-01-01

    A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio) have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs) in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC) clones encompassing the two genes and identified a 0.6-kb “LWS-activating region” (LAR) upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins. PMID:21187910

  19. Organization and Differential Regulation of a Cluster of Lignin Peroxidase Genes of Phanerochaete chrysosporium

    PubMed Central

    Stewart, Philip; Cullen, Daniel

    1999-01-01

    The lignin peroxidases of Phanerochaete chrysosporium are encoded by a minimum of 10 closely related genes. Physical and genetic mapping of a cluster of eight lip genes revealed six genes occurring in pairs and transcriptionally convergent, suggesting that portions of the lip family arose by gene duplication events. The completed sequence of lipG and lipJ, together with previously published sequences, allowed phylogenetic and intron/exon classifications, indicating two main branches within the lip family. Competitive reverse transcription-PCR was used to assess lip transcript levels in both carbon- and nitrogen-limited media. Transcript patterns showed differential regulation of lip genes in response to medium composition. No apparent correlation was observed between genomic organization and transcript levels. Both constitutive and upregulated transcripts, structurally unrelated to peroxidases, were identified within the lip cluster. PMID:10348854

  20. Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization.

    PubMed

    Qiu, Jie; Ni, Yu-hui; Gong, Hai-xia; Fei, Li; Pan, Xiao-qin; Guo, Mei; Chen, Rong-hua; Guo, Xi-rong

    2007-01-12

    To identify differentially expressed genes between obese individuals and normal control, we have undertaken suppression subtractive hybridization (SSH). Omental adipose tissues were obtained via abdominal surgery for appendicitis in both 13 obese subjects [BMI (body mass index) >30 kg/m2] and 13 normal subjects (BMI >18 and <25 kg/m2). Following SSH, about one thousand clones were sequenced and found to derive from 426 different genes. These predominately expressed genes included genes involved in lipid metabolism, cytokines, signal transduction, GLUT4 translocation, cell cycle and growth, cytoskeleton, and others. Although more detailed analyses are necessary, it is anticipated that further study of genes identified will provide insights into their specific roles in the etiology of obesity.

  1. Mutations in Ehrlichia chaffeensis Causing Polar Effects in Gene Expression and Differential Host Specificities.

    PubMed

    Cheng, Chuanmin; Nair, Arathy D S; Jaworski, Deborah C; Ganta, Roman R

    2015-01-01

    Ehrlichia chaffeensis, a tick-borne rickettsial, is responsible for human monocytic ehrlichiosis. In this study, we assessed E. chaffeensis insertion mutations impacting the transcription of genes near the insertion sites. We presented evidence that the mutations within the E. chaffeensis genome at four genomic locations cause polar effects in altering gene expressions. We also reported mutations causing attenuated growth in deer (the pathogen's reservoir host) and in dog (an incidental host), but not in its tick vector, Amblyomma americanum. This is the first study documenting insertion mutations in E. chaffeensis that cause polar effects in altering gene expression from the genes located upstream and downstream to insertion sites and the differential requirements of functionally active genes of the pathogen for its persistence in vertebrate and tick hosts. This study is important in furthering our knowledge on E. chaffeensis pathogenesis.

  2. Identifying differentially expressed genes in cancer patients using a non-parameter Ising model.

    PubMed

    Li, Xumeng; Feltus, Frank A; Sun, Xiaoqian; Wang, James Z; Luo, Feng

    2011-10-01

    Identification of genes and pathways involved in diseases and physiological conditions is a major task in systems biology. In this study, we developed a novel non-parameter Ising model to integrate protein-protein interaction network and microarray data for identifying differentially expressed (DE) genes. We also proposed a simulated annealing algorithm to find the optimal configuration of the Ising model. The Ising model was applied to two breast cancer microarray data sets. The results showed that more cancer-related DE sub-networks and genes were identified by the Ising model than those by the Markov random field model. Furthermore, cross-validation experiments showed that DE genes identified by Ising model can improve classification performance compared with DE genes identified by Markov random field model.

  3. Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors

    PubMed Central

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E. S.

    2013-01-01

    A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks. PMID:23822502

  4. Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors.

    PubMed

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S

    2013-06-01

    A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.

  5. Regularized Non-negative Matrix Factorization for Identifying Differential Genes and Clustering Samples: a Survey.

    PubMed

    Liu, Jin-Xing; Wang, Dong; Gao, Ying-Lian; Zheng, Chun-Hou; Xu, Yong; Yu, Jiguo

    2017-02-07

    Non-negative Matrix Factorization (NMF), a classical method for dimensionality reduction, has been applied in many fields. It is based on the idea that negative numbers are physically meaningless in various data-processing tasks. Apart from its contribution to conventional data analysis, the recent overwhelming interest in NMF is due to its newly discovered ability to solve challenging data mining and machine learning problems, especially in relation to gene expression data. This survey paper mainly focuses on research examining the application of NMF to identify differentially expressed genes and to cluster samples, and the main NMF models, properties, principles, and algorithms with its various generalizations, extensions, and modifications are summarized. The experimental results demonstrate the performance of the various NMF algorithms in identifying differentially expressed genes and clustering samples.

  6. Efficiency Analysis of Competing Tests for Finding Differentially Expressed Genes in Lung Adenocarcinoma

    PubMed Central

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The ‘best’ test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  7. Efficiency analysis of competing tests for finding differentially expressed genes in lung adenocarcinoma.

    PubMed

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The 'best' test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  8. Deletion of Alox5 gene decreases osteogenic differentiation but increases adipogenic differentiation of mouse induced pluripotent stem cells.

