Characterization of ppGalNAc-T18, a member of the vertebrate-specific Y subfamily of UDP-N-acetyl-α-D-galactosamine:polypeptide N-acetylgalactosaminyltransferases.

PubMed

Li, Xing; Wang, Jing; Li, Wei; Xu, Yingjiao; Shao, Dong; Xie, Yinyin; Xie, Wenxian; Kubota, Tomomi; Narimatsu, Hisashi; Zhang, Yan

2012-05-01

The first step of mucin-type O-glycosylation is catalyzed by members of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-T; EC 2.4.1.41) family. Each member of this family has unique substrate specificity and expression profiles. In this report, we describe a new subfamily of ppGalNAc-Ts, designated the Y subfamily. The Y subfamily consists of four members, ppGalNAc-T8, -T9, -T17 and -T18, in which the conserved YDX(5)WGGENXE sequence in the Gal/GalNAc-T motif of ppGalNAc-Ts is mutated to LDX(5)YGGENXE. Phylogenetic analysis revealed that the Y subfamily members only exist in vertebrates. All four Y subfamily members lack in vitro GalNAc-transferase activity toward classical substrates possibly because of the UDP-GalNAc-binding pocket mutants. However, ppGalNAc-T18, the newly identified defining member, was localized in the endoplasmic reticulum rather than the Golgi apparatus in lung carcinoma cells. The knockdown of ppGalNAc-T18 altered cell morphology, proliferation potential and changed cell O-glycosylation. ppGalNAc-T18 can also modulate the in vitro GalNAc-transferase activity of ppGalNAc-T2 and -T10, suggesting that it may be a chaperone-like protein. These findings suggest that the new Y subfamily of ppGalNAc-Ts plays an important role in protein glycosylation; characterizing their functions will provide new insight into the role of ppGalNAc-Ts.

ATR inhibition controls aggressive prostate tumors deficient in Y-linked histone demethylase KDM5D.

PubMed

Komura, Kazumasa; Yoshikawa, Yuki; Shimamura, Teppei; Chakraborty, Goutam; Gerke, Travis A; Hinohara, Kunihiko; Chadalavada, Kalyani; Jeong, Seong Ho; Armenia, Joshua; Du, Shin-Yi; Mazzu, Ying Z; Taniguchi, Kohei; Ibuki, Naokazu; Meyer, Clifford A; Nanjangud, Gouri J; Inamoto, Teruo; Lee, Gwo-Shu Mary; Mucci, Lorelei A; Azuma, Haruhito; Sweeney, Christopher J; Kantoff, Philip W

2018-06-04

Epigenetic modifications control cancer development and clonal evolution in various cancer types. Here, we show that loss of the male-specific histone demethylase lysine-specific demethylase 5D (KDM5D) encoded on the Y chromosome epigenetically modifies histone methylation marks and alters gene expression, resulting in aggressive prostate cancer. Fluorescent in situ hybridization demonstrated that segmental or total deletion of the Y chromosome in prostate cancer cells is one of the causes of decreased KDM5D mRNA expression. The result of ChIP-sequencing analysis revealed that KDM5D preferably binds to promoter regions with coenrichment of the motifs of crucial transcription factors that regulate the cell cycle. Loss of KDM5D expression with dysregulated H3K4me3 transcriptional marks was associated with acceleration of the cell cycle and mitotic entry, leading to increased DNA-replication stress. Analysis of multiple clinical data sets reproducibly showed that loss of expression of KDM5D confers a poorer prognosis. Notably, we also found stress-induced DNA damage on the serine/threonine protein kinase ATR with loss of KDM5D. In KDM5D-deficient cells, blocking ATR activity with an ATR inhibitor enhanced DNA damage, which led to subsequent apoptosis. These data start to elucidate the biological characteristics resulting from loss of KDM5D and also provide clues for a potential novel therapeutic approach for this subset of aggressive prostate cancer.

The H3K27me3-demethylase KDM6A is suppressed in breast cancer stem-like cells, and enables the resolution of bivalency during the mesenchymal-epithelial transition

PubMed Central

Taube, Joseph H.; Sphyris, Nathalie; Johnson, Kelsey S.; Reisenauer, Keighley N.; Nesbit, Taylor A.; Joseph, Robiya; Vijay, Geraldine V.; Sarkar, Tapasree R.; Bhangre, Neeraja A.; Song, Joon Jin; Chang, Jeffrey T.; Lee, Min Gyu; Soundararajan, Rama; Mani, Sendurai A.

2017-01-01

The deposition of the activating H3K4me3 and repressive H3K27me3 histone modifications within the same promoter, forming a so-called bivalent domain, maintains gene expression in a repressed but transcription-ready state. We recently reported a significantly increased incidence of bivalency following an epithelial-mesenchymal transition (EMT), a process associated with the initiation of the metastatic cascade. The reverse process, known as the mesenchymal-epithelial transition (MET), is necessary for efficient colonization. Here, we identify numerous genes associated with differentiation, proliferation and intercellular adhesion that are repressed through the acquisition of bivalency during EMT, and re-expressed following MET. The majority of EMT-associated bivalent domains arise through H3K27me3 deposition at H3K4me3-marked promoters. Accordingly, we show that the expression of the H3K27me3-demethylase KDM6A is reduced in cells that have undergone EMT, stem-like subpopulations of mammary cell lines and stem cell-enriched triple-negative breast cancers. Importantly, KDM6A levels are restored following MET, concomitant with CDH1/E-cadherin reactivation through H3K27me3 removal. Moreover, inhibition of KDM6A, using the H3K27me3-demethylase inhibitor GSK-J4, prevents the re-expression of bivalent genes during MET. Our findings implicate KDM6A in the resolution of bivalency accompanying MET, and suggest KDM6A inhibition as a viable strategy to suppress metastasis formation in breast cancer. PMID:29029452

KDM5 Interacts with Foxo to Modulate Cellular Levels of Oxidative Stress

PubMed Central

Liu, Xingyin; Greer, Christina; Secombe, Julie

2014-01-01

Increased cellular levels of oxidative stress are implicated in a large number of human diseases. Here we describe the transcription co-factor KDM5 (also known as Lid) as a new critical regulator of cellular redox state. Moreover, this occurs through a novel KDM5 activity whereby it alters the ability of the transcription factor Foxo to bind to DNA. Our microarray analyses of kdm5 mutants revealed a striking enrichment for genes required to regulate cellular levels of oxidative stress. Consistent with this, loss of kdm5 results in increased sensitivity to treatment with oxidizers, elevated levels of oxidized proteins, and increased mutation load. KDM5 activates oxidative stress resistance genes by interacting with Foxo to facilitate its recruitment to KDM5-Foxo co-regulated genes. Significantly, this occurs independently of KDM5's well-characterized demethylase activity. Instead, KDM5 interacts with the lysine deacetylase HDAC4 to promote Foxo deacetylation, which affects Foxo DNA binding. PMID:25329053

CTCF-KDM4A complex correlates with histone modifications that negatively regulate CHD5 gene expression in cancer cell lines

PubMed Central

Guerra-Calderas, Lissania; González-Barrios, Rodrigo; Patiño, Carlos César; Alcaraz, Nicolás; Salgado-Albarrán, Marisol; de León, David Cantú; Hernández, Clementina Castro; Sánchez-Pérez, Yesennia; Maldonado-Martínez, Héctor Aquiles; De la Rosa-Velazquez, Inti A.; Vargas-Romero, Fernanda; Herrera, Luis A.; García-Carrancá, Alejandro; Soto-Reyes, Ernesto

2018-01-01

Histone demethylase KDM4A is involved in H3K9me3 and H3K36me3 demethylation, which are epigenetic modifications associated with gene silencing and RNA Polymerase II elongation, respectively. KDM4A is abnormally expressed in cancer, affecting the expression of multiple targets, such as the CHD5 gene. This enzyme localizes at the first intron of CHD5, and the dissociation of KDM4A increases gene expression. In vitro assays showed that KDM4A-mediated demethylation is enhanced in the presence of CTCF, suggesting that CTCF could increase its enzymatic activity in vivo, however the specific mechanism by which CTCF and KDM4A might be involved in the CHD5 gene repression is poorly understood. Here, we show that CTCF and KDM4A form a protein complex, which is recruited into the first intron of CHD5. This is related to a decrease in H3K36me3/2 histone marks and is associated with its transcriptional downregulation. Depletion of CTCF or KDM4A by siRNA, triggered the reactivation of CHD5 expression, suggesting that both proteins are involved in the negative regulation of this gene. Furthermore, the knockout of KDM4A restored the CHD5 expression and H3K36me3 and H3K36me2 histone marks. Such mechanism acts independently of CHD5 promoter DNA methylation. Our findings support a novel mechanism of epigenetic repression at the gene body that does not involve promoter silencing. PMID:29682202

Masitinib antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance

PubMed Central

KATHAWALA, RISHIL J.; CHEN, JUN-JIANG; ZHANG, YUN-KAI; WANG, YI-JUN; PATEL, ATISH; WANG, DE-SHEN; TALELE, TANAJI T.; ASHBY, CHARLES R.; CHEN, ZHE-SHENG

2014-01-01

In this in vitro study, we determined whether masitinib could reverse multidrug resistance (MDR) in cells overexpressing the ATP binding cassette subfamily G member 2 (ABCG2) transporter. Masitinib (1.25 and 2.5 μM) significantly decreases the resistance to mitoxantrone (MX), SN38 and doxorubicin in HEK293 and H460 cells overexpressing the ABCG2 transporter. In addition, masitinib (2.5 μM) significantly increased the intracellular accumulation of [3H]-MX, a substrate for ABCG2, by inhibiting the function of ABCG2 and significantly decreased the efflux of [3H]-MX. However, masitinib (2.5 μM) did not significantly alter the expression of the ABCG2 protein. In addition, a docking model suggested that masitinib binds within the transmembrane region of a homology-modeled human ABCG2 transporter. Overall, our in vitro findings suggest that masitinib reverses MDR to various anti-neoplastic drugs in HEK293 and H460 cells overexpressing ABCG2 by inhibiting their transport activity as opposed to altering their levels of expression. PMID:24626598

CYP3C1, the first member of a new cytochrome P450 subfamily found in zebrafish (Danio rerio).

PubMed

Corley-Smith, Graham E; Su, Hsiao-Ting; Wang-Buhler, Jun-Lan; Tseng, Hua-Pin; Hu, Chin-Hwa; Hoang, Thuy; Chung, Woon-Gye; Buhler, Donald R

2006-02-24

We report a new cytochrome P450 (CYP) subfamily CYP3C and the cloning through PCR from zebrafish (Danio rerio) of the first member, CYP3C1. The CYP3C1 gene is on Chromosome 3 with 13 ORF exons encoding a 505 amino acid protein which has 44-54% identities with mammalian and teleost CYP3A and CYP3B forms. As evidenced by spectral analysis, the CYP3C1 protein heterologously expressed in yeast is functional. In silico analysis identified, on the same region of the chromosome, three more genes encoding CYP3C1-like proteins that formed a clade with CYP3C1 in a phylogenetic tree. Using RT-PCR, the CYP3C1 mRNA was detected in 1-6dpf embryo/larvae and in adult fish liver and seven extrahepatic tissues. Whole-mount in situ hybridization using a riboprobe demonstrated expression in the brain during 12-120 hpf. At the 120 hpf larval stage, CYP3C1 mRNA was also detected in the pharynx and gastrointestinal tract. TCDD, dexamethasone, and rifampicin, which up-regulated CYP3A65 mRNA in zebrafish larvae, did not alter the CYP3C1 transcript levels suggesting regulatory differences between CYP3A and CYP3C enzymes in this species.

[Phylogenetic relationships among members of the subfamily sedoideae (Crassulaceae) inferred from the ITS region sequences of nuclear rDNA].

PubMed

Goncharova, S B; Artiukova, E V; Goncharov, A A

2006-06-01

Nucleotide sequences of the nuclear rDNA ITS regions were determined in 20 species of the subfamily Sedoideae (Crassulaceae). The phylogenetic relationships of these species with other members of the subfamily, occurring mainly in Southeast Asia, were analyzed. It was shown that the genus Orostachys was not monophyletic; its typical subsection was reliably included into the clade of the genus Hylotelephium. Synapomorphic substitutions and indels, specific for the subsection Orostachys, were detected in ITS1. Sister relationships were established between clades Aizopsis and Phedimus, based on which they can be recognized as isolated genera.

THE STRUCTURAL BIOLOGY OF THE FGF19 SUBFAMILY

PubMed Central

Beenken, Andrew; Mohammadi, Moosa

2013-01-01

The ability of the Fibroblast Growth Factor (FGF) 19 subfamily to signal in an endocrine fashion sets this subfamily apart from the remaining five FGF subfamilies known for their paracrine functions during embryonic development. Compared to the members of paracrine FGF subfamiles, the three members of the FGF 19 subfamily, namely FGF19, FGF21 and FGF23, have poor affinity for heparan sulfate (HS) and therefore can diffuse freely in the HS-rich extracellular matrix to enter into the bloodstream. In further contrast to paracrine FGFs, FGF 19 subfamily members have unusually poor affinity for their cognate FGF receptors (FGFRs) and therefore cannot bind and activate them in a solely HS-dependent fashion. As a result, the FGF 19 subfamily requires α/βklotho coreceptor proteins in order to bind, dimerize and activate their cognate FGFRs. This klotho-dependency also determines the tissue specificity of endocrine FGFs. Recent structural and biochemical studies have begun to shed light onto the molecular basis for the klotho-dependent endocrine mode of action of the FGF 19 subfamily. Crystal structures of FGF 19 and FGF23 show that the topology of the HS binding site (HBS) of FGF19 subfamily members deviates drastically from the common topology adopted by the paracrine FGFs. The distinct topologies of the HBS of FGF 19 and FGF23 prevent HS from direct hydrogen bonding with the backbone atoms of the HBS of these ligands and accordingly decrease the HS binding affinity of this subfamily. Recent biochemical data reveal that the αklotho ectodomain binds avidly to the ectodomain of FGFR1c, the main cognate FGFR of FGF23, creating a de novo high affinity binding site for the C-terminal tail of FGF23. The isolated FGF23 C-terminus can be used to effectively inhibit the formation of the FGF23-FGFR1c-αklotho complex and alleviate hypophosphatemia in renal phosphate disorders due to elevated levels of FGF23. PMID:22396159

Design and evaluation of 1,7-naphthyridones as novel KDM5 inhibitors.

PubMed

Labadie, Sharada S; Dragovich, Peter S; Cummings, Richard T; Deshmukh, Gauri; Gustafson, Amy; Han, Ning; Harmange, Jean-Christophe; Kiefer, James R; Li, Yue; Liang, Jun; Liederer, Bianca M; Liu, Yichin; Manieri, Wanda; Mao, Wiefeng; Murray, Lesley; Ortwine, Daniel F; Trojer, Patrick; VanderPorten, Erica; Vinogradova, Maia; Wen, Li

2016-09-15

Features from a high throughput screening (HTS) hit and a previously reported scaffold were combined to generate 1,7-naphthyridones as novel KDM5 enzyme inhibitors with nanomolar potencies. These molecules exhibited high selectivity over the related KDM4C and KDM2B isoforms. An X-ray co-crystal structure of a representative molecule bound to KDM5A showed that these inhibitors are competitive with the co-substrate (2-oxoglutarate or 2-OG). Copyright © 2016 Elsevier Ltd. All rights reserved.

Loss of tumor suppressor KDM6A amplifies PRC2-regulated transcriptional repression in bladder cancer and can be targeted through inhibition of EZH2.

PubMed

Ler, Lian Dee; Ghosh, Sujoy; Chai, Xiaoran; Thike, Aye Aye; Heng, Hong Lee; Siew, Ee Yan; Dey, Sucharita; Koh, Liang Kai; Lim, Jing Quan; Lim, Weng Khong; Myint, Swe Swe; Loh, Jia Liang; Ong, Pauline; Sam, Xin Xiu; Huang, Dachuan; Lim, Tony; Tan, Puay Hoon; Nagarajan, Sanjanaa; Cheng, Christopher Wai Sam; Ho, Henry; Ng, Lay Guat; Yuen, John; Lin, Po-Hung; Chuang, Cheng-Keng; Chang, Ying-Hsu; Weng, Wen-Hui; Rozen, Steven G; Tan, Patrick; Creasy, Caretha L; Pang, See-Tong; McCabe, Michael T; Poon, Song Ling; Teh, Bin Tean

2017-02-22

Trithorax-like group complex containing KDM6A acts antagonistically to Polycomb-repressive complex 2 (PRC2) containing EZH2 in maintaining the dynamics of the repression and activation of gene expression through H3K27 methylation. In urothelial bladder carcinoma, KDM6A (a H3K27 demethylase) is frequently mutated, but its functional consequences and therapeutic targetability remain unknown. About 70% of KDM6A mutations resulted in a total loss of expression and a consequent loss of demethylase function in this cancer type. Further transcriptome analysis found multiple deregulated pathways, especially PRC2/EZH2, in KDM6A -mutated urothelial bladder carcinoma. Chromatin immunoprecipitation sequencing analysis revealed enrichment of H3K27me3 at specific loci in KDM6A -null cells, including PRC2/EZH2 and their downstream targets. Consequently, we targeted EZH2 (an H3K27 methylase) and demonstrated that KDM6A -null urothelial bladder carcinoma cell lines were sensitive to EZH2 inhibition. Loss- and gain-of-function assays confirmed that cells with loss of KDM6A are vulnerable to EZH2. IGFBP3, a direct KDM6A/EZH2/H3K27me3 target, was up-regulated by EZH2 inhibition and contributed to the observed EZH2-dependent growth suppression in KDM6A -null cell lines. EZH2 inhibition delayed tumor onset in KDM6A -null cells and caused regression of KDM6A -null bladder tumors in both patient-derived and cell line xenograft models. In summary, our study demonstrates that inactivating mutations of KDM6A , which are common in urothelial bladder carcinoma, are potentially targetable by inhibiting EZH2. Copyright © 2017, American Association for the Advancement of Science.

KDM4A Coactivates E2F1 to Regulate the PDK-Dependent Metabolic Switch between Mitochondrial Oxidation and Glycolysis.

PubMed

Wang, Ling-Yu; Hung, Chiu-Lien; Chen, Yun-Ru; Yang, Joy C; Wang, Junjian; Campbell, Mel; Izumiya, Yoshihiro; Chen, Hong-Wu; Wang, Wen-Ching; Ann, David K; Kung, Hsing-Jien

2016-09-13

The histone lysine demethylase KDM4A/JMJD2A has been implicated in prostate carcinogenesis through its role in transcriptional regulation. Here, we describe KDM4A as a E2F1 coactivator and demonstrate a functional role for the E2F1-KDM4A complex in the control of tumor metabolism. KDM4A associates with E2F1 on target gene promoters and enhances E2F1 chromatin binding and transcriptional activity, thereby modulating the transcriptional profile essential for cancer cell proliferation and survival. The pyruvate dehydrogenase kinases (PDKs) PDK1 and PDK3 are direct targets of KDM4A and E2F1 and modulate the switch between glycolytic metabolism and mitochondrial oxidation. Downregulation of KDM4A leads to elevated activity of pyruvate dehydrogenase and mitochondrial oxidation, resulting in excessive accumulation of reactive oxygen species. The altered metabolic phenotypes can be partially rescued by ectopic expression of PDK1 and PDK3, indicating a KDM4A-dependent tumor metabolic regulation via PDK. Our results suggest that KDM4A is a key regulator of tumor metabolism and a potential therapeutic target for prostate cancer. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

The histone demethylase KDM1A is essential for the maintenance and differentiation of spermatogonial stem cells and progenitors.

PubMed

Lambrot, Romain; Lafleur, Christine; Kimmins, Sarah

2015-11-01

Little is known of the fundamental processes governed by epigenetic mechanisms in the supplier cells of spermatogenesis, the spermatogonial stem cells (SSCs). The histone H3 lysine demethylase KDM1A is expressed in spermatogonia. We hypothesized that KDM1A serves in transcriptional regulation of SSCs and fertility. Using a conditional deletion of Kdm1a [conditional knockout (cKO)] in mouse spermatogonia, we determined that Kdm1a is essential for spermatogenesis as adult cKO males completely lack germ cells. Analysis of postnatal testis development revealed that undifferentiated and differentiating spermatogonial populations form in Kdm1a-cKO animals, yet the majority fail to enter meiosis. Loss of germ cells in the cKO was rapid with none remaining by postnatal day (PND) 21. To gain insight into the mechanistic implications of Kdm1a ablation, we isolated PND 6 spermatogonia enriched for SSCs and analyzed their transcriptome by RNA sequencing. Loss of Kdm1a was associated with altered transcription of 1206 genes. Importantly, differentially expressed genes between control and Kdm1a-cKO animals included those that are essential for SSC and progenitor maintenance and spermatogonial differentiation. The complete loss of fertility and failure to establish spermatogenesis indicate that Kdm1a is a master controller of gene transcription in spermatogonia and is required for SSC and progenitor maintenance and differentiation. © FASEB.

Targeting lysine specific demethylase 4A (KDM4A) tandem TUDOR domain - A fragment based approach.

PubMed

Upadhyay, Anup K; Judge, Russell A; Li, Leiming; Pithawalla, Ron; Simanis, Justin; Bodelle, Pierre M; Marin, Violeta L; Henry, Rodger F; Petros, Andrew M; Sun, Chaohong

2018-06-01

The tandem TUDOR domains present in the non-catalytic C-terminal half of the KDM4A, 4B and 4C enzymes play important roles in regulating their chromatin localizations and substrate specificities. They achieve this regulatory role by binding to different tri-methylated lysine residues on histone H3 (H3-K4me3, H3-K23me3) and histone H4 (H4-K20me3) depending upon the specific chromatin environment. In this work, we have used a 2D-NMR based fragment screening approach to identify a novel fragment (1a), which binds to the KDM4A-TUDOR domain and shows modest competition with H3-K4me3 binding in biochemical as well as in vitro cell based assays. A co-crystal structure of KDM4A TUDOR domain in complex with 1a shows that the fragment binds stereo-specifically to the methyl lysine binding pocket forming a network of strong hydrogen bonds and hydrophobic interactions. We anticipate that the fragment 1a can be further developed into a novel allosteric inhibitor of the KDM4 family of enzymes through targeting their C-terminal tandem TUDOR domain. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular cloning and biochemical characterization of two cation chloride cotransporter subfamily members of Hydra vulgaris.

PubMed

Hartmann, Anna-Maria; Pisella, Lucie I; Medina, Igor; Nothwang, Hans Gerd

2017-01-01

Cation Chloride Cotransporters (CCCs) comprise secondary active membrane proteins mainly mediating the symport of cations (Na+, K+) coupled with chloride (Cl-). They are divided into K+-Cl- outward transporters (KCCs), the Na+-K+-Cl- (NKCCs) and Na+-Cl- (NCCs) inward transporters, the cation chloride cotransporter interacting protein CIP1, and the polyamine transporter CCC9. KCCs and N(K)CCs are established in the genome since eukaryotes and metazoans, respectively. Most of the physiological and functional data were obtained from vertebrate species. To get insights into the basal functional properties of KCCs and N(K)CCs in the metazoan lineage, we cloned and characterized KCC and N(K)CC from the cnidarian Hydra vulgaris. HvKCC is composed of 1,032 amino-acid residues. Functional analyses revealed that hvKCC mediates a Na+-independent, Cl- and K+ (Tl+)-dependent cotransport. The classification of hvKCC as a functional K-Cl cotransporter is furthermore supported by phylogenetic analyses and a similar structural organization. Interestingly, recently obtained physiological analyses indicate a role of cnidarian KCCs in hyposmotic volume regulation of nematocytes. HvN(K)CC is composed of 965 amino-acid residues. Phylogenetic analyses and structural organization suggest that hvN(K)CC is a member of the N(K)CC subfamily. However, no inorganic ion cotransport function could be detected using different buffer conditions. Thus, hvN(K)CC is a N(K)CC subfamily member without a detectable inorganic ion cotransporter function. Taken together, the data identify two non-bilaterian solute carrier 12 (SLC12) gene family members, thereby paving the way for a better understanding of the evolutionary paths of this important cotransporter family.

Sphingomonas paucimobilis beta-glucosidase Bgl1: a member of a new bacterial subfamily in glycoside hydrolase family 1.

PubMed Central

Marques, Ana Rita; Coutinho, Pedro M; Videira, Paula; Fialho, Arsénio M; Sá-Correia, Isabel

2003-01-01

The Sphingomonas paucimobilis beta-glucosidase Bgl1 is encoded by the bgl1 gene, associated with an 1308 bp open reading frame. The deduced protein has a potential signal peptide of 24 amino acids in the N-terminal region, and experimental evidence is consistent with the processing and export of the Bgl1 protein through the inner membrane to the periplasmic space. A His(6)-tagged 44.3 kDa protein was over-produced in the cytosol of Escherichia coli from a recombinant plasmid, which contained the S. paucimobilis bgl1 gene lacking the region encoding the putative signal peptide. Mature beta-glucosidase Bgl1 is specific for aryl-beta-glucosides and has no apparent activity with oligosaccharides derived from cellulose hydrolysis and other saccharides. A structure-based alignment established structural relations between S. paucimobilis Bgl1 and other members of the glycoside hydrolase (GH) family 1 enzymes. At subsite -1, the conserved residues required for catalysis by GH1 enzymes are present in Bgl1 with only minor differences. Major differences are found at subsite +1, the aglycone binding site. This alignment seeded a sequence-based phylogenetic analysis of GH1 enzymes, revealing an absence of horizontal transfer between phyla. Bootstrap analysis supported the definition of subfamilies and revealed that Bgl1, the first characterized beta-glucosidase from the genus Sphingomonas, represents a very divergent bacterial subfamily, closer to archaeal subfamilies than to others of bacterial origin. PMID:12444924

Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

PubMed

Walker, J; Tait, A

1997-11-01

A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

PubMed

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy

PubMed Central

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-01-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics. PMID:27612013

The Epigenetic Factor KDM2B Regulates EMT and Small GTPases in Colon Tumor Cells.

PubMed

Zacharopoulou, Nefeli; Tsapara, Anna; Kallergi, Galatea; Schmid, Evi; Alkahtani, Saad; Alarifi, Saud; Tsichlis, Philip N; Kampranis, Sotirios C; Stournaras, Christos

2018-05-14

The epigenetic factor KDM2B is a histone demethylase expressed in various tumors. Recently, we have shown that KDM2B regulates actin cytoskeleton organization, small Rho GTPases signaling, cell-cell adhesion and migration of prostate tumor cells. In the present study, we addressed its role in regulating EMT and small GTPases expression in colon tumor cells. We used RT-PCR for the transcriptional analysis of various genes, Western blotting for the assessment of protein expression and immunofluorescence microscopy for visualization of fluorescently labeled proteins. We report here that KDM2B regulates EZH2 and BMI1 in HCT116 colon tumor cells. Knockdown of this epigenetic factor induced potent up-regulation of the protein levels of the epithelial markers E-cadherin and ZO-1, while the mesenchymal marker N-cadherin was downregulated. On the other hand, KDM2B overexpression downregulated the levels of both epithelial markers and upregulated the mesenchymal marker, suggesting control of EMT by KDM2B. In addition, RhoA, RhoB and RhoC protein levels diminished upon KDM2B-knockdown, while all three small GTPases became upregulated in KDM2B-overexpressing HCT116 cell clones. Interestingly, Rac1 GTPase level increased upon KDM2B-knockdown and diminished in KDM2B-overexpressing HCT116 colon tumor- and DU-145 prostate cancer cells. These results establish a clear functional role of the epigenetic factor KDM2B in the regulation of EMT and small-GTPases expression in colon tumor cells and further support the recently postulated oncogenic role of this histone demethylase in various tumors. © 2018 The Author(s). Published by S. Karger AG, Basel.

Increased mitochondrial function downstream from KDM5A histone demethylase rescues differentiation in pRB-deficient cells

PubMed Central

Váraljai, Renáta; Islam, Abul B.M.M.K.; Beshiri, Michael L.; Rehman, Jalees; Lopez-Bigas, Nuria; Benevolenskaya, Elizaveta V.

2015-01-01

The retinoblastoma tumor suppressor protein pRb restricts cell growth through inhibition of cell cycle progression. Increasing evidence suggests that pRb also promotes differentiation, but the mechanisms are poorly understood, and the key question remains as to how differentiation in tumor cells can be enhanced in order to diminish their aggressive potential. Previously, we identified the histone demethylase KDM5A (lysine [K]-specific demethylase 5A), which demethylates histone H3 on Lys4 (H3K4), as a pRB-interacting protein counteracting pRB's role in promoting differentiation. Here we show that loss of Kdm5a restores differentiation through increasing mitochondrial respiration. This metabolic effect is both necessary and sufficient to induce the expression of a network of cell type-specific signaling and structural genes. Importantly, the regulatory functions of pRB in the cell cycle and differentiation are distinct because although restoring differentiation requires intact mitochondrial function, it does not necessitate cell cycle exit. Cells lacking Rb1 exhibit defective mitochondria and decreased oxygen consumption. Kdm5a is a direct repressor of metabolic regulatory genes, thus explaining the compensatory role of Kdm5a deletion in restoring mitochondrial function and differentiation. Significantly, activation of mitochondrial function by the mitochondrial biogenesis regulator Pgc-1α (peroxisome proliferator-activated receptor γ-coactivator 1α; also called PPARGC1A) a coactivator of the Kdm5a target genes, is sufficient to override the differentiation block. Overexpression of Pgc-1α, like KDM5A deletion, inhibits cell growth in RB-negative human cancer cell lines. The rescue of differentiation by loss of KDM5A or by activation of mitochondrial biogenesis reveals the switch to oxidative phosphorylation as an essential step in restoring differentiation and a less aggressive cancer phenotype. PMID:26314709

Resistance to docetaxel in prostate cancer is associated with androgen receptor activation and loss of KDM5D expression

PubMed Central

Komura, Kazumasa; Jeong, Seong Ho; Hinohara, Kunihiko; Qu, Fangfang; Wang, Xiaodong; Hiraki, Masayuki; Azuma, Haruhito; Lee, Gwo-Shu Mary; Kantoff, Philip W.; Sweeney, Christopher J.

2016-01-01

The androgen receptor (AR) plays an essential role in prostate cancer, and suppression of its signaling with androgen deprivation therapy (ADT) has been the mainstay of treatment for metastatic hormone-sensitive prostate cancer for more than 70 y. Chemotherapy has been reserved for metastatic castration-resistant prostate cancer (mCRPC). The Eastern Cooperative Oncology Group-led trial E3805: ChemoHormonal Therapy Versus Androgen Ablation Randomized Trial for Extensive Disease in Prostate Cancer (CHAARTED) showed that the addition of docetaxel to ADT prolonged overall survival compared with ADT alone in patients with metastatic hormone-sensitive prostate cancer. This finding suggests that there is an interaction between AR signaling activity and docetaxel sensitivity. Here we demonstrate that the prostate cancer cell lines LNCaP and LAPC4 display markedly different sensitivity to docetaxel with AR activation, and RNA-seq analysis of these cell lines identified KDM5D (lysine-specific demethylase 5D) encoded on the Y chromosome as a potential mediator of this sensitivity. Knocking down KDM5D expression in LNCaP leads to docetaxel resistance in the presence of dihydrotestosterone. KDM5D physically interacts with AR in the nucleus, and regulates its transcriptional activity by demethylating H3K4me3 active transcriptional marks. Attenuating KDM5D expression dysregulates AR signaling, resulting in docetaxel insensitivity. KDM5D deletion was also observed in the LNCaP-derived CRPC cell line 104R2, which displayed docetaxel insensitivity with AR activation, unlike parental LNCaP. Dataset analysis from the Oncomine database revealed significantly decreased KDM5D expression in CRPC and poorer prognosis with low KDM5D expression. Taking these data together, this work indicates that KDM5D modulates the AR axis and that this is associated with altered docetaxel sensitivity. PMID:27185910

Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

PubMed

Tabassum, Rabia

2017-10-18

Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

The histone lysine demethylase Kdm6b is required for activity-dependent preconditioning of hippocampal neuronal survival

PubMed Central

Wijayatunge, Ranjula; Chen, Liang-Fu; Cha, Young May; Zannas, Anthony S.; Frank, Christopher L.; West, Anne E.

2014-01-01

Enzymes that regulate histone lysine methylation play important roles in neuronal differentiation, but little is known about their contributions to activity-regulated gene transcription in differentiated neurons. We characterized activity-regulated expression of lysine demethylases and lysine methyltransferases in the hippocampus of adult male mice following pilocarpine-induced seizure. Pilocarpine drove a 20-fold increase in mRNA encoding the histone H3 lysine27-specific demethylase Kdm6b selectively in granule neurons of the dentate gyrus, and this induction was recapitulated in cultured hippocampal neurons by bicuculline and 4-aminopyridine (Bic+4AP) stimulation of synaptic activity. Because activity-regulated gene expression is highly correlated with neuronal survival, we tested the requirement for Kdm6b expression in Bic+4AP induced preconditioning of neuronal survival. Prior exposure to Bic+4AP promoted neuronal survival in control neurons upon growth factor withdrawal, however this effect was ablated when we knocked down Kdm6b expression. Loss of Kdm6b did not disrupt activity-induced expression of most genes, including that of a gene set previously established to promote neuronal survival in this assay. However using bioinformatic analysis of RNA sequencing data, we discovered that Kdm6b knockdown neurons showed impaired inducibility of a discrete set of genes annotated for their function in inflammation. These data reveal a novel function for Kdm6b in activity-regulated neuronal survival, and they suggest that activity- and Kdm6b-dependent regulation of inflammatory gene pathways may serve as an adaptive pro-survival response to increased neuronal activity. PMID:24983519

Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat

PubMed Central

Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying

2018-01-01

A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P < 0.01), and the average first-born litter size of individuals with an insertion/insertion genotype higher than that of those with the deletion/deletion genotype (P < 0.05). There was also a significant difference in genotype distributions of the 16 bp indel between mothers of single-lamb and multi-lamb litters in the studied goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081

miRNA-122 Protects Mice and Human Hepatocytes from Acetaminophen Toxicity by Regulating Cytochrome P450 Family 1 Subfamily A Member 2 and Family 2 Subfamily E Member 1 Expression.

PubMed

Chowdhary, Vivek; Teng, Kun-Yu; Thakral, Sharda; Zhang, Bo; Lin, Cho-Hao; Wani, Nissar; Bruschweiler-Li, Lei; Zhang, Xiaoli; James, Laura; Yang, Dakai; Junge, Norman; Brüschweiler, Rafael; Lee, William M; Ghoshal, Kalpana

2017-12-01

Acetaminophen toxicity is a leading cause of acute liver failure (ALF). We found that miRNA-122 (miR-122) is down-regulated in liver biopsy specimens of patients with ALF and in acetaminophen-treated mice. A marked decrease in the primary miR-122 expression occurs in mice on acetaminophen overdose because of suppression of its key transactivators, hepatocyte nuclear factor (HNF)-4α and HNF6. More importantly, the mortality rates of male and female liver-specific miR-122 knockout (LKO) mice were significantly higher than control mice when injected i.p. with an acetaminophen dose not lethal to the control. LKO livers exhibited higher basal expression of cytochrome P450 family 2 subfamily E member 1 (CYP2E1) and cytochrome P450 family 1 subfamily A member 2 (CYP1A2) that convert acetaminophen to highly reactive N-acetyl-p-benzoquinone imine. Upregulation of Cyp1a2 primary transcript and mRNA in LKO mice correlated with the elevation of aryl hydrocarbon receptor (AHR) and mediator 1 (MED1), two transactivators of Cyp1a2. Analysis of ChIP-seq data in the ENCODE (Encyclopedia of DNA Element) database identified association of CCCTC-binding factor (CTCF) with Ahr promoter in mouse livers. Both MED1 and CTCF are validated conserved miR-122 targets. Furthermore, depletion of Ahr, Med1, or Ctcf in Mir122 -/- hepatocytes reduced Cyp1a2 expression. Pulse-chase studies found that CYP2E1 protein level is upregulated in LKO hepatocytes. Notably, miR-122 depletion sensitized differentiated human HepaRG cells to acetaminophen toxicity that correlated with upregulation of AHR, MED1, and CYP1A2 expression. Collectively, these results reveal a critical role of miR-122 in acetaminophen detoxification and implicate its therapeutic potential in patients with ALF. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Lysine-specific demethylase 2A (KDM2A) normalizes human embryonic stem cell derived keratinocytes

PubMed Central

Iuchi, Shiro; Green, Howard

2012-01-01

Studies on human lysine-specific demethylase 2A (KDM2A) by others have recently begun. To date, the demethylase activity has been known to reduce expression of genes and eventually inhibit proliferation of cells. However, while attempting to improve proliferation of hES-cell–derived Nod keratinocytes, which grow poorly and have a short life span, we found that high expression of the KDM2A gene improves the poor proliferation of the cells. Of the four isomer cDNAs that we prepared from alternatively spliced KDM2A transcripts, only one stimulates the proliferation. This (KDM2A-N782) encodes the 782AA protein containing the JmjC, CXXC, and Ring domains, but not the F-box and AMN1 domains, unlike KDM2A, which has been studied by other groups. Our results not only show that differently spliced transcripts from a gene result in totally opposite outcomes, but also present critical evidence of the complicated activities of KDM2A, which contains all of the five domains. PMID:22635273

Germline mutations in lysine specific demethylase 1 (LSD1/KDM1A) confer susceptibility to multiple myeloma.

PubMed

Wei, Xiaomu; Calvo-Vidal, M Nieves; Chen, Siwei; Wu, Gang; Revuelta, Maria V; Sun, Jian; Zhang, Jinghui; Walsh, Michael F; Nichols, Kim E; Joseph, Vijai; Snyder, Carrie; Vachon, Celine M; McKay, James D; Wang, Shu-Ping; Jayabalan, David S; Jacobs, Lauren M; Becirovic, Dina; Waller, Rosalie G; Artomov, Mykyta; Viale, Agnes; Patel, Jayeshkumar; Phillip, Jude M; Chen-Kiang, Selina; Curtin, Karen; Salama, Mohamed; Atanackovic, Djordje; Niesvizky, Ruben; Landgren, Ola; Slager, Susan L; Godley, Lucy A; Churpek, Jane; Garber, Judy E; Anderson, Kenneth C; Daly, Mark J; Roeder, Robert G; Dumontet, Charles; Lynch, Henry T; Mullighan, Charles G; Camp, Nicola J; Offit, Kenneth; Klein, Robert J; Yu, Haiyuan; Cerchietti, Leandro; Lipkin, Steven M

2018-03-20

Given the frequent and largely incurable occurrence of multiple myeloma (MM), identification of germline genetic mutations that predispose cells to MM may provide insight into disease etiology and the developmental mechanisms of its cell of origin, the plasma cell. Here we identified familial and early-onset MM kindreds with truncating mutations in lysine-specific demethylase 1 (LSD1/KDM1A), an epigenetic transcriptional repressor that primarily demethylates histone H3 on lysine 4 and regulates hematopoietic stem cell self-renewal. Additionally, we found higher rates of germline truncating and predicted deleterious missense KDM1A mutations in MM patients unselected for family history compared to controls. Both monoclonal gammopathy of unknown significance (MGUS) and MM cells have significantly lower KDM1A transcript levels compared with normal plasma cells. Transcriptome analysis of MM cells from KDM1A mutation carriers shows enrichment of pathways and MYC target genes previously associated with myeloma pathogenesis. In mice, antigen challenge followed by pharmacological inhibition of KDM1A promoted plasma cell expansion, enhanced secondary immune response, elicited appearance of serum paraprotein, and mediated upregulation of MYC transcriptional targets. These changes are consistent with the development of MGUS. Collectively, our findings show KDM1A is the first autosomal dominant MM germline predisposition gene, providing new insights into its mechanistic roles as a tumor suppressor during post-germinal center B cell differentiation. Copyright ©2018, American Association for Cancer Research.

Overexpressed KDM5B is associated with the progression of glioma and promotes glioma cell growth via downregulating p21

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Bin; Hu, Zhiqiang, E-mail: zhiqhutg@126.com; Huang, Hui

Highlights: • KDM5B is overexpressed in glioma samples. • KDM5B stimulated proliferation of glioma cells. • Inhibition of p21contributes to KDM5B-induced proliferation. - Abstract: Epigenetic alterations such as aberrant expression of histone-modifying enzymes have been implicated in tumorigenesis. Upregulation of lysine (K)-specific demethylase 5B (KDM5B) has been reported in a variety of malignant tumors. However, the impact of KDM5B in glioma remains unclear. The objective of this study was to investigate the expression and prognostic value of KDM5B in glioma. In clinical glioma samples, we found that KDM5B expression was significantly upregulated in cancer lesions compared with normal brain tissues.more » Kaplan–Meier analysis showed that patients with glioma and higher KDM5B expression tend to have shorter overall survival time. By silencing or overexpressing KDM5B in glioma cells, we found that KDM5B could promote cell growth both in vitro and in vivo. Moreover, we demonstrated that KDM5B promoted glioma proliferation partly via regulation of the expression of p21. Our study provided evidence that KDM5B functions as a novel tumor oncogene in glioma and may be a potential therapeutic target for glioma management.« less

AST1306, a potent EGFR inhibitor, antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance.

PubMed

Zhang, Hui; Wang, Yi-Jun; Zhang, Yun-Kai; Wang, De-Shen; Kathawala, Rishil J; Patel, Atish; Talele, Tanaji T; Chen, Zhe-Sheng; Fu, Li-Wu

2014-08-01

AST1306, an inhibitor of EGFR and ErbB2, is currently in phase I of clinical trials. We evaluated the effect of AST306 on the reversal of multidrug resistance (MDR) induced by ATP-binding cassette (ABC) transporters. We found that AST1306 significantly sensitized the ABC subfamily G member 2 (ABCG2)-overexpressing cells to ABCG2 substrate chemotherapeutics. AST1306 significantly increased intracellular accumulation of [(3)H]-mitoxantrone in ABCG2-overexpressing cells by blocking ABCG2 efflux function. Moreover, AST1306 stimulated the ATPase activity of ABCG2. Homology modeling predicted the binding conformation of AST1306 to be within the transmembrane region of ABCG2. In conclusion, AST1306 could notably reverse ABCG2-mediated MDR. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.

PubMed

Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao

2015-06-15

Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.

FunShift: a database of function shift analysis on protein subfamilies

PubMed Central

Abhiman, Saraswathi; Sonnhammer, Erik L. L.

2005-01-01

Members of a protein family normally have a general biochemical function in common, but frequently one or more subgroups have evolved a slightly different function, such as different substrate specificity. It is important to detect such function shifts for a more accurate functional annotation. The FunShift database described here is a compilation of function shift analysis performed between subfamilies in protein families. It consists of two main components: (i) subfamilies derived from protein domain families and (ii) pairwise subfamily comparisons analyzed for function shift. The present release, FunShift 12, was derived from Pfam 12 and consists of 151 934 subfamilies derived from 7300 families. We carried out function shift analysis by two complementary methods on families with up to 500 members. From a total of 179 210 subfamily pairs, 62 384 were predicted to be functionally shifted in 2881 families. Each subfamily pair is provided with a markup of probable functional specificity-determining sites. Tools for searching and exploring the data are provided to make this database a valuable resource for protein function annotation. Knowledge of these functionally important sites will be useful for experimental biologists performing functional mutation studies. FunShift is available at http://FunShift.cgb.ki.se. PMID:15608176

To the theory of mechanisms subfamilies

NASA Astrophysics Data System (ADS)

Fomin, A.; Dvornikov, L.; Paramonov, M.; Jahr, A.

2016-04-01

The principles of formation of mechanisms subfamilies based on the usage of different kinds of kinematic pairs within the families of mechanisms are substantiated in the current paper. The division of mechanisms into subfamilies allows defining not only fundamental differences in the structure of mechanisms, but also provides the necessary foundation for the synthesis of new structures. 57 subfamilies of mechanisms have been totally distinguished. Among them, 31 subfamilies - within the zero family, 15 subfamilies - within the first family, 7 subfamilies - within the second family, 3 subfamilies - within the third family and 1 subfamily-within the fourth family. There were separately viewed planar mechanisms of the third family with three general imposed constraints and spatial mechanisms of the second family with two general imposed constraints in terms of their subfamilies. New methods of kinematical and dynamical investigations of mechanisms might be developed according to their analytical equations describing structural organization of different subfamilies of mechanisms.

Regulation of Epigenetic Modifiers, Including KDM6B, by Interferon-γ and Interleukin-4 in Human Macrophages.

PubMed

Yıldırım-Buharalıoğlu, Gökçe; Bond, Mark; Sala-Newby, Graciela B; Hindmarch, Charles C T; Newby, Andrew C

2017-01-01

Interferon-γ (IFN-γ) or interleukin-4 (IL-4) drives widely different transcriptional programs in macrophages. However, how IFN-γ and IL-4 alter expression of histone-modifying enzymes involved in epigenetic regulation and how this affects the resulting phenotypic polarization is incompletely understood. We investigated steady-state messenger RNA levels of 84 histone-modifying enzymes and related regulators in colony-stimulating factor-1 differentiated primary human macrophages using quantitative polymerase chain reaction. IFN-γ or IL-4 treatment for 6-48 h changed 11 mRNAs significantly. IFN-γ increased CIITA, KDM6B, and NCOA1, and IL-4 also increased KDM6B by 6 h. However, either cytokine decreased AURKB, ESCO2, SETD6, SUV39H1, and WHSC1, whereas IFN-γ alone decreased KAT2A, PRMT7, and SMYD3 mRNAs only after 18 h, which coincided with decreased cell proliferation. Rendering macrophages quiescent by growth factor starvation or adenovirus-mediated overexpression of p27 kip1 inhibited expression of AURKB, ESCO2, SUV39H1, and WHSC1, and mRNA levels were restored by overexpressing the S-phase transcription factor E2F1, implying their expression, at least partly, depended on proliferation. However, CIITA, KDM6B, NCOA1, KAT2A, PRMT7, SETD6, and SMYD3 were regulated independently of effects on proliferation. Silencing KDM6B, the only transcriptional activator upregulated by both IFN-γ and IL-4, pharmacologically or with short hairpin RNA, blunted a subset of responses to each cytokine. These findings demonstrate that IFN-γ or IL-4 can regulate the expression of histone acetyl transferases and histone methyl transferases independently of effects on proliferation and that upregulation of the histone demethylase, KDM6B, assists phenotypic polarization by both cytokines.

EED and KDM6B Coordinate the First Mammalian Cell Lineage Commitment To Ensure Embryo Implantation

PubMed Central

Saha, Biswarup; Home, Pratik; Ray, Soma; Larson, Melissa; Paul, Arindam; Rajendran, Ganeshkumar; Behr, Barry

2013-01-01

The first mammalian cell lineage commitment is the formation of the trophectoderm (TE) and the inner cell mass (ICM) lineages during preimplantation development. Proper development of the TE and ICM lineages is dependent upon establishment of specific transcriptional programs. However, the epigenetic mechanisms that functionally contribute to establish TE- and ICM-specific transcriptional programs are poorly understood. Here, we show that proper development of the TE and ICM lineages is coordinated via combinatorial regulation of embryonic ectoderm development (EED) and lysine-specific demethylase 6B (KDM6B). During blastocyst formation, the relative levels of EED and KDM6B expression determine altered polycomb repressor 2 (PRC2) complex recruitment and incorporation of the repressive histone H3 lysine 27 trimethylation (H3K27Me3) mark at the chromatin domains of TE-specific master regulators CDX2 and GATA3, leading to their activation in the TE lineage and repression in the ICM lineage. Furthermore, ectopic gain of EED along with depletion of KDM6B in preimplantation mouse embryos abrogates CDX2 and GATA3 expression in the nascent TE lineage. The loss of CDX2 and GATA3 in the nascent TE lineage results in improper TE development, leading to failure in embryo implantation to the uterus. Our study delineates a novel epigenetic mechanism that orchestrates proper development of the first mammalian cell lineages. PMID:23671187

Influence of the KDM4A rs586339 polymorphism on overall survival in Asian non-small-cell lung cancer patients.

PubMed

Marvalim, Charlie; Wong, Jing Xiang Gimson; Sutiman, Natalia; Lim, Wan Teck; Tan, Shao Weng; Kanesvaran, Ravindran; Ng, Quan Sing; Jain, Amit; Ang, Mei Kim; Tan, Wan Ling; Toh, Chee Keong; Tan, Eng Huat; Chowbay, Balram

2017-03-01

The critical role of lysine demethylase 4A (KDM4A), in regulating chromatin structure and consequently in driving cellular proliferation and oncogenesis has been the focus of recent studies. Non-small-cell lung cancer (NSCLC) patients with adenocarcinoma histology who were homozygous for KDM4A single nucleotide polymorphism (SNP)-A482 (rs586339) were recently shown to have significantly worse overall survival (OS) compared with patients with the wild-type or the heterozygous genotype at this locus (hazard ratio=1.68, P=0.042). In the current study, we investigated the association between the same polymorphism with OS in our Asian NSCLC-adenocarcinoma patients comprising Chinese (N=572), Malays (N=50), and Indians (N=22). KDM4A SNP-A482 genotype status was determined by Sanger sequencing. OS was calculated from the date of diagnosis to date of death or censored at the date of last follow-up. Kaplan-Meier analysis, log-rank test, and Cox regression methods were utilized to evaluate OS outcomes. KDM4A SNP-A482 had a minor allele (C) frequency of 18.8% and a major allele (A) frequency of 81.2% in our Asian NSCLC (adenocarcinoma) patients. However, the OS in our Asian NSCLC patients homozygous for KDM4A SNP-A482 was not significantly different from those who were wild type or heterozygous at this locus [CC vs. AA/AC: median OS (95% confidence interval): 40.2 (18.7-61.6) vs. 29.6 (26.9-32.3) months; P=0.858]. The results remained statistically nonsignificant even after adjustment for epidermal growth factor receptor mutational status, suggesting that KDM4A SNP-A482 does not significantly influence OS in Asian NSCLC patients.

Plant homologs of mammalian MBT-domain protein-regulated KDM1 histone lysine demethylases do not interact with plant Tudor/PWWP/MBT-domain proteins

PubMed Central

Sadiq, Irfan; Keren, Ido; Citovsky, Vitaly

2016-01-01

Histone lysine demethylases of the LSD1/KDM1 family play important roles in epigenetic regulation of eukaryotic chromatin, and they are conserved between plants and animals. Mammalian LSD1 is thought to be targeted to its substrates, i.e., methylated histones, by an MBT-domain protein SFMBT1 that represents a component of the LSD1-based repressor complex and binds methylated histones. Because MBT-domain proteins are conserved between different organisms, from animals to plants, we examined whether the KDM1-type histone lysine demethylases KDM1C and FLD of Arabidopsis interact with the Arabidopsis Tudor/PWWP/MBT-domain SFMBT1-like proteins SL1, SL2, SL3, and SL4. No such interaction was detected using the bimolecular fluorescence complementation assay in living plant cells. Thus, plants most likely direct their KDM1 chromatin-modifying enzymes to methylated histones of the target chromatin by a mechanism different from that employed by the mammalian cells. PMID:26826387

Plant homologs of mammalian MBT-domain protein-regulated KDM1 histone lysine demethylases do not interact with plant Tudor/PWWP/MBT-domain proteins.

PubMed

Sadiq, Irfan; Keren, Ido; Citovsky, Vitaly

2016-02-19

Histone lysine demethylases of the LSD1/KDM1 family play important roles in epigenetic regulation of eukaryotic chromatin, and they are conserved between plants and animals. Mammalian LSD1 is thought to be targeted to its substrates, i.e., methylated histones, by an MBT-domain protein SFMBT1 that represents a component of the LSD1-based repressor complex and binds methylated histones. Because MBT-domain proteins are conserved between different organisms, from animals to plants, we examined whether the KDM1-type histone lysine demethylases KDM1C and FLD of Arabidopsis interact with the Arabidopsis Tudor/PWWP/MBT-domain SFMBT1-like proteins SL1, SL2, SL3, and SL4. No such interaction was detected using the bimolecular fluorescence complementation assay in living plant cells. Thus, plants most likely direct their KDM1 chromatin-modifying enzymes to methylated histones of the target chromatin by a mechanism different from that employed by the mammalian cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Preclinical activity of combined HDAC and KDM1A inhibition in glioblastoma

PubMed Central

Singh, Melissa M.; Johnson, Blake; Venkatarayan, Avinashnarayan; Flores, Elsa R.; Zhang, Jianping; Su, Xiaoping; Barton, Michelle; Lang, Frederick; Chandra, Joya

2015-01-01

Background Glioblastoma (GBM) is the most common and aggressive form of brain cancer. Our previous studies demonstrated that combined inhibition of HDAC and KDM1A increases apoptotic cell death in vitro. However, whether this combination also increases death of the glioma stem cell (GSC) population or has an effect in vivo is yet to be determined. Therefore, we evaluated the translational potential of combined HDAC and KDM1A inhibition on patient-derived GSCs and xenograft GBM mouse models. We also investigated the changes in transcriptional programing induced by the combination in an effort to understand the induced molecular mechanisms of GBM cell death. Methods Patient-derived GSCs were treated with the combination of vorinostat, a pan-HDAC inhibitor, and tranylcypromine, a KDM1A inhibitor, and viability was measured. To characterize transcriptional profiles associated with cell death, we used RNA-Seq and validated gene changes by RT-qPCR and protein expression via Western blot. Apoptosis was measured using DNA fragmentation assays. Orthotopic xenograft studies were conducted to evaluate the effects of the combination on tumorigenesis and to validate gene changes in vivo. Results The combination of vorinostat and tranylcypromine reduced GSC viability and displayed efficacy in the U87 xenograft model. Additionally, the combination led to changes in apoptosis-related genes, particularly TP53 and TP73 in vitro and in vivo. Conclusions These data support targeting HDACs and KDM1A in combination as a strategy for GBM and identifies TP53 and TP73 as being altered in response to treatment. PMID:25795306

Over-expression in Escherichia coli, purification and reconstitution in liposomes of the third member of the OCTN sub-family: The mouse carnitine transporter OCTN3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scalise, Mariafrancesca; Galluccio, Michele; Pochini, Lorena

2012-05-25

Highlights: Black-Right-Pointing-Pointer mOCTN3 transport protein has been cloned in pET-21a(+) and over-expressed in Escherichia coli. Black-Right-Pointing-Pointer The expressed mOCTN3 has been purified to homogeneity by Ni-chelating chromatography. Black-Right-Pointing-Pointer The protein solubilised in Triton X-100 has been reconstituted in liposomes. Black-Right-Pointing-Pointer Recombinant mOCTN3 catalyses transport of carnitine by a uniport mode. -- Abstract: pET-21a(+)-mOCTN3-6His was constructed and used for over-expression in Escherichia coli Rosetta(DE3)pLysS. After IPTG induction a protein with apparent molecular mass of 53 kDa was collected in the insoluble fraction of the cell lysate and purified by Ni{sup 2+}-chelating chromatography with a yield of 2 mg/l of cell culture.more » The over-expressed protein was identified with mOCTN3 by anti-His antibody and reconstitution in liposomes. mOCTN3 required peculiar conditions for optimal expression and reconstitution in liposomes. The protein catalyzed a time dependent [{sup 3}H]carnitine uptake which was stimulated by intraliposomal ATP and nearly independent of the pH. The K{sub m} for carnitine was 36 {mu}M. [{sup 3}H]carnitine transport was inhibited by carnitine analogues and some Cys and NH{sub 2} reagents. This paper represents the first outcome in over-expressing, in active form, the third member of the OCTN sub-family, mOCTN3, in E. coli.« less

Multi-Protein Dynamic Combinatorial Chemistry: A Novel Strategy that Leads to Simultaneous Discovery of Subfamily-Selective Inhibitors for Nucleic Acid Demethylases FTO and ALKBH3.

PubMed

Das, Mohua; Tianming, Yang; Jinghua, Dong; Prasetya, Fransisca; Yiming, Xie; Wong, Kendra; Cheong, Adeline; Woon, Esther C Y

2018-06-19

Dynamic combinatorial chemistry (DCC) is a powerful supramolecular approach for discovering ligands for biomolecules. To date, most, if not all, biologically-templated DCC employ only a single biomolecule in directing the self-assembly process. To expand the scope and potential of DCC, herein, we developed a novel multi-protein DCC strategy which combines the discriminatory power of zwitterionic 'thermal-tag' with the sensitivity of differential scanning fluorimetry. This strategy enables the discovery of ligands against several proteins of interest concurrently. It is remarkably sensitive and could differentiate the binding of ligands to structurally-similar subfamily members, which is extremely challenging to achieve. Through this approach, we were able to simultaneously identify subfamily-selective probes against two clinically important epigenetic enzymes, FTO (7; IC₅₀ = 2.6 µM) and ALKBH3 (8; IC₅₀ = 3.7 µM). To our knowledge, this is the first report of a subfamily-selective ALKBH3 inhibitor. The developed strategy could, in principle, be adapted to a broad range of proteins, thus it shall be of widespread scientific interest. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cytochrome P450 CYP3A in marsupials: cloning and identification of the first CYP3A subfamily member, isoform 3A70 from Eastern gray kangaroo (Macropus giganteus).

PubMed

El-Merhibi, Adaweyah; Ngo, Suong N T; Marchant, Ceilidh L; Height, Tamara A; Stupans, Ieva; McKinnon, Ross A

2012-09-15

Australian marsupials are unique fauna that have evolved and adapted to unique environments and thus it is likely that their detoxification systems differ considerably from those of well-studied eutherian mammals. Knowledge of these processes in marsupials is therefore vital to understanding the consequences of exposure to xenobiotics. Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of both xenobiotics and endogenous substrates. In this study we have cloned and characterized CYP3A70, the first identified member of the CYP3A gene subfamily from Eastern gray kangaroo (Macropus giganteus). A 1665 base pair kangaroo hepatic CYP3A complete cDNA, designated CYP3A70, was cloned by reverse transcription-polymerase chain reaction approaches, which encodes a protein of 506 amino acids. The CYP3A70 cDNA shares approximately 71% nucleotide and 65% amino acid sequence homology to human CYP3A4 and displays high sequence similarity to other published mammalian CYP3As from human, monkey, cow, pig, dog, rat, rabbit, mouse, hamster, and guinea pig. Transfection of the CYP3A70 cDNAs into 293T cells resulted in stable cell lines expressing a CYP3A immuno-reactive protein that was recognized by a goat anti-human CYP3A4 polyclonal antibody. The anti-human CYP3A4 antibody also detected immunoreactive proteins in liver microsomes from all test marsupials, including the kangaroo, koala, wallaby, and wombat, with multiple CYP3A immunoreactive bands observed in kangaroo and wallaby tissues. Relatively, very low CYP catalytic activity was detected for the kangaroo CYP3A70 cDNA-expressed proteins (19.6 relative luminescent units/μg protein), which may be due to low protein expression levels. Collectively, this study provides primary molecular data regarding the Eastern kangaroo hepatic CYP3A70 gene and enables further functional analyses of CYP3A enzymes in marsupials. Copyright © 2012 Elsevier B.V. All rights reserved.

Integrated genomic analyses identify KDM1A's role in cell proliferation via modulating E2F signaling activity and associate with poor clinical outcome in oral cancer.

PubMed

Narayanan, Sathiya Pandi; Singh, Smriti; Gupta, Amit; Yadav, Sandhya; Singh, Shree Ram; Shukla, Sanjeev

2015-10-28

The histone demethylase KDM1A specifically demethylates lysine residues and its deregulation has been implicated in the initiation and progression of various cancers. However, KDM1A's molecular role and its pathological consequences, and prognostic significance in oral cancer remain less understood. In the present study, we sought to investigate the expression of KDM1A and its downstream role in oral cancer pathogenesis. By comparing mRNA expression profiles, we identified an elevated KDM1A expression in oral tumors when compared to normal oral tissues. In silico pathway prediction identified the association between KDM1A and E2F1 signaling in oral cancer. Pathway scanning, functional annotation analysis and In vitro assays showed the KDM1A's involvement in oral cancer cell proliferation and the cell cycle. Moreover, real time PCR and luciferase assays confirmed KDM1A's role in regulation of E2F1 signaling activity in oral cancer. Elevated KDM1A expression is associated with poor clinical outcome in oral cancer. Our data indicate that deregulated KDM1A expression is positively associated with proliferative phenotype of oral cancer and confers poor clinical outcome. These cumulative data suggest that KDM1A might be a potential diagnostic and therapeutic target for oral cancer. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Leaf and Stem CO2 Uptake in the Three Subfamilies of the Cactaceae 1

PubMed Central

Nobel, Park S.; Hartsock, Terry L.

1986-01-01

Net CO2 uptake over 24-hour periods was examined for the leaves and for the stems of 11 species of cacti representing all three subfamilies. For Pereskia aculeata, Pereskia grandifolia, and Maihuenia poeppigii (subfamily Pereskioideae), all the net shoot CO2 uptake was by the leaves and during the daytime. In contrast, for the leafless species Carnegiea gigantea, Ferocactus acanthodes, Coryphantha vivipara, and Mammillaria dioica (subfamily Cactoideae), all the shoot net CO2 uptake was by the stems and at night. Similarly, for leafless Opuntia ficus-indica (subfamily Opuntioideae), all net CO2 uptake occurred at night. For leafy members of the Opuntioideae (Pereskiopsis porteri, Quiabentia chacoensis, Austrocylindropuntia subulata), at least 88% of the shoot CO2 uptake over 24 hours was by the leaves and some CO2 uptake occurred at night. Leaves responded to the instantaneous level of photosynthetically active radiation (PAR) during the daytime, as occurs for C3 plants, whereas nocturnal CO2 uptake by stems of O. ficus-indica and F. acanthodes responded to the total daily PAR, as occurs for Crassulacean acid metabolism (CAM) plants. Thus, under the well-watered conditions employed, the Pereskioideae behaved as C3 plants, the Cactoideae behaved as CAM plants, and the Opuntioideae exhibited characteristics of both pathways. PMID:16664741

The BBX subfamily IV: additional cogs and sprockets to fine-tune light-dependent development.

PubMed

Sarmiento, Felipe

2013-04-01

Plants depend on light during all phases of its life cycle, and have evolved a complex signaling network to constantly monitor its surroundings. Photomorphogenesis, a process during which the plant reprograms itself in order to dwell life in presence of light is one of the most studied phenomena in plants. Recent mutant analyses using model plant Arabidopsis thaliana and protein interaction assays have unraveled a new set of players, an 8-member subfamily of B-box proteins, known as BBX subfamily IV. For the members of this subfamily, positive (BBX21, BBX22) as well as negative (BBX24) functions have been described for its members, showing a strong association to two major players of the photomorphogenic cascade, HY5 and COP1. The roles of these new BBX regulators are not restricted to photomorphogenesis, but also have functions in other facets of light-dependent development. Therefore this newly identified set of regulators has opened up new insights into the understanding of the fine-tuning of this complex process.

KDM2B Recruitment of the Polycomb Group Complex, PRC1.1, Requires Cooperation between PCGF1 and BCORL1.

PubMed

Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A

2016-10-04

KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.

