Sample records for knock-out mice show

  1. Bex1 knock out mice show altered skeletal muscle regeneration

    SciTech Connect

    Koo, Jae Hyung Smiley, Mark A.; Lovering, Richard M.; Margolis, Frank L.


    Bex1 and Calmodulin (CaM) are upregulated during skeletal muscle regeneration. We confirm this finding and demonstrate the novel finding that they interact in a calcium-dependent manner. To study the role of Bex1 and its interaction with CaM in skeletal muscle regeneration, we generated Bex1 knock out (Bex1-KO) mice. These mice appeared to develop normally and are fertile, but displayed a functional deficit in exercise performance compared to wild type (WT) mice. After intramuscular injection of cardiotoxin, which causes extensive and reproducible myotrauma followed by recovery, regenerating muscles of Bex1-KO mice exhibited elevated and prolonged cell proliferation, as well as delayed cell differentiation, compared to WT mice. Thus, our results provide the first evidence that Bex1-KO mice show altered muscle regeneration, and allow us to propose that the interaction of Bex1 with Ca{sup 2+}/CaM may be involved in skeletal muscle regeneration.

  2. Accelerated retinal aging in PACAP knock-out mice.


    Kovács-Valasek, Andrea; Szabadfi, Krisztina; Dénes, Viktória; Szalontai, Bálint; Tamás, Andrea; Kiss, Péter; Szabó, Aliz; Setalo, Gyorgy; Reglődi, Dóra; Gábriel, Robert


    Pituitary adenylate cyclase activating polypeptide (PACAP) is a neurotrophic and neuroprotective peptide. PACAP and its receptors are widely distributed in the retina. A number of reports provided evidence that PACAP is neuroprotective in retinal degenerations. The current study compared retina cell type-specific differences in young (3-4months) and aged adults (14-16months), of wild-type (WT) mice and knock-out (KO) mice lacking endogenous PACAP production during the course of aging. Histological, immunocytochemical and Western blot examinations were performed. The staining for standard neurochemical markers (tyrosine hydroxylase for dopaminergic cells, calbindin 28 kDa for horizontal cells, protein kinase Cα for rod bipolar cells) of young adult PACAP KO retinas showed no substantial alterations compared to young adult WT retinas, except for the specific PACAP receptor (PAC1-R) staining. We could not detect PAC1-R immunoreactivity in bipolar and horizontal cells in young adult PACAP KO animals. Some other age-related changes were observed only in the PACAP KO mice only. These alterations included horizontal and rod bipolar cell dendritic sprouting into the photoreceptor layer and decreased ganglion cell number. Also, Müller glial cells showed elevated GFAP expression compared to the aging WT retinas. Furthermore, Western blot analyses revealed significant differences between the phosphorylation state of ERK1/2 and JNK in KO mice, indicating alterations in the MAPK signaling pathway. These results support the conclusion that endogenous PACAP contributes to protection against aging of the nervous system.

  3. IL-4 Knock Out Mice Display Anxiety-Like Behavior.


    Moon, Morgan L; Joesting, Jennifer J; Blevins, Neil A; Lawson, Marcus A; Gainey, Stephen J; Towers, Albert E; McNeil, Leslie K; Freund, Gregory G


    Inflammation is a recognized antecedent and coincident factor when examining the biology of anxiety. Little is known, however, about how reductions in endogenous anti-inflammatory mediators impact anxiety. Therefore, mood- cognition- and anxiety-associated/like behaviors were examined in IL-4 knock out (KO) mice and wild-type (WT) mice. In comparison to WT mice, IL-4 KO mice demonstrated decreased burrowing and increased social exploration. No differences were seen in forced swim or saccharine preference testing. IL-4 KO mice had similar performance to WT mice in the Morris water maze and during object location and novel object recognition. In the elevated zero-maze, IL-4 KO mice, in comparison to WT mice, demonstrated anxiety-like behavior. Anxiety-like behavior in IL-4 KO mice was not observed, however, during open-field testing. Taken together, these data indicate that IL-4 KO mice display state, but not trait, anxiety suggesting that reductions in endogenous anti-inflammatory bioactives can engender subtypes of anxiety.

  4. IL-4 Knock out Mice Display Anxiety-like Behavior

    PubMed Central

    Moon, Morgan L.; Joesting, Jennifer J.; Blevins, Neil A.; Lawson, Marcus A.; Gainey, Stephen J.; Towers, Albert E.; McNeil, Leslie K.; Freund, Gregory G.


    Inflammation is a recognized antecedent and coincident factor when examining the biology of anxiety. Little is known, however, about how reductions in endogenous anti-inflammatory mediators impact anxiety. Therefore, mood- cognition- and anxiety-associated/like behaviors were examined in IL-4 knock out (KO) mice and wild-type (WT) mice. In comparison to WT mice, IL-4 KO mice demonstrated decreased burrowing and increased social exploration. No differences were seen in forced swim or saccharine preference testing. IL-4 KO mice had similar performance to WT mice in the Morris water maze and during object location and novel object recognition. In the elevated zero-maze, IL-4 KO mice, in comparison to WT mice, demonstrated anxiety-like behavior. Anxiety-like behavior in IL-4 KO mice was not observed, however, during open-field testing. Taken together, these data indicate that IL-4 KO mice display state, but not trait, anxiety suggesting that reductions in endogenous anti-inflammatory bioactives can engender subtypes of anxiety. PMID:25772794

  5. Prion Protein (PrP) Knock-Out Mice Show Altered Iron Metabolism: A Functional Role for PrP in Iron Uptake and Transport

    PubMed Central

    Singh, Ajay; Kong, Qingzhong; Luo, Xiu; Petersen, Robert B.; Meyerson, Howard; Singh, Neena


    Despite overwhelming evidence implicating the prion protein (PrP) in prion disease pathogenesis, the normal function of this cell surface glycoprotein remains unclear. In previous reports we demonstrated that PrP mediates cellular iron uptake and transport, and aggregation of PrP to the disease causing PrP-scrapie (PrPSc) form results in imbalance of iron homeostasis in prion disease affected human and animal brains. Here, we show that selective deletion of PrP in transgenic mice (PrPKO) alters systemic iron homeostasis as reflected in hematological parameters and levels of total iron and iron regulatory proteins in the plasma, liver, spleen, and brain of PrPKO mice relative to matched wild type controls. Introduction of radiolabeled iron (59FeCl3) to Wt and PrPKO mice by gastric gavage reveals inefficient transport of 59Fe from the duodenum to the blood stream, an early abortive spike of erythropoiesis in the long bones and spleen, and eventual decreased 59Fe content in red blood cells and all major organs of PrPKO mice relative to Wt controls. The iron deficient phenotype of PrPKO mice is reversed by expressing Wt PrP in the PrPKO background, demonstrating a functional role for PrP in iron uptake and transport. Since iron is required for essential metabolic processes and is also potentially toxic if mismanaged, these results suggest that loss of normal function of PrP due to aggregation to the PrPSc form induces imbalance of brain iron homeostasis, resulting in disease associated neurotoxicity. PMID:19568430

  6. TRP vanilloid 2 knock-out mice are susceptible to perinatal lethality but display normal thermal and mechanical nociception.


    Park, Una; Vastani, Nisha; Guan, Yun; Raja, Srinivasa N; Koltzenburg, Martin; Caterina, Michael J


    TRP vanilloid 2 (TRPV2) is a nonselective cation channel expressed prominently in medium- to large-diameter sensory neurons that can be activated by extreme heat (>52°C). These features suggest that TRPV2 might be a transducer of noxious heat in vivo. TRPV2 can also be activated by hypoosmolarity or cell stretch, suggesting potential roles in mechanotransduction. To address the physiological functions of TRPV2 in somatosensation, we generated TRPV2 knock-out mice and examined their behavioral and electrophysiological responses to heat and mechanical stimuli. TRPV2 knock-out mice showed reduced embryonic weight and perinatal viability. As adults, surviving knock-out mice also exhibited a slightly reduced body weight. TRPV2 knock-out mice showed normal behavioral responses to noxious heat over a broad range of temperatures and normal responses to punctate mechanical stimuli, both in the basal state and under hyperalgesic conditions such as peripheral inflammation and L5 spinal nerve ligation. Moreover, behavioral assays of TRPV1/TRPV2 double knock-out mice or of TRPV2 knock-out mice treated with resiniferatoxin to desensitize TRPV1-expressing afferents revealed no thermosensory consequences of TRPV2 absence. In line with behavioral findings, electrophysiological recordings from skin afferents showed that C-fiber responses to heat and C- and Aδ-fiber responses to noxious mechanical stimuli were unimpaired in the absence of TRPV2. The prevalence of thermosensitive Aδ-fibers was too low to permit comparison between genotypes. Thus, TRPV2 is important for perinatal viability but is not essential for heat or mechanical nociception or hypersensitivity in the adult mouse.

  7. Motivational effects of ethanol in DARPP-32 knock-out mice.


    Risinger, F O; Freeman, P A; Greengard, P; Fienberg, A A


    DARPP-32 (dopamine and adenosine 3',5'-monophosphate-regulated phosphoprotein, 32 kDa) is an important component of dopaminergic function in brain areas thought to be important for drug and alcohol addiction. The present experiments characterized the acquisition of ethanol-induced conditioned taste aversion, ethanol-induced conditioned place preference, and ethanol self-administration in DARPP-32 knock-out (KO) mice compared to wild-type (WT) controls. For taste conditioning, KO and WT mice received access to 0.2 m NaCl solution followed immediately by intraperitoneal injection of 0-4 gm/kg ethanol. Ethanol produced dose-dependent conditioned taste aversion that was the same in both genotypes. For place conditioning, KO and WT mice received eight pairings of a tactile stimulus with ethanol (2 gm/kg, i.p.), and a different stimulus with saline. Ethanol produced increases in locomotor activity during conditioning, with KO mice showing higher activity levels after ethanol compared to WT mice. WT mice, but not KO mice, acquired conditioned preference for the ethanol-paired stimulus. In the self-administration procedure, KO and WT mice were trained to lever press for access to 10% v/v ethanol. Subsequently, the mice had 23 hr/d access to food, ethanol, and water. Response patterns were determined using 0-30% v/v ethanol concentrations. WT mice displayed concentration-dependent responding for ethanol. Responding on the ethanol lever by KO mice did not change as a function of ethanol concentration. Saccharin (0.2% w/v) was subsequently added to the ethanol mixture, and responding was examined at 0, 5, 10, and 20% ethanol concentrations. Ethanol responding increased in both genotypes, although WT mice showed higher rates at all concentrations.