    PubMed

    Wu, Yanru; Sun, Hualing; Song, Fangfang; Huang, Cui; Wang, Jiawei

    2014-10-01

    Induced pluripotent stem cells (iPSCs) have great potential in bone tissue engineering to repair large bone defects. Before their clinical application, investigations are needed to discover the genes and osteoconductive scaffolds that influence their differentiation toward an osteogenic lineage. Alox5 plays controversial and complex roles in the regulation of bone and fat metabolism. To detect the effect of Alox5 on osteogenic and adipogenic differentiation of iPSCs, both Alox5 knockout mouse iPSCs (Alox5-KO-iPSCs) and wild-type mouse iPSCs (Wild-iPSCs) were developed. The mRNA levels of many osteogenic markers in Alox5-KO-iPSCs were significantly reduced, while many adipogenic markers were enhanced. Furthermore, when implanted in rat cranial critical-sized defects with collagen/chitosan/hydroxyapatite scaffolds (CCHS), Alox5-KO-iPSCs produced significantly less new bone than Wild-iPSCs and both cell-scaffold groups had no tumor formation. There was a significant difference in the expression of Cox2 during the osteogenic and adipogenic differentiation between the two kinds of iPSCs in vitro. In conclusion, firstly, Alox5 knockout reduced the osteogenic but increased the adipogenic differentiation potential of mouse iPSCs. These disorders might be related to the change of Cox2 expression. Secondly, combined with iPSCs, CCHS can serve as a potential substrate to repair critical-sized bony defects. However, more studies are required to confirm the mechanisms through which Alox5 affects the osteogenic and adipogenic abilities of iPSCs in vivo and the effect of Cox2 inhibition in this system.

  9. Differential expression profiles and pathways of genes in sugarcane leaf at elongation stage in response to drought stress

    PubMed Central

    Li, Changning; Nong, Qian; Solanki, Manoj Kumar; Liang, Qiang; Xie, Jinlan; Liu, Xiaoyan; Li, Yijie; Wang, Weizan; Yang, Litao; Li, Yangrui

    2016-01-01

    Water stress causes considerable yield losses in sugarcane. To investigate differentially expressed genes under water stress, a pot experiment was performed with the sugarcane variety GT21 at three water-deficit levels (mild, moderate, and severe) during the elongation stage and gene expression was analyzed using microarray technology. Physiological parameters of sugarcane showed significant alterations in response to drought stress. Based on the expression profile of 15,593 sugarcane genes, 1,501 (9.6%) genes were differentially expressed under different water-level treatments; 821 genes were upregulated and 680 genes were downregulated. A gene similarity analysis showed that approximately 62.6% of the differentially expressed genes shared homology with functional proteins. In a Gene Ontology (GO) analysis, 901 differentially expressed genes were assigned to 36 GO categories. Moreover, 325 differentially expressed genes were classified into 101 pathway categories involved in various processes, such as the biosynthesis of secondary metabolites, ribosomes, carbon metabolism, etc. In addition, some unannotated genes were detected; these may provide a basis for studies of water-deficit tolerance. The reliability of the observed expression patterns was confirmed by RT-PCR. The results of this study may help identify useful genes for improving drought tolerance in sugarcane. PMID:27170459

  10. Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

    PubMed Central

    2011-01-01

    Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. Results A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. Conclusion The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their

  11. Eye development and retinal differentiation in an altricial fish species, the senegalese sole (Solea senegalensis, Kaup 1858).

    PubMed

    Bejarano-Escobar, Ruth; Blasco, Manuel; DeGrip, Willem J; Oyola-Velasco, José Antonio; Martín-Partido, Gervasio; Francisco-Morcillo, Javier

    2010-11-15

    We describe the major events in the retinogenesis in an altricial fish species, the Senegalese sole. The major developmental events in the sole retina occurred early after hatching (posthatching day 0, P0). Thus, (1) plexiform layers became recognizable at P1. (2) Proliferative activity disappeared from the central retina at P1, and, as development progressed, became restricted to cells located in the circumferential germinal zone, and to sparse cells dispersed throughout the inner nuclear layer and the outer nuclear layer. (3) Apoptotic cells were sparsely observed, randomly localized in all three nuclear layers of the early posthatching retina from P0 to P4. (4) The first synaptic vesicles were detected at P0 in early postmitotic ganglion cells. However, their appearance in the plexiform layers was delayed until P2. (5) The neurochemical development of most major retinal cell classes occurred between P0 and P5. Thus, although Isl1 immunoreactive ganglion cells were the first to become postmitotic in the vitreal surface of the central retina at P0, the first glutamine synthetase-expressing Müller cells appeared in the central retina by P5. The onset of expression for other retinal markers, such as rod opsin, calretinin, parvalbumin, a-tyrosine hydroxylase, and a-protein kinase C, occurred between P2 and P4. Our results suggest that the most relevant processes involved in Senegalese sole retinogenesis occur during the prolarval and early larval stages (P0–P5). Furthermore, we conclude that altricial fish species may constitute a convenient model organism to address the relationship between the structural and functional development of sensory organs with the acquisition of behavioral repertoires.

