Construction site Voice Operated Information System (VOIS) test
NASA Astrophysics Data System (ADS)
Lawrence, Debbie J.; Hettchen, William
1991-01-01
The Voice Activated Information System (VAIS), developed by USACERL, allows inspectors to verbally log on-site inspection reports on a hand held tape recorder. The tape is later processed by the VAIS, which enters the information into the system's database and produces a written report. The Voice Operated Information System (VOIS), developed by USACERL and Automated Sciences Group, through a ESACERL cooperative research and development agreement (CRDA), is an improved voice recognition system based on the concepts and function of the VAIS. To determine the applicability of the VOIS to Corps of Engineers construction projects, Technology Transfer Test Bad (T3B) funds were provided to the Corps of Engineers National Security Agency (NSA) Area Office (Fort Meade) to procure and implement the VOIS, and to train personnel in its use. This report summarizes the NSA application of the VOIS to quality assurance inspection of radio frequency shielding and to progress payment logs, and concludes that the VOIS is an easily implemented system that can offer improvements when applied to repetitive inspection procedures. Use of VOIS can save time during inspection, improve documentation storage, and provide flexible retrieval of stored information.
Vicente, Esther M; Lodge, Martin A; Rowe, Steven P; Wahl, Richard L; Frey, Eric C
2017-05-01
We investigated the feasibility of using simpler methods than manual whole-organ volume-of-interest (VOI) definition to estimate the organ activity concentration in single photon emission computed tomography (SPECT) in cases where the activity in the organ can be assumed to be uniformly distributed on the scale of the voxel size. In particular, we investigated an anatomic region-of-interest (ROI) defined in a single transaxial slice, and a single sphere placed inside the organ boundaries. The evaluation was carried out using Monte Carlo simulations based on patient indium 111 In pentetreotide SPECT and computed tomography (CT) images. We modeled constant activity concentrations in each organ, validating this assumption by comparing the distribution of voxel values inside the organ VOIs of the simulated data with the patient data. We simulated projection data corresponding to 100, 50, and 25% of the clinical count level to study the effects of noise level due to shortened acquisition time. Images were reconstructed using a previously validated quantitative SPECT reconstruction method. The evaluation was performed in terms of the accuracy and precision of the activity concentration estimates. The results demonstrated that the non-uniform image intensity observed in the reconstructed images in the organs with normal uptake was consistent with uniform activity concentration in the organs on the scale of the voxel size; observed non-uniformities in image intensity were due to a combination of partial-volume effects at the boundaries of the organ, artifacts in the reconstructed image due to collimator-detector response compensation, and noise. Using an ROI defined in a single transaxial slice produced similar biases compared to the three-dimensional (3D) whole-organ VOIs, provided that the transaxial slice was near the central plane of the organ and that the pixels from the organ boundaries were not included in the ROI. Although this slice method was sensitive to noise
Quantitative 1D diffraction signatures during dual detector scatter VOI breast CBCT
NASA Astrophysics Data System (ADS)
LeClair, Robert J.
2017-03-01
Dual detector VOI scatter CBCT is similar to dual detector VOI CBCT except that during the high resolution scan, the low resolution flat panel detector is also used to capture the scattered photons. Simulations show a potential use of scatter to diagnose suspicious VOIs. Energy integrated signals due to scatter (EISs) were computed for a specific imaging task involving a malignant lesion and was labelled as a hypothetical experiment (expt) result. The signal was compared to predictions (pred) using benign and malignant lesions. The ΔEISs=EISs|expt - EISs|pred displayed eye catching diffraction structure when the prediction calculation used a benign lesion. The structure occurred even when the phantom compositions were different for prediction and experiment calculations. Since the diffraction structure has a circularly symmetric behaviour because the tissues are amorphous in nature, the 2D ΔEISs patterns were transformed to 1D signals. The 1D signals were obtained by calculating the mean ΔEISs signals in rings. The mean pixel values were a function of the momentum transfer argument q = 4π sin(θ/2)/λ which ranged from 12 to 46 nm-1. The 1D signals correlated well with the 2D profiles. Of particular interest were scatter signatures between q = 20 and 30 nm-1 where malignant tissue is predicted to scatter more than benign fibroglandular tissue. The 1D diffraction signatures could allow a better method to diagnose a suspicious lesion during dual detector scatter VOI CBCT.
NASA Astrophysics Data System (ADS)
Meng, Qier; Kitasaka, Takayuki; Oda, Masahiro; Mori, Kensaku
2017-03-01
Airway segmentation is an important step in analyzing chest CT volumes for computerized lung cancer detection, emphysema diagnosis, asthma diagnosis, and pre- and intra-operative bronchoscope navigation. However, obtaining an integrated 3-D airway tree structure from a CT volume is a quite challenging task. This paper presents a novel airway segmentation method based on intensity structure analysis and bronchi shape structure analysis in volume of interest (VOI). This method segments the bronchial regions by applying the cavity enhancement filter (CEF) to trace the bronchial tree structure from the trachea. It uses the CEF in each VOI to segment each branch and to predict the positions of VOIs which envelope the bronchial regions in next level. At the same time, a leakage detection is performed to avoid the leakage by analysing the pixel information and the shape information of airway candidate regions extracted in the VOI. Bronchial regions are finally obtained by unifying the extracted airway regions. The experiments results showed that the proposed method can extract most of the bronchial region in each VOI and led good results of the airway segmentation.
Optimization of a secondary VOI protocol for lung imaging in a clinical CT scanner.
Larsen, Thomas C; Gopalakrishnan, Vissagan; Yao, Jianhua; Nguyen, Catherine P; Chen, Marcus Y; Moss, Joel; Wen, Han
2018-05-21
We present a solution to meet an unmet clinical need of an in-situ "close look" at a pulmonary nodule or at the margins of a pulmonary cyst revealed by a primary (screening) chest CT while the patient is still in the scanner. We first evaluated options available on current whole-body CT scanners for high resolution screening scans, including ROI reconstruction of the primary scan data and HRCT, but found them to have insufficient SNR in lung tissue or discontinuous slice coverage. Within the capabilities of current clinical CT systems, we opted for the solution of a secondary, volume-of-interest (VOI) protocol where the radiation dose is focused into a short-beam axial scan at the z position of interest, combined with a small-FOV reconstruction at the xy position of interest. The objective of this work was to design a VOI protocol that is optimized for targeted lung imaging in a clinical whole-body CT system. Using a chest phantom containing a lung-mimicking foam insert with a simulated cyst, we identified the appropriate scan mode and optimized both the scan and recon parameters. The VOI protocol yielded 3.2 times the texture amplitude-to-noise ratio in the lung-mimicking foam when compared to the standard chest CT, and 8.4 times the texture difference between the lung mimicking and reference foams. It improved details of the wall of the simulated cyst and better resolution in a line-pair insert. The Effective Dose of the secondary VOI protocol was 42% on average and up to 100% in the worst-case scenario of VOI positioning relative to the standard chest CT. The optimized protocol will be used to obtain detailed CT textures of pulmonary lesions, which are biomarkers for the type and stage of lung diseases. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.
Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.
Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F
2006-10-01
Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.
Lopes, Leonardo Wanderley; de Oliveira Florencio, Vanessa; Silva, Priscila Oliveira Costa; da Nóbrega E Ugulino, Ana Celiane; Almeida, Anna Alice
2018-01-04
We aimed to correlate the Vocal Tract Discomfort Scale (VTDS) with the Voice Symptom Scale (VoiSS) for evaluation of patients with dysphonia. In addition, we aimed to compare vocal tract discomfort symptoms in patients with and without self-reported voice problem. This is a descriptive, cross-sectional, and retrospective study. We analyzed 143 women and 62 men with voice disorders, as confirmed by endoscopic larynx examination. All patients completed the VTDS and VoiSS at vocal evaluation. Descriptive statistics and the Spearman correlation test were applied to all variables. The degree of covariance of variables was noted. The Mann-Whitney U test was used to compare the average number of discomfort symptoms among patients with and without self-reported voice problems. A weak to moderate positive correlation was observed between the average number, frequency, and intensity of comfort symptom and the total score, physical domain score, and limitation domain score of the VoiSS. The vocal tract discomfort symptoms and the emotional domain score of the VoiSS were weakly correlated. Patients with self-reported voice problems had a higher number, frequency, and intensity of vocal tract discomfort symptoms. There is correlation between the VTDS and VoiSS scales, with greater references to vocal tract discomfort symptom in patients with self-reported voice problems. Therefore, the discomfort symptoms seem to influence the perception of the impact of a voice problem. Copyright © 2017 The Voice Foundation. Published by Elsevier Inc. All rights reserved.
Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates
Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro
2010-01-01
AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477
Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.
2001-01-01
The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.
Kets de Vries, Manfred F
2004-01-01
Much of the business literature on leadership starts with the assumption that leaders are rational beings. But irrationality is integral to human nature, and inner conflict often contributes to the drive to succeed. Although a number of business scholars have explored the psychology of executives, Manfred F.R Kets de Vries has made the analysis of CEOs his life's work. In this article, Kets de Vries, a psychoanalyst, author, and instead professor, draws on three decades of study to describe the psychological profile of successful CEOs. He explores senior executives' vulnerabilities, which are often intensified by followers' attempts to manipulate their leaders. Leaders, he says, have an uncanny ability to awaken transferential processes--in which people transfer the dynamics of past relationships onto present interactions--among their employees and even in themselves. These processes can present themselves in a number of ways, sometimes negatively. What's more, many top executives, being middle-aged, suffer from depression. Mid-life prompts a reappraisal of career identity, and by the time a leader is a CEO, an existential crisis is often imminent. This can happen with anyone, but the probability is higher with CEOs, and senior executives because so many have devoted themselves exclusively to work. Not all CEOs are psychologically unhealthy, of course. Healthy leaders are talented in self-observation and self-analysis, Kets de Vries says. The best are highly motivated to spend time on self-reflection. Their lives are in balance, they can play, they are creative and inventive, and they have the capacity to be nonconformist. "Those who accept the madness in themselves may be the healthiest leaders of all," he concludes.
NASA Technical Reports Server (NTRS)
Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve
2003-01-01
A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.
Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.
Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David
2017-09-01
The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fischer, Gary J [Albuquerque, NM
2010-08-17
The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.
USDA-ARS?s Scientific Manuscript database
The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...
Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network
NASA Astrophysics Data System (ADS)
Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue
2006-09-01
In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.
The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.
ERIC Educational Resources Information Center
Rice, Jeff
2003-01-01
Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…
Cross-cultural adaptation of the Chilean version of the Voice Symptom Scale - VoiSS.
Ruston, Francisco Contreras; Moreti, Felipe; Vivero, Martín; Malebran, Celina; Behlau, Mara
This research aims to accomplish the cross-cultural equivalence of the Chilean version of the VoiSS protocol through its cultural and linguistic adaptation. After the translation of the VoiSS protocol to Chilean Spanish by two bilingual speech therapists and its back translation to English, we compared the items of the original tool with the previous translated version. The existing discrepancies were modified by a consensus committee of five speech therapists and the translated version was entitled Escala de Sintomas Vocales - ESV, with 30 questions and five answers: "Never", "Occasionally", "Sometimes", "Most of the time", "Always". For cross-cultural equivalence, the protocol was applied to 15 individuals with vocal problems. In each question the option of "Not applicable" was added to the answer choices for identification of the questions not comprehended or not appropriate for the target population. Two individuals had difficulty answering two questions, which made it necessary to adapt the translation of only one of them. The modified ESV was applied to three individuals with vocal problems, and there were incomprehensible inappropriate questions for the Chilean culture. The ESV reflects the original English version, both in the number of questions and the limitations of the emotional and physical domains. There is now a cross-cultural equivalence of VoiSS in Chilean Spanish, titled ESV. The validation of the ESV for Chilean Spanish is ongoing. RESUMEN Este estudio tuvo como objetivo realizar la equivalencia cultural de la versión Chilena del protocolo Voice Symptom Scale - VoiSS por medio de su adaptación cultural y lingüística. Después de la traducción del VoiSS para el Español Chileno, por dos fonoaudiólogos bilingües, y de la retro traducción para el inglés, se realizó una comparación de los ítems del instrumento original con la versión traducida, surgiendo discrepancias; tales divergencias fueron resueltas por un comité compuesto por
An Efficient Next Hop Selection Algorithm for Multi-Hop Body Area Networks
Ayatollahitafti, Vahid; Ngadi, Md Asri; Mohamad Sharif, Johan bin; Abdullahi, Mohammed
2016-01-01
Body Area Networks (BANs) consist of various sensors which gather patient’s vital signs and deliver them to doctors. One of the most significant challenges faced, is the design of an energy-efficient next hop selection algorithm to satisfy Quality of Service (QoS) requirements for different healthcare applications. In this paper, a novel efficient next hop selection algorithm is proposed in multi-hop BANs. This algorithm uses the minimum hop count and a link cost function jointly in each node to choose the best next hop node. The link cost function includes the residual energy, free buffer size, and the link reliability of the neighboring nodes, which is used to balance the energy consumption and to satisfy QoS requirements in terms of end to end delay and reliability. Extensive simulation experiments were performed to evaluate the efficiency of the proposed algorithm using the NS-2 simulator. Simulation results show that our proposed algorithm provides significant improvement in terms of energy consumption, number of packets forwarded, end to end delay and packet delivery ratio compared to the existing routing protocol. PMID:26771586
Classification of Scaffold Hopping Approaches
Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders
2012-01-01
The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715
Steerable Hopping Six-Legged Robot
NASA Technical Reports Server (NTRS)
Younse, Paulo; Aghazarian, Hrand
2010-01-01
The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…
The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop
ERIC Educational Resources Information Center
Soderman, Johan
2013-01-01
Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…
Variable range hopping in ZnO films
NASA Astrophysics Data System (ADS)
Ali, Nasir; Ghosh, Subhasis
2018-04-01
We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.
Hop Optimization and Relay Node Selection in Multi-hop Wireless Ad-Hoc Networks
NASA Astrophysics Data System (ADS)
Li, Xiaohua(Edward)
In this paper we propose an efficient approach to determine the optimal hops for multi-hop ad hoc wireless networks. Based on the assumption that nodes use successive interference cancellation (SIC) and maximal ratio combining (MRC) to deal with mutual interference and to utilize all the received signal energy, we show that the signal-to-interference-plus-noise ratio (SINR) of a node is determined only by the nodes before it, not the nodes after it, along a packet forwarding path. Based on this observation, we propose an iterative procedure to select the relay nodes and to calculate the path SINR as well as capacity of an arbitrary multi-hop packet forwarding path. The complexity of the algorithm is extremely low, and scaling well with network size. The algorithm is applicable in arbitrarily large networks. Its performance is demonstrated as desirable by simulations. The algorithm can be helpful in analyzing the performance of multi-hop wireless networks.
... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...
ERIC Educational Resources Information Center
Hall, Marcella Runell
2009-01-01
Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…
Mode Hopping in Semiconductor Lasers
NASA Astrophysics Data System (ADS)
Heumier, Timothy Alan
Semiconductor lasers have found widespread use in fiberoptic communications, merchandising (bar-code scanners), entertainment (videodisc and compact disc players), and in scientific inquiry (spectroscopy, laser cooling). Some uses require a minimum degree of stability of wavelength which is not met by these lasers: Under some conditions, semiconductor lasers can discontinuously switch wavelengths in a back-and-forth manner. This is called mode hopping. We show that mode hopping is directly correlated to noise in the total intensity, and that this noise is easily detected by a photodiode. We also show that there are combinations of laser case temperature and injection current which lead to mode hopping. Conversely, there are other combinations for which the laser is stable. These results are shown to have implications for controlling mode hopping.
2018-01-01
As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation. PMID:29329248
Jung, Haejoon; Lee, In-Ho
2018-01-12
As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.
Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.
2011-01-01
Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular
NASA Technical Reports Server (NTRS)
Degner, R.; Kaplan, M. H.; Manning, J.; Meetin, R.; Pasternack, S.; Peterson, S.; Seifert, H.
1971-01-01
Research on several aspects of lunar transport using the hopping mode is reported. Hopping exploits the weak lunar gravity, permits fuel economy because of partial recompression of propellant gas on landing, and does not require a continuous smooth surface for operation. Three questions critical to the design of a lunar hopping vehicle are addressed directly in this report: (1) the tolerance of a human pilot for repeated accelerations; (2) means for controlling vehicle attitude during ballistic flight; and (3) means of propulsion. In addition, a small scale terrestrial demonstrator built to confirm feasibility of the proposed operational mode is described, along with results of preliminary study of unmanned hoppers for moon exploration.
Beer spoilage bacteria and hop resistance.
Sakamoto, Kanta; Konings, Wil N
2003-12-31
For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However
Hip-Hop and the Academic Canon
ERIC Educational Resources Information Center
Abe, Daudi
2009-01-01
Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…
HopBase: a unified resource for Humulus genomics
Hill, Steven T.; Sudarsanam, Ramcharan
2017-01-01
Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075
Why do mammals hop? Understanding the ecology, biomechanics and evolution of bipedal hopping.
McGowan, Craig P; Collins, Clint E
2018-06-15
Bipedal hopping is a specialized mode of locomotion that has arisen independently in at least five groups of mammals. We review the evolutionary origins of these groups, examine three of the most prominent hypotheses for why bipedal hopping may have arisen, and discuss how this unique mode of locomotion influences the behavior and ecology of modern species. While all bipedal hoppers share generally similar body plans, differences in underlying musculoskeletal anatomy influence what performance benefits each group may derive from this mode of locomotion. Based on a review of the literature, we conclude that the most likely reason that bipedal hopping evolved is associated with predator avoidance by relatively small species in forested environments. Yet, the morphological specializations associated with this mode of locomotion have facilitated the secondary acquisition of performance characteristics that enable these species to be highly successful in ecologically demanding environments such as deserts. We refute many long-held misunderstandings about the origins of bipedal hopping and identify potential areas of research that would advance the understanding of this mode of locomotion. © 2018. Published by The Company of Biologists Ltd.
Genomics of the hop psuedo-autosomal regions
USDA-ARS?s Scientific Manuscript database
Hop is one of the few crop species with female and male plants with sex being determined by either XX or XY chromosomes. Hop cones are only produced in female hops with or without fertilization. This has lead to most genomic research being directed toward female plants. Very little work has been don...
Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).
Stannard, Hayley J; Tulk, Melissa L; Old, Julie M
2017-03-01
Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine
Nerve Conduction Through Dendrites via Proton Hopping.
Kier, Lemont B
2017-01-01
In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention
ERIC Educational Resources Information Center
Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.
2014-01-01
The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…
Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿
Behr, Jürgen; Vogel, Rudi F.
2010-01-01
In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of
Multi-hop teleportation based on W state and EPR pairs
NASA Astrophysics Data System (ADS)
Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang
2016-05-01
Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).
Revolutionizing Environmental Education through Indigenous Hip Hop Culture
ERIC Educational Resources Information Center
Gorlewski, Julie; Porfilio, Brad J.
2012-01-01
Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…
Kankolongo Cibaka, Marie-Lucie; Decourrière, Laura; Lorenzo-Alonso, Celso-José; Bodart, Etienne; Robiette, Raphaël; Collin, Sonia
2016-11-16
Monovarietal dry-hopped beers were produced with the dual-purpose hop cultivars Amarillo, Hallertau Blanc, and Mosaic. The grapefruit-like 3-sulfanyl-4-methylpentan-1-ol was found in all three beers at concentrations much higher than expected on the basis of the free thiol content in hop. Even cysteinylated precursors proved unable to explain our results. As observed in wine, the occurrence of S-glutathione precursors was therefore suspected in hop. The analytical standards of S-3-(4-methyl-1-hydroxypentyl)glutathione, never described before, and of S-3-(1-hydroxyhexyl)glutathione, previously evidenced in grapes, were chemically synthesized. An optimized extraction of glutathionylated precursors was then applied to Amarillo, Hallertau Blanc, and Mosaic hop samples. HPLC-ESI(+)MS/MS revealed, for the first time, the occurrence of S-3-(1-hydroxyhexyl)glutathione and S-3-(4-methyl-1-hydroxypentyl)glutathione in hop, at levels well above those reported for their cysteinylated counterparts. S-3-(1-Hydroxyhexyl)glutathione emerged in all cases as the major adduct in hop. Yet, although 3-sulfanylhexan-1-ol seems relatively ubiquitous in free, cysteinylated, and glutathionylated forms, the glutathione adduct of 3-sulfanyl-4-methylpentan-1-ol, never evidenced in other plants up to now, was found only in the Hallertau Blanc variety.
ERIC Educational Resources Information Center
Horton, Akesha Monique
2013-01-01
Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…
Knee Joint Loading during Single-Leg Forward Hopping.
Krupenevich, Rebecca L; Pruziner, Alison L; Miller, Ross H
2017-02-01
Increased or abnormal loading on the intact limb is thought to contribute to the relatively high risk of knee osteoarthritis in this limb for individuals with unilateral lower limb loss. This theory has been assessed previously by studying walking, but knee joint loading during walking is often similar between individuals with and without limb loss, prompting assessment of other movements that may place unusual loads on the knee. One such movement, hopping, is a form of locomotion that individuals with unilateral lower limb loss may situationally use instead of walking, but the mechanical effects of hopping on the intact limb are unknown. Compare knee joint kinetics of healthy adults during single-leg forward hopping compared to walking, a more traditional form of locomotion. Twenty-four healthy adults walked and hopped at self-selected speeds of 1.5 and 2.3 m·s, respectively. Joint moments were calculated using inverse dynamics. A paired Student's t-test was utilized to compare peak, impulse, and loading rate (LR) of knee adduction moment (KAM), and peak knee flexion moment (KFM) between walking and hopping. Peak KFM and KAM LR were greater during hopping compared to walking (peak KFM: 20.73% vs 5.51% body weight (BW) × height (Ht), P < 0.001; KAM LR: 0.47 vs. 0.33 BW·Ht·s, P = 0.01). Kinetic measures affecting knee joint loading are greater in hopping compared to walking. It may be advisable to limit single-leg forward hopping in the limb loss population until it is known if these loads increase knee osteoarthritis risk.
Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia
2017-01-01
The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516
Hip-hop as a resource for understanding the urban context
NASA Astrophysics Data System (ADS)
Brown, Bryan
2010-06-01
This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.
Time synchronization of a frequency-hopped MFSK communication system
NASA Technical Reports Server (NTRS)
Simon, M. K.; Polydoros, A.; Huth, G. K.
1981-01-01
In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.
High-Speed On-Board Data Processing for Science Instruments: HOPS
NASA Technical Reports Server (NTRS)
Beyon, Jeffrey
2015-01-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.
Research on synchronization technology of frequency hopping communication system
NASA Astrophysics Data System (ADS)
Zhao, Xiangwu; Quan, Houde; Cui, Peizhang
2018-05-01
Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.
Scaffold hopping in drug discovery using inductive logic programming.
Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H
2008-05-01
In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.
Multi-Hop Teleportation of an Unknown Qubit State Based on W States
NASA Astrophysics Data System (ADS)
Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen
2018-04-01
Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.
Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore
2015-01-01
Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that
How Does a Hopping Kangaroo Breathe?
ERIC Educational Resources Information Center
Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.
2010-01-01
We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…
From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education
NASA Astrophysics Data System (ADS)
Dolberry, Maurice E.
Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of
Hip-Hopping across China: Intercultural Formulations of Local Identities
ERIC Educational Resources Information Center
Barrett, Catrice
2012-01-01
The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…
Signaling induced by hop/STI-1 depends on endocytosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael
The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP{sup C}), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP{sup C} and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling inducedmore » by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP{sup C} by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases.« less
HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.
Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar
2018-05-08
HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.
HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops
ERIC Educational Resources Information Center
Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.
2008-01-01
Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…
Leg exoskeleton reduces the metabolic cost of human hopping.
Grabowski, Alena M; Herr, Hugh M
2009-09-01
During bouncing gaits such as hopping and running, leg muscles generate force to enable elastic energy storage and return primarily from tendons and, thus, demand metabolic energy. In an effort to reduce metabolic demand, we designed two elastic leg exoskeletons that act in parallel with the wearer's legs; one exoskeleton consisted of a multiple leaf (MLE) and the other of a single leaf (SLE) set of fiberglass springs. We hypothesized that hoppers, hopping on both legs, would adjust their leg stiffness while wearing an exoskeleton so that the combination of the hopper and exoskeleton would behave as a linear spring-mass system with the same total stiffness as during normal hopping. We also hypothesized that decreased leg force generation while wearing an exoskeleton would reduce the metabolic power required for hopping. Nine subjects hopped in place at 2.0, 2.2, 2.4, and 2.6 Hz with and without an exoskeleton while we measured ground reaction forces, exoskeletal compression, and metabolic rates. While wearing an exoskeleton, hoppers adjusted their leg stiffness to maintain linear spring-mass mechanics and a total stiffness similar to normal hopping. Without accounting for the added weight of each exoskeleton, wearing the MLE reduced net metabolic power by an average of 6% and wearing the SLE reduced net metabolic power by an average of 24% compared with hopping normally at frequencies between 2.0 and 2.6 Hz. Thus, when hoppers used external parallel springs, they likely decreased the mechanical work performed by the legs and substantially reduced metabolic demand compared with hopping without wearing an exoskeleton.
Hopper on wheels: evolving the hopping robot concept
NASA Technical Reports Server (NTRS)
Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.
2001-01-01
This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.
Extreme Kinematics in Selected Hip Hop Dance Sequences.
Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen
2015-09-01
Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.
Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika
2007-01-01
The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.
Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State
NASA Astrophysics Data System (ADS)
Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen
2017-10-01
Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.
Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C
2017-07-01
Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.
Toward Hip-Hop Pedagogies for Music Education
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2010 CFR
2010-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2013 CFR
2013-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2012 CFR
2012-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2011 CFR
2011-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
Framing and Reviewing Hip-Hop Educational Research
ERIC Educational Resources Information Center
Petchauer, Emery
2009-01-01
Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…
Low Power Multi-Hop Networking Analysis in Intelligent Environments.
Etxaniz, Josu; Aranguren, Gerardo
2017-05-19
Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.
Low Power Multi-Hop Networking Analysis in Intelligent Environments
Etxaniz, Josu; Aranguren, Gerardo
2017-01-01
Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847
Vortex variable range hopping in a conventional superconducting film
NASA Astrophysics Data System (ADS)
Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.
2017-12-01
The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.
Optimum Detection Of Slow-Frequency-Hopping Signals
NASA Technical Reports Server (NTRS)
Levitt, Barry K.; Cheng, Unjeng
1994-01-01
Two papers present theoretical analyses of various schemes for coherent and noncoherent detection of M-ary-frequency-shift-keyed (MFSK) signals with slow frequency hopping. Special attention focused on continuous-phase-modulation (CPM) subset of SFH/MFSK signals, for which frequency modulation such carrier phase remains continuous (albeit unknown) during each hop.
NASA Astrophysics Data System (ADS)
Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun
2018-04-01
For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.
Varietal discrimination of hop pellets by near and mid infrared spectroscopy.
Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A
2018-04-01
Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Porfilio, Brad J., Ed.; Viola, Michael J., Ed.
2012-01-01
Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…
Three-Dimensional Tracking of Interfacial Hopping Diffusion
NASA Astrophysics Data System (ADS)
Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.
2017-12-01
Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.
NASA Astrophysics Data System (ADS)
Youn, Joo-Sang; Seok, Seung-Joon; Kang, Chul-Hee
This paper presents a new QoS model for end-to-end service provisioning in multi-hop wireless networks. In legacy IEEE 802.11e based multi-hop wireless networks, the fixed assignment of service classes according to flow's priority at every node causes priority inversion problem when performing end-to-end service differentiation. Thus, this paper proposes a new QoS provisioning model called Dynamic Hop Service Differentiation (DHSD) to alleviate the problem and support effective service differentiation between end-to-end nodes. Many previous works for QoS model through the 802.11e based service differentiation focus on packet scheduling on several service queues with different service rate and service priority. Our model, however, concentrates on a dynamic class selection scheme, called Per Hop Class Assignment (PHCA), in the node's MAC layer, which selects a proper service class for each packet, in accordance with queue states and service requirement, in every node along the end-to-end route of the packet. The proposed QoS solution is evaluated using the OPNET simulator. The simulation results show that the proposed model outperforms both best-effort and 802.11e based strict priority service models in mobile ad hoc environments.
Gold Binding by Native and Chemically Modified Hops Biomasses
López, M. Laura; Gardea-Torresdey, J. L.; Peralta-Videa, J. R.; ...
2005-01-01
Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass ( Humulus lupulus ) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding atmore » pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively.« less
Gold Binding by Native and Chemically Modified Hops Biomasses
López, M. Laura; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.
2005-01-01
Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass (Humulus lupulus) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively. PMID:18365087
The Hip-Hop club scene: Gender, grinding and sex.
Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard
2007-01-01
Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.
Being Hip-Hop: Beyond Skills and Songs
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…
Injury incidence in hip hop dance.
Ojofeitimi, S; Bronner, S; Woo, H
2012-06-01
Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.
HopBase: A unified resource for Humulus genomics
USDA-ARS?s Scientific Manuscript database
Hop (Humulus lupulus L. var lupulus) is a plant of worldwide significance, used primarily for its’ bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop has led to additional interest from pharmacy and healthcare industries as well a...
ERIC Educational Resources Information Center
Buchanan, Ian P.
2013-01-01
Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…
Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea
Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun
2016-01-01
Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293
Resonant Mode-hopping Micromixing
Jang, Ling-Sheng; Chao, Shih-Hui; Holl, Mark R.; Meldrum, Deirdre R.
2009-01-01
A common micromixer design strategy is to generate interleaved flow topologies to enhance diffusion. However, problems with these designs include complicated structures and dead volumes within the flow fields. We present an active micromixer using a resonating piezoceramic/silicon composite diaphragm to generate acoustic streaming flow topologies. Circulation patterns are observed experimentally and correlate to the resonant mode shapes of the diaphragm. The dead volumes in the flow field are eliminated by rapidly switching from one discrete resonant mode to another (i.e., resonant mode-hop). Mixer performance is characterized by mixing buffer with a fluorescence tracer containing fluorescein. Movies of the mixing process are analyzed by converting fluorescent images to two-dimensional fluorescein concentration distributions. The results demonstrate that mode-hopping operation rapidly homogenized chamber contents, circumventing diffusion-isolated zones. PMID:19551159
Energy landscape in frustrated systems: Cation hopping in pyrochlores
NASA Astrophysics Data System (ADS)
Brooks Hinojosa, Beverly; Asthagiri, Aravind; Nino, Juan C.
2013-07-01
We investigate the dynamics of the local environment and electronic structure in inherently dipolar frustrated pyrochlore compounds to help identify the fundamental nature of dipolar disorder in pyrochlore systems and determine the necessary and sufficient conditions for dielectric relaxation. We map out the energy landscape associated with cation hopping events in three compounds and correlate the hopping pathway with experimental dielectric response. Comprehensive analysis of the calculations allows us to postulate rules to predict the occurrence of relaxation and cation hopping pathways.
Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten
2012-01-01
While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.
Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.
Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc
2016-09-12
In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).
Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program
Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc
2016-01-01
Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968
Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education
ERIC Educational Resources Information Center
Tobias, Evan S.
2014-01-01
Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…
Hip Hop Dance Experience Linked to Sociocognitive Ability.
Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C
2017-01-01
Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.
Hip Hop Dance Experience Linked to Sociocognitive Ability
Bonny, Justin W.; Lindberg, Jenna C.; Pacampara, Marc C.
2017-01-01
Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills. PMID:28146562
Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian
2018-04-01
Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p < 0.01), triple hop (417 ± 106 vs 519 ± 102% limb length, p < 0.01), timed hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p < 0.01), and crossover hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength
Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.
Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J
2006-04-01
A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and
Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom
ERIC Educational Resources Information Center
Adjapong, Edmund S.; Emdin, Christopher
2015-01-01
A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…
Treating primary insomnia - the efficacy of valerian and hops.
Salter, Shanah; Brownie, Sonya
2010-06-01
To evaluate the efficacy of valerian and hops in the treatment of primary insomnia. The AMED and MEDLINE databases were searched for primary sources of literature published between 1950 and 2009, using keywords: herbal medicine, medicinal plants, herbal, Valeriana officinalis, valerian, Humulus lupulus, hops, sleep, insomnia. Studies were included if they evaluated the efficacy of valerian or hops in improving primary insomnia in adults: sixteen studies met the inclusion criteria. Twelve of these found that the use of valerian, on its own, or in combination with hops, is associated with improvements in some sleep parameters (eg. sleep latency and quality of sleep). However, these results need to be interpreted cautiously as there were significant differences in design between the studies. Further randomised, double blind, placebo controlled trials are needed before such herbal treatments can be confidently recommended for the treatment of primary insomnia.
Reeb-Whitaker, Carolyn K; Bonauto, David K
2014-11-01
There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis
ERIC Educational Resources Information Center
Lindsey, Treva B.
2015-01-01
This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…
Hopping Diffusion of Nanoparticles in Polymer Matrices
2016-01-01
We propose a hopping mechanism for diffusion of large nonsticky nanoparticles subjected to topological constraints in both unentangled and entangled polymer solids (networks and gels) and entangled polymer liquids (melts and solutions). Probe particles with size larger than the mesh size ax of unentangled polymer networks or tube diameter ae of entangled polymer liquids are trapped by the network or entanglement cells. At long time scales, however, these particles can diffuse by overcoming free energy barrier between neighboring confinement cells. The terminal particle diffusion coefficient dominated by this hopping diffusion is appreciable for particles with size moderately larger than the network mesh size ax or tube diameter ae. Much larger particles in polymer solids will be permanently trapped by local network cells, whereas they can still move in polymer liquids by waiting for entanglement cells to rearrange on the relaxation time scales of these liquids. Hopping diffusion in entangled polymer liquids and networks has a weaker dependence on particle size than that in unentangled networks as entanglements can slide along chains under polymer deformation. The proposed novel hopping model enables understanding the motion of large nanoparticles in polymeric nanocomposites and the transport of nano drug carriers in complex biological gels such as mucus. PMID:25691803
Multiple-hopping trajectories near a rotating asteroid
NASA Astrophysics Data System (ADS)
Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian
2017-03-01
We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.