A novel member of glycoside hydrolase family 30 subfamily 8 with altered substrate specificity

Treesearch

Franz J. St John; Diane Dietrich; Casey Crooks; Edwin Pozharski; Javier M. González; Elizabeth Bales; Kennon Smith; Jason C. Hurlbert

2014-01-01

Endoxylanases classified into glycoside hydrolase family 30 subfamily 8 (GH30-8) are known to hydrolyze the hemicellulosic polysaccharide glucuronoxylan (GX) but not arabinoxylan or neutral xylooligosaccharides. This is owing to the specificity of these enzymes for the

Alcohol-induced suppression of KDM6B dysregulates the mineralization potential in dental pulp stem cells

PubMed Central

Hoang, Michael; Kim, Jeffrey J.; Kim, Yiyoung; Tong, Elizabeth; Trammell, Benjamin; Liu, Yao; Shi, Songtao; Lee, Chang-Ryul; Hong, Christine; Wang, Cun-Yu; Kim, Yong

2016-01-01

Epigenetic changes, such as alteration of DNA methylation patterns, have been proposed as a molecular mechanism underlying the effect of alcohol on the maintenance of adult stem cells. We have performed genome-wide gene expression microarray and DNA methylome analysis to identify molecular alterations via DNA methylation changes associated with exposure of human dental pulp stem cells (DPSCs) to ethanol (EtOH). By combined analysis of the gene expression and DNA methylation, we have found a significant number of genes that are potentially regulated by EtOH-induced DNA methylation. As a focused approach, we have also performed a pathway-focused RT-PCR array analysis to examine potential molecular effects of EtOH on genes involved in epigenetic chromatin modification enzymes, fibroblastic markers, and stress and toxicity pathways in DPSCs. We have identified and verified that lysine specific demethylase 6B (KDM6B) was significantly dysregulated in DPSCs upon EtOH exposure. EtOH treatment during odontogenic/osteogenic differentiation of DPSCs suppressed the induction of KDM6B with alterations in the expression of differentiation markers. Knockdown of KDM6B resulted in a marked decrease in mineralization from implanted DPSCs in vivo. Furthermore, an ectopic expression of KDM6B in EtOH-treated DPSCs restored the expression of differentiation-related genes. Our study has demonstrated that EtOH-induced inhibition of KDM6B plays a role in the dysregulation of odontogenic/osteogenic differentiation in the DPSC model. This suggests a potential molecular mechanism for cellular insults of heavy alcohol consumption that can lead to decreased mineral deposition potentially associated with abnormalities in dental development and also osteopenia/osteoporosis, hallmark features of fetal alcohol spectrum disorders. PMID:27286573

From a novel HTS hit to potent, selective, and orally bioavailable KDM5 inhibitors.

PubMed

Liang, Jun; Labadie, Sharada; Zhang, Birong; Ortwine, Daniel F; Patel, Snahel; Vinogradova, Maia; Kiefer, James R; Mauer, Till; Gehling, Victor S; Harmange, Jean-Christophe; Cummings, Richard; Lai, Tommy; Liao, Jiangpeng; Zheng, Xiaoping; Liu, Yichin; Gustafson, Amy; Van der Porten, Erica; Mao, Weifeng; Liederer, Bianca M; Deshmukh, Gauri; An, Le; Ran, Yingqing; Classon, Marie; Trojer, Patrick; Dragovich, Peter S; Murray, Lesley

2017-07-01

A high-throughput screening (HTS) of the Genentech/Roche library identified a novel, uncharged scaffold as a KDM5A inhibitor. Lacking insight into the binding mode, initial attempts to improve inhibitor potency failed to improve potency, and synthesis of analogs was further hampered by the presence of a C-C bond between the pyrrolidine and pyridine. Replacing this with a C-N bond significantly simplified synthesis, yielding pyrazole analog 35, of which we obtained a co-crystal structure with KDM5A. Using structure-based design approach, we identified 50 with improved biochemical, cell potency and reduced MW and lower lipophilicity (LogD) compared with the original hit. Furthermore, 50 showed lower clearance than 9 in mice. In combination with its remarkably low plasma protein binding (PPB) in mice (40%), oral dosing of 50 at 5mg/kg resulted in unbound C max ∼2-fold of its cell potency (PC9 H3K4Me3 0.96μM), meeting our criteria for an in vivo tool compound from a new scaffold. Copyright © 2017 Elsevier Ltd. All rights reserved.

Masitinib Antagonizes ATP-Binding Cassette Subfamily C Member 10-Mediated Paclitaxel Resistance: A Preclinical Study

PubMed Central

Kathawala, Rishil J.; Sodani, Kamlesh; Chen, Kang; Patel, Atish; Abuznait, Alaa H.; Anreddy, Nagaraju; Sun, Yue-Li; Kaddoumi, Amal; Ashby, Charles R.; Chen, Zhe-Sheng

2014-01-01

Paclitaxel displays clinical activity against a wide variety of solid tumors. However, resistance to paclitaxel significantly attenuates the response to chemotherapy. The ABC transporter subfamily C member 10 (ABCC10), also known as multi-drug resistance protein 7 (MRP7) efflux transporter, is a major mediator of paclitaxel resistance. In this study, we show that masitinib, a small molecule stem-cell growth factor receptor (c-Kit) tyrosine kinase inhibitor, at non-toxic concentrations, significantly attenuates paclitaxel resistance in HEK293 cells transfected with ABCC10. Our in vitro studies indicated that masitinib (2.5 μM) enhanced the intracellular accumulation and decreased the efflux of paclitaxel by inhibiting the ABCC10 transport activity without altering the expression level of ABCC10 protein. Furthermore, masitinib, in combination with paclitaxel, significantly inhibited the growth of ABCC10-expressing tumors in nude athymic mice in vivo. Masitinib administration also resulted in a significant increase in the levels of paclitaxel in the plasma, tumors and lungs compared to paclitaxel alone. In conclusion, the combination of paclitaxel and masitinib could serve as a novel and useful therapeutic strategy to reverse paclitaxel resistance mediated by ABCC10. PMID:24431074

Congenital Hyperinsulinism in Infants with Turner Syndrome: Possible Association with Monosomy X and KDM6A Haploinsufficiency.

PubMed

Gibson, Christopher E; Boodhansingh, Kara E; Li, Changhong; Conlin, Laura; Chen, Pan; Becker, Susan A; Bhatti, Tricia; Bamba, Vaneeta; Adzick, N Scott; De Leon, Diva D; Ganguly, Arupa; Stanley, Charles A

2018-06-14

Previous case reports have suggested a possible association of congenital hyperinsulinism with Turner syndrome. We examined the clinical and molecular features in girls with both congenital hyperinsulinism and Turner syndrome seen at The Children's Hospital of Philadelphia (CHOP) between 1974 and 2017. Records of girls with hyperinsulinism and Turner syndrome were reviewed. Insulin secretion was studied in pancreatic islets and in mouse islets treated with an inhibitor of KDM6A, an X chromosome gene associated with hyperinsulinism in Kabuki syndrome. Hyperinsulinism was diagnosed in 12 girls with Turner syndrome. Six were diazoxide-unresponsive; 3 had pancreatectomies. The incidence of Turner syndrome among CHOP patients with hyperinsulinism (10 of 1,050 from 1997 to 2017) was 48 times more frequent than expected. The only consistent chromosomal anomaly in these girls was the presence of a 45,X cell line. Studies of isolated islets from 1 case showed abnormal elevated cytosolic calcium and heightened sensitivity to amino acid-stimulated insulin release; similar alterations were demonstrated in mouse islets treated with a KDM6A inhibitor. These results demonstrate a higher than expected frequency of Turner syndrome among children with hyperinsulinism. Our data suggest that haploinsufficiency for KDM6A due to mosaic X chromosome monosomy may be responsible for hyperinsulinism in Turner syndrome. © 2018 S. Karger AG, Basel.

Aberrant promoter hypermethylation of PBRM1, BAP1, SETD2, KDM6A and other chromatin-modifying genes is absent or rare in clear cell RCC

PubMed Central

Ibragimova, Ilsiya; Maradeo, Marie E.; Dulaimi, Essel; Cairns, Paul

2013-01-01

Recent sequencing studies of clear cell (conventional) renal cell carcinoma (ccRCC) have identified inactivating point mutations in the chromatin-modifying genes PBRM1, KDM6A/UTX, KDM5C/JARID1C, SETD2, MLL2 and BAP1. To investigate whether aberrant hypermethylation is a mechanism of inactivation of these tumor suppressor genes in ccRCC, we sequenced the promoter region within a bona fide CpG island of PBRM1, KDM6A, SETD2 and BAP1 in bisulfite-modified DNA of a representative series of 50 primary ccRCC, 4 normal renal parenchyma specimens and 5 RCC cell lines. We also interrogated the promoter methylation status of KDM5C and ARID1A in the Cancer Genome Atlas (TCGA) ccRCC Infinium data set. PBRM1, KDM6A, SETD2 and BAP1 were unmethylated in all tumor and normal specimens. KDM5C and ARID1A were unmethylated in the TCGA 219 ccRCC and 119 adjacent normal specimens. Aberrant promoter hypermethylation of PBRM1, BAP1 and the other chromatin-modifying genes examined here is therefore absent or rare in ccRCC. PMID:23644518

Reduced Histone H3 Lysine 9 Methylation Contributes to the Pathogenesis of Latent Autoimmune Diabetes in Adults via Regulation of SUV39H2 and KDM4C.

PubMed

Liu, Xi-Yu; Li, Hong

2017-01-01

Aims . Latent autoimmune diabetes in adults (LADA) is an autoimmune disease of which the mechanism is not clear. Emerging evidence suggests that histone methylation contributes to autoimmunity. Methods . Blood CD4 + T lymphocytes from 26 LADA patients and 26 healthy controls were isolated to detect histone H3 lysine 4 and H3 lysine 9 methylation status. Results . Reduced global H3 lysine 9 methylation was observed in LADA patients' CD4 + T lymphocytes, compared to healthy controls ( P < 0.05). H3 lysine 4 methylation was not statistically different. The reduced H3 lysine 9 methylation was associated with GADA titer but not correlated with glycosylated hemoglobin (HbA1c). When the LADA patient group was divided into those with complication and those without, relatively reduced global H3 lysine 9 methylation was observed in LADA patients with complication ( P < 0.05). The expression of histone methyltransferase SUV39H2 for H3 lysine 9 methylation was downregulated in LADA patients, and the expression of histone demethylase KDM4C which made H3 lysine 9 demethylation was upregulated. Conclusion . The reduction of histone H3 lysine 9 methylation which may due to the downregulation of methyltransferase SUV39H2 and the upregulation of demethylase KDM4C was found in CD4 + T lymphocytes of LADA patients.

Structure-function analysis of HKE4, a member of the new LIV-1 subfamily of zinc transporters.

PubMed Central

Taylor, Kathryn M; Morgan, Helen E; Johnson, Andrea; Nicholson, Robert I

2004-01-01

The KE4 proteins are an emerging group of proteins with little known functional data. In the present study, we report the first characterization of the recombinant human KE4 protein in mammalian cells. The KE4 sequences are included in the subfamily of ZIP (Zrt-, Irt-like Proteins) zinc transporters, which we have termed LZT (LIV-1 subfamily of ZIP zinc Transporters). All these LZT sequences contain similarities to ZIP transporters, including the consensus sequence in transmembrane domain IV, which is essential for zinc transport. However, the new LZT subfamily can be separated from other ZIP transporters by the presence of a highly conserved potential metalloprotease motif (HEXPHEXGD) in transmembrane domain V. Here we report the location of HKE4 on intracellular membranes, including the endoplasmic reticulum, and its ability to increase the intracellular free zinc as measured with the zinc-specific fluorescent dye, Newport Green, in a time-, temperature- and concentration-dependent manner. This is in contrast with the zinc influx ability of another LZT protein, LIV-1, which was due to its plasma membrane location. Therefore we have added to the functionality of LZT proteins by reporting their ability to increase intracellular-free zinc, whether they are located on the plasma membrane or on intracellular membranes. This result, in combination with the crucial role that zinc plays in cell growth, emphasizes the importance of this new LZT subfamily, including the KE4 sequences, in the control of intracellular zinc homoeostasis, aberrations of which can lead to diseases such as cancer, immunological disorders and neurological dysfunction. PMID:14525538

Expanding the Oro-Dental and Mutational Spectra of Kabuki Syndrome and Expression of KMT2D and KDM6A in Human Tooth Germs

PubMed Central

Porntaveetus, Thantrira; Abid, Mushriq F; Theerapanon, Thanakorn; Srichomthong, Chalurmpon; Ohazama, Atsushi; Kawasaki, Katsushige; Kawasaki, Maiko; Suphapeetiporn, Kanya; Sharpe, Paul T.; Shotelersuk, Vorasuk

2018-01-01

Kabuki syndrome is a rare genetic disorder characterized by distinct dysmorphic facial features, intellectual disability, and multiple developmental abnormalities. Despite more than 350 documented cases, the oro-dental spectrum associated with kabuki syndrome and expression of KMT2D (histone-lysine N-methyltransferase 2D) or KDM6A (lysine-specific demethylase 6A) genes in tooth development have not been well defined. Here, we report seven unrelated Thai patients with Kabuki syndrome having congenital absence of teeth, malocclusion, high-arched palate, micrognathia, and deviated tooth shape and size. Exome sequencing successfully identified that six patients were heterozygous for mutations in KMT2D, and one in KDM6A. Six were novel mutations, of which five were in KMT2D and one in KDM6A. They were truncating mutations including four frameshift deletions and two nonsense mutations. The predicted non-functional KMT2D and KDM6A proteins are expected to cause disease by haploinsufficiency. Our study expands oro-dental, medical, and mutational spectra associated with Kabuki syndrome. We also demonstrate for the first time that KMT2D and KDM6A are expressed in the dental epithelium of human tooth germs. PMID:29725259

Identification and Characterization of Three Orchid MADS-Box Genes of the AP1/AGL9 Subfamily during Floral Transition1

PubMed Central

Yu, Hao; Goh, Chong Jin

2000-01-01

Gene expressions associated with in vitro floral transition in an orchid hybrid (Dendrobium grex Madame Thong-In) were investigated by differential display. One clone, orchid transitional growth related gene 7 (otg7), encoding a new MADS-box gene, was identified to be specifically expressed in the transitional shoot apical meristem (TSAM). Using this clone as a probe, three orchid MADS-box genes, DOMADS1, DOMADS2, and DOMADS3, were subsequently isolated from the TSAM cDNA library. Phylogenetic analyses show that DOMADS1 and DOMADS2 are new members of the AGL2 subfamily and SQUA subfamily, respectively. DOMADS3 contains the signature amino acids as with the members in the independent OSMADS1 subfamily separated from the AGL2 subfamily. All three of the DOMADS genes were expressed in the TSAM during floral transition and later in mature flowers. DOMADS1 RNA was uniformly expressed in both of the inflorescence meristem and the floral primordium and later localized in all of the floral organs. DOMADS2 showed a novel expression pattern that has not been previously characterized for any other MADS-box genes. DOMADS2 transcript was expressed early in the 6-week-old vegetative shoot apical meristem in which the obvious morphological change to floral development had yet to occur. It was expressed throughout the process of floral transition and later in the columns of mature flowers. The onset of DOMADS3 transcription was in the early TSAM at the stage before the differentiation of the first flower primordium. Later, DOMADS3 transcript was only detectable in the pedicel tissues. Our results suggest that the DOMADS genes play important roles in the process of floral transition. PMID:10938351

Expression Profiling of Nuclear Receptors Identifies Key Roles of NR4A Subfamily in Uterine Fibroids

PubMed Central

Yin, Hanwei; Lo, Jay H.; Kim, Ji-Young; Marsh, Erica E.; Kim, J. Julie; Ghosh, Asish K.; Bulun, Serdar

2013-01-01

Uterine fibroids (UFs), also known as uterine leiomyomas, are benign, fibrotic smooth muscle tumors. Although the GnRH analog leuprolide acetate that suppresses gonadal steroid hormones is used as a treatment, it has significant side effects, thereby limiting its use. Availability of more effective therapy is limited because of a lack of understanding of molecular underpinnings of the disease. Although ovarian steroid hormones estrogen and progesterone and their receptors are clearly involved, the role of other nuclear receptors (NRs) in UFs is not well defined. We used quantitative real-time PCR to systematically profile the expression of 48 NRs and identified several NRs that were aberrantly expressed in UFs. Among others, expression of NR4A subfamily members including NGFIB (NR4A1), NURR1 (NR4A2), and NOR1 (NR4A3) were dramatically suppressed in leiomyoma compared with the matched myometrium. Restoration of expression of each of these NR4A members in the primary leiomyoma smooth muscle cells decreased cell proliferation. Importantly, NR4As regulate expressions of the profibrotic factors including TGFβ3 and SMAD3, and several collagens that are key components of the extracellular matrix. Finally, we identify NR4A members as targets of leuprolide acetate treatment. Together, our results implicate several NRs including the NR4A subfamily in leiomyoma etiology and identify NR4As as potential therapeutic targets for treating fibrotic diseases. PMID:23550059

Thieno[3,2-b]pyrrole-5-carboxamides as New Reversible Inhibitors of Histone Lysine Demethylase KDM1A/LSD1. Part 1: High-Throughput Screening and Preliminary Exploration.

PubMed

Sartori, Luca; Mercurio, Ciro; Amigoni, Federica; Cappa, Anna; Fagá, Giovanni; Fattori, Raimondo; Legnaghi, Elena; Ciossani, Giuseppe; Mattevi, Andrea; Meroni, Giuseppe; Moretti, Loris; Cecatiello, Valentina; Pasqualato, Sebastiano; Romussi, Alessia; Thaler, Florian; Trifiró, Paolo; Villa, Manuela; Vultaggio, Stefania; Botrugno, Oronza A; Dessanti, Paola; Minucci, Saverio; Zagarrí, Elisa; Carettoni, Daniele; Iuzzolino, Lucia; Varasi, Mario; Vianello, Paola

2017-03-09

Lysine specific demethylase 1 KDM1A (LSD1) regulates histone methylation and it is increasingly recognized as a potential therapeutic target in oncology. We report on a high-throughput screening campaign performed on KDM1A/CoREST, using a time-resolved fluorescence resonance energy transfer (TR-FRET) technology, to identify reversible inhibitors. The screening led to 115 hits for which we determined biochemical IC 50 , thus identifying four chemical series. After data analysis, we have prioritized the chemical series of N-phenyl-4H-thieno[3, 2-b]pyrrole-5-carboxamide for which we obtained X-ray structures of the most potent hit (compound 19, IC 50 = 2.9 μM) in complex with the enzyme. Initial expansion of this chemical class, both modifying core structure and decorating benzamide moiety, was directed toward the definition of the moieties responsible for the interaction with the enzyme. Preliminary optimization led to compound 90, which inhibited the enzyme with a submicromolar IC 50 (0.162 μM), capable of inhibiting the target in cells.

Mutation Update for Kabuki Syndrome Genes KMT2D and KDM6A and Further Delineation of X-Linked Kabuki Syndrome Subtype 2.

PubMed

Bögershausen, Nina; Gatinois, Vincent; Riehmer, Vera; Kayserili, Hülya; Becker, Jutta; Thoenes, Michaela; Simsek-Kiper, Pelin Özlem; Barat-Houari, Mouna; Elcioglu, Nursel H; Wieczorek, Dagmar; Tinschert, Sigrid; Sarrabay, Guillaume; Strom, Tim M; Fabre, Aurélie; Baynam, Gareth; Sanchez, Elodie; Nürnberg, Gudrun; Altunoglu, Umut; Capri, Yline; Isidor, Bertrand; Lacombe, Didier; Corsini, Carole; Cormier-Daire, Valérie; Sanlaville, Damien; Giuliano, Fabienne; Le Quan Sang, Kim-Hanh; Kayirangwa, Honorine; Nürnberg, Peter; Meitinger, Thomas; Boduroglu, Koray; Zoll, Barbara; Lyonnet, Stanislas; Tzschach, Andreas; Verloes, Alain; Di Donato, Nataliya; Touitou, Isabelle; Netzer, Christian; Li, Yun; Geneviève, David; Yigit, Gökhan; Wollnik, Bernd

2016-09-01

Kabuki syndrome (KS) is a rare but recognizable condition that consists of a characteristic face, short stature, various organ malformations, and a variable degree of intellectual disability. Mutations in KMT2D have been identified as the main cause for KS, whereas mutations in KDM6A are a much less frequent cause. Here, we report a mutation screening in a case series of 347 unpublished patients, in which we identified 12 novel KDM6A mutations (KS type 2) and 208 mutations in KMT2D (KS type 1), 132 of them novel. Two of the KDM6A mutations were maternally inherited and nine were shown to be de novo. We give an up-to-date overview of all published mutations for the two KS genes and point out possible mutation hot spots and strategies for molecular genetic testing. We also report the clinical details for 11 patients with KS type 2, summarize the published clinical information, specifically with a focus on the less well-defined X-linked KS type 2, and comment on phenotype-genotype correlations as well as sex-specific phenotypic differences. Finally, we also discuss a possible role of KDM6A in Kabuki-like Turner syndrome and report a mutation screening of KDM6C (UTY) in male KS patients. © 2016 WILEY PERIODICALS, INC.

Original Research: miR-194 inhibits proliferation and invasion and promotes apoptosis by targeting KDM5B in esophageal squamous cell carcinoma cells.

PubMed

Cui, Guanghui; Liu, Donglei; Li, Weihao; Li, Yuhang; Liang, Youguang; Shi, Wensong; Zhao, Song

2017-01-01

Increasing evidence suggests that miR-194 is down-regulated in esophageal squamous cell carcinoma tumor tissue. However, the role and underlying mechanism of miR-194 in esophageal squamous cell carcinoma have not been well defined. We used DIANA, TargetScan and miRanda to perform target prediction analysis and found KDM5B is a potential target of miR-194. Based on these findings, we speculated that miR-194 might play a role in esophageal squamous cell carcinoma development and progression by regulation the expression of KDM5B. We detected the expression of miR-194 and KDM5B by quantitative real-time reverse transcription PCR (qRT-PCR) and Western blot assays, respectively, and found down-regulation of miR-194 and up-regulation of KDM5B existed in esophageal squamous cell carcinoma cell lines. By detecting proliferation, invasion and apoptosis of TE6 and TE14 cells transfected with miR-194 mimics or mimic control, miR-194 was found to inhibit proliferation and invasion and promote apoptosis of esophageal squamous cell carcinoma cells. miR-194 was further verified to regulate proliferation, apoptosis and invasion of esophageal squamous cell carcinoma cells by directly targeting KDM5B. Furthermore, animal studies were performed and showed that overexpression of miR-194 inhibited the growth of esophageal squamous cell carcinoma tumors in vivo. These results confirmed our speculation that miR-194 targets KDM5B to inhibit esophageal squamous cell carcinoma development and progression. These findings offer new clues for esophageal squamous cell carcinoma development and progression and novel potential therapeutic targets for esophageal squamous cell carcinoma. © 2016 by the Society for Experimental Biology and Medicine.

KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

PubMed Central

Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

2012-01-01

CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

Evolution, substrate specificity and subfamily classification of glycoside hydrolase family 5 (GH5).

PubMed

Aspeborg, Henrik; Coutinho, Pedro M; Wang, Yang; Brumer, Harry; Henrissat, Bernard

2012-09-20

The large Glycoside Hydrolase family 5 (GH5) groups together a wide range of enzymes acting on β-linked oligo- and polysaccharides, and glycoconjugates from a large spectrum of organisms. The long and complex evolution of this family of enzymes and its broad sequence diversity limits functional prediction. With the objective of improving the differentiation of enzyme specificities in a knowledge-based context, and to obtain new evolutionary insights, we present here a new, robust subfamily classification of family GH5. About 80% of the current sequences were assigned into 51 subfamilies in a global analysis of all publicly available GH5 sequences and associated biochemical data. Examination of subfamilies with catalytically-active members revealed that one third are monospecific (containing a single enzyme activity), although new functions may be discovered with biochemical characterization in the future. Furthermore, twenty subfamilies presently have no characterization whatsoever and many others have only limited structural and biochemical data. Mapping of functional knowledge onto the GH5 phylogenetic tree revealed that the sequence space of this historical and industrially important family is far from well dispersed, highlighting targets in need of further study. The analysis also uncovered a number of GH5 proteins which have lost their catalytic machinery, indicating evolution towards novel functions. Overall, the subfamily division of GH5 provides an actively curated resource for large-scale protein sequence annotation for glycogenomics; the subfamily assignments are openly accessible via the Carbohydrate-Active Enzyme database at http://www.cazy.org/GH5.html.

Characterization of two-step deglycosylation via oxidation by glycoside oxidoreductase and defining their subfamily

PubMed Central

Kim, Eun-Mi; Seo, Joo-Hyun; Baek, Kiheon; Kim, Byung-Gee

2015-01-01

Herein, we report a two-step deglycosylation mediated by the oxidation of glycoside which is different from traditional glycoside hydrolase (GH) mechanism. Previously, we reported a novel flavin adenine dinucleotide (FAD)-dependent glycoside oxidoreductase (FAD-GO) having deglycosylation activity. Various features of the reaction of FAD-GO such as including mechanism and catalytic residue and substrate specificity were studied. In addition, classification of novel FAD-GO subfamily was attempted. Deglycosylation of glycoside was performed spontaneously via oxidation of 3-OH of glycone moiety by FAD-GO mediated oxidation reaction. His493 residue was identified as a catalytic residue for the oxidation step. Interestingly, this enzyme has broad glycone and aglycon specificities. For the classification of FAD-GO enzyme subfamily, putative FAD-GOs were screened based on the FAD-GO from Rhizobium sp. GIN611 (gi 365822256) using BLAST search. The homologs of R. sp. GIN611 included the putative FAD-GOs from Stenotrophomonas strains, Sphingobacterium strains, Agrobacterium tumefaciens str. C58, and etc. All the cloned FAD-GOs from the three strains catalyzed the deglycosylation via enzymatic oxidation. Based on their substrate specificities, deglycosylation and oxidation activities to various ginsenosides, the FAD-GO subfamily members can be utilized as novel biocatalysts for the production of various aglycones. PMID:26057169

ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

PubMed

Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

2018-02-20

Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Activation of HIV Transcription by the Viral Tat Protein Requires a Demethylation Step Mediated by Lysine-specific Demethylase 1 (LSD1/KDM1)

PubMed Central

Sakane, Naoki; Kwon, Hye-Sook; Pagans, Sara; Kaehlcke, Katrin; Mizusawa, Yasuhiro; Kamada, Masafumi; Lassen, Kara G.; Chan, Jonathan; Greene, Warner C.; Schnoelzer, Martina; Ott, Melanie

2011-01-01

The essential transactivator function of the HIV Tat protein is regulated by multiple posttranslational modifications. Although individual modifications are well characterized, their crosstalk and dynamics of occurrence during the HIV transcription cycle remain unclear. We examine interactions between two critical modifications within the RNA-binding domain of Tat: monomethylation of lysine 51 (K51) mediated by Set7/9/KMT7, an early event in the Tat transactivation cycle that strengthens the interaction of Tat with TAR RNA, and acetylation of lysine 50 (K50) mediated by p300/KAT3B, a later process that dissociates the complex formed by Tat, TAR RNA and the cyclin T1 subunit of the positive transcription elongation factor b (P-TEFb). We find K51 monomethylation inhibited in synthetic Tat peptides carrying an acetyl group at K50 while acetylation can occur in methylated peptides, albeit at a reduced rate. To examine whether Tat is subject to sequential monomethylation and acetylation in cells, we performed mass spectrometry on immunoprecipitated Tat proteins and generated new modification-specific Tat antibodies against monomethylated/acetylated Tat. No bimodified Tat protein was detected in cells pointing to a demethylation step during the Tat transactivation cycle. We identify lysine-specific demethylase 1 (LSD1/KDM1) as a Tat K51-specific demethylase, which is required for the activation of HIV transcription in latently infected T cells. LSD1/KDM1 and its cofactor CoREST associates with the HIV promoter in vivo and activate Tat transcriptional activity in a K51-dependent manner. In addition, small hairpin RNAs directed against LSD1/KDM1 or inhibition of its activity with the monoamine oxidase inhibitor phenelzine suppresses the activation of HIV transcription in latently infected T cells. Our data support the model that a LSD1/KDM1/CoREST complex, normally known as a transcriptional suppressor, acts as a novel activator of HIV transcription through demethylation

Odontomariinae, a new middle paleozoic subfamily of slit-bearing euophaloidean gastropods (Euophalomorpha, Gastropoda)

USGS Publications Warehouse

Fryda, J.; Heidelberger, D.; Blodgett, R.B.

2006-01-01

A new subfamily, the Odontomariinae subfam. nov., is established herein for a distinctive group of uncoiled, slit-bearing Middle Devonian euomphalid gastropods. Its taxonomic position is based on the recent discovery of open coiled protoconchs and it is placed within the Euomphalomorpha. The genera Odontomaria Odontomaria C. F. Roemer and Tubiconcha n. gen. belonging to this new subfamily are enlarged based on studies on new material of the following species: Odontomaria semiplicata (Sandberger & Sandberger), Odontomaria gracilis n. sp., Odontomaria jankei n. sp., Odontomaria cheeneetnukensis n. sp., Odontomaria cindiprellerae n. sp. and Tubiconcha leunissi (Heidelberger, 2001). Members of the Odontomariinae were mainly sedentary organisms in high-energy, moderately shallow water. ?? 2006 E. Schweizerbart'sche Verlagsbuchhandlung.

A novel member of glycoside hydrolase family 30 subfamily 8 with altered substrate specificity

PubMed Central

St John, Franz J.; Dietrich, Diane; Crooks, Casey; Pozharski, Edwin; González, Javier M.; Bales, Elizabeth; Smith, Kennon; Hurlbert, Jason C.

2014-01-01

Endoxylanases classified into glycoside hydrolase family 30 subfamily 8 (GH30-8) are known to hydrolyze the hemicellulosic polysaccharide glucuronoxylan (GX) but not arabinoxylan or neutral xylooligosaccharides. This is owing to the specificity of these enzymes for the α-1,2-linked glucuronate (GA) appendage of GX. Limit hydrolysis of this substrate produces a series of aldouronates each containing a single GA substituted on the xylose penultimate to the reducing terminus. In this work, the structural and biochemical characterization of xylanase 30A from Clostridium papyro­solvens (CpXyn30A) is presented. This xylanase possesses a high degree of amino-acid identity to the canonical GH30-8 enzymes, but lacks the hallmark β8–α8 loop region which in part defines the function of this GH30 subfamily and its role in GA recognition. CpXyn30A is shown to have a similarly low activity on all xylan substrates, while hydrolysis of xylohexaose revealed a competing transglycosylation reaction. These findings are directly compared with the model GH30-8 enzyme from Bacillus subtilis, XynC. Despite its high sequence identity to the GH30-8 enzymes, CpXyn30A does not have any apparent specificity for the GA appendage. These findings confirm that the typically conserved β8–α8 loop region of these enzymes influences xylan substrate specificity but not necessarily β-1,4-xylanase function. PMID:25372685

Crystal structure of Staphylococcus aureus Zn-glyoxalase I: new subfamily of glyoxalase I family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chirgadze, Yuri N.; Boshkova, Eugenia A.; Battaile, Kevin P.

The crystal structures of protein SA0856 from Staphylococcus aureus in its apo-form and in complex with a Zn2+-ion have been presented. The 152 amino acid protein consists of two similar domains with α + β topology. In both crystalline state and in solution, the protein forms a dimer with monomers related by a twofold pseudo-symmetry rotation axis. A sequence homology search identified the protein as a member of the structural family Glyoxalase I. We have shown that the enzyme possesses glyoxalase I activity in the presence of Zn2+, Mg2+, Ni2+, and Co2+, in this order of preference. Sequence and structuremore » comparisons revealed that human glyoxalase I should be assigned to a subfamily A, while S. aureus glyoxalase I represents a new subfamily B, which includes also proteins from other bacteria. Both subfamilies have a similar protein chain fold but rather diverse sequences. The active sites of human and staphylococcus glyoxalases I are also different: the former contains one Zn-ion per chain; the latter incorporates two of these ions. In the active site of SA0856, the first Zn-ion is well coordinated by His58, Glu60 from basic molecule and Glu40*, His44* from adjacent symmetry-related molecule. The second Zn3-ion is coordinated only by residue His143 from protein molecule and one acetate ion. We suggest that only single Zn1-ion plays the role of catalytic center. The newly found differences between the two subfamilies could guide the design of new drugs against S. aureus, an important pathogenic micro-organism.« less

KDM5A demethylase: Erasing histone modifications to promote repair of DNA breaks

PubMed Central

2017-01-01

Repairing DNA breaks within the complexity of the cell chromatin is challenging. In this issue, Gong et al. (2017. J. Cell Biol. https://doi.org/10.1083/jcb.201611135) identify the histone demethylase KDM5A as a critical editor of the cells’ “histone code” that is required to recruit DNA repair complexes to DNA breaks. PMID:28572116

Xp11.2 microduplications including IQSEC2, TSPYL2 and KDM5C genes in patients with neurodevelopmental disorders

PubMed Central

Moey, Ching; Hinze, Susan J; Brueton, Louise; Morton, Jenny; McMullan, Dominic J; Kamien, Benjamin; Barnett, Christopher P; Brunetti-Pierri, Nicola; Nicholl, Jillian; Gecz, Jozef; Shoubridge, Cheryl

2016-01-01

Copy number variations are a common cause of intellectual disability (ID). Determining the contribution of copy number variants (CNVs), particularly gains, to disease remains challenging. Here, we report four males with ID with sub-microscopic duplications at Xp11.2 and review the few cases with overlapping duplications reported to date. We established the extent of the duplicated regions in each case encompassing a minimum of three known disease genes TSPYL2, KDM5C and IQSEC2 with one case also duplicating the known disease gene HUWE1. Patients with a duplication encompassing TSPYL2, KDM5C and IQSEC2 without gains of nearby SMC1A and HUWE1 genes have not been reported thus far. All cases presented with ID and significant deficits of speech development. Some patients also manifested behavioral disturbances such as hyperactivity and attention-deficit/hyperactivity disorder. Lymphoblastic cell lines from patients show markedly elevated levels of TSPYL2, KDM5C and SMC1A, transcripts consistent with the extent of their CNVs. The duplicated region in our patients contains several genes known to escape X-inactivation, including KDM5C, IQSEC2 and SMC1A. In silico analysis of expression data in selected gene expression omnibus series indicates that dosage of these genes, especially IQSEC2, is similar in males and females despite the fact they escape from X-inactivation in females. Taken together, the data suggest that gains in Xp11.22 including IQSEC2 cause ID and are associated with hyperactivity and attention-deficit/hyperactivity disorder, and are likely to be dosage-sensitive in males. PMID:26059843

Xp11.2 microduplications including IQSEC2, TSPYL2 and KDM5C genes in patients with neurodevelopmental disorders.

PubMed

Moey, Ching; Hinze, Susan J; Brueton, Louise; Morton, Jenny; McMullan, Dominic J; Kamien, Benjamin; Barnett, Christopher P; Brunetti-Pierri, Nicola; Nicholl, Jillian; Gecz, Jozef; Shoubridge, Cheryl

2016-03-01

Copy number variations are a common cause of intellectual disability (ID). Determining the contribution of copy number variants (CNVs), particularly gains, to disease remains challenging. Here, we report four males with ID with sub-microscopic duplications at Xp11.2 and review the few cases with overlapping duplications reported to date. We established the extent of the duplicated regions in each case encompassing a minimum of three known disease genes TSPYL2, KDM5C and IQSEC2 with one case also duplicating the known disease gene HUWE1. Patients with a duplication encompassing TSPYL2, KDM5C and IQSEC2 without gains of nearby SMC1A and HUWE1 genes have not been reported thus far. All cases presented with ID and significant deficits of speech development. Some patients also manifested behavioral disturbances such as hyperactivity and attention-deficit/hyperactivity disorder. Lymphoblastic cell lines from patients show markedly elevated levels of TSPYL2, KDM5C and SMC1A, transcripts consistent with the extent of their CNVs. The duplicated region in our patients contains several genes known to escape X-inactivation, including KDM5C, IQSEC2 and SMC1A. In silico analysis of expression data in selected gene expression omnibus series indicates that dosage of these genes, especially IQSEC2, is similar in males and females despite the fact they escape from X-inactivation in females. Taken together, the data suggest that gains in Xp11.22 including IQSEC2 cause ID and are associated with hyperactivity and attention-deficit/hyperactivity disorder, and are likely to be dosage-sensitive in males.

Transient receptor potential cation channel, subfamily V, member 4 and airway sensory afferent activation: Role of adenosine triphosphate.

PubMed

Bonvini, Sara J; Birrell, Mark A; Grace, Megan S; Maher, Sarah A; Adcock, John J; Wortley, Michael A; Dubuis, Eric; Ching, Yee-Man; Ford, Anthony P; Shala, Fisnik; Miralpeix, Montserrat; Tarrason, Gema; Smith, Jaclyn A; Belvisi, Maria G

2016-07-01

Sensory nerves innervating the airways play an important role in regulating various cardiopulmonary functions, maintaining homeostasis under healthy conditions and contributing to pathophysiology in disease states. Hypo-osmotic solutions elicit sensory reflexes, including cough, and are a potent stimulus for airway narrowing in asthmatic patients, but the mechanisms involved are not known. Transient receptor potential cation channel, subfamily V, member 4 (TRPV4) is widely expressed in the respiratory tract, but its role as a peripheral nociceptor has not been explored. We hypothesized that TRPV4 is expressed on airway afferents and is a key osmosensor initiating reflex events in the lung. We used guinea pig primary cells, tissue bioassay, in vivo electrophysiology, and a guinea pig conscious cough model to investigate a role for TRPV4 in mediating sensory nerve activation in vagal afferents and the possible downstream signaling mechanisms. Human vagus nerve was used to confirm key observations in animal tissues. Here we show TRPV4-induced activation of guinea pig airway-specific primary nodose ganglion cells. TRPV4 ligands and hypo-osmotic solutions caused depolarization of murine, guinea pig, and human vagus and firing of Aδ-fibers (not C-fibers), which was inhibited by TRPV4 and P2X3 receptor antagonists. Both antagonists blocked TRPV4-induced cough. This study identifies the TRPV4-ATP-P2X3 interaction as a key osmosensing pathway involved in airway sensory nerve reflexes. The absence of TRPV4-ATP-mediated effects on C-fibers indicates a distinct neurobiology for this ion channel and implicates TRPV4 as a novel therapeutic target for neuronal hyperresponsiveness in the airways and symptoms, such as cough. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Identification and analysis of evolutionary selection pressures acting at the molecular level in five forkhead subfamilies.

PubMed

Fetterman, Christina D; Rannala, Bruce; Walter, Michael A

2008-09-24

Members of the forkhead gene family act as transcription regulators in biological processes including development and metabolism. The evolution of forkhead genes has not been widely examined and selection pressures at the molecular level influencing subfamily evolution and differentiation have not been explored. Here, in silico methods were used to examine selection pressures acting on the coding sequence of five multi-species FOX protein subfamily clusters; FoxA, FoxD, FoxI, FoxO and FoxP. Application of site models, which estimate overall selection pressures on individual codons throughout the phylogeny, showed that the amino acid changes observed were either neutral or under negative selection. Branch-site models, which allow estimated selection pressures along specified lineages to vary as compared to the remaining phylogeny, identified positive selection along branches leading to the FoxA3 and Protostomia clades in the FoxA cluster and the branch leading to the FoxO3 clade in the FoxO cluster. Residues that may differentiate paralogs were identified in the FoxA and FoxO clusters and residues that differentiate orthologs were identified in the FoxA cluster. Neutral amino acid changes were identified in the forkhead domain of the FoxA, FoxD and FoxP clusters while positive selection was identified in the forkhead domain of the Protostomia lineage of the FoxA cluster. A series of residues under strong negative selection adjacent to the N- and C-termini of the forkhead domain were identified in all clusters analyzed suggesting a new method for refinement of domain boundaries. Extrapolation of domains among cluster members in conjunction with selection pressure information allowed prediction of residue function in the FoxA, FoxO and FoxP clusters and exclusion of known domain function in residues of the FoxA and FoxI clusters. Consideration of selection pressures observed in conjunction with known functional information allowed prediction of residue function and

Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

PubMed Central

Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

2008-01-01

Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

Crystal Structure of Perakine Reductase, Founding Member of a Novel Aldo-Keto Reductase (AKR) Subfamily That Undergoes Unique Conformational Changes during NADPH Binding*

PubMed Central

Sun, Lianli; Chen, Yixin; Rajendran, Chitra; Mueller, Uwe; Panjikar, Santosh; Wang, Meitian; Mindnich, Rebekka; Rosenthal, Cindy; Penning, Trevor M.; Stöckigt, Joachim

2012-01-01

Perakine reductase (PR) catalyzes the NADPH-dependent reduction of the aldehyde perakine to yield the alcohol raucaffrinoline in the biosynthetic pathway of ajmaline in Rauvolfia, a key step in indole alkaloid biosynthesis. Sequence alignment shows that PR is the founder of the new AKR13D subfamily and is designated AKR13D1. The x-ray structure of methylated His6-PR was solved to 2.31 Å. However, the active site of PR was blocked by the connected parts of the neighbor symmetric molecule in the crystal. To break the interactions and obtain the enzyme-ligand complexes, the A213W mutant was generated. The atomic structure of His6-PR-A213W complex with NADPH was determined at 1.77 Å. Overall, PR folds in an unusual α8/β6 barrel that has not been observed in any other AKR protein to date. NADPH binds in an extended pocket, but the nicotinamide riboside moiety is disordered. Upon NADPH binding, dramatic conformational changes and movements were observed: two additional β-strands in the C terminus become ordered to form one α-helix, and a movement of up to 24 Å occurs. This conformational change creates a large space that allows the binding of substrates of variable size for PR and enhances the enzyme activity; as a result cooperative kinetics are observed as NADPH is varied. As the founding member of the new AKR13D subfamily, PR also provides a structural template and model of cofactor binding for the AKR13 family. PMID:22334702

New subfamilies of major intrinsic proteins in fungi suggest novel transport properties in fungal channels: implications for the host-fungal interactions

PubMed Central

2014-01-01

Background Aquaporins (AQPs) and aquaglyceroporins (AQGPs) belong to the superfamily of Major Intrinsic Proteins (MIPs) and are involved in the transport of water and neutral solutes across the membranes. MIP channels play significant role in plant-fungi symbiotic relationship and are believed to be important in host-pathogen interactions in human fungal diseases. In plants, at least five major MIP subfamilies have been identified. Fungal MIP subfamilies include orthodox aquaporins and five subgroups within aquaglyceroporins. XIP subfamily is common to both plants and fungi. In this study, we have investigated the extent of diversity in fungal MIPs and explored further evolutionary relationships with the plant MIP counterparts. Results We have extensively analyzed the available fungal genomes and examined nearly 400 fungal MIPs. Phylogenetic analysis and homology modeling exhibit the existence of a new MIP cluster distinct from any of the known fungal MIP subfamilies. All members of this cluster are found in microsporidia which are unicellular fungal parasites. Members of this family are small in size, charged and have hydrophobic residues in the aromatic/arginine selectivity filter and these features are shared by small and basic intrinsic proteins (SIPs), one of the plant MIP subfamilies. We have also found two new subfamilies (δ and γ2) within the AQGP group. Fungal AQGPs are the most diverse and possess the largest number of subgroups. We have also identified distinguishing features in loops E and D in the newly identified subfamilies indicating their possible role in channel transport and gating. Conclusions Fungal SIP-like MIP family is distinct from any of the known fungal MIP families including orthodox aquaporins and aquaglyceroporins. After XIPs, this is the second MIP subfamily from fungi that may have possible evolutionary link with a plant MIP subfamily. AQGPs in fungi are more diverse and possess the largest number of subgroups. The aromatic

Phylogeny of Celastraceae subfamily Hippocrateoideae inferred from morphological characters and nuclear and plastid loci.

PubMed

Coughenour, Jennifer M; Simmons, Mark P; Lombardi, Julio A; Yakobson, Kendra; Archer, Robert H

2011-05-01

The phylogeny of Celastraceae subfamily Hippocrateoideae (∼ 100 species and 19 genera in the Old and New World tropics) was inferred using morphological characters together with plastid (matK, trnL-F) and nuclear (ITS and 26S rDNA) genes. The subfamily is easily recognized by the synapomorphies of transversely flattened, deeply lobed capsules and seeds with membranous basal wings or narrow stipes together with bisexual, 5-merous flowers that generally have an extrastaminal disk and three stamens. Hippocrateoideae, like Salacioideae, are inferred to have an Old World origin. The narrow stipes of Neotropical species that are water-dispersed are inferred to be derived within the subfamily from ancestral species with wind-dispersed winged seeds. Helictonema, a monotypic genus endemic to tropical Africa, has a small, white, spongy aril that is located at the base of the seed wing and appears to be unique within Hippocrateoideae. Our inference that Helictonema is sister to the remaining members of the subfamily, considered in the context of Sarawakodendron being sister to Salacioideae, suggests that small arils and capsular fruit were primitive within both subfamilies. The aril became dramatically enlarged within Salacioideae, in which the fruits are berries, and lost entirely within Hippocrateoideae, in which the fruits are transversely flattened capsules. All five Old World taxa of Prionostemma and all eight currently recognized species within Simirestis are transferred to Pristimera, one South African variety of Pristimera is raised to species level, and all three taxa in Pristimera subgenus Trochantha are transferred to the new genus Trochantha. Copyright © 2011 Elsevier Inc. All rights reserved.

The ZNF75 zinc finger gene subfamily: Isolation and mapping of the four members in humans and great apes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Villa, A.; Strina, D.; Frattini, A.

We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16more » and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.« less

Characterisation of a collagen gene subfamily from the potato cyst nematode Globodera pallida.

PubMed

Gray, L J; Curtis, R H; Jones, J T

2001-01-24

We have isolated two full-length genomic DNA sequences, which encode the cuticle collagen proteins GP-COL-1 and GP-COL-2, from the potato cyst nematode Globodera pallida. A third, partial collagen gene ORF termed gp-col-t(t=truncated) has also been isolated and appears to represent an unexpressed pseudogene. The gp-col-1 and gp-col-2 genes both contain three short (<97 bp) introns which disrupt coding regions predicted to specify proteins with molecular weights of 33 and 32.7 kDa respectively. All three sequences show high similarity to each other and to the previously isolated G. pallida cDNA clone gp-col-8. The conserved pattern of cysteine residues and non-(Gly-X-Y)(n) region sequence similarity observed in all four G. pallida genes suggests that these molecules form part of the same subfamily of collagens. Southern analysis indicates that this subfamily is likely to contain further members. The G. pallida collagen sequences show striking similarity to twelve genes from Caenorhabditis elegans which collectively represent the recently classified Group 1a collagen subfamily. No data exists on the function of this subfamily in C. elegans. gp-col-1 and gp-col-2 are developmentally regulated with transcripts of both genes detected in adult virgin and gravid females but not in pre-parasitic second stage juveniles. A similar expression pattern is observed for the Group 1a collagen lemmi 5 from Meloidogyne incognita perhaps indicating a generic link between subfamily and function during the various changes in cuticular structure which accompany nematode growth and reproduction. Immunochemical studies indicate that the GP-COL-1 protein is specifically located in the hypodermis of G. pallida adult females.

A coding single-nucleotide polymorphism in lysine demethylase KDM4A associates with increased sensitivity to mTOR inhibitors.

PubMed

Van Rechem, Capucine; Black, Joshua C; Greninger, Patricia; Zhao, Yang; Donado, Carlos; Burrowes, Paul D; Ladd, Brendon; Christiani, David C; Benes, Cyril H; Whetstine, Johnathan R

2015-03-01

SNPs occur within chromatin-modulating factors; however, little is known about how these variants within the coding sequence affect cancer progression or treatment. Therefore, there is a need to establish their biochemical and/or molecular contribution, their use in subclassifying patients, and their impact on therapeutic response. In this report, we demonstrate that coding SNP-A482 within the lysine tridemethylase gene KDM4A/JMJD2A has different allelic frequencies across ethnic populations, associates with differential outcome in patients with non-small cell lung cancer (NSCLC), and promotes KDM4A protein turnover. Using an unbiased drug screen against 87 preclinical and clinical compounds, we demonstrate that homozygous SNP-A482 cells have increased mTOR inhibitor sensitivity. mTOR inhibitors significantly reduce SNP-A482 protein levels, which parallels the increased drug sensitivity observed with KDM4A depletion. Our data emphasize the importance of using variant status as candidate biomarkers and highlight the importance of studying SNPs in chromatin modifiers to achieve better targeted therapy. This report documents the first coding SNP within a lysine demethylase that associates with worse outcome in patients with NSCLC. We demonstrate that this coding SNP alters the protein turnover and associates with increased mTOR inhibitor sensitivity, which identifies a candidate biomarker for mTOR inhibitor therapy and a therapeutic target for combination therapy. ©2015 American Association for Cancer Research.

Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

PubMed Central

Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

2017-01-01

Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. PMID:27537276

Genomic characterization of bacteriophage vB_PcaP_PP2 infecting Pectobacterium carotovorum subsp. carotovorum, a new member of a proposed genus in the subfamily Autographivirinae.

PubMed

Lim, Jeong-A; Heu, Sunggi; Park, Jinwoo; Roh, Eunjung

2017-08-01

Bacteriophage vB_PcaP_PP2 (PP2) is a novel virulent phage that infects the plant-pathogenic bacterium Pectobacterium carotovorum subsp. carotovorum. PP2 phage has a 41,841-bp double-stranded DNA encoding 47 proteins, and it was identified as a member of the family Podoviridae by transmission electron microscopy. Nineteen of its open reading frames (ORFs) show homology to functional proteins, and 28 ORFs have been characterized as hypothetical proteins. PP2 phage is homologous to Cronobacter phage vB_CskP_GAP227 and Dev-CD-23823. Based on phylogenetic analysis, PP2 and its homologous bacteriophages form a new group within the subfamily Autographivirinae in the family Podoviridae, suggesting the need to establish a new genus. No lysogenic-cycle-related genes or bacterial toxins were identified.

Up-regulation of the fibroblast growth factor 8 subfamily in human hepatocellular carcinoma for cell survival and neoangiogenesis.

PubMed

Gauglhofer, Christine; Sagmeister, Sandra; Schrottmaier, Waltraud; Fischer, Carina; Rodgarkia-Dara, Chantal; Mohr, Thomas; Stättner, Stefan; Bichler, Christoph; Kandioler, Daniela; Wrba, Fritz; Schulte-Hermann, Rolf; Holzmann, Klaus; Grusch, Michael; Marian, Brigitte; Berger, Walter; Grasl-Kraupp, Bettina

2011-03-01

Fibroblast growth factors (FGFs) and their high-affinity receptors [fibroblast growth factor receptors (FGFRs)] contribute to autocrine and paracrine growth stimulation in several non-liver cancer entities. Here we report that at least one member of the FGF8 subfamily (FGF8, FGF17, and FGF18) was up-regulated in 59% of 34 human hepatocellular carcinoma (HCC) samples that we investigated. The levels of the corresponding receptors (FGFR2, FGFR3, and FGFR4) were also elevated in the great majority of the HCC cases. Overall, 82% of the HCC cases showed overexpression of at least one FGF and/or FGFR. The functional implications of the deregulated FGF/FGFR system were investigated by the simulation of an insufficient blood supply. When HCC-1.2, HepG2, or Hep3B cells were subjected to serum withdrawal or the hypoxia-mimetic drug deferoxamine mesylate, the expression of FGF8 subfamily members increased dramatically. In the serum-starved cells, the incidence of apoptosis was elevated, whereas the addition of FGF8, FGF17, or FGF18 impaired apoptosis, which was associated with phosphorylation of extracellular signal-regulated kinase 1/2 and ribosomal protein S6. In contrast, down-modulation of FGF18 by small interfering RNA (siRNA) significantly reduced the viability of the hepatocarcinoma cells. siRNA targeting FGF18 also impaired the cells' potential to form clones at a low cell density or in soft agar. With respect to the tumor microenvironment, FGF17 and FGF18 stimulated the growth of HCC-derived myofibroblasts, and FGF8, FGF17, and FGF18 induced the proliferation and tube formation of hepatic endothelial cells. FGF8, FGF17, and FGF18 are involved in autocrine and paracrine signaling in HCC and enhance the survival of tumor cells under stress conditions, malignant behavior, and neoangiogenesis. Thus, the FGF8 subfamily supports the development and progression of hepatocellular malignancy. Copyright © 2010 American Association for the Study of Liver Diseases.

Expanding the molecular signature of ossifying fibromyxoid tumors with two novel gene fusions: CREBBP-BCORL1 and KDM2A-WWTR1.

PubMed

Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R

2017-01-01

Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Genome-wide characterization of the β-1,3-glucanase gene family in Gossypium by comparative analysis

PubMed Central

Xu, Xiaoyang; Feng, Yue; Fang, Shuai; Xu, Jun; Wang, Xinyu; Guo, Wangzhen

2016-01-01

The β-1,3-glucanase gene family is involved in a wide range of plant developmental processes as well as pathogen defense mechanisms. Comprehensive analyses of β-1,3-glucanase genes (GLUs) have not been reported in cotton. Here, we identified 67, 68, 130 and 158 GLUs in four sequenced cotton species, G. raimondii (D5), G. arboreum (A2), G. hirsutum acc. TM-1 (AD1), and G. barbadense acc. 3–79 (AD2), respectively. Cotton GLUs can be classified into the eight subfamilies (A–H), and their protein domain architecture and intron/exon structure are relatively conserved within each subfamily. Sixty-seven GLUs in G. raimondii were anchored onto 13 chromosomes, with 27 genes involved in segmental duplications, and 13 in tandem duplications. Expression patterns showed highly developmental and spatial regulation of GLUs in TM-1. In particular, the expression of individual member of GLUs in subfamily E was limited to roots, leaves, floral organs or fibers. Members of subfamily E also showed more protein evolution and subgenome expression bias compared with members of other subfamilies. We clarified that GLU42 and GLU43 in subfamily E were preferentially expressed in root and leaf tissues and significantly upregulated after Verticillium dahliae inoculation. Silencing of GLU42 and GLU43 significantly increased the susceptibility of cotton to V. dahliae. PMID:27353015

Essential-Oil Constituents and Alkanes of Cephalaria ambrosioides Roem. & Schult. (Family Caprifoliaceae, Subfamily Dipsacaceae) and (Chemo)taxonomic Discernment of the Subfamilies Dipsacaceae and Morinaceae.

PubMed

Vukićević, Dušan R; Stevanović, Dragana D; Genčić, Marija S; Blagojević, Polina D; Radulović, Niko S

2016-02-01

Herein, the results of the first study of the volatile and alkane profiles of Cephalaria ambrosioides Roem. & Schult. (Caprifoliaceae, subfamily Dipsacaceae) were reported. The GC-FID and GC/MS analyses of the essential oils hydrodistilled from leaves and stems (CA1) and flowers (CA2) of C. ambrosioides allowed the identification of 284 different components. The main compounds of the studied oil samples were palmitic acid (24.3 and 32.5% for CA1 and CA2, resp.), hexahydrofarnesyl acetone (1.4 and 10.8% for CA1 and CA2, resp.), (Z)-hex-3-en-1-ol (7.0 and <0.1% for CA1 and CA2, resp.), and linoleic acid (1.9 and 6.5% for CA1 and CA2, resp.). Essential-oil compositional data of selected plant species belonging to the Dipsacaceae (15) and Morinaceae (2) subfamilies were used to resolve taxonomical ambiguities regarding the genus Cephalaria and its infrageneric relations, especially concerning the subfamily Morinaceae (formerly a genus within Dipsacaceae). The results of multivariate statistical analyses (25 different essential-oil samples) supported the exclusion of Morina species from the Dipsacaceae subfamily. The relative abundances of alkanes from n-, iso-, and anteiso-series followed a (distorted) Gaussian-like distribution and suggested that the biosyntheses of n- and branched alkanes in C. ambrosioides are possibly not controlled by the same elongase. Also, the obtained results suggested that there was a difference in the biosynthesis/accumulation of alkanes in the vegetative and reproductive parts of C. ambrosioides. Copyright © 2016 Verlag Helvetica Chimica Acta AG, Zürich.

BTG/Tob family members Tob1 and Tob2 inhibit proliferation of mouse embryonic stem cells via Id3 mRNA degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yuanfan; Wang, Chenchen; Peking University Stem Cell Research Center, China National Center for International Research, Peking University Health Science Center, Beijing 100191

2015-07-03

The mammalian BTG/Tob family is a group of proteins with anti-proliferative ability, and there are six members including BTG1, BTG2/PC3/Tis21, BTG3/ANA, BTG4/PC3B, Tob1/Tob and Tob2. Among them, Tob subfamily members, specifically Tob1/Tob and Tob2, have the most extensive C-terminal regions. As previously reported, overexpression of BTG/Tob proteins is associated with the inhibition of G1 to S-phase cell cycle progression and decreased cell proliferation in a variety of cell types. Tob subfamily proteins have similar anti-proliferative effects on cell cycle progression in cultured tumor cells. An important unresolved question is whether or not they have function in rapidly proliferating cells, suchmore » as embryonic stem cells (ESCs). Tob1 and Tob2 were expressed ubiquitously in mouse ESCs (mESCs), suggesting a possible role in early embryonic development and mESCs. To address the above question and explore the possible functions of the Tob subfamily in ESCs, we established ESCs from different genotypic knockout inner cell mass (ICM). We found that Tob1{sup −/−}, Tob2{sup −/−}, and Tob1/2 double knockout (DKO, Tob1{sup −/−} & Tob2{sup −/−}) ESCs grew faster than wild type (WT) ESCs without losing pluripotency, and we provide a possible mechanistic explanation for these observations: Tob1 and Tob2 inhibit the cell cycle via degradation of Id3 mRNA, which is a set of directly targeted genes of BMP4 signaling in mESCs that play critical roles in the maintenance of ESC properties. Together, our data suggest that BTG/Tob family protein Tob1 and Tob2 regulation cell proliferation does not compromise the basic properties of mESCs. - Highlights: • We established mouse Tob1/2 double knockout embryonic stem cells. • Tob1 and Tob2 inhibit the proliferation of ESCs without effect on pluripotency. • Tob1 and Tob2 involved in the degradation of Id3 in mESCs.« less

Intragastric Dai-Kenchu-To, a Japanese herbal medicine, stimulates colonic motility via transient receptor potential cation channel subfamily V member 1 in dogs.

PubMed

Kikuchi, Daisuke; Shibata, Chikashi; Imoto, Hirofumi; Naitoh, Takeshi; Miura, Koh; Unno, Michiaki

2013-08-01

Japanese herbal medicine, also known as Kampo, is used for various diseases in Japan. One of those medicines, Dai-Kenchu-To (DKT), is considered clinically effective for adhesive bowel obstruction and chronic constipation. Although scientific evidence of DKT to improve adhesive bowel obstruction was shown in several previous reports, mechanism of DKT to improve constipation remains unknown. Our aim was to study the effect of intragastric DKT on colonic motility and defecation, and the involvement of various receptors in DKT-induced colonic contractions. Five beagle dogs were instructed with serosal strain-gauge force transducers to measure circular muscle activity at the proximal, middle, and distal colon. Dogs are suitable for a present study to administer the drugs repeatedly to the same individual and look at its effect on colonic motility. We studied the effects of DKT (2.5 or 5 g) administered into the stomach on colonic motility. Muscarinic receptor antagonist atropine, nicotinic receptor antagonist hexamthonium, or 5-hydroxytryptamine-3 receptor antagonist ondansetron was injected intravenously 10 min before DKT administration. Capsazepine, an antagonist to transient receptor potential cation channel subfamily V member 1 (TRPV1), was administered into the stomach 5 min before DKT administration. Intragastric DKT (2.5 or 5 g) induced colonic contractions within 10 min after administration but did not induce defecation. Pretreatment with atropine, hexamthonium, ondansetron, or capsazepine inhibited DKT-induced colonic contractions. These results indicate that orally administered DKT stimulates colonic motility via TRPV1, muscarinic, nicotinic, and 5-hydroxytryptamine-3 receptors, thereby providing scientific support for the efficacy of oral DKT in chronic constipation.

Transient receptor potential melastatin subfamily member 2 cation channel regulates detrimental immune cell invasion in ischemic stroke.

PubMed

Gelderblom, Mathias; Melzer, Nico; Schattling, Benjamin; Göb, Eva; Hicking, Gordon; Arunachalam, Priyadharshini; Bittner, Stefan; Ufer, Friederike; Herrmann, Alexander M; Bernreuther, Christian; Glatzel, Markus; Gerloff, Christian; Kleinschnitz, Christoph; Meuth, Sven G; Friese, Manuel A; Magnus, Tim

2014-11-01

Brain injury during stroke results in oxidative stress and the release of factors that include extracellular Ca(2+), hydrogen peroxide, adenosine diphosphate ribose, and nicotinic acid adenine dinucleotide phosphate. These alterations of the extracellular milieu change the activity of transient receptor potential melastatin subfamily member 2 (TRPM2), a nonselective cation channel expressed in the central nervous system and the immune system. Our goal was to evaluate the contribution of TRPM2 to the tissue damage after stroke. In accordance with current quality guidelines, we independently characterized Trpm2 in a murine ischemic stroke model in 2 different laboratories. Gene deficiency of Trpm2 resulted in significantly improved neurological outcome and decreased infarct size. Besides an already known moderate neuroprotective effect of Trpm2 deficiency in vitro, ischemic brain invasion by neutrophils and macrophages was particularly reduced in Trpm2-deficient mice. Bone marrow chimeric mice revealed that Trpm2 deficiency in the peripheral immune system is responsible for the protective phenotype. Furthermore, experiments with mixed bone marrow chimeras demonstrated that Trpm2 is essential for the migration of neutrophils and, to a lesser extent, also of macrophages into ischemic hemispheres. Notably, the pharmacological TRPM2 inhibitor, N-(p-amylcinnamoyl)anthranilic acid, was equally protective in the stroke model. Although a neuroprotective effect of TRPM2 in vitro is well known, we can show for the first time that the detrimental role of TRPM2 in stroke primarily depends on its role in activating peripheral immune cells. Targeting TRPM2 systemically represents a promising therapeutic approach for ischemic stroke. © 2014 American Heart Association, Inc.

Sex differences in mouse Transient Receptor Potential Cation Channel, Subfamily M, Member 8 expressing trigeminal ganglion neurons

PubMed Central

Caudle, Stephanie L.; Jenkins, Alan C.; Ahn, Andrew H.; Neubert, John K.

2017-01-01

The detection of cool temperatures is thought to be mediated by primary afferent neurons that express the cool temperature sensing protein Transient Receptor Potential Cation Channel, Subfamily M, Member 8 (TRPM8). Using mice, this study tested the hypothesis that sex differences in sensitivity to cool temperatures were mediated by differences in neurons that express TRPM8. Ion currents from TRPM8 expressing trigeminal ganglion (TRG) neurons in females demonstrated larger hyperpolarization-activated cyclic nucleotide-gated currents (Ih) than male neurons at both 30° and 18°C. Additionally, female neurons’ voltage gated potassium currents (Ik) were suppressed by cooling, whereas male Ik was not significantly affected. At the holding potential tested (-60mV) TRPM8 currents were not visibly activated in either sex by cooling. Modeling the effect of Ih and Ik on membrane potentials demonstrated that at 30° the membrane potential in both sexes is unstable. At 18°, female TRPM8 TRG neurons develop a large oscillating pattern in their membrane potential, whereas male neurons become highly stable. These findings suggest that the differences in Ih and Ik in the TRPM8 TRG neurons of male and female mice likely leads to greater sensitivity of female mice to the cool temperature. This hypothesis was confirmed in an operant reward/conflict assay. Female mice contacted an 18°C surface for approximately half the time that males contacted the cool surface. At 33° and 10°C male and female mice contacted the stimulus for similar amounts of time. These data suggest that sex differences in the functioning of Ih and Ik in TRPM8 expressing primary afferent neurons leads to differences in cool temperature sensitivity. PMID:28472061

Comparative studies of a new subfamily of human Ste20-like kinases: homodimerization, subcellular localization, and selective activation of MKK3 and p38.