  12. Storage Temperature Alters the Expression of Differentiation-Related Genes in Cultured Oral Keratinocytes

    PubMed Central

    Utheim, Tor Paaske; Islam, Rakibul; Fostad, Ida G.; Eidet, Jon R.; Sehic, Amer; Olstad, Ole K.; Dartt, Darlene A.; Messelt, Edward B.; Griffith, May; Pasovic, Lara

    2016-01-01

    Purpose Storage of cultured human oral keratinocytes (HOK) allows for transportation of cultured transplants to eye clinics worldwide. In a previous study, one-week storage of cultured HOK was found to be superior with regard to viability and morphology at 12°C compared to 4°C and 37°C. To understand more of how storage temperature affects cell phenotype, gene expression of HOK before and after storage at 4°C, 12°C, and 37°C was assessed. Materials and Methods Cultured HOK were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium at 4°C, 12°C, and 37°C for one week. Total RNA was isolated and the gene expression profile was determined using DNA microarrays and analyzed with Partek Genomics Suite software and Ingenuity Pathway Analysis. Differentially expressed genes (fold change > 1.5 and P < 0.05) were identified by one-way ANOVA. Key genes were validated using qPCR. Results Gene expression of cultures stored at 4°C and 12°C clustered close to the unstored control cultures. Cultures stored at 37°C displayed substantial change in gene expression compared to the other groups. In comparison with 12°C, 2,981 genes were differentially expressed at 37°C. In contrast, only 67 genes were differentially expressed between the unstored control and the cells stored at 12°C. The 12°C and 37°C culture groups differed most significantly with regard to the expression of differentiation markers. The Hedgehog signaling pathway was significantly downregulated at 37°C compared to 12°C. Conclusion HOK cultures stored at 37°C showed considerably larger changes in gene expression compared to unstored cells than cultured HOK stored at 4°C and 12°C. The changes observed at 37°C consisted of differentiation of the cells towards a squamous epithelium-specific phenotype. Storing cultured ocular surface transplants at 37°C is therefore not recommended. This is particularly interesting as 37°C is the standard incubation temperature used for cell

  13. Induction of the autophagy-associated gene MAP1S via PU.1 supports APL differentiation.

    PubMed

    Haimovici, Aladin; Brigger, Daniel; Torbett, Bruce E; Fey, Martin F; Tschan, Mario P

    2014-09-01

    The PU.1 transcription factor is essential for myeloid development. We investigated if the microtubule-associated protein 1S (MAP1S) is a novel PU.1 target with a link to autophagy, a cellular recycling pathway. Comparable to PU.1, MAP1S expression was significantly repressed in primary AML blasts as compared to mature neutrophils. Accordingly, MAP1S expression was induced during neutrophil differentiation of CD34(+) progenitor and APL cells. Moreover, PU.1 bound to the MAP1S promoter and induced MAP1S expression during APL differentiation. Inhibiting MAP1S resulted in aberrant neutrophil differentiation and autophagy. Taken together, our findings implicate the PU.1-regulated MAP1S gene in neutrophil differentiation and autophagy control.

  14. Plasma cell differentiation is coupled to division-dependent DNA hypomethylation and gene regulation

    PubMed Central

    Bally, Alexander P.R.; Boss, Jeremy M.

    2016-01-01

    The epigenetic processes that regulate antibody secreting plasma cells are not well understood. Here, analysis of plasma cell differentiation revealed DNA hypomethylation of 10% of CpG loci that were overrepresented at enhancers. Inhibition of DNA methylation enhanced plasma cell commitment in a cell division-dependent manner. Examination of in vivo differentiating B cells stratified by cell division revealed a 5-fold increase in mRNA transcription coupled to DNA hypomethylation. Demethylation occurred first at binding motifs of NF-κB and AP-1 and later at those for IRF and Oct-2, and were coincident with activation and differentiation gene expression programs. These data provide mechanistic insight into the cell-division coupled transcriptional and epigenetic reprogramming and suggest DNA hypomethylation reflects the cis-regulatory history of plasma cell differentiation. PMID:27500631

  15. Microarray and differential display identify genes involved in jasmonate-dependent anther development.

    PubMed

    Mandaokar, Ajin; Kumar, V Dinesh; Amway, Matt; Browse, John

    2003-07-01

    Jasmonate (JA) is a signaling compound essential for anther development and pollen fertility in Arabidopsis. Mutations that block the pathway of JA synthesis result into male sterility. To understand the processes of anther and pollen maturation, we used microarray and differential display approaches to compare gene expression pattern in anthers of wild-type Arabidopsis and the male-sterile mutant, opr3. Microarray experiment revealed 25 genes that were up-regulated more than 1.8-fold in wild-type anthers as compared to mutant anthers. Experiments based on differential display identified 13 additional genes up-regulated in wild-type anthers compared to opr3 for a total of 38 differentially expressed genes. Searches of the Arabidopsis and non-redundant databases disclosed known or likely functions for 28 of the 38 genes identified, while 10 genes encode proteins of unknown function. Northern blot analysis of eight representative clones as probes confirmed low expression in opr3 anthers compared with wild-type anthers. JA responsiveness of these same genes was also investigated by northern blot analysis of anther RNA isolated from wild-type and opr3 plants, In these experiments, four genes were induced in opr3 anthers within 0.5-1 h of JA treatment while the remaining genes were up-regulated only 1-8 h after JA application. None of these genes was induced by JA in anthers of the coil mutant that is deficient in JA responsiveness. The four early-induced genes in opr3 encode lipoxygenase, a putative bHLH transcription factor, epithiospecifier protein and an unknown protein. We propose that these and other early components may be involved in JA signaling and in the initiation of developmental processes. The four late genes encode an extensin-like protein, a peptide transporter and two unknown proteins, which may represent components required later in anther and pollen maturation. Transcript profiling has provided a successful approach to identify genes involved in

  16. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation.