Framing Hip Hop: New Methodologies for New Times
ERIC Educational Resources Information Center
Dimitriadis, Greg
2015-01-01
This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…
Hip Hop Is Now: An Evolving Youth Culture
ERIC Educational Resources Information Center
Taylor, Carl; Taylor, Virgil
2007-01-01
Emerging from Rap music, Hip Hop has become a lifestyle to many modern youth around the world. Embodying both creativity and controversy, Hip Hop mirrors the values, violence, and hypocrisy of modern culture. The authors dispel some of the simplistic views that surround this evolving youth movement embraced by millions of young people who are…
ERIC Educational Resources Information Center
Brown, Bryan
2010-01-01
This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…
Moriya, Hyuga; Tanaka, Sohei; Iida, Yukari; Kitagawa, Satomi; Aizawa, Sen-Ichi; Taga, Atsushi; Terashima, Hiroyuki; Yamamoto, Atsushi; Kodama, Shuji
2018-05-16
Xanthohumol, isoxanthohumol, and 8-prenylnaringenin in beer, hop, and hop pellet samples were analyzed by HPLC using InertSustain phenyl column and the mobile phase containing 40% methanol and 12% 2-propanol. Fractions of isoxanthohumol and 8-prenylnaringenin obtained by the above HPLC were separately collected. Isoxanthohumol and 8-prenylnaringenin were enantioseparated by HPLC using Chiralcel OD-H column with a mobile phase composed of hexane/ethanol (90/10, v/v) and Chiralpak AD-RH column with a mobile phase composed of methanol/2-propanol/water (40/20/40, v/v/v), respectively. Both of isoxanthohumol and 8-prenylnaringenin from beer, hop, and hop pellet samples were found to be a racemic mixture. This can be explained that the two analytes were produced by non-enzymatic process. The effects of boiling conditions on the conversion of xanthohumol into isoxanthohumol were also studied. A higher concentration of ethanol in heating solvent resulted in a decrease in the conversion ratio and the conversion was stopped by addition of ethanol more than 50% (v/v). The isomerization was significantly affected pH (2-10) and the boiling medium at pH 5 was minimum for the conversion. Therefore, it was suggested that xanthohumol was relatively difficult to convert to isoxanthohumol in wort (pH 5-5.5) during boiling. This article is protected by copyright. All rights reserved.
Field-dependent hopping conduction
NASA Astrophysics Data System (ADS)
Hayashi, T.; Tokura, Y.; Fujiwara, A.
2018-07-01
We have numerically calculated transport characteristics on a Miller-Abraham network in a non-linear regime by solving the Kirchhoff's current law at each site. Assuming the Mott model, we obtained the relation between current density and electric field, J ∝exp(γ√{ E}) , which has often been observed in low-mobility materials and whose mechanism has been a source of controversy for over half a century. Our numerical calculation makes it possible to analyze the energy configuration of relevant hopping sites and visualize percolation networks. Following the percolation theory proposed by Shklovskii [Shklovskii, Sov. Phys. Semicond. 10, 855 (1976)], we show that the main mechanism of the field dependence is the replacement of dominating resistances accompanied by the geometrical evolution of the percolation networks. Our calculation is so general that it can be applied to hopping transport in a variety of systems.
Topological Anderson insulator induced by inter-cell hopping disorder
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lv, Shu-Hui; College of Sciences, Hebei University of Science and Technology, Shijiazhuang 050018; Song, Juntao, E-mail: jtsong@mail.hebtu.edu.cn
We have studied in detail the influence of same-orbit and different-orbit hopping disorders in HgTe/CdTe quantum wells. Intriguingly, similar to the behavior of the on-site Anderson disorder, a phase transition from a topologically trivial phase to a topological phase is induced at a proper strength of the same-orbit hopping disorder. For different-orbit hopping disorder, however, the phase transition does not occur. The results have been analytically verified by using effective medium theory. A consistent conclusion can be obtained by comparing phase diagrams, conductance, and conductance fluctuations. In addition, the influence of Rashba spin-orbit interaction (RSOI) on the system has beenmore » studied for different types of disorder, and the RSOI shows different influence on topological phase at different disorders. The topological phase induced by same-orbit hopping disorder is more robust against the RSOI than that induced by on-site Anderson disorder. For different-orbit hopping disorder, no matter whether the RSOI is included or not, the phase transition does not occur. The results indicate, whether or not the topological Anderson insulator can be observed depends on a competition between the different types of the disorder as well as the strength of the RSOI in a system.« less
NASA Astrophysics Data System (ADS)
Loschetter, Annick; Rohmer, Jérémy
2016-04-01
Standard and new generation of monitoring observations provide in almost real-time important information about the evolution of the volcanic system. These observations are used to update the model and contribute to a better hazard assessment and to support decision making concerning potential evacuation. The framework BET_EF (based on Bayesian Event Tree) developed by INGV enables dealing with the integration of information from monitoring with the prospect of decision making. Using this framework, the objectives of the present work are i. to propose a method to assess the added value of information (within the Value Of Information (VOI) theory) from monitoring; ii. to perform sensitivity analysis on the different parameters that influence the VOI from monitoring. VOI consists in assessing the possible increase in expected value provided by gathering information, for instance through monitoring. Basically, the VOI is the difference between the value with information and the value without additional information in a Cost-Benefit approach. This theory is well suited to deal with situations that can be represented in the form of a decision tree such as the BET_EF tool. Reference values and ranges of variation (for sensitivity analysis) were defined for input parameters, based on data from the MESIMEX exercise (performed at Vesuvio volcano in 2006). Complementary methods for sensitivity analyses were implemented: local, global using Sobol' indices and regional using Contribution to Sample Mean and Variance plots. The results (specific to the case considered) obtained with the different techniques are in good agreement and enable answering the following questions: i. Which characteristics of monitoring are important for early warning (reliability)? ii. How do experts' opinions influence the hazard assessment and thus the decision? Concerning the characteristics of monitoring, the more influent parameters are the means rather than the variances for the case considered
Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.
Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C
2015-03-01
The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation
USDA-ARS?s Scientific Manuscript database
As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...
Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture
ERIC Educational Resources Information Center
Beachum, Floyd D.
2013-01-01
Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…
Degradation of hop bitter acids by fungi
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw
2008-07-01
Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops.
A new method of hybrid frequency hopping signals selection and blind parameter estimation
NASA Astrophysics Data System (ADS)
Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian
2018-04-01
Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.
Precision QTL mapping of downy mildew resistance in Hop (Humulus lupulus L.)
USDA-ARS?s Scientific Manuscript database
Hop Downy mildew (DM) is an obligate parasite causing severe losses in hop if not controlled. Resistance to this pathogen is a primary goal for hop breeding programs. The objective of this study was to identify QTLs linked to DM resistance. Next-generation-sequencing was performed on a mapping po...
Surface hopping simulation of vibrational predissociation of methanol dimer
NASA Astrophysics Data System (ADS)
Jiang, Ruomu; Sibert, Edwin L.
2012-06-01
The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.
Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network
NASA Astrophysics Data System (ADS)
Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki
In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).
Factors of Intensification in the Hops Cluster of Chuvashia
ERIC Educational Resources Information Center
Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.
2016-01-01
The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…
A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.
Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea
2018-05-08
With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.
"Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture
ERIC Educational Resources Information Center
Callahan, J. Sean; Grantham, Tarek C.
2012-01-01
One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…
Interaction of alcoholic extracts of hops with cocaine and paracetamol in mice.
Horvat, Olga; Raskovic, Aleksandar; Jakovljevic, Vida; Sabo, Jan; Berenji, Janos
2007-01-01
This work describes a study of the interaction in the mouse model of alcoholic extracts of hops of Magnum, Aroma and wild genotypes with drugs that have excitatory effect on the cerebral cortex (cocaine) and analgesic action (paracetamol). Hop drying and preparation of the extracts were carried out according to standard pharmacological procedures for preparing total alcoholic extracts of dry herbs, consisting of one part of dry drug and two parts of 70% alcohol. The mice received four doses i.p. of 0.5% aqueous solutions of the above-mentioned extracts (10 ml/kg) 24, 16, 4 and 0.5 h prior to receiving cocaine (25 mg/kg) or paracetamol (80 mg/kg). The parameter investigated was the change in spontaneous motility of mice after combined treatment with the extracts and cocaine/paracetamol compared to control animals that received the same dose of the drug after treatment with physiological solution. Only the ethanolic extract of Magnum hops increased the spontaneous motility of mice, while none of the extracts showed analgesic action as measured by the hot-plate method. In the interaction with cocaine, the extract of Magnum hops suppressed almost completely the action of cocaine compared to controls. Extracts of the other hops also decreased the cocaine-induced locomotor activity of mice, but to a lesser extent. Hop extracts exhibited a significant pharmacological interaction with paracetamol, with the most pronounced increase in analgesic action being found for the ethanolic extract of Aroma hops and the tert-butanolic extract of wild hops.
Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play
ERIC Educational Resources Information Center
Broughton, Anthony
2017-01-01
Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…
Hierarchical Hopping through Localized States in a Random Potential
NASA Astrophysics Data System (ADS)
Rajan, Harihar; Srivastava, Vipin
2003-03-01
Generalisation of Mott's idea on (low - temperature, large-time), Variable-range-hopping is considered to include hopping at some what higher temperature(that do not kill localization). These transitions complement the variable- range-hopping in that they do not conserve energy and occur at relatively lower time scales. The hopper picks the next state in a hierarchical fashion in accordance with certain conditions. The results are found to tie up nicely with an interesting property pertaining to the energy dependence of localized states. Acknowlwdgements: One of us(VS) would like to thank Association of Commonwealth Universities and Leverhulme Trust for financial help and to Sir Sam Edwards for hospitality at Cavendish Laboratory,Cambridge CB3 0HE.
Hopping Diffusion of Nanoparticles Subjected to Topological Constraints
NASA Astrophysics Data System (ADS)
Cai, Li-Heng; Panyukov, Sergey; Rubinstein, Michael
2013-03-01
We describe a novel hopping mechanism for diffusion of large non-sticky nanoparticles subjected to topological constraints in polymer solids (networks and gels) and entangled polymer liquids (melts and solutions). Probe particles with size larger than the mesh size of unentangled polymer networks (tube diameter of entangled polymer liquids) are trapped by the network (entanglement) cages at time scales longer than the relaxation time of the network (entanglement) strand. At long time scales, however, these particles can move further by hopping between neighboring confinement cages. This hopping is controlled by fluctuations of surrounding confinement cages, which could be large enough to allow particles to slip through. The terminal particle diffusion coefficient dominated by this hopping diffusion is appreciable for particles with size slightly larger than the network mesh size (tube diameter). Very large particles in polymer solids will be permanently trapped by local network cages, whereas they can still move in polymer liquids by waiting for entanglement cages to rearrange on the relaxation time scale of the liquids. We would like to acknowledge the financial support of NSF CHE-0911588, DMR-0907515, DMR-1121107, DMR-1122483, and CBET-0609087, NIH R01HL077546 and P50HL107168, and Cystic Fibrosis Foundation under grant RUBIN09XX0.
Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice
ERIC Educational Resources Information Center
Petchauer, Emery
2015-01-01
One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…
Hop powdery mildew control through alteration of spring pruning practices
USDA-ARS?s Scientific Manuscript database
Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...
Hip Hop as Empowerment: Voices in El Alto, Bolivia
ERIC Educational Resources Information Center
Tarifa, Ariana
2012-01-01
In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…
Hip-Hop, the "Obama Effect," and Urban Science Education
ERIC Educational Resources Information Center
Emdin, Christopher; Lee, Okhee
2012-01-01
Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…
Collision-based energetic comparison of rolling and hopping over obstacles
Iida, Fumiya
2018-01-01
Locomotion of machines and robots operating in rough terrain is strongly influenced by the mechanics of the ground-machine interactions. A rolling wheel in terrain with obstacles is subject to collisional energy losses, which is governed by mechanics comparable to hopping or walking locomotion. Here we investigate the energetic cost associated with overcoming an obstacle for rolling and hopping locomotion, using a simple mechanics model. The model considers collision-based interactions with the ground and the obstacle, without frictional losses, and we quantify, analyse, and compare the sources of energetic costs for three locomotion strategies. Our results show that the energetic advantages of the locomotion strategies are uniquely defined given the moment of inertia and the Froude number associated with the system. We find that hopping outperforms rolling at larger Froude numbers and vice versa. The analysis is further extended for a comparative study with animals. By applying size and inertial properties through an allometric scaling law of hopping and trotting animals to our models, we found that the conditions at which hopping becomes energetically advantageous to rolling roughly corresponds to animals’ preferred gait transition speeds. The energetic collision losses as predicted by the model are largely verified experimentally. PMID:29538459
Variable-Range Hopping through Marginally Localized Phonons
NASA Astrophysics Data System (ADS)
Banerjee, Sumilan; Altman, Ehud
2016-03-01
We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.
Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3
ERIC Educational Resources Information Center
Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.
2012-01-01
"Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…
Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace
ERIC Educational Resources Information Center
Durham, Aisha S.
2009-01-01
The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…
Structural studies on the co-chaperone Hop and its complexes with Hsp90.
Onuoha, S C; Coulstock, E T; Grossmann, J G; Jackson, S E
2008-06-13
The tetratricopeptide repeat domain (TPR)-containing co-chaperone Hsp-organising protein (Hop) plays a critical role in mediating interactions between Heat Shock Protein (Hsp)70 and Hsp90 as part of the cellular assembly machine. It also modulates the ATPase activity of both Hsp70 and Hsp90, thus facilitating client protein transfer between the two. Despite structural work on the individual domains of Hop, no structure for the full-length protein exists, nor is it clear exactly how Hop interacts with Hsp90, although it is known that its primary binding site is the C-terminal MEEVD motif. Here, we have undertaken a biophysical analysis of the structure and binding of Hop to Hsp90 using a variety of truncation mutants of both Hop and Hsp90, in addition to mutants of Hsp90 that are thought to modulate the conformation, in particular the N-terminal dimerisation of the chaperone. The results establish that whilst the primary binding site of Hop is the C-terminal MEEVD peptide of Hsp90, binding also occurs at additional sites in the C-terminal and middle domain. In contrast, we show that another TPR-containing co-chaperone, CyP40, binds solely to the C-terminus of Hsp90. Truncation mutants of Hop were generated and used to investigate the dimerisation interface of the protein. In good agreement with recently published data, we find that the TPR2a domain that contains the Hsp90-binding site is also the primary site for dimerisation. However, our results suggest that residues within the TPR2b may play a role. Together, these data along with shape reconstruction analysis from small-angle X-ray scattering measurements are used to generate a solution structure for full-length Hop, which we show has an overall butterfly-like quaternary structure. Studies on the nucleotide dependence of Hop binding to Hsp90 establish that Hop binds to the nucleotide-free, 'open' state of Hsp90. However, the Hsp90-Hop complex is weakened by the conformational changes that occur in Hsp90 upon ATP
Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.
Schumacher, Christian; Seyfarth, André
2017-01-01
In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific
The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.
Harakeh, Zeena; Bogt, Tom F M Ter
2018-02-16
Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.
Range and energetics of charge hopping in organic semiconductors
NASA Astrophysics Data System (ADS)
Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn
2017-12-01
The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.
Teaching Controversal Topics in Contemporary German Culture through Hip-Hop
ERIC Educational Resources Information Center
Putnam, Michael
2006-01-01
This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."
Adsorbate hopping via vibrational-mode coupling induced by femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Ueba, H.; Hayashi, M.; Paulsson, M.; Persson, B. N. J.
2008-09-01
We study the heat transfer from femtosecond laser-heated hot electrons in a metal to adsorbates in the presence of vibrational-mode coupling. The theory is successfully applied to the experimental result of atomic oxygen hopping on a vicinal Pt(111) surface. The effective friction coupling between hot electrons and the vibrational mode relevant to the hopping motion depends on the transient temperature of the partner mode excited by hot electrons. The calculated two-pulse correlation and fluence dependence of the hopping probability reproduce the experimental results, which were previously analyzed using the hot-electron temperature (Te) -dependent friction ηa(Te) in a conventional heat transfer equation. A possible elementary process behind such a hypothetic modeling using ηa(Te) is discussed in terms of an indirect heating of the vibrational mode for hopping at the surface.
Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education
ERIC Educational Resources Information Center
Emdin, Christopher
2010-01-01
The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…
NASA Astrophysics Data System (ADS)
Miyazaki, Jun
2013-10-01
We present an analytical method for quantifying exciton hopping in an energetically disordered system with quenching sites. The method is subsequently used to provide a quantitative understanding of exciton hopping in a quantum dot (QD) array. Several statistical quantities that characterize the dynamics (survival probability, average number of distinct sites visited, average hopping distance, and average hopping rate in the initial stage) are obtained experimentally by measuring time-resolved fluorescence intensities at various temperatures. The time evolution of these quantities suggests in a quantitative way that at low temperature an exciton tends to be trapped at a local low-energy site, while at room temperature, exciton hopping occurs repeatedly, leading to a large hopping distance. This method will serve to facilitate highly efficient optoelectronic devices using QDs such as photovoltaic cells and light-emitting diodes, since exciton hopping is considered to strongly influence their operational parameters. The presence of a dark QD (quenching site) that exhibits fast decay is also quantified.
The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.
Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David
2016-08-15
Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.
Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs
Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor
2017-01-01
Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014
Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.
Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor
2017-08-01
Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.
Cox, Louis Anthony; Popken, Douglas A; VanSickle, John J; Sahu, Ranajit
2005-08-01
The U.S. Department of Agriculture (USDA) tests a subset of cattle slaughtered in the United States for bovine spongiform encephalitis (BSE). Knowing the origin of cattle (U.S. vs. Canadian) at testing could enable new testing or surveillance policies based on the origin of cattle testing positive. For example, if a Canadian cow tests positive for BSE, while no U.S. origin cattle do, the United States could subject Canadian cattle to more stringent testing. This article illustrates the application of a value-of-information (VOI) framework to quantify and compare potential economic costs to the United States of implementing tracking cattle origins to the costs of not doing so. The potential economic value of information from a tracking program is estimated to exceed its costs by more than five-fold if such information can reduce future losses in export and domestic markets and reduce future testing costs required to reassure or win back customers. Sensitivity analyses indicate that this conclusion is somewhat robust to many technical, scientific, and market uncertainties, including the current prevalence of BSE in the United States and/or Canada and the likely reactions of consumers to possible future discoveries of BSE in the United States and/or Canada. Indeed, the potential value of tracking information is great enough to justify locating and tracking Canadian cattle already in the United States when this can be done for a reasonable cost. If aggressive tracking and testing can win back lost exports, then the VOI of a tracking program may increase to over half a billion dollars per year.
Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.
Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less
Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians
ERIC Educational Resources Information Center
Sulé, V. Thandi
2016-01-01
Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…
Towards a Pedagogy of Hip Hop in Urban Teacher Education
ERIC Educational Resources Information Center
Bridges, Thurman
2011-01-01
This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…
ERIC Educational Resources Information Center
Talley, Clarence, Sr.
2011-01-01
Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…
Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity
ERIC Educational Resources Information Center
Hill, Marc Lamont
2009-01-01
For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…
Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).
Hartmann, Richard; Strunz, Walter T
2017-12-12
We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.
Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.
Neiens, Silva D; Steinhaus, Martin
2018-02-14
The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.
Christian Hip Hop as Pedagogy: A South African Case Study
ERIC Educational Resources Information Center
Abraham, Ibrahim
2015-01-01
Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…
Hopping and trapping mechanisms in organic field-effect transistors
NASA Astrophysics Data System (ADS)
Konezny, S. J.; Bussac, M. N.; Zuppiroli, L.
2010-01-01
A charge carrier in the channel of an organic field-effect transistor (OFET) is coupled to the electric polarization of the gate in the form of a surface Fröhlich polaron [N. Kirova and M. N. Bussac, Phys. Rev. B 68, 235312 (2003)]. We study the effects of the dynamical field of polarization on both small-polaron hopping and trap-limited transport mechanisms. We present numerical calculations of polarization energies, band-narrowing effects due to polarization, hopping barriers, and interface trap depths in pentacene and rubrene transistors as functions of the dielectric constant of the gate insulator and demonstrate that a trap-and-release mechanism more appropriately describes transport in high-mobility OFETs. For mobilities on the order 0.1cm2/Vs and below, all states are highly localized and hopping becomes the predominant mechanism.
Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth
USDA-ARS?s Scientific Manuscript database
Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...
Hop limited epidemic-like information spreading in mobile social networks with selfish nodes
NASA Astrophysics Data System (ADS)
Wu, Yahui; Deng, Su; Huang, Hongbin
2013-07-01
Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.
Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R
2015-06-01
Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.
NASA Astrophysics Data System (ADS)
Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu
2017-08-01
Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.
Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L
2016-12-01
Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was
Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.
2016-01-01
Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at
Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute
NASA Astrophysics Data System (ADS)
Beyer, Eric W.
The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions
Structure and DNA-binding of meiosis-specific protein Hop2
NASA Astrophysics Data System (ADS)
Zhou, Donghua; Moktan, Hem; Pezza, Roberto
2014-03-01
Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.
Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Price, D E; Durling, R L
2005-10-10
The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors,more » HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.« less
A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.
Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia
2018-06-01
African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.
Analysis of muscle activity and ankle joint movement during the side-hop test.
Yoshida, Masahiro; Taniguchi, Keigo; Katayose, Masaki
2011-08-01
Functional performance tests (FPTs) that consist of movements, such as hopping, landing, and cutting, provide useful measurements. Although some tests have been established for kinematic studies of the knee joint, very few tests have been established for the ankle joint. To use the FPT as a test battery for patients with an ankle sprain, it is necessary to document typical patterns of muscle activation and range of motion (ROM) of the ankle joint during FPTs. Therefore, the purpose of this study was to investigate the pattern of the ROM of the ankle inversion/eversion and the muscle activity of the peroneus longus muscle (PL) and the tibial anterior muscle (TA) in normal subjects during the side-hop test. To emphasize the characteristics of ROM and electromyography (EMG) at each phase, the side-hop tests were divided into 4 phases: lateral-hop contact phase (LC), lateral-hop flight phase (LF), medial hop contact phase (MC), and medial hop flight phase (MF), and the ROM of ankle inversion/eversion, a peak angle of ankle inversion, and Integral EMG (IEMG) of PL and TA compared among 4 phases. Fifteen male subjects with no symptoms of ankle joint problems participated in this research. The ROM of ankle inversion/eversion during the side-hop test was 27 ± 3.8° (mean ± SD), and there was a significant difference in the ROM of ankle inversion/eversion among 4 phases (p < 0.05). The phase in which the widest ROM was presented was the MF. A peak angle of the ankle inversion at MC was significantly greater than at LC and MF (p <0.05). A peak angle of the ankle inversion at LF was significantly greater than at LC and MF. The PL remained contracting with 50-160% of maximal voluntary contraction (MVC). The IEMGs of PL in both the contact phases were significantly greater than in both the flight phases (p < 0.05). In addition, the PL activity at LC was significantly greater than at MC. The TA remained contracting at 50-80% of MVC through the side-hop test. The IEMG of TA at
He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny
2005-01-01
Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413
Limit Properties of One Dimensional Periodic Hopping Model
NASA Astrophysics Data System (ADS)
Zhang, Yun-xin
2010-02-01
One dimensional periodic hopping model is useful to understand the motion of microscopic particles in thermal noise environment. In this research, by formal calculation and based on detailed balance, the explicit expressions of the limits of mean velocity and diffusion constant of this model as the number of internal mechanochemical sates tend to infinity are obtained. These results will be helpful to understand the limit of the one dimensional hopping model. At the same time, the work can be used to get more useful results in continuous form from the corresponding ones obtained by discrete models.
A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops
ERIC Educational Resources Information Center
Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.
2012-01-01
A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…
Hip-Hop and a Hybrid Text in a Postsecondary English Class
ERIC Educational Resources Information Center
Sanchez, Deborah M.
2010-01-01
This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…
Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously
ERIC Educational Resources Information Center
Price, Robert J., Jr.
2005-01-01
Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…
Unexpectedly Fast Phonon-Assisted Exciton Hopping between Carbon Nanotubes
Davoody, A. H.; Karimi, F.; Arnold, M. S.; ...
2017-06-05
Carbon-nanotube (CNT) aggregates are promising light-absorbing materials for photovoltaics. The hopping rate of excitons between CNTs directly affects the efficiency of these devices. We theoretically investigate phonon-assisted exciton hopping, where excitons scatter with phonons into a same-tube transition state, followed by intertube Coulomb scattering into the final state. Second-order hopping between bright excitonic states is as fast as the first-order process (~1 ps). For perpendicular CNTs, the high rate stems from the high density of phononic states; for parallel CNTs, the reason lies in relaxed selection rules. Moreover, second-order exciton transfer between dark and bright states, facilitated by phonons withmore » large angular momentum, has rates comparable to bright-to-bright transfer, so dark excitons provide an additional pathway for energy transfer in CNT composites. Furthermore, as dark excitons are difficult to probe in experiment, predictive theory is critical for understanding exciton dynamics in CNT composites.« less
Unexpectedly Fast Phonon-Assisted Exciton Hopping between Carbon Nanotubes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davoody, A. H.; Karimi, F.; Arnold, M. S.
Carbon-nanotube (CNT) aggregates are promising light-absorbing materials for photovoltaics. The hopping rate of excitons between CNTs directly affects the efficiency of these devices. We theoretically investigate phonon-assisted exciton hopping, where excitons scatter with phonons into a same-tube transition state, followed by intertube Coulomb scattering into the final state. Second-order hopping between bright excitonic states is as fast as the first-order process (~1 ps). For perpendicular CNTs, the high rate stems from the high density of phononic states; for parallel CNTs, the reason lies in relaxed selection rules. Moreover, second-order exciton transfer between dark and bright states, facilitated by phonons withmore » large angular momentum, has rates comparable to bright-to-bright transfer, so dark excitons provide an additional pathway for energy transfer in CNT composites. Furthermore, as dark excitons are difficult to probe in experiment, predictive theory is critical for understanding exciton dynamics in CNT composites.« less
Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip
Nelson, Gregory M.; Huffman, Holly; Smith, David F.
2003-01-01
Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function. PMID:14627198
Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.
Nelson, Gregory M; Huffman, Holly; Smith, David F
2003-01-01
Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.
Polish Hip Hop as a Form of Multiliteracies and Situated Learning
ERIC Educational Resources Information Center
Torrence, Michael L.
2009-01-01
The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…
A study on a wheel-based stair-climbing robot with a hopping mechanism
NASA Astrophysics Data System (ADS)
Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji
2008-08-01
In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.
Majorana edge States in atomic wires coupled by pair hopping.
Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P
2013-10-25
We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.
van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques
2015-01-01
Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail in yeast where their sequential membrane targeting and assembly is well understood. Mammalian CORVET and HOPS subunits significantly differ from their yeast homologues, and novel proteins with high homology to CORVET/HOPS subunits have evolved. However, an analysis of the molecular interactions between these subunits in mammals is lacking. Here, we provide a detailed analysis of interactions within the mammalian CORVET and HOPS as well as an additional endosomal-targeting complex (VIPAS39-VPS33B) that does not exist in yeast. We show that core interactions within CORVET and HOPS are largely conserved but that the membrane-targeting module in HOPS has significantly changed to accommodate binding to mammalian-specific RAB7 interacting lysosomal protein (RILP). Arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome-associated mutations in VPS33B selectively disrupt recruitment to late endosomes by RILP or binding to its partner VIPAS39. Within the shared core of CORVET/HOPS, we find that VPS11 acts as a molecular switch that binds either CORVET-specific TGFBRAP1 or HOPS-specific VPS39/RILP thereby allowing selective targeting of these tethering complexes to early or late endosomes to time fusion events in the endo/lysosomal pathway. PMID:26463206
No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.
Gibson, W; Campbell, A; Allison, G
2013-09-01
Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Niu, Yuekun; Sun, Jian; Ni, Yu; Song, Yun
2018-06-01
The dynamical mean-field theory is employed to study the orbital-selective Mott transition (OSMT) of the two-orbital Hubbard model with nearest neighbor hopping and next-nearest neighbor (NNN) hopping. The NNN hopping breaks the particle-hole symmetry at half filling and gives rise to an asymmetric density of states (DOS). Our calculations show that the broken symmetry of DOS benefits the OSMT, where the region of the orbital-selective Mott phase significantly extends with the increasing NNN hopping integral. We also find that Hund's rule coupling promotes OSMT by blocking the orbital fluctuations, but the influence of NNN hopping is more remarkable.
Don't Believe the Hype: Hip-Hop Literacies and English Education
ERIC Educational Resources Information Center
Belle, Crystal
2016-01-01
Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…
ERIC Educational Resources Information Center
Piekarski, Bill
2004-01-01
From its humble origins some 30 years ago in New York's bombed-out, poverty-ravaged South Bronx, hip-hop has risen to become a dominant cultural force both here and abroad. Strictly defined, the term refers to the entire cultural constellation that accompanies rap music, which in 2001 surpassed country music as the most popular musical genre in…
High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT).
Howard, E L; Whittock, S P; Jakše, J; Carling, J; Matthews, P D; Probasco, G; Henning, J A; Darby, P; Cerenak, A; Javornik, B; Kilian, A; Koutoulis, A
2011-05-01
Implementation of molecular methods in hop (Humulus lupulus L.) breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. However, use of molecular marker technology is limited due to expense, time inefficiency, laborious methodology and dependence on DNA sequence information. Diversity arrays technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of quality polymorphic markers without reliance on DNA sequence information. This study is the first to utilise DArT for hop genotyping, identifying 730 polymorphic markers from 92 hop accessions. The marker quality was high and similar to the quality of DArT markers previously generated for other species; although percentage polymorphism and polymorphism information content (PIC) were lower than in previous studies deploying other marker systems in hop. Genetic relationships in hop illustrated by DArT in this study coincide with knowledge generated using alternate methods. Several statistical analyses separated the hop accessions into genetically differentiated North American and European groupings, with hybrids between the two groups clearly distinguishable. Levels of genetic diversity were similar in the North American and European groups, but higher in the hybrid group. The markers produced from this time and cost-efficient genotyping tool will be a valuable resource for numerous applications in hop breeding and genetics studies, such as mapping, marker-assisted selection, genetic identity testing, guidance in the maintenance of genetic diversity and the directed breeding of superior cultivars.
Hopping locomotion at different gravity: metabolism and mechanics in humans.
Pavei, Gaspare; Minetti, Alberto E
2016-05-15
Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.
Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures
NASA Astrophysics Data System (ADS)
Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter
2018-05-01
The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.
Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki
2017-01-01
Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop
ERIC Educational Resources Information Center
Roach, Ronald
2004-01-01
As a cultural movement, hip-hop manages to get billed as both a positive and negative influence on young people, especially on Black and Latino youth. On one hand, there are African American activists, artists and entrepreneurs, such as Russell Simmons, who seek to build a progressive political movement among young hip-hop fans and who have had…
Analytical methods for quantitation of prenylated flavonoids from hops.
Nikolić, Dejan; van Breemen, Richard B
2013-01-01
The female flowers of hops ( Humulus lupulus L.) are used as a flavoring agent in the brewing industry. There is growing interest in possible health benefits of hops, particularly as estrogenic and chemopreventive agents. Among the possible active constituents, most of the attention has focused on prenylated flavonoids, which can chemically be classified as prenylated chalcones and prenylated flavanones. Among chalcones, xanthohumol (XN) and desmethylxanthohumol (DMX) have been the most studied, while among flavanones, 8-prenylnaringenin (8-PN) and 6-prenylnaringenin (6-PN) have received the most attention. Because of the interest in medicinal properties of prenylated flavonoids, there is demand for accurate, reproducible and sensitive analytical methods to quantify these compounds in various matrices. Such methods are needed, for example, for quality control and standardization of hop extracts, measurement of the content of prenylated flavonoids in beer, and to determine pharmacokinetic properties of prenylated flavonoids in animals and humans. This review summarizes currently available analytical methods for quantitative analysis of the major prenylated flavonoids, with an emphasis on the LC-MS and LC-MS-MS methods and their recent applications to biomedical research on hops. This review covers all methods in which prenylated flavonoids have been measured, either as the primary analytes or as a part of a larger group of analytes. The review also discusses methodological issues relating to the quantitative analysis of these compounds regardless of the chosen analytical approach.
Buttles, John W [Idaho Falls, ID
2011-12-20
Wireless communication devices include a software-defined radio coupled to processing circuitry. The processing circuitry is configured to execute computer programming code. Storage media is coupled to the processing circuitry and includes computer programming code configured to cause the processing circuitry to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.
Buttles, John W
2013-04-23
Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.
High-Speed Hopping: Time-Resolved Tomographic PIV Measurements of Water Flea Swimming
NASA Astrophysics Data System (ADS)
Murphy, D. W.; Webster, D. R.; Yen, J.
2012-11-01
Daphniids, also known as water fleas, are small, freshwater crustaceans that live in a low-to-intermediate Reynolds number regime. These plankters are equipped with a pair of branched, setae-bearing antennae that they beat to impulsively propel themselves, or ``hop,'' through the water. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. We present time-resolved tomographic PIV measurements of swimming by Daphnia magna. The body kinematics and flow physics of the daphniid hop are quantified. It is shown that the flow generated by each stroking antenna resembles an asymmetric viscous vortex ring. It is proposed that the flow produced by the daphniid hop can be modeled as a double Stokeslet consisting of two impulsively applied point forces separated by the animal width. The flow physics are discussed in the context of other species operating in the same Reynolds number range of 10 to 100: sea butterfly swimming and flight by the smallest flying insects.