  8. Phenotypic and Molecular Alterations in the Mammary Tissue of R-Spondin1 Knock-Out Mice during Pregnancy

    PubMed Central

    Chadi, Sead; Polyte, Jacqueline; Lefevre, Lucas; Castille, Johan; Ehanno, Aude; Laubier, Johann; Jaffrézic, Florence; Le Provost, Fabienne


    R-spondin1 (Rspo1) is a member of a secreted protein family which has pleiotropic functions in development and stem cell growth. Rspo1 knock-out mice are sex-reversed, but some remain sub-fertile, so they fail to nurse their pups. A lack of Rspo1 expression in the mammary gland results in an absence of duct side-branching development and defective alveolar formation. The aim of this study was to characterize the phenotypic and molecular alterations of mammary gland due to Rspo1 knock-out. Using the transcriptional profiling of mammary tissues, we identified misregulated genes in the mammary gland of Rspo1 knock-out mice during pregnancy. A stronger expression of mesenchymal markers was observed, without modifications to the structure of mammary epithelial tissue. Mammary epithelial cell immunohistochemical analysis revealed a persistence of virgin markers, which signify a delay in cell differentiation. Moreover, serial transplantation experiments showed that Rspo1 is associated with a regenerative potential of mammary epithelial cell control. Our finding also highlights the negatively regulated expression of Rspo1’s partners, Lgr4 and RNF43, in the mammary gland during pregnancy. Moreover, we offer evidence that Tgf-β signalling is modified in the absence of Rspo1. Taken together, our results show an abrupt halt or delay to mammary development during pregnancy due to the loss of a further differentiated function. PMID:27611670

  9. Progressive deafness and altered cochlear innervation in knock-out mice lacking prosaposin.


    Akil, Omar; Chang, Jolie; Hiel, Hakim; Kong, Jee-Hyun; Yi, Eunyoung; Glowatzki, Elisabeth; Lustig, Lawrence R


    After a yeast two-hybrid screen identified prosaposin as a potential interacting protein with the nicotinic acetylcholine receptor (nAChR) subunit alpha10, studies were performed to characterize prosaposin in the normal rodent inner ear. Prosaposin demonstrates diffuse organ of Corti expression at birth, with gradual localization to the inner hair cells (IHCs) and its supporting cells, inner pillar cells, and synaptic region of the outer hair cells (OHCs) and Deiters' cells (DCs) by postnatal day 21 (P21). Microdissected OHC and DC quantitative reverse transcriptase-PCR and immunohistology localizes prosaposin mRNA to DCs and OHCs, and protein predominantly to the apex of the DCs. Subsequent studies in a prosaposin knock-out (KO) (-/-) mouse showed intact but slightly reduced hearing through P19, but deafness by P25 and reduced distortion product otoacoustic emissions from P15 onward. Beginning at P12, the prosaposin KO mice showed histologic organ of Corti changes including cellular hypertrophy in the region of the IHC and greater epithelial ridge, a loss of OHCs from cochlear apex, and vacuolization of OHCs. Immunofluorescence revealed exuberant overgrowth of auditory afferent neurites in the region of the IHCs and proliferation of auditory efferent neurites in the region of the tunnel of Corti. IHC recordings from these KO mice showed normal I-V curves and responses to applied acetylcholine. Together, these results suggest that prosaposin helps maintain normal innervation patterns to the organ of Corti. Furthermore, prosaposin's overlapping developmental expression pattern and binding capacity toward the nAChR alpha10 suggest that alpha10 may also play a role in this function.

  10. Mildly Increased Mechanical Nociceptive Sensitivity in REV-ERBα Knock-out Mice

    PubMed Central

    Lee, Jaehyun; Ko, Hyoung-Gon; Kim, Kyungjin


    Nociception is one of the most complex senses that is affected not only by external stimulation but also internal conditions. Previous studies have suggested that circadian rhythm is important in modulating nociception. REV-ERBα knock-out (KO) mice have disrupted circadian rhythm and altered mood-related phenotypes. In this study, we examined the role of REV-ERBα in inflammatory nociception. We found that the nociceptive sensitivity of KO mice was partially enhanced in mechanical nociception. However, this partial alteration was independent of the circadian rhythm. Taken together, deletion of REV-ERBα induced a mild change in mechanical nociceptive sensitivity but this alteration was not dependent on the circadian rhythm. PMID:28035185

  11. Schmallenberg virus infection of adult type I interferon receptor knock-out mice.


    Wernike, Kerstin; Breithaupt, Angele; Keller, Markus; Hoffmann, Bernd; Beer, Martin; Eschbaumer, Michael


    Schmallenberg virus (SBV), a novel orthobunyavirus, was discovered in Europe in late 2011. It causes mild and transient disease in adult ruminants, but fetal infection can lead to abortion or severe malformations. There is considerable demand for SBV research, but in vivo studies in large animals are complicated by their long gestation periods and the cost of high containment housing. The goal of this study was to investigate whether type I interferon receptor knock-out (IFNAR(-/-)) mice are a suitable small animal model for SBV. Twenty IFNAR(-/-) mice were inoculated with SBV, four were kept as controls. After inoculation, all were observed and weighed daily; two mice per day were sacrificed and blood, brain, lungs, liver, spleen, and intestine were harvested. All but one inoculated mouse lost weight, and two mice died spontaneously at the end of the first week, while another two had to be euthanized. Real-time RT-PCR detected large amounts of SBV RNA in all dead or sick mice; the controls were healthy and PCR-negative. IFNAR(-/-) mice are susceptible to SBV infection and can develop fatal disease, making them a handy and versatile tool for SBV vaccine research.

  12. Effects of cinnarizine, a calcium antagonist that produces human parkinsonism, in parkin knock out mice.


    Serrano, A; Menéndez, J; Casarejos, M J; Solano, R M; Gallego, E; Sánchez, M; Mena, M A; García de Yebenes, J


    Cinnarizine, a calcium antagonist that produces parkinsonism in humans, induces behavioural changes such as alopecia, buco-lingual dyskinesia and reduction of motor activity in female parkin knock out (PK-KO) mice but not in wild-type (WT) controls. PK-KO mice have high striatal dopamine levels and increased dopamine metabolism in spite of low reduced tyrosine hydroxylase protein. Cinnarizine, which blocks dopamine receptors and increases dopamine release, further increased dopamine metabolism. PK-KO mice increased GSH levels as a compensatory mechanism against enhanced free radical production related to acceleration of dopamine turnover. Neuronal markers, such as beta-tubulin slightly increased in PK-KO and furthermore with cinnarizine. Astroglial markers were decreased in PK-KO mice, and this effect was potentiated by cinnarizine, suggesting abnormal glia in these animals. Microglia was hyperactivated in PK-KO midbrain, suggesting inflammation in these animals. Proapoptotic proteins were increased by cinnarizine and, to a lesser extent, in PK-KO mice. Our data indicate that mutation of parkin is a risk factor for drug-induced parkinsonism.

  13. Impaired sensorimotor gating in Fmr1 knock out and Fragile X premutation model mice.


    Renoux, A J; Sala-Hamrick, K J; Carducci, N M; Frazer, M; Halsey, K E; Sutton, M A; Dolan, D F; Murphy, G G; Todd, P K


    Fragile X syndrome (FXS) is a common inherited cause of intellectual disability that results from a CGG repeat expansion in the FMR1 gene. Large repeat expansions trigger both transcriptional and translational suppression of Fragile X protein (FMRP) production. Fragile X-associated Tremor/Ataxia Syndrome (FXTAS) is an allelic neurodegenerative disease caused by smaller "pre-mutation" CGG repeat expansions that enhance FMR1 transcription but lead to translational inefficiency and reduced FMRP expression in animal models. Sensorimotor gating as measured by pre-pulse inhibition (PPI) is altered in both FXS patients and Fmr1 knock out (KO) mice. Similarly, FXTAS patients have demonstrated PPI deficits. Recent work suggests there may be overlapping synaptic defects between Fmr1 KO and CGG knock-in premutation mouse models (CGG KI). We therefore sought to interrogate PPI in CGG KI mice. Using a quiet PPI protocol more akin to human testing conditions, we find that Fmr1 KO animals have significantly impaired PPI. Using this same protocol, we find CGG KI mice demonstrate an age-dependent impairment in PPI compared to wild type (WT) controls. This study describes a novel phenotype in CGG KI mice that can be used in future therapeutic development targeting premutation associated symptoms.

  14. Uptake and catabolism of modified LDL in scavenger-receptor class A type I/II knock-out mice.

    PubMed Central

    Van Berkel, T J; Van Velzen, A; Kruijt, J K; Suzuki, H; Kodama, T


    The liver is the major organ responsible for the uptake of modified low-density lipoprotein (LDL) from the blood circulation, with endothelial and Kupffer cells as major cellular uptake sites. Scavenger-receptors, which include various classes, are held responsible for this uptake. Mice deficient in scavenger-receptor class A types I and II were created and the fate of acetylated LDL (Ac-LDL) in vivo and its interaction with liver endothelial, Kupffer and peritoneal macrophages was characterized. Surprisingly, the decay in vivo (t12 < 2 min), tissue distribution and liver uptake (at 5 min it was 77.4 +/- 4.6% of the injected dose) of Ac-LDL in the knock-out mice were not significantly different from control mice (t12 < 2 min and liver uptake 79.1 +/- 4.6% of the injected dose). A separation of mice liver cells into parenchymal, endothelial and Kupffer cells 10 min after injection of Ac-LDL indicated that in both control and knock-out mice the liver endothelial cells were responsible for more than 70% of the liver uptake. Both in control and knock-out mice, preinjection of polyinosinic acid (poly I, 200 microg) completely blocked the liver uptake, indicating that both in control and knock-out mice the scavenger-receptors are sensitive to poly I. Preinjection of suboptimal poly I concentrations (20 and 50 microg) provided evidence that the serum decay and liver uptake of Ac-LDL is more readily inhibited in the knock-out mice as compared with the control mice, indicating less efficient removal of Ac-LDL in vivo in the knock-out mice under these conditions. Studies in vitro with isolated liver endothelial and Kupffer cells from knock-out mice indicate that the cell association of Ac-LDL during 2 h at 37 degrees C is 50 and 53% of the control, respectively, whereas the degradation reaches values of 58 and 63%. For peritoneal macrophages from knock-out mice the cell association of Ac-LDL was identical to the control mice whereas the Ac-LDL degradation in cells from the

  15. Knock-out of nexilin in mice leads to dilated cardiomyopathy and endomyocardial fibroelastosis.


    Aherrahrou, Zouhair; Schlossarek, Saskia; Stoelting, Stephanie; Klinger, Matthias; Geertz, Birgit; Weinberger, Florian; Kessler, Thorsten; Aherrahrou, Redouane; Moreth, Kristin; Bekeredjian, Raffi; Hrabě de Angelis, Martin; Just, Steffen; Rottbauer, Wolfgang; Eschenhagen, Thomas; Schunkert, Heribert; Carrier, Lucie; Erdmann, Jeanette


    Cardiomyopathy is one of the most common causes of chronic heart failure worldwide. Mutations in the gene encoding nexilin (NEXN) occur in patients with both hypertrophic and dilated cardiomyopathy (DCM); however, little is known about the pathophysiological mechanisms and relevance of NEXN to these disorders. Here, we evaluated the functional role of NEXN using a constitutive Nexn knock-out (KO) mouse model. Heterozygous (Het) mice were inter-crossed to produce wild-type (WT), Het, and homozygous KO mice. At birth, 32, 46, and 22 % of the mice were WT, Het, and KO, respectively, which is close to the expected Mendelian ratio. After postnatal day 6, the survival of the Nexn KO mice decreased dramatically and all of the animals died by day 8. Phenotypic characterizations of the WT and KO mice were performed at postnatal days 1, 2, 4, and 6. At birth, the relative heart weights of the WT and KO mice were similar; however, at day 4, the relative heart weight of the KO group was 2.3-fold higher than of the WT group. In addition, the KO mice developed rapidly progressive cardiomyopathy with left ventricular dilation and wall thinning and decreased cardiac function. At day 6, the KO mice developed a fulminant DCM phenotype characterized by dilated ventricular chambers and systolic dysfunction. At this stage, collagen deposits and some elastin deposits were observed within the left ventricle cavity, which resembles the features of endomyocardial fibroelastosis (EFE). Overall, these results further emphasize the role of NEXN in DCM and suggest a novel role in EFE.

