The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

PubMed

Kimura, J; Kimura, M

1987-09-05

The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

PubMed

Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

2015-01-13

Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

PubMed Central

Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

2016-01-01

ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae.

PubMed

Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine; Belyi, Yury

2016-01-01

The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5' untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62-K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62-K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62-K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62-K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62-K70 segment of Rps26 and the 5' untranslated region of mRNA. The data suggested a specific role of the Y62-K70 motif during translation initiation. Here, we report that single-site substitutions

The discovery of potent ribosomal S6 kinase inhibitors by high-throughput screening and structure-guided drug design

PubMed Central

Kalusa, Andrew; Cano, Celine; Travers, Jon; Boxall, Kathy; Chow, Chiau Ling; Burns, Sam; Schmitt, Jessica; Pickard, Lisa; Barillari, Caterina; McAndrew, P. Craig; Clarke, Paul A.; Linardopoulos, Spiros; Griffin, Roger J.; Aherne, G. Wynne; Raynaud, Florence I.; Workman, Paul; Jones, Keith; van Montfort, Rob L.M.

2013-01-01

The ribosomal P70 S6 kinases play a crucial role in PI3K/mTOR regulated signalling pathways and are therefore potential targets for the treatment of a variety of diseases including diabetes and cancer. In this study we describe the identification of three series of chemically distinct S6K1 inhibitors. In addition, we report a novel PKA-S6K1 chimeric protein with five mutations in or near its ATP-binding site, which was used to determine the binding mode of two of the three inhibitor series, and provided a robust system to aid the optimisation of the oxadiazole-substituted benzimidazole inhibitor series. We show that the resulting oxadiazole-substituted aza-benzimidazole is a potent and ligand efficient S6 kinase inhibitor, which blocks the phosphorylation of RPS6 at Ser235/236 in TSC negative HCV29 human bladder cancer cells by inhibiting S6 kinase activity and thus provides a useful tool compound to investigate the function of S6 kinases. PMID:24072592

Cryo-EM structure of the spinach chloroplast ribosome reveals the location of plastid-specific ribosomal proteins and extensions

PubMed Central

Graf, Michael; Arenz, Stefan; Huter, Paul; Dönhöfer, Alexandra; Nováček, Jiří

2017-01-01

Abstract Ribosomes are the protein synthesizing machines of the cell. Recent advances in cryo-EM have led to the determination of structures from a variety of species, including bacterial 70S and eukaryotic 80S ribosomes as well as mitoribosomes from eukaryotic mitochondria, however, to date high resolution structures of plastid 70S ribosomes have been lacking. Here we present a cryo-EM structure of the spinach chloroplast 70S ribosome, with an average resolution of 5.4 Å for the small 30S subunit and 3.6 Å for the large 50S ribosomal subunit. The structure reveals the location of the plastid-specific ribosomal proteins (RPs) PSRP1, PSRP4, PSRP5 and PSRP6 as well as the numerous plastid-specific extensions of the RPs. We discover many features by which the plastid-specific extensions stabilize the ribosome via establishing additional interactions with surrounding ribosomal RNA and RPs. Moreover, we identify a large conglomerate of plastid-specific protein mass adjacent to the tunnel exit site that could facilitate interaction of the chloroplast ribosome with the thylakoid membrane and the protein-targeting machinery. Comparing the Escherichia coli 70S ribosome with that of the spinach chloroplast ribosome provides detailed insight into the co-evolution of RP and rRNA. PMID:27986857

Type I allergy to elderberry (Sambucus nigra) is elicited by a 33.2 kDa allergen with significant homology to ribosomal inactivating proteins.

PubMed

Förster-Waldl, E; Marchetti, M; Schöll, I; Focke, M; Radauer, C; Kinaciyan, T; Nentwich, I; Jäger, S; Schmid, E R; Boltz-Nitulescu, G; Scheiner, O; Jensen-Jarolim, E

2003-12-01

Patients suffering from allergic rhinoconjunctivitis and dyspnoea during summer may exhibit these symptoms after contact with flowers or dietary products of the elderberry tree Sambucus nigra. Patients with a history of summer hayfever were tested in a routine setting for sensitization to elderberry. Nine patients having allergic symptoms due to elderberry and specific sensitization were investigated in detail. We studied the responsible allergens in extracts from elderberry pollen, flowers and berries, and investigated cross-reactivity with allergens from birch, grass and mugwort. Sera from patients were tested for IgE reactivity to elderberry proteins by one-dimensional (1D) and 2D electrophoresis/immunoblotting. Inhibition studies with defined allergens and elderberry-specific antibodies were used to evaluate cross-reactivity. The main elderberry allergen was purified by gel filtration and reversed-phase HPLC, and subjected to mass spectrometry. The in-gel-digested allergen was analysed by the MS/MS sequence analysis and peptide mapping. The N-terminal sequence of the predominant allergen was analysed. 0.6% of 3668 randomly tested patients showed positive skin prick test and/or RAST to elderberry. IgE in patients' sera detected a predominant allergen of 33.2 kDa in extracts from elderberry pollen, flowers and berries, with an isoelectric point at pH 7.0. Pre-incubation of sera with extracts from birch, mugwort or grass pollen rendered insignificant or no inhibition of IgE binding to blotted elderberry proteins. Specific mouse antisera reacted exclusively with proteins from elderberry. N-terminal sequence analysis, as well as MS/MS spectrometry of the purified elderberry allergen, indicated homology with ribosomal inactivating proteins (RIPs). We present evidence that the elderberry plant S. nigra harbours allergenic potency. Independent methodologies argue for a significant homology of the predominant 33.2 kDa elderberry allergen with homology to RIPs. We

Purification and characterization of charantin, a napin-like ribosome-inactivating peptide from bitter gourd (Momordica charantia) seeds.

PubMed

Parkash, A; Ng, T B; Tso, W W

2002-05-01

A peptide designated charantin, with a molecular mass of 9.7 kDa, was isolated from bitter gourd seeds. The procedure comprised affinity chromatography on Affi-gel blue gel, ion-exchange chromatography on Mono S and gel filtration on Superdex 75. The N-terminal sequence of charantin exhibited marked similarity to that of the 7.8-kDa napin-like peptide previously isolated from bitter gourd seeds. Charantin inhibited cell-free translation in a rabbit reticulocyte lysate system with an IC50 of 400 nm, a potency lower than that of the previously reported small ribosome-inactivating protein gamma-momorcharin (IC50 = 55 nm) which also exhibited an abundance of arginine and glutamate/glutamine residues. Charantin reacted positively in the N-glycosidase assay, yielding a band similar to that formed by the small ribosome-inactivating proteins gamma-momorcharin and luffin S.

[C-terminal fragment of ribosomal protein S15 is located at the decoding site of the human ribosome].

PubMed

Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'iaminova, A G; Karpova, G G

2008-01-01

Protein S15 is a characteristic component of the mammalian 80S ribosome that neighbors mRNA codon at the decoding site and the downstream triplets. In this study we determined S15 protein fragments located close to mRNA positions +4 to +12 with respect to the first nucleotide of the P site codon on the human ribosome. For cross-linking to ribosomal protein S15, a set of mRNA was used that contained triplet UUU/UUC at the 5'-termini and a perfluorophenyl azide-modified uridine in position 3' of this triplet. The locations of mRNA analogues on the ribosome were governed by tRNAPhe cognate to the UUU/UUC triplet targeted to the P site. Cross-linked S15 protein was isolated from the irradiated with mild UV light complexes of 80S ribosomes with tRNAPhe and mRNA analogues with subsequent cleavage with CNBr that splits polypeptide chain after methionines. Analysis of modified oligopeptides resulted from the cleavage revealed that in all cases cross-linking site was located in C-terminal fragment 111-145 of protein S15 indicating that this fragment is involved in formation of decoding site of the eukaryotic ribosome.

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

PubMed

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

Mice deficient in ribosomal protein S6 phosphorylation suffer from muscle weakness that reflects a growth defect and energy deficit.

PubMed

Ruvinsky, Igor; Katz, Maximiliano; Dreazen, Avigail; Gielchinsky, Yuval; Saada, Ann; Freedman, Nanette; Mishani, Eyal; Zimmerman, Gabriel; Kasir, Judith; Meyuhas, Oded

2009-05-19

Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-)), are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET) and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/-) muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a) a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b) a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG) in the muscle. This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar role has been assigned for ribosomal protein S6 kinase 1, even though it regulates

Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae.

PubMed

Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

2018-05-18

The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.

Escherichia coli Ribosomal Protein S1 Unfolds Structured mRNAs Onto the Ribosome for Active Translation Initiation

PubMed Central

Duval, Mélodie; Korepanov, Alexey; Fuchsbauer, Olivier; Fechter, Pierre; Haller, Andrea; Fabbretti, Attilio; Choulier, Laurence; Micura, Ronald; Klaholz, Bruno P.; Romby, Pascale; Springer, Mathias; Marzi, Stefano

2013-01-01

Regulation of translation initiation is well appropriate to adapt cell growth in response to stress and environmental changes. Many bacterial mRNAs adopt structures in their 5′ untranslated regions that modulate the accessibility of the 30S ribosomal subunit. Structured mRNAs interact with the 30S in a two-step process where the docking of a folded mRNA precedes an accommodation step. Here, we used a combination of experimental approaches in vitro (kinetic of mRNA unfolding and binding experiments to analyze mRNA–protein or mRNA–ribosome complexes, toeprinting assays to follow the formation of ribosomal initiation complexes) and in vivo (genetic) to monitor the action of ribosomal protein S1 on the initiation of structured and regulated mRNAs. We demonstrate that r-protein S1 endows the 30S with an RNA chaperone activity that is essential for the docking and the unfolding of structured mRNAs, and for the correct positioning of the initiation codon inside the decoding channel. The first three OB-fold domains of S1 retain all its activities (mRNA and 30S binding, RNA melting activity) on the 30S subunit. S1 is not required for all mRNAs and acts differently on mRNAs according to the signals present at their 5′ ends. This work shows that S1 confers to the ribosome dynamic properties to initiate translation of a large set of mRNAs with diverse structural features. PMID:24339747

Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice

PubMed Central

Smith, Mark A.; Katsouri, Loukia; Irvine, Elaine E.; Hankir, Mohammed K.; Pedroni, Silvia M.A.; Voshol, Peter J.; Gordon, Matthew W.; Choudhury, Agharul I.; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J.

2015-01-01

Summary Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. PMID:25865886

Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae

PubMed Central

Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

2018-01-01

Abstract The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits. PMID:29788267

Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.

PubMed

Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte

2018-06-27

All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.

Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice.

PubMed

Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun

2016-07-01

Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.

IL-3 Maintains Activation of the p90S6K/RPS6 Pathway and Increases Translation in Human Eosinophils.

PubMed

Esnault, Stephane; Kelly, Elizabeth A B; Shen, Zhong-Jian; Johansson, Mats W; Malter, James S; Jarjour, Nizar N

2015-09-15

IL-5 is a major therapeutic target to reduce eosinophilia. However, all of the eosinophil-activating cytokines, such as IL-5, IL-3, and GM-CSF, are typically present in atopic diseases, including allergic asthma. As a result of the functional redundancy of these three cytokines on eosinophils and the loss of IL-5R on airway eosinophils, it is important to take IL-3 and GM-CSF into account to efficiently reduce tissue eosinophil functions. Moreover, these three cytokines signal through a common β-chain receptor but yet differentially affect protein production in eosinophils. Notably, the increased ability of IL-3 to induce the production of proteins, such as semaphorin-7A, without affecting mRNA levels suggests a unique influence of IL-3 on translation. The purpose of this study was to identify the mechanisms by which IL-3 distinctively affects eosinophil function compared with IL-5 and GM-CSF, with a focus on protein translation. Peripheral blood eosinophils were used to study intracellular signaling and protein translation in cells activated with IL-3, GM-CSF, or IL-5. We establish that, unlike GM-CSF or IL-5, IL-3 triggers prolonged signaling through activation of ribosomal protein S6 (RPS6) and the upstream kinase 90-kDa ribosomal S6 kinase (p90S6K). Blockade of p90S6K activation inhibited phosphorylation of RPS6 and IL-3-enhanced semaphorin-7A translation. Furthermore, in an allergen-challenged environment, in vivo phosphorylation of RPS6 and p90S6K was enhanced in human airway compared with circulating eosinophils. Our findings provide new insights into the mechanisms underlying differential activation of eosinophils by IL-3, GM-CSF, and IL-5. These observations identify IL-3 and its downstream intracellular signals as novel targets that should be considered to modulate eosinophil functions. Copyright © 2015 by The American Association of Immunologists, Inc.

p70 ribosomal S6 kinase regulates subpleural fibrosis following transforming growth factor-α expression in the lung

PubMed Central

Madala, Satish K.; Thomas, George; Edukulla, Ramakrishna; Davidson, Cynthia; Schmidt, Stephanie; Schehr, Angelica

2015-01-01

The p70 ribosomal S6 kinase (S6K) is a downstream substrate that is phosphorylated and activated by the mammalian target of rapamycin complex and regulates multiple cellular processes associated with fibrogenesis. Recent studies demonstrate that aberrant mTORC1-S6K signaling contributes to various pathological conditions, but a direct role in pulmonary fibroproliferation has not been established. Increased phosphorylation of the S6K pathway is detected immediately following transforming growth factor-α (TGF-α) expression in a transgenic model of progressive lung fibrosis. To test the hypothesis that the S6K directly regulates pulmonary fibroproliferative disease we determined the cellular sites of S6K phosphorylation during the induction of fibrosis in the TGF-α model and tested the efficacy of specific pharmacological inhibition of the S6K pathway to prevent and reverse fibrotic disease. Following TGF-α expression increased phosphorylation of the S6K was detected in the airway and alveolar epithelium and the mesenchyme of advanced subpleural fibrotic regions. Specific inhibition of the S6K with the small molecule inhibitor LY-2584702 decreased TGF-α and platelet-derived growth factor-β-induced proliferation of lung fibroblasts in vitro. Administration of S6K inhibitors to TGF-α mice prevented the development of extensive subpleural fibrosis and alterations in lung mechanics, and attenuated the increase in total lung hydroxyproline. S6K inhibition after fibrosis was established attenuated the progression of subpleural fibrosis. Together these studies demonstrate targeting the S6K pathway selectively modifies the progression of pulmonary fibrosis in the subpleural compartment of the lung. PMID:26566903

Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice.

PubMed

Smith, Mark A; Katsouri, Loukia; Irvine, Elaine E; Hankir, Mohammed K; Pedroni, Silvia M A; Voshol, Peter J; Gordon, Matthew W; Choudhury, Agharul I; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J

2015-04-21

Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The putative RNA helicase Dbp6p functionally interacts with Rpl3p, Nop8p and the novel trans-acting Factor Rsa3p during biogenesis of 60S ribosomal subunits in Saccharomyces cerevisiae.

PubMed Central

de la Cruz, Jesús; Lacombe, Thierry; Deloche, Olivier; Linder, Patrick; Kressler, Dieter

2004-01-01

Ribosome biogenesis requires at least 18 putative ATP-dependent RNA helicases in Saccharomyces cerevisiae. To explore the functional environment of one of these putative RNA helicases, Dbp6p, we have performed a synthetic lethal screen with dbp6 alleles. We have previously characterized the nonessential Rsa1p, whose null allele is synthetically lethal with dbp6 alleles. Here, we report on the characterization of the four remaining synthetic lethal mutants, which reveals that Dbp6p also functionally interacts with Rpl3p, Nop8p, and the so-far-uncharacterized Rsa3p (ribosome assembly 3). The nonessential Rsa3p is a predominantly nucleolar protein required for optimal biogenesis of 60S ribosomal subunits. Both Dbp6p and Rsa3p are associated with complexes that most likely correspond to early pre-60S ribosomal particles. Moreover, Rsa3p is co-immunoprecipitated with protA-tagged Dbp6p under low salt conditions. In addition, we have established a synthetic interaction network among factors involved in different aspects of 60S-ribosomal-subunit biogenesis. This extensive genetic analysis reveals that the rsa3 null mutant displays some specificity by being synthetically lethal with dbp6 alleles and by showing some synthetic enhancement with the nop8-101 and the rsa1 null allele. PMID:15126390

Ribosomal proteins L7 and L8 function in concert with six A3 assembly factors to propagate assembly of domains I and II of 25S rRNA in yeast 60S ribosomal subunits

PubMed Central

Jakovljevic, Jelena; Ohmayer, Uli; Gamalinda, Michael; Talkish, Jason; Alexander, Lisa; Linnemann, Jan; Milkereit, Philipp; Woolford, John L.

2012-01-01

Ribosome biogenesis is a complex multistep process that involves alternating steps of folding and processing of pre-rRNAs in concert with assembly of ribosomal proteins. Recently, there has been increased interest in the roles of ribosomal proteins in eukaryotic ribosome biogenesis in vivo, focusing primarily on their function in pre-rRNA processing. However, much less is known about participation of ribosomal proteins in the formation and rearrangement of preribosomal particles as they mature to functional subunits. We have studied ribosomal proteins L7 and L8, which are required for the same early steps in pre-rRNA processing during assembly of 60S subunits but are located in different domains within ribosomes. Depletion of either leads to defects in processing of 27SA3 to 27SB pre-rRNA and turnover of pre-rRNAs destined for large ribosomal subunits. A specific subset of proteins is diminished from these residual assembly intermediates: six assembly factors required for processing of 27SA3 pre-rRNA and four ribosomal proteins bound to domain I of 25S and 5.8S rRNAs surrounding the polypeptide exit tunnel. In addition, specific sets of ribosomal proteins are affected in each mutant: In the absence of L7, proteins bound to domain II, L6, L14, L20, and L33 are greatly diminished, while proteins L13, L15, and L36 that bind to domain I are affected in the absence of L8. Thus, L7 and L8 might establish RNP structures within assembling ribosomes necessary for the stable association and function of the A3 assembly factors and for proper assembly of the neighborhoods containing domains I and II. PMID:22893726

Synaptically Driven Phosphorylation of Ribosomal Protein S6 Is Differentially Regulated at Active Synapses versus Dendrites and Cell Bodies by MAPK and PI3K/mTOR Signaling Pathways

ERIC Educational Resources Information Center

Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald

2017-01-01

High-frequency stimulation of the medial perforant path triggers robust phosphorylation of ribosomal protein S6 (rpS6) in activated dendritic domains and granule cell bodies. Here we dissect the signaling pathways responsible for synaptically driven rpS6 phosphorylation in the dentate gyrus using pharmacological agents to inhibit PI3-kinase/mTOR…

[Protein kinase A inhibitor H-89 blocks polyploidization of SP600125-induced CMK cells by regulating phosphorylation of ribosomal protein S6 kinase 1].

PubMed

Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu

2016-10-01

Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.

Effects of the 1- N-(4-Amino-2 S-hydroxybutyryl) and 6'- N-(2-Hydroxyethyl) Substituents on Ribosomal Selectivity, Cochleotoxicity, and Antibacterial Activity in the Sisomicin Class of Aminoglycoside Antibiotics.

PubMed

Sonousi, Amr; Sarpe, Vikram A; Brilkova, Margarita; Schacht, Jochen; Vasella, Andrea; Böttger, Erik C; Crich, David

2018-05-10

Syntheses of the 6'- N-(2-hydroxyethyl) and 1- N-(4-amino-2 S-hydroxybutyryl) derivatives of the 4,6-aminoglycoside sisomicin and that of the doubly modified 1- N-(4-amino-2 S-hydroxybutyryl)-6'- N-(2-hydroxyethyl) derivative known as plazomicin are reported together with their antibacterial and antiribosomal activities and selectivities. The 6'- N-(2-hydroxyethyl) modification results in a moderate increase in prokaryotic/eukaryotic ribosomal selectivity, whereas the 1- N-(4-amino-2 S-hydroxybutyryl) modification has the opposite effect. When combined in plazomicin, the effects of the two groups on ribosomal selectivity cancel each other out, leading to the prediction that plazomicin will exhibit ototoxicity comparable to those of the parent and the current clinical aminoglycoside antibiotics gentamicin and tobramycin, as borne out by ex vivo studies with mouse cochlear explants. The 6'- N-(2-hydroxyethyl) modification restores antibacterial activity in the presence of the AAC(6') aminoglycoside-modifying enzymes, while the 1- N-(4-amino-2 S-hydroxybutyryl) modification overcomes resistance to the AAC(2') class but is still affected to some extent by the AAC(3) class. Neither modification is able to circumvent the ArmA ribosomal methyltransferase-induced aminoglycoside resistance. The use of phenyltriazenyl protection for the secondary amino group of sisomicin facilitates the synthesis of each derivative and their characterization through the provision of sharp NMR spectra for all intermediates.

Folding behavior of ribosomal protein S6 studied by modified Go¯ -like model

NASA Astrophysics Data System (ADS)

Wu, L.; Zhang, J.; Wang, J.; Li, W. F.; Wang, W.

2007-03-01

Recent experimental and theoretical studies suggest that, although topology is the determinant factor in protein folding, especially for small single-domain proteins, energetic factors also play an important role in the folding process. The ribosomal protein S6 has been subjected to intensive studies. A radical change of the transition state in its circular permutants has been observed, which is believed to be caused by a biased distribution of contact energies. Since the simplistic topology-only Gō -like model is not able to reproduce such an observation, we modify the model by introducing variable contact energies between residues based on their physicochemical properties. The modified Gō -like model can successfully reproduce the Φ -value distributions, folding nucleus, and folding pathways of both the wild-type and circular permutants of S6. Furthermore, by comparing the results of the modified and the simplistic models, we find that the hydrophobic effect constructs the major force that balances the loop entropies. This may indicate that nature maintains the folding cooperativity of this protein by carefully arranging the location of hydrophobic residues in the sequence. Our study reveals a strategy or mechanism used by nature to get out of the dilemma when the native structure, possibly required by biological function, conflicts with folding cooperativity. Finally, the possible relationship between such a design of nature and amyloidosis is also discussed.

Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

PubMed Central

Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

1978-01-01

A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

Factors Affecting Nuclear Export of the 60S Ribosomal Subunit In Vivo

PubMed Central

Stage-Zimmermann, Tracy; Schmidt, Ute; Silver, Pamela A.

2000-01-01

In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ∼45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b–GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b–GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b–GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b–GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120. PMID:11071906

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Translational control of ribosomal protein S15.

PubMed

Portier, C; Philippe, C; Dondon, L; Grunberg-Manago, M; Ebel, J P; Ehresmann, B; Ehresmann, C

1990-08-27

The expression of ribosomal protein S15 is shown to be translationally and negatively autocontrolled using a fusion within a reporter gene. Isolation and characterization of several deregulated mutants indicate that the regulatory site (the translational operator site) overlaps the ribosome loading site of the S15 messenger. In this region, three domains, each exhibiting a stem-loop structure, were determined using chemical and enzymatic probes. The most downstream hairpin carries the Shine-Dalgarno sequence and the initiation codon. Genetic and structural data derived from mutants constructed by site-directed mutagenesis show that the operator is a dynamic structure, two domains of which can form a pseudoknot. Binding of S15 to these two domains suggests that the pseudoknot could be stabilized by S15. A model is presented in which two alternative structures would explain the molecular basis of the S15 autocontrol.

sORFs.org: a repository of small ORFs identified by ribosome profiling.

PubMed

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-04

With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

sORFs.org: a repository of small ORFs identified by ribosome profiling

PubMed Central

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-01

With the advent of ribosome profiling, a next generation sequencing technique providing a “snap-shot’’ of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these ‘sORFs’, indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729

Hypophosphorylation of Ribosomal Protein S6 is a Molecular Mechanism Underlying Ischemic Tolerance Induced by either Hibernation or Preconditioning

PubMed Central

Miyake, Shin-ichi; Wakita, Hideaki; Bernstock, Joshua D.; Castri, Paola; Ruetzler, Christl; Miyake, Junko; Lee, Yang-ja; Hallenbeck, John M.