You know what it is: learning words through listening to hip-hop.
Chesley, Paula
2011-01-01
Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.
You Know What It Is: Learning Words through Listening to Hip-Hop
Chesley, Paula
2011-01-01
Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations. PMID:22205942
Simulation of Downlink Synchronization for a Frequency-Hopped Satellite Communication System
1992-04-01
naflonie SIMULATION OF DOWNLINK SYNCHRONIZATION FOR A FREQUENCY-HOPPED SATELLITE COMMUNICATION SYSTEM (U) by Lyle Waper_Communicadion and Xa elo Elkaoftron...is offset by an increase in complexity while establishing the communication link, termed synchronization . This document describes a downlink... synchronization process that involves the transmission of synchronization hops by the satellite and a two-step ground terminal synchonization procedure. In
Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience
ERIC Educational Resources Information Center
Wessel, Roger D.; Wallaert, Kerry A.
2011-01-01
This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…
QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)
USDA-ARS?s Scientific Manuscript database
Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...
Electrical transport via variable range hopping in an individual multi-wall carbon nanotube
NASA Astrophysics Data System (ADS)
Husain Khan, Zishan; Husain, M.; Perng, T. P.; Salah, Numan; Habib, Sami
2008-11-01
E-beam lithography is used to make four leads on an individual multi-wall carbon nanotube for carrying out electrical transport measurements. Temperature dependence of conductance of an individual multi-wall carbon nanotube (MWNT) is studied over a temperature range of (297 4.8 K). The results indicate that the conduction is governed by variable range hopping (VRH) for the entire temperature range (297 4.8 K). This VRH mechanism changes from three dimensions (3D) to two dimensions (2D) as we go down to 70 K. Three-dimensional variable range hopping (3D VRH) is responsible for conduction in the temperature range (297 70 K), which changes to two-dimensional VRH for much lower temperatures (70 4.8 K). For 3D VRH, various Mott parameters such as density of states, hopping distance and hopping energy have been calculated. The 2D VRH mechanism has been applied for the temperature range (70 4.8 K) and, with the help of this model, the parameters such as localization length and hopping distance are calculated. All these parameters give interesting information about this complex structure, which may be useful for many applications.
Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy
ERIC Educational Resources Information Center
Cermak, Michael J.
2012-01-01
This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…
Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn
2012-01-01
Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times
First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China
USDA-ARS?s Scientific Manuscript database
Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...
Structure and Charge Hopping Dynamics in Green Rust
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wander, Matthew C; Rosso, Kevin M; Schoonen, Martin A
Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe 2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH) 2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mössbauer spectra show a characteristic signature for intermediate valence on the iron atoms inmore » this sheet, indicative of a Fe 2+-Fe 3+ valence interchange reaction faster than approximately 10 7 s -1. Using Fe(OH) 2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe 3+ hole polarons in this material, providing a first principles assessment of the Fe 2+-Fe 3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6 Å is the fastest. The predicted rate is on the order of 10 12 s -1 consistent the Mössbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 10 7 s -1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe 2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.« less
Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander
2018-03-17
Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.
Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment
ERIC Educational Resources Information Center
Petchauer, Emery
2011-01-01
College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…
Trends in German Hip Hop Music and Its Usefulness for the Classroom
ERIC Educational Resources Information Center
Schmidt, Johannes
2008-01-01
German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…
Nanowire-based thermoelectric ratchet in the hopping regime
NASA Astrophysics Data System (ADS)
Bosisio, Riccardo; Fleury, Geneviève; Pichard, Jean-Louis; Gorini, Cosimo
2016-04-01
We study a thermoelectric ratchet consisting of an array of disordered nanowires arranged in parallel on top of an insulating substrate and contacted asymmetrically to two electrodes. Transport is investigated in the Mott hopping regime, when localized electrons can propagate through the nanowires via thermally assisted hops. When the electronic temperature in the nanowires is different from the phononic one in the substrate, we show that a finite electrical current is generated even in the absence of driving forces between the electrodes. We discuss the device performance both as an energy harvester, when an excess heat from the substrate is converted into useful power, and as a refrigerator, when an external power is supplied to cool down the substrate.
Results of Computing Amplitude and Phase of the VLF Wave Using Wave Hop Theory
NASA Astrophysics Data System (ADS)
Pal, Sujay; Basak, Tamal; Chakrabarti, Sandip K.
2011-07-01
We present the basics of the wave hop theory to compute the amplitude and phase of the VLF signals. We use the Indian Navy VTX transmitter at 18.2 kHz as an example of the source and compute the VLF propagation characteristics for several propagation paths using the wave-hop theory. We find the signal amplitudes as a function of distance from the transmitter using wave hop theory in different bearing angles and compare with the same obtained from the Long Wave Propagation Capability (LWPC) code which uses the mode theory. We repeat a similar exercise for the diurnal and seasonal behavior. We note that the signal variation by wave hop theory gives more detailed information in the day time. We further present the spatial variation of the signal amplitude over whole of India at a given time including the effect of sunrise and sunset terminator and also compare the same with that from the mode theory. We point out that the terminator effect is clearly understood in wave hop results than that from the mode theory.
Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E
2015-08-01
Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.
Frame error rate for single-hop and dual-hop transmissions in 802.15.4 LoWPANs
NASA Astrophysics Data System (ADS)
Biswas, Sankalita; Ghosh, Biswajit; Chandra, Aniruddha; Dhar Roy, Sanjay
2017-08-01
IEEE 802.15.4 is a popular standard for personal area networks used in different low-rate short-range applications. This paper examines the error rate performance of 802.15.4 in fading wireless channel. An analytical model is formulated for evaluating frame error rate (FER); first, for direct single-hop transmission between two sensor nodes, and second, for dual-hop (DH) transmission using an in-between relay node. During modeling the transceiver design parameters are chosen according to the specifications set for both the 2.45 GHz and 868/915 MHz bands. We have also developed a simulation test bed for evaluating FER. Some results showed expected trends, such as FER is higher for larger payloads. Other observations are not that intuitive. It is interesting to note that the error rates are significantly higher for the DH case and demands a signal-to-noise ratio (SNR) penalty of about 7 dB. Also, the FER shoots from zero to one within a very small range of SNR.
Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network
NASA Astrophysics Data System (ADS)
Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen
2018-06-01
We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.
Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network
NASA Astrophysics Data System (ADS)
Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen
2018-02-01
We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.
Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice
ERIC Educational Resources Information Center
Travis, Raphael, Jr.; Deepak, Anne
2011-01-01
Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…
NASA Astrophysics Data System (ADS)
Dimova, Dilyana; Bajorath, Jürgen
2017-07-01
Computational scaffold hopping aims to identify core structure replacements in active compounds. To evaluate scaffold hopping potential from a principal point of view, regardless of the computational methods that are applied, a global analysis of conventional scaffolds in analog series from compound activity classes was carried out. The majority of analog series was found to contain multiple scaffolds, thus enabling the detection of intra-series scaffold hops among closely related compounds. More than 1000 activity classes were found to contain increasing proportions of multi-scaffold analog series. Thus, using such activity classes for scaffold hopping analysis is likely to overestimate the scaffold hopping (core structure replacement) potential of computational methods, due to an abundance of artificial scaffold hops that are possible within analog series.
Metal-insulator transition in a doubly orbitally degenerate model with correlated hopping
NASA Astrophysics Data System (ADS)
Didukh, L.; Skorenkyy, Yu.; Dovhopyaty, Yu.; Hankevych, V.
2000-03-01
In the present paper, we propose a doubly orbitally degenerate narrow-band model with correlated hopping. The peculiarity of the model is taking into account the matrix element of electron-electron interaction, which describes intersite hoppings of electrons. In particular, this leads to the concentration dependence of the effective hopping integral. The cases of the strong and weak Hund's coupling are considered. By means of a generalized mean-field approximation the single-particle Green function and quasiparticle energy spectrum are calculated. Metal-insulator transition is studied in the model at different integer values of the electron concentration. With the help of the obtained energy spectrum, we find energy gap width and criteria of metal-insulator transition.
HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis.
Kang, Yongsung; Jelenska, Joanna; Cecchini, Nicolas M; Li, Yujie; Lee, Min Woo; Kovar, David R; Greenberg, Jean T
2014-06-01
A central mechanism of virulence of extracellular bacterial pathogens is the injection into host cells of effector proteins that modify host cellular functions. HopW1 is an effector injected by the type III secretion system that increases the growth of the plant pathogen Pseudomonas syringae on the Columbia accession of Arabidopsis. When delivered by P. syringae into plant cells, HopW1 causes a reduction in the filamentous actin (F-actin) network and the inhibition of endocytosis, a known actin-dependent process. When directly produced in plants, HopW1 forms complexes with actin, disrupts the actin cytoskeleton and inhibits endocytosis as well as the trafficking of certain proteins to vacuoles. The C-terminal region of HopW1 can reduce the length of actin filaments and therefore solubilize F-actin in vitro. Thus, HopW1 acts by disrupting the actin cytoskeleton and the cell biological processes that depend on actin, which in turn are needed for restricting P. syringae growth in Arabidopsis.
Ho, Ruoya; Stroupe, Christopher
2016-10-01
Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biddle, J.; Priour, D. J. Jr.; Wang, B.
We study the quantum localization phenomena of noninteracting particles in one-dimensional lattices based on tight-binding models with various forms of hopping terms beyond the nearest neighbor, which are generalizations of the famous Aubry-Andre and noninteracting Anderson models. For the case with deterministic disordered potential induced by a secondary incommensurate lattice (i.e., the Aubry-Andre model), we identify a class of self-dual models, for which the boundary between localized and extended eigenstates are determined analytically by employing a generalized Aubry-Andre transformation. We also numerically investigate the localization properties of nondual models with next-nearest-neighbor hopping, Gaussian, and power-law decay hopping terms. We findmore » that even for these nondual models, the numerically obtained mobility edges can be well approximated by the analytically obtained condition for localization transition in the self-dual models, as long as the decay of the hopping rate with respect to distance is sufficiently fast. For the disordered potential with genuinely random character, we examine scenarios with next-nearest-neighbor hopping, exponential, Gaussian, and power-law decay hopping terms numerically. We find that the higher-order hopping terms can remove the symmetry in the localization length about the energy band center compared to the Anderson model. Furthermore, our results demonstrate that for the power-law decay case, there exists a critical exponent below which mobility edges can be found. Our theoretical results could, in principle, be directly tested in shallow atomic optical lattice systems enabling non-nearest-neighbor hopping.« less
The Philippine "Hip Hop Stick Dance"
ERIC Educational Resources Information Center
Lewis, Lisa
2012-01-01
This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…
Steenackers, Bart; De Cooman, Luc; De Vos, Dirk
2015-04-01
The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.
Generalized trajectory surface-hopping method for internal conversion and intersystem crossing
NASA Astrophysics Data System (ADS)
Cui, Ganglong; Thiel, Walter
2014-09-01
Trajectory-based fewest-switches surface-hopping (FSSH) dynamics simulations have become a popular and reliable theoretical tool to simulate nonadiabatic photophysical and photochemical processes. Most available FSSH methods model internal conversion. We present a generalized trajectory surface-hopping (GTSH) method for simulating both internal conversion and intersystem crossing processes on an equal footing. We consider hops between adiabatic eigenstates of the non-relativistic electronic Hamiltonian (pure spin states), which is appropriate for sufficiently small spin-orbit coupling. This choice allows us to make maximum use of existing electronic structure programs and to minimize the changes to available implementations of the traditional FSSH method. The GTSH method is formulated within the quantum mechanics (QM)/molecular mechanics framework, but can of course also be applied at the pure QM level. The algorithm implemented in the GTSH code is specified step by step. As an initial GTSH application, we report simulations of the nonadiabatic processes in the lowest four electronic states (S0, S1, T1, and T2) of acrolein both in vacuo and in acetonitrile solution, in which the acrolein molecule is treated at the ab initio complete-active-space self-consistent-field level. These dynamics simulations provide detailed mechanistic insight by identifying and characterizing two nonadiabatic routes to the lowest triplet state, namely, direct S1 → T1 hopping as major pathway and sequential S1 → T2 → T1 hopping as minor pathway, with the T2 state acting as a relay state. They illustrate the potential of the GTSH approach to explore photoinduced processes in complex systems, in which intersystem crossing plays an important role.
MLF1 is a proapoptotic antagonist of HOP complex-mediated survival.
Sun, Yi; Chao, Jyh-Rong; Xu, Wu; Pourpak, Alan; Boyd, Kelli; Moshiach, Simon; Qi, Guo-Yan; Fu, Amina; Shao, Hua-Rong; Pounds, Stanley; Morris, Stephan W
2017-04-01
In the HAX1/HtrA2-OMI/PARL (HOP) mitochondrial protein complex, anti-apoptotic signals are generated by cleavage and activation of the serine protease HtrA2/OMI by the rhomboid protease PARL upon recruitment of both proteases to inner mitochondrial membrane protein HAX1 (HS1-associated protein X-1). Here we report the negative regulation of the HOP complex by human leukemia-associated myeloid leukemia factor 1 (MLF1). We demonstrate that MLF1 physically and functionally associates with HAX1 and HtrA2. Increased interaction of MLF1 with HAX1 and HtrA2 displaces HtrA2 from the HOP complex and inhibits HtrA2 cleavage and activation, resulting in the apoptotic cell death. Conversely, over-expressed HAX1 neutralizes MLF1's effect and inhibits MLF1-induced apoptosis. Importantly, Mlf1 deletion reverses B- and T-cell lymphopenia and significantly ameliorates the progressive striatal and cerebellar neurodegeneration observed in Hax1 -/- mice, with a doubling of the lifespan of Mlf1 -/- /Hax1 -/- animals compared to Hax1 -/- animals. Collectively, these data indicate that MLF1 serves as a proapoptotic antagonist that interacts with the HOP mitochondrial complex to modulate cell survival. Copyright © 2017 Elsevier B.V. All rights reserved.
Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay.
Zhong, Xuefeng; Chen, Fangjiong; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua
2018-01-16
Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter-receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter-receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity.
Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay
Zhong, Xuefeng; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua
2018-01-01
Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter–receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter–receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity. PMID:29337911
Lamm, Christian E.; Kraner, Max. E.; Hofmann, Jörg; Börnke, Frederik; Mock, Hans-Peter; Sonnewald, Uwe
2017-01-01
Perception of pathogens by host pattern recognition receptors (PRRs) or R proteins is a prerequisite to promote successful immune responses. The Hsp70/Hsp90 organizing protein Hop/Sti1, a multifunctional cochaperone, has been implicated in the maturation of a receptor-like kinase (RLK) necessary for chitin sensing. However, it remains unknown whether Hop/Sti1 is generally participating in PRR genesis. Using RNA-interference (RNAi), we silenced Hop/Sti1 expression in Nicotiana tabacum to gain further insight into the role of the cochaperone in plant defense responses. As expected, transgenic plants do not respond to chitin treatment anymore. In contrast to this, trafficking and functionality of the flagellin PRR FLS2 were unaltered, suggesting a selective involvement of Hop/Sti1 during PRR maturation. Furthermore, Hop/Sti1 was identified as a cellular determinant of Potato virus Y (PVY) symptom development in tobacco, since PVY was able to accumulate to near wild-type level without provoking the usual veinal necrosis phenotype. In addition, typical antiviral host defense responses were suppressed in the transgenic plants. These data suggest that perception of PVY is dependent on Hop/Sti1-mediated receptor maturation, while viral symptoms represent a failing attempt to restrict PVY spread. In addition, Hop/Sti1 colocalized with virus-induced membrane aggregates in wild-type plants. The retention of Hop/Sti1 in potential viral replication complexes suggests a role during viral translation/replication, explaining why RNAi-lines do not exhibit increased susceptibility to PVY. This study provides evidence for a dual role of Hop/Sti1 in PRR maturation and pathogen perception as well as in promoting viral proliferation. PMID:29075278
Dumas, Elizabeth R; Michaud, Amy E; Bergeron, Chantal; Lafrance, Jennifer L; Mortillo, Susan; Gafner, Stefan
2009-09-01
There is little scientific evidence to support the efficacy of natural deodorants and therefore, such products may be perceived as inefficacious. The evaluation of the in vitro antibacterial activity of a hop extract and the evaluation of the odor-reducing capacity of a hops/zinc ricinoleate-containing product by a sensory evaluation panel is employed to verify deodorant performance. The goal of this study was to evaluate the in vitro antibacterial activity of a hop extract against Corynebacterium xerosis and Staphylococcus epidermidis and to verify in vivo deodorant performance of a hops/zinc ricinoleate-containing product. The hops extract was evaluated on a culture of an armpit swab from six volunteers. Furthermore, the extract was submitted to a zone of inhibition test and an agar-dilution assay against two major odor-causing bacteria. The clinical evaluation of the finished product was carried out according to a standard method for substantiating deodorant efficacy using trained odor judges for the assessment of axillary malodor (ASTM method E 1207-87 Standard Practice for the Sensory Evaluation of Axillary Deodorancy). The supercritical hops extract showed good antibacterial activities in all three tests. Minimum inhibitory concentration values of 6.25 and 25 mug/mL against C. xerosis and S. aureus, respectively, were obtained in the agar-dilution assay. In the clinical underarm odor-reduction evaluation, the mean malodor score dropped from 6.28 (+/-0.70) to 1.80 (+/-0.71) after 8 h of application. There was still a noticeable effect at both 12 and 24 h after the application, with a score of 1.82 (+/-0.74) and 2.24 (+/-0.77), respectively. The hops extract has good in vitro antibacterial properties and, in combination with zinc ricinoleate in an appropriate base, delivers in vivo odor reduction. The clinical efficacy is likely due to a combination of the base ingredients and the antibacterial actives.
Granata, K P; Padua, D A; Wilson, S E
2002-04-01
Leg stiffness was compared between age-matched males and females during hopping at preferred and controlled frequencies. Stiffness was defined as the linear regression slope between the vertical center of mass (COM) displacement and ground-reaction forces recorded from a force plate during the stance phase of the hopping task. Results demonstrate that subjects modulated the vertical displacement of the COM during ground contact in relation to the square of hopping frequency. This supports the accuracy of the spring-mass oscillator as a representative model of hopping. It also maintained peak vertical ground-reaction load at approximately three times body weight. Leg stiffness values in males (33.9+/-8.7 kN/m) were significantly (p<0.01) greater than in females (26.3+/-6.5 kN/m) at each of three hopping frequencies, 3.0, 2.5 Hz, and a preferred hopping rate. In the spring-mass oscillator model leg stiffness and body mass are related to the frequency of motion. Thus male subjects necessarily recruited greater leg stiffness to drive their heavier body mass at the same frequency as the lighter female subjects during the controlled frequency trials. However, in the preferred hopping condition the stiffness was not constrained by the task because frequency was self-selected. Nonetheless, both male and female subjects hopped at statistically similar preferred frequencies (2.34+/-0.22 Hz), therefore, the females continued to demonstrate less leg stiffness. Recognizing the active muscle stiffness contributes to biomechanical stability as well as leg stiffness, these results may provide insight into the gender bias in risk of musculoskeletal knee injury.
Condom use and hip hop culture: the case of urban young men in New York City.
Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G
2008-06-01
We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.
Use of the Homeland-Defense Operational Planning System (HOPS) for Emergency Management
DOE Office of Scientific and Technical Information (OSTI.GOV)
Durling, Jr., R L; Price, D E
2005-12-16
The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors,more » HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.« less
Hopping Conduction in Polymers
NASA Astrophysics Data System (ADS)
Bässler, Heinz
The concept of hopping within a Gaussian density of localized states introduced earlier to rationalize charge transport in random organic photoconductors is developed further to account for temporal features of time of flight (TOF) signals. At moderate degree of energetic disorder (σ/kT~3.5…4.5) there is a transport regime intermediate between dispersive and quasi-Gaussian type whose signatures are (i) universal TOF signals that can appear weakly dispersive despite yielding a well defined carrier mobility and (ii) an asymmetric propagator of the carrier packet yielding a time dependent diffusivity.
NASA Technical Reports Server (NTRS)
Beyon, Jeffrey Y.; Ng, Tak-Kwong; Davis, Mitchell J.; Adams, James K.; Bowen, Stephen C.; Fay, James J.; Hutchinson, Mark A.
2015-01-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program since April, 2012. The HOPS team recently completed two flight campaigns during the summer of 2014 on two different aircrafts with two different science instruments. The first flight campaign was in July, 2014 based at NASA Langley Research Center (LaRC) in Hampton, VA on the NASA's HU-25 aircraft. The science instrument that flew with HOPS was Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) CarbonHawk Experiment Simulator (ACES) funded by NASA's Instrument Incubator Program (IIP). The second campaign was in August, 2014 based at NASA Armstrong Flight Research Center (AFRC) in Palmdale, CA on the NASA's DC-8 aircraft. HOPS flew with the Multifunctional Fiber Laser Lidar (MFLL) instrument developed by Excelis Inc. The goal of the campaigns was to perform an end-to-end demonstration of the capabilities of the HOPS prototype system (HOPS COTS) while running the most computationally intensive part of the ASCENDS algorithm real-time on-board. The comparison of the two flight campaigns and the results of the functionality tests of the HOPS COTS are presented in this paper.
Experiments in balance with a 2D one-legged hopping machine
NASA Astrophysics Data System (ADS)
Raibert, M. H.; Brown, H. B., Jr.
1984-03-01
The ability to balance is important to the mobility obtained by legged creatures found in nature, and may someday lead to versatile legged vehicles. In order to study the role of balance in legged locomotion and to develop appropriate control strategies, a 2D hopping machine was constructed for experimentation. The machine has one leg on which it hops and runs, making balance a prime consideration. Control of the machine's locomotion was decomposed into three separate parts: a vertical height control part, a horizontal velocity part, and an angular attitude control part. Experiments showed that the three part control scheme, while very simple to implement, was powerful enough to permit the machine to hop in place, to run at a desired rate, to translate from place to place, and to leap over obstacles. Results from modeling and computer simulation of a similar one-legged device are described by Raibert (1983).
Assessing hopping developmental level in childhood using wearable inertial sensor devices.
Masci, Ilaria; Vannozzi, Giuseppe; Getchell, Nancy; Cappozzo, Aurelio
2012-07-01
Assessing movement skills is a fundamental issue in motor development. Current process-oriented assessments, such as developmental sequences, are based on subjective judgments; if paired with quantitative assessments, a better understanding of movement performance and developmental change could be obtained. Our purpose was to examine the use of inertial sensors to evaluate developmental differences in hopping over distance. Forty children executed the task wearing the inertial sensor and relevant time durations and 3D accelerations were obtained. Subjects were also categorized in different developmental levels according to the hopping developmental sequence. Results indicated that some time and kinematic parameters changed with some developmental levels, possibly as a function of anthropometry and previous motor experience. We concluded that, since inertial sensors were suitable in describing hopping performance and sensitive to developmental changes, this technology is promising as an in-field and user-independent motor development assessment tool.
Representin': Drawing from Hip-Hop and Urban Youth Culture to Inform Teacher Education
ERIC Educational Resources Information Center
Irizarry, Jason G.
2009-01-01
The potential of drawing from urban youth culture, and hip-hop more specifically, to serve as a bridge to the standard curriculum has been well documented. However, the richness and potential benefits of hip-hop are more far-reaching and present significant implications for teacher education and professional development efforts as well. This…
Distributed Detection with Collisions in a Random, Single-Hop Wireless Sensor Network
2013-05-26
public release; distribution is unlimited. Distributed detection with collisions in a random, single-hop wireless sensor network The views, opinions...1274 2 ABSTRACT Distributed detection with collisions in a random, single-hop wireless sensor network Report Title We consider the problem of... WIRELESS SENSOR NETWORK Gene T. Whipps?† Emre Ertin† Randolph L. Moses† ?U.S. Army Research Laboratory, Adelphi, MD 20783 †The Ohio State University
Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.
2009-01-01
Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557
Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.
2013-01-01
Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484
2016-12-15
This graphic shows a theoretical path of a water molecule on Ceres. Some water molecules fall into cold, dark craters at high latitudes called "cold traps," where very little of the ice turns into vapor, even over the course of a billion years. Other water molecules that do not land in cold traps are lost to space as they hop around the dwarf planet. http://photojournal.jpl.nasa.gov/catalog/PIA21083
ERIC Educational Resources Information Center
Love, Bettina L.
2016-01-01
Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…
Hopping and the Stokes-Einstein relation breakdown in simple glass formers.
Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco
2014-10-21
One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition--like that of other statistical systems--is exact when the spatial dimension d → ∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions,d = 2, 3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes-Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses.
Hopping and the Stokes–Einstein relation breakdown in simple glass formers
Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco
2014-01-01
One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition—like that of other statistical systems—is exact when the spatial dimension d→∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions, d=2,3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes–Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses. PMID:25288722
Lürick, Anna; Kuhlee, Anne; Bröcker, Cornelia; Kümmel, Daniel; Raunser, Stefan; Ungermann, Christian
2015-01-01
Membrane fusion at vacuoles requires a consecutive action of the HOPS tethering complex, which is recruited by the Rab GTPase Ypt7, and vacuolar SNAREs to drive membrane fusion. It is assumed that the Sec1/Munc18-like Vps33 within the HOPS complex is largely responsible for SNARE chaperoning. Here, we present direct evidence for HOPS binding to SNAREs and the Habc domain of the Vam3 SNARE protein, which may explain its function during fusion. We show that HOPS interacts strongly with the Vam3 Habc domain, assembled Q-SNAREs, and the R-SNARE Ykt6, but not the Q-SNARE Vti1 or the Vam3 SNARE domain. Electron microscopy combined with Nanogold labeling reveals that the binding sites for vacuolar SNAREs and the Habc domain are located in the large head of the HOPS complex, where Vps16 and Vps33 have been identified before. Competition experiments suggest that HOPS bound to the Habc domain can still interact with assembled Q-SNAREs, whereas Q-SNARE binding prevents recognition of the Habc domain. In agreement, membranes carrying Vam3ΔHabc fuse poorly unless an excess of HOPS is provided. These data suggest that the Habc domain of Vam3 facilitates the assembly of the HOPS/SNARE machinery at fusion sites and thus supports efficient membrane fusion. PMID:25564619
Long-Term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice
Sasaoka, Norio; Sakamoto, Megumi; Kanemori, Shoko; Kan, Michiru; Tsukano, Chihiro; Takemoto, Yoshiji; Kakizuka, Akira
2014-01-01
Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD) is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the “amyloid hypothesis” has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein), by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the “amyloid hypothesis”, we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy) in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the “amyloid hypothesis”, and indicate that Hop extract is a promising candidate for an effective prophylactic for AD. PMID:24489866
We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education
ERIC Educational Resources Information Center
Dando, Michael
2017-01-01
Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2014 CFR
2014-04-01
... following processes: (1) The additive is manufactured from a hexane extract of hops by simultaneous... approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide diluted to 500 milliliters... fractionations, using methylene chloride, hexane, and methyl alcohol as solvents, followed by isomerization by...
Epigenetic changes detected in micropropagated hop plants.
Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles
2009-07-01
Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.
USDA-ARS?s Scientific Manuscript database
Increasing labor costs and reduced labor pools for hop production have resulted in the necessity to develop strategies to improve efficiency and automate hop production and harvest. One solution for reducing labor inputs is the use and production of “low-trellis” hop varieties optimized for mechani...
Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education
ERIC Educational Resources Information Center
Petchauer, Emery
2010-01-01
Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…
Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao
2017-10-24
The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.
Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City
Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.
2008-01-01
Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799
HARE: Supporting Efficient Uplink Multi-Hop Communications in Self-Organizing LPWANs.
Adame Vázquez, Toni; Barrachina-Muñoz, Sergio; Bellalta, Boris; Bel, Albert
2018-01-03
The emergence of low-power wide area networks (LPWANs) as a new agent in the Internet of Things (IoT) will result in the incorporation into the digital world of low-automated processes from a wide variety of sectors. The single-hop conception of typical LPWAN deployments, though simple and robust, overlooks the self-organization capabilities of network devices, suffers from lack of scalability in crowded scenarios, and pays little attention to energy consumption. Aimed to take the most out of devices' capabilities, the HARE protocol stack is proposed in this paper as a new LPWAN technology flexible enough to adopt uplink multi-hop communications when proving energetically more efficient. In this way, results from a real testbed show energy savings of up to 15% when using a multi-hop approach while keeping the same network reliability. System's self-organizing capability and resilience have been also validated after performing numerous iterations of the association mechanism and deliberately switching off network devices.
Study of hopping type conduction from AC conductivity in multiferroic composite
NASA Astrophysics Data System (ADS)
Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan
2018-05-01
0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).
HARE: Supporting Efficient Uplink Multi-Hop Communications in Self-Organizing LPWANs
Barrachina-Muñoz, Sergio; Bellalta, Boris
2018-01-01
The emergence of low-power wide area networks (LPWANs) as a new agent in the Internet of Things (IoT) will result in the incorporation into the digital world of low-automated processes from a wide variety of sectors. The single-hop conception of typical LPWAN deployments, though simple and robust, overlooks the self-organization capabilities of network devices, suffers from lack of scalability in crowded scenarios, and pays little attention to energy consumption. Aimed to take the most out of devices’ capabilities, the HARE protocol stack is proposed in this paper as a new LPWAN technology flexible enough to adopt uplink multi-hop communications when proving energetically more efficient. In this way, results from a real testbed show energy savings of up to 15% when using a multi-hop approach while keeping the same network reliability. System’s self-organizing capability and resilience have been also validated after performing numerous iterations of the association mechanism and deliberately switching off network devices. PMID:29301351
Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen
2015-07-01
Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.
Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc
2010-01-01
The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041
Examining Hip-Hop as Culturally Relevant Pedagogy
ERIC Educational Resources Information Center
Kim, Jung; Pulido, Isaura
2015-01-01
Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…
The small GTPase Arl8b regulates assembly of the mammalian HOPS complex on lysosomes
Khatter, Divya; Raina, Vivek B.; Dwivedi, Devashish; Sindhwani, Aastha; Bahl, Surbhi; Sharma, Mahak
2015-01-01
The homotypic fusion and protein sorting (HOPS) complex is a multi-subunit complex conserved from yeast to mammals that regulates late endosome and lysosome fusion. However, little is known about how the HOPS complex is recruited to lysosomes in mammalian cells. Here, we report that the small GTPase Arl8b, but not Rab7 (also known as RAB7A), is essential for membrane localization of the human (h)Vps41 subunit of the HOPS complex. Assembly of the core HOPS subunits to Arl8b- and hVps41-positive lysosomes is guided by their subunit–subunit interactions. RNA interference (RNAi)-mediated depletion of hVps41 resulted in the impaired degradation of EGFR that was rescued upon expression of wild-type but not an Arl8b-binding-defective mutant of hVps41, suggesting that Arl8b-dependent lysosomal localization of hVps41 is required for its endocytic function. Furthermore, we have also identified that the Arl8b effector SKIP (also known as PLEKHM2) interacts with and recruits HOPS subunits to Arl8b and kinesin-positive peripheral lysosomes. Accordingly, RNAi-mediated depletion of SKIP impaired lysosomal trafficking and degradation of EGFR. These findings reveal that Arl8b regulates the association of the human HOPS complex with lysosomal membranes, which is crucial for the function of this tethering complex in endocytic degradation. PMID:25908847
Towards an Efficient Flooding Scheme Exploiting 2-Hop Backward Information in MANETs
NASA Astrophysics Data System (ADS)
Le, Trong Duc; Choo, Hyunseung
Flooding is an indispensable operation for providing control or routing functionalities to mobile ad hoc networks (MANETs). Previously, many flooding schemes have been studied with the intention of curtailing the problems of severe redundancies, contention, and collisions in traditional implementations. A recent approach with relatively high efficiency is 1HI by Liu et al., which uses only 1-hop neighbor information. The scheme achieves local optimality in terms of the number of retransmission nodes with time complexity &Theta(n log n), where n is the number of neighbors of a node; however, this method tends to make many redundant transmissions. In this paper, we present a novel flooding algorithm, 2HBI (2-hop backward information), that efficiently reduces the number of retransmission nodes and solves the broadcast storm problem in ad hoc networks using our proposed concept, “2-hop backward information.” The most significant feature of the proposed algorithm is that it does not require any extra communication overhead other than the exchange of 1-hop HELLO messages but maintains high deliverability. Comprehensive computer simulations show that the proposed scheme significantly reduces redundant transmissions in 1HI and in pure flooding, up to 38% and 91%, respectively; accordingly it alleviates contention and collisions in networks.
Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function
NASA Astrophysics Data System (ADS)
Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.
2018-04-01
Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.
O'Connor, Annalouise; Konda, Veera; Reed, Ralph L; Christensen, J Mark; Stevens, Jan F; Contractor, Nikhat
2018-03-01
Xanthohumol (XN), a prenylated flavonoid found in hops, exhibits anti-inflammatory and antioxidant properties. However, poor bioavailability may limit therapeutic applications. As food components are known to modulate polyphenol absorption, the objective is to determine whether a protein matrix could enhance the bioavailability of XN post oral consumption in humans. This is a randomized, double-blind, crossover study in healthy participants (n = 6) evaluating XN and its major metabolites (isoxanthohumol [IX], 6- and 8-prenylnaringenin [6-PN, 8-PN]) for 6 h following consumption of 12.4 mg of XN delivered via a spent hops-rice protein matrix preparation or a control spent hops preparation. Plasma XN and metabolites are measured by LC-MS/MS. C max , T max , and area-under-the-curve (AUC) values were determined. Circulating XN and metabolite response to each treatment was not bioequivalent. Plasma concentrations of XN and XN + metabolites (AUC) are greater with consumption of the spent hops-rice protein matrix preparation. Compared to a standard spent hops powder, a protein-rich spent hops matrix demonstrates enhanced plasma levels of XN and metabolites following acute oral intake. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lateral hopping of CO molecules on Pt(111) surface by femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Hayashi, M.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.; Ueba, H.