  16. Glutaminyl cyclase knock-out mice exhibit slight hypothyroidism but no hypogonadism: implications for enzyme function and drug development.


    Schilling, Stephan; Kohlmann, Stephanie; Bäuscher, Christoph; Sedlmeier, Reinhard; Koch, Birgit; Eichentopf, Rico; Becker, Andreas; Cynis, Holger; Hoffmann, Torsten; Berg, Sabine; Freyse, Ernst-Joachim; von Hörsten, Stephan; Rossner, Steffen; Graubner, Sigrid; Demuth, Hans-Ulrich


    Glutaminyl cyclases (QCs) catalyze the formation of pyroglutamate (pGlu) residues at the N terminus of peptides and proteins. Hypothalamic pGlu hormones, such as thyrotropin-releasing hormone and gonadotropin-releasing hormone are essential for regulation of metabolism and fertility in the hypothalamic pituitary thyroid and gonadal axes, respectively. Here, we analyzed the consequences of constitutive genetic QC ablation on endocrine functions and on the behavior of adult mice. Adult homozygous QC knock-out mice are fertile and behave indistinguishably from wild type mice in tests of motor function, cognition, general activity, and ingestion behavior. The QC knock-out results in a dramatic drop of enzyme activity in the brain, especially in hypothalamus and in plasma. Other peripheral organs like liver and spleen still contain QC activity, which is most likely caused by its homolog isoQC. The serum gonadotropin-releasing hormone, TSH, and testosterone concentrations were not changed by QC depletion. The serum thyroxine was decreased by 24% in homozygous QC knock-out animals, suggesting a mild hypothyroidism. QC knock-out mice were indistinguishable from wild type with regard to blood glucose and glucose tolerance, thus differing from reports of thyrotropin-releasing hormone knock-out mice significantly. The results suggest a significant formation of the hypothalamic pGlu hormones by alternative mechanisms, like spontaneous cyclization or conversion by isoQC. The different effects of QC depletion on the hypothalamic pituitary thyroid and gonadal axes might indicate slightly different modes of substrate conversion of both enzymes. The absence of significant abnormalities in QC knock-out mice suggests the presence of a therapeutic window for suppression of QC activity in current drug development.

  17. Systemic and Cerebral Iron Homeostasis in Ferritin Knock-Out Mice

    PubMed Central

    Li, Wei; Garringer, Holly J.; Goodwin, Charles B.; Richine, Briana; Acton, Anthony; VanDuyn, Natalia; Muhoberac, Barry B.; Irimia-Dominguez, Jose; Chan, Rebecca J.; Peacock, Munro; Nass, Richard; Ghetti, Bernardino; Vidal, Ruben


    Ferritin, a 24-mer heteropolymer of heavy (H) and light (L) subunits, is the main cellular iron storage protein and plays a pivotal role in iron homeostasis by modulating free iron levels thus reducing radical-mediated damage. The H subunit has ferroxidase activity (converting Fe(II) to Fe(III)), while the L subunit promotes iron nucleation and increases ferritin stability. Previous studies on the H gene (Fth) in mice have shown that complete inactivation of Fth is lethal during embryonic development, without ability to compensate by the L subunit. In humans, homozygous loss of the L gene (FTL) is associated with generalized seizure and atypical restless leg syndrome, while mutations in FTL cause a form of neurodegeneration with brain iron accumulation. Here we generated mice with genetic ablation of the Fth and Ftl genes. As previously reported, homozygous loss of the Fth allele on a wild-type Ftl background was embryonic lethal, whereas knock-out of the Ftl allele (Ftl-/-) led to a significant decrease in the percentage of Ftl-/- newborn mice. Analysis of Ftl-/- mice revealed systemic and brain iron dyshomeostasis, without any noticeable signs of neurodegeneration. Our findings indicate that expression of the H subunit can rescue the loss of the L subunit and that H ferritin homopolymers have the capacity to sequester iron in vivo. We also observed that a single allele expressing the H subunit is not sufficient for survival when both alleles encoding the L subunit are absent, suggesting the need of some degree of complementation between the subunits as well as a dosage effect. PMID:25629408

  18. Prolonged Starvation Causes Up-Regulation of AQP1 in Adipose Tissue Capillaries of AQP7 Knock-Out Mice

    PubMed Central

    Skowronski, Mariusz T.; Skowronska, Agnieszka; Rojek, Aleksandra; Oklinski, Michal K.; Nielsen, Søren


    Aquaporins (AQPs) are membrane proteins involved in the regulation of cellular transport and the balance of water and glycerol and cell volume in the white adipose tissue (WAT). In our previous study, we found the co-expression of the AQP1 water channel and AQP7 in the mouse WAT. In our present study, we aimed to find out whether prolonged starvation influences the AQP1 expression of AQP7 knock-out mice (AQP7 KO) in the WAT. To resolve this hypothesis, immunoperoxidase, immunoblot and immunogold microscopy were used. AQP1 expression was found with the use of immunohistochemistry and was confirmed by immunogold microscopy in the vessels of mouse WAT of all studied groups. Semi-quantitative immunoblot and quantitative immunogold microscopy showed a significant increase (by 2.5- to 3-fold) in the abundance of AQP1 protein expression in WAT in the 72 h starved AQP7 KO mice as compared to AQP7+/+ (p < 0.05) and AQP7−/− (p < 0.01) controls, respectively. In conclusion, the AQP1 water channel located in the vessels of WAT is up-regulated in response to prolonged starvation in the WAT of AQP7 KO mice. The present data suggest that an interaction of different AQP isoforms is required for maintaining proper water homeostasis within the mice WAT. PMID:27455244

  19. Knock-out of HCN1 subunit flattens dorsal-ventral frequency gradient of medial entorhinal neurons in adult mice.


    Giocomo, Lisa M; Hasselmo, Michael E


    Layer II stellate cells at different locations along the dorsal to ventral axis of medial entorhinal cortex show differences in the frequency of intrinsic membrane potential oscillations and resonance (Giocomo et al., 2007). The frequency differences scale with differences in the size and spacing of grid-cell firing fields recorded in layer II of the medial entorhinal cortex in behaving animals. To determine the mechanism for this difference in intrinsic frequency, we analyzed oscillatory properties in adult control mice and adult mice with a global deletion of the HCN1 channel. Data from whole-cell patch recordings show that the oscillation frequency gradient along the dorsal-ventral axis previously shown in juvenile rats also appears in control adult mice, indicating that the dorsal-ventral gradient generalizes across age and species. Knock-out of the HCN1 channel flattens the dorsal-ventral gradient of the membrane potential oscillation frequency, the resonant frequency, the time constant of the "sag" potential and the amplitude of the sag potential. This supports a role of the HCN1 subunit in the mechanism of the frequency gradient in these neurons. These findings have important implications for models of grid cells and generate predictions for future in vivo work on entorhinal grid cells.

  20. Smad3 knock-out mice as a useful model to study intestinal fibrogenesis

    PubMed Central

    Zanninelli, Giuliana; Vetuschi, Antonella; Sferra, Roberta; D’Angelo, Angela; Fratticci, Amato; Continenza, Maria Adelaide; Chiaramonte, Maria; Gaudio, Eugenio; Caprilli, Renzo; Latella, Giovanni


    AIM: To evaluate the possible differences in morphology and immunohistochemical expression of CD3, transforming growth factor β1(TGF-β1), Smad7, α-smooth muscle actin (α-Sma), and collagen types I-VII of small and large intestine in Smad3 null and wild-type mice. METHODS: Ten null and ten wild-type adult mice were sacrificed at 4 mo of age and the organs (esophagus, small and large bowel, ureters) were collected for histology(hematoxylin and eosin, Masson thrichrome, silver staining), morphometry and immunohistochemistry analysis. TGF-β1 levels of intestinal tissue homogenates were assessed by ELISA. RESULTS: No macroscopic intestinal lesions were detected both in null and wild-type mice. Histological and morphometric evaluation revealed a significant reduction in muscle layer thickness of small and large intestine in null mice as compared to wild-type mice. Immunohistochemistry evaluation showed a significant increase of CD3+T cell, TGF-β1 and Smad7 staining in the small and large intestine mucosa of Smad3 null mice as compared to wild-type mice. α-Sma and collagen I-VII staining of small and large intestine did not differ between the two groups of mice. TGF-β1 levels of colonic tissue homogenates were significantly higher in null mice than in wild-type mice. In preliminary experiments a significant reduction of TNBS-induced intestinal fibrosis was observed in null mice as compared to wild-type mice. CONCLUSION: Smad3 null mice are a useful model to investigate the in vivo role of the TGF-β/Smad signalling pathway in intestinal inflammation and fibrosis. PMID:16534873

  1. C6 knock-out Mice Are Protected from Thrombophilia Mediated by Antiphospholipid Antibodies

    PubMed Central

    Laura, Carrera-Marín Ana; Zurina, Romay-Penabad; Elizabeth, Papalardo; Elba, Reyes-Maldonado; Ethel, Garcia-Latorre; Gracie, Vargas; Tuya, Shilagard; Silvia, Pierangeli