PubMed

Yustein, Jason T; Xia, Liang; Kahlenburg, J Michelle; Robinson, Dan; Templeton, Dennis; Kung, Hsing-Jien

2003-09-18

The Sterile-20 or Ste20 family of serine/threonine kinases is a group of signaling molecules whose physiological roles within mammalian cells are just starting to be elucidated. Here, in this report we present the characterization of three human Ste20-like kinases with greater than 90% similarity within their catalytic domains that define a novel subfamily of Ste20s. Members of this kinase family include rat thousand and one (TAO1) and chicken KFC (kinase from chicken). For the lack of a consensus nomenclature in the literature, in this report, we shall call this family hKFC (for their homology to chicken KFC) and the three members hKFC-A, hKFC-B, and hKFC-C, respectively. These kinases have many similarities including an aminoterminal kinase domain, a serine-rich region, and a coiled-coil configuration within the C-terminus. All three kinases are able to activate the p38 MAP kinase pathway through the specific activation of the upstream MKK3 kinase. We also offer evidence, both theoretical and biochemical, showing that these kinases can undergo self-association. Despite these similarities, these kinases differ in tissue distribution, apparent subcellular localization, and feature structural differences largely within the carboxyl-terminal sequence.

Structural and Functional Elucidation of Peptide Ts11 Shows Evidence of a Novel Subfamily of Scorpion Venom Toxins

PubMed Central

Cremonez, Caroline M.; Maiti, Mohitosh; Peigneur, Steve; Cassoli, Juliana Silva; Dutra, Alexandre A. A.; Waelkens, Etienne; Lescrinier, Eveline; Herdewijn, Piet; de Lima, Maria Elena; Pimenta, Adriano M. C.; Arantes, Eliane C.; Tytgat, Jan

2016-01-01

To date, several families of peptide toxins specifically interacting with ion channels in scorpion venom have been described. One of these families comprise peptide toxins (called KTxs), known to modulate potassium channels. Thus far, 202 KTxs have been reported, belonging to several subfamilies of KTxs (called α, β, γ, κ, δ, and λ-KTxs). Here we report on a previously described orphan toxin from Tityus serrulatus venom, named Ts11. We carried out an in-depth structure-function analysis combining 3D structure elucidation of Ts11 and electrophysiological characterization of the toxin. The Ts11 structure is highlighted by an Inhibitor Cystine Knot (ICK) type scaffold, completely devoid of the classical secondary structure elements (α-helix and/or β-strand). This has, to the best of our knowledge, never been described before for scorpion toxins and therefore represents a novel, 6th type of structural fold for these scorpion peptides. On the basis of their preferred interaction with voltage-gated K channels, as compared to all the other targets tested, it can be postulated that Ts11 is the first member of a new subfamily, designated as ε-KTx. PMID:27706049

Structural and Functional Elucidation of Peptide Ts11 Shows Evidence of a Novel Subfamily of Scorpion Venom Toxins.

PubMed

Cremonez, Caroline M; Maiti, Mohitosh; Peigneur, Steve; Cassoli, Juliana Silva; Dutra, Alexandre A A; Waelkens, Etienne; Lescrinier, Eveline; Herdewijn, Piet; de Lima, Maria Elena; Pimenta, Adriano M C; Arantes, Eliane C; Tytgat, Jan

2016-09-30

To date, several families of peptide toxins specifically interacting with ion channels in scorpion venom have been described. One of these families comprise peptide toxins (called KTxs), known to modulate potassium channels. Thus far, 202 KTxs have been reported, belonging to several subfamilies of KTxs (called α, β, γ, κ, δ, and λ-KTxs). Here we report on a previously described orphan toxin from Tityus serrulatus venom, named Ts11. We carried out an in-depth structure-function analysis combining 3D structure elucidation of Ts11 and electrophysiological characterization of the toxin. The Ts11 structure is highlighted by an Inhibitor Cystine Knot (ICK) type scaffold, completely devoid of the classical secondary structure elements (α-helix and/or β-strand). This has, to the best of our knowledge, never been described before for scorpion toxins and therefore represents a novel, 6th type of structural fold for these scorpion peptides. On the basis of their preferred interaction with voltage-gated K channels, as compared to all the other targets tested, it can be postulated that Ts11 is the first member of a new subfamily, designated as ε-KTx.

Molecular evolution and functional divergence of the cytochrome P450 3 (CYP3) Family in Actinopterygii (ray-finned fish).

PubMed

Yan, Jun; Cai, Zhonghua

2010-12-10

The cytochrome P450 (CYP) superfamily is a multifunctional hemethiolate enzyme that is widely distributed from Bacteria to Eukarya. The CYP3 family contains mainly the four subfamilies CYP3A, CYP3B, CYP3C and CYP3D in vertebrates; however, only the Actinopterygii (ray-finned fish) have all four subfamilies and detailed understanding of the evolutionary relationship of Actinopterygii CYP3 family members would be valuable. Phylogenetic relationships were constructed to trace the evolutionary history of the Actinopterygii CYP3 family genes. Selection analysis, relative rate tests and functional divergence analysis were combined to interpret the relationship of the site-specific evolution and functional divergence in the Actinopterygii CYP3 family. The results showed that the four CYP3 subfamilies in Actinopterygii might be formed by gene duplication. The first gene duplication event was responsible for divergence of the CYP3B/C clusters from ancient CYP3 before the origin of the Actinopterygii, which corresponded to the fish-specific whole genome duplication (WGD). Tandem repeat duplication in each of the homologue clusters produced stable CYP3B, CYP3C, CYP3A and CYP3D subfamilies. Acceleration of asymmetric evolutionary rates and purifying selection together were the main force for the production of new subfamilies and functional divergence in the new subset after gene duplication, whereas positive selection was detected only in the retained CYP3A subfamily. Furthermore, nearly half of the functional divergence sites appear to be related to substrate recognition, which suggests that site-specific evolution is closely related with functional divergence in the Actinopterygii CYP3 family. The split of fish-specific CYP3 subfamilies was related to the fish-specific WGD, and site-specific acceleration of asymmetric evolutionary rates and purifying selection was the main force for the origin of the new subfamilies and functional divergence in the new subset after gene

Regression of atherosclerosis with apple procyanidins by activating the ATP-binding cassette subfamily A member 1 in a rabbit model.

PubMed

Wang, Liang; Fumoto, Toshio; Masumoto, Saeko; Shoji, Toshihiko; Miura, Tomisato; Naraoka, Masato; Matsuda, Naoya; Imaizumi, Tadaatsu; Ohkuma, Hiroki

2017-03-01

Apple polyphenol contains abundant procyanidins, which have been associated with an anti-atherosclerosis and cholesterol-lowering effect. The aim of this study was to investigate whether apple procyanidins (APCs) feature therapeutic efficacy in terms of regressing atherosclerosis and whether this efficacy is due to mechanisms other than a cholesterol-lowering effect. After eight weeks on an atherogenic diet, rabbits were given a normal diet for another eight weeks to normalize the increased serum lipids level. The rabbits in the baseline group were sacrificed at this stage. The control group was subsequently fed a normal diet for eight weeks, while the APCs group was administrated 50 mg/kg/day of APCs in addition to the normal diet. Serum lipids and aortic intimal-medial thickness (IMT) were serially examined, and the resected aorta was examined histologically and through molecular biology. Aortic IMT on ultrasonography and the lipid accumulation area examined using Sudan IV staining were significantly reduced in the APCs group as compared to the control group. Serum lipid profiles were not different between the groups. Immunohistochemistry showed significantly decreased staining of an oxidative stress marker and significantly increased staining of ATP-binding cassette subfamily A member 1 (ABCA1) in the APCs group. Western blotting and RT-PCR also showed increased expression of ABCA1 mRNA and its protein in the APCs group. This study revealed that APCs administration causes a regression of atherosclerosis. APCs might hold promise as an anti-atherosclerotic agent. Copyright © 2017 Elsevier B.V. All rights reserved.

The StarD4 subfamily of steroidogenic acute regulatory-related lipid transfer (START) domain proteins: new players in cholesterol metabolism

PubMed Central

Calderon-Dominguez, Maria; Gil, Gregorio; Medina, Miguel Angel; Pandak, William M.; Rodríguez-Agudo, Daniel

2014-01-01

Cholesterol levels in the body are maintained through the coordinated regulation of its uptake, synthesis, distribution, storage and efflux. However, the way cholesterol is sorted within cells remains poorly defined. The discovery of the newly described StarD4 subfamily, part of the steroidogenic acute regulatory lipid transfer (START) domain family of proteins, affords an opportunity for the study of intracellular cholesterol movement, metabolism and its disorders. The three members of this intracelular subfamily of proteins (StarD4, StarD5 and StarD6) have a similar lipid binding pocket specific for sterols (cholesterol in particular), but differing regulation and localization. The ability to bind and transport cholesterol through a non-vesicular mean suggests that they play a previously unappreciated role in cholesterol homeostasis. PMID:24440759

Inferences of biogeographical histories within subfamily Hyacinthoideae using S-DIVA and Bayesian binary MCMC analysis implemented in RASP (Reconstruct Ancestral State in Phylogenies)

PubMed Central

Ali, Syed Shujait; Yu, Yan; Pfosser, Martin; Wetschnig, Wolfgang

2012-01-01

Background and Aims Subfamily Hyacinthoideae (Hyacinthaceae) comprises more than 400 species. Members are distributed in sub-Saharan Africa, Madagascar, India, eastern Asia, the Mediterranean region and Eurasia. Hyacinthoideae, like many other plant lineages, show disjunct distribution patterns. The aim of this study was to reconstruct the biogeographical history of Hyacinthoideae based on phylogenetic analyses, to find the possible ancestral range of Hyacinthoideae and to identify factors responsible for the current disjunct distribution pattern. Methods Parsimony and Bayesian approaches were applied to obtain phylogenetic trees, based on sequences of the trnL-F region. Biogeographical inferences were obtained by applying statistical dispersal-vicariance analysis (S-DIVA) and Bayesian binary MCMC (BBM) analysis implemented in RASP (Reconstruct Ancestral State in Phylogenies). Key Results S-DIVA and BBM analyses suggest that the Hyacinthoideae clade seem to have originated in sub-Saharan Africa. Dispersal and vicariance played vital roles in creating the disjunct distribution pattern. Results also suggest an early dispersal to the Mediterranean region, and thus the northward route (from sub-Saharan Africa to Mediterranean) of dispersal is plausible for members of subfamily Hyacinthoideae. Conclusions Biogeographical analyses reveal that subfamily Hyacinthoideae has originated in sub-Saharan Africa. S-DIVA indicates an early dispersal event to the Mediterranean region followed by a vicariance event, which resulted in Hyacintheae and Massonieae tribes. By contrast, BBM analysis favours dispersal to the Mediterranean region, eastern Asia and Europe. Biogeographical analysis suggests that sub-Saharan Africa and the Mediterranean region have played vital roles as centres of diversification and radiation within subfamily Hyacinthoideae. In this bimodal distribution pattern, sub-Saharan Africa is the primary centre of diversity and the Mediterranean region is the

Analysis of the murine Dtk gene identifies conservation of genomic structure within a new receptor tyrosine kinase subfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, P.M.; Crosier, K.E.; Crosier, P.S.

The receptor tyrosine kinase Dtk/Tyro 3/Sky/rse/brt/tif is a member of a new subfamily of receptors that also includes Axl/Ufo/Ark and Eyk/Mer. These receptors are characterized by the presence of two immunoglobulin-like loops and two fibronectin type III repeats in their extracellular domains. The structure of the murine Dtk gene has been determined. The gene consists of 21 exons that are distributed over 21 kb of genomic DNA. An isoform of Dtk is generated by differential splicing of exons from the 5{prime} region of the gene. The overall genomic structure of Dtk is virtually identical to that determined for the humanmore » UFO gene. This particular genomic organization is likely to have been duplicated and closely maintained throughout evolution. 38 refs., 3 figs., 1 tab.« less

Generic revision of the ant subfamily Dorylinae (Hymenoptera, Formicidae)

PubMed Central

Borowiec, Marek L.

2016-01-01

Abstract The generic classification of the ant subfamily Dorylinae is revised, with the aim of facilitating identification of easily-diagnosable monophyletic genera. The new classification is based on recent molecular phylogenetic evidence and a critical reappraisal of doryline morphology. New keys and diagnoses based on workers and males are provided, along with reviews of natural history and phylogenetic relationships, distribution maps, and a list of valid species for each lineage. Twenty-eight genera (27 extant and 1 extinct) are recognized within the subfamily, an increase from 20 in the previous classification scheme. Species classified in the polyphyletic Cerapachys and Sphinctomyrmex prior to this publication are here distributed among 9 and 3 different genera, respectively. Amyrmex and Asphinctanilloides are synonymized under Leptanilloides and the currently recognized subgenera are synonymized for Dorylus. No tribal classification is proposed for the subfamily, but several apparently monophyletic genus-groups are discussed. Valid generic names recognized here include: Acanthostichus (= Ctenopyga), Aenictogiton, Aenictus (= Paraenictus, Typhlatta), Cerapachys (= Ceratopachys), Cheliomyrmex, Chrysapace gen. rev., Cylindromyrmex (= Holcoponera, Hypocylindromyrmex, Metacylindromyrmex), Dorylus (= Alaopone syn. n., Anomma syn. n., Cosmaecetes, Dichthadia syn. n., Rhogmus syn. n., Shuckardia, Sphecomyrmex, Sphegomyrmex, Typhlopone syn. n.), Eburopone gen. n., Eciton (= Camptognatha, Holopone, Mayromyrmex), Eusphinctus gen. rev., Labidus (= Nycteresia, Pseudodichthadia), Leptanilloides (= Amyrmex syn. n., Asphinctanilloides syn. n.), Lioponera gen. rev. (= Neophyracaces syn. n., Phyracaces syn. n.), Lividopone, Neivamyrmex (= Acamatus, Woitkowskia), Neocerapachys gen. n., Nomamyrmex, Ooceraea gen. rev. (= Cysias syn. n.), Parasyscia gen. rev., †Procerapachys, Simopone, Sphinctomyrmex, Syscia gen. rev., Tanipone, Vicinopone, Yunodorylus gen. rev., Zasphinctus

Phylogenetic analysis of the cytochrome P450 3 (CYP3) gene family.

PubMed

McArthur, Andrew G; Hegelund, Tove; Cox, Rachel L; Stegeman, John J; Liljenberg, Mette; Olsson, Urban; Sundberg, Per; Celander, Malin C

2003-08-01

Cytochrome P450 genes (CYP) constitute a superfamily with members known from the Bacteria, Archaea, and Eukarya. The CYP3 gene family includes the CYP3A and CYP3B subfamilies. Members of the CYP3A subfamily represent the dominant CYP forms expressed in the digestive and respiratory tracts of vertebrates. The CYP3A enzymes metabolize a wide variety of chemically diverse lipophilic organic compounds. To understand vertebrate CYP3 diversity better, we determined the killifish (Fundulus heteroclitus) CYP3A30 and CYP3A56 and the ball python (Python regius) CYP3A42 sequences. We performed phylogenetic analyses of 45 vertebrate CYP3 amino acid sequences using a Bayesian approach. Our analyses indicate that teleost, diapsid, and mammalian CYP3A genes have undergone independent diversification and that the ancestral vertebrate genome contained a single CYP3A gene. Most CYP3A diversity is the product of recent gene duplication events. There is strong support for placement of the guinea pig CYP3A genes within the rodent CYP3A diversification. The rat, mouse, and hamster CYP3A genes are mixed among several rodent CYP3A subclades, indicative of a complex history involving speciation and gene duplication.

Leaf and stem CO/sub 2/ uptake in the three subfamilies of the Cactaceae. [Pereskia aculeata; Pereskia grandifolia; Maihuenia poeppigii; Carnegiea gigantea; Ferocactus acanthodes; Coryphantha vivipara; Mammillaria dioica; Opuntia ficus-inidica; Pereskiopsis porteri; Quiabentia chacoensis; Austrocylindropuntia subulata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nobel, P.S.; Hartsock, T.L.

Net CO/sub 2/ uptake over 24-hour periods was examined for the leaves and for the stems of 11 species of cacti representing all three subfamilies. For Pereskia aculeata, Pereskia grandifolia, and Maihuenia poeppigii (subfamily Pereskioideae), all the net shoot CO/sub 2/ uptake was by the leaves and during the daytime. In contrast, for the leafless species Carnegiea gigantea, Ferocactus acanthodes, Coryphantha vivipara, and Mammillaria dioica (subfamily Cactoideae), all the shoot net CO/sub 2/ uptake was by the stems and at night. Similarly, for leafless Opuntia ficus-indica (subfamily Opuntioideae), all net CO/sub 2/ uptake occurred at night. For leafy members ofmore » the Opuntioideae (Pereskiopsis porteri, Quiabentia chacoensis, Austrocylindropuntia subulata), at least 88% of the shoot CO/sub 2/ uptake over 24 hours was by the leaves and some CO/sub 2/ uptake occurred at night. Leaves responded to the instantaneous level of photosynthetically active radiation (PAR) during the daytime, as occurs for C/sub 3/ plants, whereas nocturnal CO/sub 2/ uptake by stems of O. ficus-indica and F. acanthodes responded to the total daily PAR, as occurs for Crassulacean acid metabolism (CAM) plants. Thus, under the well-watered conditions employed, the Pereskioideae behaved as C/sub 3/ plants, the Cactoideae behaved as CAM plants, and the Opuntioideae exhibited characteristics of both pathways.« less

Multi-locus phylogeny of dolphins in the subfamily Lissodelphininae: character synergy improves phylogenetic resolution

PubMed Central

Harlin-Cognato, April D; Honeycutt, Rodney L

2006-01-01

Background Dolphins of the genus Lagenorhynchus are anti-tropically distributed in temperate to cool waters. Phylogenetic analyses of cytochrome b sequences have suggested that the genus is polyphyletic; however, many relationships were poorly resolved. In this study, we present a combined-analysis phylogenetic hypothesis for Lagenorhynchus and members of the subfamily Lissodelphininae, which is derived from two nuclear and two mitochondrial data sets and the addition of 34 individuals representing 9 species. In addition, we characterize with parsimony and Bayesian analyses the phylogenetic utility and interaction of characters with statistical measures, including the utility of highly consistent (non-homoplasious) characters as a conservative measure of phylogenetic robustness. We also explore the effects of removing sources of character conflict on phylogenetic resolution. Results Overall, our study provides strong support for the monophyly of the subfamily Lissodelphininae and the polyphyly of the genus Lagenorhynchus. In addition, the simultaneous parsimony analysis resolved and/or improved resolution for 12 nodes including: (1) L. albirostris, L. acutus; (2) L. obscurus and L. obliquidens; and (3) L. cruciger and L. australis. In addition, the Bayesian analysis supported the monophyly of the Cephalorhynchus, and resolved ambiguities regarding the relationship of L. australis/L. cruciger to other members of the genus Lagenorhynchus. The frequency of highly consistent characters varied among data partitions, but the rate of evolution was consistent within data partitions. Although the control region was the greatest source of character conflict, removal of this data partition impeded phylogenetic resolution. Conclusion The simultaneous analysis approach produced a more robust phylogenetic hypothesis for Lagenorhynchus than previous studies, thus supporting a phylogenetic approach employing multiple data partitions that vary in overall rate of evolution. Even in

Sequence Analysis and Characterization of Active Human Alu Subfamilies Based on the 1000 Genomes Pilot Project.

PubMed

Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A

2015-08-29

The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A genomic view of the NOD-like receptor family in teleost fish: Identification of a novel NLR subfamily in zebrafish

USGS Publications Warehouse

Laing, K.J.; Purcell, M.K.; Winton, J.R.; Hansen, J.D.

2008-01-01

Background. A large multigene family of NOD-like receptor (NLR) molecules have been described in mammals and implicated in immunity and apoptosis. Little information, however, exists concerning this gene family in non-mammalian taxa. This current study, therefore, provides an in-depth investigation of this gene family in lower vertebrates including extensive phylogenetic comparison of zebrafish NLRs with orthologs in tetrapods, and analysis of their tissue-specific expression. Results. Three distinct NLR subfamilies were identified by mining genome databases of various non-mammalian vertebrates; the first subfamily (NLR-A) resembles mammalian NODs, the second (NLR-B) resembles mammalian NALPs, while the third (NLR-C) appears to be unique to teleost fish. In zebrafish, NLR-A and NLR-B subfamilies contain five and six genes respectively. The third subfamily is large, containing several hundred NLR-C genes, many of which are predicted to encode a C-terminal B30.2 domain. This subfamily most likely evolved from a NOD3-like molecule. Gene predictions for zebrafish NLRs were verified using sequence derived from ESTs or direct sequencing of cDNA. Reverse-transcriptase (RT)-PCR analysis confirmed expression of representative genes from each subfamily in selected tissues. Conclusion. Our findings confirm the presence of multiple NLR gene orthologs, which form a large multigene family in teleostei. Although the functional significance of the three major NLR subfamilies is unclear, we speculate that conservation and abundance of NLR molecules in all teleostei genomes, reflects an essential role in cellular control, apoptosis or immunity throughout bony fish. ?? 2008 Laing et al; licensee BioMed Central Ltd.

Key to adults of North American genera of the subfamily Cecidomyiinae (Diptera: Cecidomyiidae)

USDA-ARS?s Scientific Manuscript database

Keys to the subfamilies of Cecidomyiidae and to the 150 genera of Cecidomyiinae known to occur in North America are presented. Information is given for each of the genera on distribution, number of species and habits. Patterns of general distribution for the subfamily are discussed. A glossary to an...

CDD/SPARCLE: functional classification of proteins via subfamily domain architectures.

PubMed

Marchler-Bauer, Aron; Bo, Yu; Han, Lianyi; He, Jane; Lanczycki, Christopher J; Lu, Shennan; Chitsaz, Farideh; Derbyshire, Myra K; Geer, Renata C; Gonzales, Noreen R; Gwadz, Marc; Hurwitz, David I; Lu, Fu; Marchler, Gabriele H; Song, James S; Thanki, Narmada; Wang, Zhouxi; Yamashita, Roxanne A; Zhang, Dachuan; Zheng, Chanjuan; Geer, Lewis Y; Bryant, Stephen H

2017-01-04

NCBI's Conserved Domain Database (CDD) aims at annotating biomolecular sequences with the location of evolutionarily conserved protein domain footprints, and functional sites inferred from such footprints. An archive of pre-computed domain annotation is maintained for proteins tracked by NCBI's Entrez database, and live search services are offered as well. CDD curation staff supplements a comprehensive collection of protein domain and protein family models, which have been imported from external providers, with representations of selected domain families that are curated in-house and organized into hierarchical classifications of functionally distinct families and sub-families. CDD also supports comparative analyses of protein families via conserved domain architectures, and a recent curation effort focuses on providing functional characterizations of distinct subfamily architectures using SPARCLE: Subfamily Protein Architecture Labeling Engine. CDD can be accessed at https://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Evolution of EF-hand calcium-modulated proteins. II. Domains of several subfamilies have diverse evolutionary histories

NASA Technical Reports Server (NTRS)

Nakayama, S.; Moncrief, N. D.; Kretsinger, R. H.

1992-01-01

In the first report in this series we described the relationships and evolution of 152 individual proteins of the EF-hand subfamilies. Here we add 66 additional proteins and define eight (CDC, TPNV, CLNB, LPS, DGK, 1F8, VIS, TCBP) new subfamilies and seven (CAL, SQUD, CDPK, EFH5, TPP, LAV, CRGP) new unique proteins, which we assume represent new subfamilies. The main focus of this study is the classification of individual EF-hand domains. Five subfamilies--calmodulin, troponin C, essential light chain, regulatory light chain, CDC31/caltractin--and three uniques--call, squidulin, and calcium-dependent protein kinase--are congruent in that all evolved from a common four-domain precursor. In contrast calpain and sarcoplasmic calcium-binding protein (SARC) each evolved from its own one-domain precursor. The remaining 19 subfamilies and uniques appear to have evolved by translocation and splicing of genes encoding the EF-hand domains that were precursors to the congruent eight and to calpain and to SARC. The rates of evolution of the EF-hand domains are slower following formation of the subfamilies and establishment of their functions. Subfamilies are not readily classified by patterns of calcium coordination, interdomain linker stability, and glycine and proline distribution. There are many homoplasies indicating that similar variants of the EF-hand evolved by independent pathways.

DNA methylation and hydroxymethylation analyses of the active LINE-1 subfamilies in mice.

PubMed

Murata, Yui; Bundo, Miki; Ueda, Junko; Kubota-Sakashita, Mie; Kasai, Kiyoto; Kato, Tadafumi; Iwamoto, Kazuya

2017-10-19

Retrotransposon long interspersed nuclear element-1 (LINE-1) occupies a large proportion of the mammalian genome, comprising approximately 100,000 genomic copies in mice. Epigenetic status of the 5' untranslated region (5'-UTR) of LINE-1 is critical for its promoter activity. DNA methylation levels in the 5'-UTR of human active LINE-1 subfamily can be measured by well-established methods, such as a pyrosequencing-based assay. However, because of the considerable sequence and structural diversity in LINE-1 among species, methods for such assays should be adapted for the species of interest. Here we developed pyrosequencing-based assays to examine methylcytosine (mC) and hydroxymethylcytosine (hmC) levels of the three active LINE-1 subfamilies in mice (TfI, A, and GfII). Using these assays, we quantified mC and hmC levels in four brain regions and four nonbrain tissues including tail, heart, testis, and ovary. We observed tissue- and subfamily-specific mC and hmC differences. We also found that mC levels were strongly correlated among different brain regions, but mC levels of the testis showed a poor correlation with those of other tissues. Interestingly, mC levels in the A and GfII subfamilies were highly correlated, possibly reflecting their close evolutionary relationship. Our assays will be useful for exploring the epigenetic regulation of the active LINE-1 subfamilies in mice.

Comparative ribotyping of Staphylococcus intermedius isolated from members of the Canoidea gives possible evidence for host-specificity and co-evolution of bacteria and hosts.

PubMed

Aarestrup, F M

2001-07-01

A total of 41 Staphylococcus intermedius isolates were isolated from skin of healthy members of six phylogenetic groups within the Canoidea (the dog family, skunk subfamily, weasel subfamily, racoon family, red panda and bear family) of different geographical origin and compared by EcoRI ribotyping and cluster analysis. The S. intermedius isolates from the different families and subfamilies clustered together in separate groups, almost completely following the phylogenetic relationship of the animal hosts. These ribotype data indicate host-specificity of different types of S. intermedius and suggest co-evolution between the animal hosts within the Canoidea and S. intermedius.

Structural and Functional Characterization of a Ruminal β-Glycosidase Defines a Novel Subfamily of Glycoside Hydrolase Family 3 with Permuted Domain Topology*

PubMed Central

Ramírez-Escudero, Mercedes; del Pozo, Mercedes V.; Marín-Navarro, Julia; González, Beatriz; Golyshin, Peter N.; Polaina, Julio; Ferrer, Manuel; Sanz-Aparicio, Julia

2016-01-01

Metagenomics has opened up a vast pool of genes for putative, yet uncharacterized, enzymes. It widens our knowledge on the enzyme diversity world and discloses new families for which a clear classification is still needed, as is exemplified by glycoside hydrolase family-3 (GH3) proteins. Herein, we describe a GH3 enzyme (GlyA1) from resident microbial communities in strained ruminal fluid. The enzyme is a β-glucosidase/β-xylosidase that also shows β-galactosidase, β-fucosidase, α-arabinofuranosidase, and α-arabinopyranosidase activities. Short cello- and xylo-oligosaccharides, sophorose and gentibiose, are among the preferred substrates, with the large polysaccharide lichenan also being hydrolyzed by GlyA1. The determination of the crystal structure of the enzyme in combination with deletion and site-directed mutagenesis allowed identification of its unusual domain composition and the active site architecture. Complexes of GlyA1 with glucose, galactose, and xylose allowed picturing the catalytic pocket and illustrated the molecular basis of the substrate specificity. A hydrophobic platform defined by residues Trp-711 and Trp-106, located in a highly mobile loop, appears able to allocate differently β-linked bioses. GlyA1 includes an additional C-terminal domain previously unobserved in GH3 members, but crystallization of the full-length enzyme was unsuccessful. Therefore, small angle x-ray experiments have been performed to investigate the molecular flexibility and overall putative shape. This study provided evidence that GlyA1 defines a new subfamily of GH3 proteins with a novel permuted domain topology. Phylogenetic analysis indicates that this topology is associated with microbes inhabiting the digestive tracts of ruminants and other animals, feeding on chemically diverse plant polymeric materials. PMID:27679487

Discovering the silk road: Nuclear and mitochondrial sequence data resolve the phylogenetic relationships among theraphosid spider subfamilies.

PubMed

Lüddecke, Tim; Krehenwinkel, Henrik; Canning, Gregory; Glaw, Frank; Longhorn, Stuart J; Tänzler, René; Wendt, Ingo; Vences, Miguel

2018-02-01

The mygalomorph spiders in the family Theraphosidae, also known as "tarantulas", are one of the most popular and diverse groups of arachnids, but their evolutionary history remains poorly understood because morphological analyses have only provided mostly controversial results, and a broad molecular perspective has been lacking until now. In this study we provide a preliminary molecular phylogenetic hypothesis of relationships among theraphosid subfamilies, based on 3.5 kbp of three nuclear and three mitochondrial markers, for 52 taxa representing 10 of the 11 commonly accepted subfamilies. Our analysis confirms the monophyly of the Theraphosidae and of most recognized theraphosid subfamilies, supports the validity of the Stromatopelminae and Poecilotheriinae, and indicates paraphyly of the Schismatothelinae. The placement of representatives of Schismatothelinae also indicates possible non-monophyly of Aviculariinae and supports the distinction of the previously contentious subfamily Psalmopoeinae. Major clades typically corresponded to taxa occurring in the same biogeographic region, with two of them each occurring in Africa, South America and Asia. Because relationships among these major clades were poorly supported, more extensive molecular data sets are required to test the hypothesis of independent colonization and multiple dispersal events among these continents. Copyright © 2017 Elsevier Inc. All rights reserved.

Protein interactions and ligand binding: from protein subfamilies to functional specificity.

PubMed

Rausell, Antonio; Juan, David; Pazos, Florencio; Valencia, Alfonso

2010-02-02

The divergence accumulated during the evolution of protein families translates into their internal organization as subfamilies, and it is directly reflected in the characteristic patterns of differentially conserved residues. These specifically conserved positions in protein subfamilies are known as "specificity determining positions" (SDPs). Previous studies have limited their analysis to the study of the relationship between these positions and ligand-binding specificity, demonstrating significant yet limited predictive capacity. We have systematically extended this observation to include the role of differential protein interactions in the segregation of protein subfamilies and explored in detail the structural distribution of SDPs at protein interfaces. Our results show the extensive influence of protein interactions in the evolution of protein families and the widespread association of SDPs with protein interfaces. The combined analysis of SDPs in interfaces and ligand-binding sites provides a more complete picture of the organization of protein families, constituting the necessary framework for a large scale analysis of the evolution of protein function.

DR-78, a novel Drosophila melanogaster genomic DNA fragment highly homologous to the DNA-binding domain of thyroid hormone-retinoic acid-vitamin D receptor subfamily.

PubMed

Martín-Blanco, E; Kornberg, T B

1993-11-16

Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.

Molecular Evolution of the CYP2D Subfamily in Primates: Purifying Selection on Substrate Recognition Sites without the Frequent or Long-Tract Gene Conversion

PubMed Central

Yasukochi, Yoshiki; Satta, Yoko

2015-01-01

The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. PMID:25808902

A large-scale chloroplast phylogeny of the Lamiaceae sheds new light on its subfamilial classification

PubMed Central

Li, Bo; Cantino, Philip D.; Olmstead, Richard G.; Bramley, Gemma L. C.; Xiang, Chun-Lei; Ma, Zhong-Hui; Tan, Yun-Hong; Zhang, Dian-Xiang

2016-01-01

Lamiaceae, the sixth largest angiosperm family, contains more than 7000 species distributed all over the world. However, although considerable progress has been made in the last two decades, its phylogenetic backbone has never been well resolved. In the present study, a large-scale phylogenetic reconstruction of Lamiaceae using chloroplast sequences was carried out with the most comprehensive sampling of the family to date (288 species in 191 genera, representing approximately 78% of the genera of Lamiaceae). Twelve strongly supported primary clades were inferred, which form the phylogenetic backbone of Lamiaceae. Six of the primary clades correspond to the current recognized subfamilies Ajugoideae, Lamioideae, Nepetoideae, Prostantheroideae, Scutellarioideae, and Symphorematoideae, and one corresponds to a portion of Viticoideae. The other five clades comprise: 1) Acrymia and Cymaria; 2) Hymenopyramis, Petraeovitex, Peronema, and Garrettia; 3) Premna, Gmelina, and Cornutia; 4) Callicarpa; and 5) Tectona. Based on these results, three new subfamilies—Cymarioideae, Peronematoideae, and Premnoideae—are described, and the compositions of other subfamilies are updated based on new findings from the last decade. Furthermore, our analyses revealed five strongly supported, more inclusive clades that contain subfamilies, and we give them phylogenetically defined, unranked names: Cymalamiina, Scutelamiina, Perolamiina, Viticisymphorina, and Calliprostantherina. PMID:27748362

A phylogeny of robber flies (Diptera: Asilidae) at the subfamilial level: molecular evidence.

PubMed

Bybee, Seth M; Taylor, Sean D; Riley Nelson, C; Whiting, Michael F

2004-03-01

We present the first formal analysis of phylogenetic relationships among the Asilidae, based on four genes: 16S rDNA, 18S rDNA, 28S rDNA, and cytochrome oxidase II. Twenty-six ingroup taxa representing 11 of the 12 described subfamilies were selected to produce a phylogenetic estimate of asilid subfamilial relationships via optimization alignment, parsimony, and maximum likelihood techniques. Phylogenetic analyses support the monophyly of Asilidae with Leptogastrinae as the most basal robber fly lineage. Apocleinae+(Asilinae+Ommatiinae) is supported as monophyletic. The laphriinae-group (Laphriinae+Laphystiinae) and the dasypogoninae-group (Dasypogoninae+Stenopogoninae+Stichopogoninae+ Trigonomiminae) are paraphyletic. These results suggest that current subfamilial classification only partially reflects robber fly phylogeny, indicating the need for further phylogenetic investigation of this group.

Aquaporins in Digestive System.

PubMed

Zhu, Shuai; Ran, Jianhua; Yang, Baoxue; Mei, Zhechuan

2017-01-01

In this chapter, we mainly discuss the expression and function of aquaporins (AQPs ) expressed in digestive system . AQPs in gastrointestinal tract include four members of aquaporin subfamily: AQP1, AQP4, AQP5 and AQP8, and a member of aquaglyceroporin subfamily: AQP3. In the digestive glands, especially the liver, we discuss three members of aquaporin subfamily: AQP1, AQP5 and AQP8, a member of aquaglyceroporin subfamily: AQP9. AQP3 is involved in the diarrhea and inflammatory bowel disease; AQP5 is relevant to gastric carcinoma cell proliferation and migration; AQP9 plays considerable role in glycerol metabolism , urea transport and hepatocellular carcinoma. Further investigation is necessary for specific locations and functions of AQPs in digestive system.

Comparative chloroplast genomics reveals the evolution of Pinaceae genera and subfamilies.

PubMed

Lin, Ching-Ping; Huang, Jen-Pan; Wu, Chung-Shien; Hsu, Chih-Yao; Chaw, Shu-Miaw

2010-01-01

As the largest and the basal-most family of conifers, Pinaceae provides key insights into the evolutionary history of conifers. We present comparative chloroplast genomics and analysis of concatenated 49 chloroplast protein-coding genes common to 19 gymnosperms, including 15 species from 8 Pinaceous genera, to address the long-standing controversy about Pinaceae phylogeny. The complete cpDNAs of Cathaya argyrophylla and Cedrus deodara (Abitoideae) and draft cpDNAs of Larix decidua, Picea morrisonicola, and Pseudotsuga wilsoniana are reported. We found 21- and 42-kb inversions in congeneric species and different populations of Pinaceous species, which indicates that structural polymorphics may be common and ancient in Pinaceae. Our phylogenetic analyses reveal that Cedrus is clustered with Abies-Keteleeria rather than the basal-most genus of Pinaceae and that Cathaya is closer to Pinus than to Picea or Larix-Pseudotsuga. Topology and structural change tests and indel-distribution comparisons lend further evidence to our phylogenetic finding. Our molecular datings suggest that Pinaceae first evolved during Early Jurassic, and diversification of Pinaceous subfamilies and genera took place during Mid-Jurassic and Lower Cretaceous, respectively. Using different maximum-likelihood divergences as thresholds, we conclude that 2 (Abietoideae and Larix-Pseudotsuga-Piceae-Cathaya-Pinus), 4 (Cedrus, non-Cedrus Abietoideae, Larix-Pseudotsuga, and Piceae-Cathaya-Pinus), or 5 (Cedrus, non-Cedrus Abietoideae, Larix-Pseudotsuga, Picea, and Cathaya-Pinus) groups/subfamilies are more reasonable delimitations for Pinaceae. Specifically, our views on subfamilial classifications differ from previous studies in terms of the rank of Cedrus and with recognition of more than two subfamilies.

Comparative Chloroplast Genomics Reveals the Evolution of Pinaceae Genera and Subfamilies

PubMed Central

Lin, Ching-Ping; Huang, Jen-Pan; Wu, Chung-Shien; Hsu, Chih-Yao; Chaw, Shu-Miaw

2010-01-01

As the largest and the basal-most family of conifers, Pinaceae provides key insights into the evolutionary history of conifers. We present comparative chloroplast genomics and analysis of concatenated 49 chloroplast protein-coding genes common to 19 gymnosperms, including 15 species from 8 Pinaceous genera, to address the long-standing controversy about Pinaceae phylogeny. The complete cpDNAs of Cathaya argyrophylla and Cedrus deodara (Abitoideae) and draft cpDNAs of Larix decidua, Picea morrisonicola, and Pseudotsuga wilsoniana are reported. We found 21- and 42-kb inversions in congeneric species and different populations of Pinaceous species, which indicates that structural polymorphics may be common and ancient in Pinaceae. Our phylogenetic analyses reveal that Cedrus is clustered with Abies–Keteleeria rather than the basal-most genus of Pinaceae and that Cathaya is closer to Pinus than to Picea or Larix–Pseudotsuga. Topology and structural change tests and indel-distribution comparisons lend further evidence to our phylogenetic finding. Our molecular datings suggest that Pinaceae first evolved during Early Jurassic, and diversification of Pinaceous subfamilies and genera took place during Mid-Jurassic and Lower Cretaceous, respectively. Using different maximum-likelihood divergences as thresholds, we conclude that 2 (Abietoideae and Larix–Pseudotsuga–Piceae–Cathaya–Pinus), 4 (Cedrus, non-Cedrus Abietoideae, Larix–Pseudotsuga, and Piceae–Cathaya–Pinus), or 5 (Cedrus, non-Cedrus Abietoideae, Larix–Pseudotsuga, Picea, and Cathaya–Pinus) groups/subfamilies are more reasonable delimitations for Pinaceae. Specifically, our views on subfamilial classifications differ from previous studies in terms of the rank of Cedrus and with recognition of more than two subfamilies. PMID:20651328

Unequal subfamily proportions among honey bee queen and worker brood

PubMed

Tilley; Oldroyd

1997-12-01

Queens from three colonies of feral honey bees, Apis mellifera were removed and placed in separate nucleus colonies. For each colony, eggs and larvae were taken from the nucleus and placed in the main hive on each of 3-4 consecutive weeks. Workers in the queenless parts selected young larvae to rear as queens. Queen pupae, together with the surrounding worker pupae, were removed from each colony and analysed at two to three microsatellite loci to determine their paternity. In all three colonies, the paternity of larvae chosen by the bees to rear as queens was not a random sample of the paternities in the worker brood, with certain subfamilies being over-represented in queens. These results support an important prediction of kin selection theory: when colonies are queenless, unequal relatedness within colonies could lead to the evolution of reproductive competition, that is some subfamilies achieving greater reproductive success than others. The mechanism by which such dominance is achieved could be through a system of kin recognition and nepotism, but we conclude that genetically based differential attractiveness of larvae for rearing as queens is more likely.Copyright 1997 The Association for the Study of Animal BehaviourCopyright 1997The Association for the Study of Animal Behaviour.

The Role of Recombination in the Origin and Evolution of Alu Subfamilies

PubMed Central

Teixeira-Silva, Ana; Silva, Raquel M.; Carneiro, João; Amorim, António; Azevedo, Luísa

2013-01-01

Alus are the most abundant and successful short interspersed nuclear elements found in primate genomes. In humans, they represent about 10% of the genome, although few are retrotransposition-competent and are clustered into subfamilies according to the source gene from which they evolved. Recombination between them can lead to genomic rearrangements of clinical and evolutionary significance. In this study, we have addressed the role of recombination in the origin of chimeric Alu source genes by the analysis of all known consensus sequences of human Alus. From the allelic diversity of Alu consensus sequences, validated in extant elements resulting from whole genome searches, distinct events of recombination were detected in the origin of particular subfamilies of AluS and AluY source genes. These results demonstrate that at least two subfamilies are likely to have emerged from ectopic Alu-Alu recombination, which stimulates further research regarding the potential of chimeric active Alus to punctuate the genome. PMID:23750218

The role of recombination in the origin and evolution of Alu subfamilies.

PubMed

Teixeira-Silva, Ana; Silva, Raquel M; Carneiro, João; Amorim, António; Azevedo, Luísa

2013-01-01

Alus are the most abundant and successful short interspersed nuclear elements found in primate genomes. In humans, they represent about 10% of the genome, although few are retrotransposition-competent and are clustered into subfamilies according to the source gene from which they evolved. Recombination between them can lead to genomic rearrangements of clinical and evolutionary significance. In this study, we have addressed the role of recombination in the origin of chimeric Alu source genes by the analysis of all known consensus sequences of human Alus. From the allelic diversity of Alu consensus sequences, validated in extant elements resulting from whole genome searches, distinct events of recombination were detected in the origin of particular subfamilies of AluS and AluY source genes. These results demonstrate that at least two subfamilies are likely to have emerged from ectopic Alu-Alu recombination, which stimulates further research regarding the potential of chimeric active Alus to punctuate the genome.

Molecular evolution of the CYP2D subfamily in primates: purifying selection on substrate recognition sites without the frequent or long-tract gene conversion.

PubMed

Yasukochi, Yoshiki; Satta, Yoko

2015-03-25

The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Phylogeny and Evolutionary Patterns in the Dwarf Crayfish Subfamily (Decapoda: Cambarellinae)

PubMed Central

Pedraza-Lara, Carlos; Doadrio, Ignacio; Breinholt, Jesse W.; Crandall, Keith A.

2012-01-01

The Dwarf crayfish or Cambarellinae, is a morphologically singular subfamily of decapod crustaceans that contains only one genus, Cambarellus. Its intriguing distribution, along the river basins of the Gulf Coast of United States (Gulf Group) and into Central México (Mexican Group), has until now lacked of satisfactory explanation. This study provides a comprehensive sampling of most of the extant species of Cambarellus and sheds light on its evolutionary history, systematics and biogeography. We tested the impact of Gulf Group versus Mexican Group geography on rates of cladogenesis using a maximum likelihood framework, testing different models of birth/extinction of lineages. We propose a comprehensive phylogenetic hypothesis for the subfamily based on mitochondrial and nuclear loci (3,833 bp) using Bayesian and Maximum Likelihood methods. The phylogenetic structure found two phylogenetic groups associated to the two main geographic components (Gulf Group and Mexican Group) and is partially consistent with the historical structure of river basins. The previous hypothesis, which divided the genus into three subgenera based on genitalia morphology was only partially supported (P = 0.047), resulting in a paraphyletic subgenus Pandicambarus. We found at least two cases in which phylogenetic structure failed to recover monophyly of recognized species while detecting several cases of cryptic diversity, corresponding to lineages not assigned to any described species. Cladogenetic patterns in the entire subfamily are better explained by an allopatric model of speciation. Diversification analyses showed similar cladogenesis patterns between both groups and did not significantly differ from the constant rate models. While cladogenesis in the Gulf Group is coincident in time with changes in the sea levels, in the Mexican Group, cladogenesis is congruent with the formation of the Trans-Mexican Volcanic Belt. Our results show how similar allopatric divergence in

Molecular systematics of the subfamily Limenitidinae (Lepidoptera: Nymphalidae)

PubMed Central

Dhungel, Bidur

2018-01-01

We studied the systematics of the subfamily Limenitidinae (Lepidoptera: Nymphalidae) using molecular methods to reconstruct a robust phylogenetic hypothesis. The molecular data matrix comprised 205 Limenitidinae species, four outgroups, and 11,327 aligned nucleotide sites using up to 18 genes per species of which seven genes (CycY, Exp1, Nex9, PolII, ProSup, PSb and UDPG6DH) have not previously been used in phylogenetic studies. We recovered the monophyly of the subfamily Limenitidinae and seven higher clades corresponding to four traditional tribes Parthenini, Adoliadini, Neptini, Limenitidini as well as three additional independent lineages. One contains the genera Harma + Cymothoe and likely a third, Bhagadatta, and the other two independent lineages lead to Pseudoneptis and to Pseudacraea. These independent lineages are circumscribed as new tribes. Parthenini was recovered as sister to rest of Limenitidinae, but the relationships of the remaining six lineages were ambiguous. A number of genera were found to be non-monophyletic, with Pantoporia, Euthalia, Athyma, and Parasarpa being polyphyletic, whereas Limenitis, Neptis, Bebearia, Euryphura, and Adelpha were paraphyletic. PMID:29416955

Tergal glands in termite soldiers of the subfamily Syntermitinae (Isoptera: Termitidae).

PubMed

Costa-Leonardo, Ana Maria; Haifig, Ives; Laranjo, Lara Teixeira

2012-02-01

The subfamily Syntermitinae comprises 14 genera of termites that are exclusively neotropical. The present study reports morphological data about mandibulate nasute soldiers from termite species belonging to three different genera within this subfamily. We describe tergal glands that were present under all tergites of soldiers of the following species: Cornitermes cumulans, Procornitermes araujoi, Syntermes nanus, and Syntermes wheeleri. The tergal glands were composed of class 2 and class 3 cells. Class 2 cells never reached the cuticle and were located below a flat layer of epidermal cells. Class 3 cells, composed of secretory cells and canal cells, were sporadic, whereas class 2 secretory cells were abundant. Secretory cells of class 3 were narrow and their cytoplasms were filled with several clear, oval-shaped vesicles with limiting membranes. The ultrastructure of class 2 cells showed well-developed smooth endoplasmic reticulum, Golgi apparatus, elongated mitochondria, several electron-lucent vesicles, and electron-dense granules that contain paracrystalline structures in S. nanus. Scanning electron micrographs displayed pores, campaniform sensilla and hairs in the outer cuticle of the soldier tergites. We hypothesize that soldier tergal glands may be involved in the production of defensive compounds, which occur in similar glands of certain cockroaches, or of primer pheromones, that might act in the regulation of soldier differentiation in the termite colony. To date, tergal glands have only been described in termite imagoes, and their occurrence in these soldiers of basal Syntermitinae implies a specific role in this caste that is still speculative and needs to be clarified. Copyright © 2011 Elsevier Ltd. All rights reserved.

Comparative genomic analysis of the eight-membered ring cystine knot-containing bone morphogenetic protein antagonists.

PubMed

Avsian-Kretchmer, Orna; Hsueh, Aaron J W

2004-01-01

TGF-beta family proteins with a cystine knot motif serve as ligands for diverse families of plasma membrane receptors. Bone morphogenetic protein (BMP) antagonists represent a subgroup of these proteins, some of which bind BMPs and antagonize their actions during development and morphogenesis. Availability of completed genome sequences from diverse organisms allows bioinformatic analysis of the evolution of BMP antagonists and facilitates their classification. Using a regular expression algorithm (http://BioRegEx.stanford.edu), an exhaustive search of the human genome identified all cystine knot-containing BMP antagonists. Based on the size of the cystine ring, these proteins were divided into three subfamilies: CAN (eight-membered ring), twisted gastrulation (nine-membered ring), as well as chordin and noggin (10-membered ring). The CAN family can be divided further into four subgroups based on a conserved arrangement of additional cysteine residues-gremlin and PRDC, cerberus and coco, and DAN, together with USAG-1 and sclerostin. We searched for orthologs of human BMP antagonists in the genomes of model organisms and analyzed their phylogenetic relationship. New human paralogs were identified together with the verification of orthologous relationships of known genes. We also discuss the physiological roles of the CAN subfamily of BMP antagonists and the associated genetic defects. Based on the known three-dimensional structure of key cystine knot proteins, we postulated disulfide bondings for eight-membered ring BMP antagonists to predict their potential folding and dimerization.

Cross-phenotype analysis of Immunochip data identifies KDM4C as a relevant locus for the development of systemic vasculitis.

PubMed

Ortiz-Fernández, Lourdes; Carmona, Francisco David; López-Mejías, Raquel; González-Escribano, Maria Francisca; Lyons, Paul A; Morgan, Ann W; Sawalha, Amr H; Smith, Kenneth G C; González-Gay, Miguel A; Martín, Javier

2018-04-01

Systemic vasculitides represent a heterogeneous group of rare complex diseases of the blood vessels with a poorly understood aetiology. To investigate the shared genetic component underlying their predisposition, we performed the first cross-phenotype meta-analysis of genetic data from different clinically distinct patterns of vasculitis. Immunochip genotyping data from 2465 patients diagnosed with giant cell arteritis, Takayasu's arteritis, antineutrophil cytoplasmic antibody-associated vasculitis or IgA vasculitis as well as 4632 unaffected controls were analysed to identify common susceptibility loci for vasculitis development. The possible functional consequences of the associated variants were interrogated using publicly available annotation data. The strongest association signal corresponded with an intergenic polymorphism located between HLA-DQB1 and HLA-DQA2 (rs6932517, P=4.16E-14, OR=0.74). This single nucleotide polymorphism is in moderate linkage disequilibrium with the disease-specific human leucocyte antigen (HLA) class II associations of each type of vasculitis and could mark them. Outside the HLA region, we identified the KDM4C gene as a common risk locus for vasculitides (highest peak rs16925200, P=6.23E-07, OR=1.75). This gene encodes a histone demethylase involved in the epigenetic control of gene expression. Through a combined analysis of Immunochip data, we have identified KDM4C as a new risk gene shared between systemic vasculitides, consistent with the increasing evidences of the crucial role that the epigenetic mechanisms have in the development of complex immune-mediated conditions. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Molecular phylogeny of the highly diversified catfish subfamily Loricariinae (Siluriformes, Loricariidae) reveals incongruences with morphological classification.

PubMed

Covain, Raphaël; Fisch-Muller, Sonia; Oliveira, Claudio; Mol, Jan H; Montoya-Burgos, Juan I; Dray, Stéphane

2016-01-01

The Loricariinae belong to the Neotropical mailed catfish family Loricariidae, the most species-rich catfish family. Among loricariids, members of the Loricariinae are united by a long and flattened caudal peduncle and the absence of an adipose fin. Despite numerous studies of the Loricariidae, there is no comprehensive phylogeny of this morphologically highly diversified subfamily. To fill this gap, we present a molecular phylogeny of this group, including 350 representatives, based on the analysis of mitochondrial and nuclear genes (8426 positions). The resulting phylogeny indicates that Loricariinae are distributed into two sister tribes: Harttiini and Loricariini. The Harttiini tribe, as classically defined, constitutes a paraphyletic assemblage and is here restricted to the three genera Harttia, Cteniloricaria, and Harttiella. Two subtribes are distinguished within Loricariini: Farlowellina and Loricariina. Within Farlowellina, the nominal genus formed a paraphyletic group, as did Sturisoma and Sturisomatichthys. Within Loricariina, Loricaria, Crossoloricaria, and Apistoloricaria are also paraphyletic. To solve these issues, and given the lack of clear morphological diagnostic features, we propose here to synonymize several genera (Quiritixys with Harttia; East Andean members of Crossoloricaria, and Apistoloricaria with Rhadinoloricaria; Ixinandria, Hemiloricaria, Fonchiiichthys, and Leliella with Rineloricaria), to restrict others (Crossoloricaria, and Sturisomatichthys to the West Andean members, and Sturisoma to the East Andean species), and to revalidate the genus Proloricaria. Copyright © 2015 Elsevier Inc. All rights reserved.

In silico cloning and characterization of the TGA (TGACG MOTIF-BINDING FACTOR) transcription factors subfamily in Carica papaya.

PubMed

Idrovo Espín, Fabio Marcelo; Peraza-Echeverria, Santy; Fuentes, Gabriela; Santamaría, Jorge M

2012-05-01

The TGA transcription factors belong to the subfamily of bZIP group D that play a major role in disease resistance and development. Most of the TGA identified in Arabidopsis interact with the master regulator of SAR, NPR1 that controls the expression of PR genes. As a first approach to determine the possible involvement of these transcription factors in papaya defense, we characterized Arabidopsis TGA orthologs from the genome of Carica papaya cv. SunUp. Six orthologs CpTGA1 to CpTGA6, were identified. The predicted CpTGA proteins were highly similar to AtTGA sequences and probably share the same DNA binding properties and transcriptional regulation features. The protein sequences alignment evidenced the presence of conserved domains, characteristic of this group of transcription factors. The phylogeny showed that CpTGA evolved into three different subclades associated with defense and floral development. This is the first report of basal expression patterns assessed by RT-PCR, from the whole subfamily of CpTGA members in different tissues from papaya cv. Maradol mature plants. Overall, CpTGA1, CpTGA3 CpTGA6 and CpTGA4 showed a basal expression in all tissues tested; CpTGA2 expressed strongly in all tissues except in petioles while CpTGA5 expressed only in petals and to a lower extent in petioles. Although more detailed studies in anthers and other floral structures are required, we suggest that CpTGA5 might be tissue-specific, and it might be involved in papaya floral development. On the other hand, we report here for the first time, the expression of the whole family of CpTGA in response to salicylic acid (SA). The expression of CpTGA3, CpTGA4 and CpTGA6 increased in response to SA, what would suggest its involvement in the SAR response in papaya. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Identification and expression analysis of zebrafish polypeptide α-N-acetylgalactosaminyltransferase Y-subfamily genes during embryonic development.

PubMed

Nakayama, Yoshiaki; Nakamura, Naosuke; Kawai, Tamiko; Kaneda, Eiichi; Takahashi, Yui; Miyake, Ayumi; Itoh, Nobuyuki; Kurosaka, Akira

2014-09-01

Mucin-type glycosylation is one of the most common posttranslational modifications of secretory and membrane proteins and has diverse physiological functions. The initial biosynthesis of mucin-type carbohydrates is catalyzed by UDP-GalNAc: polypeptide α-N-acetylgalactosaminyltransferases (GalNAc-Ts) encoded by GALNT genes. Among these, GalNAc-T8, -T9, -T17, and -T18 form a characteristic subfamily called "Y-subfamily" and have no or very low in vitro transferase activities when assayed with typical mucin peptides as acceptor substrates. Although the Y-subfamily isozymes have been reported to be possibly involved in various diseases, their in vivo functions have not been reported. Here, we isolated zebrafish Y-subfamily galnt genes, and determined their spatial and temporal expressions during the early development of zebrafish. Our study demonstrated that all the Y-subfamily isozymes were well conserved in zebrafish with GalNAc-T18 having two orthologs, galnt18a and galnt18b, and with the other three isozymes each having a corresponding ortholog, galnt8, galnt9, and galnt17. The galnt8 was expressed in the cephalic mesoderm and hatching gland during early developmental stages, and differently expressed in the head, somatic muscles, and liver in the later stages. The other three orthologs also exhibited the characteristic expression patterns, although their expressions were generally strong in the nervous systems. In addition to the expression in the brain, galnt17 and galnt18a were expressed in the somitic muscles, and galnt18a and galnt18b in the notochord. These expression patterns may contribute to the functional analysis of the Y-subfamily, whose physiological roles still remain to be elucidated. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and characterization of mouse ACF7, a novel member of the dystonin subfamily of actin binding proteins.

PubMed

Bernier, G; Mathieu, M; De Repentigny, Y; Vidal, S M; Kothary, R

1996-11-15

We have recently cloned the gene responsible for the mouse neurological disorder dystonia musculorum. The predicted product of this gene, dystonin (Dst), is a neural isoform of bullous pemphigoid antigen 1 (Bpag1) with an N-terminal actin binding domain. Here we report on the cloning and characterization of mouse ACF7. Sequence analysis revealed extended homology of mACF7 with both the actin binding domain (ABD) and the Bpag1 portions of dystonin. Moreover, mACF7 and Dst display similar isoform diversity and encode similar sized transcripts in the nervous system. Phylogenetic analysis of mACF7 and dystonin ABD sequences suggests a recent evolutionary origin and that these proteins form a separate novel subfamily within the beta-spectrin superfamily of actin binding proteins. Given the implication of several actin binding proteins in genetic disorders, it is important to know the pattern of mACF7 expression. mACF7 transcripts are detected principally in lung, brain, spinal cord, skeletal and cardiac muscle, and skin. Intriguingly, mACF7 expression in lung is strongly induced just before birth and is restricted to type II alveolar cells. To determine whether spontaneous mutants that may be defective in mACF7 exist, we have mapped the mACF7 gene to mouse chromosome 4.

Analgesia and Opioids: A Pharmacogenetics Shortlist for Implementation in Clinical Practice.

PubMed

Matic, Maja; de Wildt, Saskia N; Tibboel, Dick; van Schaik, Ron H N

2017-07-01

The use of opioids to alleviate pain is complicated by the risk of severe adverse events and the large variability in dose requirements. Pharmacogenetics (PGx) could possibly be used to tailor pain medication based on an individual's genetic background. Many potential genetic markers have been described, and the importance of genetic predisposition in opioid efficacy and toxicity has been demonstrated in knockout mouse models and human twin studies. Such predictors are especially of value for neonates and young children, in whom the assessment of efficacy or side effects is complicated by the inability of the patient to communicate this properly. The current problem is determining which of the many potential candidates to focus on for clinical implementation. We systematically searched publications on PGx for opioids in 5 databases, aiming to identify PGx markers with sufficient robust data and high enough occurrence for potential clinical application. The initial search yielded 4257 unique citations, eventually resulting in 852 relevant articles covering 24 genes. From these genes, we evaluated the evidence and selected the most promising 10 markers: cytochrome P450 family 2 subfamily D member 6 ( CYP2D6 ), cytochrome P450 family 3 subfamily A member 4 ( CYP3A4 ), cytochrome P450 family 3 subfamily A member 5 ( CYP3A5 ), UDP glucuronosyltransferase family 2 member B7 ( UGT2B7 ), ATP binding cassette subfamily B member 1 ( ABCB1 ), ATP binding cassette subfamily C member 3 ( ABCC3 ), solute carrier family 22 member 1 ( SLC22A1 ), opioid receptor kappa 1 ( OPRM1 ), catechol- O -methyltransferase ( COMT ), and potassium voltage-gated channel subfamily J member 6 ( KCNJ6 ). Treatment guidelines based on genotype are already available only for CYP2D6 . The application of PGx in the management of pain with opioids has the potential to improve therapy. We provide a shortlist of 10 genes that are the most promising markers for clinical use in this context. © 2016

Functional characterization of type-B response regulators in the Arabidopsis cytokinin response.

PubMed

Hill, Kristine; Mathews, Dennis E; Kim, Hyo Jung; Street, Ian H; Wildes, Sarah L; Chiang, Yi-Hsuan; Mason, Michael G; Alonso, Jose M; Ecker, Joseph R; Kieber, Joseph J; Schaller, G Eric

2013-05-01

Cytokinins play critical roles in plant growth and development, with the transcriptional response to cytokinin being mediated by the type-B response regulators. In Arabidopsis (Arabidopsis thaliana), type-B response regulators (ARABIDOPSIS RESPONSE REGULATORS [ARRs]) form three subfamilies based on phylogenic analysis, with subfamily 1 having seven members and subfamilies 2 and 3 each having two members. Cytokinin responses are predominantly mediated by subfamily 1 members, with cytokinin-mediated effects on root growth and root meristem size correlating with type-B ARR expression levels. To determine which type-B ARRs can functionally substitute for the subfamily 1 members ARR1 or ARR12, we expressed different type-B ARRs from the ARR1 promoter and assayed their ability to rescue arr1 arr12 double mutant phenotypes. ARR1, as well as a subset of other subfamily 1 type-B ARRs, restore the cytokinin sensitivity to arr1 arr12. Expression of ARR10 from the ARR1 promoter results in cytokinin hypersensitivity and enhances shoot regeneration from callus tissue, correlating with enhanced stability of the ARR10 protein compared with the ARR1 protein. Examination of transfer DNA insertion mutants in subfamilies 2 and 3 revealed little effect on several well-characterized cytokinin responses. However, a member of subfamily 2, ARR21, restores cytokinin sensitivity to arr1 arr12 roots when expressed from the ARR1 promoter, indicating functional conservation of this divergent family member. Our results indicate that the type-B ARRs have diverged in function, such that some, but not all, can complement the arr1 arr12 mutant. In addition, our results indicate that type-B ARR expression profiles in the plant, along with posttranscriptional regulation, play significant roles in modulating their contribution to cytokinin signaling.

The mariner transposons belonging to the irritans subfamily were maintained in chordate genomes by vertical transmission.

PubMed

Sinzelle, Ludivine; Chesneau, Albert; Bigot, Yves; Mazabraud, André; Pollet, Nicolas

2006-01-01

Mariner-like elements (MLEs) belong to the Tc1-mariner superfamily of DNA transposons, which is very widespread in animal genomes. We report here the first complete description of a MLE, Xtmar1, within the genome of a poikilotherm vertebrate, the amphibian Xenopus tropicalis. A close relative, XlMLE, is also characterized within the genome of a sibling species, Xenopus laevis. The phylogenetic analysis of the relationships between MLE transposases reveals that Xtmar1 is closely related to Hsmar2 and Bytmar1 and that together they form a second distinct lineage of the irritans subfamily. All members of this lineage are also characterized by the 36- to 43-bp size of their imperfectly conserved inverted terminal repeats and by the -8-bp motif located at their outer extremity. Since XlMLE, Xlmar1, and Hsmar2 are present in species located at both extremities of the vertebrate evolutionary tree, we looked for MLE relatives belonging to the same subfamily in the available sequencing projects using the amino acid consensus sequence of the Hsmar2 transposase as an in silico probe. We found that irritans MLEs are present in chordate genomes including most craniates. This therefore suggests that these elements have been present within chordate genomes for 750 Myr and that the main way they have been maintained in these species has been via vertical transmission. The very small number of stochastic losses observed in the data available suggests that their inactivation during evolution has been very slow.

Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts.

PubMed

Asakura, Yukari; Bayraktar, Omer Ali; Barkan, Alice

2008-11-01

Chloroplast genomes in angiosperms encode approximately 20 group II introns, approximately half of which are classified as subgroup IIB. The splicing of all but one of the subgroup IIB introns requires a heterodimer containing the peptidyl-tRNA hydrolase homolog CRS2 and one of two closely related proteins, CAF1 or CAF2, that harbor a recently recognized RNA binding domain called the CRM domain. Two CRS2/CAF-dependent introns require, in addition, a CRM domain protein called CFM2 that is only distantly related to CAF1 and CAF2. Here, we show that CFM3, a close relative of CFM2, associates in vivo with those CRS2/CAF-dependent introns that are not CFM2 ligands. Mutant phenotypes in rice and Arabidopsis support a role for CFM3 in the splicing of most of the introns with which it associates. These results show that either CAF1 or CAF2 and either CFM2 or CFM3 simultaneously bind most chloroplast subgroup IIB introns in vivo, and that the CAF and CFM subunits play nonredundant roles in splicing. These results suggest that the expansion of the CRM protein family in plants resulted in two subfamilies that play different roles in group II intron splicing, with further diversification within a subfamily to accommodate multiple intron ligands.

PLU-1/JARID1B/KDM5B is required for embryonic survival and contributes to cell proliferation in the mammary gland and in ER+ breast cancer cells.