2009-12-01
Theory of heat transfer between adsorbate vibrational degrees of freedom and ultrafast laser heated hot electrons including vibrational intermode coupling is applied to calculate two-pulse correlation, laser fluence dependence and time dependence of lateral hopping of CO molecules from a step to terrace site on a stepped Pt (111) surface. The intermode coupling is a key ingredient to describe vibrational heating of the frustrated translation mode responsible for the CO hopping. The calculated results are in good agreement with the experimental results, especially if we scale down the experimentally determined absorbed fluence. It is found that CO hopping is induced by indirect heating of the FT mode by the FR mode with a strong frictional coupling to hot electrons.
Adaptations in single-leg hop biomechanics following anterior cruciate ligament reconstruction.
Orishimo, Karl F; Kremenic, Ian J; Mullaney, Michael J; McHugh, Malachy P; Nicholas, Stephen J
2010-11-01
When a patient performs a clinically normal hop test based on distance, it cannot be assumed that the biomechanics are similar between limbs. The objective was to compare takeoff and landing biomechanics between legs in patients who have undergone anterior cruciate ligament reconstruction. Kinematics and ground reaction forces were recorded as 13 patients performed the single-leg hop on each leg. Distance hopped, joint range of motion, peak joint kinetics and the peak total extensor moment were compared between legs during both takeoff and landing. Average hop distance ratio (involved/noninvolved) was 93 ± 4%. Compared to the noninvolved side, knee motion during takeoff on the involved side was significantly reduced (P = 0.008). Peak moments and powers on the involved side were lower at the knee and higher at the ankle and hip compared with the noninvolved side (Side by Joint P = 0.011; P = 0.003, respectively). The peak total extensor moment was not different between legs (P = 0.305) despite a decrease in knee moment and increases in ankle and hip moments (Side by Joint P = 0.015). During landing, knee motion was reduced (P = 0.043), and peak power absorbed was decreased at the knee and hip and increased at the ankle on the involved side compared to the noninvolved side (P = 0.003). The compensations by other joints may indicate protective adaptations to avoid overloading the reconstructed knee.
Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.
Lawson, Carl J
2015-12-01
The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.
Polaron hopping in olivine phosphates studied by nuclear resonant scattering
NASA Astrophysics Data System (ADS)
Tracy, Sally June
Valence fluctuations of Fe2+ and Fe3+ were studied in a solid solution of LixFePO4 by nuclear resonant forward scattering of synchrotron x rays while the sample was heated in a diamond-anvil pressure cell. The spectra acquired at different temperatures and pressures were analyzed for the frequencies of valence changes using the Blume-Tjon model of a system with a fluctuating Hamiltonian. These frequencies were analyzed to obtain activation energies and an activation volume for polaron hopping. There was a large suppression of hopping frequency with pressure, giving an anomalously large activation volume. This large, positive value is typical of ion diffusion, which indicates correlated motions of polarons, and Li+ ions that alter the dynamics of both. In a parallel study of NaxFePO4, the interplay between sodium ordering and electron mobility was investigated using a combination of synchrotron x-ray diffraction and nuclear resonant scattering. Conventional Mossbauer spectra were collected while the sample was heated in a resistive furnace. An analysis of the temperature evolution of the spectral shapes was used to identify the onset of fast electron hopping and determine the polaron hopping rate. Synchrotron x-ray diffraction measurements were carried out in the same temperature range. Reitveld analysis of the diffraction patterns was used to determine the temperature of sodium redistribution on the lattice. The diffraction analysis also provides new information about the phase stability of the system. The temperature evolution of the iron site occupancies from the Mossbauer measurements, combined with the synchrotron diffraction results give strong evidence for a relationship between the onset of fast electron dynamics and the redistribution of sodium in the lattice. Measurements of activation barriers for polaron hopping gave fundamental insights about the correlation between electronic carriers and mobile ions. This work established that polaron-ion interactions
Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L
2018-03-30
Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.
Force feedback effects on single molecule hopping and pulling experiments
NASA Astrophysics Data System (ADS)
Rico-Pasto, M.; Pastor, I.; Ritort, F.
2018-03-01
Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.
Force feedback effects on single molecule hopping and pulling experiments.
Rico-Pasto, M; Pastor, I; Ritort, F
2018-03-28
Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.
Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop
ERIC Educational Resources Information Center
Irby, Decoteau J.; Petchauer, Emery; Kirkland, David
2013-01-01
Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…
Human hopping on damped surfaces: strategies for adjusting leg mechanics.
Moritz, Chet T; Farley, Claire T
2003-08-22
Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.
ERIC Educational Resources Information Center
Hill, Marc Lamont
2009-01-01
This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…
Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems
NASA Astrophysics Data System (ADS)
Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen
2002-09-01
Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.
The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers
NASA Astrophysics Data System (ADS)
Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong
2013-06-01
The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.
Multimodal Hip Hop Productions as Media Literacies
ERIC Educational Resources Information Center
Turner, K. C. Nat
2012-01-01
This study draws on ethnographic data from a year-long multimodal media production (MMP) course and the experience of an African American female adolescent who used the production of multimodal Hip Hop texts to express her creativity and growing socially conscious view of the world. The study demonstrates how students made meaning multimodally and…
Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States
NASA Astrophysics Data System (ADS)
Mendels, Dan; Organic Electronics Group Technion Team
2014-03-01
An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.
Generalized trajectory surface hopping method based on the Zhu-Nakamura theory
NASA Astrophysics Data System (ADS)
Oloyede, Ponmile; Mil'nikov, Gennady; Nakamura, Hiroki
2006-04-01
We present a generalized formulation of the trajectory surface hopping method applicable to a general multidimensional system. The method is based on the Zhu-Nakamura theory of a nonadiabatic transition and therefore includes the treatment of classically forbidden hops. The method uses a generalized recipe for the conservation of angular momentum after forbidden hops and an approximation for determining a nonadiabatic transition direction which is crucial when the coupling vector is unavailable. This method also eliminates the need for a rigorous location of the seam surface, thereby ensuring its applicability to a wide class of chemical systems. In a test calculation, we implement the method for the DH2+ system, and it shows a remarkable agreement with the previous results of C. Zhu, H. Kamisaka, and H. Nakamura, [J. Chem. Phys. 116, 3234 (2002)]. We then apply it to a diatomic-in-molecule model system with a conical intersection, and the results compare well with exact quantum calculations. The successful application to the conical intersection system confirms the possibility of directly extending the present method to an arbitrary potential of general topology.
Anti-jamming communication for body area network using chaotic frequency hopping.
Gopalakrishnan, Balamurugan; Bhagyaveni, Marcharla Anjaneyulu
2017-12-01
The healthcare industries research trends focus on patient reliable communication and security is a paramount requirement of healthcare applications. Jamming in wireless communication medium has become a major research issue due to the ease of blocking communication in wireless networks and throughput degradation. The most commonly used technique to overcome jamming is frequency hopping (FH). However, in traditional FH pre-sharing of key for channel selection and a high-throughput overhead is required. So to overcome this pre-sharing of key and to increase the security chaotic frequency hopping (CFH) has been proposed. The design of chaos-based hop selection is a new development that offers improved performance in transmission of information without pre-shared key and also increases the security. The authors analysed the performance of proposed CFH system under different reactive jamming durations. The percentage of error reduction by the reactive jamming for jamming duration 0.01 and 0.05 s for FH and CFH is 55.03 and 84.24%, respectively. The obtained result shows that CFH is more secure and difficult to jam by the reactive jammer.
ERIC Educational Resources Information Center
Craig, Todd
2015-01-01
Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…
Chicano Hip-Hop as Interethnic Contact Zone
ERIC Educational Resources Information Center
McFarland, Pancho
2008-01-01
Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…
Parallel Monotonic Basin Hopping for Low Thrust Trajectory Optimization
NASA Technical Reports Server (NTRS)
McCarty, Steven L.; McGuire, Melissa L.
2018-01-01
Monotonic Basin Hopping has been shown to be an effective method of solving low thrust trajectory optimization problems. This paper outlines an extension to the common serial implementation by parallelizing it over any number of available compute cores. The Parallel Monotonic Basin Hopping algorithm described herein is shown to be an effective way to more quickly locate feasible solutions, and improve locally optimal solutions in an automated way without requiring a feasible initial guess. The increased speed achieved through parallelization enables the algorithm to be applied to more complex problems that would otherwise be impractical for a serial implementation. Low thrust cislunar transfers and a hybrid Mars example case demonstrate the effectiveness of the algorithm. Finally, a preliminary scaling study quantifies the expected decrease in solve time compared to a serial implementation.,
Performance of cellular frequency-hopped spread-spectrum radio networks
NASA Astrophysics Data System (ADS)
Gluck, Jeffrey W.; Geraniotis, Evaggelos
1989-10-01
Multiple access interference is characterized for cellular mobile networks, in which users are assumed to be Poisson-distributed in the plane and employ frequency-hopped spread-spectrum signaling with transmitter-oriented assignment of frequency-hopping patterns. Exact expressions for the bit error probabilities are derived for binary coherently demodulated systems without coding. Approximations for the packet error probability are derived for coherent and noncoherent systems and these approximations are applied when forward-error-control coding is employed. In all cases, the effects of varying interference power are accurately taken into account according to some propagation law. Numerical results are given in terms of bit error probability for the exact case and throughput for the approximate analyses. Comparisons are made with previously derived bounds and it is shown that these tend to be very pessimistic.
Locomotion in Extinct Giant Kangaroos: Were Sthenurines Hop-Less Monsters?
Janis, Christine M.; Buttrill, Karalyn; Figueirido, Borja
2014-01-01
Sthenurine kangaroos (Marsupialia, Diprotodontia, Macropodoidea) were an extinct subfamily within the family Macropodidae (kangaroos and rat-kangaroos). These “short-faced browsers” first appeared in the middle Miocene, and radiated in the Plio-Pleistocene into a diversity of mostly large-bodied forms, more robust than extant forms in their build. The largest (Procoptodon goliah) had an estimated body mass of 240 kg, almost three times the size of the largest living kangaroos, and there is speculation whether a kangaroo of this size would be biomechanically capable of hopping locomotion. Previously described aspects of sthenurine anatomy (specialized forelimbs, rigid lumbar spine) would limit their ability to perform the characteristic kangaroo pentapedal walking (using the tail as a fifth limb), an essential gait at slower speeds as slow hopping is energetically unfeasible. Analysis of limb bone measurements of sthenurines in comparison with extant macropodoids shows a number of anatomical differences, especially in the large species. The scaling of long bone robusticity indicates that sthenurines are following the “normal” allometric trend for macropodoids, while the large extant kangaroos are relatively gracile. Other morphological differences are indicative of adaptations for a novel type of locomotor behavior in sthenurines: they lacked many specialized features for rapid hopping, and they also had anatomy indicative of supporting their body with an upright trunk (e.g., dorsally tipped ischiae), and of supporting their weight on one leg at a time (e.g., larger hips and knees, stabilized ankle joint). We propose that sthenurines adopted a bipedal striding gait (a gait occasionally observed in extant tree-kangaroos): in the smaller and earlier forms, this gait may have been employed as an alternative to pentapedal locomotion at slower speeds, while in the larger Pleistocene forms this gait may have enabled them to evolve to body sizes where hopping was
Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.
Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine
2013-10-01
Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.
An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping
NASA Astrophysics Data System (ADS)
Bai, Xin; Qiu, Jing; Wang, Linjun
2018-03-01
We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.
Human hopping on damped surfaces: strategies for adjusting leg mechanics.
Moritz, Chet T; Farley, Claire T
2003-01-01
Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003
Coleman, M Nicole; Butler, Ebony O; Long, Amanda M; Fisher, Felicia D
2016-10-01
Hip-hop media and Black-oriented reality television are powerful mechanisms for conveying and promoting stereotypes of Black women. Black women's sexuality is frequently presented as highly-salient in each medium. However, little is known about the impact of those images on Black women's sexuality and identity. The current study uses focus-group methodology to engage young adult Black in critical discussion of two predominant sexual scripts found in hip-hop music and Black-oriented reality television - the Freak and the Gold Digger. Analyses revealed shared and distinct aspects of each sexual script represented in both media and the impact of those scripts on participants' experiences. Implications for future research are discussed.
ERIC Educational Resources Information Center
Söderman, Johan; Sernhede, Ove
2016-01-01
Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…
Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung
2017-01-01
Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p < 0.05). Significant side differences (p = 0.02) were identified in the entire population for the medial triple hop test, such that participants jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified
Hip-Hop Feminism: A Standpoint to Enhance the Positive Self-Identity of Black College Women
ERIC Educational Resources Information Center
Henry, Wilma J.
2010-01-01
The popularity of hip-hop among young Black college women, coupled with the deluge of negative and positive messages in this culture regarding these women's identity, signals an opportunity for the arrival of a contemporary, culturally relevant epistemology--hip-hop feminism. Through the lens of Black feminist theory, this article explores hip-hop…
Potential for Non-Contact ACL Injury Between Step-Close-Jump and Hop-Jump Tasks.
Wang, Li-I; Gu, Chin-Yi; Chen, Wei-Ling; Chang, Mu-San
2010-01-01
This study aimed to compare the kinematics and kinetics during the landing of hop-jump and step-close-jump movements in order to provide further inferring that the potential risk of ACL injuries. Eleven elite male volleyball players were recruited to perform hop-jump and step-close-jump tasks. Lower extremity kinematics and ground reaction forces during landing in stop-jump tasks were recorded. Lower extremity kinetics was calculated by using an inverse dynamic process. Step-close-jump tasks demonstrated smaller peak proximal tibia anterior shear forces during the landing phase. In step-close-jump tasks, increasing hip joint angular velocity during initial foot-ground contact decreased peak posterior ground reaction force during the landing phase, which theoretically could reduce the risk of ACL injury. Key pointsThe different landing techniques required for these two stop-jump tasks do not necessarily affect the jump height.Hop-jump decreased the hip joint angular velocity at initial foot contact with ground, which could lead to an increasing peak posterior GRF during the landing phase.Hop-jump decreased hip and knee joint angular flexion displacement during the landing, which could increase the peak vertical loading rate during the landing phase.
The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.
Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W
2009-07-01
The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.
Sindhwani, Aastha; Kaur, Harmeet; Tuli, Amit
2017-01-01
Salmonella enterica serovar typhimurium extensively remodels the host late endocytic compartments to establish its vacuolar niche within the host cells conducive for its replication, also known as the Salmonella-containing vacuole (SCV). By maintaining a prolonged interaction with late endosomes and lysosomes of the host cells in the form of interconnected network of tubules (Salmonella-induced filaments or SIFs), Salmonella gains access to both membrane and fluid-phase cargo from these compartments. This is essential for maintaining SCV membrane integrity and for bacterial intravacuolar nutrition. Here, we have identified the multisubunit lysosomal tethering factor—HOPS (HOmotypic fusion and Protein Sorting) complex as a crucial host factor facilitating delivery of late endosomal and lysosomal content to SCVs, providing membrane for SIF formation, and nutrients for intravacuolar bacterial replication. Accordingly, depletion of HOPS subunits significantly reduced the bacterial load in non-phagocytic and phagocytic cells as well as in a mouse model of Salmonella infection. We found that Salmonella effector SifA in complex with its binding partner; SKIP, interacts with HOPS subunit Vps39 and mediates recruitment of this tethering factor to SCV compartments. The lysosomal small GTPase Arl8b that binds to, and promotes membrane localization of Vps41 (and other HOPS subunits) was also required for HOPS recruitment to SCVs and SIFs. Our findings suggest that Salmonella recruits the host late endosomal and lysosomal membrane fusion machinery to its vacuolar niche for access to host membrane and nutrients, ensuring its intracellular survival and replication. PMID:29084291
PARALLEL HOP: A SCALABLE HALO FINDER FOR MASSIVE COSMOLOGICAL DATA SETS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Skory, Stephen; Turk, Matthew J.; Norman, Michael L.
2010-11-15
Modern N-body cosmological simulations contain billions (10{sup 9}) of dark matter particles. These simulations require hundreds to thousands of gigabytes of memory and employ hundreds to tens of thousands of processing cores on many compute nodes. In order to study the distribution of dark matter in a cosmological simulation, the dark matter halos must be identified using a halo finder, which establishes the halo membership of every particle in the simulation. The resources required for halo finding are similar to the requirements for the simulation itself. In particular, simulations have become too extensive to use commonly employed halo finders, suchmore » that the computational requirements to identify halos must now be spread across multiple nodes and cores. Here, we present a scalable-parallel halo finding method called Parallel HOP for large-scale cosmological simulation data. Based on the halo finder HOP, it utilizes message passing interface and domain decomposition to distribute the halo finding workload across multiple compute nodes, enabling analysis of much larger data sets than is possible with the strictly serial or previous parallel implementations of HOP. We provide a reference implementation of this method as a part of the toolkit {sup yt}, an analysis toolkit for adaptive mesh refinement data that include complementary analysis modules. Additionally, we discuss a suite of benchmarks that demonstrate that this method scales well up to several hundred tasks and data sets in excess of 2000{sup 3} particles. The Parallel HOP method and our implementation can be readily applied to any kind of N-body simulation data and is therefore widely applicable.« less
I Feel What He Was Doin': Responding to Justice-Oriented Teaching through Hip-Hop Aesthetics
ERIC Educational Resources Information Center
Petchauer, Emery
2011-01-01
This study illustrates a set of learning activities designed from two hip-hop aesthetics and explores their use among a classroom of African American preservice teachers who graduated from urban school districts. Based on the two hip-hop aesthetics of kinetic consumption and autonomy/distance, the specific goal of these learning activities is to…
ERIC Educational Resources Information Center
Emdin, Christopher
2011-01-01
This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…
ERIC Educational Resources Information Center
Henry, Wilma J.; West, Nicole M.; Jackson, Andrea
2010-01-01
This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…
ERIC Educational Resources Information Center
Irby, Decoteau J.; Hall, H. Bernard
2011-01-01
Grounded in critical and culturally relevant theory, hip-hop-based education (HHBE) research documents the use of hip-hop in educational settings. Despite the richness of the emerging field, overreliance on teacher-researcher perspectives leaves much to be desired. Little is known of the extent and ways HHBE is used by nonresearching K-12…
"You Don't Have to Claim Her": Reconstructing Black Femininity through Critical Hip-Hop Literacy
ERIC Educational Resources Information Center
Kelly, Lauren Leigh
2016-01-01
This article explores the ways in which females who identify with hip-hop often develop and construct their identities in relation to media representations of blackness and femininity in hip-hop music and culture. In order for educators to support female students in constructing identities of empowerment and agency, they should be willing and able…
Guo, Zhong; Johnston, Wayne; Kovtun, Oleksiy; Mureev, Sergey; Bröcker, Cornelia; Ungermann, Christian; Alexandrov, Kirill
2013-01-01
Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data. PMID:24312556
AC and DC conductivity due to hopping mechanism in double ion doped ceramics
NASA Astrophysics Data System (ADS)
Rizwana, Mahboob, Syed; Sarah, P.
2018-04-01
Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.
Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network
NASA Astrophysics Data System (ADS)
Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji
In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.
Sbardella, Maicon; Racanicci, Aline Mc; Gois, Franz D; de Lima, Cristiane B; Migotto, Dannielle L; Costa, Leandro B; Miyada, Valdomiro S
2018-04-01
The effects of dietary levels of hop β-acids on physical attributes, lipid oxidation and chemical composition of pork meat were evaluated. Thirty-two castrated male pigs obtained from a complete block design feeding experiment (6.23 ± 0.42 kg initial body weight (BW) to 20.45 ± 0.95 kg final BW) and fed diets supplemented with 0, 120, 240 or 360 mg kg -1 hop β-acids during 35 days were slaughtered to sample longissimus dorsi muscle for meat analysis. No effects (P > 0.05) of dietary hop β-acids were observed on meat physical attributes. Quadratic effects (P < 0.05) of hop β-acids were observed on lipid and protein contents and on thiobarbituric acid-reactive substance (TBARS) values of meatballs, whose equations allowed the estimation of dietary hop β-acid levels of 176, 169 and 181 mg kg -1 to provide up to 16.20% lipid reduction, 1.95% protein accretion and 23.31% TBARS reduction respectively. Dietary hop β-acids fed to pigs might reduce lipid, increase protein and reduce lipid oxidation without affecting physical attributes of the pork meat. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture
ERIC Educational Resources Information Center
Baszile, Denise Taliaferro
2009-01-01
Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…
NASA Astrophysics Data System (ADS)
Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.
2017-11-01
Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.
Elastic all-optical multi-hop interconnection in data centers with adaptive spectrum allocation
NASA Astrophysics Data System (ADS)
Hong, Yuanyuan; Hong, Xuezhi; Chen, Jiajia; He, Sailing
2017-01-01
In this paper, a novel flex-grid all-optical interconnect scheme that supports transparent multi-hop connections in data centers is proposed. An inter-rack all-optical multi-hop connection is realized with an optical loop employed at flex-grid wavelength selective switches (WSSs) in an intermediate rack rather than by relaying through optical-electric-optical (O-E-O) conversions. Compared with the conventional O-E-O based approach, the proposed all-optical scheme is able to off-load the traffic at intermediate racks, leading to a reduction of the power consumption and cost. The transmission performance of the proposed flex-grid multi-hop all-optical interconnect scheme with various modulation formats, including both coherently detected and directly detected approaches, are investigated by Monte-Carlo simulations. To enhance the spectrum efficiency (SE), number-of-hop adaptive bandwidth allocation is introduced. Numerical results show that the SE can be improved by up to 33.3% at 40 Gbps, and by up to 25% at 100 Gbps. The impact of parameters, such as targeted bit error rate (BER) level and insertion loss of components, on the transmission performance of the proposed approach are also explored. The results show that the maximum SE improvement of the adaptive approach over the non-adaptive one is enhanced with the decrease of the targeted BER levels and the component insertion loss.
Liu, Zechang; Wang, Liping; Liu, Yumei
2018-01-18
Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Karam, Joseph A; Parikh, Rasesh Y; Nayak, Dhananjaya; Rosenkranz, David; Gangaraju, Vamsi K
2017-04-14
Piwi-interacting RNAs (piRNAs) are 26-30-nucleotide germ line-specific small non-coding RNAs that have evolutionarily conserved function in mobile genetic element (transposons) silencing and maintenance of genome integrity. Drosophila Hsp70/90-organizing protein homolog (Hop), a co-chaperone, interacts with piRNA-binding protein Piwi and mediates silencing of phenotypic variations. However, it is not known whether Hop has a direct role in piRNA biogenesis and transposon silencing. Here, we show that knockdown of Hop in the germ line nurse cells (GLKD) of Drosophila ovaries leads to activation of transposons. Hop GLKD females can lay eggs at the same rate as wild-type counterparts, but the eggs do not hatch into larvae. Hop GLKD leads to the accumulation of γ-H2Av foci in the germ line, indicating increased DNA damage in the ovary. We also show that Hop GLKD-induced transposon up-regulation is due to inefficient piRNA biogenesis. Based on these results, we conclude that Hop is a critical component of the piRNA pathway and that it maintains genome integrity by silencing transposons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
An Energy Efficient MAC Protocol for Multi-Hop Swallowable Body Sensor Networks
Lin, Lin; Yang, Chengfeng; Wong, Kai Juan; Yan, Hao; Shen, Junwen; Phee, Soo Jay
2014-01-01
Swallowable body sensor networks (BSNs) are composed of sensors which are swallowed by patients and send the collected data to the outside coordinator. These sensors are energy constraint and the batteries are difficult to be replaced. The medium access control (MAC) protocol plays an important role in energy management. This paper investigates an energy efficient MAC protocol design for swallowable BSNs. Multi-hop communication is analyzed and proved more energy efficient than single-hop communication within the human body when the circuitry power is low. Based on this result, a centrally controlled time slotting schedule is proposed. The major workload is shifted from the sensors to the coordinator. The coordinator collects the path-loss map and calculates the schedules, including routing, slot assignment and transmission power. Sensor nodes follow the schedules to send data in a multi-hop way. The proposed protocol is compared with the IEEE 802.15.6 protocol in terms of energy consumption. The results show that it is more energy efficient than IEEE 802.15.6 for swallowable BSN scenarios. PMID:25330049
Lateral hopping of CO on Cu(111) induced by femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Ueba, H.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.
2010-09-01
We present a theoretical study of the lateral hopping of a single CO molecule on Cu(111) induced by femtosecond laser pulses by Mehlhorn [Phys. Rev. Lett. 104, 076101 (2010)]10.1103/PhysRevLett.104.076101. Our model assumes an intermode coupling between the CO frustrated translation (FT) and frustrated rotation (FR) modes with a weak and strong electronic friction coupling to hot electrons, respectively, and heat transfer between the FT mode and the substrate phonons. In this model the effective electronic friction coupling of the FT mode depends on the absorbed laser fluence F through the temperature of the FR mode. The calculated hopping yield as a function of F nicely reproduces the nonlinear increase observed above F=4.0J/m2 . It is found that the electronic heating via friction coupling nor the phonon coupling alone cannot explain the experimental result. Both heatings are cooperatively responsible for CO hopping on Cu(111). The electronic heat transfer dominates over the phononic one at high F , where the effective electronic friction coupling becomes larger than the phononic coupling.
Trigsted, Stephanie M; Post, Eric G; Bell, David R
2017-05-01
To determine possible differences in single-hop kinematics and kinetics in females with anterior cruciate ligament reconstruction compared to healthy controls. A second purpose was to make comparisons between the healthy and reconstructed limbs. Subjects were grouped based on surgical status (33 ACLR patients and 31 healthy controls). 3D motion capture synchronized with force plates was used to capture the landing phase of three successful trials of single hop for distance during a single data collection session. Peak values during the loading phase were analysed. Subjects additionally completed three successful trials of the triple hop for distance Tegner activity scale and International Knee Document Committee 2000 (IKDC). Controls demonstrated greater peak knee flexion and greater internal knee extension moment and hip extension moment than ACLR subjects. Within the ACLR group, the healthy limb exhibited greater peak knee flexion, hip flexion, hip extension moment, single hop and triple hops for distance and normalized quadriceps strength. Patients who undergo anterior cruciate ligament reconstruction land in a more extended posture when compared to healthy controls and compared to their healthy limb. III.
NASA Astrophysics Data System (ADS)
Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc
2018-03-01
We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.
Opportunity Looks Back After Hop to a New Pad
2010-05-19
NASA rover Opportunity captured this image of the tracks the rover left on a drive from one energy-favorable position on the northern end of a sand ripple to another. The rover team calls this hopping from lily pad to lily pad.
Farris, Dominic James; Hicks, Jennifer L.; Delp, Scott L.; Sawicki, Gregory S.
2014-01-01
Experiments have shown that elastic ankle exoskeletons can be used to reduce ankle joint and plantar-flexor muscle loading when hopping in place and, in turn, reduce metabolic energy consumption. However, recent experimental work has shown that such exoskeletons cause less favourable soleus (SO) muscle–tendon mechanics than is observed during normal hopping, which might limit the capacity of the exoskeleton to reduce energy consumption. To directly link plantar-flexor mechanics and energy consumption when hopping in exoskeletons, we used a musculoskeletal model of the human leg and a model of muscle energetics in simulations of muscle–tendon dynamics during hopping with and without elastic ankle exoskeletons. Simulations were driven by experimental electromyograms, joint kinematics and exoskeleton torque taken from previously published data. The data were from seven males who hopped at 2.5 Hz with and without elastic ankle exoskeletons. The energetics model showed that the total rate of metabolic energy consumption by ankle muscles was not significantly reduced by an ankle exoskeleton. This was despite large reductions in plantar-flexor force production (40–50%). The lack of larger metabolic reductions with exoskeletons was attributed to increases in plantar-flexor muscle fibre velocities and a shift to less favourable muscle fibre lengths during active force production. This limited the capacity for plantar-flexors to reduce activation and energy consumption when hopping with exoskeleton assistance. PMID:25278469
Organic magnetoresistance based on hopping theory
NASA Astrophysics Data System (ADS)
Yang, Fu-Jiang; Xie, Shi-Jie
2014-09-01
For the organic magnetoresistance (OMAR) effect, we suggest a spin-related hopping of carriers (polarons) based on Marcus theory. The mobility of polarons is calculated with the master equation (ME) and then the magnetoresistance (MR) is obtained. The theoretical results are consistent with the experimental observation. Especially, the sign inversion of the MR under different driving bias voltages found in the experiment is predicted. Besides, the effects of molecule disorder, hyperfine interaction (HFI), polaron localization, and temperature on the MR are investigated.
Correlated Hopping in the 1D Falicov--Kimball Model
NASA Astrophysics Data System (ADS)
Gajek, Z.; Lemanski, R.
2001-10-01
Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.
The Hip Hop peer crowd: An opportunity for intervention to reduce tobacco use among at-risk youth.
Walker, Matthew W; Navarro, Mario A; Hoffman, Leah; Wagner, Dana E; Stalgaitis, Carolyn A; Jordan, Jeffrey W
2018-07-01
Peer crowds, peer groups with macro-level connections and shared norms that transcend geography and race/ethnicity, have been linked to risky health behaviors. Research has demonstrated that Hip Hop peer crowd identification, which is common among multicultural youth, is associated with increased risk of tobacco use. To address this, the FDA Center for Tobacco Products created Fresh Empire, the first national tobacco education campaign tailored for Hip Hop youth aged 12-17 who are multicultural (Hispanic, African American, Asian-Pacific Islander, or Multiracial). As part of campaign development, peer crowd (Hip Hop, Mainstream, Popular, Alternative, Country) and cigarette smoking status were examined for the first time with a nationally recruited sample. Youth were recruited via targeted social media advertisements. Participants aged 13-17 (n = 5153) self-reported peer crowd identification via the I-Base Survey™ and cigarette smoking status. Differences in smoking status by peer crowd were examined using chi-square and followed up with z-tests to identify specific differences. Alternative youth were most at risk of cigarette smoking, followed by Hip Hop. Specifically, Hip Hop youth were significantly less likely to be Non-susceptible Non-triers than Popular, Mainstream, and Country youth, and more likely to be Experimenters than Popular and Mainstream youth. Representative studies show that Alternative is relatively small compared to other high-risk crowds, such as the Hip Hop peer crowd. The current research underscores the potential utility of interventions tailored to larger at-risk crowds for campaigns like Fresh Empire. Published by Elsevier Ltd.
60. View of lined canal and hop barn, looking southwest. ...
60. View of lined canal and hop barn, looking southwest. Photo by Robin Lee Tedder, Puget Power, 1989. - Puget Sound Power & Light Company, White River Hydroelectric Project, 600 North River Avenue, Dieringer, Pierce County, WA
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-27
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. ER10-2658-000] HOP Energy, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes Request for Blanket Section... of HOP Energy, LLC's application for market-based rate authority, with an accompanying rate tariff...
NASA Astrophysics Data System (ADS)
Landry, Brian R.; Subotnik, Joseph E.
2011-11-01
We evaluate the accuracy of Tully's surface hopping algorithm for the spin-boson model for the case of a small diabatic coupling parameter (V). We calculate the transition rates between diabatic surfaces, and we compare our results to the expected Marcus rates. We show that standard surface hopping yields an incorrect scaling with diabatic coupling (linear in V), which we demonstrate is due to an incorrect treatment of decoherence. By modifying standard surface hopping to include decoherence events, we recover the correct scaling (˜V2).
Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy
2017-01-01
Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284
Dichotomy between the band and hopping transport in organic crystals: insights from experiments.
Yavuz, I
2017-10-04
The molecular understanding of charge-transport in organic crystals has often been tangled with identifying the true dynamical origin. While in two distinct cases where complete delocalization and localization of charge-carriers are associated with band-like and hopping-like transports, respectively, their possible coalescence poses some mystery. Moreover, the existing models are still controversial at ambient temperatures. Here, we review the issues in charge-transport theories of organic materials and then provide an overview of prominent transport models. We explored ∼60 organic crystals, the single-crystal hole/electron mobilities of which have been predicted by band-like and hopping-like transport models, separately. Our comparative results show that at room-temperature neither of the models are exclusively capable of accurately predicting mobilities in a very broad range. Hopping-like models well-predict experimental mobilities around μ ∼ 1 cm 2 V -1 s -1 but systematically diverge at high mobilities. Similarly, band-like models are good at μ > ∼50 cm 2 V -1 s -1 but systematically diverge at lower mobilities. These results suggest the development of a unique and robust room-temperature transport model incorporating a mixture of these two extreme cases, whose relative importance is associated with their predominant regions. We deduce that while band models are beneficial for rationally designing high mobility organic-semiconductors, hopping models are good to elucidate the charge-transport of most organic-semiconductors.
Abortion and contemporary hip-hop: a thematic analysis of lyrics from 1990-2015.
Premkumar, Ashish; Brown, Katherine; Mengesha, Biftu; Jackson, Andrea V
2017-07-01
To evaluate the representation of abortion in contemporary hip-hop music, gaining insight into the myriad of attitudes of abortion in the black community. We used Genius, an online storehouse for lyrical content, to identify songs by querying the database for search terms related to family planning, including slang terms. We then cross-referenced identified songs using an online list of songs about abortion. We analyzed eligible songs using grounded theory in order to identify key themes. Of 6577 songs available, a total of 101 songs performed by 122 individual artists met inclusion criteria. The majority of artists were Black men; five artists were Black women. Key themes were: use of abortion as braggadocio; equating abortion with sin, genocide, or murder; male pressure for women to seek abortion; and the specific association of Planned Parenthood services with abortion. The moral and ethical themes surrounding abortion in hip-hop lyrics reveal a unique perspective within a marginalized community. The overall negative context of abortion in hip-hop lyrics needs to be reconciled with the gendered, economic, historical, political, racial and ethnic background of hip-hop and rap music in America. This study is the first to evaluate lyrical content from contemporary popular music in relation to abortion and family planning. Examining the intersection of reproductive rights and popular culture can provide a unique insight into the limited knowledge of the perspectives of abortion in the black community. Copyright © 2017 Elsevier Inc. All rights reserved.
Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer
2014-11-01
Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening-cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations with sprinting and/or running have been examined in orienteering athletes. The authors investigated squat jump (SJ), countermovement jump (CMJ), standing long jump (SLJ), and hopping performed by 8 elite and 8 amateur male foot-orienteering athletes (29 ± 7 y, 183 ± 5 cm, 73 ± 7 kg) and possible correlations to road, path, and forest running and sprinting performance, as well as running economy, velocity at anaerobic threshold, and peak oxygen uptake (VO(2peak)) from treadmill assessments. During SJs and CMJs, elites demonstrated superior relative peak forces, times to peak force, and prestretch augmentation, albeit lower SJ heights and peak powers. Between-groups differences were unclear for CMJ heights, hopping stiffness, and most SLJ parameters. Large pairwise correlations were observed between relative peak and time to peak forces and sprinting velocities; time to peak forces and running velocities; and prestretch augmentation and forest-running velocities. Prestretch augmentation and time to peak forces were moderately correlated to VO(2peak). Correlations between running economy and jumping or hopping were small or trivial. Overall, the elites exhibited superior stretch-shortening-cycle utilization and rapid generation of high relative maximal forces, especially vertically. These functional measures were more closely related to sprinting and/or running abilities, indicating benefits of lower-body training in orienteering.
Sista Girl Rock: Women of Colour and Hip-Hop Deejaying as Raced/Gendered Knowledge and Language
ERIC Educational Resources Information Center
Craig, Todd; Kynard, Carmen
2017-01-01
This article seeks to introduce and situate a seldom-explored subject: the role and contribution of women hip-hop deejays in the testosterone-filled genre called hip-hop. Grounding the analysis in the interviews of six women deejays--Spinderella, Kuttin Kandi, Pam the Funkstress, Reborn, Shorty Wop and Natasha Diggs--"Sista Girl Rock"…
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-17
... of Agriculture to use hop beta acids (CAS Reg. No. none specified) to treat up to 181,000 honey bee... exemption regional request for use of hop beta acids in honey bee hives to control varroa mites. Information... effect on honey bee populations. The parasitic mite is considered the primary pest of honeybees and its...
Surface-hopping dynamics and decoherence with quantum equilibrium structure.
Grunwald, Robbie; Kim, Hyojoon; Kapral, Raymond
2008-04-28
In open quantum systems, decoherence occurs through interaction of a quantum subsystem with its environment. The computation of expectation values requires a knowledge of the quantum dynamics of operators and sampling from initial states of the density matrix describing the subsystem and bath. We consider situations where the quantum evolution can be approximated by quantum-classical Liouville dynamics and examine the circumstances under which the evolution can be reduced to surface-hopping dynamics, where the evolution consists of trajectory segments exclusively evolving on single adiabatic surfaces, with probabilistic hops between these surfaces. The justification for the reduction depends on the validity of a Markovian approximation on a bath averaged memory kernel that accounts for quantum coherence in the system. We show that such a reduction is often possible when initial sampling is from either the quantum or classical bath initial distributions. If the average is taken only over the quantum dispersion that broadens the classical distribution, then such a reduction is not always possible.
Ahmadi, Sheida; Bowles, Richard K
2017-04-21
Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.
NASA Astrophysics Data System (ADS)
Kohno, Masanori
2018-05-01
The single-particle spectral properties of the two-dimensional t-J model with next-nearest-neighbor hopping are investigated near the Mott transition by using cluster perturbation theory. The spectral features are interpreted by considering the effects of the next-nearest-neighbor hopping on the shift of the spectral-weight distribution of the two-dimensional t-J model. Various anomalous features observed in hole-doped and electron-doped high-temperature cuprate superconductors are collectively explained in the two-dimensional t-J model with next-nearest-neighbor hopping near the Mott transition.
An, Yong Q; Taylor, Antoinette J; Conradson, Steven D; Trugman, Stuart A; Durakiewicz, Tomasz; Rodriguez, George
2011-05-20
We describe a femtosecond pump-probe study of ultrafast hopping dynamics of 5f electrons in the Mott insulator UO₂ following Mott-gap excitation at temperatures of 5-300 K. Hopping-induced response of the lattice and electrons is probed by transient reflectivity at mid- and above-gap photon energies, respectively. These measurements show an instantaneous hop, subsequent picosecond lattice deformation, followed by acoustic phonon emission and microsecond relaxation. Temperature-dependent studies indicate that the slow relaxation results from Hubbard excitons formed by U³⁺-U⁵⁺ pairs.
59. View of lined canal east of bellmouth near hop ...
59. View of lined canal east of bellmouth near hop barn, looking southwest. Photo by Robin Lee Tedder, Puget Power, 1989. - Puget Sound Power & Light Company, White River Hydroelectric Project, 600 North River Avenue, Dieringer, Pierce County, WA
GENERAL VIEW OF SITE LOOKING SOUTHWEST. JUPITER 'HOP' STAND, FOREGROUND ...
GENERAL VIEW OF SITE LOOKING SOUTHWEST. JUPITER 'HOP' STAND, FOREGROUND CENTER, REDSTONE TEST STAND FOREGROUND RIGHT, SATURN I C TEST STAND BACKGROUND LEFT. - Marshall Space Flight Center, Redstone Rocket (Missile) Test Stand, Dodd Road, Huntsville, Madison County, AL
Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde
2013-01-01
During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313
Nicaise, Valerie; Joe, Anna; Jeong, Byeong-ryool; Korneli, Christin; Boutrot, Freddy; Westedt, Isa; Staiger, Dorothee; Alfano, James R; Zipfel, Cyril
2013-03-06
Pathogens target important components of host immunity to cause disease. The Pseudomonas syringae type III-secreted effector HopU1 is a mono-ADP-ribosyltransferase required for full virulence on Arabidopsis thaliana. HopU1 targets several RNA-binding proteins including GRP7, whose role in immunity is still unclear. Here, we show that GRP7 associates with translational components, as well as with the pattern recognition receptors FLS2 and EFR. Moreover, GRP7 binds specifically FLS2 and EFR transcripts in vivo through its RNA recognition motif. HopU1 does not affect the protein-protein associations between GRP7, FLS2 and translational components. Instead, HopU1 blocks the interaction between GRP7 and FLS2 and EFR transcripts in vivo. This inhibition correlates with reduced FLS2 protein levels upon Pseudomonas infection in a HopU1-dependent manner. Our results reveal a novel virulence strategy used by a microbial effector to interfere with host immunity.
Prediction of infection risk of hop by Pseudoperonspora humuli
USDA-ARS?s Scientific Manuscript database
Downy mildew, caused by Pseudoperonospora humuli, is one of the most destructive diseases of hop. Weather factors associated with infection risk by P. humuli in the maritime region of western Oregon were examined for 24 and 48-h periods and quadratic discriminant function models were developed to c...
Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica
2018-06-01
Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.
Child-Mediated Stroke Communication: findings from Hip Hop Stroke.
Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William
2012-01-01
Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.
Kirkland, Megan C; Chen, Alice; Downer, Matthew B; Holloway, Brett J; Wallack, Elizabeth M; Lockyer, Evan J; Buckle, Natasha C M; Abbott, Courtney L; Ploughman, Michelle
2018-06-01
People with mild multiple sclerosis (MS) often report subtle deficits in balance and cognition but display no measurable impairment on clinical assessments. We examined whether hopping to a metronome beat had the potential to detect anticipatory motor control deficits among people with mild MS (Expanded Disability Status Scale ≤ 3.5). Participants with MS (n = 13), matched controls (n = 9), and elderly subjects (n = 13) completed tests of cognition (Montreal Cognitive Assessment (MoCA)) and motor performance (Timed 25 Foot Walk Test (T25FWT)). Participants performed two bipedal hopping tasks: at 40 beats/min (bpm) and 60-bpm in random order. Hop characteristics (length, symmetry, variability) and delay from the metronome beat were extracted from an instrumented walkway and compared between groups. The MS group became more delayed from the metronome beat over time whereas elderly subjects tended to hop closer to the beat (F = 4.52, p = 0.02). Delay of the first hop during 60-bpm predicted cognition in people with MS (R = 0.55, β = 4.64 (SD 4.63), F = 4.85, p = 0.05) but not among control (R = 0.07, p = 0.86) or elderly subjects (R = 0.17, p = 0.57). In terms of hopping characteristics, at 60-bpm, people with MS and matched controls were significantly different from the elderly group. However, at 40-bpm, the MS group was no longer significantly different from the elderly group, even though matched controls and elderly still differed significantly. This new timed hopping test may be able to detect both physical ability, and feed-forward anticipatory control impairments in people with mild MS. Hopping at a frequency of 40-bpm seemed more challenging. Several aspects of anticipatory motor control can be measured: including reaction time to the first metronome cue and the ability to adapt and anticipate the beat over time. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.
Hop (Humulus lupulus L.) response mechanisms in drought stress: Proteomic analysis with physiology.
Kolenc, Zala; Vodnik, Dominik; Mandelc, Stanislav; Javornik, Branka; Kastelec, Damijana; Čerenak, Andreja
2016-08-01
Drought is one of the major environmental devastating stressors that impair the growth and productivity of crop plants. Despite the relevance of drought stress, changes in physiology and resistance mechanisms are not completely understood for certain crops, including hop (Humulus lupulus L.). In this research the drought response of hop was studied using a conventional physiological approach (gas exchange techniques, fluorescence, relative water content measurements) and proteomic analysis (2D-DIGE). Plants of two cultivars (Aurora and Savinjski golding) were exposed to progressive drought in a pot experiment and analysed at different stress stages (mild, moderate and severe). Measurements of relative water content revealed a hydrostable water balance of hop. Photosynthesis was decreased due to stomatal and non-stomatal limitation to the same extent in both cultivars. Of 28 identified differentially abundant proteins, the majority were down regulated and included in photosynthetic (41%) and sugar metabolism (33%). Fifteen % of identified proteins were classified into the nitrogen metabolism, 4% were related to a ROS related pathway and 7% to other functions. Copyright © 2016. Published by Elsevier Masson SAS.
Wang, Xuping; Yang, Lei; Yang, Xiaolan; Tian, Yanhua
2014-06-01
Hops (Humulus lupulus L.) contain 40-140 mg g(-1) polyphenols. The objective of this study was to determine the phenolic composition of a high-purity (total phenolic content = 887 mg g(-1) ) hop polyphenol extract (HPE) and evaluate its antioxidant activities in vivo and in vitro and its antimutagenic activity. The antioxidant activity of HPE was compared with the activity of green tea polyphenols. The phenolic compositions of HPE were more than 55% proanthocyanidins and more than 28% flavonoid glycosides. In vitro, HPE effectively scavenged α,α-diphenyl-β-picrylhydrazyl, hydroxyl and superoxide anion radicals, and inhibited DNA oxidative damage. In vivo, oral HPE at a polyphenol dose of 200-800 mg kg(-1) body weight significantly prevented a bromobenzene-induced decrease in liver superoxide dismutase and glutathione peroxidase activity, and decreased levels of liver thiobarbituric acid reactive substances in bromobenzene-treated mice. An oral dose of 20-80 mg kg(-1) body weight HPE significantly reduced the frequency of bone marrow micronuclei induced by cyclophosphamide. The antioxidant activities of hop polyphenols in vitro and in vivo were higher than green tea polyphenols at the same concentration. Hop polyphenols had the same or higher antioxidant activity than tea polyphenols. Hop polyphenols might be useful as natural antioxidants and antimutagens. © 2013 Society of Chemical Industry.
Young Children Manifest Spiritualities in Their Hip-Hop Writing
ERIC Educational Resources Information Center
Norton, Nadjwa E. L.
2014-01-01
In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…
Denby, Charles M; Li, Rachel A; Vu, Van T; Costello, Zak; Lin, Weiyin; Chan, Leanne Jade G; Williams, Joseph; Donaldson, Bryan; Bamforth, Charles W; Petzold, Christopher J; Scheller, Henrik V; Martin, Hector Garcia; Keasling, Jay D
2018-03-20
Flowers of the hop plant provide both bitterness and "hoppy" flavor to beer. Hops are, however, both a water and energy intensive crop and vary considerably in essential oil content, making it challenging to achieve a consistent hoppy taste in beer. Here, we report that brewer's yeast can be engineered to biosynthesize aromatic monoterpene molecules that impart hoppy flavor to beer by incorporating recombinant DNA derived from yeast, mint, and basil. Whereas metabolic engineering of biosynthetic pathways is commonly enlisted to maximize product titers, tuning expression of pathway enzymes to affect target production levels of multiple commercially important metabolites without major collateral metabolic changes represents a unique challenge. By applying state-of-the-art engineering techniques and a framework to guide iterative improvement, strains are generated with target performance characteristics. Beers produced using these strains are perceived as hoppier than traditionally hopped beers by a sensory panel in a double-blind tasting.
The multiple hop test: a discriminative or evaluative instrument for chronic ankle instability?
Eechaute, Christophe; Bautmans, Ivan; De Hertogh, Willem; Vaes, Peter
2012-05-01
To determine whether the multiple hop test should be used as an evaluative or a discriminative instrument for chronic ankle instability (CAI). Blinded case-control study. : University research laboratory. Twenty-nine healthy subjects (21 men, 8 women, mean age 21.8 years) and 29 patients with CAI (17 men, 12 women, mean age 24.9 years) were selected. Subjects performed a multiple hop test and hopped on 10 different tape markers while trying to avoid any postural correction. Minimal detectable changes (MDC) of the number of balance errors, the time value, and the visual analog scale (VAS) score (perceived difficulty) were calculated as evaluative measures. For the discriminative properties, a receiver operating characteristic curve was determined and the area under curve (AUC), the sensitivity, specificity, diagnostic accuracy (DA), and likelihood ratios (LR) were calculated whether 1, 2, or 3 outcomes were positive. Based on their MDC, outcomes should, respectively, change by more than 7 errors (41%), 6 seconds (15%), and 27 mm (55%, VAS score) before considering it as a real change. Area under curves were, respectively, 79% (errors), 77% (time value), and 65% (VAS score). The most optimal cutoff point was, respectively, 13.5 errors, 35 seconds, and 32.5 mm. When 2 of 3 outcomes were positive, the sensitivity was 86%, the specificity was 79%, the DA was 83%, the positive LR was 4.2, and the negative LR was 0.17. The multiple hop test seems to be more a discriminative instrument for CAI, and its responsiveness needs to be demonstrated.
Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.
Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry
2015-02-01
Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.
Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states
DOE Office of Scientific and Technical Information (OSTI.GOV)
Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de
A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully’s fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronicmore » wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.« less
USDA-ARS?s Scientific Manuscript database
The temporal development of biological control of arthropod pests in perennial cropping systems is largely unreported. In this study, the development of biological control of twospotted spider mite, Tetranychus urticae Koch and hop aphid, Phorodon humuli (Schrank) in a new planting of hop in Oregon...
Generalization of fewest-switches surface hopping for coherences
NASA Astrophysics Data System (ADS)
Tempelaar, Roel; Reichman, David R.
2018-03-01
Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.
Alirezaei, Masoud; Rezaei, Maryam; Hajighahramani, Shahin; Sookhtehzari, Ali; Kiani, Katayoun
2017-01-01
The present study was designed to evaluate the antioxidant effects of oleuropein against oxidative stress in the hippocampal area of rats. We used seven experimental groups as follows: Control, Propofol, Propofol-Ketamine (Pro.-Ket.), Xylazine-Ketamine (Xyl.-Ket.), and three oleuropein-pretreated groups (Ole.-Pro., Ole.-Pro.-Ket. and Ole.-Xyl.-Ket.). The oleuropein-pretreated groups received oleuropein (15 mg/kg body weight as orally) for 10 consecutive days. Propofol 100 mg/kg, xylazine 3 mg/kg, and ketamine 75 mg/kg once as ip was used on the 11th day of treatment. Spatial memory impairment and antioxidant status of hippocampus were measured via Morris water maze, lipid peroxidation marker, and antioxidant enzyme activities. Spatial memory impairment and lipid peroxidation significantly increased in Xyl.-Ket.-treated rats in comparison to the control, propofol, Ole.-Pro. and Ole.-Pro.-Ket. groups. Oleuropein pretreatment significantly reversed spatial memory impairment and lipid peroxidation in the Ole.-Xyl.-Ket. group as compared to the Xyl.-Ket.-treated rats. There was no significant difference between the control and the propofol group in lipid peroxidation and spatial memory status. Superoxide dismutase and catalase activities both significantly decreased in Xyl.-Ket.-treated rats when compared to the control, propofol, Ole.-Pro., Ole.-Pro.-Ket., and Ole.-Xyl.-Ket. groups. In contrast, glutathione peroxidase activity in Xyl.-Ket.-treated rats significantly increased as compared to the control, propofol, Pro.-Ket., Ole.-Pro., and Ole.-Pro.-Ket. groups. We concluded that xylazine in combination with ketamine is an oxidative anesthetic drug and oleuropein pretreatment attenuates cognitive dysfunction and oxidative stress induced by anesthesia in the hippocampal area of rats. We also confirmed the antioxidant properties of propofol as a promising antioxidant anesthetic agent.
Feng, Yiping; Song, Qingyun; Lv, Wenying; Liu, Guoguang
2017-12-01
Ketoprofen (KET) is a mostly used nonsteroidal anti-inflammatory drug that has been frequently detected in wastewater effluents and surface waters. In this study, we investigated the degradation of KET by sulfate radical (SO 4 - ) based advanced oxidation processes (SR-AOPs) in aqueous solution. The degradation kinetics, mechanisms, and effects of natural water matrices on thermally activated persulfate (TAP) oxidation of KET were systematically investigated. Increasing the temperature and persulfate (PS) concentrations greatly enhanced the degradation of KET. KET degradation is pH-dependent with an optimum pH of 5.0. Reactions in the presence of radical quenchers revealed the dominant role of SO 4 - in oxidizing KET. Water matrix significantly influenced the degradation of KET. The common inorganic anions present in natural waters exhibited inhibitory effect on KET degradation, and the inhibition followed the order of Cl - > CO 3 2- > HCO 3 - > NO 3 - ; however, no significant inhibition of KET degradation was observed in the presence of Ca 2+ and Mg 2+ cations. The presence of natural organic matter (NOM) suppressed KET degradation, and the suppression increased as NOM concentration increase. Products identification and mineralization experiments revealed that KET and its degradation intermediates were finally transformed into CO 2 and H 2 O. The results of this study indicated that applying SR-AOPs for the remediation of KET contaminated water matrix is technically possible. Copyright © 2017 Elsevier Ltd. All rights reserved.
The crossover between tunnel and hopping conductivity in granulated films of noble metals
NASA Astrophysics Data System (ADS)
Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey
2017-11-01
The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.
NASA Astrophysics Data System (ADS)
Quang Nguyen, Sang; Kong, Hyung Yun
2016-11-01
In this article, the presence of multi-hop relaying, eavesdropper and co-channel interference (CCI) in the same system model is investigated. Specifically, the effect of CCI on a secured multi-hop relaying network is studied, in which the source communicates with the destination via multi-relay-hopping under the presence of an eavesdropper and CCI at each node. The optimal relay at each cluster is selected to help forward the message from the source to the destination. We apply two relay selection approaches to such a system model, i.e. the optimal relay is chosen based on (1) the maximum channel gain from the transmitter to all relays in the desired cluster and (2) the minimum channel gain from the eavesdropper to all relays in each cluster. For the performance evaluation and comparison, we derived the exact closed form of the secrecy outage probability of the two approaches. That analysis is verified by Monte Carlo simulation. Finally, the effects of the number of hops, the transmit power at the source, relays and the external sources, the distance between the external sources and each node in the system, and the location of the eavesdropper are presented and discussed.
Medical-School Curriculum Goes Interactive, Online, ... and Hip-Hop
ERIC Educational Resources Information Center
Mangan, Katherine
2008-01-01
This article reports that Canadian medical students, inspired by an online community and an obscure heart condition, have ditched their books and transformed their class notes into a pulsating, hip-hop music video. "Diagnosis Wenckebach"--the name comes from a type of abnormal heart rhythm--was created as just one of many innovative…
ERIC Educational Resources Information Center
Gangloff-Bailey, Felicia
2017-01-01
The influence of hip hop culture and music on African-American youth is profound and can be used as a tool to shape positive outcomes in education. Hip hop has been used effectively in the classroom to engage students and enhance their critical thinking (Gangloff-Bailey & Freeman, 2014). In addition, hip hop has been described as a socializer…
Nonadiabatic small-polaron hopping electron transport in diphenoquinone-doped polycarbonate
NASA Astrophysics Data System (ADS)
Yamaguchi, Yasuhiro; Yokoyama, Masaaki
1991-10-01
The dependences of electron mobility on the electric field F, temperature T, and hopping site distance R have been characterized in 3,5-dimethyl-3',5'-di-tert-butyl-4,4'-diphenoquinone dispersed molecularly in a polycarbonate according to Schein's analytical technique. The electron mobility can be described in the form a0R2 exp(-2R/R0) exp(-E0/kT) × exp[β(1/kT-1/kT0)F1/2], where a0, R0, β, and T0 are constants. Moreover, it is found that the zero-field activation energy E0 is independent of R. The invariable E0 and the exponential dependence of the Arrhenius prefactor on R strongly suggest that the electron transport therein is due to nonadiabatic small-polaron hopping. Based on the small-polaron theory, the transport properties are qualitatively discussed in terms of molecular properties.
VoiLA: A multidisciplinary study of Volatile recycling in the Lesser Antilles Arc
NASA Astrophysics Data System (ADS)
Collier, J.; Blundy, J. D.; Goes, S. D. B.; Henstock, T.; Harmon, N.; Kendall, J. M.; Macpherson, C.; Rietbrock, A.; Rychert, C.; Van Hunen, J.; Wilkinson, J.; Wilson, M.
2017-12-01
Project VoiLA will address the role of volatiles in controlling geological processes at subduction zones. The study area was chosen as it subducts oceanic lithosphere formed at the slow-spreading Mid Atlantic Ridge. This should result in a different level and pattern of hydration to compare with subduction zones in the Pacific which consume oceanic lithosphere generated at faster spreading rates. In five project components, we will test (1) where volatiles are held within the incoming plate; (2) where they are transported and released below the arc; (3) how the volatile distribution and pathways relate to the construction of the arc; and (4) their relationship to seismic and volcanic hazards and the fractionation of economic metals. Finally, (5) the behaviour of the Lesser Antilles arc will be compared with that of other well-studied systems to improve our wider understanding of the role of water in subduction processes. To address these questions the project will combine seismology; petrology and numerical modelling of wedge dynamics and its consequences on dehydration and melting. So-far island-based fieldwork has included mantle xenolith collection and installation of a temporary seismometer network. In 2016 and 2017 we conducted cruises onboard the RRS James Cook that collected a network of passive-recording and active-recording ocean-bottom seismometer data within the back-arc, fore-arc and incoming plate region. A total of 175 deployments and recoveries were made with the loss of only 6 stations. The presentation will present preliminary results from the project.
Gatica-Arias, A; Farag, M A; Stanke, M; Matoušek, J; Wessjohann, L; Weber, G
2012-01-01
Hop is an important source of secondary metabolites, such as flavonoids. Some of these are pharmacologically active. Nevertheless, the concentration of some classes as flavonoids in wild-type plants is rather low. To enhance the production in hop, it would be interesting to modify the regulation of genes in the flavonoid biosynthetic pathway. For this purpose, the regulatory factor PAP1/AtMYB75 from Arabidopsis thaliana L. was introduced into hop plants cv. Tettnanger by Agrobacterium-mediated genetic transformation. Twenty kanamycin-resistant transgenic plants were obtained. It was shown that PAP1/AtMYB75 was stably incorporated and expressed in the hop genome. In comparison to the wild-type plants, the color of female flowers and cones of transgenic plants was reddish to pink. Chemical analysis revealed higher levels of anthocyanins, rutin, isoquercitin, kaempferol-glucoside, kaempferol-glucoside-malonate, desmethylxanthohumol, xanthohumol, α-acids and β-acids in transgenic plants compared to wild-type plants.
HapHop-Physio: a computer game to support cognitive therapies in children.
Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S
2017-01-01
Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.
Powdery mildew reaction of hop cultivars and USDA germplasm, 2015
USDA-ARS?s Scientific Manuscript database
This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...
Variable-range-hopping magnetoresistance
NASA Astrophysics Data System (ADS)
Azbel, Mark Ya
1991-03-01
The hopping magnetoresistance R of a two-dimensional insulator with metallic impurities is considered. In sufficiently weak magnetic fields it increases or decreases depending on the impurity density n: It decreases if n is low and increases if n is high. In high magnetic fields B, it always exponentially increases with √B . Such fields yield a one-dimensional temperature dependence: lnR~1/ √T . The calculation provides an accurate leading approximation for small impurities with one eigenstate in their potential well. In the limit of infinitesimally small impurities, an impurity potential is described by a generalized function. This function, similar to a δ function, is localized at a point, but, contrary to a δ function in the dimensionality above 1, it has finite eigenenergies. Such functions may be helpful in the study of scattering and localization of any waves.
Moya-Angeler, Joaquín; Vaquero, Javier; Forriol, Francisco
2017-06-01
The purpose of this study was to evaluate the functional status prior to and at different times after anterior cruciate ligament reconstruction (ACLR), and to analyze the changes in the kinetic patterns of the involved and uninvolved lower limb during gait, sprint and three hop tests. Seventy-four male patients with an ACL injury were included in the study. All patients performed a standardized kinetic protocol including gait, sprint and three hop tests (single-leg hop, drop vertical jump and vertical jump tests), preoperatively and at 3, 6, and 12 months after ACLR with a semitendinosus gracilis tendon autograft. Measurements were performed with two force plates. The lower limb symmetry index (LSI) was calculated to determine whether a side-to-side leg difference was classified as normal (LSI >90%) or abnormal (LSI <90%). The LSI presented high values (>90%) at almost all times before and after ACLR in gait, sprint and single-leg hop tests (p < 0.005), with a tendency to increase postoperatively. A lower LSI was observed (<90%) in tests where both extremities were tested simultaneously, such as the drop vertical jump and vertical hop tests (p < 0.05). We observed a tendency to increase symmetry restoration in the kinetics of the involved and uninvolved limb up to twelve months after ACLR, especially in those tests, in which, both limbs were tested individually (gait analysis, sprint and single-leg hop tests). Therefore, the isolation of the involved and uninvolved limb seems to be a critical component in the functional rehabilitation and evaluation of patients before and after ACLR. level III.
Moaddel, Ruin; Venkata, Swarajya Lakshmi Vattem; Tanga, Mary J.; Bupp, James E.; Green, Carol E.; Iyer, Lalitha; Furimsky, Anna; Goldberg, Michael E.; Torjman, Marc C.; Wainer, Irving W.
2010-01-01
A parallel chiral/achiral LC-MS/MS assay has been developed and validated to measure the plasma and urine concentrations of the enantiomers of ketamine, (R)- and (S)-Ket, in Complex Regional Pain Syndrome (CRPS) patients receiving a 5-day continuous infusion of a sub-anesthetic dose of (R,S)-Ket. The method was also validated for the determination of the enantiomers of the Ket metabolites norketamine, (R)-and (S)-norKet and dehydronorketamine, (R)- and (S)-DHNK, as well as the diastereomeric metabolites hydroxynorketamine, (2S,6S)-/(2R,6R)-HNK and two hydroxyketamines, (2S,6S)-HKet and (2S,6R)-Hket. In this method, (R,S)-Ket, (R,S)-norKet and (R,S)-DHNK and the diastereomeric hydroxyl-metabolites were separated and quantified using a C18 stationary phase and the relative enantiomeric concentrations of (R,S)-Ket, (R,S)-norKet and (R,S)-DHNK were determined using an AGP-CSP. The analysis of the results of microsomal incubations of (R)- and (S)-Ket and a plasma and urine sample from a CRPS patient indicated the presence of 10 additional compounds and glucuronides. The data from the analysis of the patient sample also demonstrated that a series of HNK metabolites were the primary metabolites in plasma and (R)- and (S)-DHNK were the major metabolites found in urine. The results suggest that norKet is the initial, but not the primary, metabolite and that downstream norKet metabolites play a role in (R,S)-Ket-related pain relief in CRPS patients. PMID:20875593
Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage
Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa
2014-01-01
Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474
Willigenburg, Nienke; Hewett, Timothy E.
2016-01-01
Objective To define the relationship between FMS™ scores and hop performance, hip strength, and knee strength in collegiate football players. Design Cross-sectional cohort. Participants Freshmen of a division I collegiate American football team (n=59). Main Outcome Measures The athletes performed the FMS™, as well as a variety of hop tests, isokinetic knee strength and isometric hip strength tasks. We recorded total FMS™ score, peak strength and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman’s correlation coefficients quantified the relationships these measures, and chi-square analyses compared the number of athletes with asymmetries on the different tasks. Results We observed significant correlations (r=0.38–0.56, p≤0.02) between FMS™ scores and hop distance, but not between FMS™ scores and hip or knee strength (all p≥0.21). The amount of asymmetry on the FMS™ test was significantly correlated to the amount of asymmetry on the timed 6m hop (r=0.44, p<0.01), but not to hip or knee strength asymmetries between limbs (all p≥0.34). Conclusions FMS™ score was positively correlated to hop distance, and limb asymmetry in FMS™ tasks was correlated to limb asymmetry in 6m hop time in football players. No significant correlations were observed between FMS™ score and hip and knee strength, or between FMS™ asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time and cost efficient alternative to FMS™ testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries. PMID:26886801
Willigenburg, Nienke; Hewett, Timothy E
2017-03-01
To define the relationship between Functional Movement Screen (FMS) scores and hop performance, hip strength, and knee strength in collegiate football players. Cross-sectional cohort. Freshmen of a Division I collegiate American football team (n = 59). The athletes performed the FMS, and also a variety of hop tests, isokinetic knee strength, and isometric hip strength tasks. We recorded total FMS score, peak strength, and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman correlation coefficients quantified the relationships between these measures, and χ analyses compared the number of athletes with asymmetries on the different tasks. We observed significant correlations (r = 0.38-0.56, P ≤ 0.02) between FMS scores and hop distance but not between FMS scores and hip or knee strength (all P ≥ 0.21). The amount of asymmetry on the FMS test was significantly correlated to the amount of asymmetry on the timed 6-m hop (r = 0.44, P < 0.01) but not to hip or knee strength asymmetries between limbs (all P ≥ 0.34). Functional Movement Screen score was positively correlated to hop distance, and limb asymmetry in FMS tasks was correlated to limb asymmetry in 6-m hop time in football players. No significant correlations were observed between FMS score and hip and knee strength or between FMS asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time-efficient and cost-efficient alternative to FMS testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries.
Haakensen, Monique; Vickers, David M; Ziola, Barry
2009-09-07
Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
This article focuses on a hip-hop perspective of school, schooling, and school music. The study involves applications of ethnographic (including autoethnographic) techniques within the framework of a holistic multiple case study. One case is an adult amateur hip-hop musician named Terrence (pseudonym), and the other is myself (a traditionally…
Dynamic Task Allocation in Multi-Hop Multimedia Wireless Sensor Networks with Low Mobility
Jin, Yichao; Vural, Serdar; Gluhak, Alexander; Moessner, Klaus
2013-01-01
This paper presents a task allocation-oriented framework to enable efficient in-network processing and cost-effective multi-hop resource sharing for dynamic multi-hop multimedia wireless sensor networks with low node mobility, e.g., pedestrian speeds. The proposed system incorporates a fast task reallocation algorithm to quickly recover from possible network service disruptions, such as node or link failures. An evolutional self-learning mechanism based on a genetic algorithm continuously adapts the system parameters in order to meet the desired application delay requirements, while also achieving a sufficiently long network lifetime. Since the algorithm runtime incurs considerable time delay while updating task assignments, we introduce an adaptive window size to limit the delay periods and ensure an up-to-date solution based on node mobility patterns and device processing capabilities. To the best of our knowledge, this is the first study that yields multi-objective task allocation in a mobile multi-hop wireless environment under dynamic conditions. Simulations are performed in various settings, and the results show considerable performance improvement in extending network lifetime compared to heuristic mechanisms. Furthermore, the proposed framework provides noticeable reduction in the frequency of missing application deadlines. PMID:24135992
Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura
2015-12-17
The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.
ERIC Educational Resources Information Center
Rowland, Ronald K.
2011-01-01
Research historically has demonstrated that a generational disconnect between the popular cultures from which students and teachers define normative behavior can impact classroom management and student learning. The purpose of this study was to examine attitudes, beliefs and perceptions of high school faculty toward the hip-hop culture and its…
NASA Astrophysics Data System (ADS)
Jain, Amber; Herman, Michael F.; Ouyang, Wenjun; Subotnik, Joseph E.
2015-10-01
We provide an in-depth investigation of transmission coefficients as computed using the augmented-fewest switches surface hopping algorithm in the low energy regime. Empirically, microscopic reversibility is shown to hold approximately. Furthermore, we show that, in some circumstances, including decoherence on top of surface hopping calculations can help recover (as opposed to destroy) oscillations in the transmission coefficient as a function of energy; these oscillations can be studied analytically with semiclassical scattering theory. Finally, in the spirit of transition state theory, we also show that transmission coefficients can be calculated rather accurately starting from the curve crossing point and running trajectories forwards and backwards.