    Background Complement activation plays a role in pathogenesis of the Antiphospholipid Syndrome (APS), but the involvement of the C5b-9 membrane attack complex (MAC) is unknown. Here we studied the effects of human polyclonal antiphospholipid (aPL) antibodies on thrombosis and tissue factor (TF) up-regulation in C6 deficient (C6-/-) mice. Methods C6-/- or the wild-type (C3H/HeJ) C6+/+ mice were injected twice with IgG-APS (n=2) or IgM-APS (n=1) isolated from APS patients or with the corresponding control Igs (IgG-NHS or IgM-NHS). Then, the size of induced thrombi in the femoral vein were determined 72 hours after the first injection. Tissue factor was determined in homogenates of carotid arteries and in peritoneal macrophages. Results Thrombus sizes were significantly larger in C6+/+ treated with IgG-APS1 or with IgG-APS2 or with IgM-APS when compared with C6+/+ mice treated with IgG-NHS or with IgM-NHS, respectively. The sizes of thrombi were significantly smaller in the C6-/- mice injected with IgG-APS1, IgG-APS2 or IgM-APS (p<0.001), compared to their C6+/+ counterparts showing an important abrogation of thrombus formation in mice lacking C6. The TF expression and activity in the C6-/- mice treated with IgG-APS were diminished when compared to C6+/+ treated with the same immunoglobulins. All mice injected with IgG-APS and IgM-APS had medium-high titers of aCL and aβ2GPI antibodies. Conclusions These data indicate that the C6 component of the complement system mediates aPL-thrombogenic effects, underscoring an important pathogenic mechanism and indicating the possibility of inhibiting complement to ameliorate APS-related manifestations. PMID:22933620

  2. Autistic-Like Traits and Cerebellar Dysfunction in Purkinje Cell PTEN Knock-Out Mice.


    Cupolillo, Dario; Hoxha, Eriola; Faralli, Alessio; De Luca, Annarita; Rossi, Ferdinando; Tempia, Filippo; Carulli, Daniela


    Autism spectrum disorders (ASDs) are neurodevelopmental disorders characterized by impaired social interaction, isolated areas of interest, and insistence on sameness. Mutations in Phosphatase and tensin homolog missing on chromosome 10 (PTEN) have been reported in individuals with ASDs. Recent evidence highlights a crucial role of the cerebellum in the etiopathogenesis of ASDs. In the present study we analyzed the specific contribution of cerebellar Purkinje cell (PC) PTEN loss to these disorders. Using the Cre-loxP recombination system, we generated conditional knockout mice in which PTEN inactivation was induced specifically in PCs. We investigated PC morphology and physiology as well as sociability, repetitive behavior, motor learning, and cognitive inflexibility of adult PC PTEN-mutant mice. Loss of PTEN in PCs results in autistic-like traits, including impaired sociability, repetitive behavior and deficits in motor learning. Mutant PCs appear hypertrophic and show structural abnormalities in dendrites and axons, decreased excitability, disrupted parallel fiber and climbing fiber synapses and late-onset cell death. Our results unveil new roles of PTEN in PC function and provide the first evidence of a link between the loss of PTEN in PCs and the genesis of ASD-like traits.

  3. Knock out of the NADPH oxidase Nox4 has no impact on life span in mice.


    Rezende, Flavia; Schürmann, Christoph; Schütz, Susanne; Harenkamp, Sabine; Herrmann, Eva; Seimetz, Michael; Weißmann, Norbert; Schröder, Katrin


    The free radical theory of aging suggests reactive oxygen species as a main reason for accumulation of damage events eventually leading to aging. Nox4, a member of the family of NADPH oxidases constitutively produces ROS and therefore has the potential to be a main driver of aging. Herein we analyzed the life span of Nox4 deficient mice and found no difference when compared to their wildtype littermates. Accordingly neither Tert expression nor telomere length was different in cells isolated from those animals. In fact, Nox4 mRNA expression in lungs of wildtype mice dropped with age. We conclude that Nox4 has no influence on lifespan of healthy mice.

  4. Generation and Behavioral Characterization of β-catenin Forebrain-Specific Conditional Knock-Out Mice

    PubMed Central

    Gould, Todd D.; O'Donnell, Kelley C.; Picchini, Alyssa M.; Dow, Eliot R.; Chen, Guang; Manji, Husseini K.


    The canonical Wnt pathway and β-catenin have been implicated in the pathophysiology of mood disorders. We generated forebrain-specific CRE-mediated conditional β-catenin knockout mice to begin exploring the behavioral implications of decreased Wnt pathway signaling in the central nervous system. In situ hybridization revealed a progressive knockout of β-catenin that began between 2 and 4 weeks of age, and by 12 weeks resulted in considerably decreased β-catenin expression in regions of the forebrain, including the frontal cortex, hippocampus, and striatum. A significant decrease in protein levels of β-catenin in these brain regions was observed by western blot. Behavioral characterization of these mice in several tests (including the forced swim test, tail suspension test (TST), learned helplessness, response and sensitization to stimulants, and light/dark box among other tests) revealed relatively circumscribed alterations. In the TST, knockout mice spent significantly less time struggling (a depression-like phenotype). However, knockout mice did not differ from their wild-type littermates in the other behavioral tests of mood-related or anxiety-related behaviors. These results suggest that a considerable β-catenin reserve exists, and that a 50-70% β-catenin reduction in circumscribed brain regions is only capable of inducing subtle behavioral changes. Alternatively, regulating β-catenin may modulate drug effects rather than being a model of mood disorder pathophysiology per se. PMID:18299155

  5. Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

    SciTech Connect

    Malur, Anagha; Huizar, Isham; Wells, Greg; Barna, Barbara P.; Malur, Achut G.; Thomassen, Mary Jane


    Highlights: Black-Right-Pointing-Pointer Lentivirus-ABCG1 reduces lipid accumulation in lungs of GM-CSF knock-out mice. Black-Right-Pointing-Pointer Up-regulation of ABCG1 improves lung function. Black-Right-Pointing-Pointer Upregulation of ABCG1 improves surfactant metabolism. -- Abstract: We have shown decreased expression of the nuclear transcription factor, peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) and the PPAR{gamma}-regulated ATP-binding cassette transporter G1 (ABCG1) in alveolar macrophages from patients with pulmonary alveolar proteinosis (PAP). PAP patients also exhibit neutralizing antibodies to granulocyte-macrophage colony stimulating factor (GM-CSF), an upregulator of PPAR{gamma}. In association with functional GM-CSF deficiency, PAP lung is characterized by surfactant-filled alveolar spaces and lipid-filled alveolar macrophages. Similar pathology characterizes GM-CSF knock-out (KO) mice. We reported previously that intratracheal instillation of a lentivirus (lenti)-PPAR{gamma} plasmid into GM-CSF KO animals elevated ABCG1 and reduced alveolar macrophage lipid accumulation. Here, we hypothesized that instillation of lenti-ABCG1 might be sufficient to decrease lipid accumulation and improve pulmonary function in GM-CSF KO mice. Animals received intratracheal instillation of lenti-ABCG1 or control lenti-enhanced Green Fluorescent Protein (eGFP) plasmids and alveolar macrophages were harvested 10 days later. Alveolar macrophage transduction efficiency was 79% as shown by lenti-eGFP fluorescence. Quantitative PCR analyses indicated a threefold (p = 0.0005) increase in ABCG1 expression with no change of PPAR{gamma} or ABCA1 in alveolar macrophages of lenti-ABCG1 treated mice. ABCG1 was unchanged in control lenti-eGFP and PBS-instilled groups. Oil Red O staining detected reduced intracellular neutral lipid in alveolar macrophages from lenti-ABCG1 treated mice. Extracellular cholesterol and phospholipids were also decreased as shown by

  6. Impaired glucose tolerance and predisposition to the fasted state in liver glycogen synthase knock-out mice.


    Irimia, Jose M; Meyer, Catalina M; Peper, Caron L; Zhai, Lanmin; Bock, Cheryl B; Previs, Stephen F; McGuinness, Owen P; DePaoli-Roach, Anna; Roach, Peter J


    Conversion to glycogen is a major fate of ingested glucose in the body. A rate-limiting enzyme in the synthesis of glycogen is glycogen synthase encoded by two genes, GYS1, expressed in muscle and other tissues, and GYS2, primarily expressed in liver (liver glycogen synthase). Defects in GYS2 cause the inherited monogenic disease glycogen storage disease 0. We have generated mice with a liver-specific disruption of the Gys2 gene (liver glycogen synthase knock-out (LGSKO) mice), using Lox-P/Cre technology. Conditional mice carrying floxed Gys2 were crossed with mice expressing Cre recombinase under the albumin promoter. The resulting LGSKO mice are viable, develop liver glycogen synthase deficiency, and have a 95% reduction in fed liver glycogen content. They have mild hypoglycemia but dispose glucose less well in a glucose tolerance test. Fed, LGSKO mice also have a reduced capacity for exhaustive exercise compared with mice carrying floxed alleles, but the difference disappears after an overnight fast. Upon fasting, LGSKO mice reach within 4 h decreased blood glucose levels attained by control floxed mice only after 24 h of food deprivation. The LGSKO mice maintain this low blood glucose for at least 24 h. Basal gluconeogenesis is increased in LGSKO mice, and insulin suppression of endogenous glucose production is impaired as assessed by euglycemic-hyperinsulinemic clamp. This observation correlates with an increase in the liver gluconeogenic enzyme phosphoenolpyruvate carboxykinase expression and activity. This mouse model mimics the pathophysiology of glycogen storage disease 0 patients and highlights the importance of liver glycogen stores in whole body glucose homeostasis.