  17. Burkholderia cenocepacia differential gene expression during host-pathogen interactions and adaptation to the host environment.

    PubMed

    O'Grady, Eoin P; Sokol, Pamela A

    2011-01-01

    Members of the Burkholderia cepacia complex (Bcc) are important in medical, biotechnological, and agricultural disciplines. These bacteria naturally occur in soil and water environments and have adapted to survive in association with plants and animals including humans. All Bcc species are opportunistic pathogens including Burkholderia cenocepacia that causes infections in cystic fibrosis and chronic granulomatous disease patients. The adaptation of B. cenocepacia to the host environment was assessed in a rat chronic respiratory infection model and compared to that of high cell-density in vitro grown cultures using transcriptomics. The distribution of genes differentially expressed on chromosomes 1, 2, and 3 was relatively proportional to the size of each genomic element, whereas the proportion of plasmid-encoded genes differentially expressed was much higher relative to its size and most genes were induced in vivo. The majority of genes encoding known virulence factors, components of types II and III secretion systems and chromosome 2-encoded type IV secretion system were similarly expressed between in vitro and in vivo environments. Lower expression in vivo was detected for genes encoding N-acyl-homoserine lactone synthase CepI, orphan LuxR homolog CepR2, zinc metalloproteases ZmpA and ZmpB, LysR-type transcriptional regulator ShvR, nematocidal protein AidA, and genes associated with flagellar motility, Flp type pilus formation, and type VI secretion. Plasmid-encoded type IV secretion genes were markedly induced in vivo. Additional genes induced in vivo included genes predicted to be involved in osmotic stress adaptation or intracellular survival, metal ion, and nutrient transport, as well as those encoding outer membrane proteins. Genes identified in this study are potentially important for virulence during host-pathogen interactions and may be associated with survival and adaptation to the host environment during chronic lung infections.

  18. Exome analysis reveals differentially mutated gene signatures of stage, grade and subtype in breast cancers.

    PubMed

    Li, You; Wang, Xiaosheng; Vural, Suleyman; Mishra, Nitish K; Cowan, Kenneth H; Guda, Chittibabu

    2015-01-01

    Breast cancers exhibit highly heterogeneous molecular profiles. Although gene expression profiles have been used to predict the risks and prognostic outcomes of breast cancers, the high variability of gene expression limits its clinical application. In contrast, genetic mutation profiles would be more advantageous than gene expression profiles because genetic mutations can be stably detected and the mutational heterogeneity widely exists in breast cancer genomes. We analyzed 98 breast cancer whole exome samples that were sorted into three subtypes, two grades and two stages. The sum deleterious effect of all mutations in each gene was scored to identify differentially mutated genes (DMGs) for this case-control study. DMGs were corroborated using extensive published knowledge. Functional consequences of deleterious SNVs on protein structure and function were also investigated. Genes such as ERBB2, ESP8, PPP2R4, KIAA0922, SP4, CENPJ, PRCP and SELP that have been experimentally or clinically verified to be tightly associated with breast cancer prognosis are among the DMGs identified in this study. We also identified some genes such as ARL6IP5, RAET1E, and ANO7 that could be crucial for breast cancer development and prognosis. Further, SNVs such as rs1058808, rs2480452, rs61751507, rs79167802, rs11540666, and rs2229437 that potentially influence protein functions are observed at significantly different frequencies in different comparison groups. Protein structure modeling revealed that many non-synonymous SNVs have a deleterious effect on protein stability, structure and function. Mutational profiling at gene- and SNV-level revealed differential patterns within each breast cancer comparison group, and the gene signatures correlate with expected prognostic characteristics of breast cancer classes. Some of the genes and SNVs identified in this study show high promise and are worthy of further investigation by experimental studies.

  19. Exome Analysis Reveals Differentially Mutated Gene Signatures of Stage, Grade and Subtype in Breast Cancers

    PubMed Central

    Li, You; Wang, Xiaosheng; Vural, Suleyman; Mishra, Nitish K.; Cowan, Kenneth H.; Guda, Chittibabu

    2015-01-01

    Breast cancers exhibit highly heterogeneous molecular profiles. Although gene expression profiles have been used to predict the risks and prognostic outcomes of breast cancers, the high variability of gene expression limits its clinical application. In contrast, genetic mutation profiles would be more advantageous than gene expression profiles because genetic mutations can be stably detected and the mutational heterogeneity widely exists in breast cancer genomes. We analyzed 98 breast cancer whole exome samples that were sorted into three subtypes, two grades and two stages. The sum deleterious effect of all mutations in each gene was scored to identify differentially mutated genes (DMGs) for this case-control study. DMGs were corroborated using extensive published knowledge. Functional consequences of deleterious SNVs on protein structure and function were also investigated. Genes such as ERBB2, ESP8, PPP2R4, KIAA0922, SP4, CENPJ, PRCP and SELP that have been experimentally or clinically verified to be tightly associated with breast cancer prognosis are among the DMGs identified in this study. We also identified some genes such as ARL6IP5, RAET1E, and ANO7 that could be crucial for breast cancer development and prognosis. Further, SNVs such as rs1058808, rs2480452, rs61751507, rs79167802, rs11540666, and rs2229437 that potentially influence protein functions are observed at significantly different frequencies in different comparison groups. Protein structure modeling revealed that many non-synonymous SNVs have a deleterious effect on protein stability, structure and function. Mutational profiling at gene- and SNV-level revealed differential patterns within each breast cancer comparison group, and the gene signatures correlate with expected prognostic characteristics of breast cancer classes. Some of the genes and SNVs identified in this study show high promise and are worthy of further investigation by experimental studies. PMID:25803781

  20. Transcriptomic analysis reveals differential gene expression in response to aluminium in common bean (Phaseolus vulgaris) genotypes

    PubMed Central

    Eticha, Dejene; Zahn, Marc; Bremer, Melanie; Yang, Zhongbao; Rangel, Andrés F.; Rao, Idupulapati M.; Horst, Walter J.