PubMed

Catchpole, Steven; Spencer-Dene, Bradley; Hall, Debbie; Santangelo, Samantha; Rosewell, Ian; Guenatri, Mounia; Beatson, Richard; Scibetta, Angelo G; Burchell, Joy M; Taylor-Papadimitriou, Joyce

2011-05-01

The four members of the JARID1/KDM5 family of proteins, a sub-group of the larger ARID (AT rich DNA binding domain) family, have been shown to demethylate trimethylated lysine 4 on histone 3 (H3K4me3), a chromatin mark associated with actively transcribed genes. In some lower organisms a single homologue of JARID1 is found, and functions of the four proteins found in mice and humans may be specific or overlapping. To investigate the function of the Jarid1B protein we examined the effects of deletion of the gene in mice. Systemic knock out of Jarid1b resulted in early embryonic lethality, whereas mice not expressing the related Jarid1A gene are viable and fertile. A second mouse strain expressing a Jarid1b gene with the ARID domain deleted was viable and fertile but displayed a mammary phenotype, where terminal end bud development and side branching was delayed at puberty and in early pregnancy. Since development of terminal end buds are completely dependent on signalling from the estrogen receptor (ERα), we investigated the expression of a target gene (progesterone receptor) in the ∆ARID mouse and found levels to be reduced as compared to wild-type. JARID1B is widely expressed in ER+ breast cancers and breast cancer cell lines, and interaction with ERα was demonstrated by co-immunoprecipitations in cells transfected with tagged ERα and JARID1B genes. Down-regulation of expression of JARID1B using shRNAi in MCF-7 cells resulted in a dramatic decrease in E2 stimulated tumour growth in nude mice. The data demonstrate a specific role for Jarid1B in early embryonic development, in the development and differentiation of the normal mammary gland, and in estrogen induced growth of ER+ breast cancer.

DNA Barcoding of the parasitoid wasp subfamily Doryctinae (Hymenoptera: Braconidae) from Chamela, Mexico.

PubMed

Gutiérrez-Arellano, Daniela; Gutiérrez-Arellano, Claudia Renata; Zaldívar-Riverón, Alejandro

2015-01-01

Background and aims. The Doryctinae is a considerably diverse, poorly studied group of parasitoid wasps and one of the most diverse subfamilies within Braconidae. Taxonomic knowledge of this group remains highly incomplete, specially in the tropics. In Mexico, it has been reported as the subfamily with the highest number of recorded genera. A preliminary Barcoding study carried out in the Chamela region, located near the Mexican pacific coast in Jalisco, identified 185 barcoding species of Dorytinae assigned to 19 identified doryctine genera. This work updates the later study, representing a three years effort to assess the species richness of this subfamily for the Chamela region. Materials and methods. Ten collecting field trips of 5 to 10 days each were carried out from June 2009 to May 2011. A 2% divergence criterion using the BIN system implemented in BOLD was followed in order to establish species boundaries among the specimens that were collected. Results and conclusions. A total of 961 specimens were collected, from which 883 COI sequences were obtained. The sequences generated corresponded to 289 barcoding species and 30 identified genera. The most speciose genera were Heterospilus Haliday (170 spp.), Ecphylus Förster (19 spp.), Allorhogas Gahan (15 spp.) and Callihormius Ashmead (14 spp.). Addition of previously collected material increased the diversity of the subfamily in the region to 34 genera and 290 species. Paraphyly of Heterospilus with respect to Neoheterospilus and Heterospathius was again recovered. Twenty new species and two new genera (Sabinita Belokobylskij, Zaldívar-Riverón et Martínez, Ficobolus Martínez, Belokobylskij et Zaldívar-Riverón) have been described so far from the material collected in this work.

Plastid phylogenomics of the cool-season grass subfamily: clarification of relationships among early-diverging tribes.

PubMed

Saarela, Jeffery M; Wysocki, William P; Barrett, Craig F; Soreng, Robert J; Davis, Jerrold I; Clark, Lynn G; Kelchner, Scot A; Pires, J Chris; Edger, Patrick P; Mayfield, Dustin R; Duvall, Melvin R

2015-05-04

Whole plastid genomes are being sequenced rapidly from across the green plant tree of life, and phylogenetic analyses of these are increasing resolution and support for relationships that have varied among or been unresolved in earlier single- and multi-gene studies. Pooideae, the cool-season grass lineage, is the largest of the 12 grass subfamilies and includes important temperate cereals, turf grasses and forage species. Although numerous studies of the phylogeny of the subfamily have been undertaken, relationships among some 'early-diverging' tribes conflict among studies, and some relationships among subtribes of Poeae have not yet been resolved. To address these issues, we newly sequenced 25 whole plastomes, which showed rearrangements typical of Poaceae. These plastomes represent 9 tribes and 11 subtribes of Pooideae, and were analysed with 20 existing plastomes for the subfamily. Maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) robustly resolve most deep relationships in the subfamily. Complete plastome data provide increased nodal support compared with protein-coding data alone at nodes that are not maximally supported. Following the divergence of Brachyelytrum, Phaenospermateae, Brylkinieae-Meliceae and Ampelodesmeae-Stipeae are the successive sister groups of the rest of the subfamily. Ampelodesmeae are nested within Stipeae in the plastome trees, consistent with its hybrid origin between a phaenospermatoid and a stipoid grass (the maternal parent). The core Pooideae are strongly supported and include Brachypodieae, a Bromeae-Triticeae clade and Poeae. Within Poeae, a novel sister group relationship between Phalaridinae and Torreyochloinae is found, and the relative branching order of this clade and Aveninae, with respect to an Agrostidinae-Brizinae clade, are discordant between MP and ML/BI trees. Maximum likelihood and Bayesian analyses strongly support Airinae and Holcinae as the successive sister groups of a Dactylidinae

Plastid phylogenomics of the cool-season grass subfamily: clarification of relationships among early-diverging tribes

PubMed Central

Saarela, Jeffery M.; Wysocki, William P.; Barrett, Craig F.; Soreng, Robert J.; Davis, Jerrold I.; Clark, Lynn G.; Kelchner, Scot A.; Pires, J. Chris; Edger, Patrick P.; Mayfield, Dustin R.; Duvall, Melvin R.

2015-01-01

Whole plastid genomes are being sequenced rapidly from across the green plant tree of life, and phylogenetic analyses of these are increasing resolution and support for relationships that have varied among or been unresolved in earlier single- and multi-gene studies. Pooideae, the cool-season grass lineage, is the largest of the 12 grass subfamilies and includes important temperate cereals, turf grasses and forage species. Although numerous studies of the phylogeny of the subfamily have been undertaken, relationships among some ‘early-diverging’ tribes conflict among studies, and some relationships among subtribes of Poeae have not yet been resolved. To address these issues, we newly sequenced 25 whole plastomes, which showed rearrangements typical of Poaceae. These plastomes represent 9 tribes and 11 subtribes of Pooideae, and were analysed with 20 existing plastomes for the subfamily. Maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) robustly resolve most deep relationships in the subfamily. Complete plastome data provide increased nodal support compared with protein-coding data alone at nodes that are not maximally supported. Following the divergence of Brachyelytrum, Phaenospermateae, Brylkinieae–Meliceae and Ampelodesmeae–Stipeae are the successive sister groups of the rest of the subfamily. Ampelodesmeae are nested within Stipeae in the plastome trees, consistent with its hybrid origin between a phaenospermatoid and a stipoid grass (the maternal parent). The core Pooideae are strongly supported and include Brachypodieae, a Bromeae–Triticeae clade and Poeae. Within Poeae, a novel sister group relationship between Phalaridinae and Torreyochloinae is found, and the relative branching order of this clade and Aveninae, with respect to an Agrostidinae–Brizinae clade, are discordant between MP and ML/BI trees. Maximum likelihood and Bayesian analyses strongly support Airinae and Holcinae as the successive sister groups of a

TRPV3 in Drug Development

PubMed Central

Broad, Lisa M.; Mogg, Adrian J.; Eberle, Elizabeth; Tolley, Marcia; Li, Dominic L.; Knopp, Kelly L.

2016-01-01

Transient receptor potential vanilloid 3 (TRPV3) is a member of the TRP (Transient Receptor Potential) super-family. It is a relatively underexplored member of the thermo-TRP sub-family (Figure 1), however, genetic mutations and use of gene knock-outs and selective pharmacological tools are helping to provide insights into its role and therapeutic potential. TRPV3 is highly expressed in skin, where it is implicated in skin physiology and pathophysiology, thermo-sensing and nociception. Gain of function TRPV3 mutations in rodent and man have enabled the role of TRPV3 in skin health and disease to be particularly well defined. Pre-clinical studies provide some rationale to support development of TRPV3 antagonists for therapeutic application for the treatment of inflammatory skin conditions, itch and pain. However, to date, only one compound directed towards block of the TRPV3 receptor (GRC15300) has progressed into clinical trials. Currently, there are no known clinical trials in progress employing a TRPV3 antagonist. PMID:27618069

Seed morphology and anatomy and its utility in recognizing subfamilies and tribes of Zingiberaceae.

PubMed

Benedict, John C; Smith, Selena Y; Collinson, Margaret E; Leong-Škorničková, Jana; Specht, Chelsea D; Marone, Federica; Xiao, Xianghui; Parkinson, Dilworth Y

2015-11-01

Recent phylogenetic analyses based on molecular data suggested that the monocot family Zingiberaceae be separated into four subfamilies and four tribes. Robust morphological characters to support these clades are lacking. Seeds were analyzed in a phylogenetic context to test independently the circumscription of clades and to better understand evolution of seed characters within Zingiberaceae. Seventy-five species from three of the four subfamilies were analyzed using synchrotron based x-ray tomographic microscopy (SRXTM) and scored for 39 morphoanatomical characters. Zingiberaceae seeds are some of the most structurally complex seeds in angiosperms. No single seed character was found to distinguish each subfamily, but combinations of characters were found to differentiate between the subfamilies. Recognition of the tribes based on seeds was possible for Globbeae, but not for Alpinieae, Riedelieae, or Zingibereae, due to considerable variation. SRXTM is an excellent, nondestructive tool to capture morphoanatomical variation of seeds and allows for the study of taxa with limited material available. Alpinioideae, Siphonochiloideae, Tamijioideae, and Zingiberoideae are well supported based on both molecular and morphological data, including multiple seed characters. Globbeae are well supported as a distinctive tribe within the Zingiberoideae, but no other tribe could be differentiated using seeds due to considerable homoplasy when compared with currently accepted relationships based on molecular data. Novel seed characters suggest tribal affinities for two currently unplaced Zingiberaceae taxa: Siliquamomum may be related to Riedelieae and Monolophus to Zingibereae, but further work is needed before formal revision of the family. © 2015 Botanical Society of America.

Seed morphology and anatomy and its utility in recognizing subfamilies and tribes of Zingiberaceae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benedict, John C.; Smith, Selena Y.; Collinson, Margaret E.

PREMISE OF THE STUDY: Recent phylogenetic analyses based on molecular data suggested that the monocot family Zingiberaceae be separated into four subfamilies and four tribes. Robust morphological characters to support these clades are lacking. Seeds were analyzed in a phylogenetic context to test independently the circumscription of clades and to better understand evolution of seed characters within Zingiberaceae. METHODS: Seventy-five species from three of the four subfamilies were analyzed using synchrotron based x-ray tomographic microscopy (SRXTM) and scored for 39 morphoanatomical characters. KEY RESULTS: Zingiberaceae seeds are some of the most structurally complex seeds in angiosperms. No single seed charactermore » was found to distinguish each subfamily, but combinations of characters were found to differentiate between the subfamilies. Recognition of the tribes based on seeds was possible for Globbeae, but not for Alpinieae, Riedelieae, or Zingibereae, due to considerable variation. CONCLUSIONS: SRXTM is an excellent, nondestructive tool to capture morphoanatomical variation of seeds and allows for the study of taxa with limited material available. Alpinioideae, Siphonochiloideae, Tamijioideae, and Zingiberoideae are well supported based on both molecular and morphological data, including multiple seed characters. Globbeae are well supported as a distinctive tribe within the Zingiberoideae, but no other tribe could be differentiated using seeds due to considerable homoplasy when compared with currently accepted relationships based on molecular data. Novel seed characters suggest tribal affinities for two currently unplaced Zingiberaceae taxa: Siliquamomum may be related to Riedelieae and Monolophus to Zingibereae, but further work is needed before formal revision of the family.« less

Relicts from Tertiary Australasia: undescribed families and subfamilies of songbirds (Passeriformes) and their zoogeographic signal.

PubMed

Schodde, Richard; Christidis, Les

2014-04-14

A number of hitherto unrecognized, deeply divergent taxa of Australasian songbirds have been revealed by DNA sequence studies in the last decade. Differentiation among them is at levels equivalent to family and subfamily rank among songbirds generally. Accordingly, the purpose of this paper is to name and describe eleven of them formally under Articles 13.1, 13.2, 16.1 and 16.2 of the International Code of Zoological Nomenclature so that they are made available for use in zoology. The taxa are: families Oreoicidae, Eulacestomatidae, Rhagologidae, Ifritidae and Melampittidae, and subfamilies Pachycareinae, Oreoscopinae, Toxorhamphinae, Oedistomatinae, Peltopsinae and Lamproliinae. The families to which the subfamilies belong are documented. Morphological and behavioural traits of the new family-group taxa are discussed; reasons for taxonomic rankings are summarized; and grounds for the geographic origin of corvoid songbirds, to which all the new families belong, are briefly addressed. One new genus,Megalampitta in Melampittidae, is also described.

Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

PubMed

Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

2015-12-29

GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

DNA Barcoding of the parasitoid wasp subfamily Doryctinae (Hymenoptera: Braconidae) from Chamela, Mexico

PubMed Central

Gutiérrez-Arellano, Daniela; Gutiérrez-Arellano, Claudia Renata

2015-01-01

Abstract Background and aims. The Doryctinae is a considerably diverse, poorly studied group of parasitoid wasps and one of the most diverse subfamilies within Braconidae. Taxonomic knowledge of this group remains highly incomplete, specially in the tropics. In Mexico, it has been reported as the subfamily with the highest number of recorded genera. A preliminary Barcoding study carried out in the Chamela region, located near the Mexican pacific coast in Jalisco, identified 185 barcoding species of Dorytinae assigned to 19 identified doryctine genera. This work updates the later study, representing a three years effort to assess the species richness of this subfamily for the Chamela region. Materials and methods. Ten collecting field trips of 5 to 10 days each were carried out from June 2009 to May 2011. A 2% divergence criterion using the BIN system implemented in BOLD was followed in order to establish species boundaries among the specimens that were collected. Results and conclusions. A total of 961 specimens were collected, from which 883 COI sequences were obtained. The sequences generated corresponded to 289 barcoding species and 30 identified genera. The most speciose genera were Heterospilus Haliday (170 spp.), Ecphylus Förster (19 spp.), Allorhogas Gahan (15 spp.) and Callihormius Ashmead (14 spp.). Addition of previously collected material increased the diversity of the subfamily in the region to 34 genera and 290 species. Paraphyly of Heterospilus with respect to Neoheterospilus and Heterospathius was again recovered. Twenty new species and two new genera (Sabinita Belokobylskij, Zaldívar-Riverón et Martínez, Ficobolus Martínez, Belokobylskij et Zaldívar-Riverón) have been described so far from the material collected in this work. PMID:26023287

Isofunctional Protein Subfamily Detection Using Data Integration and Spectral Clustering.

PubMed

Boari de Lima, Elisa; Meira, Wagner; Melo-Minardi, Raquel Cardoso de

2016-06-01

As increasingly more genomes are sequenced, the vast majority of proteins may only be annotated computationally, given experimental investigation is extremely costly. This highlights the need for computational methods to determine protein functions quickly and reliably. We believe dividing a protein family into subtypes which share specific functions uncommon to the whole family reduces the function annotation problem's complexity. Hence, this work's purpose is to detect isofunctional subfamilies inside a family of unknown function, while identifying differentiating residues. Similarity between protein pairs according to various properties is interpreted as functional similarity evidence. Data are integrated using genetic programming and provided to a spectral clustering algorithm, which creates clusters of similar proteins. The proposed framework was applied to well-known protein families and to a family of unknown function, then compared to ASMC. Results showed our fully automated technique obtained better clusters than ASMC for two families, besides equivalent results for other two, including one whose clusters were manually defined. Clusters produced by our framework showed great correspondence with the known subfamilies, besides being more contrasting than those produced by ASMC. Additionally, for the families whose specificity determining positions are known, such residues were among those our technique considered most important to differentiate a given group. When run with the crotonase and enolase SFLD superfamilies, the results showed great agreement with this gold-standard. Best results consistently involved multiple data types, thus confirming our hypothesis that similarities according to different knowledge domains may be used as functional similarity evidence. Our main contributions are the proposed strategy for selecting and integrating data types, along with the ability to work with noisy and incomplete data; domain knowledge usage for detecting

Isofunctional Protein Subfamily Detection Using Data Integration and Spectral Clustering

PubMed Central

Boari de Lima, Elisa; Meira, Wagner; de Melo-Minardi, Raquel Cardoso

2016-01-01

As increasingly more genomes are sequenced, the vast majority of proteins may only be annotated computationally, given experimental investigation is extremely costly. This highlights the need for computational methods to determine protein functions quickly and reliably. We believe dividing a protein family into subtypes which share specific functions uncommon to the whole family reduces the function annotation problem’s complexity. Hence, this work’s purpose is to detect isofunctional subfamilies inside a family of unknown function, while identifying differentiating residues. Similarity between protein pairs according to various properties is interpreted as functional similarity evidence. Data are integrated using genetic programming and provided to a spectral clustering algorithm, which creates clusters of similar proteins. The proposed framework was applied to well-known protein families and to a family of unknown function, then compared to ASMC. Results showed our fully automated technique obtained better clusters than ASMC for two families, besides equivalent results for other two, including one whose clusters were manually defined. Clusters produced by our framework showed great correspondence with the known subfamilies, besides being more contrasting than those produced by ASMC. Additionally, for the families whose specificity determining positions are known, such residues were among those our technique considered most important to differentiate a given group. When run with the crotonase and enolase SFLD superfamilies, the results showed great agreement with this gold-standard. Best results consistently involved multiple data types, thus confirming our hypothesis that similarities according to different knowledge domains may be used as functional similarity evidence. Our main contributions are the proposed strategy for selecting and integrating data types, along with the ability to work with noisy and incomplete data; domain knowledge usage for detecting

Novel triterpene oxidizing activity of Arabidopsis thaliana CYP716A subfamily enzymes.

PubMed

Yasumoto, Shuhei; Fukushima, Ery O; Seki, Hikaru; Muranaka, Toshiya

2016-02-01

Triterpenoids have diverse chemical structures and bioactivities. Cytochrome P450 monooxygenases play a key role in their structural diversification. In higher plants, CYP716A subfamily enzymes are triterpene oxidases. In this study, Arabidopsis thaliana CYP716A1 and CYP716A2 were characterized by heterologously expressing them in simple triterpene-producing yeast strains. In contrast to the C-28 oxidative activity of CYP716A1 shown in several CYP716A subfamily enzymes, remarkably, CYP716A2 displayed 22α-hydroxylation activity against α-amyrin that has not been previously reported, which produces the cytotoxic triterpenoid, 22α-hydroxy-α-amyrin. Our results contribute to the enrichment of the molecular toolbox that allows for the combinatorial biosynthesis of diverse triterpenoids. © 2016 Federation of European Biochemical Societies.

The effects of IL-20 subfamily cytokines on reconstituted human epidermis suggest potential roles in cutaneous innate defense and pathogenic adaptive immunity in psoriasis.

PubMed

Sa, Susan M; Valdez, Patricia A; Wu, Jianfeng; Jung, Kenneth; Zhong, Fiona; Hall, Linda; Kasman, Ian; Winer, Jane; Modrusan, Zora; Danilenko, Dimitry M; Ouyang, Wenjun

2007-02-15

IL-19, IL-20, IL-22, IL-24, and IL-26 are members of the IL-10 family of cytokines that have been shown to be up-regulated in psoriatic skin. Contrary to IL-10, these cytokines signal using receptor complex R1 subunits that are preferentially expressed on cells of epithelial origin; thus, we henceforth refer to them as the IL-20 subfamily cytokines. In this study, we show that primary human keratinocytes (KCs) express receptors for these cytokines and that IL-19, IL-20, IL-22, and IL-24 induce acanthosis in reconstituted human epidermis (RHE) in a dose-dependent manner. These cytokines also induce expression of the psoriasis-associated protein S100A7 and keratin 16 in RHE and cause persistent activation of Stat3 with nuclear localization. IL-22 had the most pronounced effects on KC proliferation and on the differentiation of KCs in RHE, inducing a decrease in the granular cell layer (hypogranulosis). Furthermore, gene expression analysis performed on cultured RHE treated with these cytokines showed that IL-19, IL-20, IL-22, and IL-24 regulate many of these same genes to variable degrees, inducing a gene expression profile consistent with inflammatory responses, wound healing re-epithelialization, and altered differentiation. Many of these genes have also been found to be up-regulated in psoriatic skin, including several chemokines, beta-defensins, S100 family proteins, and kallikreins. These results confirm that IL-20 subfamily cytokines are important regulators of epidermal KC biology with potentially pivotal roles in the immunopathology of psoriasis.

Modelling and mutational analysis of Aspergillus nidulans UreA, a member of the subfamily of urea/H+ transporters in fungi and plants

PubMed Central

Sanguinetti, Manuel; Amillis, Sotiris; Pantano, Sergio; Scazzocchio, Claudio; Ramón, Ana

2014-01-01

We present the first account of the structure–function relationships of a protein of the subfamily of urea/H+ membrane transporters of fungi and plants, using Aspergillus nidulans UreA as a study model. Based on the crystal structures of the Vibrio parahaemolyticus sodium/galactose symporter (vSGLT) and of the Nucleobase-Cation-Symport-1 benzylhydantoin transporter from Microbacterium liquefaciens (Mhp1), we constructed a three-dimensional model of UreA which, combined with site-directed and classical random mutagenesis, led to the identification of amino acids important for UreA function. Our approach allowed us to suggest roles for these residues in the binding, recognition and translocation of urea, and in the sorting of UreA to the membrane. Residues W82, Y106, A110, T133, N275, D286, Y388, Y437 and S446, located in transmembrane helixes 2, 3, 7 and 11, were found to be involved in the binding, recognition and/or translocation of urea and the sorting of UreA to the membrane. Y106, A110, T133 and Y437 seem to play a role in substrate selectivity, while S446 is necessary for proper sorting of UreA to the membrane. Other amino acids identified by random classical mutagenesis (G99, R141, A163, G168 and P639) may be important for the basic transporter's structure, its proper folding or its correct traffic to the membrane. PMID:24966243

Soybean (Glycine max) expansin gene superfamily origins: segmental and tandem duplication events followed by divergent selection among subfamilies

PubMed Central

2014-01-01

Background Expansins are plant cell wall loosening proteins that are involved in cell enlargement and a variety of other developmental processes. The expansin superfamily contains four subfamilies; namely, α-expansin (EXPA), β-expansin (EXPB), expansin-like A (EXLA), and expansin-like B (EXLB). Although the genome sequencing of soybeans is complete, our knowledge about the pattern of expansion and evolutionary history of soybean expansin genes remains limited. Results A total of 75 expansin genes were identified in the soybean genome, and grouped into four subfamilies based on their phylogenetic relationships. Structural analysis revealed that the expansin genes are conserved in each subfamily, but are divergent among subfamilies. Furthermore, in soybean and Arabidopsis, the expansin gene family has been mainly expanded through tandem and segmental duplications; however, in rice, segmental duplication appears to be the dominant process that generates this superfamily. The transcriptome atlas revealed notable differential expression in either transcript abundance or expression patterns under normal growth conditions. This finding was consistent with the differential distribution of the cis-elements in the promoter region, and indicated wide functional divergence in this superfamily. Moreover, some critical amino acids that contribute to functional divergence and positive selection were detected. Finally, site model and branch-site model analysis of positive selection indicated that the soybean expansin gene superfamily is under strong positive selection, and that divergent selection constraints might have influenced the evolution of the four subfamilies. Conclusion This study demonstrated that the soybean expansin gene superfamily has expanded through tandem and segmental duplication. Differential expression indicated wide functional divergence in this superfamily. Furthermore, positive selection analysis revealed that divergent selection constraints might have

Regulation of protease-activated receptor 1 signaling by the adaptor protein complex 2 and R4 subfamily of regulator of G protein signaling proteins.

PubMed

Chen, Buxin; Siderovski, David P; Neubig, Richard R; Lawson, Mark A; Trejo, Joann

2014-01-17

The G protein-coupled protease-activated receptor 1 (PAR1) is irreversibly proteolytically activated by thrombin. Hence, the precise regulation of PAR1 signaling is important for proper cellular responses. In addition to desensitization, internalization and lysosomal sorting of activated PAR1 are critical for the termination of signaling. Unlike most G protein-coupled receptors, PAR1 internalization is mediated by the clathrin adaptor protein complex 2 (AP-2) and epsin-1, rather than β-arrestins. However, the function of AP-2 and epsin-1 in the regulation of PAR1 signaling is not known. Here, we report that AP-2, and not epsin-1, regulates activated PAR1-stimulated phosphoinositide hydrolysis via two different mechanisms that involve, in part, a subset of R4 subfamily of "regulator of G protein signaling" (RGS) proteins. A significantly greater increase in activated PAR1 signaling was observed in cells depleted of AP-2 using siRNA or in cells expressing a PAR1 (420)AKKAA(424) mutant with defective AP-2 binding. This effect was attributed to AP-2 modulation of PAR1 surface expression and efficiency of G protein coupling. We further found that ectopic expression of R4 subfamily members RGS2, RGS3, RGS4, and RGS5 reduced activated PAR1 wild-type signaling, whereas signaling by the PAR1 AKKAA mutant was minimally affected. Intriguingly, siRNA-mediated depletion analysis revealed a function for RGS5 in the regulation of signaling by the PAR1 wild type but not the AKKAA mutant. Moreover, activation of the PAR1 wild type, and not the AKKAA mutant, induced Gαq association with RGS3 via an AP-2-dependent mechanism. Thus, AP-2 regulates activated PAR1 signaling by altering receptor surface expression and through recruitment of RGS proteins.

A conserved human DJ1-subfamily motif (DJSM) is critical for anti-oxidative and deglycase activities of Plasmodium falciparum DJ1.

PubMed

Nair, Divya N; Prasad, Rajesh; Singhal, Neha; Bhattacharjee, Manish; Sudhakar, Renu; Singh, Pushpa; Thanumalayan, Subramonian; Kiran, Uday; Sharma, Yogendra; Sijwali, Puran Singh

2018-06-01

Plasmodium falciparum DJ1 (PfDJ1) belongs to the DJ-1/ThiJ/PfpI superfamily whose members are present in all the kingdoms of life and exhibit diverse cellular functions and biochemical activities. The common feature of the superfamily is the class I glutamine amidotransferase domain with a conserved redox-active cysteine residue, which mediates various activities of the superfamily members, including anti-oxidative activity in PfDJ1 and human DJ1 (hDJ1). As the superfamily members represent diverse functional classes, to investigate if there is any sequence feature unique to hDJ1-like proteins, sequences of the representative proteins of different functional classes were compared and analysed. A novel motif unique to PfDJ1 and several other hDJ1-like proteins, with the consensus sequence of TSXGPX5FXLX5L, was identified that we designated as the hDJ1-subfamily motif (DJSM). Several mutations that have been associated with Parkinson's disease are also present in DJSM, suggesting its functional importance in hDJ1-like proteins. Mutations of the conserved residues of DJSM of PfDJ1 did not significantly affect overall secondary structure, but caused both a significant loss (S151A and P154A) and gain (L168A) of anti-oxidative activity. We also report that PfDJ1 has deglycase activity, which was significantly decreased in its mutants of the catalytic cysteine (C106A) and DJSM (S151A and P154A). Episomal expression of the catalytic cysteine (C106A) or DJSM (P154A) mutant decreased growth rates of parasites as compared to that of wild type parasites or parasites expressing wild type PfDJ1. S151 appears to properly position the nucleophilic elbow containing C106 and P154 forms a hydrogen bond with C106, which could be a reason for the loss of activities of PfDJ1 upon their mutations. Taken together, DJSM delineates PfDJ1 and other hDJ1-subfamily proteins from the remaining superfamily, and is critical for anti-oxidative and deglycase activities of PfDJ1. Copyright © 2018

Unrelated sequences at the 5' end of mouse LINE-1 repeated elements define two distinct subfamilies.

PubMed Central

Wincker, P; Jubier-Maurin, V; Roizès, G

1987-01-01

Some full length members of the mouse long interspersed repeated DNA family L1Md have been shown to be associated at their 5' end with a variable number of tandem repetitions, the A repeats, that have been suggested to be transcription controlling elements. We report that the other type of repeat, named F, found at the 5' end of a few L1 elements is also an integral part of full length L1 copies. Sequencing shows that the F repeats are GC rich, and organized in tandem. The L1 copies associated with either A or F repeats can be correlated with two different subsets of L1 sequences distinguished by a series of variant nucleotides specific to each and by unassociated but frequent restriction sites. These findings suggest that sequence replacement has occurred at least once in 5' of L1Md, and is related to the generation of specific subfamilies. Images PMID:3684566

Ancient Complexity, Opisthokont Plasticity, and Discovery of the 11th Subfamily of Arf GAP Proteins

PubMed Central

Schlacht, Alexander; Mowbrey, Kevin; Elias, Marek; Kahn, Richard A.; Dacks, Joel B.

2013-01-01

The organelle paralogy hypothesis is one model for the acquisition of non-endosymbiotic organelles, generated from molecular evolutionary analyses of proteins encoding specificity in the membrane traffic system. GTPase Activating Proteins (GAPs) for the ADP-ribosylation factor (Arfs) GTPases are additional regulators of the kinetics and fidelity of membrane traffic. Here we describe molecular evolutionary analyses of Arf GAP protein family. Of the ten subfamilies previously defined in humans, we find that five were likely present in the Last Eukaryotic Common Ancestor (LECA). Of the three more recently derived subfamilies, one was likely present in the ancestor of opisthokonts (animals and fungi) and apusomonads (flagellates classified as the sister lineage to opisthokonts), while two arose in the holozoan lineage. We also propose to have identified a novel ancient subfamily (ArfGAPC2), present in diverse eukaryotes but which is lost frequently, including in the opisthokonts. Surprisingly few ancient domains accompanying the ArfGAP domain were identified, in marked contrast to the extensively decorated human Arf GAPs. Phylogenetic analyses of the subfamilies reveal patterns of single and multiple gene duplications specific to the Holozoa, to some degree mirroring evolution of Arf GAP targets, the Arfs. Conservation, and lack thereof, of various residues in the ArfGAP structure provide contextualization of previously identified functional amino acids and their application to Arf GAP biology in general. Overall, our results yield insights into current Arf GAP biology, reveal complexity in the ancient eukaryotic ancestor, and integrate the Arf GAP family into a proposed mechanism for the evolution of non-endosymbiotic organelles. PMID:23433073

Two new subfamilies of DNA mismatch repair proteins (MutS) specifically abundant in the marine environment

PubMed Central

Ogata, Hiroyuki; Ray, Jessica; Toyoda, Kensuke; Sandaa, Ruth-Anne; Nagasaki, Keizo; Bratbak, Gunnar; Claverie, Jean-Michel

2011-01-01

MutS proteins are ubiquitous in cellular organisms and have important roles in DNA mismatch repair or recombination. In the virus world, the amoeba-infecting Mimivirus, as well as the recently sequenced Cafeteria roenbergensis virus are known to encode a MutS related to the homologs found in octocorals and ɛ-proteobacteria. To explore the presence of MutS proteins in other viral genomes, we performed a genomic survey of four giant viruses (‘giruses') (Pyramimonas orientalis virus (PoV), Phaeocystis pouchetii virus (PpV), Chrysochromulina ericina virus (CeV) and Heterocapsa circularisquama DNA virus (HcDNAV)) that infect unicellular marine algae. Our analysis revealed the presence of a close homolog of Mimivirus MutS in all the analyzed giruses. These viral homologs possess a specific domain structure, including a C-terminal HNH-endonuclease domain, defining the new MutS7 subfamily. We confirmed the presence of conserved mismatch recognition residues in all members of the MutS7 subfamily, suggesting their role in DNA mismatch repair rather than DNA recombination. PoV and PpV were found to contain an additional type of MutS, which we propose to call MutS8. The MutS8 proteins in PoV and PpV were found to be closely related to homologs from ‘Candidatus Amoebophilus asiaticus', an obligate intracellular amoeba-symbiont belonging to the Bacteroidetes. Furthermore, our analysis revealed that MutS7 and MutS8 are abundant in marine microbial metagenomes and that a vast majority of these environmental sequences are likely of girus origin. Giruses thus seem to represent a major source of the underexplored diversity of the MutS family in the microbial world. PMID:21248859

The reprogramming factor nuclear receptor subfamily 5, group A, member 2 cannot replace octamer-binding transcription factor 4 function in the self-renewal of embryonic stem cells.

PubMed

Choi, Kyeng-Won; Oh, Hye-Rim; Lee, Jaeyoung; Lim, Bobae; Han, Yong-Mahn; Oh, Junseo; Kim, Jungho

2014-02-01

Although octamer-binding transcription factor 4 (Oct-4) is one of the most intensively studied factors in mammalian development, no cellular genes capable of replacing Oct-4 function in embryonic stem (ES) cells have been found. Recent data show that nuclear receptor subfamily 5, group A, member 2 (Nr5a2) is able to replace Oct-4 function in the reprogramming process; however, it is unclear whether Nr5a2 can replace Oct-4 function in ES cells. In this study, the ability of Nr5a2 to maintain self-renewal and pluripotency in ES cells was investigated. Nr5a2 localized to the nucleus in ES cells, similarly to Oct-4. However, expression of Nr5a2 failed to rescue the stem cell phenotype or to maintain the self-renewal ability of ES cells. Furthermore, as compared with Oct-4-expressing ES cells, Nr5a2-expressing ES cells showed a reduced number of cells in S-phase, did not expand normally, and did not remain in an undifferentiated state. Ectopic expression of Nr5a2 in ES cells was not able to activate transcription of ES cell-specific genes, and gene expression profiling demonstrated differences between Nr5a2-expressing and Oct-4-expressing ES cells. In addition, Nr5a2-expressing ES cells were not able to form teratomas in nude mice. Taken together, these results strongly suggest that the gene regulation properties of Nr5a2 and Oct-4 and their abilities to confer self-renewal and pluripotency of ES cells differ. The present study provides strong evidence that Nr5a2 cannot replace Oct-4 function in ES cells. © 2013 FEBS.

The Exiguobacterium sibiricum 255-15 GtfC Enzyme Represents a Novel Glycoside Hydrolase 70 Subfamily of 4,6-α-Glucanotransferase Enzymes.

PubMed

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

2016-01-15

The glycoside hydrolase 70 (GH70) family originally was established for glucansucrase enzymes found solely in lactic acid bacteria synthesizing α-glucan polysaccharides from sucrose (e.g., GtfA). In recent years, we have characterized GtfB and related Lactobacillus enzymes as 4,6-α-glucanotransferase enzymes. These GtfB-type enzymes constitute the first GH70 subfamily of enzymes that are unable to act on sucrose as a substrate but are active with maltodextrins and starch, cleave α1→4 linkages, and synthesize linear α1→6-glucan chains. The GtfB disproportionating type of activity results in the conversion of malto-oligosaccharides into isomalto/malto-polysaccharides with a relatively high percentage of α1→6 linkages. This paper reports the identification of the members of a second GH70 subfamily (designated GtfC enzymes) and the characterization of the Exiguobacterium sibiricum 255-15 GtfC enzyme, which is also inactive with sucrose and displays 4,6-α-glucanotransferase activity with malto-oligosaccharides. GtfC differs from GtfB in synthesizing isomalto/malto-oligosaccharides. Biochemically, the GtfB- and GtfC-type enzymes are related, but phylogenetically, they clearly constitute different GH70 subfamilies, displaying only 30% sequence identity. Whereas the GtfB-type enzyme largely has the same domain order as glucansucrases (with α-amylase domains A, B, and C plus domains IV and V), this GtfC-type enzyme differs in the order of these domains and completely lacks domain V. In GtfC, the sequence of conserved regions I to IV of clan GH-H is identical to that in GH13 (I-II-III-IV) but different from that in GH70 (II-III-IV-I because of a circular permutation of the (β/α)8 barrel. The GtfC 4,6-α-glucanotransferase enzymes thus represent structurally and functionally very interesting evolutionary intermediates between α-amylase and glucansucrase enzymes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

The Atypical Response Regulator Protein ChxR Has Structural Characteristics and Dimer Interface Interactions That Are Unique within the OmpR/PhoB Subfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hickey, John M.; Lovell, Scott; Battaile, Kevin P.

2013-05-29

Typically as a result of phosphorylation, OmpR/PhoB response regulators form homodimers through a receiver domain as an integral step in transcriptional activation. Phosphorylation stabilizes the ionic and hydrophobic interactions between monomers. Recent studies have shown that some response regulators retain functional activity in the absence of phosphorylation and are termed atypical response regulators. The two currently available receiver domain structures of atypical response regulators are very similar to their phospho-accepting homologs, and their propensity to form homodimers is generally retained. An atypical response regulator, ChxR, from Chlamydia trachomatis, was previously reported to form homodimers; however, the residues critical to thismore » interaction have not been elucidated. We hypothesize that the intra- and intermolecular interactions involved in forming a transcriptionally competent ChxR are distinct from the canonical phosphorylation (activation) paradigm in the OmpR/PhoB response regulator subfamily. To test this hypothesis, structural and functional studies were performed on the receiver domain of ChxR. Two crystal structures of the receiver domain were solved with the recently developed method using triiodo compound I3C. These structures revealed many characteristics unique to OmpR/PhoB subfamily members: typical or atypical. Included was the absence of two {alpha}-helices present in all other OmpR/PhoB response regulators. Functional studies on various dimer interface residues demonstrated that ChxR forms relatively stable homodimers through hydrophobic interactions, and disruption of these can be accomplished with the introduction of a charged residue within the dimer interface. A gel shift study with monomeric ChxR supports that dimerization through the receiver domain is critical for interaction with DNA.« less

Lysine-specific demethylase 2A expression is associated with cell growth and cyclin D1 expression in colorectal adenocarcinoma.

PubMed

Cao, Lin-Lin; Du, Changzheng; Liu, Hangqi; Pei, Lin; Qin, Li; Jia, Mei; Wang, Hui

2018-04-01

Lysine-specific demethylase 2A (KDM2A), a specific H3K36me1/2 demethylase, has been reported to be closely associated with several types of cancer. In this study, we aimed to investigate the expression and function of KDM2A in colorectal adenocarcinoma. A total of 215 colorectal adenocarcinoma specimens were collected, and then subjected to immunohistochemistry assay to evaluate the expression levels of KDM2A, cyclin D1 and other proteins in colorectal adenocarcinoma tissues. Real-time polymerase chain reaction, Western blot, and other molecular biology methods were used to explore the role of KDM2A in colorectal adenocarcinoma cells. In this study, we report that the expression level of KDM2A is high in colorectal adenocarcinoma tissues, and this high expression promotes the proliferation and colony formation of colorectal adenocarcinoma cells, as demonstrated by KDM2A knockdown experiments. In addition, the expression of KDM2A is closely associated with cyclin D1 expression in colorectal adenocarcinoma tissues and cell lines. Our study reveals a novel role for high-expressed KDM2A in colorectal adenocarcinoma cell growth, and that the expression of KDM2A is associated with that of cyclin D1 in colorectal adenocarcinoma.

The histone demethylase Fbxl11/Kdm2a plays an essential role in embryonic development by repressing cell-cycle regulators.

PubMed

Kawakami, Eri; Tokunaga, Akinori; Ozawa, Manabu; Sakamoto, Reiko; Yoshida, Nobuaki

2015-02-01

Methylation and de-methylation of histone lysine residues play pivotal roles in mammalian early development; these modifications influence chromatin architecture and regulate gene transcription. Fbxl11 (F-box and leucine-rich repeat 11)/Kdm2a is a histone demethylase that selectively removes mono- and di-methylation from histone H3K36. Previously, two other histone H3K36 demethylases (Jmjd5 or Fbxl10) were analyzed based on the phenotypes of the corresponding knockout (KO) mice; the results of those studies implicated H3K36 demethylases in cell proliferation, apoptosis, and senescence (Fukuda et al., 2011; Ishimura et al., 2012). To elucidate the physiological role of Fbxl11, we generated and examined Fbxl11 KO mice. Fbxl11 was expressed throughout the body during embryogenesis, and the Fbxl11 KO mice exhibited embryonic lethality at E10.5-12.5, accompanied with severe growth defects leading to reduced body size. Furthermore, knockout of Fbxl11 decreased cell proliferation and increased apoptosis. The lack of Fbxl11 resulted in downregulation of the Polycomb group protein (PcG) Ezh2, PcG mediated H2A ubiquitination and upregulation of the cyclin-dependent kinase inhibitor p21Cip1. Taken together, our findings suggest that Fbxl11 plays an essential role in embryonic development and homeostasis by regulating cell proliferation and survival. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Prevalent Exon-Intron Structural Changes in the APETALA1/FRUITFULL, SEPALLATA, AGAMOUS-LIKE6, and FLOWERING LOCUS C MADS-Box Gene Subfamilies Provide New Insights into Their Evolution

PubMed Central

Yu, Xianxian; Duan, Xiaoshan; Zhang, Rui; Fu, Xuehao; Ye, Lingling; Kong, Hongzhi; Xu, Guixia; Shan, Hongyan

2016-01-01

AP1/FUL, SEP, AGL6, and FLC subfamily genes play important roles in flower development. The phylogenetic relationships among them, however, have been controversial, which impedes our understanding of the origin and functional divergence of these genes. One possible reason for the controversy may be the problems caused by changes in the exon-intron structure of genes, which, according to recent studies, may generate non-homologous sites and hamper the homology-based sequence alignment. In this study, we first performed exon-by-exon alignments of these and three outgroup subfamilies (SOC1, AG, and STK). Phylogenetic trees reconstructed based on these matrices show improved resolution and better congruence with species phylogeny. In the context of these phylogenies, we traced evolutionary changes of exon-intron structures in each subfamily. We found that structural changes have occurred frequently following gene duplication and speciation events. Notably, exons 7 and 8 (if present) suffered more structural changes than others. With the knowledge of exon-intron structural changes, we generated more reasonable alignments containing all the focal subfamilies. The resulting trees showed that the SEP subfamily is sister to the monophyletic group formed by AP1/FUL and FLC subfamily genes and that the AGL6 subfamily forms a sister group to the three abovementioned subfamilies. Based on this topology, we inferred the evolutionary history of exon-intron structural changes among different subfamilies. Particularly, we found that the eighth exon originated before the divergence of AP1/FUL, FLC, SEP, and AGL6 subfamilies and degenerated in the ancestral FLC-like gene. These results provide new insights into the origin and evolution of the AP1/FUL, FLC, SEP, and AGL6 subfamilies. PMID:27200066

A single amino acid substitution in IIIf subfamily of basic helix-loop-helix transcription factor AtMYC1 leads to trichome and root hair patterning defects by abolishing its interaction with partner proteins in Arabidopsis.

PubMed

Zhao, Hongtao; Wang, Xiaoxue; Zhu, Dandan; Cui, Sujuan; Li, Xia; Cao, Ying; Ma, Ligeng

2012-04-20

Plant trichomes and root hairs are powerful models for the study of cell fate determination. In Arabidopsis thaliana, trichome and root hair initiation requires a combination of three groups of proteins, including the WD40 repeat protein transparent TESTA GLABRA1 (TTG1), R2R3 repeat MYB protein GLABRA1 (GL1), or werewolf (WER) and the IIIf subfamily of basic helix-loop-helix (bHLH) protein GLABRA3 (GL3) or enhancer of GLABRA3 (EGL3). The bHLH component acts as a docking site for TTG1 and MYB proteins. Here, we isolated a mutant showing defects in trichome and root hair patterning that carried a point mutation (R173H) in AtMYC1 that encodes the fourth member of IIIf bHLH family protein. Genetic analysis revealed partial redundant yet distinct function between AtMYC1 and GL3/EGL3. GLABRA2 (GL2), an important transcription factor involved in trichome and root hair control, was down-regulated in Atmyc1 plants, suggesting the requirement of AtMYC1 for appropriate GL2 transcription. Like its homologs, AtMYC1 formed a complex with TTG1 and MYB proteins but did not dimerized. In addition, the interaction of AtMYC1 with MYB proteins and TTG1 was abrogated by the R173H substitution in Atmyc1-1. We found that this amino acid (Arg) is conserved in the AtMYC1 homologs GL3/EGL3 and that it is essential for their interaction with MYB proteins and for their proper functions. Our findings indicate that AtMYC1 is an important regulator of trichome and root hair initiation, and they reveal a novel amino acid necessary for protein-protein interactions and gene function in IIIf subfamily bHLH transcription factors.

A Single Amino Acid Substitution in IIIf Subfamily of Basic Helix-Loop-Helix Transcription Factor AtMYC1 Leads to Trichome and Root Hair Patterning Defects by Abolishing Its Interaction with Partner Proteins in Arabidopsis*

PubMed Central

Zhao, Hongtao; Wang, Xiaoxue; Zhu, Dandan; Cui, Sujuan; Li, Xia; Cao, Ying; Ma, Ligeng

2012-01-01

Plant trichomes and root hairs are powerful models for the study of cell fate determination. In Arabidopsis thaliana, trichome and root hair initiation requires a combination of three groups of proteins, including the WD40 repeat protein TRANSPARENT TESTA GLABRA1 (TTG1), R2R3 repeat MYB protein GLABRA1 (GL1), or WEREWOLF (WER) and the IIIf subfamily of basic helix-loop-helix (bHLH) protein GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). The bHLH component acts as a docking site for TTG1 and MYB proteins. Here, we isolated a mutant showing defects in trichome and root hair patterning that carried a point mutation (R173H) in AtMYC1 that encodes the fourth member of IIIf bHLH family protein. Genetic analysis revealed partial redundant yet distinct function between AtMYC1 and GL3/EGL3. GLABRA2 (GL2), an important transcription factor involved in trichome and root hair control, was down-regulated in Atmyc1 plants, suggesting the requirement of AtMYC1 for appropriate GL2 transcription. Like its homologs, AtMYC1 formed a complex with TTG1 and MYB proteins but did not dimerized. In addition, the interaction of AtMYC1 with MYB proteins and TTG1 was abrogated by the R173H substitution in Atmyc1-1. We found that this amino acid (Arg) is conserved in the AtMYC1 homologs GL3/EGL3 and that it is essential for their interaction with MYB proteins and for their proper functions. Our findings indicate that AtMYC1 is an important regulator of trichome and root hair initiation, and they reveal a novel amino acid necessary for protein-protein interactions and gene function in IIIf subfamily bHLH transcription factors. PMID:22334670

The draft genome of the C3 panicoid grass species Dichanthelium oligosanthes.

PubMed

Studer, Anthony J; Schnable, James C; Weissmann, Sarit; Kolbe, Allison R; McKain, Michael R; Shao, Ying; Cousins, Asaph B; Kellogg, Elizabeth A; Brutnell, Thomas P

2016-10-28

Comparisons between C 3 and C 4 grasses often utilize C 3 species from the subfamilies Ehrhartoideae or Pooideae and C 4 species from the subfamily Panicoideae, two clades that diverged over 50 million years ago. The divergence of the C 3 panicoid grass Dichanthelium oligosanthes from the independent C 4 lineages represented by Setaria viridis and Sorghum bicolor occurred approximately 15 million years ago, which is significantly more recent than members of the Bambusoideae, Ehrhartoideae, and Pooideae subfamilies. D. oligosanthes is ideally placed within the panicoid clade for comparative studies of C 3 and C 4 grasses. We report the assembly of the nuclear and chloroplast genomes of D. oligosanthes, from high-throughput short read sequencing data and a comparative transcriptomics analysis of the developing leaf of D. oligosanthes, S. viridis, and S. bicolor. Physiological and anatomical characterizations verified that D. oligosanthes utilizes the C 3 pathway for carbon fixation and lacks Kranz anatomy. Expression profiles of transcription factors along developing leaves of D. oligosanthes and S. viridis were compared with previously published data from S. bicolor, Zea mays, and Oryza sativa to identify a small suite of transcription factors that likely acquired functions specifically related to C 4 photosynthesis. The phylogenetic location of D. oligosanthes makes it an ideal C 3 plant for comparative analysis of C 4 evolution in the panicoid grasses. This genome will not only provide a better C 3 species for comparisons with C 4 panicoid grasses, but also highlights the power of using high-throughput sequencing to address questions in evolutionary biology.

HCV proteins and immunoglobulin variable gene (IgV) subfamilies in HCV-induced type II mixed cryoglobulinemia: a concurrent pathogenetic role.

PubMed

Sautto, Giuseppe; Mancini, Nicasio; Solforosi, Laura; Diotti, Roberta A; Clementi, Massimo; Burioni, Roberto

2012-01-01

The association between hepatitis C virus (HCV) infection and type II mixed cryoglobulinemia (MCII) is well established, but the role played by distinct HCV proteins and by specific components of the anti-HCV humoral immune response remains to be clearly defined. It is widely accepted that HCV drives the expansion of few B-cell clones expressing a restricted pool of selected immunoglobulin variable (IgV) gene subfamilies frequently endowed with rheumatoid factor (RF) activity. Moreover, the same IgV subfamilies are frequently observed in HCV-transformed malignant B-cell clones occasionally complicating MCII. In this paper, we analyze both the humoral and viral counterparts at the basis of cryoglobulins production in HCV-induced MCII, with particular attention reserved to the single IgV subfamilies most frequently involved.

Molecular Evolutionary Characterization of a V1R Subfamily Unique to Strepsirrhine Primates

PubMed Central

Yoder, Anne D.; Chan, Lauren M.; dos Reis, Mario; Larsen, Peter A.; Campbell, C. Ryan; Rasoloarison, Rodin; Barrett, Meredith; Roos, Christian; Kappeler, Peter; Bielawski, Joseph; Yang, Ziheng

2014-01-01

Vomeronasal receptor genes have frequently been invoked as integral to the establishment and maintenance of species boundaries among mammals due to the elaborate one-to-one correspondence between semiochemical signals and neuronal sensory inputs. Here, we report the most extensive sample of vomeronasal receptor class 1 (V1R) sequences ever generated for a diverse yet phylogenetically coherent group of mammals, the tooth-combed primates (suborder Strepsirrhini). Phylogenetic analysis confirms our intensive sampling from a single V1R subfamily, apparently unique to the strepsirrhine primates. We designate this subfamily as V1Rstrep. The subfamily retains extensive repertoires of gene copies that descend from an ancestral gene duplication that appears to have occurred prior to the diversification of all lemuriform primates excluding the basal genus Daubentonia (the aye-aye). We refer to the descendent clades as V1Rstrep-α and V1Rstrep-β. Comparison of the two clades reveals different amino acid compositions corresponding to the predicted ligand-binding site and thus potentially to altered functional profiles between the two. In agreement with previous studies of the mouse lemur (genus, Microcebus), the majority of V1Rstrep gene copies appear to be intact and under strong positive selection, particularly within transmembrane regions. Finally, despite the surprisingly high number of gene copies identified in this study, it is nonetheless probable that V1R diversity remains underestimated in these nonmodel primates and that complete characterization will be limited until high-coverage assembled genomes are available. PMID:24398377

AOX1-Subfamily Gene Members in Olea europaea cv. "Galega Vulgar"-Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting.

PubMed

Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia

2018-02-17

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.

Analysis of Species-Selectivity of Human, Mouse and Rat Cytochrome P450 1A and 2B Subfamily Enzymes using Molecular Modeling, Docking and Dynamics Simulations.

PubMed

Karthikeyan, Bagavathy Shanmugam; Suvaithenamudhan, Suvaiyarasan; Akbarsha, Mohammad Abdulkader; Parthasarathy, Subbiah

2018-06-01

Cytochrome P450 (CYP) 1A and 2B subfamily enzymes are important drug metabolizing enzymes, and are highly conserved across species in terms of sequence homology. However, there are major to minor structural and macromolecular differences which provide for species-selectivity and substrate-selectivity. Therefore, species-selectivity of CYP1A and CYP2B subfamily proteins across human, mouse and rat was analyzed using molecular modeling, docking and dynamics simulations when the chiral molecules quinine and quinidine were used as ligands. The three-dimensional structures of 17 proteins belonging to CYP1A and CYP2B subfamilies of mouse and rat were predicted by adopting homology modeling using the available structures of human CYP1A and CYP2B proteins as templates. Molecular docking and dynamics simulations of quinine and quinidine with CYP1A subfamily proteins revealed the existence of species-selectivity across the three species. On the other hand, in the case of CYP2B subfamily proteins, no role for chirality of quinine and quinidine in forming complexes with CYP2B subfamily proteins of the three species was indicated. Our findings reveal the roles of active site amino acid residues of CYP1A and CYP2B subfamily proteins and provide insights into species-selectivity of these enzymes across human, mouse, and rat.

Phylogeny of the most species-rich freshwater bivalve family (Bivalvia: Unionida: Unionidae): Defining modern subfamilies and tribes.

PubMed

Lopes-Lima, Manuel; Froufe, Elsa; Do, Van Tu; Ghamizi, Mohamed; Mock, Karen E; Kebapçı, Ümit; Klishko, Olga; Kovitvadhi, Satit; Kovitvadhi, Uthaiwan; Paulo, Octávio S; Pfeiffer, John M; Raley, Morgan; Riccardi, Nicoletta; Şereflişan, Hülya; Sousa, Ronaldo; Teixeira, Amílcar; Varandas, Simone; Wu, Xiaoping; Zanatta, David T; Zieritz, Alexandra; Bogan, Arthur E

2017-01-01

Freshwater mussels of the order Unionida are key elements of freshwater habitats and are responsible for important ecological functions and services. Unfortunately, these bivalves are among the most threatened freshwater taxa in the world. However, conservation planning and management are hindered by taxonomic problems and a lack of detailed ecological data. This highlights the urgent need for advances in the areas of systematics and evolutionary relationships within the Unionida. This study presents the most comprehensive phylogeny to date of the larger Unionida family, i.e., the Unionidae. The phylogeny is based on a combined dataset of 1032bp (COI+28S) of 70 species in 46 genera, with 7 of this genera being sequenced for the first time. The resulting phylogeny divided the Unionidae into 6 supported subfamilies and 18 tribes, three of which are here named for the first time (i.e., Chamberlainiini nomen novum, Cristariini nomen novum and Lanceolariini nomen novum). Molecular analyses were complemented by investigations of selected morphological, anatomical and behavioral characters used in traditional phylogenetic studies. No single morphological, anatomical or behavioral character was diagnostic at the subfamily level and few were useful at the tribe level. However, within subfamilies, many tribes can be recognized based on a subset of these characters. The geographical distribution of each of the subfamilies and tribes is also presented. The present study provides important advances in the systematics of these extraordinary taxa with implications for future ecological and conservation studies. Copyright © 2016 Elsevier Inc. All rights reserved.

Centromeric retrotransposon lineages predate the maize/rice divergence and differ in abundance and activity.

PubMed

Sharma, Anupma; Presting, Gernot G

2008-02-01

Centromeric retrotransposons (CR) are located almost exclusively at the centromeres of plant chromosomes. Analysis of the emerging Zea mays inbred B73 genome sequence revealed two novel subfamilies of CR elements of maize (CRM), bringing the total number of known CRM subfamilies to four. Orthologous subfamilies of each of these CRM subfamilies were discovered in the rice lineage, and the orthologous relationships were demonstrated with extensive phylogenetic analyses. The much higher number of CRs in maize versus Oryza sativa is due primarily to the recent expansion of the CRM1 subfamily in maize. At least one incomplete copy of a CRM1 homolog was found in O. sativa ssp. indica and O. officinalis, but no member of this subfamily could be detected in the finished O. sativa ssp. japonica genome, implying loss of this prolific subfamily in that subspecies. CRM2 and CRM3, as well as the corresponding rice subfamilies, have been recently active but are present in low numbers. CRM3 is a full-length element related to the non-autonomous CentA, which is the first described CRM. The oldest subfamily (CRM4), as well as its rice counterpart, appears to contain only inactive members that are not located in currently active centromeres. The abundance of active CR elements is correlated with chromosome size in the three plant genomes for which high quality genomic sequence is available, and the emerging picture of CR elements is one in which different subfamilies are active at different evolutionary times. We propose a model by which CR elements might influence chromosome and genome size.

Evolutionary and biogeographic history of the subfamily Neoplecostominae (Siluriformes: Loricariidae)

PubMed Central

Roxo, Fábio F; Zawadzki, Cláudio H; Alexandrou, Markos A; Costa Silva, Guilherme J; Chiachio, Marcio C; Foresti, Fausto; Oliveira, Claudio

2012-01-01

Freshwater fish evolution has been shaped by changes in the earth's surface involving changes in the courses of rivers and fluctuations in sea level. The main objective of this study is to improve our knowledge of the evolution of loricariids, a numerous and adaptive group of freshwater catfish species, and the role of geological changes in their evolution. We use a number of different phylogenetic methods to test the relationships among 52 representative taxa within the Neoplecostominae using 4676 bps of mitochondrial and nuclear DNA. Our analysis revealed that the subfamily Neoplecostominae is monophyletic, including Pseudotocinclus, with three lineages recognized. The first lineage is composed of part of Pareiorhina rudolphi, P. cf. rudolphi, and Pseudotocinclus; the second is composed of Isbrueckerichthys, Pareiorhaphis, Kronichthys, and the species Neoplecostomus ribeirensis; and the third is composed of Pareiorhina carrancas, P. cf. carrancas, Pareiorhina sp. 1, a new genus, and all the species of the genus Neoplecostomus, except N. ribeirensis. The relaxed molecular clock calibration provides a temporal framework for the evolution of the group, which we use for a likelihood-based historical biogeographic analysis to test relevant hypotheses on the formation of southeast Brazil. We hypothesize that headwater capture events and marine regressions have shaped the patterns of distribution within the subfamily Neoplecostominae throughout the distinct basins of southeast Brazil. PMID:23145330

HCV Proteins and Immunoglobulin Variable Gene (IgV) Subfamilies in HCV-Induced Type II Mixed Cryoglobulinemia: A Concurrent Pathogenetic Role

PubMed Central

Sautto, Giuseppe; Mancini, Nicasio; Solforosi, Laura; Diotti, Roberta A.; Clementi, Massimo; Burioni, Roberto

2012-01-01

The association between hepatitis C virus (HCV) infection and type II mixed cryoglobulinemia (MCII) is well established, but the role played by distinct HCV proteins and by specific components of the anti-HCV humoral immune response remains to be clearly defined. It is widely accepted that HCV drives the expansion of few B-cell clones expressing a restricted pool of selected immunoglobulin variable (IgV) gene subfamilies frequently endowed with rheumatoid factor (RF) activity. Moreover, the same IgV subfamilies are frequently observed in HCV-transformed malignant B-cell clones occasionally complicating MCII. In this paper, we analyze both the humoral and viral counterparts at the basis of cryoglobulins production in HCV-induced MCII, with particular attention reserved to the single IgV subfamilies most frequently involved. PMID:22690241

Locations of the ets subfamily members net, elk1, and sap1 (ELK3, ELK1, and ELK4) on three homologous regions of the mouse and human genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giovane, A.; Sobieszczuk, P.; Mignon, C.

1995-10-10

Net, Elk1, and Sap1 are related members of the Ets oncoprotein family. We show by in situ hybridization on banded chromosomes with specific cDNA probes that their map positions on mouse and human chromosomes (respectively) are net, 10C-D1 and 12q22-q23 (now called ELK3), sap1, 1E3-G and 1q32 (ELK4), and elk1, XA1-A3 and Xp11.2-p11.1 (ELK1), as well as a second locus 14q32 (ELK2) unique to the human genome. The results for the mouse net, sap1, and elk1 and human ELK3 genes are new. The human elk1 mapping confirms a previous study. The human ELK4 localization agrees with data published during themore » preparation of the manuscript. Human ELK3 colocalizes with sap2, and we confirm that they are identical. These results firmly establish for the first time that Net, Elk1, and Sap1 are distinct gene products with different chromosomal localizations in both the mouse and the human genomes. Net, Elk1, and Sap1 are conserved and map to homologous regions of the mouse and human chromosomes. 19 refs., 1 fig., 1 tab.« less

Comparative Mitogenomic Analysis of Species Representing Six Subfamilies in the Family Tenebrionidae

PubMed Central

Zhang, Hong-Li; Liu, Bing-Bing; Wang, Xiao-Yang; Han, Zhi-Ping; Zhang, Dong-Xu; Su, Cai-Na

2016-01-01

To better understand the architecture and evolution of the mitochondrial genome (mitogenome), mitogenomes of ten specimens representing six subfamilies in Tenebrionidae were selected, and comparative analysis of these mitogenomes was carried out in this study. Ten mitogenomes in this family share a similar gene composition, gene order, nucleotide composition, and codon usage. In addition, our results show that nucleotide bias was strongly influenced by the preference of codon usage for A/T rich codons which significantly correlated with the G + C content of protein coding genes (PCGs). Evolutionary rate analyses reveal that all PCGs have been subjected to a purifying selection, whereas 13 PCGs displayed different evolution rates, among which ATPase subunit 8 (ATP8) showed the highest evolutionary rate. We inferred the secondary structure for all RNA genes of Tenebrio molitor (Te2) and used this as the basis for comparison with the same genes from other Tenebrionidae mitogenomes. Some conserved helices (stems) and loops of RNA structures were found in different domains of ribosomal RNAs (rRNAs) and the cloverleaf structure of transfer RNAs (tRNAs). With regard to the AT-rich region, we analyzed tandem repeat sequences located in this region and identified some essential elements including T stretches, the consensus motif at the flanking regions of T stretch, and the secondary structure formed by the motif at the 3′ end of T stretch in major strand, which are highly conserved in these species. Furthermore, phylogenetic analyses using mitogenomic data strongly support the relationships among six subfamilies: ((Tenebrionidae incertae sedis + (Diaperinae + Tenebrioninae)) + (Pimeliinae + Lagriinae)), which is consistent with phylogenetic results based on morphological traits. PMID:27258256

A multilocus phylogeny of Podoctidae (Arachnida, Opiliones, Laniatores) and parametric shape analysis reveal the disutility of subfamilial nomenclature in armored harvestman systematics.

PubMed

Sharma, Prashant P; Santiago, Marc A; Kriebel, Ricardo; Lipps, Savana M; Buenavente, Perry A C; Diesmos, Arvin C; Janda, Milan; Boyer, Sarah L; Clouse, Ronald M; Wheeler, Ward C

2017-01-01

The taxonomy and systematics of the armored harvestmen (suborder Laniatores) are based on various sets of morphological characters pertaining to shape, armature, pedipalpal setation, and the number of articles of the walking leg tarsi. Few studies have tested the validity of these historical character systems in a comprehensive way, with reference to an independent data class, i.e., molecular sequence data. We examined as a test case the systematics of Podoctidae, a family distributed throughout the Indo-Pacific. We tested the validity of the three subfamilies of Podoctidae using a five-locus phylogeny, and examined the evolution of dorsal shape as a proxy for taxonomic utility, using parametric shape analysis. Here we show that two of the three subfamilies, Ibaloniinae and Podoctinae, are non-monophyletic, with the third subfamily, Erecananinae, recovered as non-monophyletic in a subset of analyses. Various genera were also recovered as non-monophyletic. As first steps toward revision of Podoctidae, the subfamilies Erecananinae Roewer, 1912 and Ibaloniinae Roewer, 1912 are synonymized with Podoctinae Roewer, 1912 new synonymies, thereby abolishing unsubstantiated subfamilial divisions within Podoctidae. We once again synonymize the genus Paralomanius Goodnight & Goodnight, 1948 with Lomanius Roewer, 1923 revalidated. We additionally show that eggs carried on the legs of male Podoctidae are not conspecific to the males, falsifying the hypothesis of paternal care in this group. Copyright © 2016 Elsevier Inc. All rights reserved.

Polysaccharide-inducible endoglucanases from Lentinula edodes exhibit a preferential hydrolysis of 1,3-1,4-β-glucan and xyloglucan.