  7. Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice

    PubMed Central

    Zhang, Qiangge; Gao, Xian; Li, Chenchen; Feliciano, Catia; Wang, Dongqing; Zhou, Dingxi; Mei, Yuan; Monteiro, Patricia; Anand, Michelle; Itohara, Shigeyoshi; Dong, Xiaowei; Fu, Zhanyan


    Intellectual disability is a common neurodevelopmental disorder characterized by impaired intellectual and adaptive functioning. Both environmental insults and genetic defects contribute to the etiology of intellectual disability. Copy number variations of SORBS2 have been linked to intellectual disability. However, the neurobiological function of SORBS2 in the brain is unknown. The SORBS2 gene encodes ArgBP2 (Arg/c-Abl kinase binding protein 2) protein in non-neuronal tissues and is alternatively spliced in the brain to encode nArgBP2 protein. We found nArgBP2 colocalized with F-actin at dendritic spines and growth cones in cultured hippocampal neurons. In the mouse brain, nArgBP2 was highly expressed in the cortex, amygdala, and hippocampus, and enriched in the outer one-third of the molecular layer in dentate gyrus. Genetic deletion of Sorbs2 in mice led to reduced dendritic complexity and decreased frequency of AMPAR-miniature spontaneous EPSCs in dentate gyrus granule cells. Behavioral characterization revealed that Sorbs2 deletion led to a reduced acoustic startle response, and defective long-term object recognition memory and contextual fear memory. Together, our findings demonstrate, for the first time, an important role for nArgBP2 in neuronal dendritic development and excitatory synaptic transmission, which may thus inform exploration of neurobiological basis of SORBS2 deficiency in intellectual disability. SIGNIFICANCE STATEMENT Copy number variations of the SORBS2 gene are linked to intellectual disability, but the neurobiological mechanisms are unknown. We found that nArgBP2, the only neuronal isoform encoded by SORBS2, colocalizes with F-actin at neuronal dendritic growth cones and spines. nArgBP2 is highly expressed in the cortex, amygdala, and dentate gyrus in the mouse brain. Genetic deletion of Sorbs2 in mice leads to impaired dendritic complexity and reduced excitatory synaptic transmission in dentate gyrus granule cells, accompanied by

  8. Peripheral Benzodiazepine Receptor/Translocator Protein Global Knock-out Mice Are Viable with No Effects on Steroid Hormone Biosynthesis*♦

    PubMed Central

    Tu, Lan N.; Morohaku, Kanako; Manna, Pulak R.; Pelton, Susanne H.; Butler, W. Ronald; Stocco, Douglas M.; Selvaraj, Vimal


    Translocator protein (TSPO), previously known as the peripheral benzodiazepine receptor, is a mitochondrial outer membrane protein implicated as essential for cholesterol import to the inner mitochondrial membrane, the rate-limiting step in steroid hormone biosynthesis. Previous research on TSPO was based entirely on in vitro experiments, and its critical role was reinforced by an early report that claimed TSPO knock-out mice were embryonic lethal. In a previous publication, we examined Leydig cell-specific TSPO conditional knock-out mice that suggested TSPO was not required for testosterone production in vivo. This raised controversy and several questions regarding TSPO function. To examine the definitive role of TSPO in steroidogenesis and embryo development, we generated global TSPO null (Tspo−/−) mice. Contrary to the early report, Tspo−/− mice survived with no apparent phenotypic abnormalities and were fertile. Examination of adrenal and gonadal steroidogenesis showed no defects in Tspo−/− mice. Adrenal transcriptome comparison of gene expression profiles showed that genes involved in steroid hormone biosynthesis (Star, Cyp11a1, and Hsd3b1) were unchanged in Tspo−/− mice. Adrenocortical ultrastructure illustrated no morphological alterations in Tspo−/− mice. In an attempt to correlate our in vivo findings to previously used in vitro models, we also determined that siRNA knockdown or the absence of TSPO in different mouse and human steroidogenic cell lines had no effect on steroidogenesis. These findings directly refute the dogma that TSPO is indispensable for steroid hormone biosynthesis and viability. By amending the current model, this study advances our understanding of steroidogenesis with broad implications in biology and medicine. PMID:24936060

  9. Behavioral Phenotype of Fmr1 Knock-Out Mice during Active Phase in an Altered Light/Dark Cycle.


    Saré, R Michelle; Levine, Merlin; Smith, Carolyn Beebe


    Fragile X syndrome (FXS) is the most commonly inherited form of intellectual disability and is a disorder that is also highly associated with autism. FXS occurs as a result of an expanded CGG repeat sequence leading to transcriptional silencing. In an animal model of FXS in which Fmr1 is knocked out (Fmr1 KO), many physical, physiological, and behavioral characteristics of the human disease are recapitulated. Prior characterization of the mouse model was conducted during the day, the inactive phase of the circadian cycle. Circadian rhythms are an important contributor to behavior and may play a role in the study of disease phenotype. Moreover, changes in the parameters of circadian rhythm are known to occur in FXS animal models. We conducted an investigation of key behavioral phenotypes in Fmr1 KO mice during their active phase. We report that phase did not alter the Fmr1 KO phenotype in open field activity, anxiety, and learning and memory. There was a slight effect of phase on social behavior as measured by time in chamber, but not by time spent sniffing. Our data strengthen the existing data characterizing the phenotype of Fmr1 KO mice, indicating that it is independent of circadian phase.

  10. Adenoviral gene therapy of the Tay-Sachs disease in hexosaminidase A-deficient knock-out mice.


    Guidotti, J E; Mignon, A; Haase, G; Caillaud, C; McDonell, N; Kahn, A; Poenaru, L


    The severe neurodegenerative disorder, Tays-Sachs disease, is caused by a beta-hexosaminidase alpha-subunit deficiency which prevents the formation of lysosomal heterodimeric alpha-beta enzyme, hexosaminidase A (HexA). No treatment is available for this fatal disease; however, gene therapy could represent a therapeutic approach. We previously have constructed and characterized, in vitro, adenoviral and retroviral vectors coding for alpha- and beta-subunits of the human beta-hexosaminidases. Here, we have determined the in vivo strategy which leads to the highest HexA activity in the maximum number of tissues in hexA -deficient knock-out mice. We demonstrated that intravenous co-administration of adenoviral vectors coding for both alpha- and beta-subunits, resulting in preferential liver transduction, was essential to obtain the most successful results. Only the supply of both subunits allowed for HexA overexpression leading to massive secretion of the enzyme in serum, and full or partial enzymatic activity restoration in all peripheral tissues tested. The enzymatic correction was likely to be due to direct cellular transduction by adenoviral vectors and/or uptake of secreted HexA by different organs. These results confirmed that the liver was the preferential target organ to deliver a large amount of secreted proteins. In addition, the need to overexpress both subunits of heterodimeric proteins in order to obtain a high level of secretion in animals defective in only one subunit is emphasized. The endogenous non-defective subunit is otherwise limiting.

  11. Effects of SIRT1 gene knock-out via activation of SREBP2 protein-mediated PI3K/AKT signaling on osteoarthritis in mice.


    Yu, Fei; Zeng, Hui; Lei, Ming; Xiao, De-Ming; Li, Wei; Yuan, Hao; Lin, Jian-Jing


    This study investigated the effects of SIRT1 gene knock-out on osteoarthritis in mice, and the possible roles of SREBP2 protein and the PI3K/AKT signaling pathway in the effects. Mice were randomly divided into a normal group and a SIRT1 gene knock-out group (6 mice in each group). In these groups, one side of the knee anterior cruciate ligament was traversed, and the ipsilateral medial meniscus was cut to establish an osteoarthritis model of knee joint. The countralateral synovial bursa was cut out, serving as controls. The knee joint specimens were then divided into four groups: SIRT1(+/+) control group (group A, n=6); SIRT1(+/+) osteoarthritis group (group B, n=6); SIRT1(-/-) control group (group C, n=6); SIRT1(-/-) osteoarthritis group (group D, n=6). HE staining, Masson staining, Safranin O-Fast Green staining and Van Gieson staining were used to observe the morphological changes in the articular cartilage of the knee. Immunohistochemical staining was employed to detect the expression of SIRT1, SREBP2, VEGF, AKT, HMGCR and type II collagen proteins. SA-β-gal staining was utilized to evaluate chondrocyte aging. The results showed clear knee joint cartilage destruction and degeneration in the SIRT1(-/-) osteoarthritis group. The tidal line was twisted and displaced anteriorly. Type II collagen was destroyed and distributed unevenly. Compared with the SIRT1(+/+) osteoarthritis group and SIRT1(-/-) control group, SIRT1 protein expression was not obviously changed in the SIRT1(-/-) osteoarthritis group (P>0.05), while the expression levels of the SREBP2, VEGF and HMGCR proteins were significantly increased (P<0.05) and the levels of AKT and type II collagen proteins were significantly decreased (P<0.05). SIRT1 gene knock-out may aggravate cartilage degeneration in osteoarthritis by activating the SREBP2 protein-mediated PI3K/AKT signalling pathway, suggesting that SIRT1 gene may play a protective role against osteoarthritis.

  12. 2-Methyl-6-(phenylethynyl) pyridine (MPEP) reverses maze learning and PSD-95 deficits in Fmr1 knock-out mice

    PubMed Central

    Gandhi, Réno M.; Kogan, Cary S.; Messier, Claude


    Fragile X Syndrome (FXS) is caused by the lack of expression of the fragile X mental retardation protein (FMRP), which results in intellectual disability and other debilitating symptoms including impairment of visual-spatial functioning. FXS is the only single-gene disorder that is highly co-morbid with autism spectrum disorder and can therefore provide insight into its pathophysiology. Lack of FMRP results in altered group I metabotropic glutamate receptor (mGluR) signaling, which is a target for putative treatments. The Hebb-Williams (H-W) mazes are a set of increasingly complex spatial navigation problems that depend on intact hippocampal and thus mGluR-5 functioning. In the present investigation, we examined whether an antagonist of mGluR-5 would reverse previously described behavioral deficits in fragile X mental retardation 1 knock-out (Fmr1 KO) mice. Mice were trained on a subset of the H-W mazes and then treated with either 20 mg/kg of an mGluR-5 antagonist, 2-Methyl-6-(phenylethynyl) pyridine (MPEP; n = 11) or an equivalent dose of saline (n = 11) prior to running test mazes. Latency and errors were dependent variables recorded during the test phase. Immediately after completing each test, marble-burying behavior was assessed, which confirmed that the drug treatment was pharmacologically active during maze learning. Although latency was not statistically different between the groups, MPEP treated Fmr1 KO mice made significantly fewer errors on mazes deemed more difficult suggesting a reversal of the behavioral deficit. MPEP treated mice were also less perseverative and impulsive when navigating mazes. Furthermore, MPEP treatment reversed post-synaptic density-95 (PSD-95) protein deficits in Fmr1 KO treated mice, whereas levels of a control protein (β-tubulin) remained unchanged. These data further validate MPEP as a potentially beneficial treatment for FXS. Our findings also suggest that adapted H-W mazes may be a useful tool to document alterations in

  13. Synergistic Roles for G-protein γ3 and γ7 Subtypes in Seizure Susceptibility as Revealed in Double Knock-out Mice*

    PubMed Central

    Schwindinger, William F.; Mirshahi, Uyenlinh L.; Baylor, Kelly A.; Sheridan, Kathleen M.; Stauffer, Anna M.; Usefof, Stephanie; Stecker, Mark M.; Mirshahi, Tooraj; Robishaw, Janet D.


    The functions of different G-protein αβγ subunit combinations are traditionally ascribed to their various α components. However, the discovery of similarly diverse γ subtypes raises the possibility that they may also contribute to specificity. To test this possibility, we used a gene targeting approach to determine whether the closely related γ3 and γ7 subunits can perform functionally interchangeable roles in mice. In contrast to single knock-out mice that show normal survival, Gng3−/−Gng7−/− double knock-out mice display a progressive seizure disorder that dramatically reduces their median life span to only 75 days. Biochemical analyses reveal that the severe phenotype is not due to redundant roles for the two γ subunits in the same signaling pathway but rather is attributed to their unique actions in different signaling pathways. The results suggest that the γ3 subunit is a component of a Gi/o protein that is required for γ-aminobutyric acid, type B, receptor-regulated neuronal excitability, whereas the γ7 subunit is a component of a Golf protein that is responsible for A2A adenosine or D1 dopamine receptor-induced neuro-protective response. The development of this mouse model offers a novel experimental framework for exploring how signaling pathways integrate to produce normal brain function and how their combined dysfunction leads to spontaneous seizures and premature death. The results underscore the critical role of the γ subunit in this process. PMID:22207761

  14. Exacerbation of spontaneous autoimmune nephritis following regulatory T cell depletion in B cell lymphoma 2-interacting mediator knock-out mice.