2015-01-01

Thirteen-lined ground squirrels (Ictidomys tridecemlineatus) have an extraordinary capacity to withstand prolonged and profound reductions of blood flow and oxygen delivery to brain without incurring any cellular damage. As such, the hibernation torpor of I. tridecemlineatus provides a valuable model of tolerance to ischemic stress. Herein, we report that during hibernation torpor, a marked reduction in the phosphorylation of the ribosomal protein S6 (rpS6) occurs within the brains of I. tridecemlineatus. Of note, rpS6 phosphorylation was shown to increase in the brains of rats that underwent an occlusion of the middle cerebral artery. However, such an increase was attenuated after the implementation of an ischemic preconditioning paradigm. In addition, cultured cortical neurons treated with the rpS6 kinase (S6K) inhibitors, D-glucosamine or PF4708671, displayed a decrease in rpS6 phosphorylation and a subsequent increase in tolerance to oxygen/glucose deprivation, an in vitro model of ischemic stroke. Collectively, such evidence suggests that the down regulation of rpS6 signal transduction may account for a substantial part of the observed increase in cellular tolerance to brain ischemia that occurs during hibernation torpor and after ischemic preconditioning. Further identification and characterization of the mechanisms used by hibernating species to increase ischemic tolerance may eventually clarify how the loss of homeostatic control that occurs during and after cerebral ischemia in the clinic can ultimately be minimized and/or prevented. PMID:26375300

Reduced Ribosomal Protein S6 Phosphorylation following Progressive Resistance Exercise in Growing Adolescent Rats

PubMed Central

Hellyer, Nathan J.; Nokleby, Jessica J.; Thicke, Bethany M.; Zhan, Wen-Zhi; Sieck, Gary C.; Mantilla, Carlos B.

2011-01-01

The purpose of the present study was to investigate moderate intensity progressive resistance exercise (PRE) in growing adolescent rats and its effect on muscle hypertrophy (defined as an increase in fiber cross-sectional area). We hypothesized that in adolescent animals moderate intensity PRE would increase: 1) fiber cross-sectional area (CSA); 2) myosin heavy chain (MyHC) content; and 3) expression and phosphorylation of cell signaling molecules involved in translational regulation, compared to age-matched sedentary controls (SED). In the PRE group, three-week old male rats were trained to climb a vertical ladder as a mode of PRE training such that by 10 weeks, all animals in the PRE group had progressed to carry an additional 80% of body weight per climb. In agreement with our hypotheses, we observed that 10 weeks of moderate PRE in adolescent animals was sufficient to increase CSA of muscle fibers and increase MyHC content. Average muscle fiber CSA increased by greater than 10% and total MyHC content increased by 35% (p<0.05) in the PRE group compared to SED animals. Concurrently, we investigated sustained changes in the expression and phosphorylation of key signaling molecules that are previously identified regulators of hypertrophy in adult animal models. Contrary to our hypotheses, expression and phosphorylation of the translational regulators mTOR and Akt were not increased in the PRE group. In addition, we observed that the ratio of phosphorylated-to-unphosphorylated ribosomal protein S6 (rpS6) was reduced over six-fold in PRE animals (p<0.05) and total rpS6 protein levels were unchanged between PRE and sedentary animals (p>0.05). We conclude that moderate intensity PRE is sufficient to induce muscle hypertrophy in adolescent animals while the signaling mechanisms associated with muscle hypertrophy may differ between growing adolescents and adults. PMID:22614147

The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits

PubMed Central

Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

2016-01-01

The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

PubMed

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Purification, characterization and crystallization of the human 80S ribosome

PubMed Central

Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

2014-01-01

Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

Ribosomal RNA and ribosomal proteins in corynebacteria.

PubMed

Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

2003-09-04

Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

PubMed

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

Sequential protein association with nascent 60S ribosomal particles.

PubMed

Saveanu, Cosmin; Namane, Abdelkader; Gleizes, Pierre-Emmanuel; Lebreton, Alice; Rousselle, Jean-Claude; Noaillac-Depeyre, Jacqueline; Gas, Nicole; Jacquier, Alain; Fromont-Racine, Micheline

2003-07-01

Ribosome biogenesis in eukaryotes depends on the coordinated action of ribosomal and nonribosomal proteins that guide the assembly of preribosomal particles. These intermediate particles follow a maturation pathway in which important changes in their protein composition occur. The mechanisms involved in the coordinated assembly of the ribosomal particles are poorly understood. We show here that the association of preribosomal factors with pre-60S complexes depends on the presence of earlier factors, a phenomenon essential for ribosome biogenesis. The analysis of the composition of purified preribosomal complexes blocked in maturation at specific steps allowed us to propose a model of sequential protein association with, and dissociation from, early pre-60S complexes for several preribosomal factors such as Mak11, Ssf1, Rlp24, Nog1, and Nog2. The presence of either Ssf1 or Nog2 in complexes that contain the 27SB pre-rRNA defines novel, distinct pre-60S particles that contain the same pre-rRNA intermediates and that differ only by the presence or absence of specific proteins. Physical and functional interactions between Rlp24 and Nog1 revealed that the assembly steps are, at least in part, mediated by direct protein-protein interactions.

The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.

PubMed

Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

2016-09-19

The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul

2009-06-01

Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultantmore » fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.« less

BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo

PubMed Central

Sapkota, Gopal P.; Cummings, Lorna; Newell, Felicity S.; Armstrong, Christopher; Bain, Jennifer; Frodin, Morten; Grauert, Matthias; Hoffmann, Matthias; Schnapp, Gisela; Steegmaier, Martin; Cohen, Philip; Alessi, Dario R.

2006-01-01

Hormones and growth factors induce the activation of a number of protein kinases that belong to the AGC subfamily, including isoforms of PKA, protein kinase B (also known as Akt), PKC, S6K p70 (ribosomal S6 kinase), RSK (p90 ribosomal S6 kinase) and MSK (mitogen- and stress-activated protein kinase), which then mediate many of the physiological processes that are regulated by these extracellular agonists. It can be difficult to assess the individual functions of each AGC kinase because their substrate specificities are similar. Here we describe the small molecule BI-D1870, which inhibits RSK1, RSK2, RSK3 and RSK4 in vitro with an IC50 of 10–30 nM, but does not signi-ficantly inhibit ten other AGC kinase members and over 40 other protein kinases tested at 100-fold higher concentrations. BI-D1870 is cell permeant and prevents the RSK-mediated phorbol ester- and EGF (epidermal growth factor)-induced phosphoryl-ation of glycogen synthase kinase-3β and LKB1 in human embry-onic kidney 293 cells and Rat-2 cells. In contrast, BI-D1870 does not affect the agonist-triggered phosphorylation of substrates for six other AGC kinases. Moreover, BI-D1870 does not suppress the phorbol ester- or EGF-induced phosphorylation of CREB (cAMP-response-element-binding protein), consistent with the genetic evidence indicating that MSK, and not RSK, isoforms mediate the mitogen-induced phosphorylation of this transcription factor. PMID:17040210

Characterization of a phorbol ester-stimulated S6 kinase from MDCK renal epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meier, K.E.; Krebs, E.G.

Increased phosphorylation of S6, a 40S ribosomal subunit protein, is observed in mammalian cells in response to growth factors and phorbol esters. The goal of this study was to identify the S6 kinase that is stimulated by phorbol ester treatment of MDCK cells. MDCK clone D1 cells express high levels of protein kinase C(PKC). PKC and S6 kinase activities were measured following DEAE-Sephacel fractionation of cytosol; this procedure separated the two kinase activities. When confluent MDCK-D1 cells were exposed to 100 nM phorbol 12-myristate 13-acetate (PMA), 95% of the total cellular PKC activity became associated with the particulate fraction withinmore » 1 hour. Cytosolic S6 kinase activity was maximal by 1 hour and then declined thereafter, preceding any detectable loss of total cellular PKC. The PMA-responsive S6 kinase was partially purified from MDCK-D1 cytosol by consecutive steps of DEAE-Sephacel, ammonium sulfate precipitation, Ultrogel AcA 34, heparin-agarose, and Ultrogel AcA 34. The partially-purified enzyme had an apparent molecular size of approximately 80 kDa. In addition to S6, the enzyme phosphorylated synthetic peptides based on the carboxyl terminal sequence of S6. S6 kinase activity utilized ATP but not GTP, and was inhibited by heparin, NaCl, and ..beta..-glycerophosphate. In conclusion, a phorbol ester-stimulated S6 kinase has been partially purified from an epithelial cell line. This kinase is distinct from PKC.« less

Protein-protein interactions within late pre-40S ribosomes.

PubMed

Campbell, Melody G; Karbstein, Katrin

2011-01-20

Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

Cholecystokinin (CCK) stimulates S6 phosphorylation and induced activation of S6 protein kinase in rat pancreatic acini

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, C.; Okabayashi, Y.; Williams, J.

CCK and insulin stimulate pancreatic protein synthesis at a post transcriptional step. To better understand this regulation the authors evaluated the phosphorylation state of ribosomal protein S6 and the presence of a specific S6 protein kinase in pancreatic acini from diabetic rats. Both CCK and insulin increased S6 phosphorylation by up to 400% in intact TSP-labelled acini. The phorbol ester 12-0-tetradecanoylphorbol 13-acetate also stimulated both protein synthesis and S6 phosphorlyation suggesting a role for protein kinase C in mediating the effect of CCK. By contrast, the CaS ionophore ionomycin had no effect on either parameter. Recently, insulin has been shownmore » to activate a unique S6 kinase in various cells. To test for its presence, cytosolic extracts were prepared from acini stimulated with CCK and insulin by homogenization in US -glycerophosphate buffer and assayed for the kinase using el-TSP ATP and rat pancreatic ribosomes followed by SDS-polyacrylamide gel electrophoresis. CCK and insulin both increased S6 kinase activity which required neither CaS or phospholipid. The dose response for CCk was similar to S6 phosphorlyation in the intact acini. TPA did not stimulate the S6 kinase. Thus, CCK may induce S6 phosphorylation both via C kinase and by activation of a unique S6 kinase.« less

The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

PubMed Central

Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.

2013-01-01

Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868

Pseudoknot and translational control in the expression of the S15 ribosomal protein.

PubMed

Bénard, L; Philippe, C; Ehresmann, B; Ehresmann, C; Portier, C

1996-01-01

Translational autocontrol of the expression of the ribosomal protein S15 proceeds through the transitory formation of a pseudoknot. A synopsis of the known data is used to propose a molecular model of the mechanism involved and for the role of the pseudoknot. This latter structure is able to recruit 30S ribosomal subunits to initiate translation, but also to bind S15 and to stop translation by trapping the ribosome on its loading site. Information on the S15 protein recognition of the messenger RNA site was deduced from mutational analyses and chemical probing. A comparison of this messenger site with the S15 ribosomal binding site was conducted by analysing hydroxyl radical footprintings of these two sites. The existence of two subsites in 16S RNA suggests that the ribosomal protein S15 might present either two different binding sites or at least one common subsite. Clues for the presence of a common site between the messenger and 16S RNA are given which cannot rule out that recognition specificity is linked to a few other determinants. Whether these determinants are different or not remains an open question.

Protein-Protein Interactions within Late Pre-40S Ribosomes

PubMed Central

Campbell, Melody G.; Karbstein, Katrin

2011-01-01

Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762

A relevant IgE-reactive 28kDa protein identified from Salsola kali pollen extract by proteomics is a natural degradation product of an integral 47kDa polygalaturonase.

PubMed

Mas, Salvador; Oeo-Santos, Carmen; Cuesta-Herranz, Javier; Díaz-Perales, Araceli; Colás, Carlos; Fernández, Javier; Barber, Domingo; Rodríguez, Rosalía; de Los Ríos, Vivian; Barderas, Rodrigo; Villalba, Mayte

2017-08-01

A highly prevalent IgE-binding protein band of 28kDa is observed when Salsola kali pollen extract is incubated with individual sera from Amaranthaceae pollen sensitized patients. By an immunoproteomic analysis of S. kali pollen extract, we identified this protein band as an allergenic polygalacturonase enzyme. The allergen, named Sal k 6, exhibits a pI of 7.14 and a molecular mass of 39,554.2Da. It presents similarities to Platanaceae, Poaceae, and Cupressaceae allergenic polygalacturonases. cDNA-encoding sequence was subcloned into the pET41b vector and produced in bacteria as a His-tag fusion recombinant protein. The far-UV CD spectrum determined that rSal k 6 was folded. Immunostaining of the S. kali pollen protein extract with a rSal k 6-specific pAb and LC-MS/MS proteomic analyses confirmed the co-existence of the 28kDa band together with an allergenic band of about 47kDa in the pollen extract. Therefore, the 28kDa was assigned as a natural degradation product of the 47kDa integral polygalacturonase. The IgE-binding inhibition to S. kali pollen extract using rSal k 6 as inhibitor showed that signals directed to both protein bands of 28 and 47kDa were completely abrogated. The average prevalence of rSal k 6 among the three populations analyzed was 30%, with values correlating well with the levels of grains/m 3 of Amaranthaceae pollen. Sal k 6 shares IgE epitopes with Oleaceae members (Fraxinus excelsior, Olea europaea and Syringa vulgaris), with IgE-inhibition values ranging from 20% to 60%, respectively. No IgE-inhibition was observed with plant-derived food extracts. Copyright © 2017 Elsevier B.V. All rights reserved.

The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

PubMed

Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

2013-10-17

Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

PubMed

Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

2016-09-27

Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

PubMed Central

Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

2016-01-01

Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.

PubMed

Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R

2017-01-01

Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.

Enzymatic specificity of three ribosome-inactivating proteins against fungal ribosomes, and correlation with antifungal activity.

PubMed

Park, Sang-Wook; Stevens, Noah M; Vivanco, Jorge M

2002-12-01

Ribosome-inactivating proteins (RIPs) are enzymes that cleave a specific adenine base from the highly conserved sarcin/ricin (S/R) loop of the large ribosomal RNA, thus arresting protein synthesis at the translocation step. In the present study, we employed three RIPs to dissect the antifungal activity of RIPs as plant defense proteins. We measured the catalytic activity of RAT (the catalytic A-chain of ricin from Ricinus communis L.), saporin-S6 (from Saponaria officinalis L.), and ME (RIP from Mirabilis expansa R&P) against intact ribosomal substrates isolated from various pathogenic fungi. We further determined the enzymatic specificity of these three RIPs against fungal ribosomes, from Rhizoctonia solani Kuhn, Alternaria solani Sorauer, Trichoderma reesei Simmons and Candida albicans Berkhout, and correlated the data with antifungal activity. RAT showed the strongest toxicity against all tested fungal ribosomes, except for the ribosomes isolated from C. albicans, which were most susceptible to saporin. RAT and saporin showed higher enzymatic activity than ME against ribosomes from all of the fungal species assayed, but did not show detectable antifungal activity. In contrast, ME showed substantial inhibitory activity against fungal growth. Using N-hydroxysuccinimide-fluorescein labeling of RIPs and fluorescence microscopy, we determined that ME was targeted to the surface of fungal cells and transferred into the cells. Thus, ME caused ribosome depurination and subsequent fungal mortality. In contrast, saporin did not interact with fungal cells, correlating with its lack of antifungal activity.

Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night.

PubMed

Turkina, Maria V; Klang Årstrand, Hanna; Vener, Alexander V

2011-01-01

Protein synthesis in plants is characterized by increase in the translation rates for numerous proteins and central metabolic enzymes during the day phase of the photoperiod. The detailed molecular mechanisms of this diurnal regulation are unknown, while eukaryotic protein translation is mainly controlled at the level of ribosomal initiation complexes, which also involves multiple events of protein phosphorylation. We characterized the extent of protein phosphorylation in cytosolic ribosomes isolated from leaves of the model plant Arabidopsis thaliana harvested during day or night. Proteomic analyses of preparations corresponding to both phases of the photoperiod detected phosphorylation at eight serine residues in the C-termini of six ribosomal proteins: S2-3, S6-1, S6-2, P0-2, P1 and L29-1. This included previously unknown phosphorylation of the 40S ribosomal protein S6 at Ser-231. Relative quantification of the phosphorylated peptides using stable isotope labeling and mass spectrometry revealed a 2.2 times increase in the day/night phosphorylation ratio at this site. Phosphorylation of the S6-1 and S6-2 variants of the same protein at Ser-240 increased by the factors of 4.2 and 1.8, respectively. The 1.6 increase in phosphorylation during the day was also found at Ser-58 of the 60S ribosomal protein L29-1. It is suggested that differential phosphorylation of the ribosomal proteins S6-1, S6-2 and L29-1 may contribute to modulation of the diurnal protein synthesis in plants.

Defective ribosome assembly in Shwachman-Diamond syndrome.

PubMed

Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

2011-10-20

Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

PubMed

Galián, J A; Rosato, M; Rosselló, J A

2012-06-01

In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.

DTIC Science & Technology

1987-04-16

the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r

Phosphorylation of Ribosomal Protein RPS6 Integrates Light Signals and Circadian Clock Signals

DOE PAGES

Enganti, Ramya; Cho, Sung Ki; Toperzer, Jody D.; ...

2018-01-19

The translation of mRNA into protein is tightly regulated by the light environment as well as by the circadian clock. Although changes in translational efficiency have been well documented at the level of mRNA-ribosome loading, the underlying mechanisms are unclear. The reversible phosphorylation of RIBOSOMAL PROTEIN OF THE SMALL SUBUNIT 6 (RPS6) has been known for 40 years, but the biochemical significance of this event remains unclear to this day. Here, we confirm using a clock-deficient strain of Arabidopsis thaliana that RPS6 phosphorylation (RPS6-P) is controlled by the diel light-dark cycle with a peak during the day. Strikingly, when wild-type,more » clock-enabled, seedlings that have been entrained to a light-dark cycle are placed under free-running conditions, the circadian clock drives a cycle of RPS6-P with an opposite phase, peaking during the subjective night. We show that in wild-type seedlings under a light-dark cycle, the incoherent light and clock signals are integrated by the plant to cause an oscillation in RPS6-P with a reduced amplitude with a peak during the day. Sucrose can stimulate RPS6-P, as seen when sucrose in the medium masks the light response of etiolated seedlings. However, the diel cycles of RPS6-P are observed in the presence of 1% sucrose and in its absence. Sucrose at a high concentration of 3% appears to interfere with the robust integration of light and clock signals at the level of RPS6-P. Finally, we addressed whether RPS6-P occurs uniformly in polysomes, non-polysomal ribosomes and their subunits, and non-ribosomal protein. It is the polysomal RPS6 whose phosphorylation is most highly stimulated by light and repressed by darkness. These data exemplify a striking case of contrasting biochemical regulation between clock signals and light signals. Although the physiological significance of RPS6-P remains unknown, our data provide a mechanistic basis for the future understanding of this enigmatic event.« less

Phosphorylation of Ribosomal Protein RPS6 Integrates Light Signals and Circadian Clock Signals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Enganti, Ramya; Cho, Sung Ki; Toperzer, Jody D.

The translation of mRNA into protein is tightly regulated by the light environment as well as by the circadian clock. Although changes in translational efficiency have been well documented at the level of mRNA-ribosome loading, the underlying mechanisms are unclear. The reversible phosphorylation of RIBOSOMAL PROTEIN OF THE SMALL SUBUNIT 6 (RPS6) has been known for 40 years, but the biochemical significance of this event remains unclear to this day. Here, we confirm using a clock-deficient strain of Arabidopsis thaliana that RPS6 phosphorylation (RPS6-P) is controlled by the diel light-dark cycle with a peak during the day. Strikingly, when wild-type,more » clock-enabled, seedlings that have been entrained to a light-dark cycle are placed under free-running conditions, the circadian clock drives a cycle of RPS6-P with an opposite phase, peaking during the subjective night. We show that in wild-type seedlings under a light-dark cycle, the incoherent light and clock signals are integrated by the plant to cause an oscillation in RPS6-P with a reduced amplitude with a peak during the day. Sucrose can stimulate RPS6-P, as seen when sucrose in the medium masks the light response of etiolated seedlings. However, the diel cycles of RPS6-P are observed in the presence of 1% sucrose and in its absence. Sucrose at a high concentration of 3% appears to interfere with the robust integration of light and clock signals at the level of RPS6-P. Finally, we addressed whether RPS6-P occurs uniformly in polysomes, non-polysomal ribosomes and their subunits, and non-ribosomal protein. It is the polysomal RPS6 whose phosphorylation is most highly stimulated by light and repressed by darkness. These data exemplify a striking case of contrasting biochemical regulation between clock signals and light signals. Although the physiological significance of RPS6-P remains unknown, our data provide a mechanistic basis for the future understanding of this enigmatic event.« less

The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

PubMed

MacConnell, W P; Kaplan, N O

1982-05-25

The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

PubMed Central

Arenz, Stefan; Graf, Michael; Nguyen, Fabian; Huter, Paul; Polikanov, Yury S.; Blanchard, Scott C.; Wilson, Daniel N.

2016-01-01

The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis. PMID:27330110

Heptameric (L12)6/L10 rather than canonical pentameric complexes are found by tandem MS of intact ribosomes from thermophilic bacteria.

PubMed

Ilag, Leopold L; Videler, Hortense; McKay, Adam R; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H; Robinson, Carol V

2005-06-07

Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus.

Heptameric (L12)6/L10 rather than canonical pentameric complexes are found by tandem MS of intact ribosomes from thermophilic bacteria

PubMed Central

Ilag, Leopold L.; Videler, Hortense; McKay, Adam R.; Sobott, Frank; Fucini, Paola; Nierhaus, Knud H.; Robinson, Carol V.

2005-01-01

Ribosomes are universal translators of the genetic code into protein and represent macromolecular structures that are asymmetric, often heterogeneous, and contain dynamic regions. These properties pose considerable challenges for modern-day structural biology. Despite these obstacles, high-resolution x-ray structures of the 30S and 50S subunits have revealed the RNA architecture and its interactions with proteins for ribosomes from Thermus thermophilus, Deinococcus radiodurans, and Haloarcula marismortui. Some regions, however, remain inaccessible to these high-resolution approaches because of their high conformational dynamics and potential heterogeneity, specifically the so-called L7/L12 stalk complex. This region plays a vital role in protein synthesis by interacting with GTPase factors in translation. Here, we apply tandem MS, an approach widely applied to peptide sequencing for proteomic applications but not previously applied to MDa complexes. Isolation and activation of ions assigned to intact 30S and 50S subunits releases proteins S6 and L12, respectively. Importantly, this process reveals, exclusively while attached to ribosomes, a phosphorylation of L12, the protein located in multiple copies at the tip of the stalk complex. Moreover, through tandem MS we discovered a stoichiometry for the stalk protuberance on Thermus thermophilus and other thermophiles and contrast this assembly with the analogous one on ribosomes from mesophiles. Together with evidence for a potential interaction with the degradosome, these results show that important findings on ribosome structure, interactions, and modifications can be discovered by tandem MS, even on well studied ribosomes from Thermus thermophilus. PMID:15923259

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

PubMed

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

Reducing Ribosomal Protein S6 Kinase 1 Expression Improves Spatial Memory and Synaptic Plasticity in a Mouse Model of Alzheimer's Disease

PubMed Central

Caccamo, Antonella; Branca, Caterina; Talboom, Joshua S.; Shaw, Darren M.; Turner, Dharshaun; Ma, Luyao; Messina, Angela; Huang, Zebing; Wu, Jie

2015-01-01

Aging is the most important risk factor associated with Alzheimer's disease (AD); however, the molecular mechanisms linking aging to AD remain unclear. Suppression of the ribosomal protein S6 kinase 1 (S6K1) increases healthspan and lifespan in several organisms, from nematodes to mammals. Here we show that S6K1 expression is upregulated in the brains of AD patients. Using a mouse model of AD, we found that genetic reduction of S6K1 improved synaptic plasticity and spatial memory deficits, and reduced the accumulation of amyloid-β and tau, the two neuropathological hallmarks of AD. Mechanistically, these changes were linked to reduced translation of tau and the β-site amyloid precursor protein cleaving enzyme 1, a key enzyme in the generation of amyloid-β. Our results implicate S6K1 dysregulation as a previously unidentified molecular mechanism underlying synaptic and memory deficits in AD. These findings further suggest that therapeutic manipulation of S6K1 could be a valid approach to mitigate AD pathology. SIGNIFICANCE STATEMENT Aging is the most important risk factor for Alzheimer's disease (AD). However, little is known about how it contributes to AD pathogenesis. S6 kinase 1 (S6K1) is a protein kinase involved in regulation of protein translation. Reducing S6K1 activity increases lifespan and healthspan. We report the novel finding that reducing S6K1 activity in 3xTg-AD mice ameliorates synaptic and cognitive deficits. These improvement were associated with a reduction in amyloid-β and tau pathology. Mechanistically, lowering S6K1 levels reduced translation of β-site amyloid precursor protein cleaving enzyme 1 and tau, two key proteins involved in AD pathogenesis. These data suggest that S6K1 may represent a molecular link between aging and AD. Given that aging is the most important risk factor for most neurodegenerative diseases, our results may have far-reaching implications into other diseases. PMID:26468204

Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba

PubMed Central

Galián, J A; Rosato, M; Rosselló, J A

2012-01-01

In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S–5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S–5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S–5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S–5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary. PMID:22354111

Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits

PubMed Central

Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.