PubMed

Takeda, Takumi; Nakano, Yuki; Takahashi, Machiko; Sakamoto, Yuichi; Konno, Naotake

2013-08-07

Three genes encoding glycoside hydrolase family 12 (GH12) enzymes from Lentinula edodes, namely Lecel12A, Lecel12B, and Lecel12C, were newly cloned by PCR using highly conserved sequence primers. To investigate enzymatic properties, recombinant enzymes encoded by L. edodes DNAs and GH12 genes from Postia placenta (PpCel12A and PpCel12B) and Schizophyllum commune (ScCel12A) were prepared in Brevibacillus choshinensis. Recombinant LeCel12A, PpCel12A, and PpCel12B, which were grouped in GH12 subfamily 1, preferentially hydrolyzed 1,3-1,4-β-glucan. By contrast, LeCel12B, LeCel12C, and ScCel12A, members of the subfamily 2, exhibited specific hydrolysis of xyloglucan. These results suggest that two subfamilies of GH12 are separated based on the substrate specificity. Transcript levels of L. edodes genes increased 72 h after growth of L. edodes mycelia cells in the presence of plant cell wall polymers such as xyloglucan, 1,3-1,4-β-glucan, and cellulose. These results suggest that L. edodes GH12 enzymes have evolved to hydrolyze 1,3-1,4-β-glucan and xyloglucan, which might enhance hyphal extension and nutrient acquisition.

Investigation of drug-drug interactions caused by human pregnane X receptor-mediated induction of CYP3A4 and CYP2C subfamilies in chimeric mice with a humanized liver.

PubMed

Hasegawa, Maki; Tahara, Harunobu; Inoue, Ryo; Kakuni, Masakazu; Tateno, Chise; Ushiki, Junko

2012-03-01

The induction of cytochrome P450 (P450) enzymes is one of the risk factors for drug-drug interactions (DDIs). To date, the human pregnane X receptor (PXR)-mediated CYP3A4 induction has been well studied. In addition to CYP3A4, the expression of CYP2C subfamily is also regulated by PXR, and the DDIs caused by the induction of CYP2C enzymes have been reported to have a major clinical impact. The purpose of the present study was to investigate whether chimeric mice with a humanized liver (PXB mice) can be a suitable animal model for investigating the PXR-mediated induction of CYP2C subfamily, together with CYP3A4. We evaluated the inductive effect of rifampicin (RIF), a typical human PXR ligand, on the plasma exposure to the four P450 substrate drugs (triazolam/CYP3A4, pioglitazone/CYP2C8, (S)-warfarin/CYP2C9, and (S)-(-)-mephenytoin/CYP2C19) by cassette dosing in PXB mice. The induction of several drug-metabolizing enzymes and transporters in the liver was also examined by measuring the enzyme activity and mRNA expression levels. Significant reductions in the exposure to triazolam, pioglitazone, and (S)-(-)-mephenytoin, but not to (S)-warfarin, were observed. In contrast to the in vivo results, all the four P450 isoforms, including CYP2C9, were elevated by RIF treatment. The discrepancy in the (S)-warfarin results between in vivo and in vitro studies may be attributed to the relatively small contribution of CYP2C9 to (S)-warfarin elimination in the PXB mice used in this study. In summary, PXB mice are a useful animal model to examine DDIs caused by PXR-mediated induction of CYP2C and CYP3A4.

Alphasatellitidae: a new family with two subfamilies for the classification of geminivirus- and nanovirus-associated alphasatellites.

PubMed

Briddon, Rob W; Martin, Darren P; Roumagnac, Philippe; Navas-Castillo, Jesús; Fiallo-Olivé, Elvira; Moriones, Enrique; Lett, Jean-Michel; Zerbini, F Murilo; Varsani, Arvind

2018-05-09

Nanoviruses and geminiviruses are circular, single stranded DNA viruses that infect many plant species around the world. Nanoviruses and certain geminiviruses that belong to the Begomovirus and Mastrevirus genera are associated with additional circular, single stranded DNA molecules (~ 1-1.4 kb) that encode a replication-associated protein (Rep). These Rep-encoding satellite molecules are commonly referred to as alphasatellites and here we communicate the establishment of the family Alphasatellitidae to which these have been assigned. Within the Alphasatellitidae family two subfamilies, Geminialphasatellitinae and Nanoalphasatellitinae, have been established to respectively accommodate the geminivirus- and nanovirus-associated alphasatellites. Whereas the pairwise nucleotide sequence identity distribution of all the known geminialphasatellites (n = 628) displayed a troughs at ~ 70% and 88% pairwise identity, that of the known nanoalphasatellites (n = 54) had a troughs at ~ 67% and ~ 80% pairwise identity. We use these pairwise identity values as thresholds together with phylogenetic analyses to establish four genera and 43 species of geminialphasatellites and seven genera and 19 species of nanoalphasatellites. Furthermore, a divergent alphasatellite associated with coconut foliar decay disease is assigned to a species but not a subfamily as it likely represents a new alphasatellite subfamily that could be established once other closely related molecules are discovered.

Functional diversity for biomass deconstruction in family 5 subfamily 5 (GH5_5) of fungal endo-β1,4-glucanases.

PubMed

Li, Bingyao; Walton, Jonathan D

2017-05-01

Endo-β1,4-glucanases in glycosyl hydrolase family 5 (GH5) are ubiquitous enzymes in the multicellular fungi and are common components of enzyme cocktails for biomass conversion. We recently showed that an endo-glucanase of subfamily 5 of GH5 (GH5_5) from Sporotrichum thermophile (StCel5A) was more effective at releasing glucose from pretreated corn stover, when part of an eight-component synthetic enzyme mixture, compared to its closely related counterpart from Trichoderma reesei, TrCel5A. StCel5A and TrCel5A belong to different clades of GH5_5 (GH5_5_1 and GH5_5_2, respectively). To test whether the superior activity of StCel5A was a general property of all enzymes in the GH5_5_2 clade, StCel5A, TrCel5A, and two additional members of each subfamily were expressed in a common host that had been engineered to suppress its native cellulases (T. reesei Δxyr1) and compared against each other alone on pure substrates, in synthetic mixtures on pure substrates, and against each other in synthetic mixtures on real biomass. The results indicated that superiority is a unique property of StCel5A and not of GH5_5_2 generally. The six Cel5A enzymes had significant differences in relative activities on different substrates, in specific activities, and in sensitivities to mannan inhibition. Importantly, the behavior of the six endo-glucanases on pure cellulose substrates did not predict their behavior in combination with other cellulolytic enzymes on a real lignocellulosic biomass substrate.

The draft genome of the C 3 panicoid grass species Dichanthelium oligosanthes

DOE PAGES

Studer, Anthony J.; Schnable, James C.; Weissmann, Sarit; ...

2016-10-28

Comparisons between C 3 and C 4 grasses often utilize C 3 species from the subfamilies Ehrhartoideae or Pooideae and C 4 species from the subfamily Panicoideae, two clades that diverged over 50 million years ago. The divergence of the C 3 panicoid grass Dichanthelium oligosanthes from the independent C 4 lineages represented by Setaria viridis and Sorghum bicolor occurred approximately 15 million years ago, which is significantly more recent than members of the Bambusoideae, Ehrhartoideae, and Pooideae subfamilies. D. oligosanthes is ideally placed within the panicoid clade for comparative studies of C 3 and C 4 grasses. Here, wemore » report the assembly of the nuclear and chloroplast genomes of D. oligosanthes, from high-throughput short read sequencing data and a comparative transcriptomics analysis of the developing leaf of D. oligosanthes, S. viridis, and S. bicolor. Physiological and anatomical characterizations verified that D. oligosanthes utilizes the C 3 pathway for carbon fixation and lacks Kranz anatomy. Expression profiles of transcription factors along developing leaves of D. oligosanthes and S. viridis were compared with previously published data from S. bicolor, Zea mays, and Oryza sativa to identify a small suite of transcription factors that likely acquired functions specifically related to C 4 photosynthesis. In conclusion, the phylogenetic location of D. oligosanthes makes it an ideal C 3 plant for comparative analysis of C 4 evolution in the panicoid grasses. This genome will not only provide a better C 3 species for comparisons with C 4 panicoid grasses, but also highlights the power of using high-throughput sequencing to address questions in evolutionary biology.« less

The draft genome of the C 3 panicoid grass species Dichanthelium oligosanthes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Studer, Anthony J.; Schnable, James C.; Weissmann, Sarit

Comparisons between C 3 and C 4 grasses often utilize C 3 species from the subfamilies Ehrhartoideae or Pooideae and C 4 species from the subfamily Panicoideae, two clades that diverged over 50 million years ago. The divergence of the C 3 panicoid grass Dichanthelium oligosanthes from the independent C 4 lineages represented by Setaria viridis and Sorghum bicolor occurred approximately 15 million years ago, which is significantly more recent than members of the Bambusoideae, Ehrhartoideae, and Pooideae subfamilies. D. oligosanthes is ideally placed within the panicoid clade for comparative studies of C 3 and C 4 grasses. Here, wemore » report the assembly of the nuclear and chloroplast genomes of D. oligosanthes, from high-throughput short read sequencing data and a comparative transcriptomics analysis of the developing leaf of D. oligosanthes, S. viridis, and S. bicolor. Physiological and anatomical characterizations verified that D. oligosanthes utilizes the C 3 pathway for carbon fixation and lacks Kranz anatomy. Expression profiles of transcription factors along developing leaves of D. oligosanthes and S. viridis were compared with previously published data from S. bicolor, Zea mays, and Oryza sativa to identify a small suite of transcription factors that likely acquired functions specifically related to C 4 photosynthesis. In conclusion, the phylogenetic location of D. oligosanthes makes it an ideal C 3 plant for comparative analysis of C 4 evolution in the panicoid grasses. This genome will not only provide a better C 3 species for comparisons with C 4 panicoid grasses, but also highlights the power of using high-throughput sequencing to address questions in evolutionary biology.« less

3D reconstruction of wooden member of ancient architecture from point clouds

NASA Astrophysics Data System (ADS)

Zhang, Ruiju; Wang, Yanmin; Li, Deren; Zhao, Jun; Song, Daixue

2006-10-01

This paper presents a 3D reconstruction method to model wooden member of ancient architecture from point clouds based on improved deformable model. Three steps are taken to recover the shape of wooden member. Firstly, Hessian matrix is adopted to compute the axe of wooden member. Secondly, an initial model of wooden member is made by contour orthogonal to its axis. Thirdly, an accurate model is got through the coupling effect between the initial model and the point clouds of the wooden member according to the theory of improved deformable model. Every step and algorithm is studied and described in the paper. Using the point clouds captured from Forbidden City of China, shaft member and beam member are taken as examples to test the method proposed in the paper. Results show the efficiency and robustness of the method addressed in the literature to model the wooden member of ancient architecture.

Examining the Chirality, Conformation and Selective Kinase Inhibition of 3-((3R,4R)-4-methyl-3-(methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-3-oxopropanenitrile (CP-690,550)

PubMed Central

Jiang, Jian-kang; Ghoreschi, Kamran; Deflorian, Francesca; Chen, Zhi; Perreira, Melissa; Pesu, Marko; Smith, Jeremy; Nguyen, Dac-Trung; Liu, Eric H.; Leister, William; Costanzi, Stefano; O’Shea, John J.; Thomas, Craig J.

2009-01-01

Here, we examine the significance that stereochemistry plays within the clinically relevant Janus Kinase 3 (Jak3) inhibitor CP-690,550. A synthesis of all four enantiopure stereoisomers of the drug was carried out and an examination of each compound revealed that only the enantiopure 3R, 4R isomer was capable of blocking Stat5 phosphorylation (Jak3 dependent). Each compound was profiled across a panel of over 350 kinases which revealed a high level of selectivity for the Jak family kinases for these related compounds. Each stereoisomer retained a degree of binding to Jak3 and Jak2 and the 3R, 4S and 3S, 4R stereoisomers were further revealed to have binding affinity for selected members of the STE7 and STE20 subfamily of kinases. Finally, an appraisal of the minimum energy conformation of each stereoisomer and molecular docking at Jak3 was performed in an effort to better understand each compounds selectivity and potency profiles. PMID:19053756

Altered profile of mRNA expression in atrioventricular node of streptozotocin-induced diabetic rats

PubMed Central

Howarth, Frank Christopher; Parekh, Khatija; Jayaprakash, Petrilla; Inbaraj, Edward Samuel; Oz, Murat; Dobrzynski, Halina; Adrian, Thomas Edward

2017-01-01

Prolonged action potential duration, reduced action potential firing rate, upstroke velocity and rate of diastolic depolarization have been demonstrated in atrioventricular node (AVN) cells from streptozotocin (STZ)-induced diabetic rats. To further clarify the molecular basis of these electrical disturbances, the mRNA profiles encoding a variety of proteins associated with the generation and conduction of electrical activity in the AVN, were evaluated in the STZ-induced diabetic rat heart. Expression of mRNA was measured in AVN biopsies using reverse transcription-quantitative polymerase chain reaction techniques. Notable differences in mRNA expression included upregulation of genes encoding membrane and intracellular Ca2+ transport, including solute carrier family 8 member A1, transient receptor potential channel 1, ryanodine receptor 2/3, hyperpolarization-activated cyclic-nucleotide 2 and 3, calcium channel voltage-dependent, β2 subunit and sodium channels 3a, 4a, 7a and 3b. In addition to this, potassium channels potassium voltage-gated channel subfamily A member 4, potassium channel calcium activated intermediate/small conductance subfamily N α member 2, potassium voltage-gated channel subfamily J members 3, 5, and 11, potassium channel subfamily K members 1, 2, 3 and natriuretic peptide B (BNP) were upregulated in AVN of STZ heart, compared with controls. Alterations in gene expression were associated with upregulation of various proteins including the inwardly rectifying, potassium channel Kir3.4, NCX1 and BNP. The present study demonstrated notable differences in the profile of mRNA encoding proteins associated with the generation, conduction and regulation of electrical signals in the AVN of the STZ-induced diabetic rat heart. These data will provide a basis for a substantial range of future studies to investigate whether variations in mRNA translate into alterations in electrophysiological function. PMID:28731153

Molecular and enzymatic characterization of a subfamily I.4 lipase from an edible oil-degrader Bacillus sp. HH-01.

PubMed

Kamijo, Takashi; Saito, Akihiro; Ema, Sadaharu; Yoh, Inchi; Hayashi, Hiroko; Nagata, Ryo; Nagata, Yoshiho; Ando, Akikazu

2011-02-01

An edible-oil degrading bacterial strain HH-01 was isolated from oil plant gummy matter and was classified as a member of the genus Bacillus on the basis of the nucleotide sequence of the 16S rRNA gene. A putative lipase gene and its flanking regions were cloned from the strain based on its similarity to lipase genes from other Bacillus spp. The deduced product was composed of 214 amino acids and the putative mature protein, consisting of 182 amino acids, exhibited 82% amino acid sequence identity with the subfamily I.4 lipase LipA of Bacillus subtilis 168. The recombinant product was successfully overproduced as a soluble form in Escherichia coli and showed lipase activity. The gene was, therefore, designated as lipA of HH-01. HH-01 LipA was stable at pH 4-11 and up to 30°C, and its optimum pH and temperature were 8-9 and 30°C, respectively. The enzyme showed preferential hydrolysis of the 1(3)-position ester bond in trilinolein. The activity was, interestingly, enhanced by supplementing with 1 mM CoCl(2), in contrast to other Bacillus lipases. The lipA gene seemed to be constitutively transcribed during the exponential growth phase, regardless of the presence of edible oil.

Vitamin D. Treatment of Prostate Cancer: The Inhibitory Role of IGFBP-3

DTIC Science & Technology

2005-01-01

cassette, sub-family C (CFTR/MRP), member 6 AA424804 Flag 1.62 2.36 Xeroderma pigmentosum , complementation group C (XPC) AA287323 1.44 1.83 2.25...expressed gene I (POVI) T72067 2.37 7.30 Xeroderma pigmentosum , complementation group C (XPC) AA287323 2.25 11.2 Claudin 4 AA506754 2.21 7.30 UDP...Diego: Academic Press; 2001. in DNA damage response ( xeroderma pigmentosum pp 257-303. compledamentatgerouponse C e r [e 3. Miller GJ. Vitamin D and

Systematics of Australian Thrasorinae (Hymenoptera, Cynipoidea, Figitidae) with descriptions of Mikeiinae, new subfamily, two new genera, and three new species

PubMed Central

Paretas-Martínez, J.; Restrepo-Ortiz, C.; Buffington, M.; Pujade-Villar, J.

2011-01-01

Abstract The Australian Thrasorinae are revised and Mikeius is transferred to Mikeiinae Paretas-Martínez & Pujade-Villar, subfam. n., and Mikeius clavatus Pujade-Villar & Restrepo-Ortiz, sp. n., is described. Two new genera of Thrasorinae are erected: Cicatrix Paretas-Martínez, gen. n., including Cicatrix pilosiscutum(Girault), comb. n. from Amblynotus, Cicatrix schauffi (Buffington), comb. n. from Mikeius, and Cicatrix neumannoides Paretas-Martínez & Restrepo-Ortiz, sp. n.; and Palmiriella Pujade-Villar & Paretas-Martínez, gen. n., including Palmiriella neumanni (Buffington), comb. n. from Mikeius, Thrasorus rieki Paretas-Martínez & Pujade-Villar, sp. n., is also described. A phylogenetic analysis of 176 morphological and biological characters, including all these new taxa and all genera previously included in Thrasorinae, was conducted. All subfamilies were recovered as monophyletic, with the following relationships: Parnipinae (Euceroptrinae (Mikeiinae (Plectocynipinae (Thrasorinae)))). A worldwide key to the subfamilies of Figitidae is provided that includes the new subfamily, as well as a key to genera Thrasorinae. PMID:21852926

Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

PubMed

Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

1999-07-01

The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

AOX1-Subfamily Gene Members in Olea europaea cv. “Galega Vulgar”—Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting

PubMed Central

Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit

2018-01-01

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998

Research Advances in CKLFSF-like MARVEL Transmembrane Domain Containing Member 3.

PubMed

Hu, Feng-zhan; Sheng, Zheng-zuo; Qin, Cai-peng; Xu, Tao

2016-06-10

CKLF-like MARVEL transmembrane domain containing member/chemokine-like factor super family member (CKLFSF/CMTM) is a novel tumor suppressor gene. CMTM3 is broadly expressed in normal human tissues and evolutionary conserved,especially in testis,spleen,and some cells of peripheral blood mononuclear cells. However,its expression is undetectable or down-regulated in most carcinoma cell lines and tissues. Restoration of CMTM3 may inhibit the proliferation,migration,and invasion of carcinoma cells. Although the exact mechanism of its anti-tumor activity remains unclear,CKLFSF3/CMTM3 is closely connected with immune system and associated with sex during tumorigenesis. The study advances of CKLFSF3/CMTM3 are elaborated in this review as CMTM3 may be a new target in the gene therapies for tumors,especially genitourinary tumors,while further studies on CMTM3 and its anti-tumor mechanisms are warranted.

The phylogeny of the family Lacertidae (Reptilia) based on nuclear DNA sequences: convergent adaptations to arid habitats within the subfamily Eremiainae.

PubMed

Mayer, Werner; Pavlicev, Mihaela

2007-09-01

The family Lacertidae encompasses more than 250 species distributed in the Palearctis, Ethiopis and Orientalis. Lacertids have been subjected in the past to several morphological and molecular studies to establish their phylogeny. However, the problems of convergent adaptation in morphology and of excessively variable molecular markers have hampered the establishment of well supported deeper phylogenetic relationships. Particularly the adaptations to xeric environments have often been used to establish a scenario for the origin and radiation of major lineages within lacertids. Here we present a molecular phylogenetic study based on two nuclear marker genes and representatives of 37 lacertid genera and distinct species groups (as in the case of the collective genus Lacerta). Roughly 1600 bp of the nuclear rag1 and c-mos genes were sequenced and analyzed. While the results provide good support to the hitherto suggested main subfamilies of Gallotiinae (Gallotia and Psammodromus), Eremiainae and Lacertinae [Harris, D.J., Arnold, E.N., Thomas, R.H., 1998. Relationships of lacertid lizards (Reptilia: Lacertidae) estimated from mitochondrial DNA sequences and morphology. Proc. R. Soc. Lond. B 265, 1939-1948], they also suggest unexpected relationships. In particular, the oriental genus Takydromus, previously considered the sister-group to the three subfamilies, is nested within Lacertinae. Moreover, the genera within the Eremiainae are further divided into two groups, roughly corresponding to their respective geographical distributions in the Ethiopian and the Saharo-Eurasian ranges. The results support an independent origin of adaptations to xeric conditions in different subfamilies. The relationships within the subfamily Lacertinae could not be resolved with the markers used. The species groups of the collective genus Lacerta show a bush-like topology in the inferred Bayesian tree, suggesting rapid radiation. The composition of the subfamilies Eremiainae and Lacertinae

Current status of subfamily Ichneumoninae (Hymenoptera: Ichneumonidae) from Malaysia and Singapore

NASA Astrophysics Data System (ADS)

Norhafiza, A. F.; Idris, A. B.

2013-11-01

In this paper, 25 genera and 38 species under 10 tribes (Alomyini, Compsophorini, Goedartiini, Heresiarchini, Ichneumonini, Ischnojoppini, Joppocryptini, Listrodromini, Oedicephalini and Platylabini) of the subfamily Ichneumoninae housed in the Centre for Insect Systematics, UKM and Raffles Museum of Biodiversity Research (National University of Singapore) are reported from Malaysia and Singapore. The tribe Heresiarchini has the greatest number of species (13) followed by Ichneumonini with six species. Imeria is the largest genus which contains five species recorded. Six species in this study are new records for Malaysia.

32 CFR 884.3 - Placing member under restraint pending delivery.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 6 2014-07-01 2014-07-01 false Placing member under restraint pending delivery. 884.3 Section 884.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE... cause exists and whether a reasonable belief exists that restraint is necessary, the commander should...

32 CFR 884.3 - Placing member under restraint pending delivery.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 6 2013-07-01 2013-07-01 false Placing member under restraint pending delivery. 884.3 Section 884.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE... cause exists and whether a reasonable belief exists that restraint is necessary, the commander should...

32 CFR 884.3 - Placing member under restraint pending delivery.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 6 2012-07-01 2012-07-01 false Placing member under restraint pending delivery. 884.3 Section 884.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE... cause exists and whether a reasonable belief exists that restraint is necessary, the commander should...

32 CFR 884.3 - Placing member under restraint pending delivery.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 6 2011-07-01 2011-07-01 false Placing member under restraint pending delivery. 884.3 Section 884.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE... cause exists and whether a reasonable belief exists that restraint is necessary, the commander should...

32 CFR 884.3 - Placing member under restraint pending delivery.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 6 2010-07-01 2010-07-01 false Placing member under restraint pending delivery. 884.3 Section 884.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE... cause exists and whether a reasonable belief exists that restraint is necessary, the commander should...

Isolation and characterization of the chicken trypsinogen gene family.

PubMed Central

Wang, K; Gan, L; Lee, I; Hood, L

1995-01-01

Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885

Whole genome comparisons of Fragaria, Prunus and Malus reveal different modes of evolution between Rosaceous subfamilies

PubMed Central

2012-01-01

Background Rosaceae include numerous economically important and morphologically diverse species. Comparative mapping between the member species in Rosaceae have indicated some level of synteny. Recently the whole genome of three crop species, peach, apple and strawberry, which belong to different genera of the Rosaceae family, have been sequenced, allowing in-depth comparison of these genomes. Results Our analysis using the whole genome sequences of peach, apple and strawberry identified 1399 orthologous regions between the three genomes, with a mean length of around 100 kb. Each peach chromosome showed major orthology mostly to one strawberry chromosome, but to more than two apple chromosomes, suggesting that the apple genome went through more chromosomal fissions in addition to the whole genome duplication after the divergence of the three genera. However, the distribution of contiguous ancestral regions, identified using the multiple genome rearrangements and ancestors (MGRA) algorithm, suggested that the Fragaria genome went through a greater number of small scale rearrangements compared to the other genomes since they diverged from a common ancestor. Using the contiguous ancestral regions, we reconstructed a hypothetical ancestral genome for the Rosaceae 7 composed of nine chromosomes and propose the evolutionary steps from the ancestral genome to the extant Fragaria, Prunus and Malus genomes. Conclusion Our analysis shows that different modes of evolution may have played major roles in different subfamilies of Rosaceae. The hypothetical ancestral genome of Rosaceae and the evolutionary steps that lead to three different lineages of Rosaceae will facilitate our understanding of plant genome evolution as well as have a practical impact on knowledge transfer among member species of Rosaceae. PMID:22475018

First contact pheromone identified for a longhorned beetle (Coleoptera: Cerambycidae) in the subfamily Prioninae

Treesearch

Annie E. Spikes; Matthew A. Paschen; Jocelyn G. Miller; Jardel A. Moreira; Paul B. Hamel; Nathan M. Schiff; Matthew D. Ginzel

2010-01-01

Little is known of the reproductive behavior of longhorned beetles (Coleoptera: Cerambycidae) in the subfamily Prioninae. Mallodon dasystomus (Say), the hardwood stump borer, is a widely distributed prionine that is native to the southern U.S. Here, we explored the chemically-mediated mating behavior of M dasystomus, and tested the hypothesis that males recognize...

A new genus and species of subfamily Banchinae (Hymenoptera, Ichneumonidae) from China.

PubMed

Sheng, Mao-Ling; Sun, Shu-Ping; Wang, Xi-Nan; Wu, Hai-Wei

2018-04-23

A new genus, Verruca Sheng Sun gen. nov., of the ichneumonid tribe Atrophini, subfamily Banchinae is described for one new species, Verruca dentia Sheng Sun, sp. nov. The species was collected from Shandong and Jiangxi Provinces, situated near the northern border of the Oriental part of China. The new genus is placed within the existing key to genera. A key to the genera of Atrophini, with the apical portion of the ovipositor with ridges, is also provided.

KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

PubMed Central

Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

2017-01-01

Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

Discovery of germacrene A synthases in Barnadesia spinosa: The first committed step in sesquiterpene lactone biosynthesis in the basal member of the Asteraceae.

PubMed

Nguyen, Trinh-Don; Faraldos, Juan A; Vardakou, Maria; Salmon, Melissa; O'Maille, Paul E; Ro, Dae-Kyun

2016-10-28

The Andes-endemic Barnadesioideae lineage is the oldest surviving and phylogenetically basal subfamily of the Asteraceae (Compositae), a prolific group of flowering plants with world-wide distribution (∼24,000 species) marked by a rich diversity of sesquiterpene lactones (STLs). Intriguingly, there is no evidence that members of the Barnadesioideae produce STLs, specialized metabolites thought to have contributed to the adaptive success of the Asteraceae family outside South America. The biosynthesis of STLs requires the intimate expression and functional integration of germacrene A synthase (GAS) and germacrene A oxidase (GAO) to sequentially cyclize and oxidize farnesyl diphosphate into the advanced intermediate germacrene A acid leading to diverse STLs. Our previous discovery of GAO activity conserved across all major subfamilies of Asteraceae, including the phylogenetically basal lineage of Barnadesioideae, prompted further investigation of the presence of the gateway GAS in Barnadesioideae. Herein we isolated two terpene synthases (BsGAS1/BsGAS2) from the basal Barnadesia spinosa (Barnadesioideae) that displayed robust GAS activity when reconstituted in yeast and characterized in vitro. Despite the apparent lack of STLs in the Barnadesioideae, this work unambiguously confirms the presence of GAS in the basal genera of the Asteraceae. Phylogenetic analysis reveals that the two BsGASs fall into two distinct clades of the Asteraceae's GASs, and BsGAS1 clade is only retained in the evolutionary closer Cichorioideae subfamily, implicating BsGAS2 is likely the ancestral base of most GASs found in the lineages outside the Barnadesioideae. Taken together, these results show the enzymatic capacities of GAS and GAO emerged prior to the subsequent radiation of STL-producing Asteraceae subfamilies. Copyright © 2016 Elsevier Inc. All rights reserved.

3DUI assisted lower and upper member therapy.

PubMed

Uribe-Quevedo, Alvaro; Perez-Gutierrez, Byron

2012-01-01

3DUIs are becoming very popular among researchers, developers and users as they allow more immersive and interactive experiences by taking advantage of the human dexterity. The features offered by these interfaces outside the gaming environment, have allowed the development of applications in the medical area by enhancing the user experience and aiding the therapy process in controlled and monitored environments. Using mainstream videogame 3DUIs based on inertial and image sensors available in the market, this work presents the development of a virtual environment and its navigation through lower member captured gestures for assisting motion during therapy.

3. VIEW OF MAKERS PLATE ATTACHED TO UPPER CHORD MEMBER ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

3. VIEW OF MAKERS PLATE ATTACHED TO UPPER CHORD MEMBER WHICH STATES 'HUSTON AND CLEVELAND CONTRACTORS, COLUMBUS, OHIO, 1904.' - Main Street Parker Pony Truss Bridge, Main Street (Route 170) spanning Yellow Creek, Poland, Mahoning County, OH

Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

PubMed

Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

2011-01-01

The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

Current knowledge on bioacoustics of the subfamily Lophyohylinae (Hylidae, Anura) and description of Ocellated treefrog Itapotihyla langsdorffii vocalizations.

PubMed

Forti, Lucas Rodriguez; Foratto, Roseli Maria; Márquez, Rafael; Pereira, Vânia Rosa; Toledo, Luís Felipe

2018-01-01

Anuran vocalizations, such as advertisement and release calls, are informative for taxonomy because species recognition can be based on those signals. Thus, a proper acoustic description of the calls may support taxonomic decisions and may contribute to knowledge about amphibian phylogeny. Here we present a perspective on advertisement call descriptions of the frog subfamily Lophyohylinae, through a literature review and a spatial analysis presenting bioacoustic coldspots (sites with high diversity of species lacking advertisement call descriptions) for this taxonomic group. Additionally, we describe the advertisement and release calls of the still poorly known treefrog, Itapotihyla langsdorffii . We analyzed recordings of six males using the software Raven Pro 1.4 and calculated the coefficient of variation for classifying static and dynamic acoustic properties. We found that more than half of the species within the subfamily do not have their vocalizations described yet. Most of these species are distributed in the western and northern Amazon, where recording sampling effort should be strengthened in order to fill these gaps. The advertisement call of I. langsdorffii is composed of 3-18 short unpulsed notes (mean of 13 ms long), presents harmonic structure, and has a peak dominant frequency of about 1.4 kHz. This call usually presents amplitude modulation, with decreasing intensity along the sequence of notes. The release call is a simple unpulsed note with an average duration of 9 ms, and peak dominant frequency around 1.8 kHz. Temporal properties presented higher variations than spectral properties at both intra- and inter-individual levels. However, only peak dominant frequency was static at intra-individual level. High variability in temporal properties and lower variations related to spectral ones is usual for anurans; The first set of variables is determined by social environment or temperature, while the second is usually related to species

3. DETAIL OF TRUSS PANELS AND INCLINED PORTAL MEMBER AT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

3. DETAIL OF TRUSS PANELS AND INCLINED PORTAL MEMBER AT THE SOUTHEAST ENTRANCE TO THE BRIDGE, LOOKING WEST. - Chicago, Madison & Northern Railroad, Sanitary & Ship Canal Bridge, Spanning Sanitary & Ship Canal, east of Kedzie Avenue, Chicago, Cook County, IL

Fourfold polyphyly of the genus formerly known as Upucerthia, with notes on the systematics and evolution of the avian subfamily Furnariinae

USGS Publications Warehouse

Chesser, R.T.; Barker, F.K.; Brumfield, R.T.

2007-01-01

The traditional avian subfamily Furnariinae, a group of terrestrial ovenbirds typical of the Andean and Patagonian arid zones, consists of the genera Furnarius, Cinclodes, Geositta, Upucerthia, Chilia, and Eremobius. We investigated phylogenetic relationships within the Furnariinae, with particular attention to the nine species of the genus Upucerthia, using nuclear and mitochondrial DNA sequences from all genera in the subfamily. Upucerthia was found to be highly polyphyletic, its constituent species forming four non-sister clades: (1) a basal lineage consisting of two Upucerthia species, U. ruficaudus and U. andaecola, as well as the monotypic genera Eremobius and Chilia; (2) a lineage consisting of U. harterti and U. certhioides, two species behaviorally divergent from other Upucerthia species; (3) a lineage consisting of U. serrana, which is not closely related to any other Upucerthia species; and (4) a lineage, sister to Cinclodes, consisting of the four Upucerthia species U. dumetaria, U. albigula, U. validirostris, and U. jelskii. The larger Furnariinae was also found to be highly polyphyletic; the terrestrial open country ecotype characteristic of this subfamily occurs in four unrelated clades in the family Furnariidae, including a basal lineage as well as derived lineages. Although the large degree of divergence among Upucerthia clades was not previously recognized, owing to ecological, behavioral, and morphological similarities, the groupings correspond closely to relationships suggested by plumage. This is in contrast to studies of other avian genera in which plumage patterns have been shown to be extensively convergent. The generic names Upucerthia and Ochetorhynchus are available for two of the former Upucerthia clades; new generic names may be warranted for the other two.

NRfamPred: a proteome-scale two level method for prediction of nuclear receptor proteins and their sub-families.

PubMed

Kumar, Ravindra; Kumari, Bandana; Srivastava, Abhishikha; Kumar, Manish

2014-10-29

Nuclear receptor proteins (NRP) are transcription factor that regulate many vital cellular processes in animal cells. NRPs form a super-family of phylogenetically related proteins and divided into different sub-families on the basis of ligand characteristics and their functions. In the post-genomic era, when new proteins are being added to the database in a high-throughput mode, it becomes imperative to identify new NRPs using information from amino acid sequence alone. In this study we report a SVM based two level prediction systems, NRfamPred, using dipeptide composition of proteins as input. At the 1st level, NRfamPred screens whether the query protein is NRP or non-NRP; if the query protein belongs to NRP class, prediction moves to 2nd level and predicts the sub-family. Using leave-one-out cross-validation, we were able to achieve an overall accuracy of 97.88% at the 1st level and an overall accuracy of 98.11% at the 2nd level with dipeptide composition. Benchmarking on independent datasets showed that NRfamPred had comparable accuracy to other existing methods, developed on the same dataset. Our method predicted the existence of 76 NRPs in the human proteome, out of which 14 are novel NRPs. NRfamPred also predicted the sub-families of these 14 NRPs.

Characterization of human ATP-binding cassette protein subfamily D reconstituted into proteoliposomes.

PubMed

Okamoto, Takumi; Kawaguchi, Kosuke; Watanabe, Shiro; Agustina, Rina; Ikejima, Toshiki; Ikeda, Keisuke; Nakano, Minoru; Morita, Masashi; Imanaka, Tsuneo

2018-02-19

In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1‒3 are located on peroxisomal membrane and play an important role in the transportation of various fatty acid-CoA derivatives, including very long chain fatty acid-CoA, into peroxisomes. ABCD4 is located on lysosomal membrane and is suggested to be involved in the transport of vitamin B 12 from lysosomes to the cytosol. However, the precise transport mechanism by which these ABC transporters facilitate the import or export of substrate has yet to be well elucidated. In this study, the overexpression of human ABCD1‒4 in the methylotrophic yeast Pichia pastoris and a purification procedure were developed. The detergent-solubilized proteins were reconstituted into liposomes. ABCD1‒4 displayed stable ATPase activity, which was inhibited by AlF 3 . Furthermore, ABCD1‒4 were found to possess an equal levels of acyl-CoA thioesterase activity. Proteoliposomes is expected to be an aid in the further biochemical characterization of ABCD transporters. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular phylogenetics of subfamily Ornithogaloideae (Hyacinthaceae) based on nuclear and plastid DNA regions, including a new taxonomic arrangement

PubMed Central

Martínez-Azorín, Mario; Crespo, Manuel B.; Juan, Ana; Fay, Michael F.

2011-01-01

Background and Aims The taxonomic arrangement within subfamily Ornithogaloideae (Hyacinthaceae) has been a matter of controversy in recent decades: several new taxonomic treatments have been proposed, based exclusively on plastid DNA sequences, and these have resulted in classifications which are to a great extent contradictory. Some authors have recognized only a single genus Ornithogalum for the whole subfamily, including 250–300 species of variable morphology, whereas others have recognized many genera. In the latter case, the genera are inevitably much smaller and they are better defined morphologically. However, some are not monophyletic as circumscribed. Methods Phylogenetic analyses of Ornithogaloideae were based on nucleotide sequences of four plastid regions (trnL intron, trnL-F spacer, rbcL and matK) and a nuclear region (ITS). Eighty species covering all relevant taxonomic groups previously recognized in the subfamily were sampled. Parsimony and Bayesian analyses were performed. The molecular data were compared with a matrix of 34 morphological characters. Key Results Combinations of plastid and nuclear data yielded phylogenetic trees which are better resolved than those obtained with any plastid region alone or plastid regions in combination. Three main clades are found, corresponding to the previously recognized tribes Albuceae, Dipcadieae and Ornithogaleae. In these, up to 19 clades are described which are definable by morphology and biogeography. These mostly correspond to previously described taxa, though some need recircumscription. Morphological characters are assessed for their diagnostic value for taxonomy in the subfamily. Conclusions On the basis of the phylogenetic analyses, 19 monophyletic genera are accepted within Ornithogaloideae: Albuca, Avonsera, Battandiera, Cathissa, Coilonox, Dipcadi, Eliokarmos, Elsiea, Ethesia, Galtonia, Honorius, Loncomelos, Melomphis, Neopatersonia, Nicipe, Ornithogalum, Pseudogaltonia, Stellarioides and

Histone deacetylase 3 indirectly modulates tubulin acetylation

PubMed Central

Bacon, Travis; Seiler, Caroline; Wolny, Marcin; Hughes, Ruth; Watson, Peter; Schwabe, John; Grigg, Ronald; Peckham, Michelle

2015-01-01

Histone deacetylase 3 (HDAC3), a member of the Class I subfamily of HDACs, is found in both the nucleus and the cytoplasm. Its roles in the nucleus have been well characterized, but its cytoplasmic roles are still not elucidated fully. We found that blocking HDAC3 activity using MI192, a compound specific for HDAC3, modulated tubulin acetylation in the human prostate cancer cell line PC3. A brief 1 h treatment of PC3 cells with MI192 significantly increased levels of tubulin acetylation and ablated the dynamic behaviour of microtubules in live cells. siRNA-mediated knockdown (KD) of HDAC3 in PC3 cells, significantly increased levels of tubulin acetylation, and overexpression reduced it. However, the active HDAC3–silencing mediator of retinoic and thyroid receptors (SMRT)–deacetylase-activating domain (DAD) complex did not directly deacetylate tubulin in vitro. These data suggest that HDAC3 indirectly modulates tubulin acetylation. PMID:26450925

Histone deacetylase 3 indirectly modulates tubulin acetylation.

PubMed

Bacon, Travis; Seiler, Caroline; Wolny, Marcin; Hughes, Ruth; Watson, Peter; Schwabe, John; Grigg, Ronald; Peckham, Michelle

2015-12-15

Histone deacetylase 3 (HDAC3), a member of the Class I subfamily of HDACs, is found in both the nucleus and the cytoplasm. Its roles in the nucleus have been well characterized, but its cytoplasmic roles are still not elucidated fully. We found that blocking HDAC3 activity using MI192, a compound specific for HDAC3, modulated tubulin acetylation in the human prostate cancer cell line PC3. A brief 1 h treatment of PC3 cells with MI192 significantly increased levels of tubulin acetylation and ablated the dynamic behaviour of microtubules in live cells. siRNA-mediated knockdown (KD) of HDAC3 in PC3 cells, significantly increased levels of tubulin acetylation, and overexpression reduced it. However, the active HDAC3-silencing mediator of retinoic and thyroid receptors (SMRT)-deacetylase-activating domain (DAD) complex did not directly deacetylate tubulin in vitro. These data suggest that HDAC3 indirectly modulates tubulin acetylation. © 2015 Authors.

Repressive histone methylation regulates cardiac myocyte cell cycle exit.

PubMed

El-Nachef, Danny; Oyama, Kyohei; Wu, Yun-Yu; Freeman, Miles; Zhang, Yiqiang; Robb MacLellan, W

2018-05-22

Mammalian cardiac myocytes (CMs) stop proliferating soon after birth and subsequent heart growth comes from hypertrophy, limiting the adult heart's regenerative potential after injury. The molecular events that mediate CM cell cycle exit are poorly understood. To determine the epigenetic mechanisms limiting CM cycling in adult CMs (ACMs) and whether trimethylation of lysine 9 of histone H3 (H3K9me3), a histone modification associated with repressed chromatin, is required for the silencing of cell cycle genes, we developed a transgenic mouse model where H3K9me3 is specifically removed in CMs by overexpression of histone demethylase, KDM4D. Although H3K9me3 is found across the genome, its loss in CMs preferentially disrupts cell cycle gene silencing. KDM4D binds directly to cell cycle genes and reduces H3K9me3 levels at these promotors. Loss of H3K9me3 preferentially leads to increased cell cycle gene expression resulting in enhanced CM cycling. Heart mass was increased in KDM4D overexpressing mice by postnatal day 14 (P14) and continued to increase until 9-weeks of age. ACM number, but not size, was significantly increased in KDM4D expressing hearts, suggesting CM hyperplasia accounts for the increased heart mass. Inducing KDM4D after normal development specifically in ACMs resulted in increased cell cycle gene expression and cycling. We demonstrated that H3K9me3 is required for CM cell cycle exit and terminal differentiation in ACMs. Depletion of H3K9me3 in adult hearts prevents and reverses permanent cell cycle exit and allows hyperplastic growth in adult hearts in vivo. Copyright © 2017. Published by Elsevier Ltd.

THE GRK4 SUBFAMILY OF G PROTEIN-COUPLED RECEPTOR KINASES: ALTERNATIVE SPLICING, GENE ORGANIZATION, AND SEQUENCE CONSERVATION

EPA Science Inventory

The GRK4 subfamily of G protein-coupled receptor kinases. Alternative splicing, gene organization, and sequence conservation.

Premont RT, Macrae AD, Aparicio SA, Kendall HE, Welch JE, Lefkowitz RJ.

Department of Medicine, Howard Hughes Medical Institute, Duke Univer...

Multimodal use of calcitonin gene-related peptide and substance P in itch and acute pain uncovered by the elimination of vesicular glutamate transporter 2 from transient receptor potential cation channel subfamily V member 1 neurons.

PubMed

Rogoz, Katarzyna; Andersen, Helena H; Lagerström, Malin C; Kullander, Klas

2014-10-15

Primary afferents are known to use glutamate as their principal fast neurotransmitter. However, it has become increasingly clear that peptides have an influential role in both mediating and modulating sensory transmission. Here we describe the transmission accounting for different acute pain states and itch transmitted via the transient receptor potential cation channel subfamily V member 1 (TRPV1) population by either ablating Trpv1-Cre-expressing neurons or inducing vesicular glutamate transporter 2 (VGLUT2) deficiency in Trpv1-Cre-expressing neurons. Furthermore, by pharmacological inhibition of substance P or calcitonin gene-related peptide (CGRP) signaling in Vglut2-deficient mice, we evaluated the contribution of substance P or CGRP to these sensory modulations, with or without the presence of VGLUT2-mediated glutamatergic transmission in Trpv1-Cre neurons. This examination, together with c-Fos analyses, showed that glutamate via VGLUT2 in the Trpv1-Cre population together with substance P mediate acute cold pain, whereas glutamate together with CGRP mediate noxious heat. Moreover, we demonstrate that glutamate together with both substance P and CGRP mediate tissue-injury associated pain. We further show that itch, regulated by the VGLUT2-mediated transmission via the Trpv1-Cre population, depends on CGRP and gastrin-releasing peptide receptor (GRPR) transmission because pharmacological blockade of the CGRP or GRPR pathway, or genetic ablation of Grpr, led to a drastically attenuated itch. Our study reveals how different neurotransmitters combined can cooperate with each other to transmit or regulate various acute sensations, including itch. Copyright © 2014 the authors 0270-6474/14/3414055-14$15.00/0.

Using amphiphilic pseudo amino acid composition to predict enzyme subfamily classes.

PubMed

Chou, Kuo-Chen

2005-01-01

With protein sequences entering into databanks at an explosive pace, the early determination of the family or subfamily class for a newly found enzyme molecule becomes important because this is directly related to the detailed information about which specific target it acts on, as well as to its catalytic process and biological function. Unfortunately, it is both time-consuming and costly to do so by experiments alone. In a previous study, the covariant-discriminant algorithm was introduced to identify the 16 subfamily classes of oxidoreductases. Although the results were quite encouraging, the entire prediction process was based on the amino acid composition alone without including any sequence-order information. Therefore, it is worthy of further investigation. To incorporate the sequence-order effects into the predictor, the 'amphiphilic pseudo amino acid composition' is introduced to represent the statistical sample of a protein. The novel representation contains 20 + 2lambda discrete numbers: the first 20 numbers are the components of the conventional amino acid composition; the next 2lambda numbers are a set of correlation factors that reflect different hydrophobicity and hydrophilicity distribution patterns along a protein chain. Based on such a concept and formulation scheme, a new predictor is developed. It is shown by the self-consistency test, jackknife test and independent dataset tests that the success rates obtained by the new predictor are all significantly higher than those by the previous predictors. The significant enhancement in success rates also implies that the distribution of hydrophobicity and hydrophilicity of the amino acid residues along a protein chain plays a very important role to its structure and function.

An Uncharacterized Member of the Ribokinase Family in Thermococcus kodakarensis Exhibits myo-Inositol Kinase Activity*

PubMed Central

Sato, Takaaki; Fujihashi, Masahiro; Miyamoto, Yukika; Kuwata, Keiko; Kusaka, Eriko; Fujita, Haruo; Miki, Kunio; Atomi, Haruyuki

2013-01-01

Here we performed structural and biochemical analyses on the TK2285 gene product, an uncharacterized protein annotated as a member of the ribokinase family, from the hyperthermophilic archaeon Thermococcus kodakarensis. The three-dimensional structure of the TK2285 protein resembled those of previously characterized members of the ribokinase family including ribokinase, adenosine kinase, and phosphofructokinase. Conserved residues characteristic of this protein family were located in a cleft of the TK2285 protein as in other members whose structures have been determined. We thus examined the kinase activity of the TK2285 protein toward various sugars recognized by well characterized ribokinase family members. Although activity with sugar phosphates and nucleosides was not detected, kinase activity was observed toward d-allose, d-lyxose, d-tagatose, d-talose, d-xylose, and d-xylulose. Kinetic analyses with the six sugar substrates revealed high Km values, suggesting that they were not the true physiological substrates. By examining activity toward amino sugars, sugar alcohols, and disaccharides, we found that the TK2285 protein exhibited prominent kinase activity toward myo-inositol. Kinetic analyses with myo-inositol revealed a greater kcat and much lower Km value than those obtained with the monosaccharides, resulting in over a 2,000-fold increase in kcat/Km values. TK2285 homologs are distributed among members of Thermococcales, and in most species, the gene is positioned close to a myo-inositol monophosphate synthase gene. Our results suggest the presence of a novel subfamily of the ribokinase family whose members are present in Archaea and recognize myo-inositol as a substrate. PMID:23737529

Genome-wide analysis of the homeodomain-leucine zipper (HD-ZIP) gene family in peach (Prunus persica).

PubMed

Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L

2014-04-08

In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.

A Species-Level Phylogeny of Extant Snakes with Description of a New Colubrid Subfamily and Genus.

PubMed

Figueroa, Alex; McKelvy, Alexander D; Grismer, L Lee; Bell, Charles D; Lailvaux, Simon P

2016-01-01

With over 3,500 species encompassing a diverse range of morphologies and ecologies, snakes make up 36% of squamate diversity. Despite several attempts at estimating higher-level snake relationships and numerous assessments of generic- or species-level phylogenies, a large-scale species-level phylogeny solely focusing on snakes has not been completed. Here, we provide the largest-yet estimate of the snake tree of life using maximum likelihood on a supermatrix of 1745 taxa (1652 snake species + 7 outgroup taxa) and 9,523 base pairs from 10 loci (5 nuclear, 5 mitochondrial), including previously unsequenced genera (2) and species (61). Increased taxon sampling resulted in a phylogeny with a new higher-level topology and corroborate many lower-level relationships, strengthened by high nodal support values (> 85%) down to the species level (73.69% of nodes). Although the majority of families and subfamilies were strongly supported as monophyletic with > 88% support values, some families and numerous genera were paraphyletic, primarily due to limited taxon and loci sampling leading to a sparse supermatrix and minimal sequence overlap between some closely-related taxa. With all rogue taxa and incertae sedis species eliminated, higher-level relationships and support values remained relatively unchanged, except in five problematic clades. Our analyses resulted in new topologies at higher- and lower-levels; resolved several previous topological issues; established novel paraphyletic affiliations; designated a new subfamily, Ahaetuliinae, for the genera Ahaetulla, Chrysopelea, Dendrelaphis, and Dryophiops; and appointed Hemerophis (Coluber) zebrinus to a new genus, Mopanveldophis. Although we provide insight into some distinguished problematic nodes, at the deeper phylogenetic scale, resolution of these nodes may require sampling of more slowly-evolving nuclear genes.

A Species-Level Phylogeny of Extant Snakes with Description of a New Colubrid Subfamily and Genus

PubMed Central

McKelvy, Alexander D.; Grismer, L. Lee; Bell, Charles D.; Lailvaux, Simon P.

2016-01-01

Background With over 3,500 species encompassing a diverse range of morphologies and ecologies, snakes make up 36% of squamate diversity. Despite several attempts at estimating higher-level snake relationships and numerous assessments of generic- or species-level phylogenies, a large-scale species-level phylogeny solely focusing on snakes has not been completed. Here, we provide the largest-yet estimate of the snake tree of life using maximum likelihood on a supermatrix of 1745 taxa (1652 snake species + 7 outgroup taxa) and 9,523 base pairs from 10 loci (5 nuclear, 5 mitochondrial), including previously unsequenced genera (2) and species (61). Results Increased taxon sampling resulted in a phylogeny with a new higher-level topology and corroborate many lower-level relationships, strengthened by high nodal support values (> 85%) down to the species level (73.69% of nodes). Although the majority of families and subfamilies were strongly supported as monophyletic with > 88% support values, some families and numerous genera were paraphyletic, primarily due to limited taxon and loci sampling leading to a sparse supermatrix and minimal sequence overlap between some closely-related taxa. With all rogue taxa and incertae sedis species eliminated, higher-level relationships and support values remained relatively unchanged, except in five problematic clades. Conclusion Our analyses resulted in new topologies at higher- and lower-levels; resolved several previous topological issues; established novel paraphyletic affiliations; designated a new subfamily, Ahaetuliinae, for the genera Ahaetulla, Chrysopelea, Dendrelaphis, and Dryophiops; and appointed Hemerophis (Coluber) zebrinus to a new genus, Mopanveldophis. Although we provide insight into some distinguished problematic nodes, at the deeper phylogenetic scale, resolution of these nodes may require sampling of more slowly-evolving nuclear genes. PMID:27603205

Cryo-EM structure of the cytoplasmic domain of murine transient receptor potential cation channel subfamily C member 6 (TRPC6).

PubMed

Azumaya, Caleigh M; Sierra-Valdez, Francisco; Cordero-Morales, Julio F; Nakagawa, Terunaga

2018-05-11

The kidney maintains the internal milieu by regulating the retention and excretion of proteins, ions, and small molecules. The glomerular podocyte forms the slit diaphragm of the ultrafiltration filter, whose damage leads to progressive kidney failure and focal segmental glomerulosclerosis (FSGS). The canonical transient receptor potential 6 (TRPC6) ion channel is expressed in the podocyte and mutations in its cytoplasmic domain cause FSGS in humans. In vitro evaluation of disease-causing mutations in TRPC6 has revealed that these genetic alterations result in abnormal ion channel gating. However, the mechanism whereby the cytoplasmic domain modulates TRPC6 function is largely unknown. Here we report a cryoEM structure of the cytoplasmic domain of murine TRPC6 at 3.8Å resolution. The cytoplasmic fold of TRPC6 is characterized by an inverted dome-like chamber pierced by four radial horizontal helices that converge into a vertical coiled-coil at the central axis. Unlike in other TRP channels, TRPC6 displays a unique domain swap that occurs at the junction of the horizontal helices and coiled-coil. Multiple FSGS mutations converge at the buried interface between the vertical coiled-coil and the ankyrin repeats, which form the dome, suggesting these regions are critical for allosteric gating modulation. This functionally critical interface is a potential target for drug design. Importantly, dysfunction in other family members leads to learning deficits (TRPC1/4/5) and ataxia (TRPC3). Our data provide a structural framework for the mechanistic investigation of the TRPC family. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas.

PubMed

Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C

1994-06-17

A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.

Towards a molecular taxonomic key of the Aurantioideae subfamily using chloroplastic SNP diagnostic markers of the main clades genotyped by competitive allele-specific PCR.

PubMed

Oueslati, Amel; Ollitrault, Frederique; Baraket, Ghada; Salhi-Hannachi, Amel; Navarro, Luis; Ollitrault, Patrick

2016-08-18

Chloroplast DNA is a primary source of molecular variations for phylogenetic analysis of photosynthetic eukaryotes. However, the sequencing and analysis of multiple chloroplastic regions is difficult to apply to large collections or large samples of natural populations. The objective of our work was to demonstrate that a molecular taxonomic key based on easy, scalable and low-cost genotyping method should be developed from a set of Single Nucleotide Polymorphisms (SNPs) diagnostic of well-established clades. It was applied to the Aurantioideae subfamily, the largest group of the Rutaceae family that includes the cultivated citrus species. The publicly available nucleotide sequences of eight plastid genomic regions were compared for 79 accessions of the Aurantioideae subfamily to search for SNPs revealing taxonomic differentiation at the inter-tribe, inter-subtribe, inter-genus and interspecific levels. Diagnostic SNPs (DSNPs) were found for 46 of the 54 clade levels analysed. Forty DSNPs were selected to develop KASPar markers and their taxonomic value was tested by genotyping 108 accessions of the Aurantioideae subfamily. Twenty-seven markers diagnostic of 24 clades were validated and they displayed a very high rate of transferability in the Aurantioideae subfamily (only 1.2 % of missing data on average). The UPGMA from the validated markers produced a cladistic organisation that was highly coherent with the previous phylogenetic analysis based on the sequence data of the eight plasmid regions. In particular, the monophyletic origin of the "true citrus" genera plus Oxanthera was validated. However, some clarification remains necessary regarding the organisation of the other wild species of the Citreae tribe. We validated the concept that with well-established clades, DSNPs can be selected and efficiently transformed into competitive allele-specific PCR markers (KASPar method) allowing cost-effective highly efficient cladistic analysis in large collections at

Origins and function of 3-ribosylurate in bovid erythrocytes.

PubMed

Davids, V; Blackhurst, D M; Katz, A A; Harley, E H

2012-06-01

3-Ribosylurate is a dominant feature on high performance liquid chromatography (HPLC) profiles of acid extracts of erythrocytes from cows and buffalo, but is HPLC-undetectable in acid extracts of erythrocytes from all other species examined to date. Various aspects of this unique low molecular weight substance remain unexplored since it was first identified. In this study, the mutation(s) responsible for the appearance of ribosylurate in these cells is shown to be specific to members of both tribes of the Bovinae subfamily (Bovidae family), being detectable in the erythrocytes of both the cow and the buffalo (Bovini tribe) as well as in the kudu (Strepsicerotini tribe), but not in representative species from the other subfamilies of the Bovidae family. More specifically, expression of the mutation(s) seems to be restricted to the erythrocyte lineage of these species, ribosylurate being undetectable in cow white blood cells and primary cultures of fibroblasts. Novel evidence is presented that ribosylurate has antioxidant activity. Accumulation of high levels specifically within the haemoglobin-rich milieu of circulating erythrocytes may serve to protect perfused tissues by removing pathophysiological levels of hydrogen peroxide from plasma. Maintenance of ribosylurate levels may be important in conditions associated with oxidative stress in Bovinae. Copyright © 2011 Elsevier Ltd. All rights reserved.

Novel members of the adipokinetic hormone family in beetles of the superfamily Scarabaeoidea.

PubMed

Gäde, Gerd; Šimek, Petr; Marco, Heather G

2016-12-01

Eight beetle species of the superfamily Scarabaeoidea were investigated with respect to peptides belonging to the adipokinetic hormone (AKH) family in their neurohemal organs, the corpora cardiaca (CC). The following beetle families are represented: Scarabaeidae, Lucanidae, and Geotrupidae. AKH peptides were identified through a heterospecific trehalose-mobilizing bioassay and by sequence analyses, using liquid chromatography coupled to positive electrospray mass spectrometry (LC-ESI-MS) and analysis of the tandem MS 2 spectra obtained by collision-induced dissociation. All the beetle species have octapeptide AKHs; some have two AKHs, while others have only one. Novel AKH members were found in Euoniticellus intermedius and Circellium bacchus (family Scarabaeidae), as well as in Dorcus parallelipipedus (family Lucanidae). Two species of the family Geotrupidae and two species of the Scarabaeidae subfamily Cetoniinae contain one known AKH peptide, Melme-CC, while E. intermedius produces a novel peptide code named Euoin-AKH: pEINFTTGWamide. Two AKH peptides were each identified in CC of C. bacchus and D. parallelipipedus: the novel Cirba-AKH: pEFNFSAGWamide and the known peptide, Scade-CC-I in the former, and the novel Dorpa-AKH: pEVNYSPVW amide and the known peptide, Melme-CC in the latter. Kheper bonelli (subfamily Scarabaeinae) also has two AKHs, the known Scade-CC-I and Scade-CC-II. All the novel peptides were synthesized and the amino acid sequence assignments were unequivocally confirmed by co-elution of the synthetic peptides with their natural equivalent, and identical MS parameters of the two forms. The novel synthetic peptides are all active in inducing hypertrehalosemia in cockroaches.

Inhibition of the EGFR/STAT3/CEBPD Axis Reverses Cisplatin Cross-resistance with Paclitaxel in the Urothelial Carcinoma of the Urinary Bladder.

PubMed

Wang, Wei-Jan; Li, Chien-Feng; Chu, Yu-Yi; Wang, Yu-Hui; Hour, Tzyh-Chyuan; Yen, Chia-Jui; Chang, Wen-Chang; Wang, Ju-Ming

2017-01-15

Cisplatin (CDDP) is frequently used in combination chemotherapy with paclitaxel for treating urothelial carcinoma of the urinary bladder (UCUB). CDDP cross-resistance has been suggested to develop with paclitaxel, thus hindering successful UCUB treatment. Therefore, elucidating the mechanisms underlying CDDP-induced anticancer drug resistance is imperative and may provide an insight in developing novel therapeutic strategy. Loss-of-function assays were performed to elucidate the role of the EGFR and STAT3 in CDDP-induced CCAAT/enhancer-binding protein delta (CEBPD) expression in UCUB cells. Reporter and in vivo DNA-binding assays were employed to determine whether CEBPD directly regulates ATP binding cassette subfamily B member 1 (ABCB1) and ATP binding cassette subfamily C member 2 (ABCC2) activation. Finally, a xenograft animal assay was used to examine the abilities of gefitinib and S3I-201 (a STAT3 inhibitor) to reverse CDDP and paclitaxel sensitivity. CEBPD expression was maintained in postoperative chemotherapy patients, and this expression was induced by CDDP even in CDDP-resistant UCUB cells. Upon CDDP treatment, CEBPD activated ABCB1 and ABCC2. Furthermore, the EGFR/STAT3 pathway contributed to CDDP-induced CEBPD expression in UCUB cells. Gefitinib and S3I-201 treatment significantly reduced the expression of CEBPD and enhanced the sensitivity of CDDP-resistant UCUB cells to CDDP and paclitaxel. Our results revealed the risk of CEBPD activation in CDDP-resistant UCUB cells and suggested a therapeutic strategy for patients with UCUB or UCUB resisted to CDDP and paclitaxel by combination with either gefitinib or S3I-201. Clin Cancer Res; 23(2); 503-13. ©2016 AACR. ©2016 American Association for Cancer Research.

Flower development: the evolutionary history and functions of the AGL6 subfamily MADS-box genes.

PubMed

Dreni, Ludovico; Zhang, Dabing

2016-03-01

AGL6 is an ancient subfamily of MADS-box genes found in both gymnosperms and angiosperms. Its functions remained elusive despite the fact that the MADS-box genes and the ABC model have been studied for >20 years. Nevertheless, recent discoveries in petunia, rice, and maize support its involvement in the 'E' function of floral development, very similar to the closely related AGL2 (SEPALLATA) subfamily which has been well characterized. The known functions of AGL6 span from ancient conserved roles to new functions acquired in specific plant families. The AGL6 genes are involved in floral meristem regulation, in floral organs, and ovule (integument) and seed development, and have possible roles in both male and female germline and gametophyte development. In grasses, they are also important for the development of the first whorl of the flower, whereas in Arabidopsis they may play additional roles before floral meristem formation. This review covers these recent insights and some other aspects that are not yet fully elucidated, which deserve more studies in the future. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Role for ribosome-associated complex and stress-seventy subfamily B (RAC-Ssb) in integral membrane protein translation.

PubMed

Acosta-Sampson, Ligia; Döring, Kristina; Lin, Yuping; Yu, Vivian Y; Bukau, Bernd; Kramer, Günter; Cate, Jamie H D

2017-12-01

Targeting of most integral membrane proteins to the endoplasmic reticulum is controlled by the signal recognition particle, which recognizes a hydrophobic signal sequence near the protein N terminus. Proper folding of these proteins is monitored by the unfolded protein response and involves protein degradation pathways to ensure quality control. Here, we identify a new pathway for quality control of major facilitator superfamily transporters that occurs before the first transmembrane helix, the signal sequence recognized by the signal recognition particle, is made by the ribosome. Increased rates of translation elongation of the N-terminal sequence of these integral membrane proteins can divert the nascent protein chains to the ribosome-associated complex and stress-seventy subfamily B chaperones. We also show that quality control of integral membrane proteins by ribosome-associated complex-stress-seventy subfamily B couples translation rate to the unfolded protein response, which has implications for understanding mechanisms underlying human disease and protein production in biotechnology. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Rediscovered and new perisphaerine cockroaches from SW China with a review of subfamilial diagnosis (Blattodea: Blaberidae).

PubMed

Li, Xin-Ran; Wang, Li-Li; Wang, Zong-Qing

2018-04-17

The taxonomic records of Chinese perisphaerine cockroaches were scattered in literature, and therefore a dedicated study is desired to update our knowledge. This paper reviews the subfamilial diagnosis and Chinese species, mostly from southwestern China. We provide high-definition habitus photos and drawings, the latter emphasizes the genitalia of both sexes, which are generalized with diagrams, abstracted from specimens examined. A total of 18 species are recorded in four genera, including Perisphaerus, or pill cockroach, the type genus of the subfamily. Two new genera and three new species are proposed: Achatiblatta achates gen. sp. nov., Frumentiforma frumentiformis gen. sp. nov., and Pseudoglomeris montana sp. nov.. Pseudoglomeris has five new junior synonyms: Corydidarum, Trichoblatta, Kurokia, Glomerexis, and Glomeriblatta; the following combinations are thus revived or new: Ps. aerea comb. nov., Ps. angustifolia comb. nov., Ps. beybienkoi comb. nov., Ps. fallax comb. nov., Ps. magnifica comb. rev., Ps. montshadskii comb. nov., Ps. nigra comb. nov., Ps. sculpta comb. nov., Ps. semisulcata comb. rev., Ps. tibetana comb. nov., and Ps. valida moderata comb. nov.. The following species are revalidated and combinations revived: Pe. pygmaeus comb. rev., Ps. dubia comb. sp. rev., and Ps. planiuscla comb. sp. rev.