    Wang, Y M; Zhang, G Y; Wang, Y; Hu, M; Zhou, J J; Sawyer, A; Cao, Q; Wang, Y; Zheng, G; Lee, V W S; Harris, D C H; Alexander, S I


    Regulatory T cells (Tregs ) have been recognized as central mediators for maintaining peripheral tolerance and limiting autoimmune diseases. The loss of Tregs or their function has been associated with exacerbation of autoimmune disease. However, the temporary loss of Tregs in the chronic spontaneous disease model has not been investigated. In this study, we evaluated the role of Tregs in a novel chronic spontaneous glomerulonephritis model of B cell lymphoma 2-interacting mediator (Bim) knock-out mice by transient depleting Tregs . Bim is a pro-apoptotic member of the B cell lymphoma 2 (Bcl-2) family. Bim knock-out (Bim(-/-) ) mice fail to delete autoreactive T cells in thymus, leading to chronic spontaneous autoimmune kidney disease. We found that Treg depletion in Bim(-/-) mice exacerbated the kidney injury with increased proteinuria, impaired kidney function, weight loss and greater histological injury compared with wild-type mice. There was a significant increase in interstitial infiltrate of inflammatory cells, antibody deposition and tubular damage. Furthermore, the serum levels of cytokines interleukin (IL)-2, IL-4, IL-6, IL-10, IL-17α, interferon (IFN)-γ and tumour necrosis factor (TNF)-α were increased significantly after Treg depletion in Bim(-/-) mice. This study demonstrates that transient depletion of Tregs leads to enhanced self-reactive T effector cell function followed by exacerbation of kidney disease in the chronic spontaneous kidney disease model of Bim-deficient mice.

  15. Type II Cochlear Ganglion Neurons Do Not Drive the Olivocochlear Reflex: Re-Examination of the Cochlear Phenotype in Peripherin Knock-Out Mice

    PubMed Central


    Abstract The cochlear nerve includes a small population of unmyelinated sensory fibers connecting outer hair cells to the brain. The functional role of these type II afferent neurons is controversial, because neurophysiological data are sparse. A recent study (Froud et al., 2015) reported that targeted deletion of peripherin, a type of neurofilament, eliminated type II afferents and inactivated efferent feedback to the outer hair cells, thereby suggesting that type II afferents were the sensory drive to this sound-evoked, negative-feedback reflex, the olivocochlear pathway. Here, we re-evaluated the cochlear phenotype in mice from the peripherin knock-out line and show that (1) type II afferent terminals are present in normal number and (2) olivocochlear suppression of cochlear responses is absent even when this efferent pathway is directly activated by shocks. We conclude that type II neurons are not the sensory drive for the efferent reflex and that peripherin deletion likely causes dysfunction of synaptic transmission between olivocochlear terminals and their peripheral targets. PMID:27570826

  16. Impaired Angiogenesis during Fracture Healing in GPCR Kinase 2 Interacting Protein-1 (GIT1) Knock Out Mice

    PubMed Central

    Menon, Prashanthi; Pang, Jinjiang; Ho, Hsin-Chiu; Shi, Shanshan; Xie, Chao; Smolock, Elaine; Yan, Chen; Zuscik, Michael J.; Berk, Bradford C.


    G protein coupled receptor kinase 2 (GRK2) interacting protein-1 (GIT1), is a scaffold protein that plays an important role in angiogenesis and osteoclast activity. We have previously demonstrated that GIT1 knockout (GIT1 KO) mice have impaired angiogenesis and dysregulated osteoclast podosome formation leading to a reduction in the bone resorbing ability of these cells. Since both angiogenesis and osteoclast-mediated bone remodeling are involved in the fracture healing process, we hypothesized that GIT1 participates in the normal progression of repair following bone injury. In the present study, comparison of fracture healing in wild type (WT) and GIT1 KO mice revealed altered healing in mice with loss of GIT1 function. Alcian blue staining of fracture callus indicated a persistence of cartilagenous matrix in day 21 callus samples from GIT1 KO mice which was temporally correlated with increased type 2 collagen immunostaining. GIT1 KO mice also showed a decrease in chondrocyte proliferation and apoptosis at days 7 and 14, as determined by PCNA and TUNEL staining. Vascular microcomputed tomography analysis of callus samples at days 7, 14 and 21 revealed decreased blood vessel volume, number, and connection density in GIT1 KO mice compared to WT controls. Correlating with this, VEGF-A, phospho-VEGFR2 and PECAM1 (CD31) were decreased in GIT1 KO mice, indicating reduced angiogenesis with loss of GIT1. Finally, calluses from GIT1 KO mice displayed a reduced number of tartrate resistant acid phosphatase-positive osteoclasts at days 14 and 21. Collectively, these results indicate that GIT1 is an important signaling participant in fracture healing, with gene ablation leading to reduced callus vascularity and reduced osteoclast number in the healing callus. PMID:24586541

  17. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone.


    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L; Ferris, Craig F


    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain

  18. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone

    PubMed Central

    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R.; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L.; Ferris, Craig F.


    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain

  19. Increased analgesic tolerance to acute morphine in fosB knock-out mice: a gender study.


    Solecki, Wojciech; Krowka, Tomasz; Kubik, Jakub; Kaczmarek, Leszek; Przewlocki, Ryszard


    The proteins of Fos family are a potential candidate to link molecular mechanisms of morphine action with behavioural effects such as morphine-induced reward, dependence and tolerance. We used both male and female mice lacking fosB gene to study its contribution to morphine effects. Morphine analgesia (tail-flick test) and hypothermia were studied using morphine at cumulative doses in morphine-naive and morphine-tolerant (tolerance induced by 24 h prior 100 mg/kg morphine administration) mice. FosB -/- mice, as compared to fosB +/+ mice, developed enhanced tolerance to morphine-induced analgesia. No effects of genotype or gender on tolerance to morphine-induced hypothermia were observed. These results suggest that fosB may be involved in the development of tolerance to morphine analgesia but not hypothermia. The gender study implicates that lack of FosB proteins in female fosB -/- mice enhanced morphine analgesic potency. In conclusion, we show that fosB gene is important to analgesia but not hypothermia phenotype indicating its role in morphine effects.

  20. Attenuated Inflammatory Response in Triggering Receptor Expressed on Myeloid Cells 2 (TREM2) Knock-Out Mice following Stroke

    PubMed Central

    Brehm, Martin; Guenther, Madlen; Linnartz-Gerlach, Bettina; Neumann, Harald; Witte, Otto W.; Frahm, Christiane


    Background Triggering receptor expressed on myeloid cells-2 (TREM2) is a microglial surface receptor involved in phagocytosis. Clearance of apoptotic debris after stroke represents an important mechanism to re-attain tissue homeostasis and thereby ensure functional recovery. The role of TREM2 following stroke is currently unclear. Methods and Results As an experimental stroke model, the middle cerebral artery of mice was occluded for 30 minutes with a range of reperfusion times (duration of reperfusion: 6 h/12 h/24 h/2 d/7 d/28 d). Quantitative PCR (qPCR) revealed a greatly increased transcription of TREM2 after stroke. We subsequently analyzed the expression of pro-inflammatory cytokines, chemokines and their receptors in TREM2-knockout (TREM2-KO) mice via qPCR. Microglial activation (CD68, Iba1) and CD3-positive T-cell invasion were analyzed via qPCR and immunohistochemistry. Functional consequences of TREM2 knockout were assessed by infarct volumetry. The acute inflammatory response (12 h reperfusion) was very similar between TREM2-KO mice and their littermate controls. However, in the sub-acute phase (7 d reperfusion) following stroke, TREM2-KO mice showed a decreased transcription of pro-inflammatory cytokines TNFα, IL-1α and IL-1β, associated with a reduced microglial activity (CD68, Iba1). Furthermore, TREM2-KO mice showed a reduced transcription of chemokines CCL2 (MCP1), CCL3 (MIP1α) and the chemokine receptor CX3CR1, followed by a diminished invasion of CD3-positive T-cells. No effect on the lesion size was observed. Conclusions Although we initially expected an exaggerated pro-inflammatory response following ablation of TREM2, our data support a contradictory scenario that the sub-acute inflammatory reaction after stroke is attenuated in TREM2-KO mice. We therefore conclude that TREM2 appears to sustain a distinct inflammatory response after stroke. PMID:23301011

  1. Enamel defects and ameloblast-specific expression in Enam knock-out/lacz knock-in mice.


    Hu, Jan C-C; Hu, Yuanyuan; Smith, Charles E; McKee, Marc D; Wright, J Timothy; Yamakoshi, Yasuo; Papagerakis, Petros; Hunter, Graeme K; Feng, Jerry Q; Yamakoshi, Fumiko; Simmer, James P


    Enamelin is critical for proper dental enamel formation, and defects in the human enamelin gene cause autosomal dominant amelogenesis imperfecta. We used gene targeting to generate a knock-in mouse carrying a null allele of enamelin (Enam) that has a lacZ reporter gene replacing the Enam translation initiation site and gene sequences through exon 7. Correct targeting of the transgene was confirmed by Southern blotting and PCR analyses. No enamelin protein could be detected by Western blotting in the Enam-null mice. Histochemical 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal) staining demonstrated ameloblast-specific expression of enamelin. The enamel of the Enam(+/-) mice was nearly normal in the maxillary incisors, but the mandibular incisors were discolored and tended to wear rapidly where they contacted the maxillary incisors. The Enam(-/-) mice showed no true enamel. Radiography, microcomputed tomography, and light and scanning electron microscopy were used to document changes in the enamel of Enam(-/-) mice but did not discern any perturbations of bone, dentin, or any other tissue besides the enamel layer. Although a thick layer of enamel proteins covered normal-appearing dentin of unerupted teeth, von Kossa staining revealed almost a complete absence of mineral formation in this protein layer. However, a thin, highly irregular, mineralized crust covered the dentin on erupted teeth, apparently arising from the formation and fusion of small mineralization foci (calcospherites) in the deeper part of the accumulated enamel protein layer. These results demonstrate ameloblast-specific expression of enamelin and reveal that enamelin is essential for proper enamel matrix organization and mineralization.