2013-01-01

Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

PubMed

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit

NASA Astrophysics Data System (ADS)

Hashem, Yaser; Des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U. T.; Frank, Joachim

2013-11-01

Hepatitis C virus (HCV) and classical swine fever virus (CSFV) messenger RNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5'-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound initiator methionyl transfer RNA to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF3 (refs 2, 5, 6, 7, 9, 10, 11, 12), but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF3 and the HCV IRES revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components. Here we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Remarkably, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S-IRES binary complex, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favouring translation of viral mRNAs.

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

PubMed

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

Ribosomal vaccines. I. Immunogenicity of ribosomal fractions isolated from Salmonella typhimurium and Yersinia pestis.

PubMed

Johnson, W

1972-06-01

The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein.

p90 ribosomal S6 kinase: a potential therapeutic target in lung cancer.

PubMed

Poomakkoth, Noufira; Issa, Aya; Abdulrahman, Nabeel; Abdelaziz, Somaia Gamal; Mraiche, Fatima

2016-01-14

A global survey of cancer has shown that lung cancer is the most common cause of the new cancer cases and cancer deaths in men worldwide. The mortality from lung cancer is more than the combined mortality from breast, prostate and colorectal cancers. The two major histological types of lung cancer are non-small cell lung cancer (NSCLC) accounting for about 85 % of cases and small cell lung cancer accounting for 15 % of cases. NSCLC, the more prevalent form of lung cancer, is often diagnosed at an advanced stage and has a very poor prognosis. Many factors have been shown to contribute to the development of lung cancer in humans including tobacco smoking, exposure to environmental carcinogens (asbestos, or radon) and genetic factors. Despite the advances in treatment, lung cancer remains one of the leading causes of cancer death worldwide. Interestingly, the overall 5 year survival from lung cancer has not changed appreciably in the past 25 years. For this reason, novel and more effective treatments and strategies for NSCLC are critically needed. p90 ribosomal S6 kinase (RSK), a serine threonine kinase that lies downstream of the Ras-MAPK (mitogen activated protein kinase) cascade, has been demonstrated to be involved in the regulation of cell proliferation in various malignancies through indirect (e.g., modulation of transcription factors) or direct effects on the cell-cycle machinery. Increased expression of RSK has been demonstrated in various cancers, including lung cancer. This review focuses on the role of RSK in lung cancer and its potential therapeutic application.

Ribosomal Vaccines I. Immunogenicity of Ribosomal Fractions Isolated from Salmonella typhimurium and Yersinia pestis

PubMed Central

Johnson, William

1972-01-01

The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein. Images PMID:4564407

Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

PubMed

Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

2007-12-07

The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

DOE PAGES

Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

2015-04-30

In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

Treesearch

Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

2010-01-01

Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

5S ribosomal RNA database Y2K

PubMed Central

Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

5S ribosomal RNA database Y2K.

PubMed

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

PubMed Central

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

2013-01-01

SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

PubMed

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Translational autocontrol of the Escherichia coli ribosomal protein S15.

PubMed

Portier, C; Dondon, L; Grunberg-Manago, M

1990-01-20

When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.

Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.

PubMed

Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V

2010-10-01

The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.

Kinase Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

DTIC Science & Technology

2017-02-01

Ribosome assembly • Autophagy • CRISPR /Cas9 6 ACCOMPLISHMENTS Major goals The major goals in this reporting period were to use the CRISPR ...defects on ribosome assembly, drug sensitivity etc. Accomplishments under these goals To set up the CRISPR /Cas9 experiment, the Karbstein...recombinant Cas9, and then assayed CRISPR /Cas9 mediated cleavage of a PCR-generated DNA. This demonstrated that the guide RNAs we had designed based on

[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].

PubMed

Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G

2007-01-01

The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.

Basic anatomy and tumor biology of the RPS6KA6 gene that encodes the p90 ribosomal S6 kinase-4

PubMed Central

Sun, Yuan; Cao, Shousong; Yang, Min; Wu, Sihong; Wang, Zhe; Lin, Xiukun; Song, Xiangrang; Liao, D.J.

2012-01-01

The RPS6KA6 gene encodes the p90 ribosomal S6 kinase-4 (RSK4) that is still largely uncharacterized. In this study we identified a new RSK4 transcription initiation site and several alternative splice sites with a 5’RACE approach. The resulting mRNA variants encompass four possible first start codons. The first 15 nucleotides (nt) of exon 22 in mouse and the penultimate exon in both human (exon 21) and mouse (exon 24) RSK4 underwent alternative splicing, although the penultimate exon deleted variant appeared mainly in cell clines, but not in most normal tissues. Demethylation agent 5-azacytidine inhibited the deletion of the penultimate exon whereas two indolocarbazole-derived inhibitors of cyclin dependent kinase 4 or 6 induced deletion of the first 39 nt from exon 21 of human RSK4. In all human cancer cell lines studied, the 90-kD wild type RSK4 was sparse but, surprisingly, several isoforms at or smaller than 72-kD were expressed as detected by seven different antibodies. On immunoblots, each of these smaller isoforms often appeared as a duplet or triplet and the levels of these isoforms varied greatly among different cell lines and culture conditions. Cyclin D1 inhibited RSK4 expression and serum starvation enhanced the inhibition, whereas c-Myc and RSK4 inhibited cyclin D1. The effects of RSK4 on cell growth, cell death and chemoresponse depended on the mRNA variant or the protein isoform expressed, on the specificity of the cell lines, as well as on the anchorage-dependent or -independent growth conditions and the in vivo situation. Moreover, we also observed that even a given cDNA might be expressed to multiple proteins; therefore, when using a cDNA, one needs to exclude this possibility before attribution of the biological results from the cDNA to the anticipated protein. Collectively, our results suggest that whether RSK4 is oncogenic or tumor suppressive depends on many factors. PMID:22614021

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

PubMed

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

PubMed Central

Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

2007-01-01

The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

Ribosomal proteins: functions beyond the ribosome.

PubMed

Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

2015-04-01

Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

PubMed

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Unique localization of the plastid-specific ribosomal proteins in the chloroplast ribosome small subunit provides mechanistic insights into the chloroplastic translation

PubMed Central

Ahmed, Tofayel; Shi, Jian

2017-01-01

Abstract Chloroplastic translation is mediated by a bacterial-type 70S chloroplast ribosome. During the evolution, chloroplast ribosomes have acquired five plastid-specific ribosomal proteins or PSRPs (cS22, cS23, bTHXc, cL37 and cL38) which have been suggested to play important regulatory roles in translation. However, their exact locations on the chloroplast ribosome remain elusive due to lack of a high-resolution structure, hindering our progress to understand their possible roles. Here we present a cryo-EM structure of the 70S chloroplast ribosome from spinach resolved to 3.4 Å and focus our discussion mainly on the architecture of the 30S small subunit (SSU) which is resolved to 3.7 Å. cS22 localizes at the SSU foot where it seems to compensate for the deletions in 16S rRNA. The mRNA exit site is highly remodeled due to the presence of cS23 suggesting an alternative mode of translation initiation. bTHXc is positioned at the SSU head and appears to stabilize the intersubunit bridge B1b during thermal fluctuations. The translation factor plastid pY binds to the SSU on the intersubunit side and interacts with the conserved nucleotide bases involved in decoding. Most of the intersubunit bridges are conserved compared to the bacteria, except for a new bridge involving uL2c and bS6c. PMID:28582576

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

NASA Technical Reports Server (NTRS)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Ribosome-inactivating proteins

PubMed Central

Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

2013-01-01

Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

PubMed

Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

1987-08-01

The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

PubMed

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

PubMed

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

PubMed Central

Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

1992-01-01

Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Comparative study between prokaryotes and eukaryotes by chemical iodination of ribosomal proteins.

PubMed

Bernabeu, C; Vázquez, D; Conde, F P

1979-04-25

Escherichia coli and Saccharomyces cerevisiae ribosomal proteins were chemically iodinated with 125I by chloramine T under conditions in which the proteins were denatured. The labelled proteins were subsequently separated by two-dimensional gel electrophoresis with an excess of untreated ribosomal proteins from the same species. The iodination did not change the electrophoretic mobility of the proteins as shown by the pattern of spots in the stained gel slabs and their autoradiography. The 125I radioactivity incorporated in the proteins was estimated by cutting out the gel spots from the two-dimensional electrophoresis gel slabs. The highest content of 125I was found in the ribosomal proteins L2, L11, L13, L20/S12, S4 and S9 from E. coli, and L2/L3, L4/L6/S7, L5, L19/L20, L22/S17, L29/S27, L35/L37 and S14/S15 from S. cerevisiae. Comparisons between the electrophoretic patterns of E. coli and S. cerevisiae ribosomal proteins were carried out by coelectrophoresis of labelled and unlabelled proteins from both species. E. coli ribosomal proteins L5, L11, L20, S2, S3 and S15/S16 were found to overlap with L15, L11/L16, L36/L37, S3, S10 and S33 from S. cerevisiae, respectively. Similar coelectrophoresis of E. coli 125I-labelled proteins with unlabelled rat liver and wheat germ ribosomal proteins showed the former to overlap with proteins L1, L11, L14, L16, L19, L20 and the latter with L2, L5, L6, L15, L17 from E. coli.

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

PubMed

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome

PubMed Central

Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard

2017-01-01

In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493

The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

PubMed Central

Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

2018-01-01

Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis

PubMed Central

Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li

2016-01-01

Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

Effects of porcine 25 kDa amelogenin and its proteolytic derivatives on bone sialoprotein expression.

PubMed

Nakayama, Y; Yang, L; Mezawa, M; Araki, S; Li, Z; Wang, Z; Sasaki, Y; Takai, H; Nakao, S; Fukae, M; Ogata, Y

2010-10-01

Amelogenins are hydrophobic proteins that are the major component of developing enamel. Enamel matrix derivative has been used for periodontal regeneration. Bone sialoprotein is an early phenotypic marker of osteoblast differentiation. In this study, we examined the ability of porcine amelogenins to regulate bone sialoprotein transcription. To determine the molecular basis of the transcriptional regulation of the bone sialoprotein gene by amelogenins, we conducted northern hybridization, transient transfection analyses and gel mobility shift assays using the osteoblast-like ROS 17/2.8 cells. Amelogenins (100 ng/mL) up-regulated bone sialoprotein mRNA at 3 h, with maximal mRNA expression occurring at 12 h (25 and 20 kDa) and 6 h (13 and 6 kDa). Amelogenins (100 ng/mL, 12 h) increased luciferase activities in pLUC3 (nucleotides -116 to +60), and 6 kDa amelogenin up-regulated pLUC4 (nucleotides -425 to +60) activity. The tyrosine kinase inhibitor inhibited amelogenin-induced luciferase activities, whereas the protein kinase A inhibitor abolished 25 kDa amelogenin-induced bone sialoprotein transcription. The effects of amelogenins were abrogated by 2-bp mutations in the fibroblast growth factor 2 response element (FRE). Gel-shift assays with radiolabeled FRE, homeodomain-protein binding site (HOX) and transforming growth factor-beta1 activation element (TAE) double-strand oligonucleotides revealed increased binding of nuclear proteins from amelogenin-stimulated ROS 17/2.8 cells at 3 h (25 and 13 kDa) and 6 h (20 and 6 kDa). These results demonstrate that porcine 25 kDa amelogenin and its proteolytic derivatives stimulate bone sialoprotein transcription by targeting FRE, HOX and TAE in the bone sialoprotein gene promoter, and that full-length amelogenin and amelogenin cleavage products are able to regulate bone sialoprotein transcription via different signaling pathways. (c) 2010 John Wiley & Sons A/S.

Erythroblast differentiation at spleen in Q137E mutant ribosomal protein S19 gene knock-in C57BL/6J mice.

PubMed

Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi

2018-01-01

We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.

Targeting Aberrant p70S6K Activation for Estrogen Receptor-Negative Breast Cancer Prevention.

PubMed

Wang, Xiao; Yao, Jun; Wang, Jinyang; Zhang, Qingling; Brady, Samuel W; Arun, Banu; Seewaldt, Victoria L; Yu, Dihua

2017-11-01

The prevention of estrogen receptor-negative (ER-) breast cancer remains a major challenge in the cancer prevention field, although antiestrogen and aromatase inhibitors have shown adequate efficacy in preventing estrogen receptor-positive (ER + ) breast cancer. Lack of commonly expressed, druggable targets is a major obstacle for meeting this challenge. Previously, we detected the activation of Akt signaling pathway in atypical hyperplasic early-stage lesions of patients. In the current study, we found that Akt and the downstream 70 kDa ribosomal protein S6 kinase (p70S6K) signaling pathway was highly activated in ER - premalignant breast lesions and ER - breast cancer. In addition, p70S6K activation induced transformation of ER - human mammary epithelial cells (hMEC). Therefore, we explored the potential of targeting Akt/p70S6K in the p70S6K activated, ER - hMEC models and mouse mammary tumor models for the prevention of ER - breast cancer. We found that a clinically applicable Akt/p70S6K dual inhibitor, LY2780301, drastically decreased proliferation of hMECs with ErbB2-induced p70S6K activation via Cyclin B1 inhibition and cell-cycle blockade at G 0 -G 1 phase, while it did not significantly reverse the abnormal acinar morphology of these hMECs. In addition, a brief treatment of LY2780301 in MMTV- neu mice that developed atypical hyperplasia (ADH) and mammary intraepithelial neoplasia (MIN) lesions with activated p70S6K was sufficient to suppress S6 phosphorylation and decrease cell proliferation in hyperplasic MECs. In summary, targeting the aberrant Akt/p70S6K activation in ER - hMEC models in vitro and in the MMTV- neu transgenic mouse model in vivo effectively inhibited Akt/S6K signaling and reduced proliferation of hMECs in vitro and ADH/MIN lesions in vivo , indicating its potential in prevention of p70S6K activated ER - breast cancer. Cancer Prev Res; 10(11); 641-50. ©2017 AACR . ©2017 American Association for Cancer Research.

[Family of ribosomal proteins S1 contains unique conservative domain].

PubMed

Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

2010-01-01

Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

NASA Astrophysics Data System (ADS)

Poirot, Olivier; Timsit, Youri

2016-05-01

From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

Phosphorylation of Wheat Germ Initiation Factors and Ribosomal Proteins 1

PubMed Central

Browning, Karen S.; Yan, Tyan Fuh J.; Lauer, Stephen J.; Aquino, Lu Ann; Tao, Mariano; Ravel, Joanne M.

1985-01-01

The ability of the wheat germ initiation factors and ribosomes to serve as substrates for a wheat germ protein kinase (Yan and Tao 1982 J Biol Chem 257: 7037-7043) has been investigated. The wheat germ kinase catalyzes the phosphorylation of the 42,000 dalton subunit of eukaryotic initiation factor (eIF)-2 and the 107,000 dalton subunit of eIF-3. Other initiation factors, eIF-4B and eIF-4A, and elongation factors, EF-1 and EF-2, are not phosphorylated by the kinase. Quantitative analysis indicates that the kinase catalyzes the incorporation of about 0.5 to 0.6 mole of phosphate per mole of the 42,000 dalton subunit of eIF-2 and about 6 moles of phosphate per mole of the 107,000 dalton subunit of eIF-3. Three proteins (Mr = 38,000, 14,800, and 12,600) of the 60S ribosomal subunit are phosphorylated by the kinase, but none of the 40S ribosomal proteins are substrates of the kinase. No effects of phosphorylation on the activities of eIF-2, eIF-3, or 60S ribosomal subunits could be demonstrated in vitro. Images Fig. 1 Fig. 3 Fig. 4 PMID:16664060

Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

PubMed Central

Chang, F. N.; Flaks, Joel G.

1972-01-01

The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

Quantitation of ten 30S ribosomal assembly intermediates using fluorescence triple correlation spectroscopy

PubMed Central

Ridgeway, William K.; Millar, David P.; Williamson, James R.

2012-01-01

The self-assembly of bacterial 30S ribosomes involves a large number of RNA folding and RNA-protein binding steps. The sequence of steps determines the overall assembly mechanism and the structure of the mechanism has ramifications for the robustness of biogenesis and resilience against kinetic traps. Thermodynamic interdependencies of protein binding inferred from omission-reconstitution experiments are thought to preclude certain assembly pathways and thus enforce ordered assembly, but this concept is at odds with kinetic data suggesting a more parallel assembly landscape. A major challenge is deconvolution of the statistical distribution of intermediates that are populated during assembly at high concentrations approaching in vivo assembly conditions. To specifically resolve the intermediates formed by binding of three ribosomal proteins to the full length 16S rRNA, we introduce Fluorescence Triple-Correlation Spectroscopy (F3CS). F3CS identifies specific ternary complexes by detecting coincident fluctuations in three-color fluorescence data. Triple correlation integrals quantify concentrations and diffusion kinetics of triply labeled species, and F3CS data can be fit alongside auto-correlation and cross-correlation data to quantify the populations of 10 specific ribosome assembly intermediates. The distribution of intermediates generated by binding three ribosomal proteins to the entire native 16S rRNA included significant populations of species that were not previously thought to be thermodynamically accessible, questioning the current interpretation of the classic omission-reconstitution experiments. F3CS is a general approach for analyzing assembly and function of macromolecular complexes, especially those too large for traditional biophysical methods. PMID:22869699

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

PubMed Central

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-01

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

Reductive alkylation of ribosomes as a probe to the topography of ribosomal proteins*

PubMed Central

Moore, Graham; Crichton, Robert R.

1974-01-01

Escherichia coli ribosomes were treated with a number of different aldehydes of various sizes in the presence of NaBH4. After incorporation of either 3H or 14C, the ribosomal proteins were separated by two-dimensional polyacrylamide-gel electrophoresis and the extent of alkylation of the lysine residues in each protein was measured. The same pattern of alkylation was observed with the four reagents used, namely formaldehyde, acetone, benzaldehyde and 3,4,5-trimethoxybenzaldehyde. Every protein in 30S and 50S subunits was modified, although there was considerable variation in the degree of alkylation of individual proteins. A topographical classification of ribosomal proteins is presented, based on the degree of exposure of lysine residues. The data indicate that every protein of the ribosome has at least one lysine residue exposed at or near the surface of the ribonucleo-protein complex. PMID:4462744

Ribonucleic Acid and Ribosomes of Bacillus stearothermophilus1

PubMed Central

Saunders, Grady F.; Campbell, L. Leon

1966-01-01

Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332–339. 1966.—The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10−2m MgCl2–10−2m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg++ concentration to 10−3m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10−2m Mg++ to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a Tm at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a Tm of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. Images PMID:5903099

High-resolution structure of the Escherichia coli ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.

Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

High-resolution structure of the Escherichia coli ribosome

DOE PAGES

Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; ...

2015-03-16

Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

PubMed

Cukras, Anthony R; Green, Rachel

2005-05-27

The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Principles of 60S ribosomal subunit assembly emerging from recent studies in yeast

PubMed Central

Konikkat, Salini; Woolford, John L.

2017-01-01

Ribosome biogenesis requires the intertwined processes of folding, modification, and processing of ribosomal RNA, together with binding of ribosomal proteins. In eukaryotic cells, ribosome assembly begins in the nucleolus, continues in the nucleoplasm, and is not completed until after nascent particles are exported to the cytoplasm. The efficiency and fidelity of ribosome biogenesis are facilitated by >200 assembly factors and ~76 different small nucleolar RNAs. The pathway is driven forward by numerous remodeling events to rearrange the ribonucleoprotein architecture of pre-ribosomes. Here, we describe principles of ribosome assembly that have emerged from recent studies of biogenesis of the large ribosomal subunit in the yeast Saccharomyces cerevisiae. We describe tools that have empowered investigations of ribosome biogenesis, and then summarize recent discoveries about each of the consecutive steps of subunit assembly. PMID:28062837

Translation Initiation Factor eIF4B Interacts with a Picornavirus Internal Ribosome Entry Site in both 48S and 80S Initiation Complexes Independently of Initiator AUG Location

PubMed Central

Ochs, Kerstin; Rust, René C.; Niepmann, Michael

1999-01-01

Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840

Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae

PubMed Central

Schmidt, Christian; Berninghausen, Otto; Becker, Thomas

2017-01-01

Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690

Ferulic acid attenuates focal cerebral ischemia-induced decreases in p70S6 kinase and S6 phosphorylation.

PubMed

Koh, Phil-Ok

2013-10-25

Ferulic acid exhibits neuroprotective effects against focal cerebral ischemia. PI3/K and Akt signaling pathways play an essential role in protecting against cerebral ischemia. Mammalian target of rapamycin (mTOR), a major downstream target of Akt, regulates p70S6 kinase and S6, both of which are involved in ribosomal biogenesis and protein synthesis. I investigated whether ferulic acid regulates mTOR, p70S6 kinase, and S6 phosphorylation during brain ischemic injury. Rats were treated immediately with vehicle or ferulic acid (100mg/kg, i.v.) after middle cerebral artery occlusion (MCAO). Brains tissues were removed at 24h after the onset of MCAO and the cerebral cortex regions were collected. Ferulic acid reduced the MCAO-induced infarct volume. I showed previously that ferulic acid prevents the MCAO injury-induced decrease of Akt phosphorylation. In this study, MCAO injury induced decreases in mTOR, p70S6 kinase, and S6 phosphorylation levels, while ferulic acid attenuated the injury-induced decreases. Immunohistochemical staining demonstrated that ferulic acid prevented the MCAO-induced reduction in the number of positive cells for phosphorylated p70S6 kinase and phosphorylated S6. These findings suggest that ferulic acid has a neuroprotective function against focal cerebral ischemia by modulating p70S6 kinase expression and S6 phosphorylation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

[SP600125-induced polyploidization of megakaryocytic leukemia cell lines by ribosomal protein S6 kinase 1 depends on the degree of cell differentiation].

PubMed

Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu

2016-10-01

Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect

Structural domains within the HIV-1 mRNA and the ribosomal protein S25 influence cap-independent translation initiation

PubMed Central

Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth A.; Contreras, Nataly; Hertz, Marla I.; Olivares, Eduardo; Cáceres, C. Joaquín; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R.; López-Lastra, Marcelo

2016-01-01

The 5′leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work we examine the internal ribosome entry site (IRES) located in the 5′leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5′leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. PMID:27191820

Purification of a 6.5 kDa protease inhibitor from Amazon Inga umbratica seeds effective against serine proteases of the boll weevil Anthonomus grandis.

PubMed

Calderon, L A; Teles, R C L; Leite, J R S A; Franco, O L; Grossi-de-Sá, M F; Medrano, F J; Bloch, C; Freitas, S M

2005-08-01

A 6.5 kDa serine protease inhibitor was purified by anion-exchange chromatography from the crude extract of the Inga umbratica seeds, containing inhibitor isoforms ranging from 6.3 to 6.7 kDa and protease inhibitors of approximately 19 kDa. The purified protein was characterized as a potent inhibitor against trypsin and chymotrypsin and it was named I. umbratica trypsin and chymotrypsin inhibitor (IUTCI). MALDI-TOF spectra of the IUTCI, in the presence of DTT, showed six disulfide bonds content, suggesting that this inhibitor belongs to Bowman-Birk family. The circular dichroism spectroscopy indicates that IUTCI is predominantly formed by unordered and beta-sheet secondary structure. It was also characterized, by fluorescence spectroscopy, as a stable protein at range of pH from 5.0 to 7.0. Moreover, this inhibitor at concentration of 75 microM presented a remarkable inhibitory activity (60%) against digestive serine proteases from boll weevil Anthonomus grandis, an important economical cotton pest.