    2010-01-01

    Background and Aims Aluminium (Al) resistance in common bean is known to be due to exudation of citrate from the root after a lag phase, indicating the induction of gene transcription and protein synthesis. The aims of this study were to identify Al-induced differentially expressed genes and to analyse the expression of candidate genes conferring Al resistance in bean. Methods The suppression subtractive hybridization (SSH) method was used to identify differentially expressed genes in an Al-resistant bean genotype (‘Quimbaya’) during the induction period. Using quantitative real-time PCR the expression patterns of selected genes were compared between an Al-resistant and an Al-sensitive genotype (‘VAX 1’) treated with Al for up to 24 h. Key Results Short-term Al treatment resulted in up-regulation of stress-induced genes and down-regulation of genes involved in metabolism. However, the expressions of genes encoding enzymes involved in citrate metabolism were not significantly affected by Al. Al treatment dramatically increased the expression of common bean expressed sequence tags belonging to the citrate transporter gene family MATE (multidrug and toxin extrusion family protein) in both the Al-resistant and -sensitive genotype in close agreement with Al-induced citrate exudation. Conclusions The expression of a citrate transporter MATE gene is crucial for citrate exudation in common bean. However, although the expression of the citrate transporter is a prerequisite for citrate exudation, genotypic Al resistance in common bean particularly depends on the capacity to sustain the synthesis of citrate for maintaining the cytosolic citrate pool that enables exudation. PMID:20237115

  1. Detection of differentially expressed genes in the early developmental stage of the mouse mandible.

    PubMed

    Yamaza, H; Matsuo, K; Kiyoshima, T; Shigemura, N; Kobayashi, I; Wada, H; Akamime, A; Sakai, H

    2001-06-01

    We previously examined the development of the mouse mandible, and demonstrated that odontogenesis occurs between embryonic day 10.5 (E10.5) and E12. Based on the histological findings, we performed cDNA subtraction between the E10.5 and E12 mandibles to detect any differentially expressed genes which might be involved in the initiation of odontogenesis. By sequencing, homology search and semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), we thus found Pgk-1, Ccte, Hsp86, Nucleolin, Hsc73, Frg1, N-ras, Set alpha and Hsj2 from the E10.5 mandible, and E25, ATPase6, Mum2, Thymosin beta4 and L21 from the E12 mandible to be differentially expressed genes. These genes are functionally related to protein transport, signal transduction, transcription, translation and molecular chaperon activity. In situ hybridization analyses of Set alpha and E25 showed that Set alpha was detected in the tooth germ at E12 and E14.5, thus indicating a close relationship of this gene to odontogenesis. Meanwhile, the in situ signal of E25 was found in the muscular layer of the tongue, thus suggesting E25 to be related to the differentiation of muscular tissue. In conclusion, we found 15 differentially expressed genes in the course of the early developmental stage of the mouse mandible using a combination of the cDNA subtraction and semi-quantitative RT-PCR methods, while in addition, two genes were demonstrated to be related to the initiation and the development of both tooth germ and the tongue according to the in situ hybridization technique.

  2. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    PubMed

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  3. Concentration-dependent gene expression responses to flusilazole in embryonic stem cell differentiation cultures

    SciTech Connect

    Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Fonteyne, Liset J.J. de la; Brauers, Karen J.J.; Claessen, Sandra; Delft, Joost H. van; Kleinjans, Jos C.S.; Piersma, Aldert H.

    2011-03-01

    The murine embryonic stem cell test (EST) is designed to evaluate developmental toxicity based on compound-induced inhibition of embryonic stem cell (ESC) differentiation into cardiomyocytes. The addition of transcriptomic evaluation within the EST may result in enhanced predictability and improved characterization of the applicability domain, therefore improving usage of the EST for regulatory testing strategies. Transcriptomic analyses assessing factors critical for risk assessment (i.e. dose) are needed to determine the value of transcriptomic evaluation in the EST. Here, using the developmentally toxic compound, flusilazole, we investigated the effect of compound concentration on gene expression regulation and toxicity prediction in ESC differentiation cultures. Cultures were exposed for 24 h to multiple concentrations of flusilazole (0.54-54 {mu}M) and RNA was isolated. In addition, we sampled control cultures 0, 24, and 48 h to evaluate the transcriptomic status of the cultures across differentiation. Transcriptomic profiling identified a higher sensitivity of development-related processes as compared to cell division-related processes in flusilazole-exposed differentiation cultures. Furthermore, the sterol synthesis-related mode of action of flusilazole toxicity was detected. Principal component analysis using gene sets related to normal ESC differentiation was used to describe the dynamics of ESC differentiation, defined as the 'differentiation track'. The concentration-dependent effects on development were reflected in the significance of deviation of flusilazole-exposed cultures from this transcriptomic-based differentiation track. Thus, the detection of developmental toxicity in EST using transcriptomics was shown to be compound concentration-dependent. This study provides further insight into the possible application of transcriptomics in the EST as an improved alternative model system for developmental toxicity testing.