  2. Enhanced Histaminergic Neurotransmission and Sleep-Wake Alterations, a Study in Histamine H3-Receptor Knock-Out Mice

    PubMed Central

    Gondard, Elise; Anaclet, Christelle; Akaoka, Hidéo; Guo, Rui-Xian; Zhang, Mei; Buda, Colette; Franco, Patricia; Kotani, Hidehito; Lin, Jian-Sheng


    Long-term abolition of a brain arousal system impairs wakefulness (W), but little is known about the consequences of long-term enhancement. The brain histaminergic arousal system is under the negative control of H3-autoreceptors whose deletion results in permanent enhancement of histamine (HA) turnover. In order to determine the consequences of enhancement of the histaminergic system, we compared the cortical EEG and sleep-wake states of H3-receptor knockout (H3R−/−) and wild-type mouse littermates. We found that H3R−/−mice had rich phenotypes. On the one hand, they showed clear signs of enhanced HA neurotransmission and vigilance, i.e., a higher EEG θ power during spontaneous W and a greater extent of W or sleep restriction during behavioral tasks, including environmental change, locomotion, and motivation tests. On the other hand, during the baseline dark period, they displayed deficient W and signs of sleep deterioration, such as pronounced sleep fragmentation and reduced cortical slow activity during slow wave sleep (SWS), most likely due to a desensitization of postsynaptic histaminergic receptors as a result of constant HA release. Ciproxifan (H3-receptor inverse agonist) enhanced W in wild-type mice, but not in H3R−/−mice, indicating a functional deletion of H3-receptors, whereas triprolidine (postsynaptic H1-receptor antagonist) or α-fluoromethylhistidine (HA-synthesis inhibitor) caused a greater SWS increase in H3R−/− than in wild-type mice, consistent with enhanced HA neurotransmission. These sleep-wake characteristics and the obesity phenotypes previously reported in this animal model suggest that chronic enhancement of histaminergic neurotransmission eventually compromises the arousal system, leading to sleep-wake, behavioral, and metabolic disorders similar to those caused by voluntary sleep restriction in humans. PMID:23303066

  3. Enhanced histaminergic neurotransmission and sleep-wake alterations, a study in histamine H3-receptor knock-out mice.


    Gondard, Elise; Anaclet, Christelle; Akaoka, Hidéo; Guo, Rui-Xian; Zhang, Mei; Buda, Colette; Franco, Patricia; Kotani, Hidehito; Lin, Jian-Sheng


    Long-term abolition of a brain arousal system impairs wakefulness (W), but little is known about the consequences of long-term enhancement. The brain histaminergic arousal system is under the negative control of H3-autoreceptors whose deletion results in permanent enhancement of histamine (HA) turnover. In order to determine the consequences of enhancement of the histaminergic system, we compared the cortical EEG and sleep-wake states of H3-receptor knockout (H3R-/-) and wild-type mouse littermates. We found that H3R-/-mice had rich phenotypes. On the one hand, they showed clear signs of enhanced HA neurotransmission and vigilance, i.e., a higher EEG θ power during spontaneous W and a greater extent of W or sleep restriction during behavioral tasks, including environmental change, locomotion, and motivation tests. On the other hand, during the baseline dark period, they displayed deficient W and signs of sleep deterioration, such as pronounced sleep fragmentation and reduced cortical slow activity during slow wave sleep (SWS), most likely due to a desensitization of postsynaptic histaminergic receptors as a result of constant HA release. Ciproxifan (H3-receptor inverse agonist) enhanced W in wild-type mice, but not in H3R-/-mice, indicating a functional deletion of H3-receptors, whereas triprolidine (postsynaptic H1-receptor antagonist) or α-fluoromethylhistidine (HA-synthesis inhibitor) caused a greater SWS increase in H3R-/- than in wild-type mice, consistent with enhanced HA neurotransmission. These sleep-wake characteristics and the obesity phenotypes previously reported in this animal model suggest that chronic enhancement of histaminergic neurotransmission eventually compromises the arousal system, leading to sleep-wake, behavioral, and metabolic disorders similar to those caused by voluntary sleep restriction in humans.

  4. Effects of eggplant (Solanum melongena) on the atherogenesis and oxidative stress in LDL receptor knock out mice (LDLR(-/-)).


    Botelho, Françoise V; Enéas, Luciana R; Cesar, Giovana C; Bizzotto, Carolina S; Tavares, Erico; Oliveira, Fabrícia A; Gloria, M Beatriz A; Silvestre, Marialice P C; Arantes, Rosa M E; Alvarez-Leite, Jacqueline I


    Eggplant (Solanum melongena) has been used as hypocholesterolemic agent in many countries. However, few controlled studies were addressed to this subject and atherogenesis. We have evaluated the effect of eggplant on cholesterol metabolism and atherogenesis in LDLR(-/-) mice. Animals were fed on chow (n=17) or atherogenic (n=21) diet during 12 weeks receiving water (control) or eggplant extract. Liver, serum and fecal lipids, together with serum lipoproteins were measured. Oxidative stress was evaluated through conjugate diene formation and ox-LDL antibodies by enzyme immunoassay. Atherosclerotic lesions were measured in different sites of aorta. Total cholesterol and atherogenic lipoproteins did not decrease after eggplant intake. Animals receiving eggplant and chow diet showed increased anti-ox-LDL antibodies and a decreased lag phase of conjugated diene formation, indicating a higher oxidative stress than controls. No differences were seen in lesion area of aortic valve. Eggplant extract had high histamine and other amine levels that could enhance LDL oxidation and its endocytosis. Eggplant did not decrease plasma cholesterol nor prevent the development of atherosclerosis in LDLR(-/-) mice. Surprisingly, eggplant increased oxidative stress, representing a risk factor for atherosclerosis. These results did not support the use of eggplant extract as hypocholesterolemic agent.

  5. Small Conductance Ca2+-Activated K+ Channel Knock-Out Mice Reveal the Identity of Calcium-Dependent Afterhyperpolarization Currents

    PubMed Central

    Bond, Chris T.; Herson, Paco S.; Strassmaier, Timothy; Hammond, Rebecca; Stackman, Robert; Maylie, James; Adelman, John P.


    Action potentials in many central neurons are followed by a prolonged afterhyperpolarization (AHP) that influences firing frequency and affects neuronal integration. In hippocampal CA1 pyramidal neurons, the current ascribed to the AHP (IAHP) has three kinetic components. The IfastAHP is predominantly attributable to voltage-dependent K+ channels, whereas Ca2+-dependent and voltage-independent K+ channels contribute to the ImediumAHP (ImAHP) and IslowAHP (IsAHP). Apamin, which selectively suppresses a component of the mAHP, increases neuronal excitability and facilitates the induction of synaptic plasticity at Schaffer collateral synapses and hippocampal-dependent learning. The Ca2+-dependent components of the AHP have been attributed to the activity of small conductance Ca2+-activated K+(SK) channels. Examination of transgenic mice, each lacking one of the three SK channel genes expressed in the CNS, reveals that mice without the SK2 subunit completely lack the apamin-sensitive component of the ImAHP in CA1 neurons, whereas the IsAHP is not different in any of the SK transgenic mice. In each of the transgenic lines, the expression levels of the remaining SK genes are not changed. The results demonstrate that only SK2 channels are necessary for the ImAHP, and none of the SK channels underlie the IsAHP. PMID:15190101

  6. Pharmacological enhancement of mGlu5 receptors rescues behavioral deficits in SHANK3 knock-out mice

    PubMed Central

    Vicidomini, Cinzia; Ponzoni, Luisa; Lim, Dmitry; Schmeisser, Michael; Reim, Dominik; Morello, Noemi; Orelanna, Daniel; Tozzi, Alessandro; Durante, Valentina; Scalmani, Paolo; Mantegazza, Massimo; Genazzani, Armando A.; Giustetto, Maurizio; Sala, Mariaelvina; Calabresi, Paolo; Boeckers, Tobias M.; Sala, Carlo; Verpelli, Chiara


    SHANK3 (also called PROSAP2) genetic haploinsufficiency is thought to be the major cause of neuropsychiatric symptoms in Phelan-McDermid syndrome (PMS). PMS is a rare genetic disorder that causes a severe form of intellectual disability (ID), expressive language delays and other autistic features. Furthermore, a significant number of SHANK3 mutations have been identified in patients with Autism Spectrum disorders ASD, and SHANK3 truncating mutations are associated with moderate to profound ID. The Shank3 protein is a scaffold protein that is located in the postsynaptic density (PSD) of excitatory synapses and is crucial for synapse development and plasticity. In this study, we investigated the molecular mechanisms associated with the ASD-like behaviors observed in Shank3Δ11-/- mice in which exon 11 has been deleted. Our results indicate that Shank3 is essential to mediating mGlu5 receptor signaling by recruiting Homer1b/c to the PSD, specifically in the striatum and cortex. Moreover, augmenting mGlu5 receptor activity by administering 3-Cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB) ameliorated the functional and behavioral defects that were observed in Shank3Δ11-/- mice, suggesting that pharmaceutical treatments that increase mGlu5 activity may represent a new approach for treating patients that are affected by PMS and SHANK3 mutations. PMID:27021819

  7. Dietary cladode powder from wild type and domesticated Opuntia species reduces atherogenesis in apoE knock-out mice.


    Garoby-Salom, Sandra; Guéraud, Françoise; Camaré, Caroline; de la Rosa, Ana-Paulina Barba; Rossignol, Michel; Santos Díaz, María del Socorro; Salvayre, Robert; Negre-Salvayre, Anne


    Dietary intake of Opuntia species may prevent the development of cardiovascular diseases. The present study was designed to characterize the biological antioxidant and anti-inflammatory properties of Opuntia species and to investigate whether Opuntia cladodes prevent the development of atherosclerosis in vivo, in apoE(-)KO mice. The effects of the two Opuntia species, the wild Opuntia streptacantha and the domesticated Opuntia ficus-indica, were tested on the generation of intra- and extracellular reactive oxygen species (ROS) production and kinetics of the LDL oxidation by murine CRL2181 endothelial cells and on the subsequent inflammatory signaling leading to the adhesion of monocytes on the activated endothelium and the formation of foam cells. Opuntia species blocked the extracellular ROS (superoxide anion) generation and LDL oxidation by CRL2181, as well as the intracellular ROS rise and signaling evoked by the oxidized LDL, including the nuclear translocation of the transcription factor NFκB, the expression of ICAM-1 and VCAM-1 adhesion molecules, and the adhesion of monocytes to CRL2181. In vivo, Opuntia significantly reduced the formation of atherosclerotic lesions and the accumulation of 4-hydroxynonenal adducts in the vascular wall of apoE-KO mice, indicating that Opuntia cladodes prevent lipid oxidation in the vascular wall. In conclusion, wild and domesticated Opuntia species exhibit antioxidant, anti-inflammatory, and antiatherogenic properties which emphasize their nutritional benefit for preventing cardiovascular diseases.