An unusual internal ribosomal entry site of inverted symmetry directs expression of a potato leafroll polerovirus replication-associated protein

PubMed Central

Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk

2003-01-01

Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413

Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

In vitro expression of Escherichia coli ribosomal protein genes: autogenous inhibition of translation.

PubMed Central

Yates, J L; Arfsten, A E; Nomura, M

1980-01-01

Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562

Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying

2013-11-15

Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletionmore » and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.« less

mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.

PubMed

Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G

2006-07-01

Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.

Selection of peptides targeting helix 31 of bacterial 16S ribosomal RNA by screening M13 phage-display libraries.

PubMed

Lamichhane, Tek N; Abeydeera, N Dinuka; Duc, Anne-Cécile E; Cunningham, Philip R; Chow, Christine S

2011-01-28

Ribosomal RNA is the catalytic portion of ribosomes, and undergoes a variety of conformational changes during translation. Structural changes in ribosomal RNA can be facilitated by the presence of modified nucleotides. Helix 31 of bacterial 16S ribosomal RNA harbors two modified nucleotides, m²G966 and m⁵C967, that are highly conserved among bacteria, though the degree and nature of the modifications in this region are different in eukaryotes. Contacts between helix 31 and the P-site tRNA, initiation factors, and ribosomal proteins highlight the importance of this region in translation. In this work, a heptapeptide M13 phage-display library was screened for ligands that target the wild-type, naturally modified bacterial helix 31. Several peptides, including TYLPWPA, CVRPFAL, TLWDLIP, FVRPFPL, ATPLWLK, and DIRTQRE, were found to be prevalent after several rounds of screening. Several of the peptides exhibited moderate affinity (in the high nM to low µM range) to modified helix 31 in biophysical assays, including surface plasmon resonance (SPR), and were also shown to bind 30S ribosomal subunits. These peptides also inhibited protein synthesis in cell-free translation assays.

Immunohistochemical analysis of S6K1 and S6K2 localization in human breast tumors.

PubMed

Filonenko, Valeriy V; Tytarenko, Ruslana; Azatjan, Sergey K; Savinska, Lilya O; Gaydar, Yuriy A; Gout, Ivan T; Usenko, Vasiliy S; Lyzogubov, Valeriy V

2004-12-01

To perform an immunohistochemical analysis of human breast adenomas and adenocarcinomas as well as normal breast tissues in respect of S6 ribosomal protein kinase (S6K) expression and localization in normal and transformed cells. The expression level and localization of S6K have been detected in formalin fixed, paraffin embedded sections of normal human breast tissues, adenomas and adenocarcinomas with different grade of differentiation. Immunohistochemical detection of S6K1 and S6K2 in normal human breast tissues and breast tumors were performed using specific monoclonal and polyclonal antibodies against S6K1 and S6K2 with following semiquantitative analysis. The increase of S6K content in the cytoplasm of epithelial cells in benign and malignant tumors has been detected. Nuclear accumulation of S6K1 and to a greater extend S6K2 have been found in breast adenocarcinomas. About 80% of breast adenocarcinomas cases revealed S6K2 nuclear staining comparing to normal tissues. In 31% of cases more then 50% of cancer cells had strong nuclear staining. Accumulation of S6K1 in the nucleus of neoplastic cells has been demonstrated in 25% of cases. Nuclear localization of S6K in the epithelial cells in normal breast tissues has not been detected. Immunohistochemical analysis of S6K1 and S6K2 expression in normal human breast tissues, benign and malignant breast tumors clearly indicates that both kinases are overexpressed in breast tumors. Semiquantitative analysis of peculiarities of S6K localization in normal tissues and tumors revealed that nucleoplasmic accumulation of S6K (especially S6K2) is a distinguishing feature of cancer cells.

A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli

PubMed Central

Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

2014-01-01

Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3′ domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3′-domain is unanchored and the 5′-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells. DOI: http://dx.doi.org/10.7554/eLife.04491.001 PMID:25313868

Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

PubMed

Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

2016-04-15

We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural domains within the HIV-1 mRNA and the ribosomal protein S25 influence cap-independent translation initiation.

PubMed

Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth; Contreras, Nataly; Hertz, Marla I; Olivares, Eduardo; Cáceres, Carlos J; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R; López-Lastra, Marcelo

2016-07-01

The 5' leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work, we examine the internal ribosome entry site (IRES) located in the 5' leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5' leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. © 2016 Federation of European Biochemical Societies.

[Protein S3 fragments neighboring mRNA during elongation and translation termination on the human ribosome].

PubMed

Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G

2008-01-01

Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.

Revealing Nature’s Synthetic Potential Through the Study of Ribosomal Natural Product Biosynthesis

PubMed Central

Dunbar, Kyle L.; Mitchell, Douglas A.

2013-01-01

Ribosomally synthesized posttranslationally modified peptides (RiPPs) are a rapidly growing class of natural products with diverse structures and activities. In recent years, a great deal of progress has been made in elucidating the biosynthesis of various RiPP family members. As with the study of nonribosomal peptide and polyketide biosynthetic enzymes, these investigations have led to the discovery of entirely new biological chemistry. With each unique enzyme investigated, a more complex picture of Nature’s synthetic potential is revealed. This review focuses on recent reports (since 2008) that have changed the way that we think about ribosomal natural product biosynthesis and the enzymology of complex bond-forming reactions. PMID:23286465

The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

PubMed

Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

2008-07-01

Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

Targeting ricin to the ribosome.

PubMed

May, Kerrie L; Yan, Qing; Tumer, Nilgun E

2013-07-01

The plant toxin ricin is highly toxic for mammalian cells and is of concern for bioterrorism. Ricin belongs to a family of functionally related toxins, collectively referred to as ribosome inactivating proteins (RIPs), which disable ribosomes and halt protein synthesis. Currently there are no specific antidotes against ricin or related RIPs. The catalytic subunit of ricin is an N-glycosidase that depurinates a universally conserved adenine residue within the sarcin/ricin loop (SRL) of the 28S rRNA. This depurination activity inhibits translation and its biochemistry has been intensively studied. Yet, recent developments paint a more complex picture of toxicity, with ribosomal proteins and cellular signaling pathways contributing to the potency of ricin. In particular, several studies have now established the importance of the ribosomal stalk structure in facilitating the depurination activity and ribosome specificity of ricin and other RIPs. This review highlights recent developments defining toxin-ribosome interactions and examines the significance of these interactions for toxicity and therapeutic intervention. Copyright © 2013 Elsevier Ltd. All rights reserved.

Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

PubMed

Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

2018-04-21

Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

Crystal Structure of Ribosome-Inactivating Protein Ricin A Chain in Complex with the C-Terminal Peptide of the Ribosomal Stalk Protein P2.

PubMed

Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui

2016-10-13

Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome.

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

PubMed

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

Role of p70S6K1-mediated phosphorylation of eIF4B and PDCD4 proteins in the regulation of protein synthesis.

PubMed

Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R

2012-12-14

Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.

Effects of detergents on ribosomal precursor subunits of Bacillus megaterium.

PubMed

Body, A; Brownstein, B H

1978-01-01

Cell extracts prepared by osmotic lysis of protoplasts were analyzed by sucrose gradient sedimentation. In the absence of detergents, ribosomal precursor particles were found in a gradient fraction which sedimented faster than mature 50S subunits and in two other fractions coincident with mature 50S and 30S ribosomal subunits. Phospholipid, an indicator of membrane, was shown to be associated with only the fastest-sedimenting ribosomal precursor particle fraction. After the extracts were treated with detergents, all phospholipid was found at the top of the gradients. Brij 58, Triton X-100, and Nonidet P-40 did not cause a change in the sedimentation values of precursors; however, the detergents deoxycholate or LOC (Amway Corp.) disrupted the fastest-sedimenting precursor and converted the ribosomal precursor subunits which sedimented at the 50S and 30S positions to five different classes of more slowly sedimenting particles. Earlier reports on the in vivo assembly of ribosomal subunits have shown that several stages of ribosomal precursor subunits exist, and, in the presence of the detergents deoxycholate and LOC, which had been used to prepare cell extracts, the precursors sedimented more slowly. Our data are consistent with the hypothesis that those detergents selectively modify the structure of ribosomal precursors and lend further support to the hypothesis that the in vivo ribosomal precursor subunits have 50S and 30S sedimentation values. In addition, these data support the idea that the ribosomal precursor particles found in the fast-sedimenting fraction may constitute a unique precursor fraction.

Effects of Detergents on Ribosomal Precursor Subunits of Bacillus megaterium

PubMed Central

Body, Barbara A.; Brownstein, Bernard H.

1978-01-01

Cell extracts prepared by osmotic lysis of protoplasts were analyzed by sucrose gradient sedimentation. In the absence of detergents, ribosomal precursor particles were found in a gradient fraction which sedimented faster than mature 50S subunits and in two other fractions coincident with mature 50S and 30S ribosomal subunits. Phospholipid, an indicator of membrane, was shown to be associated with only the fastest-sedimenting ribosomal precursor particle fraction. After the extracts were treated with detergents, all phospholipid was found at the top of the gradients. Brij 58, Triton X-100, and Nonidet P-40 did not cause a change in the sedimentation values of precursors; however, the detergents deoxycholate or LOC (Amway Corp.) disrupted the fastest-sedimenting precursor and converted the ribosomal precursor subunits which sedimented at the 50S and 30S positions to five different classes of more slowly sedimenting particles. Earlier reports on the in vivo assembly of ribosomal subunits have shown that several stages of ribosomal precursor subunits exist, and, in the presence of the detergents deoxycholate and LOC, which had been used to prepare cell extracts, the precursors sedimented more slowly. Our data are consistent with the hypothesis that those detergents selectively modify the structure of ribosomal precursors and lend further support to the hypothesis that the in vivo ribosomal precursor subunits have 50S and 30S sedimentation values. In addition, these data support the idea that the ribosomal precursor particles found in the fast-sedimenting fraction may constitute a unique precursor fraction. PMID:412833

The Structure of the Anti-tuberculosis Antibiotics Viomycin and Capreomycin Bound to the 70S Ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanley, R.; Blaha, G; Grodzicki, R

2010-01-01

Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less

The structures of the anti-tuberculosis antibiotics viomycin and capreomycin bound to the 70S ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanley, Robin E.; Blaha, Gregor; Grodzicki, Robert L.

2010-05-03

Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

PubMed

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

2017-06-20

The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

PubMed

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Role of Mex67-Mtr2 in the Nuclear Export of 40S Pre-Ribosomes

PubMed Central

Occhipinti, Laura; Kemmler, Stefan; Panse, Vikram G.

2012-01-01

Nuclear export of mRNAs and pre-ribosomal subunits (pre40S and pre60S) is fundamental to all eukaryotes. While genetic approaches in budding yeast have identified bona fide export factors for mRNAs and pre60S subunits, little is known regarding nuclear export of pre40S subunits. The yeast heterodimeric transport receptor Mex67-Mtr2 (TAP-p15 in humans) binds mRNAs and pre60S subunits in the nucleus and facilitates their passage through the nuclear pore complex (NPC) into the cytoplasm by interacting with Phe-Gly (FG)-rich nucleoporins that line its transport channel. By exploiting a combination of genetic, cell-biological, and biochemical approaches, we uncovered an unanticipated role of Mex67-Mtr2 in the nuclear export of 40S pre-ribosomes. We show that recruitment of Mex67-Mtr2 to pre40S subunits requires loops emanating from its NTF2-like domains and that the C-terminal FG-rich nucleoporin interacting UBA-like domain within Mex67 contributes to the transport of pre40S subunits to the cytoplasm. Remarkably, the same loops also recruit Mex67-Mtr2 to pre60S subunits and to the Nup84 complex, the respective interactions crucial for nuclear export of pre60S subunits and mRNAs. Thus Mex67-Mtr2 is a unique transport receptor that employs a common interaction surface to participate in the nuclear export of both pre-ribosomal subunits and mRNAs. Mex67-Mtr2 could engage a regulatory crosstalk among the three major export pathways for optimal cellular growth and proliferation. PMID:22956913

cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

PubMed

Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

2009-11-01

RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

PubMed

Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

2017-01-01

Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

Insulin Activates RSK (p90 Ribosomal S6 Kinase) to Trigger a New Negative Feedback Loop That Regulates Insulin Signaling for Glucose Metabolism*

PubMed Central

Smadja-Lamère, Nicolas; Shum, Michael; Déléris, Paul; Roux, Philippe P.; Abe, Jun-Ichi; Marette, André

2013-01-01

We previously demonstrated that the mTORC1/S6K1 pathway is activated by insulin and nutrient overload (e.g. amino acids (AA)), which leads to the inhibition of the PI3K/Akt pathway via the inhibitory serine phosphorylation of IRS-1, notably on serine 1101 (Ser-1101). However, even in the absence of AA, insulin can still promote IRS-1 Ser-1101 phosphorylation by other kinases that remain to be fully characterized. Here, we describe a new negative regulator of IRS-1, the p90 ribosomal S6 kinase (RSK). Computational analyses revealed that Ser-1101 within IRS-1 falls into the consensus motif of RSK. Moreover, recombinant RSK phosphorylated IRS-1 C-terminal fragment on Ser-1101, which was prevented by mutations of this site or when a kinase-inactive mutant of RSK was used. Using antibodies directed toward the phosphorylation sites located in the activation segment of RSK (Ser-221 or Ser-380), we found that insulin activates RSK in L6 myocytes in the absence of AA overload. Inhibition of RSK using either the pharmacological inhibitor BI-D1870 or after adenoviral expression of a dominant negative RSK1 mutant (RSK1-DN) showed that RSK selectively phosphorylates IRS-1 on Ser-1101. Accordingly, expression of the RSK1-DN mutant in L6 myocytes and FAO hepatic cells improved insulin action on glucose uptake and glucose production, respectively. Furthermore, RSK1 inhibition prevented insulin resistance in L6 myocytes chronically exposed to high glucose and high insulin. These results show that RSK is a novel regulator of insulin signaling and glucose metabolism and a potential mediator of insulin resistance, notably through the negative phosphorylation of IRS-1 on Ser-1101. PMID:24036112

Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

PubMed

Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

2014-12-01

During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

Expression, purification, and evaluation for anticancer activity of ribosomal protein L31 gene (RPL31) from the giant panda (Ailuropoda melanoleuca).

PubMed

Su, Xiu-Lan; Hou, Yi-Ling; Yan, Xiang-Hui; Ding, Xiang; Hou, Wan-Ru; Sun, Bing; Zhang, Si-Nan

2012-09-01

Ribosomal protein L31 gene is a component of the 60S large ribosomal subunit encoded by RPL31 gene, while ribosomal protein L31 (RPL31) is an important constituent of peptidyltransferase center. In our research, the cDNA and the genomic sequence of RPL31 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology respectively, following sequencing and analyzing preliminarily. We constructed a recombinant expression vector contained RPL31 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product was purified to obtain recombinant protein of RPL31 from the giant panda. Recombinant protein of RPL31 obtained from the experiment acted on human laryngeal carcinoma Hep-2 and human hepatoma HepG-2 cells for study of its anti-cancer activity by MTT [3-(4, 5-dimehyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] method. Then observe these cells growth depressive effect. The result indicated that the cDNA fragment of the RPL31 cloned from the giant panda is 419 bp in size, containing an open reading frame of 378 bp, and deduced protein was composed of 125 amino acids with an estimated molecular weight of 14.46-kDa and PI of 11.21. The length of the genomic sequence is 8,091 bp, which was found to possess four exons and three introns. The RPL31 gene can be readily expressed in E.coli, expecting 18-kDa polypeptide that formed inclusion bodies. Recombinant protein RPL31 from the giant panda consists of 157 amino acids with an estimated molecular weight of 17.86 kDa and PI of 10.77. The outcomes showed that the cell growth inhibition rate in a time- and dose-dependent on recombinant protein RPL31. And also indicated that the effect at low concentrations was better than high concentrations on Hep-2 cells, and the concentration of 0.33 μg/mL had the best rate of growth inhibition, 44 %. Consequently, our study aimed at revealing the recombinant protein RPL31 anti-cancer function from the giant panda

A computer model for the 30S ribosome subunit.

PubMed Central

Kuntz, I D; Crippen, G M

1980-01-01

We describe a computer-generated model for the locations of the 21 proteins of the 30S subunit of the E. coli ribosome. The model uses a new method of incorporating experimental measurements based on a mathematical technique called distance geometry. In this paper, we use data from two sources: immunoelectron microscopy and neutron-scattering studies. The data are generally self-consistent and lead to a set of relatively well-defined structures in which individual protein coordinates differ by approximately 20 A from one structure to another. Two important features of this calculation are the use of extended proteins rather than just the centers of mass, and the ability to confine the protein locations within an arbitrary boundary surface so that only solutions with an approximate 30S "shape" are permitted. PMID:7020786

Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

DOE R&D Accomplishments Database

Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

1982-06-01

This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

Na+/H+ exchanger isoform 1-induced osteopontin expression facilitates cardiac hypertrophy through p90 ribosomal S6 kinase.

PubMed

Abdulrahman, Nabeel; Jaspard-Vinassa, Beatrice; Fliegel, Larry; Jabeen, Aayesha; Riaz, Sadaf; Gadeau, Alain-Pierre; Mraiche, Fatima

2018-05-01

Cardiovascular diseases are the leading cause of death worldwide. One in three cases of heart failure is due to dilated cardiomyopathy. The Na + /H + exchanger isoform 1 (NHE1), a multifunctional protein and the key pH regulator in the heart, has been demonstrated to be increased in this condition. We have previously demonstrated that elevated NHE1 activity induced cardiac hypertrophy in vivo. Furthermore, the overexpression of active NHE1 elicited modulation of gene expression in cardiomyocytes including an upregulation of myocardial osteopontin (OPN) expression. To determine the role of OPN in inducing NHE1-mediated cardiomyocyte hypertrophy, double transgenic mice expressing active NHE1 and OPN knockout were generated and assessed by echocardiography and the cardiac phenotype. Our studies showed that hearts expressing active NHE1 exhibited cardiac remodeling indicated by increased systolic and diastolic left ventricular internal diameter and increased ventricular volume. Moreover, these hearts demonstrated impaired function with decreased fractional shortening and ejection fraction. Atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) mRNA was upregulated, and there was an increase in heart cell cross-sectional area confirming the cardiac hypertrophic effect. Moreover, NHE1 transgenic mice also showed increased collagen deposition, upregulation of CD44 and phosphorylation of p90 ribosomal s6 kinase (RSK), effects that were regressed in OPN knockout mice. In conclusion, we developed an interesting comparative model of active NHE1 transgenic mouse lines which express a dilated hypertrophic phenotype expressing CD44 and phosphorylated RSK, effects which were regressed in absence of OPN.

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

PubMed

Yu, Shoukai; Lemos, Bernardo

2016-12-31

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The ribosomes of Drosophila. II. Studies on intraspecific variation.

PubMed

Berger, E M; Weber, L

1974-12-01

Electrophoretic comparisons of 40S and 55S ribosomal subunit proteins from 18 strains of Drosophila melanogaster revealed the virtual absence of allelic variation. More detailed two-dimensional studies on the large subunit proteins in 6 of the strains demonstrated additional complexity but still no interstrain variation. The significance of these results is discussed with respect to present estimates of genic heterozygosity in natural populations.

Evolution of ribosomal proteins in Enterobacteriaceae.

PubMed Central

Hori, H; Osawa, S

1978-01-01

The evolution of ribosomal proteins of about 70 bacterial strains belonging to the family Enterobacteriaceae has been studied by use of previously reported data (S. Osawa, T. Itoh, and E. Otaka, J. Bacteriol. 107:168-178, 1971) and those obtained in this paper. The proximity of the bacteria was quantified by co-chromatographing the differentially labeled ribosomal proteins from two strains on a column of carboxymethyl cellulose in various combinations. The were then classified into 12 groups (=species?) according to their ribosomal protein compositions and were placed in a phylogenic tree. PMID:346556

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome

PubMed Central

Yu, Shoukai; Lemos, Bernardo

2016-01-01

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. PMID:27797956

Effect of 14-kDa and 47-kDa protein molecules of age garlic extract on peritoneal macrophages.

PubMed

Daneshmandi, Saeed; Hajimoradi, Monire; Ahmadabad, Hasan Namdar; Hassan, Zuhair Mohammad; Roudbary, Maryam; Ghazanfari, Tooba

2011-03-01

Garlic (Allium sativum), traditionally being used as a spice worldwide, has different applications and is claimed to possess beneficial effects in several health ailments such as tumor and atherosclerosis. Garlic is also an immunomodulator and its different components are responsible for different properties. The present work aimed to assess the effect of protein fractions of garlic on peritoneal macrophages. 14-kDa and 47-kDa protein fractions of garlic were purified. Mice peritoneal macrophages were lavaged and cultured in a microtiter plate and exposed to different concentrations of garlic proteins. MTT assay was performed to evaluate the viability of macrophage. The amount of nitric oxide (NO) was detected in culture supernatants of macrophages by Griess reagent and furthermore, the cytotoxicity study of culture supernatants was carried out on WEHI-164 fibrosarcoma cell line as tumor necrosis factor-α bioassay. MTT assay results for both 14-kDa and 47-kDa protein fractions of stimulated macrophages were not significant (P > 0.05). Both 14-kDa and 47-kDa fractions significantly suppressed production of NO from macrophages (P = 0.007 and P = 0.003, respectively). Cytotoxicity of macrophages' supernatant on WEHI-164 fibrosarcoma cells was not affected by garlic protein fractions (P = 0.066 for 14-kDa and P = 0.085 for 47-kDa fractions). according to our finding, 14-kDa and 47-kDa fractions of aged garlic extract are able to suppress NO production from macrophages, which can be used as a biological advantage. These molecules had no cytotoxic effect on macrophages and do not increase tumoricidal property of macrophages.

Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis

PubMed Central

Combs, D. Joshua; Nagel, Roland J.; Ares, Manuel; Stevens, Scott W.

2006-01-01

The known function of the DEXH/D-box protein Prp43p is the removal of the U2, U5, and U6 snRNPs from the postsplicing lariat-intron ribonucleoprotein complex. We demonstrate that affinity-purified Prp43p-associated material includes the expected spliceosomal components; however, we also identify several preribosomal complexes that are specifically purified with Prp43p. Conditional prp43 mutant alleles confer a 35S pre-rRNA processing defect, with subsequent depletion of 27S and 20S precursors. Upon a shift to a nonpermissive temperature, both large and small-ribosomal-subunit proteins accumulate in the nucleolus of prp43 mutants. Pulse-chase analysis demonstrates delayed kinetics of 35S, 27S, and 20S pre-rRNA processing with turnover of these intermediates. Microarray analysis of pre-mRNA splicing defects in prp43 mutants shows a very mild effect, similar to that of nonessential pre-mRNA splicing factors. Prp43p is the first DEXH/D-box protein shown to function in both RNA polymerase I and polymerase II transcript metabolism. Its essential function is in its newly characterized role in ribosome biogenesis of both ribosomal subunits, positioning Prp43p to regulate both pre-mRNA splicing and ribosome biogenesis. PMID:16382144

Characterization of Ribosomes from Neurospora crassa

PubMed Central

Storck, R.

1963-01-01

Ribosomes isolated from growing hyphae of Neurospora crassa contain 53 per cent protein and 47 per cent RNA and have a sedimentation coefficient of 81S at 20°C and infinite dilution. These ribosomes are stable at pH 7.4 in the presence of 0.01 M and 0.002 M MgCl2 but undergo a dissociation into smaller particles if the MgCl2 concentration is lowered to 0.0001 M. Two types of RNA with sedimentation coefficients of 19S2050 and 13S2050 have been extracted from the 81S particles. PMID:13984420

The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site

PubMed Central

Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

2015-01-01

Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

[Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

PubMed

Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

2005-01-01

Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

The historical Coffin-Lowry syndrome family revisited: identification of two novel mutations of RPS6KA3 in three male patients.