17 CFR 240.19c-3 - Governing off-board trading by members of national securities exchanges.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Governing off-board trading by... Members § 240.19c-3 Governing off-board trading by members of national securities exchanges. The rules of... in any reported security listed and registered on this exchange or as to which unlisted trading...

17 CFR 240.19c-3 - Governing off-board trading by members of national securities exchanges.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 17 Commodity and Securities Exchanges 3 2012-04-01 2012-04-01 false Governing off-board trading by... Members § 240.19c-3 Governing off-board trading by members of national securities exchanges. The rules of... in any reported security listed and registered on this exchange or as to which unlisted trading...

17 CFR 240.19c-3 - Governing off-board trading by members of national securities exchanges.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 17 Commodity and Securities Exchanges 3 2013-04-01 2013-04-01 false Governing off-board trading by... Members § 240.19c-3 Governing off-board trading by members of national securities exchanges. The rules of... in any reported security listed and registered on this exchange or as to which unlisted trading...

17 CFR 240.19c-3 - Governing off-board trading by members of national securities exchanges.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Governing off-board trading by... Members § 240.19c-3 Governing off-board trading by members of national securities exchanges. The rules of... in any reported security listed and registered on this exchange or as to which unlisted trading...

Salt-dependent regulation of a CNG channel subfamily in Arabidopsis.

PubMed

Kugler, Annette; Köhler, Barbara; Palme, Klaus; Wolff, Patricia; Dietrich, Petra

2009-11-27

In Arabidopsis thaliana, the family of cyclic nucleotide-gated channels (CNGCs) is composed of 20 members. Previous studies indicate that plant CNGCs are involved in the control of growth processes and responses to abiotic and biotic stresses. According to their proposed function as cation entry pathways these channels contribute to cellular cation homeostasis, including calcium and sodium, as well as to stress-related signal transduction. Here, we studied the expression patterns and regulation of CNGC19 and CNGC20, which constitute one of the five CNGC subfamilies. GUS, GFP and luciferase reporter assays were used to study the expression of CNGC19 and CNGC20 genes from Arabidopsis thaliana in response to developmental cues and salt stress. CNGC19 and CNGC20 were differentially expressed in roots and shoots. The CNGC19 gene was predominantly active in roots already at early growth stages. Major expression was observed in the phloem. CNGC20 showed highest promoter activity in mesophyll cells surrounding the veins. Its expression increased during development and was maximal in mature and senescent leaves. Both genes were upregulated in the shoot in response to elevated NaCl but not mannitol concentrations. While in the root, CNGC19 did not respond to changes in the salt concentration, in the shoot it was strongly upregulated in the observed time frame (6-72 hours). Salt-induction of CNGC20 was also observed in the shoot, starting already one hour after stress treatment. It occurred with similar kinetics, irrespective of whether NaCl was applied to roots of intact plants or to the petiole of detached leaves. No differences in K and Na contents of the shoots were measured in homozygous T-DNA insertion lines for CNGC19 and CNGC20, respectively, which developed a growth phenotype in the presence of up to 75 mM NaCl similar to that of the wild type. Together, the results strongly suggest that both channels are involved in the salinity response of different cell types in

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2012 CFR

2012-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2014 CFR

2014-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2013 CFR

2013-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2011 CFR

2011-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

A new phylogeny-based tribal classification of subfamily Detarioideae, an early branching clade of florally diverse tropical arborescent legumes.

PubMed

de la Estrella, Manuel; Forest, Félix; Klitgård, Bente; Lewis, Gwilym P; Mackinder, Barbara A; de Queiroz, Luciano P; Wieringa, Jan J; Bruneau, Anne

2018-05-02

Detarioideae (81 genera, c. 760 species) is one of the six Leguminosae subfamilies recently reinstated by the Legume Phylogeny Working Group. This subfamily displays high morphological variability and is one of the early branching clades in the evolution of legumes. Using previously published and newly generated sequences from four loci (matK-trnK, rpL16, trnG-trnG2G and ITS), we develop a new densely sampled phylogeny to assess generic relationships and tribal delimitations within Detarioideae. The ITS phylogenetic trees are poorly resolved, but the plastid data recover several strongly supported clades, which also are supported in a concatenated plastid + ITS sequence analysis. We propose a new phylogeny-based tribal classification for Detarioideae that includes six tribes: re-circumscribed Detarieae and Amherstieae, and the four new tribes Afzelieae, Barnebydendreae, Saraceae and Schotieae. An identification key and descriptions for each of the tribes are also provided.

The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tran, Timothy H.; Christoffersen, S.; Allan, Paula W.

2011-09-20

Uridine phosphorylase (UP), a key enzyme in the pyrimidine salvage pathway, catalyzes the reversible phosphorolysis of uridine or 2'-deoxyuridine to uracil and ribose 1-phosphate or 2'-deoxyribose 1-phosphate. This enzyme belongs to the nucleoside phosphorylase I superfamily whose members show diverse specificity for nucleoside substrates. Phylogenetic analysis shows Streptococcus pyogenes uridine phosphorylase (SpUP) is found in a distinct branch of the pyrimidine subfamily of nucleoside phosphorylases. To further characterize SpUP, we determined the crystal structure in complex with the products, ribose 1-phosphate and uracil, at 1.8 {angstrom} resolution. Like Escherichia coli UP (EcUP), the biological unit of SpUP is a hexamermore » with an ?/? monomeric fold. A novel feature of the active site is the presence of His169, which structurally aligns with Arg168 of the EcUP structure. A second active site residue, Lys162, is not present in previously determined UP structures and interacts with O2 of uracil. Biochemical studies of wild-type SpUP showed that its substrate specificity is similar to that of EcUP, while EcUP is {approx}7-fold more efficient than SpUP. Biochemical studies of SpUP mutants showed that mutations of His169 reduced activity, while mutation of Lys162 abolished all activity, suggesting that the negative charge in the transition state resides mostly on uracil O2. This is in contrast to EcUP for which transition state stabilization occurs mostly at O4.« less

The Search for Therapeutic Bacteriophages Uncovers One New Subfamily and Two New Genera of Pseudomonas-Infecting Myoviridae

PubMed Central

Henry, Marine; Bobay, Louis-Marie; Chevallereau, Anne; Saussereau, Emilie; Ceyssens, Pieter-Jan; Debarbieux, Laurent

2015-01-01

In a previous study, six virulent bacteriophages PAK_P1, PAK_P2, PAK_P3, PAK_P4, PAK_P5 and CHA_P1 were evaluated for their in vivo efficacy in treating Pseudomonas aeruginosa infections using a mouse model of lung infection. Here, we show that their genomes are closely related to five other Pseudomonas phages and allow a subdivision into two clades, PAK_P1-like and KPP10-like viruses, based on differences in genome size, %GC and genomic contents, as well as number of tRNAs. These two clades are well delineated, with a mean of 86% and 92% of proteins considered homologous within individual clades, and 25% proteins considered homologous between the two clades. By ESI-MS/MS analysis we determined that their virions are composed of at least 25 different proteins and electron microscopy revealed a morphology identical to the hallmark Salmonella phage Felix O1. A search for additional bacteriophage homologs, using profiles of protein families defined from the analysis of the 11 genomes, identified 10 additional candidates infecting hosts from different species. By carrying out a phylogenetic analysis using these 21 genomes we were able to define a new subfamily of viruses, the Felixounavirinae within the Myoviridae family. The new Felixounavirinae subfamily includes three genera: Felixounalikevirus, PAK_P1likevirus and KPP10likevirus. Sequencing genomes of bacteriophages with therapeutic potential increases the quantity of genomic data on closely related bacteriophages, leading to establishment of new taxonomic clades and the development of strategies for analyzing viral genomes as presented in this article. PMID:25629728

A consistent nomenclature of antimicrobial peptides isolated from frogs of the subfamily Phyllomedusinae.

PubMed

Amiche, Mohamed; Ladram, Ali; Nicolas, Pierre

2008-11-01

A growing number of cationic antimicrobial peptides have been isolated from the skin of hylid frogs belonging to the Phyllomedusinae subfamily. The amino acid sequences of these peptides are currently located in several databases under identifiers with no consistent system of nomenclature to describe them. In order to provide a workable terminology for antimicrobial peptides from Phyllomedusid frogs, we have made a systematic effort to collect, analyze, and classify all the Phyllomedusid peptide sequences available in databases. We propose that frogs belonging to the Phyllomedusinae subfamily should be described by the species names set out in Amphibian Species of the World: http://research.amnh.org/herpetology/amphibia/index.php, American Museum of Natural History, New York, USA. Multiple alignments analysis of at least 80 antimicrobial peptides isolated from 12 Phyllomedusinae species were distributed in seven distinct peptide families including dermaseptin, phylloseptin, plasticin, dermatoxin, phylloxin, hyposin and orphan peptides, and will be considered as the name of the headgroup of each family. The parent peptide's name should be followed by the first upper letter of the species for orthologous peptides and publication date determines priority. For example, the abbreviation B for bicolor and H for hypochondrialis. When two species begin with the same letter, two letters in upper case should be used (the first letter followed by the second or the third letter and so on). For example, the abbreviation DI for distincta, DU for duellmani, VA for vaillanti and VN for vanzolinii. Paralogous peptides should bear letter(s) in upper case followed by numbers.

Human kidney anion exchanger 1 interacts with kinesin family member 3B (KIF3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duangtum, Natapol; Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700; Junking, Mutita

Highlights: {yields} Impaired trafficking of kAE1 causes distal renal tubular acidosis (dRTA). {yields} The interaction between kAE1 and kinesin family member 3B (KIF3B) is reported. {yields} The co-localization between kAE and KIF3B was detected in human kidney tissues. {yields} A marked reduction of kAE1 on the cell membrane was observed when KIF3B was knockdown. {yields} KFI3B plays an important role in trafficking of kAE1 to the plasma membrane. -- Abstract: Impaired trafficking of human kidney anion exchanger 1 (kAE1) to the basolateral membrane of {alpha}-intercalated cells of the kidney collecting duct leads to the defect of the Cl{sup -}/HCO{sub 3}{supmore » -} exchange and the failure of proton (H{sup +}) secretion at the apical membrane of these cells, causing distal renal tubular acidosis (dRTA). In the sorting process, kAE1 interacts with AP-1 mu1A, a subunit of AP-1A adaptor complex. However, it is not known whether kAE1 interacts with motor proteins in its trafficking process to the plasma membrane or not. We report here that kAE1 interacts with kinesin family member 3B (KIF3B) in kidney cells and a dileucine motif at the carboxyl terminus of kAE1 contributes to this interaction. We have also demonstrated that kAE1 co-localizes with KIF3B in human kidney tissues and the suppression of endogenous KIF3B in HEK293T cells by small interfering RNA (siRNA) decreases membrane localization of kAE1 but increases its intracellular accumulation. All results suggest that KIF3B is involved in the trafficking of kAE1 to the plasma membrane of human kidney {alpha}-intercalated cells.« less

41 CFR 302-3.226 - Will the Government reimburse me if I am not eligible to return with my immediate family member(s...

Code of Federal Regulations, 2013 CFR

2013-07-01

... 41 Public Contracts and Property Management 4 2013-07-01 2012-07-01 true Will the Government... send them at my own expense? 302-3.226 Section 302-3.226 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Prior Return of Immediate Family Members § 302-3.226 Will the Government...

41 CFR 302-3.226 - Will the Government reimburse me if I am not eligible to return with my immediate family member(s...

Code of Federal Regulations, 2014 CFR

2014-07-01

... 41 Public Contracts and Property Management 4 2014-07-01 2014-07-01 false Will the Government... send them at my own expense? 302-3.226 Section 302-3.226 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Prior Return of Immediate Family Members § 302-3.226 Will the Government...

41 CFR 302-3.226 - Will the Government reimburse me if I am not eligible to return with my immediate family member(s...

Code of Federal Regulations, 2011 CFR

2011-07-01

... 41 Public Contracts and Property Management 4 2011-07-01 2011-07-01 false Will the Government... send them at my own expense? 302-3.226 Section 302-3.226 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Prior Return of Immediate Family Members § 302-3.226 Will the Government...

41 CFR 302-3.226 - Will the Government reimburse me if I am not eligible to return with my immediate family member(s...

Code of Federal Regulations, 2012 CFR

2012-07-01

... 41 Public Contracts and Property Management 4 2012-07-01 2012-07-01 false Will the Government... send them at my own expense? 302-3.226 Section 302-3.226 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Prior Return of Immediate Family Members § 302-3.226 Will the Government...

41 CFR 302-3.226 - Will the Government reimburse me if I am not eligible to return with my immediate family member(s...

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false Will the Government... send them at my own expense? 302-3.226 Section 302-3.226 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Prior Return of Immediate Family Members § 302-3.226 Will the Government...

The histone demethylase KDM5A is a key factor for the resistance to temozolomide in glioblastoma

PubMed Central

Banelli, Barbara; Carra, Elisa; Barbieri, Federica; Würth, Roberto; Parodi, Federica; Pattarozzi, Alessandra; Carosio, Roberta; Forlani, Alessandra; Allemanni, Giorgio; Marubbi, Daniela; Florio, Tullio; Daga, Antonio; Romani, Massimo

2015-01-01

Notwithstanding current multimodal treatment, including surgery, radiotherapy and chemotherapy with temozolomide (TMZ), median survival of glioblastoma (GBM) patients is about 14 months, due to the rapid emergence of cell clones resistant to treatment. Therefore, understanding the mechanisms underlying chemoresistance is mandatory to improve treatments' outcome. We generated TMZ resistant cells (TMZ-R) from a GBM cell line and from cancer stem cell-enriched cultures isolated from human GBMs. We demonstrated that TMZ resistance is partially reverted by “drug wash-out” suggesting the contribution of epigenetic mechanisms in drug resistance and supporting the possibility of TMZ rechallenge in GBM patients after prior drug exposure. The expression of histone lysine demethylase genes (KDMs) was increased in TMZ-R cells compared to parental cells, and TMZ resistance or restored sensitivity was mimicked by over-expressing or inactivating KDM5A. Methylation and expression of O6-methylguanine-DNA methyltransferase (MGMT) and drug efflux mechanisms were not altered in TMZ-R cells compared to parental TMZ sensitive cells. TMZ-R cells transiently acquired morphologic and molecular characteristics of differentiated tumor cells, features that were lost after drug wash-out. In conclusion, we demonstrated that treatment-induced TMZ resistance in GBM involves epigenetic mechanisms in a subset of slow-cycling and transiently partially differentiated cells that escape drug cytotoxicity, overcome G2 checkpoint and sustain clonal growth. We found that TMZ-R cells are sensitive to histone deacethylase inhibitors (HDACi) that synergize with TMZ. This strong synergism could be exploited to develop novel combined adjuvant therapies for this rapidly progressing and invariably lethal cancer. PMID:26566863

The histone demethylase KDM5A is a key factor for the resistance to temozolomide in glioblastoma.

PubMed

Banelli, Barbara; Carra, Elisa; Barbieri, Federica; Würth, Roberto; Parodi, Federica; Pattarozzi, Alessandra; Carosio, Roberta; Forlani, Alessandra; Allemanni, Giorgio; Marubbi, Daniela; Florio, Tullio; Daga, Antonio; Romani, Massimo

2015-01-01

Notwithstanding current multimodal treatment, including surgery, radiotherapy and chemotherapy with temozolomide (TMZ), median survival of glioblastoma (GBM) patients is about 14 months, due to the rapid emergence of cell clones resistant to treatment. Therefore, understanding the mechanisms underlying chemoresistance is mandatory to improve treatments' outcome. We generated TMZ resistant cells (TMZ-R) from a GBM cell line and from cancer stem cell-enriched cultures isolated from human GBMs. We demonstrated that TMZ resistance is partially reverted by "drug wash-out" suggesting the contribution of epigenetic mechanisms in drug resistance and supporting the possibility of TMZ rechallenge in GBM patients after prior drug exposure. The expression of histone lysine demethylase genes (KDMs) was increased in TMZ-R cells compared to parental cells, and TMZ resistance or restored sensitivity was mimicked by over-expressing or inactivating KDM5A. Methylation and expression of O6-methylguanine-DNA methyltransferase (MGMT) and drug efflux mechanisms were not altered in TMZ-R cells compared to parental TMZ sensitive cells. TMZ-R cells transiently acquired morphologic and molecular characteristics of differentiated tumor cells, features that were lost after drug wash-out. In conclusion, we demonstrated that treatment-induced TMZ resistance in GBM involves epigenetic mechanisms in a subset of slow-cycling and transiently partially differentiated cells that escape drug cytotoxicity, overcome G2 checkpoint and sustain clonal growth. We found that TMZ-R cells are sensitive to histone deacethylase inhibitors (HDACi) that synergize with TMZ. This strong synergism could be exploited to develop novel combined adjuvant therapies for this rapidly progressing and invariably lethal cancer.

The X-ray Crystallographic Structure and Activity Analysis of a Pseudomonas-Specific Subfamily of the HAD Enzyme Superfamily Evidences a Novel Biochemical Function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peisach,E.; Wang, L.; Burroughs, A.

2008-01-01

The haloacid dehalogenase (HAD) superfamily is a large family of proteins dominated by phosphotransferases. Thirty-three sequence families within the HAD superfamily (HADSF) have been identified to assist in function assignment. One such family includes the enzyme phosphoacetaldehyde hydrolase (phosphonatase). Phosphonatase possesses the conserved Rossmanniod core domain and a C1-type cap domain. Other members of this family do not possess a cap domain and because the cap domain of phosphonatase plays an important role in active site desolvation and catalysis, the function of the capless family members must be unique. A representative of the capless subfamily, PSPTO{_}2114, from the plant pathogenmore » Pseudomonas syringae, was targeted for catalytic activity and structure analyses. The X-ray structure of PSPTO{_}2114 reveals a capless homodimer that conserves some but not all of the intersubunit contacts contributed by the core domains of the phosphonatase homodimer. The region of the PSPTO{_}2114 that corresponds to the catalytic scaffold of phosphonatase (and other HAD phosphotransfereases) positions amino acid residues that are ill suited for Mg+2 cofactor binding and mediation of phosphoryl group transfer between donor and acceptor substrates. The absence of phosphotransferase activity in PSPTO{_}2114 was confirmed by kinetic assays. To explore PSPTO{_}2114 function, the conservation of sequence motifs extending outside of the HADSF catalytic scaffold was examined. The stringently conserved residues among PSPTO{_}2114 homologs were mapped onto the PSPTO{_}2114 three-dimensional structure to identify a surface region unique to the family members that do not possess a cap domain. The hypothesis that this region is used in protein-protein recognition is explored to define, for the first time, HADSF proteins which have acquired a function other than that of a catalyst. Proteins 2008.« less

Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

PubMed

Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

2011-11-01

A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

iNR-PhysChem: A Sequence-Based Predictor for Identifying Nuclear Receptors and Their Subfamilies via Physical-Chemical Property Matrix

PubMed Central

Xiao, Xuan; Wang, Pu; Chou, Kuo-Chen

2012-01-01

Nuclear receptors (NRs) form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC) whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1thyroid hormone like, NR2HNF4-like, NR3estrogen like, NR4nerve growth factor IB-like, NR5fushi tarazu-F1 like, NR6germ cell nuclear factor like, and NR0knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may become a useful high throughput tool

41 CFR 102-3.125 - How should agencies consider the roles of advisory committee members and staff?

Code of Federal Regulations, 2010 CFR

2010-07-01

... consider the roles of advisory committee members and staff? 102-3.125 Section 102-3.125 Public Contracts... How should agencies consider the roles of advisory committee members and staff? FACA does not assign... critical roles in achieving the goals and objectives assigned to advisory committees. Agency heads...

A framework for classification of prokaryotic protein kinases.

PubMed

Tyagi, Nidhi; Anamika, Krishanpal; Srinivasan, Narayanaswamy

2010-05-26

Overwhelming majority of the Serine/Threonine protein kinases identified by gleaning archaeal and eubacterial genomes could not be classified into any of the well known Hanks and Hunter subfamilies of protein kinases. This is owing to the development of Hanks and Hunter classification scheme based on eukaryotic protein kinases which are highly divergent from their prokaryotic homologues. A large dataset of prokaryotic Serine/Threonine protein kinases recognized from genomes of prokaryotes have been used to develop a classification framework for prokaryotic Ser/Thr protein kinases. We have used traditional sequence alignment and phylogenetic approaches and clustered the prokaryotic kinases which represent 72 subfamilies with at least 4 members in each. Such a clustering enables classification of prokaryotic Ser/Thr kinases and it can be used as a framework to classify newly identified prokaryotic Ser/Thr kinases. After series of searches in a comprehensive sequence database we recognized that 38 subfamilies of prokaryotic protein kinases are associated to a specific taxonomic level. For example 4, 6 and 3 subfamilies have been identified that are currently specific to phylum proteobacteria, cyanobacteria and actinobacteria respectively. Similarly subfamilies which are specific to an order, sub-order, class, family and genus have also been identified. In addition to these, we also identify organism-diverse subfamilies. Members of these clusters are from organisms of different taxonomic levels, such as archaea, bacteria, eukaryotes and viruses. Interestingly, occurrence of several taxonomic level specific subfamilies of prokaryotic kinases contrasts with classification of eukaryotic protein kinases in which most of the popular subfamilies of eukaryotic protein kinases occur diversely in several eukaryotes. Many prokaryotic Ser/Thr kinases exhibit a wide variety of modular organization which indicates a degree of complexity and protein-protein interactions in the

Structure and Activity Analyses of Escherichia coli K-12 NagD Provide Insight into the Evolution of Biochemical Function in the Haloakanoic Acid Dehlogenase Superfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay,L.; Dunaway-Mariano, D.; Allen, K.

2006-01-01

The HAD superfamily is a large superfamily of proteins which share a conserved core domain that provides those active site residues responsible for the chemistry common to all family members. The superfamily is further divided into the four subfamilies I, IIA, IIB, and III, based on the topology and insertion site of a cap domain that provides substrate specificity. This structural and functional division implies that members of a given HAD structural subclass may target substrates that have similar structural characteristics. To understand the structure/function relationships in all of the subfamilies, a type IIA subfamily member, NagD from Escherichia colimore » K-12, was selected (type I, IIB, and III members have been more extensively studied). The structure of the NagD protein was solved to 1.80 Angstroms with R{sub work} = 19.8% and R{sub free} = 21.8%. Substrate screening and kinetic analysis showed NagD to have high specificity for nucleotide monophosphates with kcat/Km = 3.12 x 10{sup 4} and 1.28 x 10{sup 4} {micro}M{sup -1} s{sup -1} for UMP and GMP, respectively. This specificity is consistent with the presence of analogues of NagD that exist as fusion proteins with a nucleotide pyrophosphatase from the Nudix family. Docking of the nucleoside substrate in the active site brings it in contact with conserved residues from the cap domain that can act as a substrate specificity loop (NagD residues 144-149) in the type IIA subfamily. NagD and other subfamily IIA and IIB members show the common trait that substrate specificity and catalytic efficiencies (k{sub cat}/K{sub m}) are low (1 x 10{sup 4} M{sup -1} s{sup -1}) and the boundaries defining physiological substrates are somewhat overlapping. The ability to catabolize other related secondary metabolites indicates that there is regulation at the genetic level.« less

Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

PubMed Central

Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

2011-01-01

A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

Alu Sb2 subfamily is present in all higher primates but was most succesfully amplified in humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richer, C.; Zietkiewicz, E.; Labuda, D.

Alu repeats can be classified into subfamilies which amplified in primate genomes at different evolutionary time periods. A young Alu subfamily, Sb2, with a characteristic 7-nucleotide duplication at position 256, has been described in seven human loci. An Sb2 insertion found near the HD gene was unique to two HD families, indicating that Sb2 was still retropositionally active. Here, we have shown that the Sb2 insertion in the CHOL locus was similarly rare, being absent in 120 individuals of Caucasian, Oriental and Black origin. In contrast, Sb2 inserts in five other loci were found fixed (non-polymorphic), based on measurements inmore » the same population sample, but absent from orthologous positions in higher apes. This suggest that Sb2 repeats spread relatively early in the human lineage following divergence from other primates and that these elements may be human-specific. By quantitative PCR, we investigated the presence of Sb2 sequences in different primate DNA, using one PCR primer anchored at the 5{prime} Alu-end and the other complementary to the duplicated Sb2-specific segment. With an Sb2-containing plasmid as a standard, we estimated the number of Sb2 repeats at 1500-1800 copies per human haploid equivalent; corresponding numbers in chimpanzee and gorilla were almost two orders of magnitude lower, while the signal observed in orangutan and gibbon DNAs was consistent with the presence of a single copy. The analysis of 22 human, 11 chimpanzee and 10 gorilla sequences indicates that the Alu Sb2 dispersed independently in these three primate lineages; gorilla consensus differs from the human Sb2 sequence by one position, while all chimpanzee repeats have their linker expanded by up to eight A-residues. Should they be thus considered as separate subfamilies? It is possible that sequence modifications with respect to the human consensus are responsible for poor retroposition of Sb2 in apes.« less

Structural Determinants of Substrate Recognition in the HAD Superfamily Member D-glycero-D-manno-Heptose-1,7-bisphosphate Phosphatase (GmhB)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, H.; Wang, L; Huang, H

2010-01-01

The haloalkanoic acid dehalogenase (HAD) enzyme superfamily is the largest family of phosphohydrolases. In HAD members, the structural elements that provide the binding interactions that support substrate specificity are separated from those that orchestrate catalysis. For most HAD phosphatases, a cap domain functions in substrate recognition. However, for the HAD phosphatases that lack a cap domain, an alternate strategy for substrate selection must be operative. One such HAD phosphatase, GmhB of the HisB subfamily, was selected for structure-function analysis. Herein, the X-ray crystallographic structures of Escherichia coli GmhB in the apo form (1.6 {angstrom} resolution), in a complex with Mg{supmore » 2+} and orthophosphate (1.8 {angstrom} resolution), and in a complex with Mg{sup 2+} and D-glycero-D-manno-heptose 1{beta},7-bisphosphate (2.2 {angstrom} resolution) were determined, in addition to the structure of Bordetella bronchiseptica GmhB bound to Mg{sup 2+} and orthophosphate (1.7 {angstrom} resolution). The structures show that in place of a cap domain, the GmhB catalytic site is elaborated by three peptide inserts or loops that pack to form a concave, semicircular surface around the substrate leaving group. Structure-guided kinetic analysis of site-directed mutants was conducted in parallel with a bioinformatics study of sequence diversification within the HisB subfamily to identify loop residues that serve as substrate recognition elements and that distinguish GmhB from its subfamily counterpart, the histidinol-phosphate phosphatase domain of HisB. We show that GmhB and the histidinol-phosphate phosphatase domain use the same design of three substrate recognition loops inserted into the cap domain yet, through selective residue usage on the loops, have achieved unique substrate specificity and thus novel biochemical function.« less

Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase.

PubMed

Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C; Santelia, Diana

2013-11-22

α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble substrates, with a strong preference for β-limit dextrin over amylopectin. Activity was shown to be dependent on a conserved aspartic acid residue (Asp(666)), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases, with a pH optimum of 7.5-8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between Cys(499) and Cys(587) is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast.

Characterization of the starch-acting MaAmyB enzyme from Microbacterium aurum B8.A representing the novel subfamily GH13_42 with an unusual, multi-domain organization

PubMed Central

Valk, Vincent; van der Kaaij, Rachel M.; Dijkhuizen, Lubbert

2016-01-01

The bacterium Microbacterium aurum strain B8.A degrades granular starches, using the multi-domain MaAmyA α-amylase to initiate granule degradation through pore formation. This paper reports the characterization of the M. aurum B8.A MaAmyB enzyme, a second starch-acting enzyme with multiple FNIII and CBM25 domains. MaAmyB was characterized as an α-glucan 1,4-α-maltohexaosidase with the ability to subsequently hydrolyze maltohexaose to maltose through the release of glucose. MaAmyB also displays exo-activity with a double blocked PNPG7 substrate, releasing PNP. In M. aurum B8.A, MaAmyB may contribute to degradation of starch granules by rapidly hydrolyzing the helical and linear starch chains that become exposed after pore formation by MaAmyA. Bioinformatics analysis showed that MaAmyB represents a novel GH13 subfamily, designated GH13_42, currently with 165 members, all in Gram-positive soil dwelling bacteria, mostly Streptomyces. All members have an unusually large catalytic domain (AB-regions), due to three insertions compared to established α-amylases, and an aberrant C-region, which has only 30% identity to established GH13 C-regions. Most GH13_42 members have three N-terminal domains (2 CBM25 and 1 FNIII). This is unusual as starch binding domains are commonly found at the C-termini of α-amylases. The evolution of the multi-domain M. aurum B8.A MaAmyA and MaAmyB enzymes is discussed. PMID:27808246

2D or Not 2D? Testing the Utility of 2D Vs. 3D Landmark Data in Geometric Morphometrics of the Sculpin Subfamily Oligocottinae (Pisces; Cottoidea).

PubMed

Buser, Thaddaeus J; Sidlauskas, Brian L; Summers, Adam P

2018-05-01

We contrast 2D vs. 3D landmark-based geometric morphometrics in the fish subfamily Oligocottinae by using 3D landmarks from CT-generated models and comparing the morphospace of the 3D landmarks to one based on 2D landmarks from images. The 2D and 3D shape variables capture common patterns across taxa, such that the pairwise Procrustes distances among taxa correspond and the trends captured by principal component analysis are similar in the xy plane. We use the two sets of landmarks to test several ecomorphological hypotheses from the literature. Both 2D and 3D data reject the hypothesis that head shape correlates significantly with the depth at which a species is commonly found. However, in taxa where shape variation in the z-axis is high, the 2D shape variables show sufficiently strong distortion to influence the outcome of the hypothesis tests regarding the relationship between mouth size and feeding ecology. Only the 3D data support previous studies which showed that large mouth sizes correlate positively with high percentages of elusive prey in the diet. When used to test for morphological divergence, 3D data show no evidence of divergence, while 2D data show that one clade of oligocottines has diverged from all others. This clade shows the greatest degree of z-axis body depth within Oligocottinae, and we conclude that the inability of the 2D approach to capture this lateral body depth causes the incongruence between 2D and 3D analyses. Anat Rec, 301:806-818, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Key biosynthetic gene subfamily recruited for pheromone production prior to the extensive radiation of Lepidoptera

PubMed Central

2008-01-01

Background Moths have evolved highly successful mating systems, relying on species-specific mixtures of sex pheromone components for long-distance mate communication. Acyl-CoA desaturases are key enzymes in the biosynthesis of these compounds and to a large extent they account for the great diversity of pheromone structures in Lepidoptera. A novel desaturase gene subfamily that displays Δ11 catalytic activities has been highlighted to account for most of the unique pheromone signatures of the taxonomically advanced ditrysian species. To assess the mechanisms driving pheromone evolution, information is needed about the signalling machinery of primitive moths. The currant shoot borer, Lampronia capitella, is the sole reported primitive non-ditrysian moth known to use unsaturated fatty-acid derivatives as sex-pheromone. By combining biochemical and molecular approaches we elucidated the biosynthesis paths of its main pheromone component, the (Z,Z)-9,11-tetradecadien-1-ol and bring new insights into the time point of the recruitment of the key Δ11-desaturase gene subfamily in moth pheromone biosynthesis. Results The reconstructed evolutionary tree of desaturases evidenced two ditrysian-specific lineages (the Δ11 and Δ9 (18C>16C)) to have orthologs in the primitive moth L. capitella despite being absent in Diptera and other insect genomes. Four acyl-CoA desaturase cDNAs were isolated from the pheromone gland, three of which are related to Δ9-desaturases whereas the fourth cDNA clusters with Δ11-desaturases. We demonstrated that this transcript (Lca-KPVQ) exclusively accounts for both steps of desaturation involved in pheromone biosynthesis. This enzyme possesses a Z11-desaturase activity that allows transforming the palmitate precursor (C16:0) into (Z)-11-hexadecenoic acid and the (Z)-9-tetradecenoic acid into the conjugated intermediate (Z,Z)-9,11-tetradecadienoic acid. Conclusion The involvement of a single Z11-desaturase in pheromone biosynthesis of a non

NAVO MSRC Navigator. Fall 2006

DTIC Science & Technology

2006-01-01

UNIX Manual Pages: xdm (1x). 7. Buddenhagen, Oswald, “The KDM Handbook,” KDE Documentation, http://docs.kde.org/development/ en /kdebase/kdm/. 8... Linux Opteron cluster was recently determined through a series of simulations that employed both fixed and adaptive meshes. The fixed-mesh scalability...approximately eight in the total number of cells in the 3-D simulation. The fixed-mesh and AMR scalability results on the Linux Opteron cluster are

Activation of TRPM3 by a potent synthetic ligand reveals a role in peptide release

PubMed Central

Held, Katharina; Kichko, Tatjana; De Clercq, Katrien; Klaassen, Hugo; Van Bree, Rieta; Vanherck, Jean-Christophe; Marchand, Arnaud; Reeh, Peter W.; Chaltin, Patrick; Voets, Thomas; Vriens, Joris

2015-01-01

Transient receptor potential (TRP) cation channel subfamily M member 3 (TRPM3), a member of the TRP channel superfamily, was recently identified as a nociceptor channel in the somatosensory system, where it is involved in the detection of noxious heat; however, owing to the lack of potent and selective agonists, little is known about other potential physiological consequences of the opening of TRPM3. Here we identify and characterize a synthetic TRPM3 activator, CIM0216, whose potency and apparent affinity greatly exceeds that of the canonical TRPM3 agonist, pregnenolone sulfate (PS). In particular, a single application of CIM0216 causes opening of both the central calcium-conducting pore and the alternative cation permeation pathway in a membrane-delimited manner. CIM0216 evoked robust calcium influx in TRPM3-expressing somatosensory neurons, and intradermal injection of the compound induced a TRPM3-dependent nocifensive behavior. Moreover, CIM0216 elicited the release of the peptides calcitonin gene-related peptide (CGRP) from sensory nerve terminals and insulin from isolated pancreatic islets in a TRPM3-dependent manner. These experiments identify CIM0216 as a powerful tool for use in investigating the physiological roles of TRPM3, and indicate that TRPM3 activation in sensory nerve endings can contribute to neurogenic inflammation. PMID:25733887

17 CFR 240.19c-3 - Governing off-board trading by members of national securities exchanges.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 17 Commodity and Securities Exchanges 4 2014-04-01 2014-04-01 false Governing off-board trading by... Members § 240.19c-3 Governing off-board trading by members of national securities exchanges. The rules of... in any reported security listed and registered on this exchange or as to which unlisted trading...

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants.

PubMed

Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

2017-02-07

Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution of each LRR-RLK subfamily remain to be understood. We identified 119 LRR-RLK genes in the Physcomitrella patens moss genome, 67 LRR-RLK genes in the Selaginella moellendorffii lycophyte genome, and no LRR-RLK genes in five green algae genomes. Furthermore, these LRR-RLK sequences, along with previously reported LRR-RLK sequences from Arabidopsis thaliana and Oryza sativa, were subjected to evolutionary analyses. Phylogenetic analyses revealed that plant LRR-RLKs belong to 19 subfamilies, eighteen of which were established in early land plants, and one of which evolved in flowering plants. More importantly, we found that the basic structures of LRR-RLK genes for most subfamilies are established in early land plants and conserved within subfamilies and across different plant lineages, but divergent among subfamilies. In addition, most members of the same subfamily had common protein motif compositions, whereas members of different subfamilies showed variations in protein motif compositions. The unique gene structure and protein motif compositions of each subfamily differentiate the subfamily classifications and, more importantly, provide evidence for functional divergence among LRR-RLK subfamilies. Maximum likelihood analyses showed that some sites within four subfamilies were under positive selection. Much of the diversity of plant LRR-RLK genes was established in early land plants. Positive selection contributed to the evolution of a few LRR-RLK subfamilies.

A review of Cunaxidae (Acariformes, Trombidiformes): Histories and diagnoses of subfamilies and genera, keys to world species, and some new locality records

PubMed Central

Skvarla, Michael J.; Fisher, J. Ray; Dowling, Ashley P. G.

2014-01-01

Abstract Cunaxidae are predaceous mites found in a variety of habitats. This work provides comprehensive keys to world subfamilies, genera, and species. Diagnoses and historical reviews are provided for subfamilies and genera. Cunaxa boneti, C. denmarki, C. exoterica, C. floridanus, C. lehmanae, C. lukoschusi, C. metzi, C. myabunderensis, C newyorkensis, C. rackae, C. reevesi, and C. reticulatus are moved to Rubroscirus and C. otiosus, C. valentis, and C. rasile are returned to Rubroscirus. Cunaxoides neopectinatus is moved to Pulaeus. Neocunaxoides pradhani and N. gilbertoi are transferred to Scutopalus. Pulaeus minutus and P. subterraneus are moved to Lupaeus. Pseudobonzia bakari, P. malookensis, and P. shamshadi are transferred to Neobonzia. Dactyloscirus bifidus is transferred to Armascirus. Scirula papillata is reported from the Western Hemisphere for the first time. Armascirus ozarkensis, A. primigenius, and Dactyloscirus dolichosetosus are reported from new localities. PMID:25061358

Identification of multiple nuclear localization signals in murine Elf3, an ETS transcription factor.

PubMed

Do, Hyun-Jin; Song, Hyuk; Yang, Heung-Mo; Kim, Dong-Ku; Kim, Nam-Hyung; Kim, Jin-Hoi; Cha, Kwang-Yul; Chung, Hyung-Min; Kim, Jae-Hwan

2006-03-20

We investigated nuclear localization signal (NLS) determinants within the AT-hook and ETS DNA-binding domains of murine Elf3 (mElf3), a member of the subfamily of epithelium-specific ETS transcription factors. Deletion mutants containing the AT-hook, ETS domain or both localized strictly in the nucleus, suggesting that these individual domains contain independent NLS motif(s). Within the AT-hook domain, four basic residues (244KRKR247) were critical for strong NLS activity, and two potent bipartite NLS motifs (236-252 and 249-267) were sufficient for nuclear import of mElf3, although less efficient than the full domain. In addition, one stretch of basic residues (318KKK320) within the ETS domain appears to be essential for mElf3 nuclear localization. Taken together, mElf3 contains multiple NLS motifs, which may function cooperatively to effect efficient nuclear transport.

Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

PubMed

Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

2004-08-01

Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

Union Members Are Community Members

ERIC Educational Resources Information Center

Gray, David

2013-01-01

Unions serve their members' interests. But union members are also community members, and their interests go well beyond increasing pay and benefits. A local union president has found that his members are best served by participating in a community-wide coalition. Providing eyeglasses to needy students, promoting healthy eating, and increasing…

In Silico/In Vivo Insights into the Functional and Evolutionary Pathway of Pseudomonas aeruginosa Oleate-Diol Synthase. Discovery of a New Bacterial Di-Heme Cytochrome C Peroxidase Subfamily

PubMed Central

Estupiñán, Mónica; Álvarez-García, Daniel; Barril, Xavier; Diaz, Pilar; Manresa, Angeles

2015-01-01

As previously reported, P. aeruginosa genes PA2077 and PA2078 code for 10S-DOX (10S-Dioxygenase) and 7,10-DS (7,10-Diol Synthase) enzymes involved in long-chain fatty acid oxygenation through the recently described oleate-diol synthase pathway. Analysis of the amino acid sequence of both enzymes revealed the presence of two heme-binding motifs (CXXCH) on each protein. Phylogenetic analysis showed the relation of both proteins to bacterial di-heme cytochrome c peroxidases (Ccps), similar to Xanthomonas sp. 35Y rubber oxidase RoxA. Structural homology modelling of PA2077 and PA2078 was achieved using RoxA (pdb 4b2n) as a template. From the 3D model obtained, presence of significant amino acid variations in the predicted heme-environment was found. Moreover, the presence of palindromic repeats located in enzyme-coding regions, acting as protein evolution elements, is reported here for the first time in P. aeruginosa genome. These observations and the constructed phylogenetic tree of the two proteins, allow the proposal of an evolutionary pathway for P. aeruginosa oleate-diol synthase operon. Taking together the in silico and in vivo results obtained we conclude that enzymes PA2077 and PA2078 are the first described members of a new subfamily of bacterial peroxidases, designated as Fatty acid-di-heme Cytochrome c peroxidases (FadCcp). PMID:26154497

38 CFR 3.359 - Determination of service connection for former members of the Armed Forces of Czechoslovakia or...

Code of Federal Regulations, 2014 CFR

2014-07-01

... connection for former members of the Armed Forces of Czechoslovakia or Poland. 3.359 Section 3.359 Pensions... connection for former members of the Armed Forces of Czechoslovakia or Poland. Rating boards will determine... Czechoslovakia or Poland under 38 U.S.C. 109(c) is service connected. This determination will be made using the...

38 CFR 3.359 - Determination of service connection for former members of the Armed Forces of Czechoslovakia or...

Code of Federal Regulations, 2010 CFR

2010-07-01

... connection for former members of the Armed Forces of Czechoslovakia or Poland. 3.359 Section 3.359 Pensions... connection for former members of the Armed Forces of Czechoslovakia or Poland. Rating boards will determine... Czechoslovakia or Poland under 38 U.S.C. 109(c) is service connected. This determination will be made using the...

38 CFR 3.359 - Determination of service connection for former members of the Armed Forces of Czechoslovakia or...

Code of Federal Regulations, 2011 CFR

2011-07-01

... connection for former members of the Armed Forces of Czechoslovakia or Poland. 3.359 Section 3.359 Pensions... connection for former members of the Armed Forces of Czechoslovakia or Poland. Rating boards will determine... Czechoslovakia or Poland under 38 U.S.C. 109(c) is service connected. This determination will be made using the...

38 CFR 3.359 - Determination of service connection for former members of the Armed Forces of Czechoslovakia or...

Code of Federal Regulations, 2013 CFR

2013-07-01

... connection for former members of the Armed Forces of Czechoslovakia or Poland. 3.359 Section 3.359 Pensions... connection for former members of the Armed Forces of Czechoslovakia or Poland. Rating boards will determine... Czechoslovakia or Poland under 38 U.S.C. 109(c) is service connected. This determination will be made using the...

38 CFR 3.359 - Determination of service connection for former members of the Armed Forces of Czechoslovakia or...

Code of Federal Regulations, 2012 CFR

2012-07-01

... connection for former members of the Armed Forces of Czechoslovakia or Poland. 3.359 Section 3.359 Pensions... connection for former members of the Armed Forces of Czechoslovakia or Poland. Rating boards will determine... Czechoslovakia or Poland under 38 U.S.C. 109(c) is service connected. This determination will be made using the...

DNA barcoding of morphologically characterized mosquitoes belonging to the subfamily Culicinae from Sri Lanka.

PubMed

Weeraratne, Thilini Chathurika; Surendran, Sinnathamby Noble; Parakrama Karunaratne, S H P

2018-04-25

Vectors of mosquito-borne diseases in Sri Lanka, except for malaria, belong to the subfamily Culicinae, which includes nearly 84% of the mosquito fauna of the country. Hence, accurate and precise species identification of culicine mosquitoes is a crucial factor in implementing effective vector control strategies. During the present study, a combined effort using morphology and DNA barcoding was made to characterize mosquitoes of the subfamily Culicinae for the first time from nine districts of Sri Lanka. Cytochrome c oxidase subunit 1 (cox1) gene from the mitochondrial genome and the internal transcribed spacer 2 (ITS2) region from the nuclear ribosomal DNA were used for molecular characterization. According to morphological identification, the field collected adult mosquitoes belonged to 5 genera and 14 species, i.e. Aedes aegypti, Ae. albopictus, Ae. pallidostriatus, Aedes sp. 1, Armigeres sp. 1, Culex bitaeniorhynchus, Cx. fuscocephala, Cx. gelidus, Cx. pseudovishnui, Cx. quinquefasciatus, Cx. tritaeniorhynchus, Cx. whitmorei, Mansonia uniformis and Mimomyia chamberlaini. Molecular analyses of 62 cox1 and 36 ITS2 sequences were exclusively comparable with the morphological identifications of all the species except for Ae. pallidostriatus and Aedes sp. 1. Although the species identification of Armigeres sp. 1 specimens using morphological features was not possible during this study, DNA barcodes of the specimens matched 100% with the publicly available Ar. subalbatus sequences, giving their species status. Analysis of all the cox1 sequences (14 clades supported by strong bootstrap value in the Neighbor-Joining tree and interspecific distances of > 3%) showed the presence of 14 different species. This is the first available DNA sequence in the GenBank records for morphologically identified Ae. pallidostriatus. Aedes sp. 1 could not be identified morphologically or by publicly available sequences. Aedes aegypti, Ae. albopictus and all Culex species reported during

Evolutionary history of fumitories (subfamily Fumarioideae, Papaveraceae): An old story shaped by the main geological and climatic events in the Northern Hemisphere.

PubMed

Pérez-Gutiérrez, Miguel A; Romero-García, Ana T; Fernández, M Carmen; Blanca, G; Salinas-Bonillo, María J; Suárez-Santiago, Víctor N

2015-07-01

Fumitories (subfamily Fumarioideae, Papaveraceae) represent, by their wide mainly northern temperate distribution (also present in South Africa) a suitable plant group to use as a model system for studying biogeographical links between floristic regions of the Northern Hemisphere and also the Southern Hemisphere Cape region. However, the phylogeny of the entire Fumarioideae subfamily is not totally known. In this work, we infer a molecular phylogeny of Fumarioideae, which we use to interpret the biogeographical patterns in the subfamily and to establish biogeographical links between floristic regions, such as those suggested by its different inter- and intra-continental disjunctions. The tribe Hypecoeae is the sister group of tribe Fumarieae, this latter holding a basal grade of monotypic or few-species genera with bisymmetric flowers, and a core group, Core Fumarieae, of more specious rich genera with zygomorphic flowers. The biogeographical analysis shows a subfamily that originated in East Asia at the end of the Early Cretaceous. From here, ancestral range expansions followed three different directions, one at the beginning of the Late Cretaceous by the ancestor of tribe Hypecoeae towards central Asia, and two during the Cretaceous-Palaeogene transition towards western North America and Indochina by the ancestor of the tribe Fumarieae. The ancestor of Core Fumarieae expanded its range from East Asia into the Himalayas before to the middle Eocene. The uplifts of the Qinghai-Tibetan Plateau together with the zonal climate pattern of the Palaeogene are suggested to be responsible both for the accelerated diversification rate resulting in the origin of the basal lineages of Core Fumarieae as well as for the westward migration of the ancestor of Fumarieae s.str. into the Irano-Turanian region. From here, this latter group reached South Africa during late Eocene and Mediterranean basin during Oligocene. There were two colonization waves of the Mediterranean following

Structure of the Regulator of G Protein Signaling 8 (RGS8)-Gαq Complex: MOLECULAR BASIS FOR Gα SELECTIVITY.

PubMed

Taylor, Veronica G; Bommarito, Paige A; Tesmer, John J G

2016-03-04

Regulator of G protein signaling (RGS) proteins interact with activated Gα subunits via their RGS domains and accelerate the hydrolysis of GTP. Although the R4 subfamily of RGS proteins generally accepts both Gαi/o and Gαq/11 subunits as substrates, the R7 and R12 subfamilies select against Gαq/11. In contrast, only one RGS protein, RGS2, is known to be selective for Gαq/11. The molecular basis for this selectivity is not clear. Previously, the crystal structure of RGS2 in complex with Gαq revealed a non-canonical interaction that could be due to interfacial differences imposed by RGS2, the Gα subunit, or both. To resolve this ambiguity, the 2.6 Å crystal structure of RGS8, an R4 subfamily member, was determined in complex with Gαq. RGS8 adopts the same pose on Gαq as it does when bound to Gαi3, indicating that the non-canonical interaction of RGS2 with Gαq is due to unique features of RGS2. Based on the RGS8-Gαq structure, residues in RGS8 that contact a unique α-helical domain loop of Gαq were converted to those typically found in R12 subfamily members, and the reverse substitutions were introduced into RGS10, an R12 subfamily member. Although these substitutions perturbed their ability to stimulate GTP hydrolysis, they did not reverse selectivity. Instead, selectivity for Gαq seems more likely determined by whether strong contacts can be maintained between α6 of the RGS domain and Switch III of Gαq, regions of high sequence and conformational diversity in both protein families. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

New taxa and notes on crickets of the subfamily Landrevinae (Orthoptera: Gryllidae) from Brunei Darussalam, Borneo.

PubMed

Tan, Ming Kai; Wahab, Rodzay Bin Haji Abdul

2017-12-19

New taxa from the subfamily Landrevinae (Orthoptera: Gryllidae) are expected despite recent work on its taxonomy. Here, two more new species from Brunei Darussalam, Borneo are described: Duolandrevus (Eulandrevus) kawataredoki sp. nov. and Endodrelanva nympha sp. nov. The male calling song of D. (E.) kawataredoki sp. nov. is also described. We report the occurrence of a Duolandrevus (Bejorama) from Brunei close to (nr.) luzonensis Otte, 1988. We also document from Brunei a case of parasitic wasp from the genus Liris (Hymenoptera: Crabronidae: Larrini) hunting a Landrevinae.

Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

PubMed

Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

2015-12-01

The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

Application of Microarrays and qPCR to Identify Phylogenetic and Functional Biomarkers Diagnostic of Microbial Communities that Biodegrade Chlorinated Solvents to Ethene

DTIC Science & Technology

2012-01-01

Acidobacteria, Actinobacteria , Bacteroidetes, Chloroflexi, Cyanobacteria, Firmicutes, and all classes of Proteobacteria accounted for 76% of this dynamic...the course of treatment (Figure 4). The dominant members in cluster group 2 were from Actinobacteria (24 subfamilies), Bacteroidetes (25 subfamilies

Long-term exposure to PM2.5 lowers influenza virus resistance via down-regulating pulmonary macrophage Kdm6a and mediates histones modification in IL-6 and IFN-β promoter regions.

PubMed

Ma, Jing-Hui; Song, Shao-Hua; Guo, Meng; Zhou, Ji; Liu, Fang; Peng, Li; Fu, Zhi-Ren

2017-11-18

Atmospheric particulates, especially PM2.5, not only damage the respiratory system, but also play important roles in pulmonary immunity. China is influenced by atmospheric diffusion conditions, industrial manufacturers, and heating and discharging. PM2.5 levels in the air rise substantially in the winter, which is also a period of flu high-incidence. Although an epidemiological link exists between PM2.5 and flu, we do not understand how long-term PM2.5 inhalation affects pulmonary immunity and the influenza virus response. Our study has prepared an in vivo PM2.5 mouse pharyngeal wall drop-in model and has found that PM2.5 exposure leads to mouse inflammatory injuries and furthers influenza A infection. Our results suggest that short-term exposure to PM2.5 significantly enhances the survival rate of influenza A-contaminated mice, while long-term PM2.5 inhalation lowers the capacity of pulmonary macrophages to secrete IL-6 and IFN-β. A disorder in the pulmonary innate defense system results in increased death rates following influenza infection. On a macromolecular level, this mechamism involves Kdm6a down-regulation after long-term exposure to PM 2.5 and a resultant increase in H3K4 and H3K9 methylation in IL-6 and IFN-β promoter regions. In summary, PM2.5 causes injuries of lung tissue cells and downregulates immune defense mechanisms in the lung. Copyright © 2017. Published by Elsevier Inc.

Analysis of 14-3-3 Family Member Function in Xenopus Embryos by Microinjection of Antisense Morpholino Oligos

NASA Astrophysics Data System (ADS)

Lau, Jeffrey M. C.; Muslin, Anthony J.

The 14-3-3 intracellular phosphoserine/threonine-binding proteins are adapter molecules that regulate signal transduction, cell cycle, nutrient sensing, apoptotic, and cytoskeletal pathways. There are seven 14-3-3 family members, encoded by separate genes, in vertebrate organisms. To evaluate the role of individual 14-3-3 proteins in vertebrate embryonic development, we utilized an antisense morpholino oligo microinjection technique in Xenopus laevis embryos. By use of this method, we showed that embryos lacking specific 14-3-3 proteins displayed unique phenotypic abnormalities. Specifically, embryos lacking 14-3-3 τ exhibited gastrulation and axial patterning defects, but embryos lacking 14-3-3 γ exhibited eye defects without other abnormalities, and embryos lacking 14-3-3 ζ appeared completely normal. These and other results demonstrate the power and specificity of the morpholino antisense oligo microinjection technique.

A Rationally Designed Agonist Defines Subfamily IIIA Abscisic Acid Receptors As Critical Targets for Manipulating Transpiration.

PubMed

Vaidya, Aditya S; Peterson, Francis C; Yarmolinsky, Dmitry; Merilo, Ebe; Verstraeten, Inge; Park, Sang-Youl; Elzinga, Dezi; Kaundal, Amita; Helander, Jonathan; Lozano-Juste, Jorge; Otani, Masato; Wu, Kevin; Jensen, Davin R; Kollist, Hannes; Volkman, Brian F; Cutler, Sean R

2017-11-17

Increasing drought and diminishing freshwater supplies have stimulated interest in developing small molecules that can be used to control transpiration. Receptors for the plant hormone abscisic acid (ABA) have emerged as key targets for this application, because ABA controls the apertures of stomata, which in turn regulate transpiration. Here, we describe the rational design of cyanabactin, an ABA receptor agonist that preferentially activates Pyrabactin Resistance 1 (PYR1) with low nanomolar potency. A 1.63 Å X-ray crystallographic structure of cyanabactin in complex with PYR1 illustrates that cyanabactin's arylnitrile mimics ABA's cyclohexenone oxygen and engages the tryptophan lock, a key component required to stabilize activated receptors. Further, its sulfonamide and 4-methylbenzyl substructures mimic ABA's carboxylate and C6 methyl groups, respectively. Isothermal titration calorimetry measurements show that cyanabactin's compact structure provides ready access to high ligand efficiency on a relatively simple scaffold. Cyanabactin treatments reduce Arabidopsis whole-plant stomatal conductance and activate multiple ABA responses, demonstrating that its in vitro potency translates to ABA-like activity in vivo. Genetic analyses show that the effects of cyanabactin, and the previously identified agonist quinabactin, can be abolished by the genetic removal of PYR1 and PYL1, which form subclade A within the dimeric subfamily III receptors. Thus, cyanabactin is a potent and selective agonist with a wide spectrum of ABA-like activities that defines subfamily IIIA receptors as key target sites for manipulating transpiration.

Testing the reliability of standard and complementary DNA barcodes for the monocot subfamily Alooideae from South Africa.

PubMed

Daru, Barnabas H; van der Bank, Michelle; Bello, Abubakar; Yessoufou, Kowiyou

2017-04-01

Although a standard DNA barcode has been identified for plants, it does not always provide species-level specimen identifications for investigating important ecological questions. In this study, we assessed the species-level discriminatory power of standard (rbcLa + matK) and complementary barcodes (ITS1 and trnH-psbA) within the subfamily Alooideae (Asphodelaceae), a large and recent plant radiation, whose species are important in horticulture yet are threatened. Alooideae has its centre of endemism in southern Africa, with some outlier species occurring elsewhere in Africa and Madagascar. We sampled 360 specimens representing 235 species within all 11 genera of the subfamily. With three distance-based methods, all markers performed poorly for our combined data set, with the highest proportion of correct species-level specimen identifications (30%) found for ITS1. However, when performance was assessed across genera, the discriminatory power varied from 0% for all single markers and combinations in Gasteria to 63% in Haworthiopsis, again for ITS1, suggesting that DNA barcoding success may be related to the evolutionary history of the lineage considered. Although ITS1 could be a good barcode for Haworthiopsis, the generally poor performance of all markers suggests that Alooideae remains a challenge. As species boundaries within Alooideae remain controversial, we call for continued search for suitable markers or the use of genomics approaches to further explore species discrimination in the group.

PANTHER: a browsable database of gene products organized by biological function, using curated protein family and subfamily classification.

PubMed

Thomas, Paul D; Kejariwal, Anish; Campbell, Michael J; Mi, Huaiyu; Diemer, Karen; Guo, Nan; Ladunga, Istvan; Ulitsky-Lazareva, Betty; Muruganujan, Anushya; Rabkin, Steven; Vandergriff, Jody A; Doremieux, Olivier

2003-01-01

The PANTHER database was designed for high-throughput analysis of protein sequences. One of the key features is a simplified ontology of protein function, which allows browsing of the database by biological functions. Biologist curators have associated the ontology terms with groups of protein sequences rather than individual sequences. Statistical models (Hidden Markov Models, or HMMs) are built from each of these groups. The advantage of this approach is that new sequences can be automatically classified as they become available. To ensure accurate functional classification, HMMs are constructed not only for families, but also for functionally distinct subfamilies. Multiple sequence alignments and phylogenetic trees, including curator-assigned information, are available for each family. The current version of the PANTHER database includes training sequences from all organisms in the GenBank non-redundant protein database, and the HMMs have been used to classify gene products across the entire genomes of human, and Drosophila melanogaster. The ontology terms and protein families and subfamilies, as well as Drosophila gene c;assifications, can be browsed and searched for free. Due to outstanding contractual obligations, access to human gene classifications and to protein family trees and multiple sequence alignments will temporarily require a nominal registration fee. PANTHER is publicly available on the web at http://panther.celera.com.

Plastome-Wide Nucleotide Substitution Rates Reveal Accelerated Rates in Papilionoideae and Correlations with Genome Features Across Legume Subfamilies.

PubMed

Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K

2017-04-01

This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.

Checklist of the subfamily Adoncholaiminae Gerlach and Riemann, 1974 (Nematoda: Oncholaimida: Oncholaimidae) of the world: genera, species, distribution, and reference list for taxonomists and ecologists

PubMed Central

2016-01-01

Abstract Background Adoncholaiminae is one of the seven subfamilies in the free-living aquatic nematode family Oncholaimidae. Nematodes in Adoncholaiminae are found from various water environment of the world. However, a checklist of all Adoncholaiminae species including full literature, especially information of experimental (not taxonomic) works, has not been updated for more than 40 years. New information A revised checklist of the subfamily Adoncholaiminae of the world is provided. It contains 31 valid and 13 invalid species names in four genera with synonyms, collection records, and full literature from 1860's to 2015 for each species. A literature survey of total 477 previous papers was conducted in this work, and 362 of them are newly added to checklist. PMID:26929708

VizieR Online Data Catalog: NGC 6802 dwarf cluster members and non-members (Tang+, 2017)

NASA Astrophysics Data System (ADS)

Tang, B.; Geisler, D.; Friel, E.; Villanova, S.; Smiljanic, R.; Casey, A. R.; Randich, S.; Magrini, L.; San, Roman I.; Munoz, C.; Cohen, R. E.; Mauro, F.; Bragaglia, A.; Donati, P.; Tautvaisiene, G.; Drazdauskas, A.; Zenoviene, R.; Snaith, O.; Sousa, S.; Adibekyan, V.; Costado, M. T.; Blanco-Cuaresma, S.; Jimenez-Esteban, F.; Carraro, G.; Zwitter, T.; Francois, P.; Jofre, P.; Sordo, R.; Gilmore, G.; Flaccomio, E.; Koposov, S.; Korn, A. J.; Lanzafame, A. C.; Pancino, E.; Bayo, A.; Damiani, F.; Franciosini, E.; Hourihane, A.; Lardo, C.; Lewis, J.; Monaco, L.; Morbidelli, L.; Prisinzano, L.; Sacco, G.; Worley, C. C.; Zaggia, S.

2016-11-01

The dwarf stars in NGC 6802 observed by GIRAFFE spectrograph are separated into four tables: 1. cluster members in the lower main sequence; 2. cluster members in the upper main sequence; 3. non-member dwarfs in the lower main sequence; 4. non-member dwarfs in the upper main sequence. The star coordinates, V band magnitude, V-I color, and radial velocity are given. (4 data files).

Expedition-8 Flight Members Pose Inside the Soyuz TMA-3 Vehicle

NASA Technical Reports Server (NTRS)

2003-01-01

Posed inside the Soyuz TMA-3 Vehicle in a processing facility at the Baikonur Cosmodrome in Kazakhstan during a pre-launch inspection are (left to right): Expedition-8 Crew members, Michael C. Foale, Mission Commander and NASA ISS Science Officer; Cosmonaut Alexander Y. Kaleri, Soyuz Commander and flight engineer; and European Space Agency (ESA) astronaut Pedro Duque of Spain. The three launched from the Cosmodrome on October 18, 2003 onboard a Soyuz rocket destined for the International Space Station (ISS).

Identification of two novel mammalian genes establishes a subfamily of KH-domain RNA-binding proteins.

PubMed

Makeyev, A V; Liebhaber, S A

2000-08-01

We have identified two novel human genes encoding proteins with a high level of sequence identity to two previously characterized RNA-binding proteins, alphaCP-1 and alphaCP-2. Both of these novel genes, alphaCP-3 and alphaCP-4, are predicted to encode proteins with triplicated KH domains. The number and organization of the KH domains, their sequences, and the sequences of the contiguous regions are conserved among all four alphaCP proteins. The common evolutionary origin of these proteins is substantiated by conservation of exon-intron organization in the corresponding genes. The map positions of alphaCP-1 and alphaCP-2 (previously reported) and those of alphaCP-3 and alphaCP-4 (present report) reveal that the four alphaCP loci are dispersed in the human genome; alphaCP-3 and alphaCP-4 mapped to 21q22.3 and 3p21, and the respective mouse orthologues mapped to syntenic regions of the mouse genome, 10B5 and 9F1-F2, respectively. Two additional loci in the human genome were identified as alphaCP-2 processed pseudogenes (PCBP2P1, 21q22.3, and PCBP2P2, 8q21-q22). Although the overall levels of alphaCP-3 and alphaCP-4 mRNAs are substantially lower than those of alphaCP-1 and alphaCP-2, transcripts of alphaCP-3 and alphaCP-4 were found in all mouse tissues tested. These data establish a new subfamily of genes predicted to encode closely related KH-containing RNA-binding proteins with potential functions in posttranscriptional controls. Copyright 2000 Academic Press.

2,3-Hexanediols as Sex Attractants and a Female-produced Sex Pheromone for Cerambycid Beetles in the Prionine Genus Tragosoma

PubMed Central

Barbour, James D.; McElfresh, J. Steven; Moreira, Jardel A.; Swift, Ian; Wright, Ian M.; Žunič, Alenka; Mitchell, Robert F.; Graham, Elizabeth E.; Alten, Ronald L.; Millar, Jocelyn G.; Hanks, Lawrence M.

2013-01-01

Recent work suggests that closely related cerambycid species often share pheromone components, or even produce pheromone blends of identical composition. However, little is known of the pheromones of species in the subfamily Prioninae. During field bioassays in California, males of three species in the prionine genus Tragosoma were attracted to 2,3-hexanediols, common components of male-produced aggregation pheromones of beetles in the subfamily Cerambycinae. We report here that the female-produced sex pheromone of Tragosoma depsarium “sp. nov. Laplante” is (2R,3R)-2,3-hex-anediol, and provide evidence from field bioassays and electro-antennography that the female-produced pheromone of both Tragosoma pilosicorne Casey and T depsarium “harrisi” LeConte may be (2S,3R)-2,3-hexanediol. Sexual dimorphism in the sculpting of the prothorax suggests that the pheromone glands are located in the prothorax of females. This is the second sex attractant pheromone structure identified from the subfamily Prioninae, and our results provide further evidence of pheromonal parsimony within the Cerambycidae, in this case extending across both subfamily and gender lines. PMID:22923142

17 CFR 240.11a2-2(T) - Transactions effected by exchange members through other members.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Transactions effected by exchange members through other members. 240.11a2-2(T) Section 240.11a2-2(T) Commodity and Securities... Regulation (rule 11a-1) § 240.11a2-2(T) Transactions effected by exchange members through other members. (a...

17 CFR 240.11a2-2(T) - Transactions effected by exchange members through other members.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Transactions effected by exchange members through other members. 240.11a2-2(T) Section 240.11a2-2(T) Commodity and Securities... Regulation (rule 11a-1) § 240.11a2-2(T) Transactions effected by exchange members through other members. (a...

The SLC3 and SLC7 families of amino acid transporters.