Thermopower of molecular junctions: Tunneling to hopping crossover in DNA
NASA Astrophysics Data System (ADS)
Korol, Roman; Kilgour, Michael; Segal, Dvira
2016-12-01
We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].
Kim, Sungwoon; Kim, Jingu
2007-06-01
To investigate the potential psychological benefits of brief exercise and sport activities on positive mood alterations, 45 Korean high school and 232 undergraduate students enrolled in physical education and stress management classes voluntarily participated and were randomly assigned to one of four activities: aerobic exercise, body conditioning, hip-hop dancing, and ice skating. Mood changes from before to after exercise (2 pm to 3 pm) were measured based on a Korean translation of the Subjective Exercise Experiences Scale. The findings suggested that the aerobics and hip-hop dancing groups rated positive well-being higher than the body conditioning and ice skating groups. Immediately after exercise, psychological distress was rated lower in the aerobics and hip-hop dancing groups, as was fatigue.
Crowding and hopping in a protein’s diffusive transport on DNA
NASA Astrophysics Data System (ADS)
Koslover, Elena F.; Díaz de la Rosa, Mario; Spakowitz, Andrew J.
2017-02-01
Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work.
Nionelli, Luana; Pontonio, Erica; Gobbetti, Marco; Rizzello, Carlo Giuseppe
2018-02-02
Aiming at meeting the consumers' demand in terms of bio-preservation, the potential of the combination of the lactic acid bacteria fermentation and the addition of hop extract as natural preservative in breadmaking, was exploited. The antifungal properties of a hop (Humulus lupulus) extract were investigated, showing a significant inhibition of the hyphal growth of Aspergillus parasiticus, Penicillium carneum, Penicillium polonicum, Penicillium paneum, Penicillium chermesinum, Aspergillus niger, Penicillium roqueforti. Lactic acid bacteria belonging to species of Enterococcus feacium, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus helveticus, Lactobacillus curvatus, Pediococcus pentosaceus, and Pediococcus acidilactici were isolated from hop and subjected to selection based on kinetics of growth and acidification. The sourdough (hS) enriched with hop extract (hE), started with three selected strains, had phenols concentration and antioxidant activity higher than those obtained in the same condition but without the hE. Hop-sourdough used in breadmaking delayed the fungal growth (14 days), giving a bread characterized by free aminoacids concentration, antioxidant and phytase activities higher than bread started only with baker's yeast, with or without the addition of hE. Specific volume and cell-total area of the bread containing hE improved, and its sensory profile was characterized by typical sourdough attributes, and a moderate bitter/herbaceous perception.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.
The frequency noise spectrum of a magnetic tunnel junction (MTJ) based spin torque oscillator (STO) is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. Here, we find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layermore » is aligned away from the anti-parallel orientation w.r.t the reference layer. Lastly, these results indicate that the origin of 1/f frequency noise is related to mode-hopping which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.
The frequency noise spectrum of a magnetic tunnel junction based spin torque oscillator is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. We find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layer is aligned awaymore » from the anti-parallel orientation w.r.t the reference layer. These results indicate that the origin of 1/f frequency noise is related to mode-hopping, which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.« less
Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.; ...
2014-09-29
The frequency noise spectrum of a magnetic tunnel junction (MTJ) based spin torque oscillator (STO) is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. Here, we find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layermore » is aligned away from the anti-parallel orientation w.r.t the reference layer. Lastly, these results indicate that the origin of 1/f frequency noise is related to mode-hopping which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.« less
Hip-hop to prevent substance use and HIV among African-American youth: a preliminary investigation.
Turner-Musa, Jocelyn O; Rhodes, Warren A; Harper, P Thandi Hicks; Quinton, Sylvia L
2008-01-01
Substance use and HIV risk behaviors are increasing among African-American youth. Interventions that incorporate youth values and beliefs are needed to reduce this trajectory. Hip-hop plays an important role in the lives of many African-American youth and provides a context within which to prevent risky behaviors. The current study examines the efficacy of a hip-hop based substance use and HIV preventive intervention that targets African-American middle-school youth. The sample consists of 68 middle-school students who completed baseline and 6-month follow-up assessments. Findings suggest that students in the intervention group were significantly more likely to have higher knowledge of perception of drug risk and more knowledge about HIV/AIDS compared to students in the comparison group at the 6-month post-intervention assessment. Discussion is centered on implications of hip-hop as a viable approach for preventing substance use and HIV within a high-risk group.
Zheng, Wei; Yan, Xiaoyong; Zhao, Wei; Qian, Chengshan
2017-12-20
A novel large-scale multi-hop localization algorithm based on regularized extreme learning is proposed in this paper. The large-scale multi-hop localization problem is formulated as a learning problem. Unlike other similar localization algorithms, the proposed algorithm overcomes the shortcoming of the traditional algorithms which are only applicable to an isotropic network, therefore has a strong adaptability to the complex deployment environment. The proposed algorithm is composed of three stages: data acquisition, modeling and location estimation. In data acquisition stage, the training information between nodes of the given network is collected. In modeling stage, the model among the hop-counts and the physical distances between nodes is constructed using regularized extreme learning. In location estimation stage, each node finds its specific location in a distributed manner. Theoretical analysis and several experiments show that the proposed algorithm can adapt to the different topological environments with low computational cost. Furthermore, high accuracy can be achieved by this method without setting complex parameters.
Evaluation of fungicides for hop downy mildew, Hubbard, Oregon, 2016
USDA-ARS?s Scientific Manuscript database
This research was conducted to quantify the degree of control of the disease with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standard fungicide,...
Critical Hip Hop Pedagogy as a Form of Liberatory Praxis
ERIC Educational Resources Information Center
Akom, A. A.
2009-01-01
This article uses Paulo Freire's problem-posing method, youth participatory action research, and case study methodology to introduce an alternative instructional strategy called Critical Hip Hop Pedagogy (CHHP). This approach attempts to address deep-rooted ideologies to social inequities by creating a space in teacher education courses for…
Evaluation of fungicides for hop downy mildew, Woodburn, Oregon, 2016
USDA-ARS?s Scientific Manuscript database
This research was conducted to quantify the degree of control of the disease downy mildew with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standa...
ERIC Educational Resources Information Center
Adjapong, Edmund S.
2017-01-01
This dissertation explores the context of urban science education as it relates to the achievement and engagement of urban youth. This study provides a framework for Hip-Hop Pedagogy, an approach to teaching and learning anchored in the creative elements of Hip-Hop culture, in STEM as an innovative approach to teaching and learning demonstrates…
ERIC Educational Resources Information Center
Rodriguez, Louie F.
2009-01-01
Hip hop culture is typically excluded from conventional educational spaces within the U.S. Drawing on the experiences of an educator who works with urban high school students and university level pre- and in-service educators, this article examines the role of hip hop culture for student engagement in two settings--an alternative high school…
Moaddel, Ruin; Venkata, Swarajya Lakshmi Vattem; Tanga, Mary J; Bupp, James E; Green, Carol E; Iyer, Lalitha; Furimsky, Anna; Goldberg, Michael E; Torjman, Marc C; Wainer, Irving W
2010-10-15
A parallel chiral/achiral LC-MS/MS assay has been developed and validated to measure the plasma and urine concentrations of the enantiomers of ketamine, (R)- and (S)-Ket, in complex regional pain syndrome (CRPS) patients receiving a 5-day continuous infusion of a sub-anesthetic dose of (R,S)-Ket. The method was also validated for the determination of the enantiomers of the Ket metabolites norketamine, (R)- and (S)-norKet and dehydronorketamine, (R)- and (S)-DHNK, as well as the diastereomeric metabolites hydroxynorketamine, (2S,6S)-/(2R,6R)-HNK and two hydroxyketamines, (2S,6S)-HKet and (2S,6R)-Hket. In this method, (R,S)-Ket, (R,S)-norKet and (R,S)-DHNK and the diastereomeric hydroxyl-metabolites were separated and quantified using a C(18) stationary phase and the relative enantiomeric concentrations of (R,S)-Ket, (R,S)-norKet and (R,S)-DHNK were determined using an AGP-CSP. The analysis of the results of microsomal incubations of (R)- and (S)-Ket and a plasma and urine sample from a CRPS patient indicated the presence of 10 additional compounds and glucuronides. The data from the analysis of the patient sample also demonstrated that a series of HNK metabolites were the primary metabolites in plasma and (R)- and (S)-DHNK were the major metabolites found in urine. The results suggest that norKet is the initial, but not the primary metabolite and that downstream norKet metabolites play a role in (R,S)-Ket-related pain relief in CRPS patients. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Adjapong, Edmund S.
This dissertation explores the context of urban science education as it relates to the achievement and engagement of urban youth. This study provides a framework for Hip-Hop Pedagogy, an approach to teaching and learning anchored in the creative elements of Hip-Hop culture, in STEM as an innovative approach to teaching and learning demonstrates the effect that Hip-Hop Pedagogy, as a culturally relevant approach to teaching has on teaching and learning in an urban science classroom. This study establishes practical tools and approaches, which were formed from by theory and research that transcend the traditional monolithic approaches to teaching science. Participants in this study are middle school students who attend an urban school in one of the largest school systems in the country. This research showed that as result of utilizing Hip-Hop pedagogical practices, students reported that they developed a deeper understanding of science content, students were more likely to identify as scientists, and students were provided a space and opportunities to deconstruct traditional classroom spaces and structures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khaldi, O.; Kassmi, M.; El Manar University, LMOP, 2092 Tunis
2014-08-28
Capacitance nonlinearities were studied in atomic layer deposited HfO{sub 2} films using two types of signals: a pure ac voltage of large magnitude (ac nonlinearities) and a small ac voltage superimposed to a large dc voltage (dc nonlinearities). In theory, ac and dc nonlinearities should be of the same order of magnitude. However, in practice, ac nonlinearities are found to be an order of magnitude higher than dc nonlinearities. Besides capacitance nonlinearities, hopping conduction is studied using low-frequency impedance measurements and is discussed through the correlated barrier hopping model. The link between hopping and nonlinearity is established. The ac nonlinearitiesmore » are ascribed to the polarization of isolated defect pairs, while dc nonlinearities are attributed to electrode polarization which originates from defect percolation paths. Both the ac and dc capacitance nonlinearities display an exponential variation with voltage, which results from field-induced lowering of the hopping barrier energy.« less
Adaptive Transmission and Channel Modeling for Frequency Hopping Communications
2009-09-21
proposed adaptive transmission method has much greater system capacity than conventional non-adaptive MC direct- sequence ( DS )- CDMA system. • We...several mobile radio systems. First, a new improved allocation algorithm was proposed for multicarrier code-division multiple access (MC- CDMA ) system...Multicarrier code-division multiple access (MC- CDMA ) system with adaptive frequency hopping (AFH) has attracted attention of researchers due to its
Hip-hop solutions of the 2N-body problem
NASA Astrophysics Data System (ADS)
Barrabés, Esther; Cors, Josep Maria; Pinyol, Conxita; Soler, Jaume
2006-05-01
Hip-hop solutions of the 2N-body problem with equal masses are shown to exist using an analytic continuation argument. These solutions are close to planar regular 2N-gon relative equilibria with small vertical oscillations. For fixed N, an infinity of these solutions are three-dimensional choreographies, with all the bodies moving along the same closed curve in the inertial frame.
HapHop-Physio: a computer game to support cognitive therapies in children
Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S
2017-01-01
Background Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. PMID:28740440
2016-01-01
Humulus lupulus L. (hops) is a popular botanical dietary supplement used by women as a sleep aid and for postmenopausal symptom relief. In addition to its efficacy for menopausal symptoms, hops can also modulate the chemical estrogen carcinogenesis pathway and potentially protect women from breast cancer. In the present study, an enriched hop extract and the key bioactive compounds [6-prenylnarigenin (6-PN), 8-prenylnarigenin (8-PN), isoxanthohumol (IX), and xanthohumol (XH)] were tested for their effects on estrogen metabolism in breast cells (MCF-10A and MCF-7). The methoxyestrones (2-/4-MeOE1) were analyzed as biomarkers for the nontoxic P450 1A1 catalyzed 2-hydroxylation and the genotoxic P450 1B1 catalyzed 4-hydroxylation pathways, respectively. The results indicated that the hop extract and 6-PN preferentially induced the 2-hydroxylation pathway in both cell lines. 8-PN only showed slight up-regulation of metabolism in MCF-7 cells, whereas IX and XH did not have significant effects in either cell line. To further explore the influence of hops and its bioactive marker compounds on P450 1A1/1B1, mRNA expression and ethoxyresorufin O-dealkylase (EROD) activity were measured. The results correlated with the metabolism data and showed that hop extract and 6-PN preferentially enhanced P450 1A1 mRNA expression and increased P450 1A1/1B1 activity. The aryl hydrocarbon receptor (AhR) activation by the isolated compounds was tested using xenobiotic response element (XRE) luciferase construct transfected cells. 6-PN was found to be an AhR agonist that significantly induced XRE activation and inhibited 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) induced XRE activity. 6-PN mediated induction of EROD activity was also inhibited by the AhR antagonist CH223191. These data show that the hop extract and 6-PN preferentially enhance the nontoxic estrogen 2-hydroxylation pathway through AhR mediated up-regulation of P450 1A1, which further emphasizes the importance of
Kea, J; Kramer, J; Forwell, L; Birmingham, T
2001-08-01
Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.
Landmann, Marianne; Sellmann, Cathrin; Engstler, Anna Janina; Ziegenhardt, Doreen; Jung, Finn; Brombach, Christine; Bergheim, Ina
2017-01-01
Using a binge-drinking mouse model, we aimed to determine whether hops (Humulus lupulus) in beer is involved in the less damaging effects of acute beer consumption on the liver in comparison with ethanol. Female C57BL/6 J mice were either fed one iso-alcoholic and iso-caloric bolus dose of ethanol, beer, beer without hops (6 g ethanol/kg body weight) or an iso-caloric bolus of maltodextrin control solution. Markers of steatosis, intestinal barrier function, activation of toll-like receptor 4 signaling cascades, lipid peroxidation and lipogenesis were determined in liver, small intestine and plasma 2 h and 12 h after acute alcohol ingestion. Alcohol-induced hepatic fat accumulation was significantly attenuated in mice fed beer whereas in those fed beer without hops, hepatic fat accumulation was similar to that found in ethanol-fed mice. While markers of intestinal barrier function e.g. portal endotoxin levels and lipogenesis only differed slightly between groups, hepatic concentrations of myeloid differentiation primary response gene 88, inducible nitric oxide synthase (iNOS) and plasminogen-activator inhibitor 1 protein as well as of 4-hydroxynonenal and 3-nitrotyrosine protein adducts were similarly elevated in livers of mice fed ethanol or beer without hops when compared with controls. Induction of these markers was markedly attenuated in mice fed hops-containing beer. Taken together, our data suggest that hops in beer markedly attenuated acute alcohol-induced liver steatosis in female mice through mechanisms involving a suppression of iNOS induction in the liver. © The Author 2016. Medical Council on Alcohol and Oxford University Press. All rights reserved.
Kim, Hyehwang; Segal, Dvira
2017-04-28
The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.
Maietti, Annalisa; Brighenti, Virginia; Bonetti, Gianpiero; Tedeschi, Paola; Prencipe, Francesco Pio; Benvenuti, Stefania; Brandolini, Vincenzo; Pellati, Federica
2017-08-05
Humulus lupulus L., commonly named hop, is well-known for its sedative and estrogenic activity. While hop cones are widely characterized, only few works have been carried out on the young shoots of this plant. In the light of this, the aim of this study was to identify for the first time the flavonoids present in young hop shoots and to compare the composition of samples harvested from different locations in Northern Italy with their antioxidant activity. The samples were extracted by means of dynamic maceration with methanol. The HPLC-UV/DAD, HPLC-ESI-MS and MS 2 analysis were carried out by using an Ascentis C 18 column (250×4.6mm I.D., 5μm), with a mobile phase composed of 0.1M formic acid in both water and acetonitrile, under gradient elution. Quercetin and kaempferol glycosides were the main compounds identified and quantified in hop shoot extracts. Total flavonols ranged from 2698±185 to 517±48μg/g (fresh weight). The antioxidant activity was determined by means of the radical scavenging activity assay against diphenylpicrylhydrazyl (DPPH) and by using a photochemiluscence assay with a Photochem ® apparatus. The results showed that hop shoots represent a new source of flavonols; therefore, they can be useful for a possible incorporation in the diet as a functional food or applied in the nutraceutical ambit. Copyright © 2017 Elsevier B.V. All rights reserved.
Accelerated sampling by infinite swapping of path integral molecular dynamics with surface hopping
NASA Astrophysics Data System (ADS)
Lu, Jianfeng; Zhou, Zhennan
2018-02-01
To accelerate the thermal equilibrium sampling of multi-level quantum systems, the infinite swapping limit of a recently proposed multi-level ring polymer representation is investigated. In the infinite swapping limit, the ring polymer evolves according to an averaged Hamiltonian with respect to all possible surface index configurations of the ring polymer and thus connects the surface hopping approach to the mean-field path-integral molecular dynamics. A multiscale integrator for the infinite swapping limit is also proposed to enable efficient sampling based on the limiting dynamics. Numerical results demonstrate the huge improvement of sampling efficiency of the infinite swapping compared with the direct simulation of path-integral molecular dynamics with surface hopping.
ERIC Educational Resources Information Center
Prier, Darius D.
2012-01-01
"Culturally Relevant Teaching" centers hip-hop culture as a culturally relevant form of critical pedagogy in urban pre-service teacher education programs. In this important book, Darius D. Prier explores how hip-hop artists construct a sense of democratic education and pedagogy with transformative possibilities in their schools and communities. In…
ERIC Educational Resources Information Center
Sulé, Venice Thandi
2015-01-01
Given the prevalence of racial segregation in the U.S., college is an opportunity to prepare students for diversity through cross-racial interaction. Hip-hop, a culture steeped in black and Latino experiences, has significant white supporters. Through diversity and critical whiteness frameworks, this research considers how white hip-hop collegians…
NASA Astrophysics Data System (ADS)
Garfinkle, Robert A.
1997-07-01
Introduction; Preface; Acknowledgements; 1. How to use this book and what you are going to see; 2. How the sky works, determining your field of view, observing tips and how to navigate in the night sky; 3. January - Taurus and Orion: the bull and hunter; 4. February - Canis Minor, Canis Major, and Puppis: dog days in February and Jason's Argo; 5. March - Cancer, Leo, and Corvus: a crab, the king of the beasts, and a crow; 6. April - Ursa Major: a dipper round tripper; 7. May - Coma Berenices and Virgo: the sparkling hair of Berenice and the wheat maiden and her bushel of galaxies; 8. June - Libra and Lupus: the balance scales and the wolf; 9. July - Scorpius, Sagittarius, and Scutum: the scorpion, archer, and shield of John Sobieski; 10. August - Draco: following the trail of the dragon; 11. September - Cygnus, Lyra, Vulpecula, and Sagitta: the swan, lyre, fox, and arrow; 12. October - Andromeda and Perseus: the chained lady and her rescuer; 13. November - Cepheus and Cassiopeia: the king and queen of Joppa; 14. December - Pisces, Triangulum, and Aries: of fishes, a triangle, and a ram; 15. Messier Marathon, a sundown to sunup hop across the skies; Appendix A: Classification tables; Appendix B: The constellations; Appendix C: The Greek alphabet; Appendix D: Decimalization of the day; Glossary; Bibliography; Index.
Crossing the Lexicon: Anglicisms in the German Hip Hop Community
ERIC Educational Resources Information Center
Garley, Matthew E.
2012-01-01
The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…
Dorandeu, Frederic; Baille, Valerie; Mikler, John; Testylier, Guy; Lallement, Guy; Sawyer, Thomas; Carpentier, Pierre
2007-05-20
Soman poisoning is known to induce full-blown tonic-clonic seizures, status epilepticus (SE), seizure-related brain damage (SRBD) and lethality. Previous studies in guinea-pigs have shown that racemic ketamine (KET), with atropine sulfate (AS), is very effective in preventing death, stopping seizures and protecting sensitive brain areas when given up to 1h after a supra-lethal challenge of soman. The active ketamine isomer, S(+) ketamine (S-KET), is more potent than the racemic mixture and it also induces less side-effects. To confirm the efficacy of KET and to evaluate the potential of S-KET for delayed medical treatment of soman-induced SE, we studied different S-KET dose regimens using the same paradigm used with KET. Guinea-pigs received pyridostigmine (26 microg/kg, IM) 30min before soman (62 microg/kg, 2 LD(50), IM), followed by therapy consisting of atropine methyl nitrate (AMN) (4 mg/kg, IM) 1min following soman exposure. S-KET, with AS (10mg/kg), was then administered IM at different times after the onset of seizures, starting at 1h post-soman exposure. The protective efficacy of S-KET proved to be comparable to KET against lethality and SRBD, but at doses two to three times lower. As with KET, delaying treatment by 2h post-poisoning greatly reduced efficacy. Conditions that may have led to an increased S-KET brain concentration (increased doses or number of injections, adjunct treatment with the oxime HI-6) did not prove to be beneficial. In summary, these observations confirm that ketamine, either racemic or S-KET, in association with AS and possibly other drugs, could be highly effective in the delayed treatment of severe soman intoxication.
Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation
NASA Astrophysics Data System (ADS)
Moktan, Hem; Pezza, Roberto; Zhou, Donghua
2015-03-01
The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.
Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen
2016-04-06
Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.
ERIC Educational Resources Information Center
Ibrahim, Awad
2017-01-01
Straddling between the purely political and the poetically artistic, I am arguing, is a Global Hip-Hop Nation (GHHN), which is yet to be charted and its cartography is yet to be demarcated. Taking two examples, the first a Hip-Hop song from within the Arab Spring and the second from the "favelas" in Brazil, my intent is to show what…
Yu, Hua-Gen
2008-05-21
A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.
Topical amitriptyline and ketamine for post-herpetic neuralgia and other forms of neuropathic pain.
Sawynok, Jana; Zinger, Celia
2016-01-01
Neuropathic pain (NP) has several therapeutic options but efficacy is limited and adverse effects occur, such that additional treatment options are needed. A topical formulation containing amitriptyline 4% and ketamine 2% (AmiKet) may provide such an option. This report summarizes both published and unpublished results of clinical trials with AmiKet. In post-herpetic neuralgia (PHN), AmiKet produces a significant analgesia which is comparable to that produced by oral gabapentin. In diabetic painful neuropathy, AmiKet showed a strong trend towards pain reduction. In mixed neuropathic pain, case series reports suggest a favourable response rate, but are limited by trial characteristics. AmiKet is absorbed minimally following topical administration. Over 700 patients have now received topical AmiKet in clinical regimens, and it is well-tolerated with the adverse effects mainly being application site reactions. Both agents are polymodal, and several mechanisms may contribute to the peripheral efficacy of AmiKet. Topical AmiKet has the potential to be a first-line treatment option for PHN, and to be useful in other NP conditions. Furthermore, AmiKet has the potential to be an adjunct to systemic therapies, with the targeting of a peripheral compartment in addition to central sites of action representing a rational drug combination.
Robotic investigation on effect of stretch reflex and crossed inhibitory response on bipedal hopping
Rosendo, Andre; Ikemoto, Shuhei; Shimizu, Masahiro; Hosoda, Koh
2018-01-01
To maintain balance during dynamic locomotion, the effects of proprioceptive sensory feedback control (e.g. reflexive control) should not be ignored because of its simple sensation and fast reaction time. Scientists have identified the pathways of reflexes; however, it is difficult to investigate their effects during locomotion because locomotion is controlled by a complex neural system and current technology does not allow us to change the control pathways in living humans. To understand these effects, we construct a musculoskeletal bipedal robot, which has similar body structure and dynamics to those of a human. By conducting experiments on this robot, we investigate the effects of reflexes (stretch reflex and crossed inhibitory response) on posture during hopping, a simple and representative bouncing gait with complex dynamics. Through over 300 hopping trials, we confirm that both the stretch reflex and crossed response can contribute to reducing the lateral inclination during hopping. These reflexive pathways do not use any prior knowledge of the dynamic information of the body such as its inclination. Beyond improving the understanding of the human neural system, this study provides roboticists with biomimetic ideas for robot locomotion control. PMID:29593088
Gold Digger or Video Girl: the salience of an emerging hip-hop sexual script.
Ross, Jasmine N; Coleman, Nicole M
2011-02-01
Concerns have been expressed in the common discourse and scholarly literature about the negative influence of Hip-Hop on its young listeners' ideas about sex and sexuality. Most of the scholarly literature has focused on the impact of this urban, Black media on young African American girls' sexual self-concept and behaviours. In response to this discourse, Stephens and Phillips (2003) proposed a Hip-Hop sexual scripting model that theorises about specific sexual scripts for young African American women. Their model includes eight different sexual scripts including the Gold Digger script. The present study proposes a ninth emerging script - the Video Girl. Participants were 18 female African American college students, between the ages of 18 and 30 years old from a large urban public university in the Southwest USA. Using q-methodology the present study found support for the existence of a Video Girl script. In addition, the data indicates that this script is distinct but closely related to Stephens and Phillips' Gold Digger script. These findings support their theory by suggesting that Hip-Hop sexual scripts are salient and hold real meaning for this sample.
A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs
Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng
2017-01-01
As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs. PMID:28098818
Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A
2017-03-28
Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO 2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.
Oszust, Karolina; Frąc, Magdalena; Gryta, Agata; Bilińska, Nina
2014-01-01
The knowledge about microorganisms—activity and diversity under hop production is still limited. We assumed that, different systems of hop production (within the same soil and climatic conditions) significantly influence on the composition of soil microbial populations and its functional activity (metabolic potential). Therefore, we compared a set of soil microbial properties in the field experiment of two hop production systems (a) ecological based on the use of probiotic preparations and organic fertilization (b) conventional—with the use of chemical pesticides and mineral fertilizers. Soil analyses included following microbial properties: The total number microorganisms, a bunch of soil enzyme activities, the catabolic potential was also assessed following Biolog EcoPlates®. Moreover, the abundance of ammonia-oxidizing archaea (AOA) was characterized by terminal restriction fragment length polymorphism analysis (T-RFLP) of PCR ammonia monooxygenase α-subunit (amoA) gene products. Conventional and ecological systems of hop production were able to affect soil microbial state in different seasonal manner. Favorable effect on soil microbial activity met under ecological, was more probably due to livestock-based manure and fermented plant extracts application. No negative influence on conventional hopyard soil was revealed. Both type of production fulfilled fertilizing demands. Under ecological production it was due to livestock-based manure fertilizers and fermented plant extracts application. PMID:24897025
Intersection of Hip-Hop and Geoscience: Changes in The Climate
NASA Astrophysics Data System (ADS)
López, R. D.; Heraldo, S. E.; Nawman, M. A.; Gerry, V. R.; Gerry, M. A.
2017-12-01
Professionals and educators in the science, technology, engineering, art, and mathematics (STEAM) field rely heavily on scientific communication to convey innovations, concepts, and evidence-based policy. The geosciences presents itself as a unique field to communicate respective scientific endeavors, as research efforts have direct impacts on the Earth's resources and understanding natural processes. Several of the authors have previously composed musical pieces that integrated Earth Sciences with music, utilizing this as mechanism to not only foster creativity, but to also establish more dynamic outreach efforts. Unfortunately, geoscience does not readily present itself as a field that is easily accessible to minorities - particularly women, people of color, and those from disadvantaged communities. However, music is somewhat of a universal form of communication that is accessible to everyone. It is through the intersection of hip-hop and geoscience, that topics can be introduced to communities in unique ways. Flows in Hydrogeology was a previous project that several of the authors produced as a means to connect with youth who identify with the hip-hop community, while encouraging inquiry in the STEAM fields. Several of the authors grew up and still reside in some of the most violent cities in the United States of America. The authors have utilized their respective backgrounds in both upbringing and career endeavors to help bridge the gap between science and disadvantaged communities. The musical piece, Changes in the Climate, illustrates the power of understanding the changes in one's life and surrounding world via delivery of concepts with hip-hop and rap. Therefore this musical composition not only integrates STEAM and music, but also serves as mechanism for outreach and encouraging diversity. Such actions could yield the success of accessing untapped potential, while fostering unique opportunities for future collaboration between professionals in geoscience
Tripathi, Pankaj; Anuradha, S; Ghosal, Gargi; Muniyappa, K
2006-12-08
Saccharomyces cerevisiae HOP1, which encodes a component of synaptonemal complex (SC), plays an important role in both gene conversion and crossing over between homologs, as well as enforces meiotic recombination checkpoint control over the progression of recombination intermediates. In hop1Delta mutants, meiosis-specific double-strand breaks (DSBs) are reduced to 10% of the wild-type level, and at aberrantly late times, these DSBs are processed into inter-sister recombination intermediates. However, the underlying mechanism by which Hop1 protein regulates these nuclear events remains obscure. Here we show that Hop1 protein interacts selectively with the Holliday junction, changes its global conformation and blocks the dissolution of the junction by a RecQ helicase. The Holliday junction-Hop1 protein complexes are significantly more stable at higher ionic strengths and molar excess of unlabeled competitor DNA than complexes containing other recombination intermediates. Structural analysis of the Holliday junction using 2-aminopurine fluorescence emission, DNase I footprinting and KMnO4 probing provide compelling evidence that Hop1 protein binding induces significant distortion at the center of the Holliday junction. We propose that Hop1 protein might coordinate the physical monitoring of meiotic recombination intermediates with the process of branch migration of Holliday junction.
Gao, Zhengguang; Liu, Hongzhan; Ma, Xiaoping; Lu, Wei
2016-11-10
Multi-hop parallel relaying is considered in a free-space optical (FSO) communication system deploying binary phase-shift keying (BPSK) modulation under the combined effects of a gamma-gamma (GG) distribution and misalignment fading. Based on the best path selection criterion, the cumulative distribution function (CDF) of this cooperative random variable is derived. Then the performance of this optical mesh network is analyzed in detail. A Monte Carlo simulation is also conducted to demonstrate the effectiveness of the results for the average bit error rate (ABER) and outage probability. The numerical result proves that it needs a smaller average transmitted optical power to achieve the same ABER and outage probability when using the multi-hop parallel network in FSO links. Furthermore, the system use of more number of hops and cooperative paths can improve the quality of the communication.
Sequential vortex hopping in an array of artificial pinning centers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keay, J. C.
2010-02-24
We use low-temperature magnetic force microscopy (MFM) to study the hopping motion of vortices in an array of artificial pinning centers (APCs). The array consists of nanoscale holes etched in a niobium thin film by Ar-ion sputtering through an anodic aluminum-oxide template. Variable-temperature magnetometry shows a transition temperature of 7.1 K and an enhancement of the magnetization up to the third matching field at 5 K. Using MFM with attractive and repulsive tip-vortex interaction, we measure the vortex-pinning strength and investigate the motion of individual vortices in the APC array. The depinning force for individual vortices at low field rangedmore » from 0.7 to 1.2 pN. The motion of individual vortices was found to be reproducible and consistent with movement between adjacent holes in the film. The movements are repeatable but the sequence of hops depends on the scan direction. This asymmetry in the motion indicates nonuniform local pinning, a consequence of array disorder and hole-size variation.« less
Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N
2001-09-01
Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.
Robust hopping based on virtual pendulum posture control.
Sharbafi, Maziar A; Maufroy, Christophe; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Seyfarth, Andre
2013-09-01
A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved.
dos Reis, Amir Curcio; Correa, João Carlos Ferrari; Bley, André Serra; Rabelo, Nayra Deise dos Anjos; Fukuda, Thiago Yukio; Lucareli, Paulo Roberto Garcia
2015-10-01
Cross-sectional study. To compare the biomechanical strategies of the trunk and lower extremity during the transition period between the first and second hop of a single-leg triple hop test in women with and without patellofemoral pain (PFP). Recent literature has shown that PFP is associated with biomechanical impairments of the lower extremities. A number of studies have analyzed the position of the trunk and lower extremities for functional activities such as walking, squatting, jumping, and the step-down test. However, studies on more challenging activities, such as the single-leg triple hop test, may be more representative of sports requiring jumping movements. Women between 18 and 35 years of age (control group, n = 20; PFP group, n = 20) participated in the study. Three-dimensional kinematic and kinetic data were collected during the transition period between the first and second hops while participants performed the single-leg triple hop test. Compared to the control group, women with PFP exhibited greater (P<.05) anterior and ipsilateral trunk lean, contralateral pelvic drop, hip internal rotation and adduction, and ankle eversion, while exhibiting less hip and knee flexion. A significant difference (P<.05) in time to peak joint angle was also found between groups for all the variables analyzed, except anterior pelvic tilt and hip flexion. In addition, women with PFP exhibited greater (P<.05) hip and knee abductor internal moments. Compared to the control group, women with PFP exhibited altered trunk, pelvis, hip, knee, and ankle kinematics and kinetics.
Red crown rot of Hop in Oregon caused by Phomopsis tuberivora
USDA-ARS?s Scientific Manuscript database
During July 2007, a hop grower in Marion County, Oregon reported weak growth and death of plants of cultivar Fuggle. Affected plants were aggregated within and among rows, and had underdeveloped lateral branches, uneven and weak bines, and chlorotic leaves; severely affected plants were dead. The p...
NASA Astrophysics Data System (ADS)
Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong
2018-06-01
Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.
Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus
Liu, Huili; Sung Choe, Hwan; Chen, Yabin; ...
2017-09-05
Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less
Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Huili; Sung Choe, Hwan; Chen, Yabin
Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less
ERIC Educational Resources Information Center
Chiu, Nicholas
2005-01-01
In this paper, the author explores the connections between hip hop and rap, sexism and homophobia, and children and teens. He describes the implications or potential consequences of sexism and homophobia within the music and media culture of hip hop and rap (with the focus on how it affects young viewers and fans in terms of gender [identity]…
ERIC Educational Resources Information Center
Hallman, Heidi L.