PubMed

Nishimoto, Hiromi Koso; Ha, Kyungsoo; Jones, Julie R; Dwivedi, Alka; Cho, Hyun-Min; Layman, Lawrence C; Kim, Hyung-Goo

2014-09-01

Coffin-Lowry syndrome (CLS) is a rare X-linked dominant disorder characterized by intellectual disability, craniofacial abnormalities, short stature, tapering fingers, hypotonia, and skeletal malformations. CLS is caused by mutations in the Ribosomal Protein S6 Kinase, 90 kDa, Polypeptide 3 (RPS6KA3) gene located at Xp22.12, which encodes Ribosomal S6 Kinase 2 (RSK2). Here we analyzed RPS6KA3 in three unrelated CLS patients including one from the historical Coffin-Lowry syndrome family and found two novel mutations. To date, over 140 mutations in RPS6KA3 have been reported. However, the etiology of the very first familial case, which was described in 1971 by Lowry with detailed phenotype and coined the term CLS, has remained unknown. More than 40 years after the report, we succeeded in identifying deposited fibroblast cells from one patient of this historic family and found a novel heterozygous 216 bp in-frame deletion, encompassing exons 15 and 16 of RPS6KA3. Drop episodes in CLS patients were reported to be associated with truncating mutations deleting the C-terminal kinase domain (KD), and only one missense mutation and one single basepair duplication involving the C-terminal KD of RSK2 in the patients with drop episode have been reported thus far. Here we report the first in-frame deletion in C-terminal KD of RPS6KA3 in a CLS patient with drop episodes. © 2014 Wiley Periodicals, Inc.

The expression of selected non-ribosomal peptide synthetases in Aspergillus fumigatus is controlled by the availability of free iron.

PubMed

Reiber, Kathrin; Reeves, Emer P; Neville, Claire M; Winkler, Robert; Gebhardt, Peter; Kavanagh, Kevin; Doyle, Sean

2005-07-01

Three non-ribosomal peptide synthetase genes, termed sidD, sidC and sidE, have been identified in Aspergillus fumigatus. Gene expression analysis by RT-PCR confirms that expression of both sidD and C was reduced by up to 90% under iron-replete conditions indicative of a likely role in siderophore biosynthesis. SidE expression was less sensitive to iron levels. In addition, two proteins purified from mycelia grown under iron-limiting conditions corresponded to SidD ( approximately 200 kDa) and SidC (496 kDa) as determined by MALDI ToF peptide mass fingerprinting and MALDI LIFT-ToF/ToF. Siderophore synthetases are unique in bacteria and fungi and represent an attractive target for antimicrobial chemotherapy.

Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

PubMed

Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

2014-03-01

Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

Superresolution Imaging of Ribosomes and RNA Polymerase in Live Escherichia coli Cells

PubMed Central

Bakshi, Somenath; Siryaporn, Albert; Goulian, Mark; Weisshaar, James C.

2012-01-01

Summary Quantitative spatial distributions of ribosomes (S2-YFP) and RNA polymerase (β′-yGFP) in live E. coli are measured by superresolution fluorescence microscopy. In moderate growth conditions, Nucleoid-ribosome segregation is strong, and RNAP localizes to the nucleoid lobes. The mean copy numbers per cell are 4600 RNAPs and 55,000 ribosomes. Only 10–15% of the ribosomes lie within the densest part of the nucleoid lobes, and at most 4% of the RNAPs lie in the two ribosome-rich endcaps. The predominant observed diffusion coefficient of ribosomes is Dribo = 0.04 μm2/s, attributed to free mRNA being translated by one or more 70S ribosomes. We find no clear evidence of sub-diffusion, as would arise from tethering of ribosomes. The degree of DNA-ribosome segregation strongly suggests that in E. coli most translation occurs on free mRNA transcripts that have diffused into the ribosome-rich regions. Both RNAP and ribosome radial distributions extend to the cytoplasmic membrane, consistent with the transertion hypothesis. However, few if any RNAP copies lie near the membrane of the endcaps. This suggests that if transertion occurs, it exerts a direct radially expanding force on the nucleoid, but not a direct axially expanding force. PMID:22624875

Phosphorylation of Ribosomal Protein S6 Kinase 1 at Thr421/Ser424 and Dephosphorylation at Thr389 Regulates SP600125-Induced Polyploidization of Megakaryocytic Cell Lines

PubMed Central

Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu

2014-01-01

Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125

Phosphorylation of ribosomal protein S6 kinase 1 at Thr421/Ser424 and dephosphorylation at Thr389 regulates SP600125-induced polyploidization of megakaryocytic cell lines.

PubMed

Li, Chang-Ling; Yang, Jin-Gang; Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu

2014-01-01

Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125

Human melanoma cells resistant to MAPK inhibitors can be effectively targeted by inhibition of the p90 ribosomal S6 kinase

PubMed Central

Kosnopfel, Corinna; Sinnberg, Tobias; Sauer, Birgit; Niessner, Heike; Schmitt, Anja; Makino, Elena; Forschner, Andrea; Hailfinger, Stephan; Garbe, Claus; Schittek, Birgit

2017-01-01

The clinical availability of small molecule inhibitors specifically targeting mutated BRAF marked a significant breakthrough in melanoma therapy. Despite a dramatic anti-tumour activity and improved patient survival, rapidly emerging resistance, however, greatly limits the clinical benefit. The majority of the already described resistance mechanisms involve a reactivation of the MAPK signalling pathway. The p90 ribosomal S6 kinase (RSK), a downstream effector of the MAPK signalling cascade, has been reported to enhance survival of melanoma cells in response to chemotherapy. Here, we can show that RSK activity is significantly increased in human melanoma cells with acquired resistance to the BRAFV600E/K inhibitor vemurafenib. Interestingly, inhibition of RSK signalling markedly impairs the viability of vemurafenib resistant melanoma cells and is effective both in two-dimensional and in three-dimensional culture systems, especially in a chronic, long-term application. The effect of RSK inhibition can be partly replicated by downregulation of the well-known RSK target, Y-box binding protein 1 (YB-1). Intriguingly, RSK inhibition also retains its efficacy in melanoma cells with combined resistance to vemurafenib and the MEK inhibitor trametinib. These data suggest that active RSK signalling might be an attractive novel therapeutic target in melanoma with acquired resistance to MAPK pathway inhibitors. PMID:28415756

S6K1ing to ResTOR Adipogenesis with Polycomb.

PubMed

Juan, Aster H; Sartorelli, Vittorio

2016-05-05

Signal-directed chromatin recruitment of mammalian Polycomb complexes is a fundamental component of epigenetic regulation. In this issue, Yi et al. (2016) reveal how mTORC1 activation deploys the ribosomal serine/threonine kinase S6K1 and Polycomb proteins at genomic regulatory regions to repress expression of anti-adipogenic developmental regulators. Copyright © 2016 Elsevier Inc. All rights reserved.

Non-canonical mechanism for translational control in bacteria: synthesis of ribosomal protein S1

PubMed Central

Boni, Irina V.; Artamonova, Valentina S.; Tzareva, Nina V.; Dreyfus, Marc

2001-01-01

Translation initiation region (TIR) of the rpsA mRNA encoding ribosomal protein S1 is one of the most efficient in Escherichia coli despite the absence of a canonical Shine–Dalgarno-element. Its high efficiency is under strong negative autogenous control, a puzzling phenomenon as S1 has no strict sequence specificity. To define sequence and structural elements responsible for translational efficiency and autoregulation of the rpsA mRNA, a series of rpsA′–′lacZ chromosomal fusions bearing various mutations in the rpsA TIR was created and tested for β-galactosidase activity in the absence and presence of excess S1. These in vivo results, as well as data obtained by in vitro techniques and phylogenetic comparison, allow us to propose a model for the structural and functional organization of the rpsA TIR specific for proteobacteria related to E.coli. According to the model, the high efficiency of translation initiation is provided by a specific fold of the rpsA leader forming a non-contiguous ribosome entry site, which is destroyed upon binding of free S1 when it acts as an autogenous repressor. PMID:11483525

Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

PubMed Central

Umaer, Khan; Ciganda, Martin

2014-01-01

Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

RNA and ribosomal protein patterns during aerial spore germination in Streptomyces granaticolor.

PubMed

Mikulík, K; Janda, I; Weiser, J; Stastná, J; Jiránová, A

1984-12-03

Disruption of the external sheath of Streptomyces granaticolor aerial spores and subsequent cultivation in a rich medium result in a synchronous germination. This method was used to analyze RNA and protein patterns during the germination. The germination process took place through a sequence of time-ordered events. RNA and protein synthesis started during the first 5 min and net DNA synthesis at 60-70 min of germination. Within the first 10 min of germination, synthesis of RNA was not sensitive to the inhibitory effect of rifamycin. During this period rRNA and other species including 4-5-S RNA were synthesized. Dormant spores contained populations of ribosomes or ribosomal precursors that were structurally and functionally defective. The ribosomal particles bound a sporulation pigment(s) of the melanine type. The ribosomal proteins complexed to the pigments formed insoluble aggregates which were easily removed from the ribosomes by one wash with 1 M NH4Cl. During the first 10 min of germination, pigment(s) were liberated from the complexes with the ribosomes and protein extracts of the washed ribosomes had essentially the same pattern as the extracts of ribosomes of vegetative cells. These structural alterations were accompanied by enhancement of the ribosome activities in polypeptide synthesis in vivo and in vitro. When the spores were incubated with a 14C-labelled amino acid mixture in the presence of rifamycin, only three proteins (GS1, GL1 and GS9) were identified to be radiolabelled in the extracts from the washed ribosomes. These experiments indicate that liberation of the sporulation pigment(s) from the complexes with ribosomal proteins and assembly of de novo synthesized proteins and proteins from a preexisting pool in the spore are involved in the reactivation of the ribosomes of dormant spores of S. granaticolor.

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain

PubMed Central

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan

2017-01-01

Abstract The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson–Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. PMID:28369621

Ribosome-inactivating proteins: potent poisons and molecular tools.

PubMed

Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

2013-11-15

Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms.

Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

PubMed Central

2016-01-01

The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

Saporin-S6: A Useful Tool in Cancer Therapy

PubMed Central

Polito, Letizia; Bortolotti, Massimo; Mercatelli, Daniele; Battelli, Maria Giulia; Bolognesi, Andrea

2013-01-01

Thirty years ago, the type 1 ribosome-inactivating protein (RIP) saporin-S6 (also known as saporin) was isolated from Saponaria officinalis L. seeds. Since then, the properties and mechanisms of action of saporin-S6 have been well characterized, and it has been widely employed in the construction of conjugates and immunotoxins for different purposes. These immunotoxins have shown many interesting results when used in cancer therapy, particularly in hematological tumors. The high enzymatic activity, stability and resistance to conjugation procedures and blood proteases make saporin-S6 a very useful tool in cancer therapy. High efficacy has been reported in clinical trials with saporin-S6-containing immunotoxins, at dosages that induced only mild and transient side effects, which were mainly fever, myalgias, hepatotoxicity, thrombocytopenia and vascular leak syndrome. Moreover, saporin-S6 triggers multiple cell death pathways, rendering impossible the selection of RIP-resistant mutants. In this review, some aspects of saporin-S6, such as the chemico-physical characteristics, the structural properties, its endocytosis, its intracellular routing and the pathogenetic mechanisms of the cell damage, are reported. In addition, the recent progress and developments of saporin-S6-containing immunotoxins in cancer immunotherapy are summarized, including in vitro and in vivo pre-clinical studies and clinical trials. PMID:24105401

Single-cell Pharmacodynamic Monitoring of S6 Ribosomal Protein Phosphorylation in AML Blasts During a Clinical Trial Combining the mTOR Inhibitor Sirolimus and Intensive Chemotherapy

PubMed Central

Perl, Alexander E.; Kasner, Margaret T.; Shank, Doris; Luger, Selina M.; Carroll, Martin

2011-01-01

Purpose Integration of signal transduction inhibitors into chemotherapy regimens generally has generally not led to anticipated increases in response and survival. However, it remains unclear whether this is because of inadequate or inconsistent inhibition of target or other complex biology. The mammalian target of rapamycin (mTOR) signaling pathway is frequently activated in acute myelogenous leukemia (AML) and we previously demonstrated the safety of combining the mTOR inhibitor, sirolimus, with mitoxantrone, etoposide, and cytarabine (MEC) chemotherapy. However, we did not reliably determine the extent of mTOR inhibition on that study. Here we sought to develop an assay that allowed us to serially quantify mTOR kinase’s activation state during therapy. Experimental design To provide evidence of mTOR kinase activation and inhibition, we applied a validated whole blood fixation/permeabilization technique for flow cytometry in order to serially monitor S6 ribosomal protein (S6) phosphorylation in immunophenotypically-identified AML blasts. Results With this approach, we demonstrate activation of mTOR signaling in 8/10 subjects’ samples (80%) and conclusively show inhibition of mTOR in the majority of subjects’ tumor cell during therapy. Of note, S6 phosphorylation in AML blasts is heterogeneous and, in some cases, intrinsically resistant to rapamycin at clinically achieved concentrations. Conclusions The methodology described is rapid and reproducible. We demonstrate the feasibility of real-time, direct pharmacodynamic monitoring by flow cytometry during clinical trials combining intensive chemotherapy and signal transduction inhibitors. This approach greatly clarifies pharmacokinetic/pharmacodynamic relationships and has broad application to pre-clinical and clinical testing of drugs whose direct or downstream effects disrupt PI3K/AKT/mTOR signaling. PMID:22167413

The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.

PubMed

Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M

2018-06-01

Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.

Elucidation of Motifs in Ribosomal Protein S9 That Mediate Its Nucleolar Localization and Binding to NPM1/Nucleophosmin

PubMed Central

Lindström, Mikael S.

2012-01-01

Biogenesis of eukaryotic ribosomes occurs mainly in a specific subnuclear compartment, the nucleolus, and involves the coordinated assembly of ribosomal RNA and ribosomal proteins. Identification of amino acid sequences mediating nucleolar localization of ribosomal proteins may provide important clues to understand the early steps in ribosome biogenesis. Human ribosomal protein S9 (RPS9), known in prokaryotes as RPS4, plays a critical role in ribosome biogenesis and directly binds to ribosomal RNA. RPS9 is targeted to the nucleolus but the regions in the protein that determine its localization remains unknown. Cellular expression of RPS9 deletion mutants revealed that it has three regions capable of driving nuclear localization of a fused enhanced green fluorescent protein (EGFP). The first region was mapped to the RPS9 N-terminus while the second one was located in the proteins C-terminus. The central and third region in RPS9 also behaved as a strong nucleolar localization signal and was hence sufficient to cause accumulation of EGFP in the nucleolus. RPS9 was previously shown to interact with the abundant nucleolar chaperone NPM1 (nucleophosmin). Evaluating different RPS9 fragments for their ability to bind NPM1 indicated that there are two binding sites for NPM1 on RPS9. Enforced expression of NPM1 resulted in nucleolar accumulation of a predominantly nucleoplasmic RPS9 mutant. Moreover, it was found that expression of a subset of RPS9 deletion mutants resulted in altered nucleolar morphology as evidenced by changes in the localization patterns of NPM1, fibrillarin and the silver stained nucleolar organizer regions. In conclusion, RPS9 has three regions that each are competent for nuclear localization, but only the central region acted as a potent nucleolar localization signal. Interestingly, the RPS9 nucleolar localization signal is residing in a highly conserved domain corresponding to a ribosomal RNA binding site. PMID:23285058

RNA regulators responding to ribosomal protein S15 are frequent in sequence space

PubMed Central

Slinger, Betty L.; Meyer, Michelle M.

2016-01-01

There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

PubMed

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Topography of Escherichia coli ribosomal proteins. The order of reactivity of thiol groups*

PubMed Central

Bakardjieva, Anastasia; Crichton, Robert R.

1974-01-01

1. 30S and 50S ribosomal subunits of Escherichia coli were treated with N-[2,3-14C]-ethylmaleimide and iodo[14C]acetamide. 2. The proteins in the native subunits which reacted with the reagents were S1,‡ S2, S12, S13, S18, S21, L2, L5, L6, L10, L11, L15, L17, L20, L26+28 and L27. 3. Several proteins, such as S1, S12, S14, S18, L2, L6, L10, L11 and either L26 or 28, had thiol groups in an oxidized form and reacted to a greater extent after reduction with β-mercaptoethanol or dithiothreitol. 4. The total number of thiol groups in 30S and 50S subunits was determined as 16–17 and 26–27 respectively. The total number of thiol groups in each ribosomal protein was also determined. 5. The reaction of 30S and 50S subunits with iodoacetamide under several different conditions established the order of reactivity of thiol groups. PMID:4618476

Growth Inhibition by Bupivacaine Is Associated with Inactivation of Ribosomal Protein S6 Kinase 1

PubMed Central

Beigh, Mushtaq Ahmad; Showkat, Mehvish; Bashir, Basharat; Bashir, Asma; Hussain, Mahboob ul; Andrabi, Khurshid Iqbal

2014-01-01

Bupivacaine is an amide type long acting local anesthetic used for epidural anesthesia and nerve blockade in patients. Use of bupivacaine is associated with severe cytotoxicity and apoptosis along with inhibition of cell growth and proliferation. Although inhibition of Erk, Akt, and AMPK seemingly appears to mediate some of the bupivacaine effects, potential downstream targets that mediate its effect remain unknown. S6 kinase 1 is a common downstream effector of several growth regulatory pathways involved in cell growth and proliferation known to be affected by bupivacaine. We have accordingly attempted to relate the growth inhibitory effects of bupivacaine with the status of S6K1 activity and we present evidence that decrease in cell growth and proliferation by bupivacaine is mediated through inactivation of S6 kinase 1 in a concentration and time dependent manner. We also show that ectopic expression of constitutively active S6 kinase 1 imparts substantial protection from bupivacaine induced cytotoxicity. Inactivation of S6K1 though associated with loss of putative mTOR mediated phosphorylation did not correspond with loss of similar phosphorylations in 4EBP1 indicating that S6K1 inhibition was not mediated through inactivation of mTORC1 signaling pathway or its down regulation. PMID:24605337

Role of the Phosphoinositide 3-Kinase-Akt-Mammalian Target of the Rapamycin Signaling Pathway in Long-Term Potentiation and Trace Fear Conditioning Memory in Rat Medial Prefrontal Cortex

ERIC Educational Resources Information Center

Sui, Li; Wang, Jing; Li, Bao-Ming

2008-01-01

Phosphatidylinositol 3-kinase (PI3K) and its downstream targets, including Akt (also known as protein kinase B, PKB), mammalian target of rapamycin (mTOR), the 70-kDa ribosomal S6 kinase (p70S6k), and the eukaryotic initiation factor 4E (eIF4E)-binding protein 1 (4E-BP1), may play important roles in long-term synaptic plasticity and memory in many…

RISSC: a novel database for ribosomal 16S–23S RNA genes spacer regions

PubMed Central

García-Martínez, Jesús; Bescós, Ignacio; Rodríguez-Sala, Jesús Javier; Rodríguez-Valera, Francisco

2001-01-01

A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S–23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documen­tation tool for studies on evolution, identification, typing and strain characterization, among others. PMID:11125084

A Plasma Protein Indistinguishable from Ribosomal Protein S19

PubMed Central

Semba, Umeko; Chen, Jun; Ota, Yoshihiko; Jia, Nan; Arima, Hidetoshi; Nishiura, Hiroshi; Yamamoto, Tetsuro

2010-01-01

A monocyte-chemoattracting factor is generated during blood coagulation and during clotting of platelet-rich plasma. This chemotactic factor attracts monocytes as a ligand of the C5a receptor; however, it inhibits C5a-induced neutrophil chemotaxis as an apparent receptor antagonist. The curious dual function of the serum monocyte chemotactic factor resembles that of the cross-linked homodimer of ribosomal protein S19 (RP S19). Indeed, the inactive precursor of the monocyte chemotactic factor was present in plasma, and the precursor molecule and RP S19, as well as the active form and the RP S19 dimer, were indistinguishable in terms of immunological reactivity and molecular size. Coagulation factor XIIIa, plasma transglutaminase, and membrane phosphatidylserine on the activated platelets were required for conversion of the precursor to the active form. In addition, the precursor molecule in plasma could be replaced by wild-type recombinant RP S19 but not by mutant forms of it. These results indicate that a molecule indistinguishable from RP S19 was present in plasma, and that the RP S19-like molecule was converted to the active form by a transglutaminase-catalyzed reaction on a scaffold that included the phosphatidylserine-exposed platelet membrane. PMID:20093496

Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

PubMed Central

Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

2014-01-01

Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

Gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein messenger RNAs as colonic carcinoma.

PubMed

Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B

1993-09-01

The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

NASA Technical Reports Server (NTRS)

Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

1985-01-01

The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

The 70 S monosome accumulation and in vitro initiation complex formation by Escherichia coli ribosomes at 5 C. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Broeze, R. J.; Pope, D. H.

1978-01-01

The inhibition of translation which is observed after shifting Escherichia coli to low temperature was investigated. 70 S ribosomes were isolated from E. coli 8 hours after a shift to 5 C synthesized protein in the absence of added mRNA (i.e., endogenous protein synthesis by 70 S monosomes) at a rate which was three times greater than the rate of endogenous protein synthesis by 70 S ribosomes which were isolated at the time of the shift to 5 C. Calculations based on the rates of endogenous protein synthesis and polyphenylalanine synthesis indicate that 70 S monosomes comprise only 0.1% of the total E. coli 70 S ribosome population after 8 hours at 5 c. Experiments designed to test initiation complex formation on ApUpG or formaldehyde treated MS-2 viral RNA demonstrated that, although the rate of formation of 30 S initiation complexes was not inhibited, the rate of formation of active 70 S initiation complexes, able to react with puromycin, was inhibited to a great extent at 5 C. A model depicting the effects of low temperature on the E. coli translation system is proposed.

Structure of ratcheted ribosomes with tRNAs in hybrid states

PubMed Central

Julián, Patricia; Konevega, Andrey L.; Scheres, Sjors H. W.; Lázaro, Melisa; Gil, David; Wintermeyer, Wolfgang; Rodnina, Marina V.; Valle, Mikel

2008-01-01

During protein synthesis, tRNAs and mRNA move through the ribosome between aminoacyl (A), peptidyl (P), and exit (E) sites of the ribosome in a process called translocation. Translocation is accompanied by the displacement of the tRNAs on the large ribosomal subunit toward the hybrid A/P and P/E states and by a rotational movement (ratchet) of the ribosomal subunits relative to one another. So far, the structure of the ratcheted state has been observed only when translation factors were bound to the ribosome. Using cryo-electron microscopy and classification, we show here that ribosomes can spontaneously adopt a ratcheted conformation with tRNAs in their hybrid states. The peptidyl-tRNA molecule in the A/P state, which is visualized here, is not distorted compared with the A/A state except for slight adjustments of its acceptor end, suggesting that the displacement of the A-site tRNA on the 50S subunit is passive and is induced by the 30S subunit rotation. Simultaneous subunit ratchet and formation of the tRNA hybrid states precede and may promote the subsequent rapid and coordinated tRNA translocation on the 30S subunit catalyzed by elongation factor G. PMID:18971332

The Phosphorylation of Ribosomal Protein in Lemna minor

PubMed Central

Trewavas, A.

1973-01-01

Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

PubMed Central

Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter

2015-01-01

Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308

Mutation of the key residue for extraribosomal function of ribosomal protein S19 cause increased grooming behaviors in mice.

PubMed

Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro

2016-08-26

Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

The 30 kDa protein co-purified with chick liver glutathione S-transferases is a carbonyl reductase.

PubMed

Tsai, S P; Wang, L Y; Yeh, H I; Tam, M F

1996-02-08

An unidentified 30 kDa protein was co-purified with chick liver glutathione S-transferases from S-hexylglutathione affinity column. The protein was isolated to apparent homogeneity with chromatofocusing. The molecular mass of the protein was determined to be 30 277 +/- 3 dalton by mass spectrometry. The protein was digested with Achromobacter proteinase I. Amino-acid sequence analyses of the resulting peptides show a high degree of identity with those of human carbonyl reductase. The protein is active with menadione as substrate. Thus, it is identified as chick liver carbonyl reductase.

Determination of relative amounts of ribosome and subunits in Escherichia coli using asymmetrical flow field-flow fractionation.