  4. Differential modulation of Bordetella pertussis virulence genes as evidenced by DNA microarray analysis.

    PubMed

    Hot, D; Antoine, R; Renauld-Mongénie, G; Caro, V; Hennuy, B; Levillain, E; Huot, L; Wittmann, G; Poncet, D; Jacob-Dubuisson, F; Guyard, C; Rimlinger, F; Aujame, L; Godfroid, E; Guiso, N; Quentin-Millet, M-J; Lemoine, Y; Locht, C

    2003-07-01

    The production of most factors involved in Bordetella pertussis virulence is controlled by a two-component regulatory system termed BvgA/S. In the Bvg+ phase virulence-activated genes (vags) are expressed, and virulence-repressed genes (vrgs) are down-regulated. The expression of these genes can also be modulated by MgSO(4) or nicotinic acid. In this study we used microarrays to analyse the influence of BvgA/S or modulation on the expression of nearly 200 selected genes. With the exception of one vrg, all previously known vags and vrgs were correctly assigned as such, and the microarray analyses identified several new vags and vrgs, including genes coding for putative autotransporters, two-component systems, extracellular sigma factors, the adenylate cyclase accessory genes cyaBDE, and two genes coding for components of a type III secretion system. For most of the new vrgs and vags the results of the microarray analyses were confirmed by RT-PCR analysis and/or lacZfusions. The degree of regulation and modulation varied between genes, and showed a continuum from strongly BvgA/S-activated genes to strongly BvgA/S-repressed genes. The microarray analyses also led to the identification of a subset of vags and vrgs that are differentially regulated and modulated by MgSO(4) or nicotinic acid, indicating that these genes may be targets for multiple regulatory circuits. For example, the expression of bilA, a gene predicted to encode an intimin-like protein, was found to be activated by BvgA/S and up-modulated by nicotinic acid. Furthermore, surprisingly, in the strain analysed here, which produces only type 2 fimbriae, the fim3 gene was identified as a vrg, while fim2 was confirmed to be a vag.

  5. Context Specific and Differential Gene Co-expression Networks via Bayesian Biclustering

    PubMed Central

    McDowell, Ian C.; Zhao, Shiwen; Brown, Christopher D.; Engelhardt, Barbara E.

    2016-01-01

    Identifying latent structure in high-dimensional genomic data is essential for exploring biological processes. Here, we consider recovering gene co-expression networks from gene expression data, where each network encodes relationships between genes that are co-regulated by shared biological mechanisms. To do this, we develop a Bayesian statistical model for biclustering to infer subsets of co-regulated genes that covary in all of the samples or in only a subset of the samples. Our biclustering method, BicMix, allows overcomplete representations of the data, computational tractability, and joint modeling of unknown confounders and biological signals. Compared with related biclustering methods, BicMix recovers latent structure with higher precision across diverse simulation scenarios as compared to state-of-the-art biclustering methods. Further, we develop a principled method to recover context specific gene co-expression networks from the estimated sparse biclustering matrices. We apply BicMix to breast cancer gene expression data and to gene expression data from a cardiovascular study cohort, and we recover gene co-expression networks that are differential across ER+ and ER- samples and across male and female samples. We apply BicMix to the Genotype-Tissue Expression (GTEx) pilot data, and we find tissue specific gene networks. We validate these findings by using our tissue specific networks to identify trans-eQTLs specific to one of four primary tissues. PMID:27467526

  6. Differential Sensitivity of Target Genes to Translational Repression by miR-17~92

    PubMed Central

    Jin, Hyun Yong; Oda, Hiroyo; Chen, Pengda; Kang, Seung Goo; Valentine, Elizabeth; Liao, Lujian; Zhang, Yaoyang; Gonzalez-Martin, Alicia; Shepherd, Jovan; Head, Steven R.; Kim, Pyeung-Hyeun; Fu, Guo; Liu, Wen-Hsien; Han, Jiahuai

    2017-01-01

    MicroRNAs (miRNAs) are thought to exert their functions by modulating the expression of hundreds of target genes and each to a small degree, but it remains unclear how small changes in hundreds of target genes are translated into the specific function of a miRNA. Here, we conducted an integrated analysis of transcriptome and translatome of primary B cells from mutant mice expressing miR-17~92 at three different levels to address this issue. We found that target genes exhibit differential sensitivity to miRNA suppression and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA under physiological conditions. Transgenic expression and deletion of the same miRNA gene regulate largely distinct sets of target genes. miR-17~92 controls target gene expression mainly through translational repression and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide molecular insights into a model in which miRNAs exert their specific functions through a small number of key target genes. PMID:28241004

  7. Xyloglucan endotransglucosylase/hydrolase genes in cucumber (Cucumis sativus) - differential expression during somatic embryogenesis.

    PubMed

    Malinowski, Robert; Filipecki, Marcin; Tagashira, Norikazu; Wiśniewska, Anita; Gaj, Paweł; Plader, Wojciech; Malepszy, Stefan

    2004-04-01

    Defined changes in the cell wall directed by many proteins accompany every morphogenetic process in plants. Xyloglucan endotransglucosylase/hydrolase proteins (XTH; EC 2.4.1.207) have the potential to modify the hemicellulose matrix within the cell wall. Cs-XTH1 and Cs-XTH3 genes, which encode XTH proteins, were found among numerous genes that are differentially expressed after the induction of cucumber somatic embryogenesis. The expression of these genes increased during somatic embryogenesis. The Cs-XTH1 gene was localized on the second chromosome near the centromere region, whereas Cs-XTH3 was found in the middle of the fifth chromosome's longer arm. Northern blot hybridization showed that both genes were preferentially expressed in roots. We also observed higher accumulation of both transcripts in somatic embryos than in the proembryogenic mass. The localization of mRNA by in situ hybridization revealed that the Cs-XTH1 transcripts were largely accumulated in the presumptive cotyledon primordia of somatic embryos. The XTH gene family consists of a number of genes with a high degree of structural similarity. Screening a cucumber genomic library has identified other members of this gene family. The intron/exon structure, sequence similarities and the close chromosomal distance between some members suggest their common evolutionary origin. The involvement of XTH-related genes in somatic embryo formation is discussed.