PubMed

Fotiadis, Dimitrios; Kanai, Yoshikatsu; Palacín, Manuel

2013-01-01

Amino acids are necessary for all living cells and organisms. Specialized transporters mediate the transfer of amino acids across plasma membranes. Malfunction of these proteins can affect whole-body homoeostasis giving raise to diverse human diseases. Here, we review the main features of the SLC3 and SLC7 families of amino acid transporters. The SLC7 family is divided into two subfamilies, the cationic amino acid transporters (CATs), and the L-type amino acid transporters (LATs). The latter are the light or catalytic subunits of the heteromeric amino acid transporters (HATs), which are associated by a disulfide bridge with the heavy subunits 4F2hc or rBAT. These two subunits are glycoproteins and form the SLC3 family. Most CAT subfamily members were functionally characterized and shown to function as facilitated diffusers mediating the entry and efflux of cationic amino acids. In certain cells, CATs play an important role in the delivery of L-arginine for the synthesis of nitric oxide. HATs are mostly exchangers with a broad spectrum of substrates and are crucial in renal and intestinal re-absorption and cell redox balance. Furthermore, the role of the HAT 4F2hc/LAT1 in tumor growth and the application of LAT1 inhibitors and PET tracers for reduction of tumor progression and imaging of tumors are discussed. Finally, we describe the link between specific mutations in HATs and the primary inherited aminoacidurias, cystinuria and lysinuric protein intolerance. Copyright © 2012 Elsevier Ltd. All rights reserved.

Novel phacB-encoded cytochrome P450 monooxygenase from Aspergillus nidulans with 3-hydroxyphenylacetate 6-hydroxylase and 3,4-dihydroxyphenylacetate 6-hydroxylase activities.

PubMed

Ferrer-Sevillano, Francisco; Fernández-Cañón, José M

2007-03-01

Aspergillus nidulans catabolizes phenylacetate (PhAc) and 3-hydroxy-, 4-hydroxy-, and 3,4-dihydroxyphenylacetate (3-OH-PhAc, 4-OH-PhAc, and 3,4-diOH-PhAc, respectively) through the 2,5-dihydroxyphenylacetate (homogentisic acid) catabolic pathway. Using cDNA subtraction techniques, we isolated a gene, denoted phacB, which is strongly induced by PhAc (and its hydroxyderivatives) and encodes a new cytochrome P450 (CYP450). A disrupted phacB strain (delta phacB) does not grow on 3-hydroxy-, 4-hydroxy-, or 3,4-dihydroxy-PhAc. High-performance liquid chromatography and gas chromatography-mass spectrum analyses of in vitro reactions using microsomes from wild-type and several A. nidulans mutant strains confirmed that the phacB-encoded CYP450 catalyzes 3-hydroxyphenylacetate and 3,4-dihydroxyphenylacetate 6-hydroxylations to generate 2,5-dihydroxyphenylacetate and 2,4,5-trihydroxyphenylacetate, respectively. Both of these compounds are used as substrates by homogentisate dioxygenase. This cytochrome P450 protein also uses PhAc as a substrate to generate 2-OH-PhAc with a very low efficiency. The phacB gene is the first member of a new CYP450 subfamily (CYP504B).

Novel phacB-Encoded Cytochrome P450 Monooxygenase from Aspergillus nidulans with 3-Hydroxyphenylacetate 6-Hydroxylase and 3,4-Dihydroxyphenylacetate 6-Hydroxylase Activities▿

PubMed Central

Ferrer-Sevillano, Francisco; Fernández-Cañón, José M.

2007-01-01

Aspergillus nidulans catabolizes phenylacetate (PhAc) and 3-hydroxy-, 4-hydroxy-, and 3,4-dihydroxyphenylacetate (3-OH-PhAc, 4-OH-PhAc, and 3,4-diOH-PhAc, respectively) through the 2,5-dihydroxyphenylacetate (homogentisic acid) catabolic pathway. Using cDNA subtraction techniques, we isolated a gene, denoted phacB, which is strongly induced by PhAc (and its hydroxyderivatives) and encodes a new cytochrome P450 (CYP450). A disrupted phacB strain (ΔphacB) does not grow on 3-hydroxy-, 4-hydroxy-, or 3,4-dihydroxy-PhAc. High-performance liquid chromatography and gas chromatography-mass spectrum analyses of in vitro reactions using microsomes from wild-type and several A. nidulans mutant strains confirmed that the phacB-encoded CYP450 catalyzes 3-hydroxyphenylacetate and 3,4-dihydroxyphenylacetate 6-hydroxylations to generate 2,5-dihydroxyphenylacetate and 2,4,5-trihydroxyphenylacetate, respectively. Both of these compounds are used as substrates by homogentisate dioxygenase. This cytochrome P450 protein also uses PhAc as a substrate to generate 2-OH-PhAc with a very low efficiency. The phacB gene is the first member of a new CYP450 subfamily (CYP504B). PMID:17189487

Genome-wide comparative analysis of papain-like cysteine protease family genes in castor bean and physic nut.

PubMed

Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu

2018-01-10

Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.

Mediterranean diet adherence in individuals with prediabetes and unknown diabetes: the Di@bet.es Study.

PubMed

Ortega, E; Franch, J; Castell, C; Goday, A; Ribas-Barba, L; Soriguer, F; Vendrell, J; Casamitjana, R; Bosch-Comas, A; Bordiú, E; Calle-Pascual, A; Carmena, R; Castaño, L; Catalá, M; Delgado, E; Gaztambide, S; Girbés, J; López-Alba, A; Martínez-Larrad, M T; Menéndez, E; Mora-Peces, I; Pascual-Manich, G; Rojo-Martínez, G; Serrano-Rios, M; Urrutía, I; Valdés, S; Vázquez, J A; Gomis, R

2013-01-01

Mediterranean diet (MedDiet) is causally related to diabetes and is a dietary pattern recommended to individuals with diabetes. We investigated MedDiet adherence in individuals with prediabetes and unknown (PREDM/UKDM) or known diabetes (KDM) compared to those with normal glucose metabolism (NORMAL). This was a national, population-based, cross-sectional, cluster-sampling study. MedDiet adherence was scored (MedScore, mean ± SD 24 ± 5) using a qualitative food frequency questionnaire. Logistic regression was used to examine the association between MedScore and PREDM/UKDM or KDM versus control subjects. We evaluated 5,076 individuals. Mean age was 50 years, 57% were female, 826 (582/244) were PREDM/UKDM, 478 were KDM and 3,772 were NORMAL. Mean age increased across MedScore tertiles (46, 51 and 56 years, p < 0.0001). Higher age-adjusted adherence to MedDiet (5-unit increment in the MedScore) was associated with lower and nondifferent odds (OR, 95% CI) of prevalent PREDM/UKDM (0.88, 0.81-0.96, p = 0.001) and KDM (0.97, 0.87-1.07, p = 0.279), respectively, compared to individuals in the NORMAL group. In a representative sample of the whole Spanish population, MedDiet adherence is independently associated with PREDM/UKDM. Therapeutic intervention may be, in part, responsible for the lack of differences in adherence observed between the KDM and NORMAL groups. However, reverse causation bias cannot be ruled out in cross-sectional studies. Copyright © 2013 S. Karger AG, Basel.

Transfer of All Cybalomiinae to other Subfamilies (Crambidae: Pyraloidea: Lepidoptera: Elusia Schaus, Dichochroma Forbes, Schacontia Dyar, Cybalomia extorris Warren, and C. lojanalis Dognin

USDA-ARS?s Scientific Manuscript database

The Cybalomiinae contained 4 genera and 9 species in the Western Hemisphere, according to Munroe (1995). These species were morphologically compared with the type species, Cybalomia pentadalis Lederer, of Cybalomiinae. All species were found to belong to other subfamilies and the following new com...

Activation of Adhesion G Protein-coupled Receptors: AGONIST SPECIFICITY OF STACHEL SEQUENCE-DERIVED PEPTIDES.

PubMed

Demberg, Lilian M; Winkler, Jana; Wilde, Caroline; Simon, Kay-Uwe; Schön, Julia; Rothemund, Sven; Schöneberg, Torsten; Prömel, Simone; Liebscher, Ines

2017-03-17

Members of the adhesion G protein-coupled receptor (aGPCR) family carry an agonistic sequence within their large ectodomains. Peptides derived from this region, called the Stachel sequence, can activate the respective receptor. As the conserved core region of the Stachel sequence is highly similar between aGPCRs, the agonist specificity of Stachel sequence-derived peptides was tested between family members using cell culture-based second messenger assays. Stachel peptides derived from aGPCRs of subfamily VI (GPR110/ADGRF1, GPR116/ADGRF5) and subfamily VIII (GPR64/ADGRG2, GPR126/ADGRG6) are able to activate more than one member of the respective subfamily supporting their evolutionary relationship and defining them as pharmacological receptor subtypes. Extended functional analyses of the Stachel sequences and derived peptides revealed agonist promiscuity, not only within, but also between aGPCR subfamilies. For example, the Stachel -derived peptide of GPR110 (subfamily VI) can activate GPR64 and GPR126 (both subfamily VIII). Our results indicate that key residues in the Stachel sequence are very similar between aGPCRs allowing for agonist promiscuity of several Stachel -derived peptides. Therefore, aGPCRs appear to be pharmacologically more closely related than previously thought. Our findings have direct implications for many aGPCR studies, as potential functional overlap has to be considered for in vitro and in vivo studies. However, it also offers the possibility of a broader use of more potent peptides when the original Stachel sequence is less effective. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

That awkward age for butterflies: insights from the age of the butterfly subfamily Nymphalinae (Lepidoptera: Nymphalidae).

PubMed

Wahlberg, Niklas

2006-10-01

The study of the historical biogeography of butterflies has been hampered by a lack of well-resolved phylogenies and a good estimate of the temporal span over which butterflies have evolved. Recently there has been surge of phylogenetic hypotheses for various butterfly groups, but estimating ages of divergence is still in its infancy for this group of insects. The main problem has been the sparse fossil record for butterflies. In this study I have used a surprisingly good fossil record for the subfamily Nymphalinae (Lepidoptera: Nymphalidae) to estimate the ages of diversification of major lineages using Bayesian relaxed clock methods. I have investigated the effects of varying priors on posterior estimates in the analyses. For this data set, it is clear that the prior of the rate of molecular evolution at the ingroup node had the largest effect on the results. Taking this into account, I have been able to arrive at a plausible history of lineage splits, which appears to be correlated with known paleogeological events. The subfamily appears to have diversified soon after the K/T event about 65 million years ago. Several splits are coincident with major paleogeological events, such as the connection of the African and Asian continents about 21 million years ago and the presence of a peninsula of land connecting the current Greater Antilles to the South American continent 35 to 33 million years ago. My results suggest that the age of Nymphalidae is older than the 70 million years speculated to be the age of butterflies as a whole.

Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase by Ikaros, Histone Deacetylase 1 (HDAC1), and Casein Kinase 2 (CK2) in B-cell Acute Lymphoblastic Leukemia*

PubMed Central

Wang, Haijun; Song, Chunhua; Ding, Yali; Pan, Xiaokang; Ge, Zheng; Tan, Bi-Hua; Gowda, Chandrika; Sachdev, Mansi; Muthusami, Sunil; Ouyang, Hongsheng; Lai, Liangxue; Francis, Olivia L.; Morris, Christopher L.; Abdel-Azim, Hisham; Dorsam, Glenn; Xiang, Meixian; Payne, Kimberly J.; Dovat, Sinisa

2016-01-01

Impaired function of the Ikaros (IKZF1) protein is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL). The mechanisms of Ikaros tumor suppressor activity in leukemia are unknown. Ikaros binds to the upstream regulatory elements of its target genes and regulates their transcription via chromatin remodeling. Here, we report that Ikaros represses transcription of the histone H3K4 demethylase, JARID1B (KDM5B). Transcriptional repression of JARID1B is associated with increased global levels of H3K4 trimethylation. Ikaros-mediated repression of JARID1B is dependent on the activity of the histone deacetylase, HDAC1, which binds to the upstream regulatory element of JARID1B in complex with Ikaros. In leukemia, JARID1B is overexpressed, and its inhibition results in cellular growth arrest. Ikaros-mediated repression of JARID1B in leukemia is impaired by pro-oncogenic casein kinase 2 (CK2). Inhibition of CK2 results in increased binding of the Ikaros-HDAC1 complex to the promoter of JARID1B, with increased formation of trimethylated histone H3 lysine 27 and decreased histone H3 Lys-9 acetylation. In cases of high-risk B-ALL that carry deletion of one Ikaros (IKZF1) allele, targeted inhibition of CK2 restores Ikaros binding to the JARID1B promoter and repression of JARID1B. In summary, the presented data suggest a mechanism through which Ikaros and HDAC1 regulate the epigenetic signature in leukemia: via regulation of JARID1B transcription. The presented data identify JARID1B as a novel therapeutic target in B-ALL and provide a rationale for the use of CK2 inhibitors in the treatment of high-risk B-ALL. PMID:26655717

Renibacterium salmoninarum: effect of hypochlorite treatment, and survival in water.

PubMed

Hirvelä-Koski, Varpu

2004-04-21

The effect of different concentrations of sodium hypochlorite on Renibacterium salmoninarum and the survival of the bacterium in autoclaved river water and groundwater were examined. The disinfection trial was performed using R. salmoninarum ATCC 33209. The concentrations of free chlorine were 10, 50, 100 and 200 mg 1(-1), the contact times were 5, 15, and 30 min and 24 h, and the test suspensions were subcultured both on Kidney disease medium (KDM2) agar and in 3 parallel KDM2 broths, which were then subcultured on KDM2 and selective KDM (SKDM) agar. The survival of the bacterium in river water and groundwater was studied using 4 isolates of R. salmoninarum including ATCC 33209. Treatment with sodium hypochlorite effectively reduced the number of culturable cells of R. salmoninarum, but use of the recovery broth showed that small numbers of cells remained viable at all concentrations of free chlorine. The numbers of R. salmoninarum decreased to an undetectable level after 4 wk incubation in the survival trials, but low numbers of colonies were again found in the subculture after 5 wk incubation. Viable cells of R. salmoninarum were still detected in subcultures of all strains after 20 wk of incubation in river water.

12 CFR 701.3 - Member inspection of credit union books, records, and minutes.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Member inspection of credit union books... inspection of credit union books, records, and minutes. (a) Member inspection rights. A group of members of a...) Accounting books and records; and (2) Minutes of the proceedings of the credit union's members, board of...

12 CFR 701.3 - Member inspection of credit union books, records, and minutes.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 12 Banks and Banking 6 2011-01-01 2011-01-01 false Member inspection of credit union books... inspection of credit union books, records, and minutes. (a) Member inspection rights. A group of members of a...) Accounting books and records; and (2) Minutes of the proceedings of the credit union's members, board of...

12 CFR 701.3 - Member inspection of credit union books, records, and minutes.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 12 Banks and Banking 7 2012-01-01 2012-01-01 false Member inspection of credit union books... inspection of credit union books, records, and minutes. (a) Member inspection rights. A group of members of a...) Accounting books and records; and (2) Minutes of the proceedings of the credit union's members, board of...

12 CFR 701.3 - Member inspection of credit union books, records, and minutes.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 12 Banks and Banking 7 2014-01-01 2014-01-01 false Member inspection of credit union books... inspection of credit union books, records, and minutes. (a) Member inspection rights. A group of members of a...) Accounting books and records; and (2) Minutes of the proceedings of the credit union's members, board of...

12 CFR 701.3 - Member inspection of credit union books, records, and minutes.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 12 Banks and Banking 7 2013-01-01 2013-01-01 false Member inspection of credit union books... inspection of credit union books, records, and minutes. (a) Member inspection rights. A group of members of a...) Accounting books and records; and (2) Minutes of the proceedings of the credit union's members, board of...

Analyses of publicly available genomics resources define FGF-2-expressing bladder carcinomas as EMT-prone, proliferative tumors with low mutation rates and high expression of CTLA-4, PD-1 and PD-L1.

PubMed

McNiel, Elizabeth A; Tsichlis, Philip N

2017-01-01

FGF-2 is overexpressed in a subset of invasive bladder carcinomas and its overexpression correlates with poor prognosis. Analyses of publicly available databases addressing the molecular mechanisms that may be responsible for the poor prognosis of these tumors, revealed that FGF-2 expression correlates positively with the expression of EMT-promoting transcription factors and with changes in gene expression that are characteristic of EMT. The same analyses also revealed that FGF-2 correlates negatively with the expression, mutation and copy number variations of FGFR-3, all of which are associated with non-invasive bladder carcinomas. Finally, they showed that FGF-2 expression correlates with the expression of FGFR-1, the expression of the IIIc variant of FGFR-2 and with the expression of Akt3. The latter observation is significant because our earlier studies had shown that Akt3 regulates FGFR-2 alternative splicing, shifting the balance toward the IIIc relative to the IIIb FGFR-2 splice variant. Since the IIIc variant is recognized by FGF-2, while the IIIb variant is not, we conclude that Akt3 may facilitate the FGF-2 response. FGF-2 is known to promote the expression of KDM2B, which functions in concert with EZH2 to repress the EZH2-targeting microRNA miR-101, activating a switch, which stably upregulates EZH2. TCGA data showing a correlation between KDM2B and EZH2 expression and Oncomine data, showing a correlation between KDM2B and tumor progression, strongly support the role of the FGF-2/KDM2B/miR-101/EZH2 pathway in bladder cancer. These observations combined, suggest a model according to which FGF-2 induces EMT, cell proliferation and cancer stem cell self-renewal by coupling the Akt3 and KDM2B-controlled pathways outlined above, in bladder carcinomas. Further analyses of publicly-available databases, revealed that FGF-2-expressing bladder carcinomas carry fewer genetic alterations and they tend to express high levels of CTLA-4, PD-1 and PD-L1, which suggests

Hepatic ontogeny and tissue distribution of mRNAs of epigenetic modifiers in mice using RNA-sequencing

PubMed Central

Lu, Hong; Cui, Julia; Gunewardena, Sumedha; Yoo, Byunggil; Zhong, Xiao-bo; Klaassen, Curtis

2012-01-01

Developmental regulation of gene expression is controlled by distinct epigenetic signatures catalyzed by various epigenetic modifiers. Little is known about the ontogeny and tissue distribution of these epigenetic modifiers. In the present study, we used a novel approach of RNA-sequencing to elucidate hepatic ontogeny and tissue distribution of mRNA expression of 142 epigenetic modifiers, including enzymes involved in DNA methylation/demethylation, histone acetylation/deacetylation, histone methylation/demethylation, histone phosphorylation and chromosome remodeling factors in male C57BL/6 mice. Livers from male C57BL/6 mice were collected at 12 ages from prenatal to adulthood. Many of these epigenetic modifiers were expressed at much higher levels in perinatal livers than adult livers, such as Dnmt1, Dnmt3a, Dnmt3b, Apobec3, Kat1, Ncoa4, Setd8, Ash2l, Dot1l, Cbx1, Cbx3, Cbx5, Cbx6, Ezh2, Suz12, Eed, Suv39h1, Suv420h2, Dek, Hdac1, Hdac2, Hdac7, Kdm2b, Kdm5c, Kdm7, Prmt1–5, Prmt7, Smarca4, Smarcb1, Chd4 and Ino80e. In contrast, hepatic mRNA expression of a few epigenetic modifiers increased during postnatal liver development, such as Smarca2, Kdm1b, Cbx7 and Chd3. In adult mice (60 d of age), most epigenetic modifiers were expressed at moderately (1–3-fold) higher levels in kidney and/or small intestine than liver. In conclusion, this study, for the first time, unveils developmental changes in mRNA abundance of all major known epigenetic modifiers in mouse liver. These data suggest that ontogenic changes in mRNA expression of epigenetic modifiers may play important roles in determining the addition and/or removal of corresponding epigenetic signatures during liver development. PMID:22772165

Hepatic ontogeny and tissue distribution of mRNAs of epigenetic modifiers in mice using RNA-sequencing.

PubMed

Lu, Hong; Cui, Julia Yue; Gunewardena, Sumedha; Yoo, Byunggil; Zhong, Xiao-bo; Klaassen, Curtis D

2012-08-01

Developmental regulation of gene expression is controlled by distinct epigenetic signatures catalyzed by various epigenetic modifiers. Little is known about the ontogeny and tissue distribution of these epigenetic modifiers. In the present study, we used a novel approach of RNA-sequencing to elucidate hepatic ontogeny and tissue distribution of mRNA expression of 142 epigenetic modifiers, including enzymes involved in DNA methylation/demethylation, histone acetylation/deacetylation, histone methylation/demethylation, histone phosphorylation and chromosome remodeling factors in male C57BL/6 mice. Livers from male C57BL/6 mice were collected at 12 ages from prenatal to adulthood. Many of these epigenetic modifiers were expressed at much higher levels in perinatal livers than adult livers, such as Dnmt1, Dnmt3a, Dnmt3b, Apobec3, Kat1, Ncoa4, Setd8, Ash2l, Dot1l, Cbx1, Cbx3, Cbx5, Cbx6, Ezh2, Suz12, Eed, Suv39h1, Suv420h2, Dek, Hdac1, Hdac2, Hdac7, Kdm2b, Kdm5c, Kdm7, Prmt1-5, Prmt7, Smarca4, Smarcb1, Chd4 and Ino80e. In contrast, hepatic mRNA expression of a few epigenetic modifiers increased during postnatal liver development, such as Smarca2, Kdm1b, Cbx7 and Chd3. In adult mice (60 d of age), most epigenetic modifiers were expressed at moderately (1-3-fold) higher levels in kidney and/or small intestine than liver. In conclusion, this study, for the first time, unveils developmental changes in mRNA abundance of all major known epigenetic modifiers in mouse liver. These data suggest that ontogenic changes in mRNA expression of epigenetic modifiers may play important roles in determining the addition and/or removal of corresponding epigenetic signatures during liver development.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1

Apparatus for fabricating composite ceramic members

DOEpatents

Roy, P.; Simpson, J.L.; Aitken, E.A.

1975-10-28

Methods and apparatus for fabrication of composite ceramic members having particular application for measuring oxygen activities in liquid sodium are described. The method involves the simultaneous deposition of ThO$sub 2$: 15 percent Y$sub 2$O$sub 3$ on a sintered stabilized zirconia member by decomposition of gaseous ThCl$sub 4$ and YCl$sub 3$ and by reacting with oxygen gas. Means are provided for establishing an electrical potential gradient across the zirconia member whereby oxygen ions, from a source on one side of the member portion to be coated, are migrated to the opposite side where a reaction and said decomposition and deposition are effected.

Genome-Wide Identification and Expression Analysis of Homeodomain Leucine Zipper Subfamily IV (HDZ IV) Gene Family from Musa accuminata

PubMed Central

Pandey, Ashutosh; Misra, Prashant; Alok, Anshu; Kaur, Navneet; Sharma, Shivani; Lakhwani, Deepika; Asif, Mehar H.; Tiwari, Siddharth; Trivedi, Prabodh K.

2016-01-01

The homeodomain zipper family (HD-ZIP) of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV) has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV encoding genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana, and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV encoding genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV encoding genes and for their possible use in the banana improvement programs. PMID:26870050

Two ways of legumin-precursor processing in conifers. Characterization and evolutionary relationships of Metasequoia cDNAs representing two divergent legumin gene subfamilies.

PubMed

Häger, K P; Wind, C

1997-06-15

Subunit monomers and oligomers of crystalloid-type legumins are major components of SDS-soluble fractions from Metasequoia glyptostroboides (Dawn redwood, Taxodiaceae) seed proteins. The subunits are made up of disulfide linked alpha-polypeptides and beta-polypeptides with molecular masses of 33 kDa and 23-25 kDa, respectively. Unusually for legumins, those from Metasequoia are glycosylated and the carbohydrate moieties are residing in the C-terminal region of the respective beta-polypeptides. A Metasequoia endosperm cDNA library has been constructed and legumin-encoding transcripts representing two divergent gene subfamilies have been characterized. Intersubfamily comparisons reveal 75% identity at the amino acid level and the values range from 53-35% when the legumin precursors deduced were compared with those from angiosperms. The predicted sequences together with data from amino acid sequencing prove that post-translational processing of Metasequoia prolegumins is directed to two different processing sites, each of them specific for one of the legumin subfamilies. The sites involved differ in their relative position and in the junction to be cleaved: Metasequoia legumin precursors MgLeg18 and MgLeg26 contain the conventional post-translational Asn-Gly processing site, which is generally regarded as highly conserved. In contrast, the MgLeg4 precursor is lacking this site and post-translational cleavage is directed to an unusual Asn-Thr processing site located in its hypervariable region, causing N-terminal extension of the beta-polypeptide relative to those hitherto known. Evidence is given that the unusual variant of processing also occurs in other conifers. Phylogenetic analysis reveals the precursors concerned as representatives of a distinct legumin subfamily, originating from duplication of an ancestral gene prior to or at the beginning of Taxodiaceae diversification.

2-Hetaryl-1,3-tropolones based on five-membered nitrogen heterocycles: synthesis, structure and properties

PubMed Central

Sayapin, Yury A; Tupaeva, Inna O; Kolodina, Alexandra A; Gusakov, Eugeny A; Komissarov, Vitaly N; Makarova, Nadezhda I; Metelitsa, Anatoly V; Tkachev, Valery V; Aldoshin, Sergey M; Minkin, Vladimir I

2015-01-01

Summary A series of derivatives of 2-hetaryl-1,3-tropolone (β-tropolone) was prepared by the acid-catalyzed reaction of 2-methylbenzoxazoles, 2-methylbenzothiazoles and 2,3,3-trimethylindoline with 3,4,5,6-tetrachloro-1,2-benzoquinone. The molecular structures of the three representative compounds were determined by X-ray crystallography. In crystal and (as shown by the DFT PBE0/6-311+G** calculations) in solution, 2-hetaryl-4,5,6,7-tetrachloro- and 2-hetaryl-5,6,7-trichloro-1,3-tropolones exist in the NH-tautomeric form with a strong resonance-assisted intramolecular N–H···O hydrogen bond. The mechanism of the formation of 1,3-tropolones in the reaction of methylene-active five-membered heterocycles with o-chloranil in acetic acid solution has been studied using density functional theory (DFT) methods. The reaction of 2-(2-benzoxa(thia)zolyl)-5,6,7-trichloro(4,5,6,7-tetrachloro)-1,3-tropolones with alcohols leads to the contraction of the seven-membered tropone ring with the formation of 2-(2-benzoxa(thia)zolyl)-6-alkoxycarbonylphenols. The molecular structure of 2-(2-ethoxycarbonyl-6-hydroxy-3,4,5-trichlorophenyl)benzoxazole has been determined by X-ray diffraction. 2-(2-Benzoxa(thia)zolyl)-6-alkoxycarbonylphenols display intense green fluorescence with anomalous Stokes shifts caused by the excited state intramolecular proton transfer (ESIPT) effects. PMID:26664640

A novel subfamily of monomeric inorganic pyrophosphatases in photosynthetic eukaryotes

PubMed Central

Gómez-García, María R.; Losada, Manuel; Serrano, Aurelio

2005-01-01

Two sPPases (soluble inorganic pyrophosphatases, EC 3.6.1.1) have been isolated from the microalga Chlamydomonas reinhardtii. Both are monomeric proteins of organellar localization, the chloroplastic sPPase I [Cr (Ch. reinhardtii)-sPPase I, 30 kDa] is a major isoform and slightly larger protein than the mitochondrial sPPase II (Cr-sPPase II, 24 kDa). They are members of sPPase family I and are encoded by two different cDNAs, as demonstrated by peptide mass fingerprint analysis. Molecular phylogenetic analyses indicated that Cr-sPPase I is closely related to other eukaryotic sPPases, whereas Cr-sPPase II resembles its prokaryotic counterparts. Chloroplastic sPPase I may have replaced a cyanobacterial ancestor very early during plastid evolution. Cr-sPPase II orthologues are found in members of the green photosynthetic lineage, but not in animals or fungi. These two sPPases from photosynthetic eukaryotes are novel monomeric family I sPPases with different molecular phylogenies and cellular localizations. PMID:16313235

First record of the subfamily Anoplophilinae (Orthoptera: Rhaphidophoridae) from Russia with description of a new species of the genus Alpinanoplophilus Ishikawa, 1993.

PubMed

Storozhenko, Sergey Yu

2015-06-17

The subfamily Anoplophilinae (Rhaphidophopridae) is recorded from Russia for the first time. Alpinanoplophilus kurilensis Storozhenko, sp. nov. is described from Kunashir Island. The holotype of the new species is deposited in the Zoological Institute of Russian Academy of Science (St. Petersburg, Russia). A revised key to the species of the genus Alpinanoplophilus Ishikawa, 1993 is provided.

PHISTc protein family members localize to different subcellular organelles and bind Plasmodium falciparum major virulence factor PfEMP-1.

PubMed

Kumar, Vikash; Kaur, Jasweer; Singh, Amrit P; Singh, Vineeta; Bisht, Anjali; Panda, Jiban J; Mishra, Prakash C; Hora, Rachna

2018-01-01

Plasmodium falciparum encodes a novel repertoire of the Plasmodium helical interspersed subtelomeric (PHIST) family of exported proteins, which play diverse roles in infected red blood cells, contributing to malaria pathogenesis. PHIST proteins are central to parasite biology and modify human erythrocytes by interacting with parasite and host proteins. Here, we have attempted to understand the localization and function of two unexplored proteins of the PHISTc subfamily, PFD1140w and PF11_0503, and compared these with a well-characterized member, PFI1780w. We demonstrate that Phist domains assume different oligomeric states owing to a distinct array of subunit interface residues. Colocalization of a Maurer's cleft signature protein, P. falciparum skeleton-binding protein-1 (PfSBP-1), and P. falciparum erythrocyte membrane protein-1 (PfEMP-1) revealed different subcellular destinations for these PHIST members. We further show the binding of recombinant PHIST proteins to the cytoplasmic tail of PfEMP-1 and a novel interaction with PfSBP-1. Interestingly, PFD1140w interacts with PfEMP-1 and PfSBP-1 simultaneously in vitro leading to formation of a complex. These two distant PHISTc members also bind PfEMP-1 on distinct sites, despite sharing the Phist domain. Our data re-emphasize a supportive role for PHIST proteins in cytoadhesion, and identify a new binding partner, PfSBP-1, for members of this family. This information therefore adds another chapter to the understanding of P. falciparum biology and highlights the significance of the unexplored PHIST family. © 2017 Federation of European Biochemical Societies.

G Protein-coupled Receptor Kinases of the GRK4 Protein Subfamily Phosphorylate Inactive G Protein-coupled Receptors (GPCRs).

PubMed

Li, Lingyong; Homan, Kristoff T; Vishnivetskiy, Sergey A; Manglik, Aashish; Tesmer, John J G; Gurevich, Vsevolod V; Gurevich, Eugenia V

2015-04-24

G protein-coupled receptor (GPCR) kinases (GRKs) play a key role in homologous desensitization of GPCRs. It is widely assumed that most GRKs selectively phosphorylate only active GPCRs. Here, we show that although this seems to be the case for the GRK2/3 subfamily, GRK5/6 effectively phosphorylate inactive forms of several GPCRs, including β2-adrenergic and M2 muscarinic receptors, which are commonly used as representative models for GPCRs. Agonist-independent GPCR phosphorylation cannot be explained by constitutive activity of the receptor or membrane association of the GRK, suggesting that it is an inherent ability of GRK5/6. Importantly, phosphorylation of the inactive β2-adrenergic receptor enhanced its interactions with arrestins. Arrestin-3 was able to discriminate between phosphorylation of the same receptor by GRK2 and GRK5, demonstrating preference for the latter. Arrestin recruitment to inactive phosphorylated GPCRs suggests that not only agonist activation but also the complement of GRKs in the cell regulate formation of the arrestin-receptor complex and thereby G protein-independent signaling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Structural insights into the difference in substrate recognition of two mannoside phosphorylases from two GH130 subfamilies.

PubMed

Ye, Yuxin; Saburi, Wataru; Odaka, Rei; Kato, Koji; Sakurai, Naofumi; Komoda, Keisuke; Nishimoto, Mamoru; Kitaoka, Motomitsu; Mori, Haruhide; Yao, Min

2016-03-01

In Ruminococcus albus, 4-O-β-D-mannosyl-D-glucose phosphorylase (RaMP1) and β-(1,4)-mannooligosaccharide phosphorylase (RaMP2) belong to two subfamilies of glycoside hydrolase family 130. The two enzymes phosphorolyze β-mannosidic linkages at the nonreducing ends of their substrates, and have substantially diverse substrate specificity. The differences in their mechanism of substrate binding have not yet been fully clarified. In the present study, we report the crystal structures of RaMP1 with/without 4-O-β-D-mannosyl-d-glucose and RaMP2 with/without β-(1→4)-mannobiose. The structures of the two enzymes differ at the +1 subsite of the substrate-binding pocket. Three loops are proposed to determine the different substrate specificities. One of these loops is contributed from the adjacent molecule of the oligomer structure. In RaMP1, His245 of loop 3 forms a hydrogen-bond network with the substrate through a water molecule, and is indispensible for substrate binding. © 2016 Federation of European Biochemical Societies.

Structural Insight into the Assembly of TRPV Channels

PubMed Central

Huynh, Kevin W.; Cohen, Matthew R.; Chakrapani, Sudha; Holdaway, Heather A.; Stewart, Phoebe L.; Moiseenkova-Bell, Vera Y.

2017-01-01

SUMMARY Transient receptor potential (TRP) proteins are a large family of polymodal nonselective cation channels. The TRP vanilloid (TRPV) subfamily consists of six homologous members with diverse functions. TRPV1–TRPV4 are nonselective cation channels proposed to play a role in nociception, while TRPV5 and TRPV6 are involved in epithelial Ca2+ homeostasis. Here we present the cryo-electron microscopy (cryo-EM) structure of functional, full-length TRPV2 at 13.6 Å resolution. The map reveals that the TRPV2 cytoplasmic domain displays a 4-fold petal-like shape in which high-resolution N-terminal ankyrin repeat domain (ARD) structures can be unambiguously fitted. Fitting of the available ARD structures for other TRPV subfamily members into the TRPV2 EM map suggests that TRPV subfamily members have highly homologous structural topologies. These results allowed us to postulate a structural explanation for the functional diversity among TRPV channels and their differential regulation by proteins and ligands. PMID:24373766

"Phylogenetic and evolutionary analysis of functional divergence among Gamma glutamyl transpeptidase (GGT) subfamilies".

PubMed

Verma, Ved Vrat; Gupta, Rani; Goel, Manisha

2015-09-14

γ-glutamyltranspeptidase (GGT) is a bi-substrate enzyme conserved in all three domains of life. It catalyzes the cleavage and transfer of γ-glutamyl moiety of glutathione to either water (hydrolysis) or substrates like peptides (transpeptidation). GGTs exhibit great variability in their enzyme kinetics although the mechanism of catalysis is conserved. Recently, GGT has been shown to be a virulence factor in microbes like Helicobacter pylori and Bacillus anthracis. In mammalian cells also, GGT inhibition prior to chemotherapy has been shown to sensitize tumors to the therapy. Therefore, lately both bacterial and eukaryotic GGTs have emerged as potential drug targets, but the efforts directed towards finding suitable inhibitors have not yielded any significant results yet. We propose that delineating the residues responsible for the functional diversity associated with these proteins could help in design of species/clade specific inhibitors. In the present study, we have carried out phylogenetic analysis on a set of 47 GGT-like proteins to address the functional diversity. These proteins segregate into various subfamilies, forming separate clades on the tree. Sequence conservation and motif prediction studies show that even though most of the highly conserved residues have been characterized biochemically in previous studies, a significant number of novel putative sites and motifs are discovered that vary in a clade specific manner. Many of the putative sites predicted during the functional divergence type I and type II analysis, lie close to the known catalytic residues and line the walls of the substrate binding cavity, reinforcing their role in modulating the substrate specificity, catalytic rates and stability of this protein. The study offers interesting insights into the evolution of GGT-like proteins in pathogenic vs. non-pathogenic bacteria, archaea and eukaryotes. Our analysis delineates residues that are highly specific to each GGT subfamily. We propose

Crystal structure of the protein At3g01520, a eukaryotic universal stress protein-like protein from Arabidopsis thaliana in complex with AMP.

PubMed

Kim, Do Jin; Bitto, Eduard; Bingman, Craig A; Kim, Hyun-Jung; Han, Byung Woo; Phillips, George N

2015-07-01

Members of the universal stress protein (USP) family are conserved in a phylogenetically diverse range of prokaryotes, fungi, protists, and plants and confer abilities to respond to a wide range of environmental stresses. Arabidopsis thaliana contains 44 USP domain-containing proteins, and USP domain is found either in a small protein with unknown physiological function or in an N-terminal portion of a multi-domain protein, usually a protein kinase. Here, we report the first crystal structure of a eukaryotic USP-like protein encoded from the gene At3g01520. The crystal structure of the protein At3g01520 was determined by the single-wavelength anomalous dispersion method and refined to an R factor of 21.8% (Rfree = 26.1%) at 2.5 Å resolution. The crystal structure includes three At3g01520 protein dimers with one AMP molecule bound to each protomer, comprising a Rossmann-like α/β overall fold. The bound AMP and conservation of residues in the ATP-binding loop suggest that the protein At3g01520 also belongs to the ATP-binding USP subfamily members. © 2015 The Authors. Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2012 CFR

2012-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional equivalent...

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2011 CFR

2011-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional equivalent...

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2010 CFR

2010-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional equivalent...

Cyanide-insensitive quinol oxidase (CIO) from Gluconobacter oxydans is a unique terminal oxidase subfamily of cytochrome bd.

PubMed

Miura, Hiroshi; Mogi, Tatsushi; Ano, Yoshitaka; Migita, Catharina T; Matsutani, Minenosuke; Yakushi, Toshiharu; Kita, Kiyoshi; Matsushita, Kazunobu

2013-06-01

Cyanide-insensitive terminal quinol oxidase (CIO) is a subfamily of cytochrome bd present in bacterial respiratory chain. We purified CIO from the Gluconobacter oxydans membranes and characterized its properties. The air-oxidized CIO showed some or weak peaks of reduced haemes b and of oxygenated and ferric haeme d, differing from cytochrome bd. CO- and NO-binding difference spectra suggested that haeme d serves as the ligand-binding site of CIO. Notably, the purified CIO showed an extraordinary high ubiquinol-1 oxidase activity with the pH optimum of pH 5-6. The apparent Vmax value of CIO was 17-fold higher than that of G. oxydans cytochrome bo3. In addition, compared with Escherichia coli cytochrome bd, the quinol oxidase activity of CIO was much more resistant to cyanide, but sensitive to azide. The Km value for O2 of CIO was 7- to 10-fold larger than that of G. oxydans cytochrome bo3 or E. coli cytochrome bd. Our results suggest that CIO has unique features attributable to the structure and properties of the O2-binding site, and thus forms a new sub-group distinct from cytochrome bd. Furthermore, CIO of acetic acid bacteria may play some specific role for rapid oxidation of substrates under acidic growth conditions.

Prevalence of impaired fasting glucose and type 1 and 2 diabetes mellitus in a large nationwide working population in Spain.

PubMed

Reviriego, Jesús; Vázquez, Luis Alberto; Goday, Albert; Cabrera, Martha; García-Margallo, María Teresa; Calvo, Eva

2016-04-01

To report the prevalence of impaired fasting glucose (IFG), undiagnosed and diagnosed diabetes, and their association to occupational categories in a representative sample of working population in Spain. A cross-sectional study of workers who attended routine medical check-ups from January 2007 to December 2007. A structured questionnaire was completed, and physical examinations and routine serum biochemical tests were performed. IFG was defined as fasting glucose levels ranging from 100 to 125 mg/dl with no diagnosis of T1DM or T2DM; T1DM was defined as previous diagnosis of T1DM; and T2DM as previous diagnosis of T2DM, treatment with oral antidiabetic drugs or insulin or fasting glucose levels ≥126 mg/dl, according to ADA criteria. Of the 371,997 participants (median age 35 [interquartile range 29-44] years), 72.4% were male. Raw prevalence rates (95% CI) of IFG, undiagnosed (UKDM), and previously known type 2 (KDM2) and type 1 (KDM1) diabetes were 10.4% (10.3-10.5%), 1.3% (1.2-1.3%), 1.1% (1.1-1.2%), and 0.3% (0.3-0.3%), respectively. With the exception of KDM1, prevalence of these conditions increased with age and was greater among manual/blue-collar workers (12.1%, 1.5%, 1.3% and 0.3%, respectively) as compared to non-manual/white-collar workers (7.3%, 0.8%, 0.8% and 0.3%, respectively). Age- and sex-adjusted prevalence rates of IFG, UKDM and KDM2 were 13.1%, 2.0% and 2.4%, respectively. In this sample of Spanish working population, impaired glycemic profiles were common. Prevalence rates of IFG and T2DM were high among blue-collar workers (except for T1DM). These data emphasize the need for earlier structured preventive schemes. Copyright © 2016 SEEN. Published by Elsevier España, S.L.U. All rights reserved.

The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

PubMed Central

Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

2001-01-01

We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

Ligand, receptor, and cell type-dependent regulation of ABCA1 and ABCG1 mRNA in prostate cancer epithelial cells

USDA-ARS?s Scientific Manuscript database

Recent evidence suggests that the liver X receptor (LXR) is a potential anti-cancer target in prostate carcinoma. There is little characterization, however, of how the two major isoforms LXRa or LXRß regulate the LXR-responsive genes ATP-binding cassette sub-family A 1 (ABCA1) and sub-family member ...

Molecular phylogeny of moth-specialized spider sub-family Cyrtarachninae, which includes bolas spiders.

PubMed

Tanikawa, Akio; Shinkai, Akira; Miyashita, Tadashi

2014-11-01

The evolutionary process of the unique web architectures of spiders of the sub-family Cyrtarachninae, which includes the triangular web weaver, bolas spider, and webless spider, is thought to be derived from reduction of orbicular 'spanning-thread webs' resembling ordinal orb webs. A molecular phylogenetic analysis was conducted to explore this hypothesis using orbicular web spiders Cyrtarachne, Paraplectana, Poecilopachys, triangular web spider Pasilobus, bolas spiders Ordgarius and Mastophora, and webless spider Celaenia. The phylogeny inferred from partial sequences of mt-COI, nuclear 18S-rRNA and 28S-rRNA showed that the common ancestor of these spiders diverged into two clades: a spanning-thread web clade and a bolas or webless clade. This finding suggests that the triangular web evolved by reduction of an orbicular spanning web, but that bolas spiders evolved in the early stage, which does not support the gradual web reduction hypothesis.

Developmental morphology of flattened shoots in Dalzellia ubonensis and Indodalzellia gracilis with implications for the evolution of diversified shoot morphologies in the subfamily Tristichoideae (Podostemaceae).

PubMed

Fujinami, Rieko; Imaichi, Ryoko

2015-06-01

Podostemaceae is a unique family of aquatic angiosperms that grow in swift-running water on rock surfaces in the tropics. Their plant bodies show a remarkable adaptation: the main plant body is mostly creeping or flattened, or in extreme cases foliose, functioning as an adhering and photosynthetic organ. In the subfamily Podostemoideae, the root is foliose, whereas in the subfamily Tristichoideae, the shoot is foliose. An evolutionary scenario for the foliose root has already been proposed, but that for the foliose shoot remains to be addressed. Shoots of Indodalzellia gracilis and Dalzellia ubonensis (subfamily Tristichoideae) were observed using light microscopy and scanning electron microscopy. Gene expression patterns of orthologs of marker genes for the shoot apical meristem, i.e., SHOOT MERISTEMLESS and WUSCHEL, in D. ubonensis were analyzed. When very young, the phyllotaxis is tristichous in both genera: a set of one dorsal and two marginal leaves forms. When the shoot branches, extra-axillary buds of two subsequent marginal leaves form as new (lateral) shoots, and the original shoot stops growing; this growth pattern is called sympodial branching. Due to zonal growth in the common zone just below the original and lateral shoot apices, flattened or foliose shoots result. The expression patterns of DuSTM and DuWUS in the shoot apices of Dalzellia were similar to those published for Terniopsis. The foliose shoots of Indodalzellia and Dalzellia evolved as a result of congenital fusion among several original and lateral branches, each of which grows separately in other Tristichoideae. © 2015 Botanical Society of America, Inc.

Modulation of the Rat Hepatic Cytochrome P4501A Subfamily Using Biotin Supplementation

PubMed Central

Ronquillo-Sánchez, M. D.; Camacho-Carranza, R.; Fernandez-Mejia, C.; Hernández-Ojeda, S.; Elinos-Baez, M.; Espinosa-Aguirre, J. J.

2013-01-01

Studies have found that biotin favors glucose and lipid metabolism, and medications containing biotin have been developed. Despite the use of biotin as a pharmacological agent, few studies have addressed toxicity aspects including the possible interaction with cytochrome P450 enzyme family. This study analyzed the effects of pharmacological doses of biotin on the expression and activity of the cytochrome P4501A subfamily involved in the metabolism of xenobiotics. Wistar rats were treated daily with biotin (2 mg/kg, i.p.), while the control groups were treated with saline. All of the rats were sacrificed by cervical dislocation after 1, 3, 5, or 7 days of treatment. CYP1A1 and CYP1A2 mRNAs were modified by biotin while enzyme activity and protein concentration were not affected. The lack of an effect of biotin on CYP1A activity was confirmed using other experimental strategies, including (i) cotreatment of the animals with biotin and a known CYP1A inducer; (ii) the addition of biotin to the reaction mixtures for the measurement of CYP1A1 and CYP1A2 activities; and (iii) the use of an S9 mixture that was prepared from control and biotin-treated rats to analyze the activation of benzo[a]pyrene (BaP) into mutagenic metabolites using the Ames test. The results suggest that biotin does not influence the CYP1A-mediated metabolism of xenobiotics. PMID:23984390

20 CFR 653.104 - Services to MSFW family members, farm labor contractors, and crew members.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Services to MSFW family members, farm labor contractors, and crew members. 653.104 Section 653.104 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR SERVICES OF THE EMPLOYMENT SERVICE SYSTEM Services for Migrant and Seasonal...

HDAC inhibitors induce global changes in histone lysine and arginine methylation and alter expression of lysine demethylases.

PubMed

Lillico, Ryan; Sobral, Marina Gomez; Stesco, Nicholas; Lakowski, Ted M

2016-02-05

Histone deacetylase (HDAC) inhibitors are cancer treatments that inhibit the removal of the epigenetic modification acetyllysine on histones, resulting in altered gene expression. Such changes in expression may influence other histone epigenetic modifications. We describe a validated liquid chromatography-tandem mass spectrometry (LC-MS/MS) method to quantify lysine acetylation and methylation and arginine methylation on histones extracted from cultured cells treated with HDAC inhibitors. The HDAC inhibitors vorinostat, mocetinostat and entinostat induced 400-600% hyperacetylation in HEK 293 and K562 cells. All HDAC inhibitors decreased histone methylarginines in HEK 293 cells but entinostat produced dose dependent reductions in asymmetric dimethylarginine, not observed in K562 cells. Vorinostat produced increases in histone lysine methylation and decreased expression of some lysine demethylases (KDM), measured by quantitative PCR. Entinostat had variable effects on lysine methylation and decreased expression of some KDM while increasing expression of others. Mocetinostat produced dose dependent increases in histone lysine methylation by LC-MS/MS. This was corroborated with a multiplex colorimetric assay showing increases in histone H3 lysine 4, 9, 27, 36 and 79 methylation. Increases in lysine methylation were correlated with dose dependent decreases in the expression of seven KDM. Mocetinostat functions as an HDAC inhibitor and a de facto KDM inhibitor. Copyright © 2015 Elsevier B.V. All rights reserved.

Alateen Members' and Non-Members' Understanding of Alcoholism.

ERIC Educational Resources Information Center

Weber, Joseph A.; McCormick, Peggy

1992-01-01

Alateen (n=49) and non-Alateen (n=52) members were compared on knowledge and understanding of alcoholism. Results indicated Alateen members understood alcoholism as family disease and alcoholism as treatable. Alateen members suggested educational curriculum with message of successful treatment for alcoholic, whereas non-Alateen members stressed…

A Rhodium(III)-Based Inhibitor of Lysine-Specific Histone Demethylase 1 as an Epigenetic Modulator in Prostate Cancer Cells.

PubMed

Yang, Chao; Wang, Wanhe; Liang, Jia-Xin; Li, Guodong; Vellaisamy, Kasipandi; Wong, Chun-Yuen; Ma, Dik-Lung; Leung, Chung-Hang

2017-03-23

We report herein a novel rhodium(III) complex 1 as a new LSD1 targeting agent and epigenetic modulator. Complex 1 disrupted the interaction of LSD1-H3K4me2 in human prostate carcinoma cells and enhanced the amplification of p21, FOXA2, and BMP2 gene promoters. Complex 1 was selective for LSD1 over other histone demethylases, such as KDM2b, KDM7, and MAO activities, and also showed antiproliferative activity toward human cancer cells. To date, complex 1 is the first metal-based inhibitor of LSD1 activity.

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

PubMed Central

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

2014-01-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

A Single Amino Acid Substitution in the v-Eyk Intracellular Domain Results in Activation of Stat3 and Enhances Cellular Transformation

PubMed Central

Besser, Daniel; Bromberg, Jacqueline F.; Darnell, James E.; Hanafusa, Hidesaburo

1999-01-01

The receptor tyrosine kinase Eyk, a member of the Axl/Tyro3 subfamily, activates the STAT pathway and transforms cells when constitutively activated. Here, we compared the potentials of the intracellular domains of Eyk molecules derived from c-Eyk and v-Eyk to transform rat 3Y1 fibroblasts. The v-Eyk molecule induced higher numbers of transformants in soft agar and stronger activation of Stat3; levels of Stat1 activation by the two Eyk molecules were similar. A mutation in the sequence Y933VPL, present in c-Eyk, to the v-Eyk sequence Y933VPQ led to increased activation of Stat3 and increased transformation efficiency. However, altering another sequence, Y862VNT, present in both Eyk molecules to F862VNT markedly decreased transformation without impairing Stat3 activation. These results indicate that activation of Stat3 enhances transformation efficiency and cooperates with another pathway to induce transformation. PMID:9891073

Prevalence of LuxR- and LuxI-type quorum sensing circuits in members of the Populus deltoides microbiome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schaefer, Amy L; Lappala, Colin; Morlen, Ryan

2013-01-01

We are interested in the root microbiome of the fast-growing Eastern cottonwood tree, Populus 25 deltoides. There is a large bank of bacterial isolates from P. deltoides and there are 44 draft 26 genomes of bacterial endophyte and rhizosphere isolates. As a first step in efforts to understand 27 the roles of bacterial communication and plant-bacterial signaling in P. deltoides we focused on 28 the prevalence of acyl-homoserine lactone (AHL) quorum sensing signal production and 29 reception in members of the P. deltoides microbiome. We screened 129 bacterial isolates for 30 AHL production using a broad-spectrum bioassay that responds tomore » many but not all AHLs, and 31 we queried the available genome sequences of microbiome isolates for homologs of AHL 32 synthase and receptor genes. AHL signal production was detected in 40% of 129 strains tested. 33 Positive isolates included -, - and -Proteobacteria. Members of the luxI family of AHL 34 synthases were identified in 18 of 39 Proteobacteria genomes including genomes of some 35 isolates that tested negative in the bioassay. Members of the luxR family of transcription factors, 36 that include AHL-responsive factors, were more abundant than luxI homologs. There were 72 in 37 the 39 Proteobacteria genomes. Some of the luxR homologs appear to be members of a 38 subfamily of LuxRs that respond to as yet unknown plant signals rather than bacterial AHLs. 39 Apparently, there is a substantial capacity for AHL cell-to-cell communication in Proteobacteria 40 of the P. deltoides microbiota and there are also Proteobacteria with LuxR homologs of the type 41 hypothesized to respond to plant signals or cues.« less

Integrative View of α2,3-Sialyltransferases (ST3Gal) Molecular and Functional Evolution in Deuterostomes: Significance of Lineage-Specific Losses

PubMed Central

Petit, Daniel; Teppa, Elin; Mir, Anne-Marie; Vicogne, Dorothée; Thisse, Christine; Thisse, Bernard; Filloux, Cyril; Harduin-Lepers, Anne

2015-01-01

Sialyltransferases are responsible for the synthesis of a diverse range of sialoglycoconjugates predicted to be pivotal to deuterostomes’ evolution. In this work, we reconstructed the evolutionary history of the metazoan α2,3-sialyltransferases family (ST3Gal), a subset of sialyltransferases encompassing six subfamilies (ST3Gal I–ST3Gal VI) functionally characterized in mammals. Exploration of genomic and expressed sequence tag databases and search of conserved sialylmotifs led to the identification of a large data set of st3gal-related gene sequences. Molecular phylogeny and large scale sequence similarity network analysis identified four new vertebrate subfamilies called ST3Gal III-r, ST3Gal VII, ST3Gal VIII, and ST3Gal IX. To address the issue of the origin and evolutionary relationships of the st3gal-related genes, we performed comparative syntenic mapping of st3gal gene loci combined to ancestral genome reconstruction. The ten vertebrate ST3Gal subfamilies originated from genome duplication events at the base of vertebrates and are organized in three distinct and ancient groups of genes predating the early deuterostomes. Inferring st3gal gene family history identified also several lineage-specific gene losses, the significance of which was explored in a functional context. Toward this aim, spatiotemporal distribution of st3gal genes was analyzed in zebrafish and bovine tissues. In addition, molecular evolutionary analyses using specificity determining position and coevolved amino acid predictions led to the identification of amino acid residues with potential implication in functional divergence of vertebrate ST3Gal. We propose a detailed scenario of the evolutionary relationships of st3gal genes coupled to a conceptual framework of the evolution of ST3Gal functions. PMID:25534026

[Distributions of H3K27me3 and its modification enzymes in different tissues of mice].

PubMed

Wang, Yuying; Wang, Xinli; Zhang, Ran; Zhang, Zhiyan; Wang, Yu; Yang, Bo; Wang, Guanjie; Zhang, Xin; Ma, Fuhao; Xu, Hongye; Wu, Xiaohui; Zhang, Feng; Li, Qing

2017-11-01

Objective To investigate the levels of trimethylated histone 3 at lysine residue 27 (H3K27me3) and its modification enzymes Zeste gene enhancer homolog 2 (EZH2), lysine-specific demethylase 6B (Kdm6B/JMJD3) and lysine-specific demethylase 6A (Kdm6A/UTX) in tissues and organs of 7-day and 2-month postnatal mice. Methods Immunohistochemistry was used to detect the expressions of H3K27me3 and its modification enzymes EZH2, JMJD3 and UTX in the brain, salivary glands, back fat, thymus, lung, heart, stomach, intestines, liver, testes, and skin of 7-day and 2-month mice. Real-time quantitative PCR was used to confirm the results. The relationships between H3K27me3 and its modification enzymes were analyzed statistically. Results Immunohistochemistry showed H3K27me3 persistently present in all examined tissues of 7-day and 2-month mice. EZH2 was persistently expressed in the brain, heart, liver, and skin of 7-day and 2-month mice, but only expressed in the salivary glands, adipose tissues, thymus, lung, intestines, and testes of 2-month mice. JMJD3 was expressed in the brain, salivary glands, adipose tissues, lung, heart, stomach, intestines, testes, skin of 7-day mice, but was not expressed in the lung, adipose tissues and stomach of 2-month mice. UTX was expressed in the brain, salivary glands, adipose tissues, lung, heart, testes, skin of 7-day mice, but only expressed in the testes of 2-month mice. Most mRNA of H3K27 modification enzymes were moderately or highly expressed as their immunohistochemical results were positive. Conclusion There was H3K27me3 persistently present in the all examined tissues at different stages. EZH2 was mostly expressed in the brain, salivary glands, adipose tissues, thymus, lung, heart, intestines, liver, testes and skin of 2-month-old mice. JMJD3 and UTX were mostly expressed in the brain, salivary glands, adipose tissues, lung, heart, skin and testes of 7-day-old mice. No significant association was found between the distribution of H3K

Analyses of publicly available genomics resources define FGF-2-expressing bladder carcinomas as EMT-prone, proliferative tumors with low mutation rates and high expression of CTLA-4, PD-1 and PD-L1

PubMed Central

McNiel, Elizabeth A; Tsichlis, Philip N

2017-01-01

Fibroblast growth factor 2 (FGF-2) is overexpressed in a subset of invasive bladder carcinomas and its overexpression correlates with poor prognosis. Analyses of publicly available databases addressing the molecular mechanisms that may be responsible for the poor prognosis of these tumors, revealed that FGF-2 expression correlates positively with the expression of epithelial to mesenchymal transition (EMT)-promoting transcription factors and with changes in gene expression that are characteristic of EMT. The same analyses also revealed that FGF-2 correlates negatively with the expression, mutation and copy number variations of FGFR-3, all of which are associated with noninvasive bladder carcinomas. Finally, they showed that FGF-2 expression correlates with the expression of FGFR-1, the expression of the IIIc variant of FGFR-2 and with the expression of Akt3. The latter observation is significant because our earlier studies had shown that Akt3 regulates FGFR-2 alternative splicing, shifting the balance toward the IIIc relative to the IIIb FGFR-2 splice variant. As the IIIc variant is recognized by FGF-2, while the IIIb variant is not, we conclude that Akt3 may facilitate the FGF-2 response. FGF-2 is known to promote the expression of KDM2B, which functions in concert with EZH2 to repress the EZH2-targeting microRNA miR-101, activating a switch, which stably upregulates EZH2. The cancer genome atlas (TCGA) data showing a correlation between KDM2B and EZH2 expression and Oncomine data, showing a correlation between KDM2B and tumor progression, strongly support the role of the FGF-2/KDM2B/miR-101/EZH2 pathway in bladder cancer. These observations combined, suggest a model according to which FGF-2 induces EMT, cell proliferation and cancer stem cell self-renewal by coupling the Akt3 and KDM2B-controlled pathways outlined above, in bladder carcinomas. Further analyses of publicly available databases, revealed that FGF-2-expressing bladder carcinomas carry fewer genetic

41 CFR 301-31.3 - Are members of my family and I eligible for payment of subsistence and transportation expense?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false Are members of my family... Contracts and Property Management Federal Travel Regulation System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES ALLOWABLE TRAVEL EXPENSES 31-THREATENED LAW ENFORCEMENT/INVESTIGATIVE EMPLOYEES § 301-31.3 Are members of my...

Sea snakes in Australian waters (Serpentes: subfamilies Hydrophiinae and Laticaudinae)--a review with an updated identification key.

PubMed

Rasmussen, Arne Redsted; Sanders, Kate Laura; Guinea, Michael L; Amey, Andrew P

2014-10-02

Sea snakes (Elapidae, subfamilies Hydrophiinae and Laticaudinae) reach high species richness in the South China Sea and in the Australian region; however, most countries in the two regions still lack up-to-date checklists and identification tools for these snakes. We present an updated reviewed checklist and a new complete identification key to sea snakes in Australian waters. The identification key includes 29 species documented and 4 possibly occurring taxa and is based mostly on easy-to-use external characters. We find no evidence for breeding populations of Laticauda in Australian waters, but include the genus on the list of possibly occurring taxa. 

High-resolution spectrum of the second member in the ( πu3 p) 4 ( πg3 p) ( πunp) Rydberg series of 32S 2

NASA Astrophysics Data System (ADS)

Ramanamma Chaudhri, Y. V.; Mahajan, C. G.

1991-02-01

High-resolution spectra of S 2 in the region of the E and F- X progressions have been used to carry out the rotational analyses of the bands at 65 869, 66 666, 65 978, 66 380, and 67 094 cm -1. The first two bands form a single progression and have been attributed to the transition E1 u( {1}/{2}, {1}/{2}) ← X0 g+. The bands at 65 978 and 66 380 cm -1 are shown to belong to the electronic transitions E'0 u+( {1}/{2}, {1}/{2}) ← X0 g+ and F1 u( {3}/{2}, {1}/{2}) ← X0 g+, respectively. The group of states E, E', and F constitutes the second member ( n = 5) of the Rydberg series ( πu3 p) 4 ( πu3 p) ( πunp) whose first member ( n = 4) is the state 3Σ u-. The band at 67 094 cm -1 has been assigned to the transition D'1 u ← X0 g+ which, when considered in the light of the state D3Π u, seems to form a second member of the Rydberg series ( πu3 p) 4 ( πg3 p) ( σunp). The vibrational and rotational constants of these electronic states have also been derived.

A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA.

PubMed

Hochbach, Anne; Schneider, Julia; Röser, Martin

2015-06-01

To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa. Copyright © 2015 Elsevier Inc. All rights reserved.

The Compromised Recognition of Turnip Crinkle Virus1 Subfamily of Microrchidia ATPases Regulates Disease Resistance in Barley to Biotrophic and Necrotrophic Pathogens1[C][W][OPEN

PubMed Central

Langen, Gregor; von Einem, Sabrina; Koch, Aline; Imani, Jafargholi; Pai, Subhash B.; Manohar, Murli; Ehlers, Katrin; Choi, Hyong Woo; Claar, Martina; Schmidt, Rebekka; Mang, Hyung-Gon; Bordiya, Yogendra; Kang, Hong-Gu; Klessig, Daniel F.; Kogel, Karl-Heinz

2014-01-01

MORC1 and MORC2, two of the seven members of the Arabidopsis (Arabidopsis thaliana) Compromised Recognition of Turnip Crinkle Virus1 subfamily of microrchidia Gyrase, Heat Shock Protein90, Histidine Kinase, MutL (GHKL) ATPases, were previously shown to be required in multiple layers of plant immunity. Here, we show that the barley (Hordeum vulgare) MORCs also are involved in disease resistance. Genome-wide analyses identified five MORCs that are 37% to 48% identical on the protein level to AtMORC1. Unexpectedly, and in clear contrast to Arabidopsis, RNA interference-mediated knockdown of MORC in barley resulted in enhanced basal resistance and effector-triggered, powdery mildew resistance locus A12-mediated resistance against the biotrophic powdery mildew fungus (Blumeria graminis f. sp. hordei), while MORC overexpression decreased resistance. Moreover, barley knockdown mutants also showed higher resistance to Fusarium graminearum. Barley MORCs, like their Arabidopsis homologs, contain the highly conserved GHKL ATPase and S5 domains, which identify them as members of the MORC superfamily. Like AtMORC1, barley MORC1 (HvMORC1) binds DNA and has Mn2+-dependent endonuclease activities, suggesting that the contrasting function of MORC1 homologs in barley versus Arabidopsis is not due to differences in their enzyme activities. In contrast to AtMORCs, which are involved in silencing of transposons that are largely restricted to pericentromeric regions, barley MORC mutants did not show a loss-of-transposon silencing regardless of their genomic location. Reciprocal overexpression of MORC1 homologs in barley and Arabidopsis showed that AtMORC1 and HvMORC1 could not restore each other’s function. Together, these results suggest that MORC proteins function as modulators of immunity, which can act negatively (barley) or positively (Arabidopsis) dependent on the species. PMID:24390392

A new subfamily LIP of the major intrinsic proteins.

PubMed

Khabudaev, Kirill Vladimirovich; Petrova, Darya Petrovna; Grachev, Mikhail Aleksandrovich; Likhoshway, Yelena Valentinovna

2014-03-04

Proteins of the major intrinsic protein (MIP) family, or aquaporins, have been detected in almost all organisms. These proteins are important in cells and organisms because they allow for passive transmembrane transport of water and other small, uncharged polar molecules. We compared the predicted amino acid sequences of 20 MIPs from several algae species of the phylum Heterokontophyta (Kingdom Chromista) with the sequences of MIPs from other organisms. Multiple sequence alignments revealed motifs that were homologous to functionally important NPA motifs and the so-called ar/R-selective filter of glyceroporins and aquaporins. The MIP sequences of the studied chromists fell into several clusters that belonged to different groups of MIPs from a wide variety of organisms from different Kingdoms. Two of these proteins belong to Plasma membrane intrinsic proteins (PIPs), four of them belong to GlpF-like intrinsic proteins (GIPs), and one of them belongs to a specific MIPE subfamily from green algae. Three proteins belong to the unclassified MIPs, two of which are of bacterial origin. Eight of the studied MIPs contain an NPM-motif in place of the second conserved NPA-motif typical of the majority of MIPs. The MIPs of heterokonts within all detected clusters can differ from other MIPs in the same cluster regarding the structure of the ar/R-selective filter and other generally conserved motifs. We proposed placing nine MIPs from heterokonts into a new group, which we have named the LIPs (large intrinsic proteins). The possible substrate specificities of the studied MIPs are discussed.