2009-01-01
This article provides a rich representation of how in-school practices that recruit students' "out-of-school" literacies, such as hip hop, can be used as critical bridges in students' learning. Hip hop, conceptualized in this article as an "out-of-school" literacy, works as a vehicle for curricular change at Eastview School for Pregnant and…
Costs and returns of producing hops in established tree plantations
Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith Woeste
2017-01-01
This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...
Efros-Shklovskii variable range hopping and nonlinear transport in 1 T /1 T'-MoS2
NASA Astrophysics Data System (ADS)
Papadopoulos, N.; Steele, G. A.; van der Zant, H. S. J.
2017-12-01
We have studied temperature- and electric-field-dependent carrier transport in single flakes of MoS2 treated with n -butyllithium. The temperature dependence of the four-terminal resistance follows the Efros-Shklovskii variable range hopping conduction mechanism. From measurements in the Ohmic and non-Ohmic regime, we estimate the localization length and the average hopping length of the carriers, as well as the effective dielectric constant. Furthermore, a comparison between two- and four-probe measurements yields a contact resistance that increases significantly with decreasing temperature.
NASA Astrophysics Data System (ADS)
Itai, K.
1987-02-01
Two models which describe one-dimensional hopping motion of a heavy particle interacting with phonons are discussed. Model A corresponds to hopping in 1D metals or to the polaron problem. In model B the momentum dependence of the particle-phonon coupling is proportional to k-1/2. The scaling equations show that only in model B does localization occur for a coupling larger than a critical value. In the localization region this model shows close analogy to the Caldeira-Leggett model for macroscopic quantum tunneling.
NASA Astrophysics Data System (ADS)
Abaza, Mohamed; Mesleh, Raed; Mansour, Ali; Aggoune, el-Hadi
2015-01-01
The performance analysis of a multi-hop decode and forward relaying free-space optical (FSO) communication system is presented in this paper. The considered FSO system uses intensity modulation and direct detection as means of transmission and reception. Atmospheric turbulence impacts are modeled as a log-normal channel, and different weather attenuation effects and geometric losses are taken into account. It is shown that multi-hop is an efficient technique to mitigate such effects in FSO communication systems. A comparison with direct link and multiple-input single-output (MISO) systems considering correlation effects at the transmitter is provided. Results show that MISO multi-hop FSO systems are superior than their counterparts over links exhibiting high attenuation. Monte Carlo simulation results are provided to validate the bit error rate (BER) analyses and conclusions.
Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J
2017-02-01
This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.
Media/Visual Literacy Art Education: Sexism in Hip-Hop Music Videos
ERIC Educational Resources Information Center
Chung, Sheng Kuan
2007-01-01
Media programs like hip-hop music videos are powerful aesthetic agents that inspire teenagers. Thus, they have tremendous influence on young people's identity formation, lifestyle choices, and knowledge construction which are manifested in the ways teens dress, express themselves, behave, and interact with each other. However, because of the…
Hajirahimkhan, Atieh; Simmler, Charlotte; Yuan, Yang; Anderson, Jeffrey R.; Chen, Shao-Nong; Nikolić, Dejan; Dietz, Birgit M.; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.
2013-01-01
The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus) and licorice (Glycyrrhiza spec.) to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata) in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE)-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of botanical
Deformation sequences of the Day Nui Con Voi metamorphic belt, northern Vietnam
NASA Astrophysics Data System (ADS)
Yeh, M. W.; Lee, T. Y.; Lo, C. H.; Chung, S. L.; Lan, C. Y.; Lee, J. C.; Lin, T. S.; Lin, Y. J.
2003-04-01
The correlation of structure, microstructure and metamorphic assemblages is of fundamental importance to the understanding of the complex tectonic history and kinematics of the Day Nui Con Voi (DNCV) metamorphic belt in Vietnam along the Ailao Shan-Red River (ASRR) shear zone as it provides constraints on the relative timing of the deformation, kinematics and metamorphism. High-grade metamorphic rocks of amphibolite faces showed consistent deformation sequences of three folding events followed by one brittle deformation through all four cross sections from Lao Cai to Viet Tri indicated the DNCV belt experienced similar deformation condition throughout its length. The first deformation event, D1, produced up-right folds (locally preserved) with sub-vertical, NE-SW striking axial planes with dextral sense of shear probably formed during the early phase of the lowermost Triassic Indosinian orogeny. Followed by this compressional event is a gravitational collapsing event, D2, which is the major deformation and metamorphic event characterized by kyanite grade metamorphism and large scale horizontal folds with NW-SE (320) striking sub-horizontal axial pane showing sinsistral sense of shear most likely formed during the Oligocene-Miocene SE extrusion of Indochina peninsula. The 3rd folding event, D3, is a post-metamorphism doming event with NW-SE (310) striking sub-vertical axial plane that folded/tilted the once sub-horizontal D2 axial planes into shallowly (<30 degrees) NE dipping on the NE limb, and SW dipping on the SW limb possibly due to left-lateral movement of the N-S trending Xian Shui He fault system in Mid-Miocene. The outward decreasing of the metamorphic grade from kyanite to garnet then biotite indicated the D3 occurred post metamorphism. Reactivation of the sub-horizontal D2 fold axial planes showed dextral sense of shear possibly due to Late Miocene-Pliocene right-lateral movement of the ASRR shear zone. This right lateral movement continuously deformed
Wang, Gang; Zhao, Zhikai; Ning, Yongjie
2018-05-28
As the application of a coal mine Internet of Things (IoT), mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH) is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.
Lankveld, D P K; Driessen, B; Soma, L R; Moate, P J; Rudy, J; Uboh, C E; van Dijk, P; Hellebrekers, L J
2006-12-01
Ketamine (KET) possesses analgesic and anti-inflammatory activity at sub-anesthetic doses, suggesting a benefit of long-term KET treatment in horses suffering from pain, inflammatory tissue injury and/or endotoxemia. However, data describing the pharmacodynamic effects and safety of constant rate infusion (CRI) of KET and its pharmacokinetic profile in nonpremedicated horses are missing. Therefore, we administered to six healthy horses a CRI of 1.5 mg/kg/h KET over 320 min following initial drug loading. Cardiopulmonary parameters, arterial blood gases, glucose, lactate, cortisol, insulin, nonesterified fatty acids, and muscle enzyme levels were measured, as were plasma concentrations of KET and its metabolites using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Levels of sedation and muscle tension were scored. Respiration and heart rate significantly increased during the early infusion phase. Glucose and cortisol significantly varied both during and after infusion. During CRI all horses scored 0 on sedation. All but one horse scored 0 on muscle tension, with one mare scoring 1. All other parameters remained within or close to physiological limits without significant changes from pre-CRI values. The mean plasma concentration of KET during the 1.5 mg/kg/h KET CRI was 235 ng/mL. The decline of its plasma concentration-time curve of both KET and norketamine (NKET) following the CRI was described by a two-compartmental model. The metabolic cascade of KET was NKET, hydroxynorketamine (HNK), and 5,6-dehydronorketamine (DHNK). The KET median elimination half-lives (t1/2alpha and t1/2beta) were 2.3 and 67.4 min, respectively. The area under the KET plasma concentration-time curve (AUC), elimination was 76.0 microg.min/mL. Volumes of C1 and C2 were 0.24 and 0.79 L/kg, respectively. It was concluded that a KET CRI of 1.5 mg/kg/h can safely be administered to healthy conscious horses for at least 6 h, although a slight modification of the initial infusion rate
Hop bitter acids exhibit anti-fibrogenic effects on hepatic stellate cells in vitro.
Saugspier, Michael; Dorn, Christoph; Thasler, Wolfgang E; Gehrig, Manfred; Heilmann, Jörg; Hellerbrand, Claus
2012-04-01
Female inflorescences of the hop plant Humulus lupulus L. contain a variety of secondary metabolites with bitter acids (BA) as quantitatively dominating secondary metabolites. The use of hops in beer brewing has a long history due to the antibacterial effects of the BA and their typical bitter taste. Furthermore, hop cones are used in traditional medicine and for pharmaceutical purposes. Recent studies indicate that BA may affect activity of the transcription factor NFκB. NFκB plays a key role in the activation process of hepatic stellate cells (HSC), which is the key event of hepatic fibrosis. The aim of this study was to investigate the effect of BA on HSC (activation) and their potential to inhibit molecular processes involved in the pathogenesis of hepatic fibrosis. HSC were isolated from murine and human liver tissue and incubated with a characterized fraction of bitter acids purified from a CO(2) hop extract. At a concentration of 25μg/ml BA started to induce LDH leakage. Already at lower concentrations BA lead to a dose dependent inhibition of HSC proliferation and inhibited IκB-α-phosphorylation, nuclear p65 translocation and binding activity in a dose dependent way (up to 10μg/ml). Accordingly, the same BA-doses inhibited the expression of pro-inflammatory and NFκB regulated genes as MCP-1 and RANTES, but did not affect expression of genes not related to NFκB signaling. In addition to the effect on activated HSC, BA inhibited the in vitro activation process of freshly isolated HSC as evidenced by delayed expression of collagen I and α-SMA mRNA and protein. Together, these findings indicate that BA inhibit NFκB activation, and herewith the activation and development of profibrogenic phenotype of HSC. Thus, bitter acids appear as potential functional nutrients for the prevention or treatment hepatic fibrosis in chronic liver disease. Copyright © 2011 Elsevier Inc. All rights reserved.
"Writing in the Margins": Brazilian Hip-Hop as an Educational Project
ERIC Educational Resources Information Center
Pardue, Derek
2004-01-01
Hip-hop culture's force as part of globalization in the fields of economics, popular aesthetics, and identity politics has been well documented. However, its articulation to educational practices has received less attention. This article draws upon fieldwork conducted in 1999 and 2002 in a youth correctional facility to analyze how state…
NASA Astrophysics Data System (ADS)
Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada
2011-06-01
The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.
Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in Lactobacillus brevis.
Schurr, Benjamin C; Hahne, Hannes; Kuster, Bernhard; Behr, Jürgen; Vogel, Rudi F
2015-04-01
The main bittering component in beer, hop iso-α-acids, have been characterised as weak acids, which act as ionophores impairing microbial cells' function under acidic conditions as present in beer. Besides medium pH, divalent cations play a central role regarding the efficacy of the antimicrobial effect. The iso-α-acids' non-bitter derivatives humulinic acids can be found in isomerised hop extracts and can be generated during hop storage. Therefore, they have been under investigation concerning their influence on beer sensory properties. This study sketches the molecular mechanism behind iso-α-acids' antimicrobial activity in Lactobacillus (L.) brevis regarding their ionophore activity versus the dependence of the inhibitory potential on manganese binding, and suggests humulinic acids as novel tasteless food preservatives. We designed and synthesised chemically modified iso-α-acids to enhance the basic understanding of the molecular mechanism of antimicrobial iso-α-acids. It could be observed that a manganese-binding dependent transmembrane redox reaction (oxidative stress) plays a crucial role in inhibition. Privation of an acidic hydroxyl group neither erased ionophore activity, nor did it entirely abolish antimicrobial activity. Humulinic acids proved to be highly inhibitory, even outperforming iso-α-acids. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Bellavista, Paolo; Giannelli, Carlo
The availability of heterogeneous wireless interfaces and of growing computing resources on widespread portable devices pushes for enabling innovative deployment scenarios where mobile nodes dynamically self-organize to offer Internet connectivity to their peers via dynamically established multi-hop multi-path opportunities. We claim the suitability of novel, mobility-aware, and application-layer middleware based on lightweight evaluation indicators to support the complexity of that scenario, involving heterogeneous wireless technologies over differentiated and statically unpredictable execution environments. To validate these claims, we have implemented an innovative middleware that manages the durability/throughput-aware formation and selection of different multi-hop paths simultaneously. This paper specifically focuses on how our middleware effectively exploits Bluetooth for multi-hop multi-path networking, by pointing out the crucial role of i) compliance with standard solutions to favor rapid deployment over off-the-shelf equipment and ii) the reduction of the usual overhead associated with some expensive Bluetooth operations, e.g., device inquiry. In particular, the paper shows how it is possible, on the one hand, to extend JSR-82 to portably access monitoring indicators for lightweight mobility/throughput estimations and, on the other hand, to reduce the time needed to update the set of available Bluetooth-based connectivity opportunities via approximated and lightweight forms of discovery.
Hsp90 can Accommodate the Simultaneous Binding of the FKBP52 and HOP Proteins
Hildenbrand, Zacariah L.; Molugu, Sudheer K.; Herrera, Nadia; Ramirez, Citlally; Xiao, Chuan; Bernal, Ricardo A.
2011-01-01
The regulation of steroidogenic hormone receptor-mediated activity plays an important role in the development of hormone-dependent cancers. For example, during prostate carcinogenesis, the regulatory function played by the androgen receptor is often converted from a growth suppressor to an oncogene thus promoting prostate cancer cell survival and eventual metastasis. Within the cytoplasm, steroid hormone receptor activity is regulated by the Hsp90 chaperone in conjunction with a series of co-chaperone proteins. Collectively, Hsp90 and its binding associates form a large heteromeric complex that scaffold the fully mature receptor for binding with the respective hormone. To date our understanding of the interactions between Hsp90 with the various TPR domain-containing co-chaperone proteins is limited due to a lack of available structural information. Here we present the stable formation of Hsp902-FKBP521- HOP2 and Hsp902-FKBP521-p232-HOP2 complexes as detected by immunoprecipitation, time course dynamic light scattering and electron microscopy. The simultaneous binding of FKBP52 and HOP to the Hsp90 dimer provide direct evidence of a novel chaperone sub-complex that likely plays a transient role in the regulation of the fully mature steroid hormone receptor. PMID:21378414
ERIC Educational Resources Information Center
Irby, Decoteau J.; Hall, H. Bernard; Hill, Marc L.
2013-01-01
Hip-hop-based education (HHBE) research analyzes how hip-hop culture is used to produce favorable educational outcomes. Despite its richness, the work reveals little about how to prepare practicing K-12 teachers to use HHBE toward the critical ends reflected in extant HHBE literature. In this article, we challenge many tacit assumptions of HHBE…
Partially suppressed shot noise in hopping conduction: observation in SiGe quantum wells
Kuznetsov; Mendez; Zuo; Snider; Croke
2000-07-10
We have observed shot noise in the hopping conduction of two-dimensional carriers confined in a p-type SiGe quantum well at a temperature of 4 K. Moreover, shot noise is suppressed relative to its "classical" value 2eI by an amount that depends on the length of the sample and the carrier density. We have found a suppression factor to the classical value of about one-half for a 2 &mgr;m long sample, and of one-fifth for a 5 &mgr;m sample. In each case, the factor decreased slightly as the density increased toward the insulator-metal transition. We explain these results in terms of the characteristic length ( approximately 1 &mgr;m in our case) of the inherent inhomogeneity of hopping transport, obtained from percolation theory.
Furbish, David; Schmeeckle, Mark; Schumer, Rina; Fathel, Siobhan
2016-01-01
We describe the most likely forms of the probability distributions of bed load particle velocities, accelerations, hop distances, and travel times, in a manner that formally appeals to inferential statistics while honoring mechanical and kinematic constraints imposed by equilibrium transport conditions. The analysis is based on E. Jaynes's elaboration of the implications of the similarity between the Gibbs entropy in statistical mechanics and the Shannon entropy in information theory. By maximizing the information entropy of a distribution subject to known constraints on its moments, our choice of the form of the distribution is unbiased. The analysis suggests that particle velocities and travel times are exponentially distributed and that particle accelerations follow a Laplace distribution with zero mean. Particle hop distances, viewed alone, ought to be distributed exponentially. However, the covariance between hop distances and travel times precludes this result. Instead, the covariance structure suggests that hop distances follow a Weibull distribution. These distributions are consistent with high-resolution measurements obtained from high-speed imaging of bed load particle motions. The analysis brings us closer to choosing distributions based on our mechanical insight.
Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke
2016-09-01
[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.
Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke
2016-01-01
[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670
AirLand Battle-Future--A Hop, Skip, or Jump?
1990-12-15
degradations to accuracy. Certain families of munitions will become smart and others will become brilliant in terms of their capability to kill a target... WORK UNIT ELEMENT NO. NO. NO. ACCESSION NO. 11. TITLE (Include Security Classification) AirLand Battle Future--A Hop, Skip, or Jump? 12. PERSONAL AUTHOR...leve.. Military tactics have traditionally been, first and foremost, a contest of wills . Any battle, past, present, or future will reveal that moral
NASA Astrophysics Data System (ADS)
Kurisu, Masamitsu; Yano, Hajime; Yoshimitsu, Tetsuo; Kubota, Takashi; Adachi, Tadashi; Kuroda, Yoji
Verification of the hopping mechanism using permanent magnets by microgravity experiments at ZARM drop tower will be presented in this report. The mechanism, which is called HMPM (Hopping Mechanism with Permanent Magnets) was developed for a small asteroid exploration rover to replace with conventional locomotion mechanism such as wheels and crawlers. The main part of HMPM consists of three permanent magnets which are two stationary magnets and one movable magnet aligned between them. HMPM itself hops by utilizing the impact force generated when the movable magnet sticks to one of the stationary magnets. The features of HMPM are that the large impact force can be generated in spite of low-power consumption, and that it can be easily miniaturized and modularized. On the other hand, the weak point of HMPM is that the performance of the mechanism cannot be controlled directly, since the performance is decided by its design. Therefore, it is significant to evaluate the performance of HMPM before it is mounted on a flight model of rover. On the microgravity experiments at the drop tower, an imitation rover with 0.8kg weight is tested to hop with the operation of a prototype HMPM mounted on the rover. The prototype module weighs only 0.03kg with dimension 0.033 m in width, 0.046 m in height, and 0.012 m in depth, except the drive circuit and power source. Experimental results show the availability of HMPM. Also, the hopping performance of HMPM which is evaluated from the motion of rover recorded by cameras equipped inside the dropping capsule is compared with the estimated performance derived from the theoretical model. From the investigation, validity of the evaluation method based on the theoretical model is discussed. In order that the potential ability of HMPM is fully derived, optimal design of HMPM will require the evaluation method. The experiments at ZARM drop tower were accomplished based on the agreement on the Hayabusa-2 project by DLR-JAXA. And we received
Smith, Christopher E; Odoh, Samuel O; Ghosh, Soumen; Gagliardi, Laura; Cramer, Christopher J; Frisbie, C Daniel
2015-12-23
Self-assembled conjugated molecular wires containing thiophene up to 6 nm in length were grown layer-by-layer using click chemistry. Reflection-absorption infrared spectroscopy, ellipsometry and X-ray photoelectron spectroscopy were used to follow the stepwise growth. The electronic structure of the conjugated wires was studied with cyclic voltammetry and UV-vis spectroscopy as well as computationally with density functional theory (DFT). The current-voltage curves (±1 V) of the conjugated molecular wires were measured with conducting probe atomic force microscopy (CP-AFM) in which the molecular wire film bound to a gold substrate was contacted with a conductive AFM probe. By systematically measuring the low bias junction resistance as a function of length for molecules 1-4 nm long, we extracted the structure dependent tunneling attenuation factor (β) of 3.4 nm(-1) and a contact resistance of 220 kΩ. The crossover from tunneling to hopping transport was observed at a molecular length of 4-5 nm with an activation energy of 0.35 eV extracted from Arrhenius plots of resistance versus temperature. DFT calculations revealed localizations of spin densities (polarons) on molecular wire radical cations. The calculations were employed to gauge transition state energies for hopping of polarons along wire segments. Individual estimated transition state energies were 0.2-0.4 eV, in good agreement with the experimental activation energy. The transition states correspond to flattening of dihedral angles about specific imine bonds. These results open up possibilities to further explore the influence of molecular architecture on hopping transport in molecular junctions, and highlight the utility of DFT to understand charge localization and associated hopping-based transport.
Charge Carrier Hopping Dynamics in Homogeneously Broadened PbS Quantum Dot Solids.
Gilmore, Rachel H; Lee, Elizabeth M Y; Weidman, Mark C; Willard, Adam P; Tisdale, William A
2017-02-08
Energetic disorder in quantum dot solids adversely impacts charge carrier transport in quantum dot solar cells and electronic devices. Here, we use ultrafast transient absorption spectroscopy to show that homogeneously broadened PbS quantum dot arrays (σ hom 2 :σ inh 2 > 19:1, σ inh /k B T < 0.4) can be realized if quantum dot batches are sufficiently monodisperse (δ ≲ 3.3%). The homogeneous line width is found to be an inverse function of quantum dot size, monotonically increasing from ∼25 meV for the largest quantum dots (5.8 nm diameter/0.92 eV energy) to ∼55 meV for the smallest (4.1 nm/1.3 eV energy). Furthermore, we show that intrinsic charge carrier hopping rates are faster for smaller quantum dots. This finding is the opposite of the mobility trend commonly observed in device measurements but is consistent with theoretical predictions. Fitting our data to a kinetic Monte Carlo model, we extract charge carrier hopping times ranging from 80 ps for the smallest quantum dots to over 1 ns for the largest, with the same ethanethiol ligand treatment. Additionally, we make the surprising observation that, in slightly polydisperse (δ ≲ 4%) quantum dot solids, structural disorder has a greater impact than energetic disorder in inhibiting charge carrier transport. These findings emphasize how small improvements in batch size dispersity can have a dramatic impact on intrinsic charge carrier hopping behavior and will stimulate further improvements in quantum dot device performance.
Corazza, Ornella; Assi, Sulaf; Schifano, Fabrizio
2013-06-01
This article reviews the recreational use of ketamine ("Special K"; KET) and explores the recent diffusion of its new derivative methoxetamine ("Special M"; MXE). The literature search on the nonclinical/recreational use of KET and MXE was carried out in a range of medical databases. Considering the limitations of peer-reviewed information, data were integrated with a qualitative assessment of a range of websites, drug fora, and other online resources including e-newsgroups, chat rooms, mailing lists, e-newsletters, and bulletin boards. The recreational use of KET has started since its discovery in 1962. This was due to its rapid onset, short duration of action, and peculiar psychotropic effects ("K-hole"). The latter effect ranges from confusion to dissociation and depersonalization (near-death experience). However, KET abuse is often associated with physical and psychological side effects, of which the worst is urological/bladder toxicity. Recently, MXE has emerged as a legal and "bladder-friendly" KET alternative. MXE presents with the same dissociative effect of KET, but with slower onset and longer duration of action. However, MXE seems to be associated with worse side effects than KET, ranging from mood disturbances/suicidal attempts to acute cerebellar toxicity. After 50 years of its discovery, KET has led to the emergence of MXE. However, this latter derivative does not appear to be a safer alternative to KET itself. © 2013 John Wiley & Sons Ltd.
Research on the frequency hopping bistatic sonar system
NASA Astrophysics Data System (ADS)
Liang, Guo-long; Zhang, Yao; Zhang, Guang-pu; Liu, Kai
2011-10-01
A new model for bistatic sonar system is established, in which frequency hopping (FH) signals are used for targets detection according to some rules. This model can decrease the time between adjacent signals and obtain more information in a unit time. The receiving system will receive and process the signals of different frequency respectively, according the FH pattern, for detecting and locating targets. This method can helps yield more stable and accurate outputs, using the characteristic of the FH signals, increase the ability of anti-detection and anti partial-band jamming.
Ketoconazole-induced testicular damage in rats reduced by Gentiana extract.
Amin, Amr
2008-04-01
Ketoconazole (KET) is an antifungal drug with a broad spectrum of activity that also induces reproductive toxicity in humans and animals. The protective effect of Gentiana (GEN) extract (Gentiana lutea) against KET-induced testicular damage was evaluated in male Wistar rats. GEN extract was administered orally (1g/kgbwt/day) for 26 days. Three weeks after extract administration, KET was co-administered intraperitoneally at a dose of 100mg/kg once a day for 5 days. KET-induced reproductive toxicity was associated with clear reductions of the weights of testes and epididymides, sperm indices and serum testosterone levels. KET also induced severe testicular histopathological lesions such as degeneration of the seminiferous tubules and depletion of germ cells. In addition, marked oxidative damage to testicular lipids and alterations of natural antioxidants (catalase (CAT) and superoxide dismutase (SOD)) were reported in association with KET toxicity. Most of the KET-induced effects were greatly decreased with the concomitant application of GEN extract. This study suggests a protective role of GEN extract that could be attributed to its antioxidant properties.
How to boost the sluggish lithium-ion hopping dynamic in borophene?
NASA Astrophysics Data System (ADS)
Liu, Jia; Chen, Xianfei; Deng, Xiaoyu; Zhang, Wentao; Li, Junfeng; Xiao, Beibei; Pu, Min
2018-05-01
In light of low atomic mass, three types of experimentally synthetized borophene including β12, χ3 and striped t-sheet have been predicted to be promising anode materials for lithium-ion batteries (LIBs) with extremely high capacity. However, the rate performances of β12 and χ3 are quite poor with high diffusion barrier of 0.66-0.81 eV on β12 and 0.60-0.85 eV on χ3 in contrast with that in t-sheet (typically <0.1 eV). Isolation of t-sheet from their blend remains a fundamental challenge in the field of nanotechnology and a mechanistic understanding and control over the hopping dynamic of Li+ therein are thus of extremely important to facilitate the development of borophene-based anode material, but still lacking. In this work, we performed a comprehensive theoretical investigation on the adsorptions and migrations of Li+ on perfect and defective β12 and χ3 based on density functional theory. We determined a new kind of vacancy in β12 that modulates the adsorption and boosts the diffusion of Li+ nearby remarkably. With the aid of charge doping, we uncover a general mechanism (charge-concentration mechanism) involved with the celebrated bonding theory of borophene, where the hopping barrier of Li+ on β12 could be reduced to be 0.06 eV, rationalizing the boosting Li+ hopping as a result of electron deficiency in vacant borophene. By extending our calculations to H functionalized borophene and Ag supported borophene, we further confirm the validity of the "charge-concentration mechanism" under more realistic experimental conditions. The proposed mechanism could be used as a guiding principle to improve or develop new borophene-based electrode materials with high rate performance for LIBs.
Hopping Conduction and Bacteria: Transport Properties of Disordered Reaction-Diffusion Systems
NASA Astrophysics Data System (ADS)
Missel, Andrew; Dahmen, Karin
2008-03-01
Reaction-diffusion (RD) systems are used to model everything from the formation of animal coat patterns to the spread of genes in a population to the seasonal variation of plankton density in the ocean. In all of these problems, disorder plays a large role, but determining its effects on transport properties in RD systems has been a challenge. We present here both analytical and numerical studies of a particular disordered RD system consisting of particles which are allowed to diffuse and compete for resources (2A->A) with spatially homogeneous rates, reproduce (A->2A) in certain areas (``oases''), and die (A->0) everywhere else (the ``desert''). In the low oasis density regime, transport is mediated through rare ``hopping events'' in which a small number of particles diffuse through the desert from one oasis to another; the situation is mathematically analogous to hopping conduction in doped semiconductors, and this analogy, along with some ideas from first passage percolation theory, allows us to make some quantitative predictions about the transport properties of the system on a large scale.
Frequency synchronization of a frequency-hopped MFSK communication system
NASA Technical Reports Server (NTRS)
Huth, G. K.; Polydoros, A.; Simon, M. K.
1981-01-01
This paper presents the performance of fine-frequency synchronization. The performance degradation due to imperfect frequency synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of frequency hops used in the estimator. The effect of imperfect fine-time synchronization is also included in the calculation of fine-frequency synchronization performance to obtain the overall performance degradation due to synchronization errors.
Purely hopping conduction in c-axis oriented LiNbO3 thin films
NASA Astrophysics Data System (ADS)
Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay
2009-05-01
Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.
Occurrence of Theaspirane and its Odorant Degradation Products in Hop and Beer.
Scholtes, Caroline; Nizet, Sabrina; Massart, Hadrien; Gerbaux, Pascal; Collin, Sonia
2015-09-23
In model oxidized media, six theaspirane-derived compounds were identified by gas chromatography-high resolution mass spectrometry: 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, dihydrodehydro-β-ionone, two monoepoxides, and a derived alcohol. Only 4-hydroxy-7,8-dihydro-β-ionone and dihydrodehydro-β-ionone have been described previously in the literature. Investigation of hop revealed five of these compounds in free form together with theaspirane (especially in the Mosaic variety), while the Citra and Amarillo hop varieties emerged as very interesting for the release of theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone from glucoside precursors. For the first time, theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, and both monoepoxides were found in a fresh commercial top fermentation beer (only theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone have recently been mentioned as Gueuze constituents).
Youth Perspectives on the Intersections of Violence, Gender, and Hip-Hop
ERIC Educational Resources Information Center
Hernandez, Diana; Weinstein, Hannah; Munoz-Laboy, Miguel
2012-01-01
Youth's perceptions of violence within their social environments can provide relevant insights into the gender-based interpersonal violence epidemic in inner-city communities. To explore this issue, we examined two sets of narratives with young men and women, aged 15 to 21, involved in hip-hop culture in New York City. In the analysis, we reveal…
Roos, Paulien E; Button, Kate; Sparkes, Valerie; van Deursen, Robert W M
2014-02-07
Anterior cruciate ligament (ACL) injury can result in failure to return to pre-injury activity levels and future osteoarthritis predisposition. Single leg hop is used in late rehabilitation to evaluate recovery and inform treatment but biomechanical understanding of this activity is insufficient. This study investigated single leg hop for distance aiming to evaluate if ACL patients had recovered: (1) landing strategies and (2) medio-lateral knee control. We hypothesized that patients with reconstructive surgery (ACLR) would have more similar landing strategies and knee control to healthy controls than patients treated conservatively (ACLD). 16 ACLD and 23 ACLR subjects were compared to 20 healthy controls (CONT). Kinematic and ground reaction force data were collected while subjects hopped their maximum distance. The main output parameters were hop distance, peak knee flexor angles and extensor moments and Fluency (a measure introduced to represent medio-lateral knee control). Statistical differences between ACL and control groups were analyzed using a general linear model univariate analysis, with COM velocity prior to landing as covariate. Hop distance was the smallest for ACLD and largest for CONT (p<0.001; ACLD 57.1±14.1; ACLR 75.1±17.8; CONT 77.7±14.07% height). ACLR used a similar kinematic strategy to CONT, but had a reduced peak knee extensor moment (p<0.001; ACLD 0.32±0.14; ACLR 0.31±0.16; CONT 0.42±0.13 BW.height). Fluency was reduced in both ACLD and ACLR (p=0.006; ACLD 0.13±0.34; ACLR 0.14±0.34; CONT 0.17±0.41s). Clinical practice uses hopping distance to evaluate ACL patients' recovery. This study demonstrated that aspects such as movement strategies and knee control need to be evaluated. © 2013 Published by Elsevier Ltd.
Xergia, Sofia A; Pappas, Evangelos; Zampeli, Franceska; Georgiou, Spyros; Georgoulis, Anastasios D
2013-03-01
Within-subject and between-subject cross-sectional study. To investigate symmetry in hop-test performance, strength, and lower extremity kinematics 6 to 9 months following anterior cruciate ligament reconstruction (ACLR). Despite the extensive body of literature involving persons following ACLR, no study has comprehensively evaluated measures of strength, lower extremity kinematics, and functional performance of functional hop tests in this population. The subjects were 22 men (mean ± SD age, 28.8 ± 11.2 years) who had ACLR using a bone-patellar tendon-bone autograft 6 to 9 (7.01 ± 0.93) months previously and 22 healthy male controls (age, 24.8 ± 9.1 years). Participants completed a self-report questionnaire and underwent isokinetic strength testing and functional and kinematic assessment of the single-, triple-, and crossover-hop tests. Two-way analyses of variance were used to test for differences between the ACLR group and the control group, and between the 2 lower extremities of the ACLR group. Compared to the control group, the ACLR group had greater isokinetic knee extension torque deficits at all speeds (P ≤.001) and greater performance asymmetry for all 3 hop tests (P<.001). Compared to the noninvolved lower extremity, the involved lower extremity of the ACLR group exhibited less ankle dorsiflexion and knee flexion in the phases of propulsion (P ≤.014) and landing (P ≤.032). When compared to the control group, the involved lower extremity exhibited less ankle dorsiflexion in the propulsion phase (P<.001) but higher hip flexion in the landing phase (P = .014). Six to 9 months following ACLR, patients continue to demonstrate functional hop and isokinetic knee extension deficits, as well as kinematic differences, during the propulsion and landing phases of the hop tests.
Hip-Hop to Health Jr. for Latino preschool children.
Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan
2006-09-01
Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.
Learning Processes and Social Mobilization in a Swedish Metropolitan Hip-Hop Collective
ERIC Educational Resources Information Center
Beach, Dennis; Sernhede, Ove
2012-01-01
Based on ethnographic research on the encounter between local culture and schools in multicultural suburban areas, this article explores possibilities suggested by autonomous learning activities in a hip-hop collective that may have a potential to break urban segregation patterns. The collective's artistic production raises questions that have not…
ERIC Educational Resources Information Center
Pulido, Isaura
2009-01-01
Using Critical Race and Latino Critical theories, this study examines 20 in-depth interviews conducted by the author with Mexican and Puerto Rican youth from the Chicago area. The author contends that youth utilized hip hop music in multiple and overlapping ways, engaging hip hop music as both a pedagogy that centers the perspectives of people of…
NASA Astrophysics Data System (ADS)
Hu, Lilei; Mandelis, Andreas; Melnikov, Alexander; Lan, Xinzheng; Hoogland, Sjoerd; Sargent, Edward H.