PubMed

Nilsson, M; Birnbaum, S; Wahlund, K G

1996-10-15

The 30S and 50S subunits and the 70S ribosome of Escherichia coli were separated in 6 minutes by using asymmetrical flow field-flow fractionation (FFF). The total analysis time for determination of the relative amounts of ribosomes and free subunits in a preparation from a cell suspension was 8 min. The method can detect a change in the mass fraction of ribosomes if it exceeds approx, 10%. The separation is based on differences in diffusion coefficients, i.e., hydrodynamic diameters, and these can be determined from observed retention times. The hydrodynamic diameters were in good agreement with literature values obtained from electron microscopy. The mass fraction of ribosomes changed as a function of the magnesium ion concentration which confirms previous knowledge and shows the accuracy of the method. The method appears as an alternative to ultracentrifugation analysis and avoids some of its drawbacks and artefacts. An obvious application can be the optimisation of cell design in metabolic engineering in order to maximise translation and protein production.

Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

PubMed Central

Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

2016-01-01

Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

Overexpression, purification, molecular characterization and the effect on tumor growth of ribosomal protein L22 from the Giant Panda (Ailuropoda melanoleuca).

PubMed

Li, Jian; Hou, Yiling; Ding, Xiang; Hou, Wanru; Song, Bo; Zeng, Yichun

2014-05-01

The ribosomal protein L22 (RPL22) protein belongs to the L22E family of ribosomal proteins. It is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of RPL22 of the Giant Panda (Ailuropoda melanoleuca). The cDNA of RPL22 was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL22 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. The result indicated that the length of the fragment cloned is 414 bp, and it contains an open-reading frame of 387 bp encoding 128 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL22 protein is 14.74 kDa with a theoretical pI 9.21. The RPL22 gene can be really expressed in E. coli and the RPL22 protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 20.1 kDa polypeptide. The data showed that the recombinant protein RPL22 had a time- and dose-dependency on the cell growth inhibition rate. The human laryngeal carcinoma Hep-2 cells treated with 0.05-6 μg/ml of RPL22 for 24 h displayed significant cell growth inhibition (p<0.05, n=8) in assayed using MTT compared to the control (untreated) cells. The data indicate that the effect at low concentrations is better than high concentrations, and the concentration of 1.5 μg/ml has the best rate of growth inhibition of 47.70%. The inhibitory rate in mice treated with 1.5 μg/ml RPL22 protein can reach 43.75%. Histology of tumor organs shows that the tissues arranged looser in RPL22 group than those in control group. Meanwhile, there is no obvious damage to other organs, such as heart, lung and kidney. Further research is on going to determine the bioactive principle(s) of recombinant protein RPL22 responsible for its anticancer activity.

An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.

PubMed

Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben

2018-01-04

sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ribosome A and P sites revealed by length analysis of ribosome profiling data

PubMed Central

Martens, Andrew T.; Taylor, James; Hilser, Vincent J.

2015-01-01

The high-throughput sequencing of nuclease-protected mRNA fragments bound to ribosomes, a technique known as ribosome profiling, quantifies the relative frequencies with which different regions of transcripts are translated. This technique has revealed novel translation initiation sites with unprecedented scope and has furthered investigations into the connections between codon biases and translation rates. Yet the location of the codon being decoded in ribosome footprints is still unknown, and has been complicated by the recent observation of footprints with non-canonical lengths. Here we show how taking into account the variations in ribosome footprint lengths can reveal the ribosome aminoacyl (A) and peptidyl (P) site locations. These location assignments are in agreement with the proposed mechanisms for various ribosome pauses and further enhance the resolution of the profiling data. We also show that GC-rich motifs at the 5′ ends of footprints are found in yeast, calling into question the anti-Shine-Dalgarno effect's role in ribosome pausing. PMID:25805170

Biochemical characterization of the 49 kDa penicillin-binding protein of Mycobacterium smegmatis.

PubMed Central

Mukherjee, T; Basu, D; Mahapatra, S; Goffin, C; van Beeumen, J; Basu, J

1996-01-01

The 49 kDa penicillin-binding protein (PBP) of Mycobacterium smegmatis catalyses the hydrolysis of the peptide or S-ester bond of carbonyl donors R1-CONH-CHR2-COX-CHR2-COO- (where X is NH or S). In the presence of a suitable amino acceptor, the reaction partitions between the transpeptidation and hydrolysis pathways, with the amino acceptor, behaving as a simple alternative nucleophile at the level of the acyl-enzyme. By virtue of its N-terminal sequence similarity, the 49 kDa PBP represents one of the class of monofunctional low-molecular-mass PBPs. An immunologically related protein of M(r) 52,000 is present in M. tuberculosis. The 49 kDa PBP is sensitive towards amoxycillin, imipenem, flomoxef and cefoxitin. PMID:8947487

Revisiting the structures of several antibiotics bound to the bacterial ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bulkley, David; Innis, C. Axel; Blaha, Gregor

2010-10-08

The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less

Revisiting the Structures of Several Antibiotics Bound to the Bacterial Ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

D Bulkley; C Innis; G Blaha

2011-12-31

The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less

A Hexane Fraction of Guava Leaves (Psidium guajava L.) Induces Anticancer Activity by Suppressing AKT/Mammalian Target of Rapamycin/Ribosomal p70 S6 Kinase in Human Prostate Cancer Cells

PubMed Central

Ryu, Nae Hyung; Park, Kyung-Ran; Kim, Sung-Moo; Yun, Hyung-Mun; Nam, Dongwoo; Lee, Seok-Geun; Jang, Hyeung-Jin; Ahn, Kyoo Seok; Kim, Sung-Hoon; Shim, Bum Sang; Choi, Seung-Hoon; Mosaddik, Ashik

2012-01-01

Abstract This study was carried out to evaluate the anticancer effects of guava leaf extracts and its fractions. The chemical compositions of the active extracts were also determined. In the present study, we set out to determine whether the anticancer effects of guava leaves are linked with their ability to suppress constitutive AKT/mammalian target of rapamycin (mTOR)/ribosomal p70 S6 kinase (S6K1) and mitogen-activated protein kinase (MAPK) activation pathways in human prostate cancer cells. We found that guava leaf hexane fraction (GHF) was the most potent inducer of cytotoxic and apoptotic effects in PC-3 cells. The molecular mechanism or mechanisms of GHF apoptotic potential were correlated with the suppression of AKT/mTOR/S6K1 and MAPK signaling pathways. This effect of GHF correlated with down-regulation of various proteins that mediate cell proliferation, cell survival, metastasis, and angiogenesis. Analysis of GHF by gas chromatography and gas chromatography–mass spectrometry tentatively identified 60 compounds, including β-eudesmol (11.98%), α-copaene (7.97%), phytol (7.95%), α-patchoulene (3.76%), β-caryophyllene oxide (CPO) (3.63%), caryophylla-3(15),7(14)-dien-6-ol (2.68%), (E)-methyl isoeugenol (1.90%), α-terpineol (1.76%), and octadecane (1.23%). Besides GHF, CPO, but not phytol, also inhibited the AKT/mTOR/S6K1 signaling pathway and induced apoptosis in prostate cancer cells. Overall, these findings suggest that guava leaves can interfere with multiple signaling cascades linked with tumorigenesis and provide a source of potential therapeutic compounds for both the prevention and treatment of cancer. PMID:22280146

A hexane fraction of guava Leaves (Psidium guajava L.) induces anticancer activity by suppressing AKT/mammalian target of rapamycin/ribosomal p70 S6 kinase in human prostate cancer cells.

PubMed

Ryu, Nae Hyung; Park, Kyung-Ran; Kim, Sung-Moo; Yun, Hyung-Mun; Nam, Dongwoo; Lee, Seok-Geun; Jang, Hyeung-Jin; Ahn, Kyoo Seok; Kim, Sung-Hoon; Shim, Bum Sang; Choi, Seung-Hoon; Mosaddik, Ashik; Cho, Somi K; Ahn, Kwang Seok

2012-03-01

This study was carried out to evaluate the anticancer effects of guava leaf extracts and its fractions. The chemical compositions of the active extracts were also determined. In the present study, we set out to determine whether the anticancer effects of guava leaves are linked with their ability to suppress constitutive AKT/mammalian target of rapamycin (mTOR)/ribosomal p70 S6 kinase (S6K1) and mitogen-activated protein kinase (MAPK) activation pathways in human prostate cancer cells. We found that guava leaf hexane fraction (GHF) was the most potent inducer of cytotoxic and apoptotic effects in PC-3 cells. The molecular mechanism or mechanisms of GHF apoptotic potential were correlated with the suppression of AKT/mTOR/S6K1 and MAPK signaling pathways. This effect of GHF correlated with down-regulation of various proteins that mediate cell proliferation, cell survival, metastasis, and angiogenesis. Analysis of GHF by gas chromatography and gas chromatography-mass spectrometry tentatively identified 60 compounds, including β-eudesmol (11.98%), α-copaene (7.97%), phytol (7.95%), α-patchoulene (3.76%), β-caryophyllene oxide (CPO) (3.63%), caryophylla-3(15),7(14)-dien-6-ol (2.68%), (E)-methyl isoeugenol (1.90%), α-terpineol (1.76%), and octadecane (1.23%). Besides GHF, CPO, but not phytol, also inhibited the AKT/mTOR/S6K1 signaling pathway and induced apoptosis in prostate cancer cells. Overall, these findings suggest that guava leaves can interfere with multiple signaling cascades linked with tumorigenesis and provide a source of potential therapeutic compounds for both the prevention and treatment of cancer.

Reengineering ribosome export.

PubMed

Lo, Kai-Yin; Johnson, Arlen W

2009-03-01

Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.

Reengineering Ribosome Export

PubMed Central

Lo, Kai-Yin

2009-01-01

Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820

Deletion of L4 domains reveals insights into the importance of ribosomal protein extensions in eukaryotic ribosome assembly.

PubMed

Gamalinda, Michael; Woolford, John L

2014-11-01

Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Multicentric prevalence study of anti P ribosomal autoantibodies in juvenile onset systemic lupus erythematosus compared with adult onset systemic lupus erythematosus.

PubMed

Pisoni, Cecilia N; Muñoz, Sebastián Andrés; Carrizo, Carolina; Cosatti, Micaela; Álvarez, Analía; Dubinsky, Diana; Bresan, Eleonora; Russo, Ricardo; Borgia, Ezequiel; García, Mercedes; Sansinanea, Pierina; Basta, María Cristina; D'Amico, Maria Agustina; Barreira, Juan Carlos; Lancioni, Eliana; Soriano, Enrique; Cunto, Carmen de; Beron, Ana; Eimon, Alicia

2015-01-01

To investigate the prevalence and associations with clinical manifestations of anti- P ribosomal antibodies in patients with juvenile-onset and adult-onset systemic lupus erythematosus (SLE). Clinical and serological data of 30 patients with juvenile-onset SLE (age at onset younger than 16 years old) were compared with data of 92 patients with adult-onset SLE. Symptoms occurring during the entire disease course were considered. Anti- P ribosomal antibodies were tested by ELISA. Anti- P ribosomal antibodies were found significantly more often in pediatric-onset SLE patients (26.7% vs. 6.5%; OR=5.21 [CI95%=1.6-16.5], p=0.003). Alopecia (OR=10.11, CI 95%=1.25-97) and skin rash (non discoid) (OR=4.1, CI 95%=1.25-13.89) were significantly associated with anti- P ribosomal antibodies. Anti-ribosomal P antibodies are more often found in patients with juvenile SLE. Alopecia and skin rash were the only clinical manifestations associated to anti-ribosomal P antibodies. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

Ribosome protection by antibiotic resistance ATP-binding cassette protein.

PubMed

Su, Weixin; Kumar, Veerendra; Ding, Yichen; Ero, Rya; Serra, Aida; Lee, Benjamin Sian Teck; Wong, Andrew See Weng; Shi, Jian; Sze, Siu Kwan; Yang, Liang; Gao, Yong-Gui

2018-05-15

The ribosome is one of the richest targets for antibiotics. Unfortunately, antibiotic resistance is an urgent issue in clinical practice. Several ATP-binding cassette family proteins confer resistance to ribosome-targeting antibiotics through a yet unknown mechanism. Among them, MsrE has been implicated in macrolide resistance. Here, we report the cryo-EM structure of ATP form MsrE bound to the ribosome. Unlike previously characterized ribosomal protection proteins, MsrE is shown to bind to ribosomal exit site. Our structure reveals that the domain linker forms a unique needle-like arrangement with two crossed helices connected by an extended loop projecting into the peptidyl-transferase center and the nascent peptide exit tunnel, where numerous antibiotics bind. In combination with biochemical assays, our structure provides insight into how MsrE binding leads to conformational changes, which results in the release of the drug. This mechanism appears to be universal for the ABC-F type ribosome protection proteins. Copyright © 2018 the Author(s). Published by PNAS.

Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry

Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering withmore » translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.« less

Immunosuppressive Yersinia Effector YopM Binds DEAD Box Helicase DDX3 to Control Ribosomal S6 Kinase in the Nucleus of Host Cells.

PubMed

Berneking, Laura; Schnapp, Marie; Rumm, Andreas; Trasak, Claudia; Ruckdeschel, Klaus; Alawi, Malik; Grundhoff, Adam; Kikhney, Alexey G; Koch-Nolte, Friedrich; Buck, Friedrich; Perbandt, Markus; Betzel, Christian; Svergun, Dmitri I; Hentschke, Moritz; Aepfelbacher, Martin

2016-06-01

Yersinia outer protein M (YopM) is a crucial immunosuppressive effector of the plaque agent Yersinia pestis and other pathogenic Yersinia species. YopM enters the nucleus of host cells but neither the mechanisms governing its nucleocytoplasmic shuttling nor its intranuclear activities are known. Here we identify the DEAD-box helicase 3 (DDX3) as a novel interaction partner of Y. enterocolitica YopM and present the three-dimensional structure of a YopM:DDX3 complex. Knockdown of DDX3 or inhibition of the exportin chromosomal maintenance 1 (CRM1) increased the nuclear level of YopM suggesting that YopM exploits DDX3 to exit the nucleus via the CRM1 export pathway. Increased nuclear YopM levels caused enhanced phosphorylation of Ribosomal S6 Kinase 1 (RSK1) in the nucleus. In Y. enterocolitica infected primary human macrophages YopM increased the level of Interleukin-10 (IL-10) mRNA and this effect required interaction of YopM with RSK and was enhanced by blocking YopM's nuclear export. We propose that the DDX3/CRM1 mediated nucleocytoplasmic shuttling of YopM determines the extent of phosphorylation of RSK in the nucleus to control transcription of immunosuppressive cytokines.

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Massively Convergent Evolution for Ribosomal Protein Gene Content in Plastid and Mitochondrial Genomes

PubMed Central

Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.

2013-01-01

Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312

A Novel Marker for Purkinje Cells, Ribosomal Protein MPS1/S27: Expression of MPS1 in Human Cerebellum.

PubMed

Fernandez-Pol, J Alberto

2016-01-01

The ribosomal protein metallopanstimulin-1 (MPS1/S27) serves critical survival purposes in cell division, in normal and cancerous cells; for this reason, selective pressures of evolution have conserved the DNA sequences encoding MPS1/S27 in Archaea and Eukariotic cells. The expression of MPS1/S27 protein in human adult cerebellum has not been established. The presence of MPS1/S27, was screened in paraffin-embedded human adult brain specimens processed for tissue inmunohistochemistry. Affinity-purified specific antibodies were directed against the N-terminus of MPS1. The antibodies to MPS1 detected Purkinje cells (PC) and their dendrites. In PC, MPS1 antigen-positive staining was found in: the nucleolus, which was strongly stained; ribosomes attached to the external nuclear membrane; cytoplasm of PC, with strong staining in a punctuate fashion; the soma-attached large dendrite trunks of PC, which were MPS1 antigen-positive; and the granular cell layer, where cellular staining in a few cells that appeared to resemble smaller PC was observed. Since MPS1 is involved in cell division, DNA repair, and ribosomal biogenesis, it may be a useful antigen for studying processes such as protein synthesis, oncogenesis, regeneration, aging, and perhaps diseases of the human cerebellum. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Cryo-EM structure of the large subunit of the spinach chloroplast ribosome

PubMed Central

Ahmed, Tofayel; Yin, Zhan; Bhushan, Shashi

2016-01-01

Protein synthesis in the chloroplast is mediated by the chloroplast ribosome (chloro-ribosome). Overall architecture of the chloro-ribosome is considerably similar to the Escherichia coli (E. coli) ribosome but certain differences are evident. The chloro-ribosome proteins are generally larger because of the presence of chloroplast-specific extensions in their N- and C-termini. The chloro-ribosome harbours six plastid-specific ribosomal proteins (PSRPs); four in the small subunit and two in the large subunit. Deletions and insertions occur throughout the rRNA sequence of the chloro-ribosome (except for the conserved peptidyl transferase center region) but the overall length of the rRNAs do not change significantly, compared to the E. coli. Although, recent advancements in cryo-electron microscopy (cryo-EM) have provided detailed high-resolution structures of ribosomes from many different sources, a high-resolution structure of the chloro-ribosome is still lacking. Here, we present a cryo-EM structure of the large subunit of the chloro-ribosome from spinach (Spinacia oleracea) at an average resolution of 3.5 Å. High-resolution map enabled us to localize and model chloro-ribosome proteins, chloroplast-specific protein extensions, two PSRPs (PSRP5 and 6) and three rRNA molecules present in the chloro-ribosome. Although comparable to E. coli, the polypeptide tunnel and the tunnel exit site show chloroplast-specific features. PMID:27762343

Structure of the ribosome post-recycling complex probed by chemical cross-linking and mass spectrometry

PubMed Central

Kiosze-Becker, Kristin; Ori, Alessandro; Gerovac, Milan; Heuer, André; Nürenberg-Goloub, Elina; Rashid, Umar Jan; Becker, Thomas; Beckmann, Roland; Beck, Martin; Tampé, Robert

2016-01-01

Ribosome recycling orchestrated by the ATP binding cassette (ABC) protein ABCE1 can be considered as the final—or the first—step within the cyclic process of protein synthesis, connecting translation termination and mRNA surveillance with re-initiation. An ATP-dependent tweezer-like motion of the nucleotide-binding domains in ABCE1 transfers mechanical energy to the ribosome and tears the ribosome subunits apart. The post-recycling complex (PRC) then re-initiates mRNA translation. Here, we probed the so far unknown architecture of the 1-MDa PRC (40S/30S·ABCE1) by chemical cross-linking and mass spectrometry (XL-MS). Our study reveals ABCE1 bound to the translational factor-binding (GTPase) site with multiple cross-link contacts of the helix–loop–helix motif to the S24e ribosomal protein. Cross-linking of the FeS cluster domain to the ribosomal protein S12 substantiates an extreme lever-arm movement of the FeS cluster domain during ribosome recycling. We were thus able to reconstitute and structurally analyse a key complex in the translational cycle, resembling the link between translation initiation and ribosome recycling. PMID:27824037

The ribosomal subunit assembly line

PubMed Central

Dlakić, Mensur

2005-01-01

Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

PubMed

Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

1995-01-01

Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

Strain improvement by combined UV mutagenesis and ribosome engineering and subsequent fermentation optimization for enhanced 6'-deoxy-bleomycin Z production.

PubMed

Zhu, Xiangcheng; Kong, Jieqian; Yang, Hu; Huang, Rong; Huang, Yong; Yang, Dong; Shen, Ben; Duan, Yanwen

2018-02-01

The bleomycins (BLMs) are important clinical drugs extensively used in combination chemotherapy for the treatment of various cancers. Dose-dependent lung toxicity and the development of drug resistance have restricted their wide applications. 6'-Deoxy-BLM Z, a recently engineered BLM analogue with improved antitumor activity, has the potential to be developed into the next-generation BLM anticancer drug. However, its low titer in the recombinant strain Streptomyces flavoviridis SB9026 has hampered current efforts, which require sufficient compound, to pursue preclinical studies and subsequent clinical development. Here, we report the strain improvement by combined UV mutagenesis and ribosome engineering, as well as the fermentation optimization, for enhanced 6'-deoxy-BLM production. A high producer, named S. flavoviridis G-4F12, was successfully isolated, producing 6'-deoxy-BLM at above 70 mg/L under the optimized fermentation conditions, representing a sevenfold increase in comparison with that of the original producer. These findings demonstrated the effectiveness of combined empirical breeding methods in strain improvement and set the stage for sustainable production of 6'-deoxy-BLM via pilot-scale microbial fermentation.

[Immunochemistry of eukaryotic ribosomes].

PubMed

Lopaczyński, W; Gałasiński, W

1990-01-01

Immunochemical investigations of ribosomes should correlate with basic knowledge of the function, structure and activity of organelles in the cell processes. Our paper presents data of immunochemical methods used to determine the structure, function and differences of ribosomes. We present the usefulness of immunochemical methods to test human ribosomes, diagnosis and therapy of many diseases.

25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

NASA Technical Reports Server (NTRS)

Baharaeen, S.; Vishniac, H. S.

1984-01-01

Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsurugi, K.; Motizuki, M.; Mitsui, K.

1988-01-01

When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were /sup 3/H-labeled in vitro and injected back into X. laevis oocytes, most /sup 3/H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, /sup 3/H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of /sup 3/H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide,more » a cysteine protease inhibitor, resulting in the accumulation of /sup 3/H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus.« less

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

Usefulness of 8 kDa protein of Fasciola hepatica in diagnosis of fascioliasis

PubMed Central

Kim, Kwangsig; Yang, Hyun Jong

2003-01-01

This study was designed to detect and evaluate an antigenicity of low molecular weight proteins of Fasciola hepatica in fascioliasis. Low molecular weight protein of F. hepatica was purified by ammonium sulfate precipitation and Sephacryl S-100 HR gel filtration. The protein obtained was estimated to be 8 kDa on 7.5-15% gradient sodium dodecyl sulfate gel electrophoresis. Immunoblotting studies showed that the 8 kDa protein reacted with human fascioliasis sera, but not other trematodiasis sera. This result suggests that the 8 kDa protein of F. hepatica is one of diagnostic antigens in human fascioliasis without cross-reaction with other human trematodiasis. PMID:12815325

NMR structure and Mg2+ binding of an RNA segment that underlies the L7/L12 stalk in the E.coli 50S ribosomal subunit

PubMed Central

Zhao, Qin; Nagaswamy, Uma; Lee, Hunjoong; Xia, Youlin; Huang, Hung-Chung; Gao, Xiaolian; Fox, George E.

2005-01-01

Helix 42 of Domain II of Escherichia coli 23S ribosomal RNA underlies the L7/L12 stalk in the ribosome and may be significant in positioning this feature relative to the rest of the 50S ribosomal subunit. Unlike the Haloarcula marismortui and Deinococcus radiodurans examples, the lower portion of helix 42 in E.coli contains two consecutive G•A oppositions with both adenines on the same side of the stem. Herein, the structure of an analog of positions 1037–1043 and 1112–1118 in the helix 42 region is reported. NMR spectra and structure calculations support a cis Watson–Crick/Watson–Crick (cis W.C.) G•A conformation for the tandem (G•A)2 in the analog and a minimally perturbed helical duplex stem. Mg2+ titration studies imply that the cis W.C. geometry of the tandem (G•A)2 probably allows O6 of G20 and N1 of A4 to coordinate with a Mg2+ ion as indicated by the largest chemical shift changes associated with the imino group of G20 and the H8 of G20 and A4. A cross-strand bridging Mg2+ coordination has also been found in a different sequence context in the crystal structure of H.marismortui 23S rRNA, and therefore it may be a rare but general motif in Mg2+ coordination. PMID:15939932

The fluctuating ribosome: thermal molecular dynamics characterized by neutron scattering

NASA Astrophysics Data System (ADS)

Zaccai, Giuseppe; Natali, Francesca; Peters, Judith; Řihová, Martina; Zimmerman, Ella; Ollivier, J.; Combet, J.; Maurel, Marie-Christine; Bashan, Anat; Yonath, Ada

2016-11-01

Conformational changes associated with ribosome function have been identified by X-ray crystallography and cryo-electron microscopy. These methods, however, inform poorly on timescales. Neutron scattering is well adapted for direct measurements of thermal molecular dynamics, the ‘lubricant’ for the conformational fluctuations required for biological activity. The method was applied to compare water dynamics and conformational fluctuations in the 30 S and 50 S ribosomal subunits from Haloarcula marismortui, under high salt, stable conditions. Similar free and hydration water diffusion parameters are found for both subunits. With respect to the 50 S subunit, the 30 S is characterized by a softer force constant and larger mean square displacements (MSD), which would facilitate conformational adjustments required for messenger and transfer RNA binding. It has been shown previously that systems from mesophiles and extremophiles are adapted to have similar MSD under their respective physiological conditions. This suggests that the results presented are not specific to halophiles in high salt but a general property of ribosome dynamics under corresponding, active conditions. The current study opens new perspectives for neutron scattering characterization of component functional molecular dynamics within the ribosome.

Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

PubMed

Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

1987-11-01

Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation

PubMed Central

Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A

2011-01-01

The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906

Selective ribosome profiling as a tool to study the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes

PubMed Central

Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd

2014-01-01

A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347

Cis-regulatory RNA elements that regulate specialized ribosome activity.

PubMed

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

Macrolide antibiotic interaction and resistance on the bacterial ribosome.

PubMed

Poehlsgaard, Jacob; Douthwaite, Stephen

2003-02-01

Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

PubMed

Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

2014-11-01

Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

PubMed Central

Lill, R; Robertson, J M; Wintermeyer, W

1989-01-01

A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

PubMed Central

Li, Bin; Pacey, Marissa P.

2017-01-01

We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

Enhanced expression of glucose transporter-1 in vascular smooth muscle cells via the Akt/tuberous sclerosis complex subunit 2 (TSC2)/mammalian target of rapamycin (mTOR)/ribosomal S6 protein kinase (S6K) pathway in experimental renal failure.

PubMed

Lin, Chih-Yuan; Hsu, Shih-Che; Lee, Herng-Sheng; Lin, Shih-Hua; Tsai, Chien-Sung; Huang, Shih-Ming; Shih, Chun-Che; Hsu, Yu-Juei

2013-02-01

Chronic renal failure (CRF) is associated with increased cardiovascular mortality, and medial vascular smooth muscle cell (VSMC) hypertrophy, proliferation, and calcification play a pivotal role in uremic vasculopathy. Glucose transporter-1 (GLUT1) facilitates the transport of glucose into VSMCs, and GLUT1 overexpression associated with high glucose influx leads to a stimulation of VSMC proliferation. However, the role of GLUT1 in uremic vasculopathy remains unclear. This study aimed to identify changes in the expression of GLUT1 in VSMCs in the setting of experimental uremia and investigate whether Akt/tuberous sclerosis complex subunit 2 (TSC2)/mammalian target of rapamycin (mTOR)/ribosomal S6 protein kinase (S6K) signaling, which plays a crucial role in VSMC proliferation and glucose metabolism, is involved in the regulation of GLUT1 expression. In vivo experimental CRF was induced in Wistar rats by 5/6 nephrectomy, and the GLUT1 expression in aortic tissue was determined by the reverse transcriptase-polymerase chain reaction, immunoblotting, and immunohistochemical staining. Indoxyl sulfate (IS) is a uremic retention solute proven with pro-proliferative effect on rat VSMCs, and we further studied the expression of GLUT1 in rat A7r5 rat embryonic aortic cells stimulated by IS in the presence or absence of phloretin, a GLUT1 inhibitor, to explore the pathogenic role of GLUT1 in uremic vasculopathy. The contribution of Akt/TSC2/mTOR/S6K signaling in modifying the GLUT1 expression was also assessed. Eight weeks after 5/6 nephrectomy, aortic tissue obtained from CRF rats exhibited increased wall thickness and VSMC hypertrophy, hyperplasia, and degeneration. Compared with the sham-operated control group, the messenger (m)RNA and protein abundance of GLUT1 were both markedly increased in CRF rats. In vitro, IS induced a significant increase in expression of GLUT1 protein as well as pro-proliferative cyclin D1 and p21 mRNA and a modest increase in expression of

Structural characterization of ribosome recruitment and translocation by type IV IRES.

PubMed

Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

2016-05-09

Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation.

Structural characterization of ribosome recruitment and translocation by type IV IRES

PubMed Central

Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

2016-01-01

Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

Purification and characterization of a novel type i ribosome inactivating protein, pachyerosin, from Pachyrhizus erosus seeds, and preparation of its immunotoxin against human hepatoma cells.

PubMed

Guo, Jin-Lin; Cheng, Yuan-Liu; Qiu, Yi; Shen, Cai-Hong; Yi, Bin; Peng, Cheng

2014-07-01

Pachyrhizus erosus seeds have a high protein content and are used in China due to their cytotoxic effect. Here we report the biological and pharmacological activity of the protein extracts from P. erosus seeds. A novel ribosome-inactivating protein, pachyerosin, from P. erosus seeds was successively purified to homogeneity using ammonium sulfate precipitation, DEAE-sepharose FF, and Sephacryl S-200. Pachyerosin showed to be a type I ribosome-inactivating protein with a molecular mass of 29 kDa and an isoelectric point of 9.19. It strongly inhibited protein synthesis of rabbit reticulocyte lysate with an IC50 of 0.37 ng/mL and showed N-glycosidase activity on rat liver ribosomes with an EC50 of 85.9 pM. The N-terminal 27 amino acids of pachyerosin revealed a 60.71% sequence identity with abrin A from the seeds of Abrus precatorius. With the aim of targeting the delivery of pachyerosin, immunotoxin was prepared by conjugating pachyerosin with anti-human AFP monoclonal antibodies SM0736. The immunotoxin pachyerosin-SM0736 efficiently inhibited the growth of the human hepatoma cell line HuH-7 with an IC50 of 0.050 ± 0.004 nM, 2360 times lower than that of pachyerosin and 430 times lower than that of the immunotoxin against human gastric cancer cell line SGC7901. These results imply that pachyerosin may be used as a new promising anticancer agent. Georg Thieme Verlag KG Stuttgart · New York.

Mechanisms of In Vivo Ribosome Maintenance Change in Response to Nutrient Signals*

PubMed Central

Mathis, Andrew D.; Naylor, Bradley C.; Carson, Richard H.; Evans, Eric; Harwell, Justin; Knecht, Jared; Hexem, Eric; Peelor, Fredrick F.; Miller, Benjamin F.; Hamilton, Karyn L.; Transtrum, Mark K.; Bikman, Benjamin T.; Price, John C.

2017-01-01

Control of protein homeostasis is fundamental to the health and longevity of all organisms. Because the rate of protein synthesis by ribosomes is a central control point in this process, regulation, and maintenance of ribosome function could have amplified importance in the overall regulatory circuit. Indeed, ribosomal defects are commonly associated with loss of protein homeostasis, aging, and disease (1–4), whereas improved protein homeostasis, implying optimal ribosomal function, is associated with disease resistance and increased lifespan (5–7). To maintain a high-quality ribosome population within the cell, dysfunctional ribosomes are targeted for autophagic degradation. It is not known if complete degradation is the only mechanism for eukaryotic ribosome maintenance or if they might also be repaired by replacement of defective components. We used stable-isotope feeding and protein mass spectrometry to measure the kinetics of turnover of ribosomal RNA (rRNA) and 71 ribosomal proteins (r-proteins) in mice. The results indicate that exchange of individual proteins and whole ribosome degradation both contribute to ribosome maintenance in vivo. In general, peripheral r-proteins and those with more direct roles in peptide-bond formation are replaced multiple times during the lifespan of the assembled structure, presumably by exchange with a free cytoplasmic pool, whereas the majority of r-proteins are stably incorporated for the lifetime of the ribosome. Dietary signals impact the rates of both new ribosome assembly and component exchange. Signal-specific modulation of ribosomal repair and degradation could provide a mechanistic link in the frequently observed associations among diminished rates of protein synthesis, increased autophagy, and greater longevity (5, 6, 8, 9). PMID:27932527

Purification and characterization of a 22-kDa microsomal protein from rat parotid gland which is phosphorylated following stimulation by agonists involving cAMP as second messenger.

PubMed

Thiel, G; Schmidt, W E; Meyer, H E; Söling, H D

1988-01-04

Stimulation of secretion in exocrine glands by agonists involving cAMP as second messenger leads to the phosphorylation of the ribosomal protein S6 (protein I) and two other particulate proteins with apparent molecular masses of 24 kDa (protein II) and 22 kDa (protein III) [Jahn, R., Unger, C. & Söling, H. D. (1980) Eur. J. Biochem. 112, 345-352]. This report describes the purification and characterization of protein III. Solubilization studies indicate that protein III is an intrinsic membrane protein. It could be extracted from the endoplasmic reticulum membrane only with Triton X-100, SDS or concentrated formic or acetic acid. The purification of this protein involved extraction of the microsomes with Triton X-100, removal of the detergent by acetone precipitation, extraction of water-soluble proteins, lipids and lipoproteins, and preparative SDS polyacrylamide gel electrophoresis. The protein has a basic pI (greater than 8.7). For determination of the amino acid composition of protein III and for sequencing of its amino-terminal portion, the protein was electroeluted out off the gel, the detergent removed and the protein finally purified by reversed-phase HPLC. Protein III could be phosphorylated in vitro by the catalytic subunit of the cAMP-dependent protein kinase to a degree of approximately 0.14 mol phosphate/mol protein. The only phosphopeptide obtained after in vitro phosphorylation and subsequent tryptic or chymotryptic digestion was identical with the phosphopeptide obtained after stimulation of intact rat parotid gland lobules with isoproterenol. The sequence of this peptide was Lys-Leu-Ser(P)-Glu-Ala-Asp-Asn-Arg. It was confirmed by an analysis of the synthetic peptide following in vitro phosphorylation with cAMP-dependent protein kinase. The first 41 N-terminal residues of protein III were sequenced. So far no sequence homology with other known peptides or proteins could be found.

Identification of p90 Ribosomal S6 Kinase 2 as a Novel Host Protein in HBx Augmenting HBV Replication by iTRAQ-Based Quantitative Comparative Proteomics.

PubMed

Yan, Li-Bo; Yu, You-Jia; Zhang, Qing-Bo; Tang, Xiao-Qiong; Bai, Lang; Huang, FeiJun; Tang, Hong

2018-05-01

The aim of this study was to screen for novel host proteins that play a role in HBx augmenting Hepatitis B virus (HBV) replication. Three HepG2 cell lines stably harboring different functional domains of HBx (HBx, HBx-Cm6, and HBx-Cm16) were cultured. ITRAQ technology integrated with LC-MS/MS analysis was applied to identify the proteome differences among these three cell lines. In brief, a total of 70 different proteins were identified among HepG2-HBx, HepG2-HBx-Cm6, and HepG2-HBx-Cm16 by double repetition. Several differentially expressed proteins, including p90 ribosomal S6 kinase 2 (RSK2), were further validated. RSK2 was expressed at higher levels in HepG2-HBx and HepG2-HBx-Cm6 compared with HepG2-HBx-Cm16. Furthermore, levels of HBV replication intermediates were decreased after silencing RSK2 in HepG2.2.15. An HBx-minus HBV mutant genome led to decreased levels of HBV replication intermediates and these decreases were restored to levels similar to wild-type HBV by transient ectopic expression of HBx. After silencing RSK2 expression, the levels of HBV replication intermediates synthesized from the HBx-minus HBV mutant genome were not restored to levels that were observed with wild-type HBV by transient HBx expression. Based on iTRAQ quantitative comparative proteomics, RSK2 was identified as a novel host protein that plays a role in HBx augmenting HBV replication. © 2018 The Authors. Proteomics - Clinical Application Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The 29-kDa proteins phosphorylated ion thrombin-activated human platelets are forms of the estrogen receptor-related 27-kDa heat shock protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mendelsohn, M.E.; Yan Zhu; O'Neill, S.

Thrombin plays a critical role in platelet activation, hemostasis, and thrombosis. Cellular activation by thrombin leads to the phosphorylation of multiple proteins, most of which are unidentified. The authors have characterized several 29-kDa proteins that are rapidly phosphorylated following exposure of intact human platelets to thrombin. A murine monoclonal antibody raised to an unidentified estrogen receptor-related 29-kDa protein selectively recognized these proteins as well as a more basic, unphosphorylated 27-kDa protein. Cellular activation by thrombin led to a marked shift in the proportion of protein from the 27-kDa unphosphorylated form to the 29-kDa phosphoprotein species. Using this antibody, they isolatedmore » and sequenced a human cDNA clone encoding a protein that was identical to the mammalian 27-kDa heat shock protein (HSP27), a protein of uncertain function that is known to be phosphorylated to several forms and to be transcriptionally induced by estrogen. The 29-kDa proteins were confirmed to be phosphorylated forms of HSP27 by immunoprecipitation studies. Thus, the estrogen receptor-related protein is HSP27, and the three major 20-kDa proteins phosphorylated in thrombin-activated platelets are forms of HSP27. These data suggest a role for HSP27 in the signal transduction events of platelet activation.« less

The ribosome as a missing link in the evolution of life.

PubMed

Root-Bernstein, Meredith; Root-Bernstein, Robert

2015-02-21

Many steps in the evolution of cellular life are still mysterious. We suggest that the ribosome may represent one important missing link between compositional (or metabolism-first), RNA-world (or genes-first) and cellular (last universal common ancestor) approaches to the evolution of cells. We present evidence that the entire set of transfer RNAs for all twenty amino acids are encoded in both the 16S and 23S rRNAs of Escherichia coli K12; that nucleotide sequences that could encode key fragments of ribosomal proteins, polymerases, ligases, synthetases, and phosphatases are to be found in each of the six possible reading frames of the 16S and 23S rRNAs; and that every sequence of bases in rRNA has information encoding more than one of these functions in addition to acting as a structural component of the ribosome. Ribosomal RNA, in short, is not just a structural scaffold for proteins, but the vestigial remnant of a primordial genome that may have encoded a self-organizing, self-replicating, auto-catalytic intermediary between macromolecules and cellular life. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

In vitro degradation of ribosomes.

PubMed

Mora, G; Rivas, A

1976-12-01

The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

PubMed

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

PubMed

Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2015-06-01

Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, H.; Grubb, J.H.; Sly, W.S.

1990-10-01

The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human {beta}-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3{percent} of the total functionalmore » receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of {beta}-glucuronidase. At pH 7.5, the rate of endocytosis was only 14{percent} the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized {beta}-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized {beta}-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor.« less

A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

PubMed

Crossland, Hannah; Timmons, James A; Atherton, Philip J

2017-12-01

Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P < 0.001) and total RNA content (-16 ± 2% vs. IGF-1; P < 0.001) in IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P < 0.05 vs. control) and total protein (+20 ± 2%; P < 0.001 vs. control) were not prevented by CX treatment. Suppression of rRNA synthesis during IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P < 0.001) and p70 S6K1 (269 ± 41% vs. CX; P < 0.001) phosphorylation. Despite robust inhibition of the dynamic ribosomal biogenesis response to IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

PubMed Central

Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

1982-01-01

1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

The p90 ribosomal S6 kinase 2 specifically affects mitotic progression by regulating the basal level, distribution and stability of mitotic spindles

PubMed Central

Park, Yun Yeon; Nam, Hyun-Ja; Do, Mihyang; Lee, Jae-Ho

2016-01-01

RSK2, also known as RPS6KA3 (ribosomal protein S6 kinase, 90 kDa, polypeptide 3), is a downstream kinase of the mitogen-activated protein kinase (MAPK) pathway, which is important in regulating survival, transcription, growth and proliferation. However, its biological role in mitotic progression is not well understood. In this study, we examined the potential involvement of RSK2 in the regulation of mitotic progression. Interestingly, depletion of RSK2, but not RSK1, caused the accumulation of mitotic cells. Time-lapse analysis revealed that mitotic duration, particularly the duration for metaphase-to-anaphase transition was prolonged in RSK2-depleted cells, suggesting activation of spindle assembly checkpoint (SAC). Indeed, more BubR1 (Bub1-related kinase) was present on metaphase plate kinetochores in RSK2-depleted cells, and depletion of BubR1 abolished the mitotic accumulation caused by RSK2 depletion, confirming BubR1-dependent SAC activation. Along with the shortening of inter-kinetochore distance, these data suggested that weakening of the tension across sister kinetochores by RSK2 depletion led to the activation of SAC. To test this, we analyzed the RSK2 effects on the stability of kinetochore–microtubule interactions, and found that RSK2-depleted cells formed less kinetochore–microtubule fibers. Moreover, RSK2 depletion resulted in the decrease of basal level of microtubule as well as an irregular distribution of mitotic spindles, which might lead to observed several mitotic progression defects such as increase in unaligned chromosomes, defects in chromosome congression and a decrease in pole-to-pole distance in these cells. Taken together, our data reveal that RSK2 affects mitotic progression by regulating the distribution, basal level and the stability of mitotic spindles. PMID:27491410

Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

PubMed Central

Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

2014-01-01

All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

PubMed

Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

2016-01-15

The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

PubMed Central

Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

2014-01-01

Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

Proteomic analysis of rodent ribosomes revealed heterogeneity including ribosomal proteins L10-like, L22-like 1, and L39-like.

PubMed

Sugihara, Yoshihiko; Honda, Hiroki; Iida, Tomoharu; Morinaga, Takuma; Hino, Shingo; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita

2010-03-05

Heterogeneity of ribosome structure, due to variations in ribosomal protein composition, has been shown to be of physiological significance in plants and yeast. Mammalian genomics have demonstrated numerous genes that are paralogous to genes encoding ribosomal proteins. Although the vast majority are considered to be pseudogenes, mRNA expression of a few paralogues, such as human ribosomal protein L39-like/L39-2, has been reported. In the present study, ribosomes from the liver, mammary gland, and testis of rodents were analyzed using a combination of two-dimensional gel electrophoresis under radical-free and highly reducing conditions, and mass spectrometry. This system allowed identification of 78 ribosomal proteins and Rack1 from a single gel. The degree of heterogeneity was far less than that reported for plant and yeast ribosomes, and was in accord with published biochemical and genetic data for mammalian ribosomes. Nevertheless, an uncharacterized paralogue of ribosomal protein L22, ribosomal protein L22-like 1, was identified as a minor ribosomal component. Ribosomal proteins L10-like and L39-like, paralogues of ribosomal proteins L10 and L39, respectively, were found in ribosomes only from the testis. Reverse transcription-polymerase chain reaction yielded supportive evidence for specific expression of L10-like and L39-like in the testis. Newly synthesized L39-like is likely to be transported to the nucleolus, where ribosome biosynthesis occurs, and then incorporated into translating ribosomes in the cytoplasm. Heterogeneity of mammalian testicular ribosomes is structurally non-negligible, and may offer valuable insights into the function of the customized ribosome.

Peeling the onion: ribosomes are ancient molecular fossils.

PubMed

Hsiao, Chiaolong; Mohan, Srividya; Kalahar, Benson K; Williams, Loren Dean

2009-11-01

We describe a method to establish chronologies of ancient ribosomal evolution. The method uses structure-based and sequence-based comparison of the large subunits (LSUs) of Haloarcula marismortui and Thermus thermophilus. These are the highest resolution ribosome structures available and represent disparate regions of the evolutionary tree. We have sectioned the superimposed LSUs into concentric shells, like an onion, using the site of peptidyl transfer as the origin (the PT-origin). This spherical approximation combined with a shell-by-shell comparison captures significant information along the evolutionary time line revealing, for example, that sequence and conformational similarity of the 23S rRNAs are greatest near the PT-origin and diverge smoothly with distance from it. The results suggest that the conformation and interactions of both RNA and protein can be described as changing, in an observable manner, over evolutionary time. The tendency of macromolecules to assume regular secondary structural elements such as A-form helices with Watson-Crick base pairs (RNA) and alpha-helices and beta-sheets (protein) is low at early time points but increases as time progresses. The conformations of ribosomal protein components near the PT-origin suggest that they may be molecular fossils of the peptide ancestors of ribosomal proteins. Their abbreviated length may have proscribed formation of secondary structure, which is indeed nearly absent from the region of the LSU nearest the PT-origin. Formation and evolution of the early PT center may have involved Mg(2+)-mediated assembly of at least partially single-stranded RNA oligomers or polymers. As one moves from center to periphery, proteins appear to replace magnesium ions. The LSU is known to have undergone large-scale conformation changes upon assembly. The T. thermophilus LSU analyzed here is part of a fully assembled ribosome, whereas the H. marismortui LSU analyzed here is dissociated from other ribosomal components

Correlation of 16S Ribosomal DNA Signature Sequences with Temperature-Dependent Growth Rates of Mesophilic and Psychrotolerant Strains of the Bacillus cereus Group

PubMed Central

Prüß, Birgit M.; Francis, Kevin P.; von Stetten, Felix; Scherer, Siegfried

1999-01-01

Sequences of the 16S ribosomal DNA (rDNA) from psychrotolerant and mesophilic strains of the Bacillus cereus group revealed signatures which were specific for these two thermal groups of bacteria. Further analysis of the genomic DNA from a wide range of food and soil isolates showed that B. cereus group strains have between 6 and 10 copies of 16S rDNA. Moreover, a number of these environmental strains have both rDNA operons with psychrotolerant signatures and rDNA operons with mesophilic signatures. The ability of these isolates to grow at low temperatures correlates with the prevalence of rDNA operons with psychrotolerant signatures, indicating specific nucleotides within the 16S rRNA to play a role in psychrotolerance. PMID:10198030

RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits

PubMed Central

Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.

2010-01-01

A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688

The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

PubMed

Ponti, Donatella; Bellenchi, Gian Carlo; Puca, Rosa; Bastianelli, Daniela; Maroder, Marella; Ragona, Giuseppe; Roussel, Pascal; Thiry, Marc; Mercola, Dan; Calogero, Antonella

2014-01-01

EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF) leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

Oleosins (24 and 18 kDa) are hydrolyzed not only in extracted soybean oil bodies but also in soybean germination.

PubMed

Chen, Yeming; Zhao, Luping; Cao, Yanyun; Kong, Xiangzhen; Hua, Yufei

2014-01-29

After oil bodies (OBs) were extracted from ungerminated soybean by pH 6.8 extraction, it was found that 24 and 18 kDa oleosins were hydrolyzed in the extracted OBs, which contained many OB extrinsic proteins (i.e., lipoxygenase, β-conglycinin, γ-conglycinin, β-amylase, glycinin, Gly m Bd 30K (Bd 30K), and P34 probable thiol protease (P34)) as well as OB intrinsic proteins. In this study, some properties (specificity, optimal pH and temperature) of the proteases of 24 and 18 kDa oleosins and the oleosin hydrolysis in soybean germination were examined, and the high relationship between Bd 30K/P34 and the proteases was also discussed. The results showed (1) the proteases were OB extrinsic proteins, which had high specificity to hydrolyze 24 and 18 kDa oleosins, and cleaved the specific peptide bonds to form limited hydrolyzed products; (2) 24 and 18 kDa oleosins were not hydrolyzed in the absence of Bd 30K and P34 (or some Tricine-SDS-PAGE undetectable proteins); (3) the protease of 24 kDa oleosin had strong resistance to alkaline pH while that of 18 kDa oleosin had weak resistance to alkaline pH, and Bd 30K and P34, resolved into two spots on two-dimensional electrophoresis gel, also showed the same trend; (4) 16 kDa oleosin as well as 24 and 18 kDa oleosins were hydrolyzed in soybean germination, and Bd 30K and P34 were always contained in the extracted OBs from germinated soybean even when all oleosins were hydrolyzed; (5) the optimal temperature and pH of the proteases were respectively determined as in the ranges of 35-50 °C and pH 6.0-6.5, while 60 °C or pH 11.0 could denature them.

In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

PubMed Central

Lalucque, Hervé; Silar, Philippe

2000-01-01

Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution

NASA Technical Reports Server (NTRS)

Cullings, K. W.; Vogler, D. R.

1998-01-01

We complied a 5.8S nuclear ribosomal gene sequence database for animals, plants, and fungi using both newly generated and GenBank sequences. We demonstrate the utility of this database as an internal check to determine whether the target organism and not a contaminant has been sequenced, as a diagnostic tool for ecologists and evolutionary biologists to determine the placement of asexual fungi within larger taxonomic groups, and as a tool to help identify fungi that form ectomycorrhizae.

Interaction of tetracycline with RNA: photoincorporation into ribosomal RNA of Escherichia coli.