  8. Identification of Differentially Expressed Gene after Femoral Fracture via Microarray Profiling

    PubMed Central

    Zhong, Donggen

    2014-01-01

    We aimed to investigate differentially expressed genes (DEGs) in different stages after femoral fracture based on rat models, providing the basis for the treatment of sport-related fractures. Gene expression data GSE3298 was downloaded from Gene Expression Omnibus (GEO), including 16 chips. All femoral fracture samples were classified into earlier fracture stage and later fracture stage. Total 87 DEGs simultaneously occurred in two stages, of which 4 genes showed opposite expression tendency. Out of the 4 genes, Rest and Cst8 were hub nodes in protein-protein interaction (PPI) network. The GO (Gene Ontology) function enrichment analysis verified that nutrition supply related genes were enriched in the earlier stage and neuron growth related genes were enriched in the later stage. Calcium signaling pathway was the most significant pathway in earlier stage; in later stage, DEGs were enriched into 2 neurodevelopment-related pathways. Analysis of Pearson's correlation coefficient showed that a total of 3,300 genes were significantly associated with fracture time, none of which was overlapped with identified DEGs. This study suggested that Rest and Cst8 might act as potential indicators for fracture healing. Calcium signaling pathway and neurodevelopment-related pathways might be deeply involved in bone healing after femoral fracture. PMID:25110652

  9. Transcriptome-based gene expression profiling identifies differentially expressed genes critical for salt stress response in radish (Raphanus sativus L.).

    PubMed

    Sun, Xiaochuan; Xu, Liang; Wang, Yan; Luo, Xiaobo; Zhu, Xianwen; Kinuthia, Karanja Benard; Nie, Shanshan; Feng, Haiyang; Li, Chao; Liu, Liwang

    2016-02-01

    Transcriptome-based gene expression analysis identifies many critical salt-responsive genes in radish and facilitates further dissecting the molecular mechanism underlying salt stress response. Salt stress severely impacts plant growth and development. Radish, a moderately salt-sensitive vegetable crop, has been studied for decades towards the physiological and biochemical performances under salt stress. However, no systematic study on isolation and identification of genes involved in salt stress response has been performed in radish, and the molecular mechanism governing this process is still indistinct. Here, the RNA-Seq technique was applied to analyze the transcriptomic changes on radish roots treated with salt (200 mM NaCl) for 48 h in comparison with those cultured in normal condition. Totally 8709 differentially expressed genes (DEGs) including 3931 up- and 4778 down-regulated genes were identified. Functional annotation analysis indicated that many genes could be involved in several aspects of salt stress response including stress sensing and signal transduction, osmoregulation, ion homeostasis and ROS scavenging. The association analysis of salt-responsive genes and miRNAs exhibited that 36 miRNA-mRNA pairs had negative correlationship in expression trends. Reverse-transcription quantitative PCR (RT-qPCR) analysis revealed that the expression profiles of DEGs were in line with results from the RNA-Seq analysis. Furthermore, the putative model of DEGs and miRNA-mediated gene regulation was proposed to elucidate how radish sensed and responded to salt stress. This study represents the first comprehensive transcriptome-based gene expression profiling under salt stress in radish. The outcomes of this study could facilitate further dissecting the molecular mechanism underlying salt stress response and provide a valuable platform for further genetic improvement of salt tolerance in radish breeding programs.

  10. Differential expression of genes and proteins associated with wool follicle cycling.

    PubMed

    Liu, Nan; Li, Hegang; Liu, Kaidong; Yu, Juanjuan; Cheng, Ming; De, Wei; Liu, Jifeng; Shi, Shuyan; He, Yanghua; Zhao, Jinshan

    2014-08-01

    Sheep are valuable resources for the wool industry. Wool growth of Aohan fine wool sheep has cycled during different seasons in 1 year. Therefore, identifying genes that control wool growth cycling might lead to ways for improving the quality and yield of fine wool. In this study, we employed Agilent sheep gene expression microarray and proteomic technology to compare the gene expression patterns of the body side skins at August and December time points in Aohan fine wool sheep (a Chinese indigenous breed). Microarray study revealed that 2,223 transcripts were differentially expressed, including 1,162 up-regulated and 1,061 down-regulated transcripts, comparing body side skin at the August time point to the December one (A/D) in Aohan fine wool sheep. Then seven differentially expressed genes were selected to validated the reliability of the gene chip data. The majority of the genes possibly related to follicle development and wool growth could be assigned into the categories including regulation of receptor binding, extracellular region, protein binding and extracellular space. Proteomic study revealed that 84 protein spots showed significant differences in expression levels. Of the 84, 63 protein spots were upregulated and 21 were downregulated in A/D. Finally, 55 protein points were determined through MALDI-TOF/MS analyses. Furthermore, the regulation mechanism of hair follicle might resemble that of fetation.