2017-01-01
Solution-processed colloidal quantum dots (CQDs) are promising materials for realizing low-cost, large-area, and flexible photovoltaic devices. The study of charge carrier transport in quantum dot solids is essential for understanding energy conversion mechanisms. Recently, solution-processed two-layer oleic-acid-capped PbS CQD solar cells with one layer treated with tetrabutylammonium iodide (TBAI) serving as the main light-absorbing layer and the other treated with 1,2-ethanedithiol (EDT) acting as an electron-blocking/hole-extraction layer were reported. These solar cells demonstrated a significant improvement in power conversion efficiency of 8.55% and long-term air stability. Coupled with photocarrier radiometry measurements, this work used a new trap-state mediated exciton hopping transport model, specifically for CQD thin films, to unveil and quantify exciton transport mechanisms through the extraction of hopping transport parameters including exciton lifetimes, hopping diffusivity, exciton detrapping time, and trap-state density. It is shown that PbS-TBAI has higher trap-state density than PbS-EDT that results in higher PbS-EDT exciton lifetimes. Hopping diffusivities of both CQD thin film types show similar temperature dependence, particularly higher temperatures yield higher hopping diffusivity. The higher diffusivity of PbS-TBAI compared with PbS-EDT indicates that PbS-TBAI is a much better photovoltaic material than PbS-EDT. Furthermore, PCR temperature spectra and deep-level photothermal spectroscopy provided additional insights to CQD surface trap states: PbS-TBAI thin films exhibit a single dominant trap level, while PbS-EDT films with lower trap-state densities show multiple trap levels.
HPLC Analysis of alpha and beta Acids in Hops
DOE Office of Scientific and Technical Information (OSTI.GOV)
Danenhower, Travis; Force, Leyna; Petersen, Kenneth
Early in brewing history, a variety of herbs and spices (such as coriander, rosemary, yarrow, and bog myrtle) were used to flavor beer (1). It is evident, from the Bavarian Purity Law of 1516, that a major shift in beer flavoring occurred around the middle of the second millennium. This law declared that only three ingredients could be used to brew beer: barley, water, and hops (1), thus eliminating other spices from German beer. (The importance of yeast had not yet been uncovered.)
Cross-Layer Scheme to Control Contention Window for Per-Flow in Asymmetric Multi-Hop Networks
NASA Astrophysics Data System (ADS)
Giang, Pham Thanh; Nakagawa, Kenji
The IEEE 802.11 MAC standard for wireless ad hoc networks adopts Binary Exponential Back-off (BEB) mechanism to resolve bandwidth contention between stations. BEB mechanism controls the bandwidth allocation for each station by choosing a back-off value from one to CW according to the uniform random distribution, where CW is the contention window size. However, in asymmetric multi-hop networks, some stations are disadvantaged in opportunity of access to the shared channel and may suffer severe throughput degradation when the traffic load is large. Then, the network performance is degraded in terms of throughput and fairness. In this paper, we propose a new cross-layer scheme aiming to solve the per-flow unfairness problem and achieve good throughput performance in IEEE 802.11 multi-hop ad hoc networks. Our cross-layer scheme collects useful information from the physical, MAC and link layers of own station. This information is used to determine the optimal Contention Window (CW) size for per-station fairness. We also use this information to adjust CW size for each flow in the station in order to achieve per-flow fairness. Performance of our cross-layer scheme is examined on various asymmetric multi-hop network topologies by using Network Simulator (NS-2).
Kivlan, Benjamin R; Carcia, Christopher R; Christoforetti, John J; Martin, RobRoy L
2016-08-01
Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Quasi-experimental, cohort comparison. Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop
Bauer, M; Leigh, C; Peirce, E; Breed, W G
2005-01-01
In most mammals, post-testicular sperm maturation is completed in the caput and corpus epididymides, with storage occurring in the cauda epididymides. However, in the spinifex hopping mouse, Notomys alexis, epididymal sperm transit is rapid and some sperm storage occurs in the distal region of the vas deferens. The aim of the present study was to determine whether the rapid progression of sperm into the vas deferens in the hopping mouse results in late sperm maturation. To determine this, sperm nuclei from the epididymides and vasa deferentia of laboratory and hopping mice were compared for: (1) thiol content after staining with monobromobimane (mBBr); (2) chromatin resistance to acid denaturation following incubation with acetic alcohol and staining with acridine orange; and (3) chromatin resistance to in vitro decondensation after incubation with 1% sodium dodecyl sulfate (SDS). It was found that, whereas laboratory mouse sperm completed chromatin condensation by the time they reached the cauda epididymidis, hopping mouse sperm nuclei from the vas deferens showed significantly less mBBr fluorescence and a greater proportion of sperm were resistant to decondensation with SDS than those in the cauda epididymidis. Therefore, the results of the present study indicate that, unlike in the laboratory mouse, hopping mouse chromatin condensation of spermatozoa continues in the vas deferens and this may be due, at least in part, to rapid epididymal transit.
Genetic and epigenetic stability of cryopreserved and cold-stored hops (Humulus lupulus L.).
Peredo, Elena L; Arroyo-García, Rosa; Reed, Barbara M; Revilla, M Angeles
2008-12-01
Conventional cold storage and cryopreservation methods for hops (Humulus lupulus L.) are available but, to our knowledge, the genetic and epigenetic stability of the recovered plants have not been tested. This study analyzed 51 accessions of hop using the molecular techniques, Random Amplified DNA Polymorphism (RAPD) and Amplified Fragment Length Polymorphism (AFLP), revealing no genetic variation among greenhouse-grown controls and cold stored or cryopreserved plants. Epigenetic stability was evaluated using Methylation Sensitive Amplified Polymorphism (MSAP). Over 36% of the loci were polymorphic when the cold and cryo-treated plants were compared to greenhouse plants. The main changes were demethylation events and they were common to the cryopreserved and cold stored plants indicating the possible effect of the in vitro establishment process, an essential step in both protocols. Protocol-specific methylation patterns were also detected indicating that both methods produced epigenetic changes in plants following cold storage and cryopreservation.
Hip-Hop, Digital Media, and the Changing Face of Music Education
ERIC Educational Resources Information Center
Thibeault, Matthew D.
2010-01-01
In this article, the author describes a true story about Dwayne Carter Jr., a rapper most music educators probably don't know but one who is beloved throughout the world as "Lil Wayne." Critics overwhelmingly proclaimed Lil Wayne the top rapper in the hip-hop game, and the album and his work leading up to it were universally regarded as some of…
Yang, Li; Teixeira, Paulo José Pereira Lima; Biswas, Surojit; Finkel, Omri M; He, Yijian; Salas-Gonzalez, Isai; English, Marie E; Epple, Petra; Mieczkowski, Piotr; Dangl, Jeffery L
2017-02-08
Independently evolved pathogen effectors from three branches of life (ascomycete, eubacteria, and oomycete) converge onto the Arabidopsis TCP14 transcription factor to manipulate host defense. However, the mechanistic basis for defense control via TCP14 regulation is unknown. We demonstrate that TCP14 regulates the plant immune system by transcriptionally repressing a subset of the jasmonic acid (JA) hormone signaling outputs. A previously unstudied Pseudomonas syringae (Psy) type III effector, HopBB1, interacts with TCP14 and targets it to the SCF COI1 degradation complex by connecting it to the JA signaling repressor JAZ3. Consequently, HopBB1 de-represses the TCP14-regulated subset of JA response genes and promotes pathogen virulence. Thus, HopBB1 fine-tunes host phytohormone crosstalk by precisely manipulating part of the JA regulon to avoid pleiotropic host responses while promoting pathogen proliferation. Copyright © 2017 Elsevier Inc. All rights reserved.
Sampling Memories: Using Hip-Hop Aesthetics to Learn from Urban Schooling Experiences
ERIC Educational Resources Information Center
Petchauer, Emery
2012-01-01
This article theorizes and charts the implementation of a learning activity designed from the hip-hop aesthetic of sampling. The purpose of this learning activity was to enable recent urban school graduates to reflect upon their previous schooling experiences as a platform for future learning in higher education. This article illustrates what…
Cultivating the Spatial Politics of Community-Based Literacy Practices in Hip-Hop
ERIC Educational Resources Information Center
Prier, Darius D.
2013-01-01
In this article, the social imagination of community-based sites of urban resistance enable out-of-school literacy practices in Black popular culture to foreground the contemporary context in which youth empowerment is nurtured in out-of-school learning settings. Second, the author chronicles how youth advocates in hip-hop--based community…
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Nanoscale live cell imaging using hopping probe ion conductance microscopy
Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.
2009-01-01
We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505
Powdery mildew caused by Podosphaera macularis on hop (Humulus lupulus) in North Carolina
USDA-ARS?s Scientific Manuscript database
In June 2015, a grower in western North Carolina detected powdery mildew in a small hop yard. Characteristic colonies of the pathogen where observed on cultivars Cashmere, Cascade, and Chinook. Leaves with powdery mildew were collected from cultivar Cashmere for confirmation of the pathogen identi...
Characterization of resistance to powdery mildew in the Hop cultivars Newport and Comet
USDA-ARS?s Scientific Manuscript database
Hop powdery mildew, caused by Podosphaera macularis, is an important disease in the Northwestern U.S. Outbreaks of powdery mildew on cultivars previously resistant to the disease have been reported increasingly with the emergence of virulent pathogen strains capable of overcoming a commonly deployed...
ERIC Educational Resources Information Center
Stewart, Pearl
2004-01-01
In December 2000, Dr. Thomas Earl Midgette had harsh words for the hip-hop movement that was sweeping his campus. When he was interviewed for an article in "Black Issues" titled "The Miseducation of Hip-Hop," Midgette didn't hold back: "You see students walking on campus reciting rap lyrics when they should be reciting…
Pua, Yong-Hao; Mentiplay, Benjamin F; Clark, Ross A; Ho, Jia-Ying
2017-11-01
Study Design Prospective cohort. Background Quadriceps strength is associated with hop distance and jump height in persons who have undergone anterior cruciate ligament (ACL) reconstruction. However, it is unknown whether the ability to rapidly generate quadriceps torque in the early phase of recovery is associated with future hopping and jumping performance in this population. Objective To evaluate the prospective associations among quadriceps strength and rate of torque development (RTD) and single-leg hop for distance, vertical jump height, vertical ground reaction force (vGRF), and vertical force loading rate during a landing task in persons who have undergone ACL reconstruction. Methods Seventy patients with unilateral ACL reconstruction participated. At 6 weeks post ACL reconstruction, isometric quadriceps strength and RTD were measured using a dynamometer. At 6 months following ACL reconstruction, patients performed the single-leg hop for distance test. Patients also performed the single-leg vertical jump test on a force plate that measured maximum jump height, vGRF, and average loading rate during landing. Results Both quadriceps strength and RTD at 6 weeks post ACL reconstruction were associated with all hopping and jumping measures at 6 months post ACL reconstruction (P≤.04). Single-leg hop distance was associated more closely with quadriceps strength than with quadriceps RTD (P = .05), and vertical jump height and vGRF measures were associated more closely with quadriceps RTD than with quadriceps strength (P = .05 and P<.01, respectively). Both quadriceps measures were associated with loading rate. Conclusion Quadriceps strength and RTD are complementary but distinct predictors of future hopping and jumping performance in persons who have undergone ACL reconstruction. These findings may contribute to improved rehabilitation of patients who are at risk for poor jumping/hopping performance and abnormal knee loading. J Orthop Sports Phys Ther 2017
Chen, W-L; Chen, Y-T; Huang, S-Y; Yang, C-Y; Wu, C-D; Chang, C-W
2017-08-01
Anterior cruciate ligament (ACL) reconstruction (ACLR) surgeries successfully restore anterior tibial translation but not tibial rotation. This study aimed to explore landing strategies focusing on the control of tibial rotation at landing when the ACL is most vulnerable. Three groups of male subjects (50 ACLRs, 26 basketball players, and 31 controls) participated in one-leg forward hop tests for determining the tibial rotatory landing strategies adopted during the initial landing phase. The differences in knee kinematics and muscle activities between internal and external tibial rotatory (ITR, ETR) landing strategies were examined. A higher proportion of basketball players (34.6%) were found to adopt ITR strategies (controls: 6.5%), exhibiting significantly greater hopping distance and knee strength. After adjusting for hopping distance, subjects adopting ITR strategies were found to hop faster with straighter knees at foot contact and with greater ITR and less knee adduction angular displacement during the initial landing phase. However, significantly greater angular displacement in knee flexion, greater medial hamstring activities, and greater co-contraction index of hamstrings and medial knee muscles were also found during initial landing. Our results support the importance of the recruitments of medial hamstrings or the local co-contraction in assisting the rotatory control of the knee during initial landing for avoiding ACL injuries. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Key features of hip hop dance motions affect evaluation by judges.
Sato, Nahoko; Nunome, Hiroyuki; Ikegami, Yasuo
2014-06-01
The evaluation of hip hop dancers presently lacks clearly defined criteria and is often dependent on the subjective impressions of judges. Our study objective was to extract hidden motion characteristics that could potentially distinguish the skill levels of hip hop dancers and to examine the relationship between performance kinematics and judging scores. Eleven expert, six nonexpert, and nine novice dancers participated in the study, where each performed the "wave" motion as an experimental task. The movements of their upper extremities were captured by a motion capture system, and several kinematic parameters including the propagation velocity of the wave were calculated. Twelve judges evaluated the performances of the dancers, and we compared the kinematic parameters of the three groups and examined the relationship between the judging scores and the kinematic parameters. We found the coefficient of variation of the propagation velocity to be significantly different among the groups (P < .01) and highly correlated with the judging scores (r = -0.800, P < .01). This revealed that the variation of propagation velocity was the most dominant variable representing the skill level of the dancers and that the smooth propagation of the wave was most closely related to the evaluation by judges.
Xu, Yang; Luo, Xiong; Wang, Weiping; Zhao, Wenbing
2017-01-01
Integrating wireless sensor network (WSN) into the emerging computing paradigm, e.g., cyber-physical social sensing (CPSS), has witnessed a growing interest, and WSN can serve as a social network while receiving more attention from the social computing research field. Then, the localization of sensor nodes has become an essential requirement for many applications over WSN. Meanwhile, the localization information of unknown nodes has strongly affected the performance of WSN. The received signal strength indication (RSSI) as a typical range-based algorithm for positioning sensor nodes in WSN could achieve accurate location with hardware saving, but is sensitive to environmental noises. Moreover, the original distance vector hop (DV-HOP) as an important range-free localization algorithm is simple, inexpensive and not related to the environment factors, but performs poorly when lacking anchor nodes. Motivated by these, various improved DV-HOP schemes with RSSI have been introduced, and we present a new neural network (NN)-based node localization scheme, named RHOP-ELM-RCC, through the use of DV-HOP, RSSI and a regularized correntropy criterion (RCC)-based extreme learning machine (ELM) algorithm (ELM-RCC). Firstly, the proposed scheme employs both RSSI and DV-HOP to evaluate the distances between nodes to enhance the accuracy of distance estimation at a reasonable cost. Then, with the help of ELM featured with a fast learning speed with a good generalization performance and minimal human intervention, a single hidden layer feedforward network (SLFN) on the basis of ELM-RCC is used to implement the optimization task for obtaining the location of unknown nodes. Since the RSSI may be influenced by the environmental noises and may bring estimation error, the RCC instead of the mean square error (MSE) estimation, which is sensitive to noises, is exploited in ELM. Hence, it may make the estimation more robust against outliers. Additionally, the least square estimation (LSE
Augmented Ehrenfest dynamics yields a rate for surface hopping
NASA Astrophysics Data System (ADS)
Subotnik, Joseph E.
2010-04-01
We present a new algorithm for mixed quantum-classical dynamics that helps bridge the gap between mean-field (Ehrenfest) and surface-hopping dynamics by defining a natural rate of decoherence. In order to derive this decoherence result, we have expanded the number of independent variables in the usual Ehrenfest routine so that mixed quantum-classical derivatives are now propagated in time alongside the usual Ehrenfest variables. Having done so, we compute a unique rate of decoherence using two independent approaches: (i) by comparing the equations of motion for the joint nuclear-electronic probability density in phase space according to Ehrenfest dynamics versus partial Wigner transform dynamics and (ii) by introducing a frozen Gaussian interpretation of Ehrenfest dynamics which allows nuclear wave packets to separate. The first consequence of this work is a means to rigorously check the accuracy of standard Ehrenfest dynamics. Second, this paper suggests a nonadiabatic dynamics algorithm, whereby the nuclei are propagated on the mean-field (Ehrenfest) potential energy surface and undergo stochastic decoherence events. Our work resembles the surface-hopping algorithm of Schwartz and co-workers [J. Chem. Phys. 123, 234106 (2005)]—only now without any adjustable parameters. For the case of two electronic states, we present numerical results on the so-called "Tully problems" and emphasize that future numerical benchmarking is still needed. Future work will also treat the problem of three or more electronic states.
Isolation of the mite Myocoptes musculinus Koch from the Spinifex Hopping mouse (Notomys alexis).
Old, J M; Hill, N J; Deane, E M
2007-04-01
This paper reports on the isolation and identification of the fur-clasping mite, Myocoptes musculinus, from the faeces of the Spinifex Hopping mouse (Notomys alexis). This investigation adds to the sparse records of ectoparasites collected from native Australian murids.
NASA Astrophysics Data System (ADS)
Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir
2018-05-01
We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.
Ketamine relaxes airway smooth muscle contracted by endothelin.
Sato, T; Matsuki, A; Zsigmond, E K; Rabito, S F
1997-04-01
Endothelins (ETs) are synthesized not only in vascular endothelial cells but also in airway epithelial cells. Increased ET-1 has been demonstrated in bronchial epithelium of asthmatic patients, and, in severe asthma attacks, ET-1 increases in plasma and bronchoalveolar lavage fluid. In this study, we investigated whether ketamine (KET) relaxes ET-induced tracheal contractions. Female guinea pigs were killed with an overdose of pentobarbital. The trachea was removed and cut spirally into two strips that were mounted in an organ bath filled with Krebs-bicarbonate buffer. The response of each strip to 10(-7) M carbachol was taken as 100% contraction to which the response to ET was referred. The contribution of the epithelium to the relaxant effect of KET was studied in denuded tracheae or in the presence of 5 x 10(-5) M indomethacin. ET-1 (3 x 10(-8) M) induced contractions that were 76 +/- 3% of those induced by carbachol. KET reversed the response to ET-1 in a dose-dependent fashion. Similarly, ET-2 (3 x 10(-8) M) induced contractions that were 74 +/- 5% of those induced by carbachol, and KET also reversed this response in a dose-dependent manner. In epithelium-denuded strips, ET-1 induced contractions that were 104 +/- 3% of those induced by carbachol, and KET still reversed this response. The tonic phase of the response to ET-1 was equal (100 +/- 6%) to the response to carbachol, and KET did not affect it significantly. In the presence of ryanodine, KET reduced the ET-1-induced contraction from 67 +/- 2% to 36 +/- 3.%, P < 0.01. In the presence of nicardipine, KET also inhibited the ET-1-induced contraction. We conclude that KET relaxes the tracheal smooth muscle contracted by ETs via a mechanism that is independent of the tracheal epithelium. The relaxant effect of KET on the ET-induced contraction of the trachealis muscle is not dependent upon blockade of 1) sarcolemma influx of Ca2+ through the dihydropyridine Ca2+ channel or 2) the release of intracellular Ca2
Hopping transport through an array of Luttinger liquid stubs
NASA Astrophysics Data System (ADS)
Chudnovskiy, A. L.
2004-01-01
We consider a thermally activated transport across and array of parallel one-dimensional quantum wires of finite length (quantum stubs). The disorder enters as a random tunneling between the nearest-neighbor stubs as well as a random shift of the bottom of the energy band in each stub. Whereas one-particle wave functions are localized across the array, the plasmons are delocalized, which affects the variable-range hopping. A perturbative analytical expression for the low-temperature resistance across the array is obtained for a particular choice of plasmon dispersion.
B-Raf kinase inhibitors: hit enrichment through scaffold hopping.
Gopalsamy, Ariamala; Shi, Mengxiao; Hu, Yongbo; Lee, Frederick; Feldberg, Larry; Frommer, Eileen; Kim, Steven; Collins, Karen; Wojciechowicz, Donald; Mallon, Robert
2010-04-15
In continuation of our efforts toward hit identification and optimization for a B-Raf kinase project, we have employed a scaffold hopping strategy. The original HTS hit scaffold pyrazolo[1,5-a]pyrimidine was replaced with different thienopyrimidine and thienopyridine scaffolds to append the optimal pharmacophore moieties in order to generate novel B-raf kinase inhibitors with desirable potency and properties. This strategy led to the identification of additional lead compound 11b which had good enzyme and cell potency, while maintaining selectivity over a number of kinases. Copyright 2010 Elsevier Ltd. All rights reserved.
Carcia, Christopher R.; Christoforetti, John J.; Martin, RobRoy L.
2016-01-01
ABSTRACT Background Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. Purpose The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Study Design Quasi-experimental, cohort comparison. Methods Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. Results No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy
Quested, Eleanor; Duda, Joan L
2009-01-01
Grounded in the self-determination theoretical framework (SDT) formulated by Deci and Ryan, and specifically the basic needs mini-theory (BNT), this study examined the relationship between perceptions of the motivational climate manifested in hip hop environments, satisfaction of the three basic needs, and indicators of well- and ill-being among hip hop dancers. Fifty-nine hip hop dancers (mean age: 20.29 years) completed a questionnaire assessing the variables of interest in the study. Perceptions of a task-involving climate were positively associated with satisfaction of the needs for autonomy, competence, and relatedness. Perceptions of an ego-involving climate negatively predicted relatedness. Satisfaction of the need for competence was positively associated with positive affect, and negatively linked to negative affect. Competence need satisfaction significantly mediated the relationship between a perceived task-involving climate and positive and negative affective states. In sum, the findings provided partial support for the facets of SDT and BNT. The results also indicated that promoting the task-involving features of dance learning environments may be beneficial to dancers' well-being.
Janning, Dennis; Igaev, Maxim; Sündermann, Frederik; Brühmann, Jörg; Beutel, Oliver; Heinisch, Jürgen J.; Bakota, Lidia; Piehler, Jacob; Junge, Wolfgang; Brandt, Roland
2014-01-01
The microtubule-associated phosphoprotein tau regulates microtubule dynamics and is involved in neurodegenerative diseases collectively called tauopathies. It is generally believed that the vast majority of tau molecules decorate axonal microtubules, thereby stabilizing them. However, it is an open question how tau can regulate microtubule dynamics without impeding microtubule-dependent transport and how tau is also available for interactions other than those with microtubules. Here we address this apparent paradox by fast single-molecule tracking of tau in living neurons and Monte Carlo simulations of tau dynamics. We find that tau dwells on a single microtubule for an unexpectedly short time of ∼40 ms before it hops to the next. This dwell time is 100-fold shorter than previously reported by ensemble measurements. Furthermore, we observed by quantitative imaging using fluorescence decay after photoactivation recordings of photoactivatable GFP–tagged tubulin that, despite this rapid dynamics, tau is capable of regulating the tubulin–microtubule balance. This indicates that tau's dwell time on microtubules is sufficiently long to influence the lifetime of a tubulin subunit in a GTP cap. Our data imply a novel kiss-and-hop mechanism by which tau promotes neuronal microtubule assembly. The rapid kiss-and-hop interaction explains why tau, although binding to microtubules, does not interfere with axonal transport. PMID:25165145
Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A
2016-06-01
When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dou, Wenjie; Subotnik, Joseph E.; Nitzan, Abraham
We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case ofmore » out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.« less
Moaddel, Ruin; Luckenbaugh, David A; Xie, Ying; Villaseñor, Alma; Brutsche, Nancy E; Machado-Vieira, Rodrigo; Ramamoorthy, Anuradha; Lorenzo, Maria Paz; Garcia, Antonia; Bernier, Michel; Torjman, Marc C; Barbas, Coral; Zarate, Carlos A; Wainer, Irving W
2015-01-01
(R,S)-ketamine is a rapid and effective antidepressant drug that produces a response in two thirds of patients with treatment-resistant depression (TRD). The underlying biochemical differences between a (R,S)-ketamine responder (KET-R) and non-responder (KET-NR) have not been definitively identified but may involve serine metabolism. The aim of the study was to examine the relationship between baseline plasma concentrations of D-serine and its precursor L-serine and antidepressant response to (R,S)-ketamine in TRD patients. Plasma samples were obtained from 21 TRD patients at baseline, 60 min before initiation of the (R,S)-ketamine infusion. Patients were classified as KET-Rs (n = 8) or KET-NRs (n = 13) based upon the difference in Montgomery-Åsberg Depression Rating Scale (MADRS) scores at baseline and 230 min after infusion, with response defined as a ≥50 % decrease in MADRS score. The plasma concentrations of D-serine and L-serine were determined using liquid chromatography-mass spectrometry. Baseline D-serine plasma concentrations were significantly lower in KET-Rs (3.02 ± 0.21 μM) than in KET-NRs (4.68 ± 0.81 μM), p < 0.001. A significant relationship between baseline D-serine plasma concentrations and percent change in MADRS at 230 min was determined using a Pearson correlation, r = 0.77, p < 0.001, with baseline D-serine explaining 60 % of the variance in (R,S)-ketamine response. The baseline concentrations of L-serine (L-Ser) in KET-Rs were also significantly lower than those measured in KET-NRs (66.2 ± 9.6 μM vs 242.9 ± 5.6 μM, respectively; p < 0.0001). The results demonstrate that the baseline D-serine plasma concentrations were significantly lower in KET-Rs than in KET-NRs and suggest that this variable can be used to predict an antidepressant response following (R,S)-ketamine administration.
Stereoselective and regiospecific hydroxylation of ketamine and norketamine.
Desta, Zeruesenay; Moaddel, Ruin; Ogburn, Evan T; Xu, Cong; Ramamoorthy, Anuradha; Venkata, Swarajya Lakshmi Vattem; Sanghvi, Mitesh; Goldberg, Michael E; Torjman, Marc C; Wainer, Irving W
2012-11-01
The objective was to determine the cytochrome P450s (CYPs) responsible for the stereoselective and regiospecific hydroxylation of ketamine [(R,S)-Ket] to diastereomeric hydroxyketamines, (2S,6S;2R,6R)-HK (5a) and (2S,6R;2R,6S)-HK (5b) and norketamine [(R,S)-norKet] to hydroxynorketamines, (2S,6S;2R,6R)-HNK (4a), (2S,6R;2R,6S)-HNK (4b), (2S,5S;2R,5R)-HNK (4c), (2S,4S;2R,4R)-HNK (4d), (2S,4R;2R,4S)-HNK (4e), (2S,5R;2R,5S)-HNK (4f). The enantiomers of Ket and norKet were incubated with characterized human liver microsomes (HLMs) and expressed CYPs. Metabolites were identified and quantified using LC/MS/MS and apparent kinetic constants estimated using single-site Michaelis-Menten, Hill or substrate inhibition equation. 5a was predominantly formed from (S)-Ket by CYP2A6 and N-demethylated to 4a by CYP2B6. 5b was formed from (R)- and (S)-Ket by CYP3A4/3A5 and N-demethylated to 4b by multiple enzymes. norKet incubation produced 4a, 4c and 4f and minor amounts of 4d and 4e. CYP2A6 and CYP2B6 were the major enzymes responsible for the formation of 4a, 4d and 4f, and CYP3A4/3A5 for the formation of 4e. The 4b metabolite was not detected in the norKet incubates. 5a and 4b were detected in plasma samples from patients receiving (R,S)-Ket, indicating that 5a and 5b are significant Ket metabolites. Large variations in HNK concentrations were observed suggesting that pharmacogenetics and/or metabolic drug interactions may play a role in therapeutic response.
NASA Astrophysics Data System (ADS)
Drechsler, S. L.; Heiner, E.; Osipov, V. A.
1986-11-01
The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.
Time Correlations in Mode Hopping of Coupled Oscillators
NASA Astrophysics Data System (ADS)
Heltberg, Mathias L.; Krishna, Sandeep; Jensen, Mogens H.
2017-05-01
We study the dynamics in a system of coupled oscillators when Arnold Tongues overlap. By varying the initial conditions, the deterministic system can be attracted to different limit cycles. Adding noise, the mode hopping between different states become a dominating part of the dynamics. We simplify the system through a Poincare section, and derive a 1D model to describe the dynamics. We explain that for some parameter values of the external oscillator, the time distribution of occupancy in a state is exponential and thus memoryless. In the general case, on the other hand, it is a sum of exponential distributions characteristic of a system with time correlations.
NASA Astrophysics Data System (ADS)
Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.
2016-02-01
This is the first of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low-coverage, single-tracer limit). The present report focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials. For diffusion in two dimensions, a number of formulas are presented for complex combinations of the different hops in systems with triangular, rectangular, and square symmetry. The formulas provide values in excellent agreement with kinetic Monte Carlo simulations, concluding that the diffusion coefficient can be directly determined from the proposed expressions without performing the simulations. Based on the diffusion barriers obtained from first-principles calculations and a physically meaningful estimate of the attempt frequencies, the proposed formulas are used to analyze the diffusion of Cu, Ag, and Rb adatoms on the surface and within the van der Waals (vdW) gap of a model topological insulator, Bi2Se3 . Considering the possibility of adsorbate intercalation from the terraces to the vdW gaps at morphological steps, we infer that, at low coverage and room temperature, (i) a majority of the Rb atoms bounce back at the steps and remain on the terraces, (ii) Cu atoms mostly intercalate into the vdW gap, the remaining fraction staying at the steps, and (iii) Ag atoms essentially accumulate at the steps and gradually intercalate into the vdW gap. These conclusions are in good qualitative agreement with previous experiments. The companion report (M. A. Gosálvez et al., Phys. Rev. B, submitted] extends the present study to the description of systems that contain asymmetric hops.
Langberg, Joshua M; Epstein, Jeffery N; Becker, Stephen P; Girio-Herrera, Erin; Vaughn, Aaron J
2012-09-01
The purpose of the study was to evaluate the Homework, Organization, and Planning Skills (HOPS) intervention for middle school students with Attention-Deficit/Hyperactivity Disorder (ADHD) as implemented by school mental health (SMH) providers using a randomized trial design. Seventeen SMH providers from five school districts implemented the HOPS intervention. Forty-seven middle school students with ADHD (grades 6-8) were randomly assigned to receive the HOPS intervention or to a waitlist comparison group. Parent and teacher ratings of organizational skills and homework problems were collected pre- and post-intervention and at a 3-monoth follow-up, and school grades were also collected. Intervention participants demonstrated significant improvements relative to the waitlist comparison across parent-rated organized action ( d = .88), materials management ( d = .63), planning ( d = 1.05), and homework completion behaviors ( d = .85). Intervention participants did not make significant improvements relative to the comparison group according to teacher ratings. SMH providers were able to implement the HOPS intervention with fidelity despite the fact that no formal ongoing consultation was provided.
Langberg, Joshua M.; Epstein, Jeffery N.; Becker, Stephen P.; Girio-Herrera, Erin; Vaughn, Aaron J.
2013-01-01
The purpose of the study was to evaluate the Homework, Organization, and Planning Skills (HOPS) intervention for middle school students with Attention-Deficit/Hyperactivity Disorder (ADHD) as implemented by school mental health (SMH) providers using a randomized trial design. Seventeen SMH providers from five school districts implemented the HOPS intervention. Forty-seven middle school students with ADHD (grades 6–8) were randomly assigned to receive the HOPS intervention or to a waitlist comparison group. Parent and teacher ratings of organizational skills and homework problems were collected pre- and post-intervention and at a 3-monoth follow-up, and school grades were also collected. Intervention participants demonstrated significant improvements relative to the waitlist comparison across parent-rated organized action (d = .88), materials management (d = .63), planning (d = 1.05), and homework completion behaviors (d = .85). Intervention participants did not make significant improvements relative to the comparison group according to teacher ratings. SMH providers were able to implement the HOPS intervention with fidelity despite the fact that no formal ongoing consultation was provided. PMID:25355991
Effects of compositional defects on small polaron hopping in micas.
Rosso, Kevin M; Ilton, Eugene S
2005-06-22
Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.
NASA Astrophysics Data System (ADS)
Radtke, R. J.; Levin, K.
1995-02-01
Experiments on the cuprate superconductors demonstrate that these materials may be viewed as a stack of Josephson junctions along the direction normal to the CuO 2 planes (the c-axis). In this paper, we present a model which describes this intrinsic Josephson coupling in terms of incherent quasiparticle hopping along the c-axis arising from wave-function overlap, impurity-assisted hopping, and boson-assised hopping. We use this model to compute the magnitude and temperature T dependence of the resulting Josephson critical current jc( T) for s- and d-wave superconductors. Contrary to other approaches, d-wave pairing in this model is compatible with an intrinsic Josephson effect at all hole concentrations and leads to jc( T) αT at low T. By parameterizing our theory with c-axis resistivity data from YBa 2Cu 3O 7-δ (YBCO), we estimate jc( T) for optimally doped and underdoped members of this family. jc( T) can be measured either directly or indirectly through microwave penetration depth experiments, and current measurements on Bi 2Sr 2CaCu 2O 8 and La 2- xSr xCuO 4 are found to be consistent with s-wave pairing and the dominance of assisted hopping processes. The situation in YBCO is still unclear, but our estimates suggest that further experiments on this compound would be of great help in elucidating the validity of our model in general and the pairing symmetry in particular.
ERIC Educational Resources Information Center
Milu, Esther
2018-01-01
This article reports on preliminary findings of three prominent Kenyan hip-hop artists, Jua Cali, Abbas Kubaff, and Nazizi Hirji, as they theorize and construct emergent ethnicities vis-à-vis their translingual practices. Using in-depth phenomenological interviews, observations of their everyday language use, and analysis of their language choices…