PubMed Central

Oehler, R; Polacek, N; Steiner, G; Barta, A

1997-01-01

Photolysis of [3H]tetracycline in the presence of Escherichia coli ribosomes results in an approximately 1:1 ratio of labelling ribosomal proteins and RNAs. In this work we characterize crosslinks to both 16S and 23S RNAs. Previously, the main target of photoincorporation of [3H]tetracycline into ribosomal proteins was shown to be S7, which is also part of the one strong binding site of tetracycline on the 30S subunit. The crosslinks on 23S RNA map exclusively to the central loop of domain V (G2505, G2576 and G2608) which is part of the peptidyl transferase region. However, experiments performed with chimeric ribosomal subunits demonstrate that peptidyltransferase activity is not affected by tetracycline crosslinked solely to the 50S subunits. Three different positions are labelled on the 16S RNA, G693, G1300 and G1338. The positions of these crosslinked nucleotides correlate well with footprints on the 16S RNA produced either by tRNA or the protein S7. This suggests that the nucleotides are labelled by tetracycline bound to the strong binding site on the 30S subunit. In addition, our results demonstrate that the well known inhibition of tRNA binding to the A-site is solely due to tetracycline crosslinked to 30S subunits and furthermore suggest that interactions of the antibiotic with 16S RNA might be involved in its mode of action. PMID:9092632

S6K1 Is Required for Increasing Skeletal Muscle Force during Hypertrophy.

PubMed

Marabita, Manuela; Baraldo, Martina; Solagna, Francesca; Ceelen, Judith Johanna Maria; Sartori, Roberta; Nolte, Hendrik; Nemazanyy, Ivan; Pyronnet, Stéphane; Kruger, Marcus; Pende, Mario; Blaauw, Bert

2016-10-04

Loss of skeletal muscle mass and force aggravates age-related sarcopenia and numerous pathologies, such as cancer and diabetes. The AKT-mTORC1 pathway plays a major role in stimulating adult muscle growth; however, the functional role of its downstream mediators in vivo is unknown. Here, we show that simultaneous inhibition of mTOR signaling to both S6K1 and 4E-BP1 is sufficient to reduce AKT-induced muscle growth and render it insensitive to the mTORC1-inhibitor rapamycin. Surprisingly, lack of mTOR signaling to 4E-BP1 only, or deletion of S6K1 alone, is not sufficient to reduce muscle hypertrophy or alter its sensitivity to rapamycin. However, we report that, while not required for muscle growth, S6K1 is essential for maintaining muscle structure and force production. Hypertrophy in the absence of S6K1 is characterized by compromised ribosome biogenesis and the formation of p62-positive protein aggregates. These findings identify S6K1 as a crucial player for maintaining muscle function during hypertrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Ribosome Biogenesis in the Yeast Saccharomyces cerevisiae

PubMed Central

Woolford, John L.; Baserga, Susan J.

2013-01-01

Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

NASA Astrophysics Data System (ADS)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

2011-07-01

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

NADH:ubiquinone oxidoreductase from bovine heart mitochondria. cDNA sequences of the import precursors of the nuclear-encoded 39 kDa and 42 kDa subunits.

PubMed Central

Fearnley, I M; Finel, M; Skehel, J M; Walker, J E

1991-01-01

The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859

Nucleotides in 16S rRNA that are required in unmodified form for features recognized by ribosomal protein S8.

PubMed Central

Thurlow, D L; Ehresmann, C; Ehresmann, B

1983-01-01

Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

Thermodynamics of the pseudo-knot in helix 18 of 16S ribosomal RNA.

PubMed

Wojciechowska, Monika; Dudek, Marta; Trylska, Joanna

2018-04-01

A fragment of E. coli 16S rRNA formed by nucleotides 500 to 545 is termed helix 18. Nucleotides 505-507 and 524-526 form a pseudo-knot and its distortion affects ribosome function. Helix 18 isolated from the ribosome context is thus an interesting fragment to investigate the structural properties and folding of RNA with pseudo-knots. With all-atom molecular dynamics simulations, spectroscopic and gel electrophoresis experiments, we investigated thermodynamics of helix 18, with a focus on its pseudo-knot. In solution studies at ambient conditions we observed dimerization of helix 18. We proposed that the loop, containing nucleotides forming the pseudo-knot, interacts with another monomer of helix 18. The native dimer is difficult to break but introducing mutations in the pseudo-knot indeed assured a monomeric form of helix 18. Molecular dynamics simulations at 310 K confirmed the stability of the pseudo-knot but at elevated temperatures this pseudo-knot was the first part of helix 18 to lose the hydrogen bond pattern. To further determine helix 18 stability, we analyzed the interactions of helix 18 with short oligomers complementary to a nucleotide stretch containing the pseudo-knot. The formation of higher-order structures by helix 18 impacts hybridization efficiency of peptide nucleic acid and 2'-O methyl RNA oligomers. © 2018 Wiley Periodicals, Inc.

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

PubMed

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

A 4'-phosphopantetheinyl transferase mediates non-ribosomal peptide synthetase activation in Aspergillus fumigatus.

PubMed

Neville, Claire; Murphy, Alan; Kavanagh, Kevin; Doyle, Sean

2005-04-01

Aspergillus fumigatus is a significant human pathogen. Non-ribosomal peptide (NRP) synthesis is thought to be responsible for a significant proportion of toxin and siderophore production in the organism. Furthermore, it has been shown that 4'-phosphopantetheinylation is required for the activation of key enzymes involved in non-ribosomal peptide synthesis in other species. Here we report the cloning, recombinant expression and functional characterisation of a 4'-phosphopantetheinyl transferase from A. fumigatus and the identification of an atypical NRP synthetase (Afpes1), spanning 14.3 kb. Phylogenetic analysis has shown that the NRP synthetase exhibits greatest identity to NRP synthetases from Metarhizium anisolpiae (PesA) and Alternaria brassicae (AbrePsy1). Northern hybridisation and RT-PCR analysis have confirmed that both genes are expressed in A. fumigatus. A 120 kDa fragment of the A. fumigatus NRP synthetase, containing a putative thiolation domain, was cloned and expressed in the baculovirus expression system. Detection of a 4'-phosphopantetheinylated peptide (SFSAMK) from this protein, by MALDI-TOF mass spectrometric analysis after coincubation of the 4'-phosphopantetheinyl transferase with the recombinant NRP synthetase fragment and acetyl CoA, confirms that it is competent to play a role in NRP synthetase activation in A. fumigatus. The 4'-phosphopantetheinyl transferase also activates, by 4'-phosphopantetheinylation, recombinant alpha-aminoadipate reductase (Lys2p) from Candida albicans, a key enzyme involved in lysine biosynthesis.

Independent suppression of ribosomal +1 frameshifts by different tRNA anticodon loop modifications.

PubMed

Klassen, Roland; Bruch, Alexander; Schaffrath, Raffael

2017-09-02

Recently, a role for the anticodon wobble uridine modification 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U) has been revealed in the suppression of translational +1 frameshifts in Saccharomyces cerevisiae. Loss of either the mcm 5 U or s 2 U parts of the modification elevated +1 frameshift rates and results obtained with reporters involving a tRNA Lys UUU dependent frameshift site suggested these effects are caused by reduced ribosomal A-site binding of the hypomodified tRNA. Combined loss of mcm 5 U and s 2 U leads to increased ribosome pausing at tRNA Lys UUU dependent codons and synergistic growth defects but effects on +1 frameshift rates remained undefined to this end. We show in here that simultaneous removal of mcm 5 U and s 2 U results in synergistically increased +1 frameshift rates that are suppressible by extra copies of tRNA Lys UUU . Thus, two distinct chemical modifications of the same wobble base independently contribute to reading frame maintenance, loss of which may cause or contribute to observed growth defects. Since the thiolation pathway is sensitive to moderately elevated temperatures in yeast, we observe a heat-induced increase of +1 frameshift rates in wild type cells that depends on the sulfur transfer protein Urm1. Furthermore, we find that temperature-induced frameshifting is kept in check by the dehydration of N6-threonylcarbamoyladenosine (t 6 A) to its cyclic derivative (ct 6 A) at the anticodon adjacent position 37. Since loss of ct 6 A in elp3 or urm1 mutant cells is detrimental for temperature stress resistance we assume that conversion of t 6 A to ct 6 A serves to limit deleterious effects on translational fidelity caused by hypomodified states of wobble uridine bases.

Ribosomes in the sea: a window on taxon-specific lysis

NASA Astrophysics Data System (ADS)

Suttle, C.; Zhong, X.; Wirth, J.

2016-02-01

Microbes are estimated to comprise more than 90% of the biomass in the world's oceans, are major drivers of biogeochemical cycles, and have turnover rates ranging from hours to days. Despite the central role that microbes play in marine ecosystems, there is no robust method to evaluate taxon-specific mortality rates. Here, we report a method that employs extracellular free-ribosomes as a proxy to evaluate taxon-specific microbial lysis. The method was validated with laboratory cultures of the marine heterotrophic bacterium Vibrio natriegens strain PWH3a and the photoautotroph Synechococcus strain DC2, with and without grazers or viruses, to identify the origin and fate of the extracellular free-ribosomes. Our results showed both viral lysis and programmed-cell-death (PCD) contribute to free-ribosome production. Ribosomes were not released when cells were grazed, but grazers could consume free-ribosomes. We show that extracellular free-ribosomes can be used to evaluate microbial mortality caused by viral lysis and PCD. This approach was applied to environmental samples by examining the taxonomic composition and relative abundance of free 16S-ribosomes in seawater samples collected from the Strait of Georgia and Saanich Inlet, British Columbia, Canada. Based on the presence of free ribosomes, lysis was detected in 2198 out of 4013 prokaryotic taxa, representing 22 bacterial and three archaeal phyla. Of these, lysis of 140 taxa could be detected in all nine samples. Based on the ratio of free ribosomes to cellular ribosomes, some taxa associated with specific ecological niches appeared to be subject to high rates of lysis, including the genera Achromobacter, Chryseobacterium, Clostridium, Delftia, Ferruginibacter, Lactobacillus, Marinomonas, Massilia, Microbacterium, Ochrobactrum, Paenibacillus, Phyllobacterium, Pseudomonas, Rhodobacter, and Stenotrophomonas. Our results showed high-lysis coupled with low-abundance, suggesting that taxa in lower abundance are subject

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum

PubMed Central

DANESHPARVAR, Afrooz; MOWLAVI, Gholamreza; MIRJALALI, Hamed; HAJJARAN, Homa; MOBEDI, Iraj; NADDAF, Saeed Reza; SHIDFAR, Mohammadreza; SADAT MAKKI, Mahsa

2017-01-01

Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites. PMID:28761482

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

PubMed

Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

2017-01-01

Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Rapamycin modulation of p70 S6 kinase signaling inhibits Rift Valley fever virus pathogenesis.

PubMed

Bell, Todd M; Espina, Virginia; Senina, Svetlana; Woodson, Caitlin; Brahms, Ashwini; Carey, Brian; Lin, Shih-Chao; Lundberg, Lindsay; Pinkham, Chelsea; Baer, Alan; Mueller, Claudius; Chlipala, Elizabeth A; Sharman, Faye; de la Fuente, Cynthia; Liotta, Lance; Kehn-Hall, Kylene

2017-07-01

Despite over 60 years of research on antiviral drugs, very few are FDA approved to treat acute viral infections. Rift Valley fever virus (RVFV), an arthropod borne virus that causes hemorrhagic fever in severe cases, currently lacks effective treatments. Existing as obligate intracellular parasites, viruses have evolved to manipulate host cell signaling pathways to meet their replication needs. Specifically, translation modulation is often necessary for viruses to establish infection in their host. Here we demonstrated phosphorylation of p70 S6 kinase, S6 ribosomal protein, and eIF4G following RVFV infection in vitro through western blot analysis and in a mouse model of infection through reverse phase protein microarrays (RPPA). Inhibition of p70 S6 kinase through rapamycin treatment reduced viral titers in vitro and increased survival and mitigated clinical disease in RVFV challenged mice. Additionally, the phosphorylation of p70 S6 kinase was decreased following rapamycin treatment in vivo. Collectively these data demonstrate modulating p70 S6 kinase can be an effective antiviral strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

PubMed

Hutsul, J A; Worobec, E

1994-02-01

An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

The stylar 120 kDa glycoprotein is required for S-specific pollen rejection in Nicotiana.

PubMed

Hancock, C Nathan; Kent, Lia; McClure, Bruce A

2005-09-01

S-RNase participates in at least three mechanisms of pollen rejection. It functions in S-specific pollen rejection (self-incompatibility) and in at least two distinct interspecific mechanisms of pollen rejection in Nicotiana. S-specific pollen rejection and rejection of pollen from Nicotiana plumbaginifolia also require additional stylar proteins. Transmitting-tract-specific (TTS) protein, 120 kDa glycoprotein (120K) and pistil extensin-like protein III (PELP III) are stylar glycoproteins that bind S-RNase in vitro and are also known to interact with pollen. Here we tested whether these glycoproteins have a direct role in pollen rejection. 120K shows the most polymorphism in size between Nicotiana species. Larger 120K-like proteins are often correlated with S-specific pollen rejection. Sequencing results suggest that the polymorphism primarily reflects differences in glycosylation, although indels also occur in the predicted polypeptides. Using RNA interference (RNAi), we suppressed expression of 120K to determine if it is required for S-specific pollen rejection. Transgenic SC N. plumbaginifolia x SI Nicotiana alata (S105S105 or SC10SC10) hybrids with no detectable 120K were unable to perform S-specific pollen rejection. Thus, 120K has a direct role in S-specific pollen rejection. However, suppression of 120K had no effect on rejection of N. plumbaginifolia pollen. In contrast, suppression of HT-B, a factor previously implicated in S-specific pollen rejection, disrupts rejection of N. plumbaginifolia pollen. Thus, S-specific pollen rejection and rejection of N. plumbaginifolia pollen are mechanistically distinct, because they require different non-S-RNase factors.

Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients

PubMed Central

Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H.; Mills, Jason A.; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M.; Podsakoff, Gregory M.; Gadue, Paul; French, Deborah L.; Mason, Philip J.; Bessler, Monica

2013-01-01

Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the “safe harbor” AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells. PMID:23744582

Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

PubMed

Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

2013-08-08

Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

Ribosome flow model with positive feedback

PubMed Central

Margaliot, Michael; Tuller, Tamir

2013-01-01

Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

PubMed Central

Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

2013-01-01

Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

PubMed Central

Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

2001-01-01

Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

Enhanced resistance to blast fungus in rice (Oryza sativa L.) by expressing the ribosome-inactivating protein α-momorcharin.

PubMed

Qian, Qian; Huang, Lin; Yi, Rong; Wang, Shuzhen; Ding, Yi

2014-03-01

Rice blast caused by Magnaporthe grisea is one of the three major diseases that seriously affect the rice production. Alpha-momorcharin (α-MC), a ribosome-inactivating protein (RIP) isolated from Momordica charantia seeds, has antifungal effects in vitro. In this study, the α-MC gene was constitutively expressed under the control of the 2×35S promoter in transgenic rice (Oryza sativa L.) using an Agrobacterium tumefaciens-mediated method. The nine transgenic plants were obtained and confirmed by PCR and RT-PCR, and the four (B2, B4, B7 and B9) of them whose copy numbers were 1, 2, 3 and 3, respectively, were shown to express the α-MC protein by Western blot. The molecular weight of α-MC in transgenic plants was approximately 38 kDa larger than the purified α-MC protein (28 kDa) in vitro. When the confirmed T1 generations were inoculated with a suspension of M. grisea spores for ten days, the lesions on leaves of transgenic plants were much lesser than those found on wild type (WT). According to the criteria of International Rice Research Institute standard, the mean values for morbidity and disease index numbers were 29.8% and 14.9%, respectively, which were lower than for WT. It is unclear whether RIPs could impact plant fitness and however our results suggest that the α-MC protein is an effective antifungal protein preventing rice blast in transgenic rice. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Isoform composition and stoichiometry of the approx. 90-kDa heat shock protein associated with glucocorticoid receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mendel, D.B.; Orti, E.

1988-05-15

The authors observed that the approx. 90-kDa non-steroid-binding component of nonactivated glucocorticoid receptors purified from WEHI-7 mouse thymoma cells (which has been identified as the approx. 90-kDa heat shock protein) consistently migrates as a doublet during polyacrylamide gel electrophoresis under denaturing and reducing conditions. It has recently been reported that murine Meth A cells contain a tumor-specific transplantation antigen (TSTA) which is related or identical to the approx. 90-kDa heat shock protein. The observation that TSTA and the approx. 90-kDa heat shock protein isolated from these cells exists as two isoforms of similar molecular mass and charge has suggested thatmore » the doublet observed is also due to the existence of two isoforms. They have therefore conducted this study to determine whether TSTA and the approx. 90-kDa component of glucocorticoid receptors are indeed related, to establish whether the receptor preferentially binds one isoform of the approx. 90-kDa heat shock protein, and to investigate the stoichiometry of the nonactivated receptor complex. They used the BuGr1 and AC88 monoclonal antibodies to purify, respectively, receptor-associated and free approx. 90-kDa heat shock protein from WEHI-7 cells grown for 48 h with (/sup 35/S)methionine to metabolically label proteins to steady state. The long-term metabolic labeling approach has also enabled them to directly determine that the purified non-activated glucocorticoid receptor contains a single steroid-binding protein and two approx. 90-kDa non-steroid-binding subunits. The consistency with which a approx. 1:2 stoichiometric ratio of steroid binding to approx. 90-kDa protein is observed supports the view that the approx. 90-kDa heat shock protein is a true component of nonactivated glucocorticoid-receptor complexes.« less

Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

NASA Technical Reports Server (NTRS)

Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.

1996-01-01

A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling.

PubMed

Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

2017-01-01

Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein-EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here.

A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling

PubMed Central

Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

2017-01-01

Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529

A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

PubMed

Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

2016-11-17

Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of a major 50-kDa molecular weight human B-cell growth factor with Tac antigen-inducing activity on B cells.

PubMed

Kawano, M; Matsushima, K; Oppenheim, J J

1987-08-01

A bioassay was developed using human small B cells adherent to anti-human IgM (anti-mu)-coated wells. These B cells were stimulated to proliferate by culture supernatants of concanavalin A (Con A)-activated human peripheral blood lymphocytes (Con A Sup) even in the presence of high concentrations of anti-mu coated on assay wells. Human B-cell growth factor (BCGF) activities were partially purified from Con A Sup. Preparative chromatography (Sephacryl S-200 and isoelectrofocusing) yielded a major peak of BCGF activity for B cells adherent to anti-mu-coated wells with a molecular weight of 50,000 (50 kDa) and a pI 7.6. The 50-kDa BCGF was further purified by sequential chromatography using DEAE-Sephacel, CM-Sepharose, Sephacryl S-200, CM-high performance liquid chromatography (HPLC), and hydroxyapatite (HA)-HPLC. The HA-HPLC-purified 50-kDa BCGF was free of interleukin-1 (IL-1), interleukin-2 (IL-2), and interferon activities, but could support growth of BCL1 cells, similar to BCGF-II. Neither IL-1 nor interferon-gamma had any growth-stimulating effect in our B-cell proliferation assay with or without BCGF in Iscove's synthetic assay medium. BCGF-induced proliferation of B cells adherent to anti-mu-coated wells could be markedly augmented by the simultaneous or sequential addition of recombinant human IL-2 (rIL-2). When cultured for 3 days with 50-kDa BCGF, about 40% of B cells adherent to anti-mu-coated wells expressed Tac antigen, and monoclonal anti-Tac antibody inhibited rIL-2 enhancement of proliferation of 50-kDa BCGF-preactivated B cells. In addition, 50-kDa BCGF could induce Tac antigen on an Epstein-Barr virus-transformed B-cell line (ORSON) in the presence of a suboptimal dose of phorbol myristate acetate (PMA) and also on a natural killer-like cell line (YT cells). We have therefore identified a major 50-kDa BCGF activity with Tac antigen-inducing activity that also has a synergistic effect with IL-2 on normal B-cell proliferation.

Ribosome profiling reveals changes in translational status of soybean transcripts during immature cotyledon development

PubMed Central

Shamimuzzaman, Md.

2018-01-01

To understand translational capacity on a genome-wide scale across three developmental stages of immature soybean seed cotyledons, ribosome profiling was performed in combination with RNA sequencing and cluster analysis. Transcripts representing 216 unique genes demonstrated a higher level of translational activity in at least one stage by exhibiting higher translational efficiencies (TEs) in which there were relatively more ribosome footprint sequence reads mapping to the transcript than were present in the control total RNA sample. The majority of these transcripts were more translationally active at the early stage of seed development and included 12 unique serine or cysteine proteases and 16 2S albumin and low molecular weight cysteine-rich proteins that may serve as substrates for turnover and mobilization early in seed development. It would appear that the serine proteases and 2S albumins play a vital role in the early stages. In contrast, our investigation of profiles of 19 genes encoding high abundance seed storage proteins, such as glycinins, beta-conglycinins, lectin, and Kunitz trypsin inhibitors, showed that they all had similar patterns in which the TE values started at low levels and increased approximately 2 to 6-fold during development. The highest levels of these seed protein transcripts were found at the mid-developmental stage, whereas the highest ribosome footprint levels of only up to 1.6 TE were found at the late developmental stage. These experimental findings suggest that the major seed storage protein coding genes are primarily regulated at the transcriptional level during normal soybean cotyledon development. Finally, our analyses also identified a total of 370 unique gene models that showed very low TE values including over 48 genes encoding ribosomal family proteins and 95 gene models that are related to energy and photosynthetic functions, many of which have homology to the chloroplast genome. Additionally, we showed that genes of the

Kinetic analysis of pre-ribosome structure in vivo

PubMed Central

Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David

2012-01-01

Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724

Ultra-deep sequencing of ribosome-associated poly-adenylated RNA in early Drosophila embryos reveals hundreds of conserved translated sORFs.

PubMed

Li, Hongmei; Hu, Chuansheng; Bai, Ling; Li, Hua; Li, Mingfa; Zhao, Xiaodong; Czajkowsky, Daniel M; Shao, Zhifeng

2016-12-01

There is growing recognition that small open reading frames (sORFs) encoding peptides shorter than 100 amino acids are an important class of functional elements in the eukaryotic genome, with several already identified to play critical roles in growth, development, and disease. However, our understanding of their biological importance has been hindered owing to the significant technical challenges limiting their annotation. Here we combined ultra-deep sequencing of ribosome-associated poly-adenylated RNAs with rigorous conservation analysis to identify a comprehensive population of translated sORFs during early Drosophila embryogenesis. In total, we identify 399 sORFs, including those previously annotated but without evidence of translational capacity, those found within transcripts previously classified as non-coding, and those not previously known to be transcribed. Further, we find, for the first time, evidence for translation of many sORFs with different isoforms, suggesting their regulation is as complex as longer ORFs. Furthermore, many sORFs are found not associated with ribosomes in late-stage Drosophila S2 cells, suggesting that many of the translated sORFs may have stage-specific functions during embryogenesis. These results thus provide the first comprehensive annotation of the sORFs present during early Drosophila embryogenesis, a necessary basis for a detailed delineation of their function in embryogenesis and other biological processes. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome

PubMed Central

Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.

2014-01-01

SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919

Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

PubMed

Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

2013-01-01

Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

Getting ready to translate: cytoplasmic maturation of eukaryotic ribosomes.

PubMed

Panse, Vikram Govind

2011-01-01

The ribosome is the 'universal ribozyme' that is responsible for the final step of decoding genetic information into proteins. While the function of the ribosome is being elucidated at the atomic level, in comparison, little is known regarding its assembly in vivo and intracellular transport. In contrast to prokaryotic ribosomes, the construction of eukaryotic ribosomes, which begins in the nucleolus, requires >200 evolutionary conserved non-ribosomal trans-acting factors, which transiently associate with pre-ribosomal subunits at distinct assembly stages and perform specific maturation steps. Notably, pre-ribosomal subunits are transported to the cytoplasm in a functionally inactive state where they undergo maturation prior to entering translation. In this review, I will summarize our current knowledge of the eukaryotic ribosome assembly pathway with emphasis on cytoplasmic maturation events that render pre-ribosomal subunits translation competent.