  11. Aberrant expression of posterior HOX genes in well differentiated histotypes of thyroid cancers.

    PubMed

    Cantile, Monica; Scognamiglio, Giosuè; La Sala, Lucia; La Mantia, Elvira; Scaramuzza, Veronica; Valentino, Elena; Tatangelo, Fabiana; Losito, Simona; Pezzullo, Luciano; Chiofalo, Maria Grazia; Fulciniti, Franco; Franco, Renato; Botti, Gerardo

    2013-11-01

    Molecular etiology of thyroid cancers has been widely studied, and several molecular alterations have been identified mainly associated with follicular and papillary histotypes. However, the molecular bases of the complex pathogenesis of thyroid carcinomas remain poorly understood. HOX genes regulate normal embryonic development, cell differentiation and other critical processes in eukaryotic cell life. Several studies have shown that HOX genes play a role in neoplastic transformation of several human tissues. In particular, the genes belonging to HOX paralogous group 13 seem to hold a relevant role in both tumor development and progression. We have identified a significant prognostic role of HOX D13 in pancreatic cancer and we have recently showed the strong and progressive over-expression of HOX C13 in melanoma metastases and deregulation of HOX B13 expression in bladder cancers. In this study we have investigated, by immunohistochemisty and quantitative Real Time PCR, the HOX paralogous group 13 genes/proteins expression in thyroid cancer evolution and progression, also evaluating its ability to discriminate between main histotypes. Our results showed an aberrant expression, both at gene and protein level, of all members belonging to paralogous group 13 (HOX A13, HOX B13, HOX C13 and HOX D13) in adenoma, papillary and follicular thyroid cancers samples. The data suggest a potential role of HOX paralogous group 13 genes in pathogenesis and differential diagnosis of thyroid cancers.

  12. HIVed, a knowledgebase for differentially expressed human genes and proteins during HIV infection, replication and latency

    PubMed Central

    Li, Chen; Ramarathinam, Sri H.; Revote, Jerico; Khoury, Georges; Song, Jiangning; Purcell, Anthony W.

    2017-01-01

    Measuring the altered gene expression level and identifying differentially expressed genes/proteins during HIV infection, replication and latency is fundamental for broadening our understanding of the mechanisms of HIV infection and T-cell dysfunction. Such studies are crucial for developing effective strategies for virus eradication from the body. Inspired by the availability and enrichment of gene expression data during HIV infection, replication and latency, in this study, we proposed a novel compendium termed HIVed (HIV expression database; http://hivlatency.erc.monash.edu/) that harbours comprehensive functional annotations of proteins, whose genes have been shown to be dysregulated during HIV infection, replication and latency using different experimental designs and measurements. We manually curated a variety of third-party databases for structural and functional annotations of the protein entries in HIVed. With the goal of benefiting HIV related research, we collected a number of biological annotations for all the entries in HIVed besides their expression profile, including basic protein information, Gene Ontology terms, secondary structure, HIV-1 interaction and pathway information. We hope this comprehensive protein-centric knowledgebase can bridge the gap between the understanding of differentially expressed genes and the functions of their protein products, facilitating the generation of novel hypotheses and treatment strategies to fight against the HIV pandemic. PMID:28358052

  13. Comparative transcriptional analysis reveals differential gene expression between Sand Daffodil tissues.

    PubMed

    De Felice, Bruna; Manfellotto, Francesco; D'Alessandro, Raffaella; De Castro, Olga; Di Maio, Antonietta; Trifuoggi, Marco

    2013-12-01

    Sand Daffodil (Pancratium maritimum) is a world-wide endangered Amayllidaceae species and represents an important anti-cancer medicinal resource due to alkaloids production. Despite its increasing pharmaceutical importance, there are not molecular resources that can be utilized toward improving genetic traits. In our research, the suppression subtractive hybridization (SSH) method conducted to generate large-scale expressed sequence tags (EST), was designed to identify gene candidates related to the morphological and physiological differences between the two tissues, leaves and bulbs, since lycorine, the main anti-cancer compound, is there synthesized. We focused on identification of transcripts in different tissues from Sand Daffodil using PCR-based suppression SSH to identify genes involved in global pathway control. Sequencing of 2,000 differentially screened clones from the SSH libraries resulted in 136 unigenes. Functional annotation and gene ontology analysis of up-regulated EST libraries showed several known biosynthetic genes and novel transcripts that may be involved in signaling, cellular transport, or metabolism. Real time RT-PCR analysis of a set of 8 candidate genes further confirmed the differential gene expression.

  14. Differential gene expression in fully-grown oocytes between gynogenetic and gonochoristic crucian carps.

    PubMed

    Xie, J; Wen, J J; Chen, B; Gui, J F

    2001-06-13

    Silver crucian carp (Carassius auratus gibelio) is a unique triploid bisexual species that can reproduce by gynogenesis. As all other gynogenetic animals, it keeps its chromosome integrity by inhibiting the first meiosis division (no extrusion of the first pole body). To understand the molecular events governing this reproduction mode, suppression subtractive hybridization was used to identify the genes differentially expressed in fully-grown oocytes of the gynogenetic and gonochoristic crucian carp (gyno-carp and gono-carp). From two specific subtractive cDNA libraries, the clones screened out by dot blots and virtual Northern blots were chosen to clone full-length cDNA by RACE. Four differentially expressed genes were obtained. Two are novel genes and are expressed specifically in the oocytes. The gyno-carp stores much more mRNA of cyclin A2, a new member of the fish A-type cyclin gene, in its fully-grown oocyte than in the gono-carp. The last gene is his