Evolutionary conservation and changes in insect TRP channels.

PubMed

Matsuura, Hironori; Sokabe, Takaaki; Kohno, Keigo; Tominaga, Makoto; Kadowaki, Tatsuhiko

2009-09-10

TRP (Transient Receptor Potential) channels respond to diverse stimuli and thus function as the primary integrators of varied sensory information. They are also activated by various compounds and secondary messengers to mediate cell-cell interactions as well as to detect changes in the local environment. Their physiological roles have been primarily characterized only in mice and fruit flies, and evolutionary studies are limited. To understand the evolution of insect TRP channels and the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in Drosophila melanogaster, Bombyx mori, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, and Pediculus humanus genomes as part of genome sequencing efforts. All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, demonstrating that these channels have the ancient origins in insects. The common pattern also suggests that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. However, a TRPP channel, the most ancient TRP channel, is missing in B. mori, A. mellifera, and N. vitripennis. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, the other insects have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels, which have been specifically retained or gained in Coleoptera and Hymenoptera. Furthermore, TRPA1, which functions for thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels (AmHsTRPA and NvHsTRPA). NvHsTRPA expressed in HEK293 cells is activated by temperature increase, demonstrating that HsTRPAs function as novel thermal sensors in Hymenoptera. The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP family members. As shown for mammalian TRP channels, this

Complementary DNA cloning and functional characterization of cytochrome P450 3A138 in common carp (Cyprinus carpio L.).

PubMed

Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu

2014-06-01

The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.

Molecular Evolution and Expansion Analysis of the NAC Transcription Factor in Zea mays

PubMed Central

Fan, Kai; Wang, Ming; Miao, Ying; Ni, Mi; Bibi, Noreen; Yuan, Shuna; Li, Feng; Wang, Xuede

2014-01-01

NAC (NAM, ATAF1, 2 and CUC2) family is a plant-specific transcription factor and it controls various plant developmental processes. In the current study, 124 NAC members were identified in Zea mays and were phylogenetically clustered into 13 distinct subfamilies. The whole genome duplication (WGD), especially an additional WGD event, may lead to expanding ZmNAC members. Different subfamily has different expansion rate, and NAC subfamily preference was found during the expansion in maize. Moreover, the duplication events might occur after the divergence of the lineages of Z. mays and S. italica, and segmental duplication seemed to be the dominant pattern for the gene duplication in maize. Furthermore, the expansion of ZmNAC members may be also related to gain and loss of introns. Besides, the restriction of functional divergence was discovered after most of the gene duplication events. These results could provide novel insights into molecular evolution and expansion analysis of NAC family in maize, and advance the NAC researches in other plants, especially polyploid plants. PMID:25369196

Identification and characterization of a member of Rab subfamily, Rab8, from Clonorchis sinensis.

PubMed

Liang, Pei; He, Lei; Yu, Jinyun; Xie, Zhizhi; Chen, Xueqing; Mao, Qiang; Liang, Chi; Huang, Yan; Lu, Gang; Yu, Xinbing

2015-05-01

The Rabs act as a binary molecular switch that utilizes the conformational changes associated with the GTP/GDP cycle to elicit responses from target proteins. It regulates a broad spectrum of cellular processes including cell proliferation, cytoskeletal assembly, and intracellular membrane trafficking in eukaryotes. The Rab8 from Clonorchis sinensis (CsRab8) was composed of 199 amino acids. The deduced amino acid sequence shared above 50% identities with other species from trematode, tapeworm, mammal, insecta, nematode, and reptile, respectively. The homologous analysis of sequences showed the conservative domains: G1 box (GDSGVGKS), G2 box (T), G3 box (DTAG), G4 box (GNKCDL), and G5 box. In addition, the structure modeling had also shown other functional domains: GTP/Mg(2+) binding sites, switch I region, and switch II region. A phylogenic tree analysis indicated that the CsRab8 was clustered with the Rab from Schistosoma japonicum, and trematode and tapeworm came from the same branch, which was different from an evolutional branch built by other species, such as mammal animal, insecta, nematode, and reptile. The recombinant CsRab8 protein was expressed in Escherichia coli and the purified protein was a soluble molecule by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis. CsRab8 was identified as a component of excretory/secretory products of C. sinensis by western blot analysis. The transcriptional level of CsRab8 at metacercaria stage was the highest at the four stages and higher by 56.49-folds than that at adult worm, 1.23-folds than that at excysted metacercaria, and 2.69-folds than that at egg stage. Immunohistochemical localization analysis showed that CsRab8 was specifically distributed in the tegument, vitellarium, eggs, and testicle of adult worms, and detected on the vitellarium and tegument of metacercaria. Combined with the results, CsRab8 is indispensable for survival and development of parasites, especially for regulating

Cadherin-related family member 3, a childhood asthma susceptibility gene product, mediates rhinovirus C binding and replication.

PubMed

Bochkov, Yury A; Watters, Kelly; Ashraf, Shamaila; Griggs, Theodor F; Devries, Mark K; Jackson, Daniel J; Palmenberg, Ann C; Gern, James E

2015-04-28

Members of rhinovirus C (RV-C) species are more likely to cause wheezing illnesses and asthma exacerbations compared with other rhinoviruses. The cellular receptor for these viruses was heretofore unknown. We report here that expression of human cadherin-related family member 3 (CDHR3) enables the cells normally unsusceptible to RV-C infection to support both virus binding and replication. A coding single nucleotide polymorphism (rs6967330, C529Y) was previously linked to greater cell-surface expression of CDHR3 protein, and an increased risk of wheezing illnesses and hospitalizations for childhood asthma. Compared with wild-type CDHR3, cells transfected with the CDHR3-Y529 variant had about 10-fold increases in RV-C binding and progeny yields. We developed a transduced HeLa cell line (HeLa-E8) stably expressing CDHR3-Y529 that supports RV-C propagation in vitro. Modeling of CDHR3 structure identified potential binding sites that could impact the virus surface in regions that are highly conserved among all RV-C types. Our findings identify that the asthma susceptibility gene product CDHR3 mediates RV-C entry into host cells, and suggest that rs6967330 mutation could be a risk factor for RV-C wheezing illnesses.

Mutations in TULP1, NR2E3, and MFRP genes in Indian families with autosomal recessive retinitis pigmentosa

PubMed Central

Singh, Hardeep; Sahini, Nishika; Jalali, Subhadra; Mohan, Gayathri

2012-01-01

Purpose To identify genes underlying autosomal recessive retinitis pigmentosa (ARRP) by homozygosity mapping. Methods Families with ARRP were recruited after complete ophthalmic evaluation of all members and diagnosis of RP by predefined criteria. Genomic DNA from affected members of 26 families was genotyped on Illumina single nucleotide polymorphism (SNP) 6.0 K arrays with standard procedures. Genotypes were evaluated for homozygous regions that were common and concordant between affected members of each family. The genes mapping to homozygous intervals within these families were screened for pathogenic changes with PCR amplification and sequencing of coding regions. Cosegegration of sequence changes with disease was determined within each pedigree, and each variation was tested for presence in 100 unrelated normal controls. Results A genome-wide scan for homozygosity showed homozygous regions harboring the tubby like protein 1 gene (TULP1; chromosome 6) in one family, the nuclear receptor subfamily 2, group E, member 3 gene (NR2E3; chromosome 15) in three families, and the membrane frizzled-related protein gene (MFRP; chromosome 11) in one family. Screening of the three genes in the respective families revealed homozygous disease-causing mutations in three families. These included a missense mutation in TULP1, a deletion-cum-insertion in NR2E3, and a single base deletion in MFRP. Patients from all three families had a rod-cone type of dystrophy with night blindness initially. The NR2E3 and MFRP genes were associated with fundus features atypical of RP. Conclusions This study shows involvement of the TULP1, NR2E3, and MFRP genes in ARRP in Indian cases. Genome-wide screening with SNP arrays followed by a prioritized candidate gene evaluation is useful in identifying genes in these patients. PMID:22605927

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

PubMed

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

2014-07-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sex Differences in the Blood Concentration of Tacrolimus in Systemic Lupus Erythematosus and Rheumatoid Arthritis Patients with CYP3A5*3/*3.

PubMed

Ito, Ayano; Okada, Yuko; Hashita, Tadahiro; Aomori, Tohru; Hiromura, Keiju; Nojima, Yoshihisa; Nakamura, Tomonori; Araki, Takuya; Yamamoto, Koujirou

2017-06-01

The purpose of this study was to describe the impact of sex and cytochrome P450 3A5 (CYP3A5) variant on the blood concentration of tacrolimus in patients with systemic lupus erythematosus or rheumatoid arthritis. The blood concentration of tacrolimus (ng/mL) divided by the daily dose of tacrolimus (mg/day) and the patient's weight (kg) (C/D) was obtained from 55 patients. The C/D value was analysed according to genetic variation in CYP3A5 or ATP binding cassette subfamily B member 1 (ABCB1), sex, and age. The C/D value in the CYP3A5*3/*3 group was significantly higher than in the CYP3A5*1/*1 and *1/*3 groups (p < 0.05, effect size: d = 1.40). In the CYP3A5*3/*3 group, the concentration of tacrolimus was significantly higher in men than in women (p < 0.05, effect size: d = 1.78). Furthermore, in the CYP3A5*3/*3 group, the concentration of tacrolimus was significantly higher in women aged over 50 years than in women aged under 50 years (p < 0.05, effect size: d = 1.18). In contrast, ABCB1 genetic variations did not show any significant effect on the C/D value. Since the blood concentration of tacrolimus in patients with CYP3A5*3/*3 varies depending on sex and age, these factors should be considered when studying the difference of sex in CYP3A.

41 CFR 302-3.200 - When a member of my immediate family who is also an employee and I are transferring to the same...

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false When a member of my... receive allowances for relocation? 302-3.200 Section 302-3.200 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members § 302-3.200...

41 CFR 302-3.200 - When a member of my immediate family who is also an employee and I are transferring to the same...

Code of Federal Regulations, 2014 CFR

2014-07-01

... 41 Public Contracts and Property Management 4 2014-07-01 2014-07-01 false When a member of my... receive allowances for relocation? 302-3.200 Section 302-3.200 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members § 302-3.200...

41 CFR 302-3.200 - When a member of my immediate family who is also an employee and I are transferring to the same...

Code of Federal Regulations, 2011 CFR

2011-07-01

... 41 Public Contracts and Property Management 4 2011-07-01 2011-07-01 false When a member of my... receive allowances for relocation? 302-3.200 Section 302-3.200 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members § 302-3.200...

41 CFR 302-3.200 - When a member of my immediate family who is also an employee and I are transferring to the same...

Code of Federal Regulations, 2012 CFR

2012-07-01

... 41 Public Contracts and Property Management 4 2012-07-01 2012-07-01 false When a member of my... receive allowances for relocation? 302-3.200 Section 302-3.200 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members § 302-3.200...

41 CFR 302-3.200 - When a member of my immediate family who is also an employee and I are transferring to the same...

Code of Federal Regulations, 2013 CFR

2013-07-01

... 41 Public Contracts and Property Management 4 2013-07-01 2012-07-01 true When a member of my... receive allowances for relocation? 302-3.200 Section 302-3.200 Public Contracts and Property Management... SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members § 302-3.200...

A G-protein-activated inwardly rectifying K+ channel (GIRK4) from human hippocampus associates with other GIRK channels.

PubMed

Spauschus, A; Lentes, K U; Wischmeyer, E; Dissmann, E; Karschin, C; Karschin, A

1996-02-01

Transcripts of a gene, GIRK4, that encodes for a 419-amino-acid protein and shows high structural similarity to other subfamily members of G-protein-activated inwardly rectifying K+ channels (GIRK) have been identified in the human hippocampus. When expressed in Xenopus oocytes, GIRK4 yielded functional GIRK channels with activity that was enhanced by the stimulation of coexpressed serotonin 1A receptors. GIRK4 potentiated basal and agonist-induced currents mediated by other GIRK channels, possibly because of channel heteromerization. Despite the structural similarity to a putative rat KATP channel, no ATP sensitivity or KATP-typical pharmacology was observed for GIRK4 alone or GIRK4 transfected in conjunction with other GIRK channels in COS-7 cells. In rat brain, GIRK4 is expressed together with three other subfamily members, GIRK1-3, most likely in identical hippocampal neurons. Thus, heteromerization or an unknown molecular interaction may cause the physiological diversity observed within this class of K+ channels.

41 CFR 302-3.202 - If my immediate family member and I both transfer to the same official station, may we both claim...

Code of Federal Regulations, 2013 CFR

2013-07-01

... 41 Public Contracts and Property Management 4 2013-07-01 2012-07-01 true If my immediate family... for the same non-employee family member? 302-3.202 Section 302-3.202 Public Contracts and Property... ALLOWANCE BY SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members...

41 CFR 302-3.202 - If my immediate family member and I both transfer to the same official station, may we both claim...

Code of Federal Regulations, 2014 CFR

2014-07-01

... 41 Public Contracts and Property Management 4 2014-07-01 2014-07-01 false If my immediate family... for the same non-employee family member? 302-3.202 Section 302-3.202 Public Contracts and Property... ALLOWANCE BY SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members...

41 CFR 302-3.202 - If my immediate family member and I both transfer to the same official station, may we both claim...

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false If my immediate family... for the same non-employee family member? 302-3.202 Section 302-3.202 Public Contracts and Property... ALLOWANCE BY SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members...

41 CFR 302-3.202 - If my immediate family member and I both transfer to the same official station, may we both claim...

Code of Federal Regulations, 2012 CFR

2012-07-01

... 41 Public Contracts and Property Management 4 2012-07-01 2012-07-01 false If my immediate family... for the same non-employee family member? 302-3.202 Section 302-3.202 Public Contracts and Property... ALLOWANCE BY SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members...

41 CFR 302-3.202 - If my immediate family member and I both transfer to the same official station, may we both claim...

Code of Federal Regulations, 2011 CFR

2011-07-01

... 41 Public Contracts and Property Management 4 2011-07-01 2011-07-01 false If my immediate family... for the same non-employee family member? 302-3.202 Section 302-3.202 Public Contracts and Property... ALLOWANCE BY SPECIFIC TYPE Types of Transfers Relocation of Two Or More Employed Immediate Family Members...

Various mutants derived from 'Khao Dawk Mali 105' using gamma radiation

USDA-ARS?s Scientific Manuscript database

Mutations induced by radiation and chemicals have been widely used for genetic studies and cultivar improvement. Khao Dawk Mali 105 (KDM105), an aromatic cultivar from Thailand, is globally known for its premium quality. Seeds of KDM105 were obtained from the International Rice Research Institute (I...

MIR146A inhibits JMJD3 expression and osteogenic differentiation in human mesenchymal stem cells

PubMed Central

Huszar, Jessica M.; Payne, Christopher J.

2014-01-01

Chromatin remodeling is important for cell differentiation. Histone methyltransferase EZH2 and histone demethylase JMJD3 (KDM6B) modulate levels of histone H3 lysine 27 trimethylation (H3K27me3). Interplay between the two modulators influence lineage specification in stem cells. Here, we identified microRNA MIR146A to be a negative regulator of JMJD3. In the osteogenic differentiation of human mesenchymal stem cells (hMSCs), we observed an upregulation of JMJD3 and a downregulation of MIR146A. Blocking JMJD3 activity in differentiating hMSCs reduced transcript levels of osteogenic gene RUNX2. H3K27me3 levels decreased at the RUNX2 promoter during cell differentiation. Modulation of MIR146A levels in hMSCs altered JMJD3 and RUNX2 expression and affected osteogenic differentiation. We conclude that JMJD3 promotes osteogenesis in differentiating hMSCs, with MIR146A regulating JMJD3. PMID:24726732

Subfamily-Specific Fluorescent Probes for Cysteine Proteases Display Dynamic Protease Activities during Seed Germination.

PubMed

Lu, Haibin; Chandrasekar, Balakumaran; Oeljeklaus, Julian; Misas-Villamil, Johana C; Wang, Zheming; Shindo, Takayuki; Bogyo, Matthew; Kaiser, Markus; van der Hoorn, Renier A L

2015-08-01

Cysteine proteases are an important class of enzymes implicated in both developmental and defense-related programmed cell death and other biological processes in plants. Because there are dozens of cysteine proteases that are posttranslationally regulated by processing, environmental conditions, and inhibitors, new methodologies are required to study these pivotal enzymes individually. Here, we introduce fluorescence activity-based probes that specifically target three distinct cysteine protease subfamilies: aleurain-like proteases, cathepsin B-like proteases, and vacuolar processing enzymes. We applied protease activity profiling with these new probes on Arabidopsis (Arabidopsis thaliana) protease knockout lines and agroinfiltrated leaves to identify the probe targets and on other plant species to demonstrate their broad applicability. These probes revealed that most commercially available protease inhibitors target unexpected proteases in plants. When applied on germinating seeds, these probes reveal dynamic activities of aleurain-like proteases, cathepsin B-like proteases, and vacuolar processing enzymes, coinciding with the remobilization of seed storage proteins. © 2015 American Society of Plant Biologists. All Rights Reserved.

Chemotypes and Biomarkers of Seven Species of New Caledonian Liverworts from the Bazzanioideae Subfamily.

PubMed

Métoyer, Benjamin; Lebouvier, Nicolas; Hnawia, Edouard; Herbette, Gaëtan; Thouvenot, Louis; Asakawa, Yoshinori; Nour, Mohammed; Raharivelomanana, Phila

2018-06-05

Volatile components of seven species of the Bazzanioideae sub-family (Lepidoziaceae) native to New Caledonia, including three endemic species ( Bazzania marginata , Acromastigum caledonicum and A. tenax ), were analyzed by GC-FID-MS in order to index these plants to known or new chemotypes. Detected volatile constituents in studied species were constituted mainly by sesquiterpene, as well as diterpene compounds. All so-established compositions cannot successfully index some of them to known chemotypes but afforded the discovery of new chemotypes such as cuparane/fusicoccane. The major component of B. francana was isolated and characterized as a new zierane-type sesquiterpene called ziera-12(13),10(14)-dien-5-ol ( 23 ). In addition, qualitative intraspecies variations of chemical composition were very important particularly for B. francana which possessed three clearly defined different compositions. We report here also the first phytochemical investigation of Acromastigum species. Moreover, crude diethyl ether extract of B. vitatta afforded a new bis(bibenzyl) called vittatin ( 51 ), for which a putative biosynthesis was suggested.

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2010 CFR

2010-07-01

.../her physical or mental health; (b) The death of a member of the immediate family; (c) Obligations imposed by authority or circumstances over which the individual has no control; (d) The divorce or...

CKLF-Like MARVEL Transmembrane Domain-Containing Member 3 (CMTM3) Inhibits the Proliferation and Tumorigenisis in Hepatocellular Carcinoma Cells.

PubMed

Li, Wujun; Zhang, Shaobo

2017-01-26

The CKLF-like MARVEL transmembrane domain-containing 3 (CMTM3), a member of the CMTM family, was found in several human tumors and plays an important role in the development and progression of tumors. However, the role of CMTM3 in hepatocellular carcinoma (HCC) remains largely unknown. Thus, in the present study, we explored its expression pattern in human HCC cell lines, as well as its functions in HCC cells. Our results demonstrated that the expression of CMTM3 is lowly expressed in HCC cell lines. In vitro, we found that overexpression of CMTM3 obviously inhibited the proliferation, invasion, and EMT process in HCC cells. Furthermore, overexpression of CMTM3 significantly downregulated the expression levels of phosphorylation of JAK2 and STAT3 in HepG2 cells. In vivo, overexpression of CMTM3 attenuated the tumor growth in Balb/c nude mice. In conclusion, we demonstrated that CMTM3 could play an important role in HCC metastasis by EMT induction via, at least partially, suppressing the JAK2/STAT3 signaling pathway. Therefore, CMTM3 may serve as a potential molecular target in the prevention and/or treatment of HCC invasion and metastasis.

Avoiding the ensemble decorrelation problem using member-by-member post-processing

NASA Astrophysics Data System (ADS)

Van Schaeybroeck, Bert; Vannitsem, Stéphane

2014-05-01

Forecast calibration or post-processing has become a standard tool in atmospheric and climatological science due to the presence of systematic initial condition and model errors. For ensemble forecasts the most competitive methods derive from the assumption of a fixed ensemble distribution. However, when independently applying such 'statistical' methods at different locations, lead times or for multiple variables the correlation structure for individual ensemble members is destroyed. Instead of reastablishing the correlation structure as in Schefzik et al. (2013) we instead propose a calibration method that avoids such problem by correcting each ensemble member individually. Moreover, we analyse the fundamental mechanisms by which the probabilistic ensemble skill can be enhanced. In terms of continuous ranked probability score, our member-by-member approach amounts to skill gain that extends for lead times far beyond the error doubling time and which is as good as the one of the most competitive statistical approach, non-homogeneous Gaussian regression (Gneiting et al. 2005). Besides the conservation of correlation structure, additional benefits arise including the fact that higher-order ensemble moments like kurtosis and skewness are inherited from the uncorrected forecasts. Our detailed analysis is performed in the context of the Kuramoto-Sivashinsky equation and different simple models but the results extent succesfully to the ensemble forecast of the European Centre for Medium-Range Weather Forecasts (Van Schaeybroeck and Vannitsem, 2013, 2014) . References [1] Gneiting, T., Raftery, A. E., Westveld, A., Goldman, T., 2005: Calibrated probabilistic forecasting using ensemble model output statistics and minimum CRPS estimation. Mon. Weather Rev. 133, 1098-1118. [2] Schefzik, R., T.L. Thorarinsdottir, and T. Gneiting, 2013: Uncertainty Quantification in Complex Simulation Models Using Ensemble Copula Coupling. To appear in Statistical Science 28. [3] Van

26 CFR 1.562-3 - Distributions by a member of an affiliated group.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Distributions by a member of an affiliated group. A personal holding company which files or is required to file a consolidated return with other members of an affiliated group may be required to file a separate personal holding company schedule by reason of the limitations and exceptions provided in section 542(b...

26 CFR 1.562-3 - Distributions by a member of an affiliated group.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Distributions by a member of an affiliated group. A personal holding company which files or is required to file a consolidated return with other members of an affiliated group may be required to file a separate personal holding company schedule by reason of the limitations and exceptions provided in section 542(b...

Immunolocalization and distribution of functional temperature-sensitive TRP channels in salivary glands.

PubMed

Sobhan, Ubaidus; Sato, Masaki; Shinomiya, Takashi; Okubo, Migiwa; Tsumura, Maki; Muramatsu, Takashi; Kawaguchi, Mitsuru; Tazaki, Masakazu; Shibukawa, Yoshiyuki

2013-11-01

Transient receptor potential (TRP) cation channels are unique cellular sensors involved in multiple cellular functions. Their role in salivary secretion remains to be elucidated. The expression and localization of temperature-sensitive TRP channels in salivary (submandibular, sublingual and parotid) glands were analyzed by immunohistochemistry and quantitative real-time reverse transcription plus the polymerase chain reaction (RT-PCR). The effects of various TRP channel agonists on carbachol (CCh)-induced salivary secretion in the submandibular gland and on the intracellular Ca(2+) concentration ([Ca(2+)]i) in a submandibular epithelial cell line were also investigated. Immunohistochemistry revealed the expression of TRP-melastatin subfamily member 8 (TRPM8) and TRP-ankyrin subfamily member 1 (TRPA1) in myoepithelial, acinar and ductal cells in the sublingual, submandibular and parotid glands. In addition, TRP-vanilloid subfamily member 1 (TRPV1), TRPV3 and TRPV4 were also expressed in myoepithelial, acinar and ductal cells in all three types of gland. Quantitative real-time RT-PCR results demonstrated the mRNA expression of TRPV1, TRPV3, TRPV4, TRPM8 and TRPA1 in acinar and ductal cells in these salivary glands. Perfusion of the entire submandibular gland with the TRPV1 agonist capsaicin (1 μM) via the submandibular artery significantly increased CCh-induced salivation, whereas perfusion with TRPM8 and TRPA1 agonists (0.5 μM WS12 and 100 μM allyl isothiocyanate) decreased it. Application of agonists for each of the thermosensitive TRP channels increased [Ca(2+)]i in a submandibular epithelial cell line. These results indicate that temperature-sensitive TRP channels are localized and distributed in acinar, ductal and myoepithelial cells in salivary glands and that they play a functional role in the regulation and/or modulation of salivary secretion.

Hydrophobic Residues near the Bilin Chromophore-Binding Pocket Modulate Spectral Tuning of Insert-Cys Subfamily Cyanobacteriochromes

PubMed Central

Cho, Sung Mi; Jeoung, Sae Chae; Song, Ji-Young; Song, Ji-Joon; Park, Youn-Il

2017-01-01

Cyanobacteriochromes (CBCRs) are a subfamily of phytochrome photoreceptors found exclusively in photosynthetic cyanobacteria. Four CBCRs containing a second Cys in the insert region (insert-Cys) have been identified from the nonheterocystous cyanobacterium Microcoleus B353 (Mbr3854g4 and Mbl3738g2) and the nitrogen fixing, heterocystous cyanobacterium Nostoc punctiforme (NpF2164g3 and NpR1597g2). These insert-Cys CBCRs can sense light in the near-UV to orange range, but key residues responsible for tuning their colour sensitivity have not been reported. In the present study, near-UV/Green (UG) photosensors Mbr3854g4 (UG1) and Mbl3738g2 (UG2) were chosen for further spectroscopic analysis of their spectral sensitivity and tuning. Consistent with most dual-Cys CBCRs, both UGs formed a second thioether linkage to the phycocyanobilin (PCB) chromophore via the insert-Cys. This bond is subject to breakage and relinkage during forward and reverse photoconversions. Variations in residues equivalent to Phe that are in close contact with the PCB chromophore D-ring in canonical red/green CBCRs are responsible for tuning the light absorption peaks of both dark and photoproducts. This is the first time these key residues that govern light absorption in insert-Cys family CBCRs have been identified and characterised. PMID:28094296

How minority members' perceptions of majority members' acculturation preferences shape minority members' own acculturation preferences: evidence from Chile.

PubMed

Zagefka, Hanna; González, Roberto; Brown, Rupert

2011-06-01

Two survey studies were conducted in Chile with members of the indigenous minority group Mapuche (Ns = 566; 394). The aim was to find predictors of minority members' acculturation preferences, especially integration. It was hypothesized that minority members' preferences would depend on their perceptions of what majority members want. Specifically, it was predicted that a perception that majority members want minority members to maintain their original culture would be associated with a greater desire for culture maintenance among minority participants. Further, it was predicted that a perception that majority members want intergroup contact would be associated with a greater desire for contact among minority participants. Finally, it was predicted that a perception that majority members are in favour of both culture maintenance and contact (i.e., integration) would be associated with more support for integration among minority participants. Results bore out these predictions. Theoretical and policy implications are discussed. ©2010 The British Psychological Society.

Violence toward a family member, angry adult conflict, and child adjustment difficulties: relations in families with 1- to 3-year-old children.

PubMed

McDonald, Renee; Jouriles, Ernest N; Briggs-Gowan, Margaret J; Rosenfield, David; Carter, Alice S

2007-06-01

In this study, the authors examined whether witnessing violence toward a family member increases the risk for adjustment difficulties among children in the 1- to 3-year age range, beyond the risk attributable to witnessing nonviolent, angry adult conflict. Participants were 1,152 caregivers of 1- to 3-year-old children, randomly selected from birth records and recruited from the community. Caregivers indicated whether their children had witnessed violence toward a family member and/or angry adult conflict. They also completed a comprehensive measure of child adjustment difficulties. Exposure to violence toward a family member and exposure to angry adult conflict were each uniquely associated with increased risk for adjustment problems. These results emerged after accounting for pertinent demographic variables and for caregiver distress variables.

Sonorensin: an Antimicrobial Peptide, Belonging to the Heterocycloanthracin Subfamily of Bacteriocins, from a New Marine Isolate, Bacillus sonorensis MT93

PubMed Central

Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas

2014-01-01

Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized. PMID:24610839

Sonorensin: an antimicrobial peptide, belonging to the heterocycloanthracin subfamily of bacteriocins, from a new marine isolate, Bacillus sonorensis MT93.

PubMed

Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas; Sahoo, Debendra K

2014-05-01

Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized.

The Plasmodium serine-type SERA proteases display distinct expression patterns and non-essential in vivo roles during life cycle progression of the malaria parasite.

PubMed

Putrianti, Elyzana D; Schmidt-Christensen, Anja; Arnold, Iris; Heussler, Volker T; Matuschewski, Kai; Silvie, Olivier

2010-06-01

Parasite proteases play key roles in several fundamental steps of the Plasmodium life cycle, including haemoglobin degradation, host cell invasion and parasite egress. Plasmodium exit from infected host cells appears to be mediated by a class of papain-like cysteine proteases called 'serine repeat antigens' (SERAs). A SERA subfamily, represented by Plasmodium falciparum SERA5, contains an atypical active site serine residue instead of a catalytic cysteine. Members of this SERAser subfamily are abundantly expressed in asexual blood stages, rendering them attractive drug and vaccine targets. In this study, we show by antibody localization and in vivo fluorescent tagging with the red fluorescent protein mCherry that the two P. berghei serine-type family members, PbSERA1 and PbSERA2, display differential expression towards the final stages of merozoite formation. Via targeted gene replacement, we generated single and double gene knockouts of the P. berghei SERAser genes. These loss-of-function lines progressed normally through the parasite life cycle, suggesting a specialized, non-vital role for serine-type SERAs in vivo. Parasites lacking PbSERAser showed increased expression of the cysteine-type PbSERA3. Compensatory mechanisms between distinct SERA subfamilies may thus explain the absence of phenotypical defect in SERAser disruptants, and challenge the suitability to develop potent antimalarial drugs based on specific inhibitors of Plasmodium serine-type SERAs.

Development of a Vaccine for Bacterial Kidney Disease in Salmon, 1984 Annual Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaattari, Stephen L.

1985-06-01

The data presented here demonstrate that there is some variability to the antigenic structure of KDB. Although gel filtration of all antigenic preparations revealed a wide range of sizes for antigens, resolution on a denaturing gel revealed relatively few protein bands and immunological assays revealed the same (3) low number of antigens. It is of particular interest that there seems to be a protein of 60 kd in all preparations, but that there are not larger individual molecular species. This, in turn indicates that the larger molecular weight species detected in gel filtration are most likely aggregates or membrane fragmentsmore » composed of a lower molecular weight subunit. Use of ultrafiltration of KDM-2 medium appears to be successful in eliminating contamination of high molecular weight material found in KDM-2. There appears to be no alteration in the number of soluble antigens produced by growth in either medium, nor in the number of proteins, as detected by SDS-PAGE. However, soluble antigens isolated from UF-KDM-2 does appear to have greater heterogeneity in their isoelectric focusing (IEF) patterns than those from UF-KDM-2. Also, although there does appear to be an extended lag period in KDB growth on UF-KDM-2, there is no alteration in final O.D. or wet weight of cells. Thus, it appears that UF-KDM-2 may be an alternate medium for those wishing to isolate purified bacterial proteins or antigens. ELISA assays have been developed for the detection of soluble KDB antigens. This system is currently being developed as a sensitive measure of the presence of soluble antigen in serum and tissues of fish. Such a sensitive assay may also allow for the detection of KD+ spawners by the testing of ovarian fluid or serum. ELISA assays have also been developed to detect antibodies to soluble and cellular antigens of KDB. These systems have been proven successful in the detection of rabbit and murine monoclonal antibodies against KDB antigens. Future work will develop

Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members.

PubMed

Heinen, R C; Diniz-Mendes, L; Silva, J T; Paschoalin, V M F

2006-11-01

Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

Long noncoding RNA OR3A4 promotes metastasis and tumorigenicity in gastric cancer

PubMed Central

Guo, Xiaobo; Yang, Ziguo; Zhi, Qiaoming; Wang, Dan; Guo, Lei; Li, Guimei; Miao, Ruizhen; Shi, Yulong; Kuang, Yuting

2016-01-01

The contribution of long noncoding RNAs (lncRNAs) to metastasis of gastric cancer remains largely unknown. We used microarray analysis to identify lncRNAs differentially expressed between normal gastric tissues and gastric cancer tissues and validated these differences in quantitative real-time (qRT)-PCR experiments. The expression levels of lncRNA olfactory receptor, family 3, subfamily A, member 4 (OR3A4) were significantly associated with lymphatic metastasis, the depth of cancer invasion, and distal metastasis in 130 paired gastric cancer tissues. The effects of OR3A4 were assessed by overexpressing and silencing OR3A4 in gastric cancer cells. OR3A4 promoted cancer cell growth, angiogenesis, metastasis, and tumorigenesis in vitro and in vivo. Global microarray analysis combined with RT-PCR, RNA immunoprecipitation, and RNA pull-down analyses after OR3A4 transfection demonstrated that OR3A4 influenced biologic functions in gastric cancer cells via regulating the activation of PDLIM2, MACC1, NTN4, and GNB2L1. Our results reveal OR3A4 as an oncogenic lncRNA that promotes tumor progression, Therefore, lncRNAs might function as key regulatory hubs in gastric cancer progression. PMID:26863570

The Evolutionary Landscape of Dbl-Like RhoGEF Families: Adapting Eukaryotic Cells to Environmental Signals

PubMed Central

Blangy, Anne

2017-01-01

Abstract The dynamics of cell morphology in eukaryotes is largely controlled by small GTPases of the Rho family. Rho GTPases are activated by guanine nucleotide exchange factors (RhoGEFs), of which diffuse B-cell lymphoma (Dbl)-like members form the largest family. Here, we surveyed Dbl-like sequences from 175 eukaryotic genomes and illuminate how the Dbl family evolved in all eukaryotic supergroups. By combining probabilistic phylogenetic approaches and functional domain analysis, we show that the human Dbl-like family is made of 71 members, structured into 20 subfamilies. The 71 members were already present in ancestral jawed vertebrates, but several members were subsequently lost in specific clades, up to 12% in birds. The jawed vertebrate repertoire was established from two rounds of duplications that occurred between tunicates, cyclostomes, and jawed vertebrates. Duplicated members showed distinct tissue distributions, conserved at least in Amniotes. All 20 subfamilies have members in Deuterostomes and Protostomes. Nineteen subfamilies are present in Porifera, the first phylum that diverged in Metazoa, 14 in Choanoflagellida and Filasterea, single-celled organisms closely related to Metazoa and three in Fungi, the sister clade to Metazoa. Other eukaryotic supergroups show an extraordinary variability of Dbl-like repertoires as a result of repeated and independent gain and loss events. Last, we observed that in Metazoa, the number of Dbl-like RhoGEFs varies in proportion of cell signaling complexity. Overall, our analysis supports the conclusion that Dbl-like RhoGEFs were present at the origin of eukaryotes and evolved as highly adaptive cell signaling mediators. PMID:28541439

Genome-wide identification of nuclear receptor (NR) genes and the evolutionary significance of the NR1O subfamily in the monogonont rotifer Brachionus spp.

PubMed

Kim, Duck-Hyun; Kim, Hui-Su; Hwang, Dae-Sik; Kim, Hee-Jin; Hagiwara, Atsushi; Lee, Jae-Seong; Jeong, Chang-Bum

2017-10-01

Nuclear receptors (NRs) are a large family of transcription factors that are involved in many fundamental biological processes. NRs are considered to have originated from a common ancestor, and are highly conserved throughout the whole animal taxa. Therefore, the genome-wide identification of NR genes in an animal taxon can provide insight into the evolutionary tendencies of NRs. Here, we identified all the NR genes in the monogonont rotifer Brachionus spp., which are considered an ecologically key species due to their abundance and world-wide distribution. The NR family was composed of 40, 32, 29, and 32 genes in the genomes of the rotifers B. calyciflorus, B. koreanus, B. plicatilis, and B. rotundiformis, respectively, which were classified into seven distinct subfamilies. The composition of each subfamily was highly conserved between species, except for NR1O genes, suggesting that they have undergone sporadic evolutionary processes for adaptation to their different environmental pressures. In addition, despite the dynamics of NR evolution, the significance of the conserved endocrine system, particularly for estrogen receptor (ER)-signaling, in rotifers was discussed on the basis of phylogenetic analyses. The results of this study may help provide a better understanding the evolution of NRs, and expand our knowledge of rotifer endocrine systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Rapid Identification of OXA-48 and OXA-163 Subfamilies in Carbapenem-Resistant Gram-Negative Bacilli with a Novel Immunochromatographic Lateral Flow Assay.

PubMed

Pasteran, Fernando; Denorme, Laurence; Ote, Isabelle; Gomez, Sonia; De Belder, Denise; Glupczynski, Youri; Bogaerts, Pierre; Ghiglione, Barbara; Power, Pablo; Mertens, Pascal; Corso, Alejandra

2016-11-01

We assessed a novel immunochromatographic lateral flow assay for direct identification of OXA-48-like carbapenemases and accurate differentiation of allele variants with distinct substrate profiles (OXA-48 or OXA-163 subfamilies). The assay allowed rapid (less than 4 min) and reliable direct confirmation of OXA-163- and/or OXA-48-like enzymes (with 100% sensitivity and 100% specificity) from cultured colonies that were recovered from both solid medium and spiked blood culture bottles. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2014 CFR

2014-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in § 1.3(ee), and... member, or functional equivalent thereof, of the board of governors of a self-regulatory organization. (3...

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2013 CFR

2013-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in § 1.3(ee), and... member, or functional equivalent thereof, of the board of governors of a self-regulatory organization. (3...

Structure-Function Analysis of a Broad Specificity Populus trichocarpa Endo-β-glucanase Reveals an Evolutionary Link between Bacterial Licheninases and Plant XTH Gene Products*

PubMed Central

Eklöf, Jens M.; Shojania, Shaheen; Okon, Mark; McIntosh, Lawrence P.; Brumer, Harry

2013-01-01

The large xyloglucan endotransglycosylase/hydrolase (XTH) gene family continues to be the focus of much attention in studies of plant cell wall morphogenesis due to the unique catalytic functions of the enzymes it encodes. The XTH gene products compose a subfamily of glycoside hydrolase family 16 (GH16), which also comprises a broad range of microbial endoglucanases and endogalactanases, as well as yeast cell wall chitin/β-glucan transglycosylases. Previous whole-family phylogenetic analyses have suggested that the closest relatives to the XTH gene products are the bacterial licheninases (EC 3.2.1.73), which specifically hydrolyze linear mixed linkage β(1→3)/β(1→4)-glucans. In addition to their specificity for the highly branched xyloglucan polysaccharide, XTH gene products are distinguished from the licheninases and other GH16 enzyme subfamilies by significant active site loop alterations and a large C-terminal extension. Given these differences, the molecular evolution of the XTH gene products in GH16 has remained enigmatic. Here, we present the biochemical and structural analysis of a unique, mixed function endoglucanase from black cottonwood (Populus trichocarpa), which reveals a small, newly recognized subfamily of GH16 members intermediate between the bacterial licheninases and plant XTH gene products. We postulate that this clade comprises an important link in the evolution of the large plant XTH gene families from a putative microbial ancestor. As such, this analysis provides new insights into the diversification of GH16 and further unites the apparently disparate members of this important family of proteins. PMID:23572521

Experimental Investigation of Compressed Thin-Walled Steel Members

NASA Astrophysics Data System (ADS)

Juhás, Pavol; Juhásová Šenitková, Ingrid

2017-10-01

The paper presents fundamental information about realized experimental-theoretical research to determinate the load-carrying capacities for thin-walled compressed steel members with quasi-homogenous and hybrid cross-sections. The webs of such members are stressed in the elastic-plastic region. This continuous research joins on previous research of the first author of the paper. The aim of this research is to investigate and analyse the elastic-plastic post-critical behaviour of thin web and its interaction with flanges. The experimental program, test members and their geometrical parameters and material properties are evident from table 1 and table 2 as well as from figure 1 and figure 2. The test arrangement and failures of the test members are illustrated on Figures 3, 4 and 5. Some partial results are presented in Table 3 of the paper, too.

Molecular Analysis, Pathogenic Mechanisms, and Readthrough Therapy on a Large Cohort of Kabuki Syndrome Patients

PubMed Central

Micale, Lucia; Augello, Bartolomeo; Maffeo, Claudia; Selicorni, Angelo; Zucchetti, Federica; Fusco, Carmela; De Nittis, Pasquelena; Pellico, Maria Teresa; Mandriani, Barbara; Fischetto, Rita; Boccone, Loredana; Silengo, Margherita; Biamino, Elisa; Perria, Chiara; Sotgiu, Stefano; Serra, Gigliola; Lapi, Elisabetta; Neri, Marcella; Ferlini, Alessandra; Cavaliere, Maria Luigia; Chiurazzi, Pietro; Monica, Matteo Della; Scarano, Gioacchino; Faravelli, Francesca; Ferrari, Paola; Mazzanti, Laura; Pilotta, Alba; Patricelli, Maria Grazia; Bedeschi, Maria Francesca; Benedicenti, Francesco; Prontera, Paolo; Toschi, Benedetta; Salviati, Leonardo; Melis, Daniela; Di Battista, Eliana; Vancini, Alessandra; Garavelli, Livia; Zelante, Leopoldo; Merla, Giuseppe

2014-01-01

Kabuki syndrome (KS) is a multiple congenital anomalies syndrome characterized by characteristic facial features and varying degrees of mental retardation, caused by mutations in KMT2D/MLL2 and KDM6A/UTX genes. In this study, we performed a mutational screening on 303 Kabuki patients by direct sequencing, MLPA, and quantitative PCR identifying 133 KMT2D, 62 never described before, and four KDM6A mutations, three of them are novel. We found that a number of KMT2D truncating mutations result in mRNA degradation through the nonsense-mediated mRNA decay, contributing to protein haploinsufficiency. Furthermore, we demonstrated that the reduction of KMT2D protein level in patients’ lymphoblastoid and skin fibroblast cell lines carrying KMT2D-truncating mutations affects the expression levels of known KMT2D target genes. Finally, we hypothesized that the KS patients may benefit from a readthrough therapy to restore physiological levels of KMT2D and KDM6A proteins. To assess this, we performed a proof-of-principle study on 14 KMT2D and two KDM6A nonsense mutations using specific compounds that mediate translational readthrough and thereby stimulate the re-expression of full-length functional proteins. Our experimental data showed that both KMT2D and KDM6A nonsense mutations displayed high levels of readthrough in response to gentamicin treatment, paving the way to further studies aimed at eventually treating some Kabuki patients with readthrough inducers. PMID:24633898

Online Study of Individuals With Genetic Changes and Features of Autism: Simons Variation in Individuals Project (Simons VIP)

ClinicalTrials.gov

2017-12-19

16p11.2 Deletions; 16p11.2 Duplications; 1q21.1 Deletions; 1q21.1 Duplications; ACTL6B; ADNP; AHDC1; ANK2; ANKRD11; ARID1B; ASH1L; ASXL3; BCL11A; CHAMP1; CHD2; CHD8; CSNK2A1; CTBP1; CTNNB1; CUL3; DDX3X; DNMT3A; DSCAM; DST; DYRK1A; FOXP1; GRIN2A; GRIN2B; HIVEP2; HNRNPH2; KAT6A; KATNAL2; KDM5B; KDM6B; KMT2C; KMT2E; KMT5B (Previously SUV420H1); MBD5; MED13L; PACS1; PBRM1; POGZ; PPP2R5D; PTCHD1; PTEN; PURA; REST; SCN2A; SETBP1; SETD5; SMARCA4 (BAF190); SMARCC1; SMARCC2; STXBP1; SYNGAP1; TBR1; Additional Genetic Changes Associated With Autism May be Added as Identified

Phylogeny and biogeography of African Murinae based on mitochondrial and nuclear gene sequences, with a new tribal classification of the subfamily

PubMed Central

2008-01-01

Background Within the subfamily Murinae, African murines represent 25% of species biodiversity, making this group ideal for detailed studies of the patterns and timing of diversification of the African endemic fauna and its relationships with Asia. Here we report the results of phylogenetic analyses of the endemic African murines through a broad sampling of murine diversity from all their distribution area, based on the mitochondrial cytochrome b gene and the two nuclear gene fragments (IRBP exon 1 and GHR). Results A combined analysis of one mitochondrial and two nuclear gene sequences consistently identified and robustly supported ten primary lineages within Murinae. We propose to formalize a new tribal arrangement within the Murinae that reflects this phylogeny. The diverse African murine assemblage includes members of five of the ten tribes and clearly derives from multiple faunal exchanges between Africa and Eurasia. Molecular dating analyses using a relaxed Bayesian molecular clock put the first colonization of Africa around 11 Mya, which is consistent with the fossil record. The main period of African murine diversification occurred later following disruption of the migration route between Africa and Asia about 7–9 Mya. A second period of interchange, dating to around 5–6.5 Mya, saw the arrival in Africa of Mus (leading to the speciose endemic Nannomys), and explains the appearance of several distinctive African lineages in the late Miocene and Pliocene fossil record of Eurasia. Conclusion Our molecular survey of Murinae, which includes the most complete sampling so far of African taxa, indicates that there were at least four separate radiations within the African region, as well as several phases of dispersal between Asia and Africa during the last 12 My. We also reconstruct the phylogenetic structure of the Murinae, and propose a new classification at tribal level for this traditionally problematic group. PMID:18616808

Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

PubMed

Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

2013-01-01

As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

Evolutionary conservation and regulation of particular alternative splicing events in plant SR proteins

PubMed Central

Kalyna, Maria; Lopato, Sergiy; Voronin, Viktor; Barta, Andrea

2006-01-01

Alternative splicing is an important mechanism for fine tuning of gene expression at the post-transcriptional level. SR proteins govern splice site selection and spliceosome assembly. The Arabidopsis genome encodes 19 SR proteins, several of which have no orthologues in metazoan. Three of the plant specific subfamilies are characterized by the presence of a relatively long alternatively spliced intron located in their first RNA recognition motif, which potentially results in an extremely truncated protein. In atRSZ33, a member of the RS2Z subfamily, this alternative splicing event was shown to be autoregulated. Here we show that atRSp31, a member of the RS subfamily, does not autoregulate alternative splicing of its similarily positioned intron. Interestingly, this alternative splicing event is regulated by atRSZ33. We demonstrate that the positions of these long introns and their capability for alternative splicing are conserved from green algae to flowering plants. Moreover, in particular alternative splicing events the splicing signals are embedded into highly conserved sequences. In different taxa, these conserved sequences occur in at least one gene within a subfamily. The evolutionary preservation of alternative splice forms together with highly conserved intron features argues for additional functions hidden in the genes of these plant-specific SR proteins. PMID:16936312

Over-expression of XIST, the Master Gene for X Chromosome Inactivation, in Females With Major Affective Disorders

PubMed Central

Ji, Baohu; Higa, Kerin K.; Kelsoe, John R.; Zhou, Xianjin

2015-01-01

Background Psychiatric disorders are common mental disorders without a pathological biomarker. Classic genetic studies found that an extra X chromosome frequently causes psychiatric symptoms in patients with either Klinefelter syndrome (XXY) or Triple X syndrome (XXX). Over-dosage of some X-linked escapee genes was suggested to cause psychiatric disorders. However, relevance of these rare genetic diseases to the pathogenesis of psychiatric disorders in the general population of psychiatric patients is unknown. Methods XIST and several X-linked genes were studied in 36 lymphoblastoid cell lines from healthy females and 60 lymphoblastoid cell lines from female patients with either bipolar disorder or recurrent major depression. XIST and KDM5C expression was also quantified in 48 RNA samples from postmortem human brains of healthy female controls and female psychiatric patients. Findings We found that the XIST gene, a master in control of X chromosome inactivation (XCI), is significantly over-expressed (p = 1 × 10− 7, corrected after multiple comparisons) in the lymphoblastoid cells of female patients with either bipolar disorder or major depression. The X-linked escapee gene KDM5C also displays significant up-regulation (p = 5.3 × 10− 7, corrected after multiple comparisons) in the patients' cells. Expression of XIST and KDM5C is highly correlated (Pearson's coefficient, r = 0.78, p = 1.3 × 10− 13). Studies on human postmortem brains supported over-expression of the XIST gene in female psychiatric patients. Interpretations We propose that over-expression of XIST may cause or result from subtle alteration of XCI, which up-regulates the expression of some X-linked escapee genes including KDM5C. Over-expression of X-linked genes could be a common mechanism for the development of psychiatric disorders between patients with those rare genetic diseases and the general population of female psychiatric patients with XIST over-expression. Our studies

ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

USDA-ARS?s Scientific Manuscript database

Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

Human papillomavirus dysregulates the cellular apparatus controlling the methylation status of H3K27 in different human cancers to consistently alter gene expression regardless of tissue of origin

PubMed Central

Zhang, Ali; Barrett, John W.; Nichols, Anthony C.; Torchia, Joe; Mymryk, Joe S.

2017-01-01

High-risk human papillomaviruses (HPV) cause cancer at multiple distinct anatomical locations. Regardless of the tissue of origin, most HPV positive (HPV+) cancers show highly upregulated expression of the p16 product of the cyclin-dependent kinase inhibitor 2A (CDKN2A) gene. Paradoxically, HPV+ tumor cells require continuous expression of this tumor suppressor for survival. Thus, restoration of normal p16 regulation has potential therapeutic value against HPV induced cancers. Normally, p16 transcription is tightly controlled at the epigenetic level via polycomb repressive complex-mediated tri-methylation of histone 3 lysine 27 (H3K27me3). Although a mechanism by which HPV induces p16 has been proposed based on tissue culture models, it has not been extensively validated in human tumors. In this study, we used data from over 800 human cervical and head and neck tumors from The Cancer Genome Atlas (TCGA) to test this model. We determined the impact of HPV status on expression from the CDKN2A locus, the adjacent CDKN2B locus, and transcript levels of key epigenetic regulators of these loci. As expected, HPV+ tumors from both anatomical sites exhibited high levels of p16. Furthermore, HPV+ tumors expressed higher levels of KDM6A, which demethylates H3K27me3. CpG methylation of the CDKN2A locus was also consistently altered in HPV+ tumors. This data validates previous tissue culture studies and identifies remarkable similarities between the effects of HPV on gene expression and DNA methylation in both cervical and oral tumors in large human cohorts. Furthermore, these results support a model whereby HPV-mediated dysregulation of CDKN2A transcription requires KDM6A, a potentially druggable target. PMID:29069809

Pleckstrin homology-like domain family A, member 3 (PHLDA3) deficiency improves islets engraftment through the suppression of hypoxic damage

PubMed Central

Yamaguchi, Yohko; Chen, Yu; Shimoda, Masayuki; Yoshimatsu, Gumpei; Unno, Michiaki; Sumi, Shoichiro; Ohki, Rieko

2017-01-01

Islet transplantation is a useful cell replacement therapy that can restore the glycometabolic function of severe diabetic patients. It is known that many transplanted islets failed to engraft, and thus, new approaches for overcoming graft loss that may improve the outcome of future clinical islet transplantations are necessary. Pleckstrin homology-like domain family A, member 3 (PHLDA3) is a known suppressor of neuroendocrine tumorigenicity, yet deficiency of this gene increases islet proliferation, prevents islet apoptosis, and improves their insulin-releasing function without causing tumors. In this study, we examined the potential use of PHLDA3-deficient islets in transplantation. We observed that: 1) transplanting PHLDA3-deficient islets into diabetic mice significantly improved their glycometabolic condition, 2) the improved engraftment of PHLDA3-deficient islets resulted from increased cell survival during early transplantation, and 3) Akt activity was elevated in PHLDA3-deficient islets, especially under hypoxic conditions. Thus, we determined that PHLDA3-deficient islets are more resistant against stresses induced by islet isolation and transplantation. We conclude that use of islets with suppressed PHLDA3 expression could be a novel and promising treatment for improving engraftment and consequent glycemic control in islet transplantation. PMID:29121094

Molecular and cellular characteristics of ABCA3 mutations associated with diffuse parenchymal lung diseases in children

PubMed Central

Flamein, Florence; Riffault, Laure; Muselet-Charlier, Céline; Pernelle, Julie; Feldmann, Delphine; Jonard, Laurence; Durand-Schneider, Anne-Marie; Coulomb, Aurore; Maurice, Michèle; Nogee, Lawrence M.; Inagaki, Nobuya; Amselem, Serge; Dubus, Jean Christophe; Rigourd, Virginie; Brémont, François; Marguet, Christophe; Brouard, Jacques; de Blic, Jacques; Clement, Annick; Epaud, Ralph; Guillot, Loïc

2012-01-01

ABCA3 (ATP-binding cassette subfamily A, member 3) is expressed in the lamellar bodies of alveolar type II cells and is crucial to pulmonary surfactant storage and homeostasis. ABCA3 gene mutations have been associated with neonatal respiratory distress (NRD) and pediatric interstitial lung disease (ILD). The objective of this study was to look for ABCA3 gene mutations in patients with severe NRD and/or ILD. The 30 ABCA3 coding exons were screened in 47 patients with severe NRD and/or ILD. ABCA3 mutations were identified in 10 out of 47 patients, including 2 homozygous, 5 compound heterozygous and 3 heterozygous patients. SP-B and SP-C expression patterns varied across patients. Among patients with ABCA3 mutations, five died shortly after birth and five developed ILD (including one without NRD). Functional studies of p.D253H and p.T1173R mutations revealed that p.D253H and p.T1173R induced abnormal lamellar bodies. Additionally, p.T1173R increased IL-8 secretion in vitro. In conclusion, we identified new ABCA3 mutations in patients with life-threatening NRD and/or ILD. Two mutations associated with ILD acted via different pathophysiological mechanisms despite similar clinical phenotypes. PMID:22068586

Complete genome sequences of two novel autographiviruses infecting a bacterium from the Pseudomonas fluorescens group.

PubMed

Nowicki, Grzegorz; Walkowiak-Nowicka, Karolina; Zemleduch-Barylska, Agata; Mleczko, Anna; Frąckowiak, Patryk; Nowaczyk, Natalia; Kozdrowska, Emilia; Barylski, Jakub

2017-09-01

In this paper, we describe two independent isolates of a new member of the subfamily Autographivirinae, Pseudomonas phage KNP. The type strain (KNP) has a linear, 40,491-bp-long genome with GC content of 57.3%, and 50 coding DNA sequences (CDSs). The genome of the second strain (WRT) contains one CDS less, encodes a significantly different tail fiber protein and is shorter (40,214 bp; GC content, 57.4%). Phylogenetic analysis indicates that both KNP and WRT belong to the genus T7virus. Together with genetically similar Pseudomonas phages (gh-1, phiPSA2, phiPsa17, PPPL-1, shl2, phi15, PPpW-4, UNO-SLW4, phiIBB-PF7A, Pf-10, and Phi-S1), they form a divergent yet coherent group that stands apart from the T7-like viruses (sensu lato). Analysis of the diversity of this group and its relatedness to other members of the subfamily Autographivirinae led us to the conclusion that this group might be considered as a candidate for a new genus.

Emerging targets in cancer immunotherapy: beyond CTLA-4 and PD-1.

PubMed

Assal, Amer; Kaner, Justin; Pendurti, Gopichand; Zang, Xingxing

2015-01-01

Manipulation of co-stimulatory or co-inhibitory checkpoint proteins allows for the reversal of tumor-induced T-cell anergy observed in cancer. The field has gained credence given success with CTLA-4 and PD-1 inhibitors. These molecules include immunoglobulin family members and the B7 subfamily as well as the TNF receptor family members. PD-L1 inhibitors and LAG-3 inhibitors have progressed through clinical trials. Other B7 family members have shown promise in preclinical models. TNFR superfamily members have shown variable success in preclinical and clinical studies. As clinical investigation in tumor immunology gains momentum, the next stage becomes learning how to combine checkpoint inhibitors and agonists with each other as well as with traditional chemotherapeutic agents.

Quercetin-3-O-glucuronide induces ABCA1 expression by LXRα activation in murine macrophages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohara, Kazuaki, E-mail: Kazuaki_Ohara@kirin.co.jp; Wakabayashi, Hideyuki; Taniguchi, Yoshimasa

Highlights: •The major circulating quercetin metabolite (Q3GA) activated LXRα. •Q3GA induced ABCA1 via LXRα activation in macrophages. •Nelumbo nucifera leaf extracts contained quercetin glycosides. •N. nucifera leaf extract feeding elevated HDLC in mice. -- Abstract: Reverse cholesterol transport (RCT) removes excess cholesterol from macrophages to prevent atherosclerosis. ATP-binding cassette, subfamily A, member 1 (ABCA1) is a crucial cholesterol transporter involved in RCT to produce high density lipoprotein-cholesterol (HDLC), and is transcriptionally regulated by liver X receptor alpha (LXRα), a nuclear receptor. Quercetin is a widely distributed flavonoid in edible plants which prevented atherosclerosis in an animal model. We found thatmore » quercetin-3-O-glucuronide (Q3GA), a major quercetin metabolite after absorption from the digestive tract, enhanced ABCA1 expression, in vitro, via LXRα in macrophages. In addition, leaf extracts of a traditional Asian edible plant, Nelumbo nucifera (NNE), which contained abundant amounts of quercetin glycosides, significantly elevated plasma HDLC in mice. We are the first to present experimental evidence that Q3GA induced ABCA1 in macrophages, and to provide an alternative explanation to previous studies on arteriosclerosis prevention by quercetin.« less

Compression member response of double steel angles on truss structure with member length variation

NASA Astrophysics Data System (ADS)

Hasibuan, Purwandy; Panjaitan, Arief; Haiqal, Muhammad

2018-05-01

One type of structures that implements steel angles as its members is truss system of telecommunication tower. For this structure, reinforcements on tower legs are also needed when antennas and microwaves installation placed on the peak of tower increases in quantity. One type of reinforcement methods commonly used is by increasing areas section capacity, where tower leg consisted of single angle section will be reinforced to be double angle sections. Regarding this case, this research discussed behavior two types of double angle steel section 2L 30.30.3 that were designed identically in area section but vary in length: 103 cm and 83 cm. At the first step, compression member together with tension member was formed to be a truss system, where compression and tension member were met at the joint plate. Schematic loading was implemented by giving tension loading on the joint plate, and this loading was terminated when each specimen reached its failure. Research findings showed that implementing shorter double angle (83 cm) sections, increased compression strength of steel angle section up to 13 %. Significant deformation occurring only on the flange for both of specimens indicated that implementing double angle is effective to prevent lateral-torsional buckling.

cDNA cloning and initial characterization of CYP3A43, a novel human cytochrome P450.

PubMed

Domanski, T L; Finta, C; Halpert, J R; Zaphiropoulos, P G

2001-02-01

The RACE amplification technology was used on a novel CYP3A-like exon 1 sequence detected during the reverse transcriptase/polymerase chain reaction analysis of human CYP3A gene expression. This resulted in the identification of cDNAs encompassing the complete coding sequence of a new member of the CYP3A gene subfamily, CYP3A43. Interestingly, the majority of the cDNAs identified were characterized by alternative splicing events such as exon skipping and complete or partial intron inclusion. CYP3A43 expression was detected in liver, kidney, pancreas, and prostate. The amino acid sequence is 75% identical to that of CYP3A4 and CYP3A5 and 71% identical to CYP3A7. CYP3A43 differs from CYP3A4 at six amino acid residues, found within the putative substrate recognition sites of CYP3A4, that are known to be determinants of substrate selectivity. The N terminus of CYP3A43 was modified for efficient expression of the protein in Escherichia coli, and a 6X histidine tag was added at the C terminus to facilitate purification. CYP3A43 gave a reduced carbon monoxide difference spectra with an absorbance maximum at 450 nm. The level of heterologous expression was significantly lower than that observed for CYP3A4 and CYP3A5. Immunoblot analyses revealed that CYP3A43 comigrates with CYP3A4 in polyacrylamide gel electrophoresis but does separate from CYP3A5. Monooxygenase assays were performed under a variety of conditions, several of which yielded reproducible, albeit low, testosterone hydroxylase activity. The findings from this study demonstrate that there is a novel CYP3A member expressed in human tissues, although its relative contribution to drug metabolism has yet to be ascertained.

From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition.

PubMed

Besnard, Guillaume; Christin, Pascal-Antoine; Malé, Pierre-Jean G; Lhuillier, Emeline; Lauzeral, Christine; Coissac, Eric; Vorontsova, Maria S

2014-12-01

Collections of specimens held by natural history museums are invaluable material for biodiversity inventory and evolutionary studies, with specimens accumulated over 300 years readily available for sampling. Unfortunately, most museum specimens yield low-quality DNA. Recent advances in sequencing technologies, so called next-generation sequencing, are revolutionizing phylogenetic investigations at a deep level. Here, the Illumina technology (HiSeq) was used on herbarium specimens of Sartidia (subfamily Aristidoideae, Poaceae), a small African-Malagasy grass lineage (six species) characteristic of wooded savannas, which is the C3 sister group of Stipagrostis, an important C4 genus from Africa and SW Asia. Complete chloroplast and nuclear ribosomal sequences were assembled for two Sartidia species, one of which (S. perrieri) is only known from a single specimen collected in Madagascar 100 years ago. Partial sequences of a few single-copy genes encoding phosphoenolpyruvate carboxylases (ppc) and malic enzymes (nadpme) were also assembled. Based on these data, the phylogenetic position of Malagasy Sartidia in the subfamily Aristidoideae was investigated and the biogeographical history of this genus was analysed with full species sampling. The evolutionary history of two genes for C4 photosynthesis (ppc-aL1b and nadpme-IV) in the group was also investigated. The gene encoding the C4 phosphoenolpyruvate caroxylase of Stipagrostis is absent from S. dewinteri suggesting that it is not essential in C3 members of the group, which might have favoured its recruitment into a new metabolic pathway. Altogether, the inclusion of historical museum specimens in phylogenomic analyses of biodiversity opens new avenues for evolutionary studies. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Lesch-Nyhan variant syndrome: variable presentation in 3 affected family members.

PubMed

Sarafoglou, Kyriakie; Grosse-Redlinger, Krista; Boys, Christopher J; Charnas, Laurence; Otten, Noelle; Broock, Robyn; Nyhan, William L

2010-06-01

Lesch-Nyhan disease is an inborn error of purine metabolism that results from deficiency of the activity of hypoxanthine phosphoribosyltransferase (HPRT). The heterogeneity of clinical phenotypes seen in HPRT deficiency corresponds to an inverse relationship between HPRT enzyme activity and clinical severity. With rare exception, each mutation produces a stereotypical pattern of clinical disease; onset of neurologic symptoms occurs during infancy and is thought to be nonprogressive. To document a family in which a single HPRT gene mutation has led to 3 different clinical and enzymatic phenotypes. Case report. Settings A university-based outpatient metabolic clinic and a biochemical genetics laboratory. Patients Three males (2 infants and their grandfather) from the same family with Lesch-Nyhan variant, including one of the oldest patients with Lesch-Nyhan variant at diagnosis (65 years). Clinical and biochemical observations. Sequencing of 5 family members revealed a novel mutation c.550G>T in exon 7 of the HPRT gene. The considerably variable clinical phenotype corresponded with the variable enzymatic activity in the 3 males, with the grandfather being the most severely affected. The different phenotypes encountered in the enzymatic analysis of cultured fibroblasts from a single mutation in the same family is unprecedented. The significant decrease in the grandfather's HPRT enzymatic activity compared with that of his grandchildren could be a function of the Hayflick Limit Theory of cell senescence.