  8. A role for glucocorticoid-signaling in depression-like behavior of gastrin-releasing peptide receptor knock-out mice.


    Monje, Francisco J; Kim, Eun-Jung; Cabatic, Maureen; Lubec, Gert; Herkner, Kurt R; Pollak, Daniela D


    Abstract Background. The gastrin-releasing peptide receptor (GRPR) is highly expressed in the limbic system, where it importantly regulates emotional functions and in the suprachiasmatic nucleus, where it is central for the photic resetting of the circadian clock. Mice lacking GRPR presented with deficient light-induced phase shift in activity as well altered emotional learning and amygdala function. The effect of GRPR deletion on depression-like behavior and its molecular signature in the amygdala, however, has not yet been evaluated. Methods. GRPR knock-out mice (GRPR-KO) were tested in the forced-swim test and the sucrose preference test for depression-like behavior. Gene expression in the basolateral nucleus of the amygdala was evaluated by micorarray analysis subsequent to laser-capture microdissection-assisted extraction of mRNA. The expression of selected genes was confirmed by RT-PCR. Results. GRPR-KO mice were found to present with increased depression-like behavior. Microarray analysis revealed down-regulation of several glucocorticoid-responsive genes in the basolateral amygdala. Acute administration of dexamethasone reversed the behavioral phenotype and alterations in gene expression. Discussion. We propose that deletion of GRPR leads to the induction of depression-like behavior which is paralleled by dysregulation of amygdala gene expression, potentially resulting from deficient light-induced corticosterone release in GRPR-KO.

  9. Circadian rhythms in heart rate, motility, and body temperature of wild-type C57 and eNOS knock-out mice under light-dark, free-run, and after time zone transition.


    Arraj, M; Lemmer, B


    The nitric oxide (NO) system is involved in the regulation of the cardiovascular system in controlling central and peripheral vascular tone and cardiac functions. It was the aim of this study to investigate in wild-type C57BL/6 and endothelial nitric oxide synthase (eNOS) knock-out mice (eNOS-/-) the contribution of NO on the circadian rhythms in heart rate (HR), motility (motor activity [MA]), and body temperature (BT) under various environmental conditions. Experiments were performed in 12:12 h of a light:dark cycle (LD), under free-run in total darkness (DD), and after a phase delay shift of the LD cycle by -6 h (i.e., under simulation of a westward time zone transition). All parameters were monitored by radiotelemetry in freely moving mice. In LD, no significant differences in the rhythms of HR and MA were observed between the two strains of mice. BT, however, was significantly lower during the light phase in eNOS-/- mice, resulting in a significantly greater amplitude. The period of the free-running rhythm in DD was slightly shorter for all variables, though not significant. In general, rhythmicity was greater in eNOS-/- than in C57 mice both in LD and DD. After a delay shift of the LD cycle, HR and BT were resynchronized to the new LD schedule within 5-6 days, and resynchronization of MA occurred within 2-3 days. The results in telemetrically instrumented mice show that complete knock-out of the endothelial NO system--though expressed in the suprachiasmatic nuclei and in peripheral tissues--did not affect the circadian organization of heart rate and motility. The circadian regulation of the body temperature was slightly affected in eNOS-/- mice.

  10. Antidepressant activity: contribution of brain microdialysis in knock-out mice to the understanding of BDNF/5-HT transporter/5-HT autoreceptor interactions

    PubMed Central

    Gardier, Alain M.


    Why antidepressants vary in terms of efficacy is currently unclear. Despite the leadership of selective serotonin reuptake inhibitors (SSRIs) in the treatment of depression, the precise neurobiological mechanisms involved in their therapeutic action are poorly understood. A better knowledge of molecular interactions between monoaminergic system, pre- and post-synaptic partners, brain neuronal circuits and regions involved may help to overcome limitations of current treatments and identify new therapeutic targets. Intracerebral in vivo microdialysis (ICM) already provided important information about the brain mechanism of action of antidepressants first in anesthetized rats in the early 1990s, and since then in conscious wild-type or knock-out mice. The principle of ICM is based on the balance between release of neurotransmitters (e.g., monoamines) and reuptake by selective transporters [e.g., serotonin transporter for serotonin 5-hydroxytryptamine (5-HT)]. Complementary to electrophysiology, this technique reflects pre-synaptic monoamines release and intrasynaptic events corresponding to ≈80% of whole brain tissue content. The inhibitory role of serotonergic autoreceptors infers that they limit somatodendritic and nerve terminal 5-HT release. It has been proposed that activation of 5-HT1A and 5-HT1B receptor sub-types limits the antidepressant-like activity of SSRIs. This hypothesis is based partially on results obtained in ICM experiments performed in naïve, non-stressed rodents. The present review will first remind the principle and methodology of ICM performed in mice. The crucial need of developing animal models that display anxiety and depression-like behaviors, neurochemical and brain morphological phenotypes reminiscent of these mood disorders in humans, will be underlined. Recently developed genetic mouse models have been generated to independently manipulate 5-HT1A auto and heteroreceptors and ICM helped to clarify the role of the pre-synaptic component

  11. Conversion of the modulatory actions of dopamine on spinal reflexes from depression to facilitation in D3 receptor knock-out mice.


    Clemens, Stefan; Hochman, Shawn


    Descending monoaminergic systems modulate spinal cord function, yet spinal dopaminergic actions are poorly understood. Using the in vitro lumbar cord, we studied the effects of dopamine and D2-like receptor ligands on spinal reflexes in wild-type (WT) and D3-receptor knock-out mice (D3KO). Low dopamine levels (1 microM) decreased the monosynaptic "stretch" reflex (MSR) amplitude in WT animals and increased it in D3KO animals. Higher dopamine concentrations (10-100 microM) decreased MSR amplitudes in both groups, but always more strongly in WT. Like low dopamine, the D3 receptor agonists pergolide and PD 128907 reduced MSR amplitude in WT but not D3KO mice. Conversely, D3 receptor antagonists (GR 103691 and nafadotride) increased the MSR in WT but not in D3KO mice. In comparison, D2-preferring agonists bromocriptine and quinpirole depressed the MSR in both groups. Low dopamine (1-5 microM) also depressed longer-latency (presumably polysynaptic) reflexes in WT but facilitated responses in D3KO mice. Additionally, in some experiments (e.g., during 10 microM dopamine or pergolide in WT), polysynaptic reflexes were facilitated in parallel to MSR depression, demonstrating differential modulatory control of these reflex circuits. Thus, low dopamine activates D3 receptors to limit reflex excitability. Moreover, in D3 ligand-insensitive mice, excitatory actions are unmasked, functionally converting the modulatory action of dopamine from depression to facilitation. Restless legs syndrome (RLS) is a CNS disorder involving abnormal limb sensations. Because RLS symptoms peak at night when dopamine levels are lowest, are relieved by D3 agonists, and likely involve increased reflex excitability, the D3KO mouse putatively explains how impaired D3 activity could contribute to this sleep disorder.

  12. Increased cellular free cholesterol in macrophage-specific Abca1 knock-out mice enhances pro-inflammatory response of macrophages.


    Zhu, Xuewei; Lee, Ji-Young; Timmins, Jenelle M; Brown, J Mark; Boudyguina, Elena; Mulya, Anny; Gebre, Abraham K; Willingham, Mark C; Hiltbold, Elizabeth M; Mishra, Nilamadhab; Maeda, Nobuyo; Parks, John S


    Macrophage-specific Abca1 knock-out (Abca1(-)(M)(/-)(M)) mice were generated to determine the role of macrophage ABCA1 expression in plasma lipoprotein concentrations and the innate immune response of macrophages. Plasma lipid and lipoprotein concentrations in chow-fed Abca1(-)(M)(/-)(M) and wild-type (WT) mice were indistinguishable. Compared with WT macrophages, Abca1(-)(M)(/-)(M) macrophages had a >95% reduction in ABCA1 protein, failed to efflux lipid to apoA-I, and had a significant increase in free cholesterol (FC) and membrane lipid rafts without induction of endoplasmic reticulum stress. Lipopolysaccharide (LPS)-treated Abca1(-)(M)(/-)(M) macrophages exhibited enhanced expression of pro-inflammatory cytokines and increased activation of the NF-kappaB and MAPK pathways, which could be diminished by silencing MyD88 or by chemical inhibition of NF-kappaB or MAPK. In vivo LPS injection also resulted in a higher pro-inflammatory response in Abca1(-)(M)(/-)(M) mice compared with WT mice. Furthermore, cholesterol depletion of macrophages with methyl-beta-cyclodextrin normalized FC content between the two genotypes and their response to LPS; cholesterol repletion of macrophages resulted in increased cellular FC accumulation and enhanced cellular response to LPS. Our results suggest that macrophage ABCA1 expression may protect against atherosclerosis by facilitating the net removal of excess lipid from macrophages and dampening pro-inflammatory MyD88-dependent signaling pathways by reduction of cell membrane FC and lipid raft content.

  13. Sensitivity of heterozygous α1,6-fucosyltransferase knock-out mice to cigarette smoke-induced emphysema: implication of aberrant transforming growth factor-β signaling and matrix metalloproteinase gene expression.


    Gao, Congxiao; Maeno, Toshitaka; Ota, Fumi; Ueno, Manabu; Korekane, Hiroaki; Takamatsu, Shinji; Shirato, Ken; Matsumoto, Akio; Kobayashi, Satoshi; Yoshida, Keiichi; Kitazume, Shinobu; Ohtsubo, Kazuaki; Betsuyaku, Tomoko; Taniguchi, Naoyuki


    We previously demonstrated that a deficiency in core fucosylation caused by the genetic disruption of α1,6-fucosyltransferase (Fut8) leads to lethal abnormalities and the development of emphysematous lesions in the lung by attenuation of TGF-β1 receptor signaling. Herein, we investigated the physiological relevance of core fucosylation in the pathogenesis of emphysema using viable heterozygous knock-out mice (Fut8(+/-)) that were exposed to cigarette smoke (CS). The Fut8(+/-) mice exhibited a marked decrease in FUT8 activity, and matrix metalloproteinase (MMP)-9 activities were elevated in the lung at an early stage of exposure. Emphysema developed after a 3-month CS exposure, accompanied by the recruitment of large numbers of macrophages to the lung. CS exposure substantially and persistently elevated the expression level of Smad7, resulting in a significant reduction of Smad2 phosphorylation (which controls MMP-9 expression) in Fut8(+/-) mice and Fut8-deficient embryonic fibroblast cells. These in vivo and in vitro studies show that impaired core fucosylation enhances the susceptibility to CS and constitutes at least part of the disease process of emphysema, in which TGF-β-Smad signaling is impaired and the MMP-mediated destruction of lung parenchyma is up-regulated.

  14. Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis

    PubMed Central

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K.; Joshi, Amritanshu B.; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D.; KuKuruga, Mark A.; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L.


    Background Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Methodology Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells

  15. Working Memory Impairment in Calcineurin Knock-out Mice Is Associated with Alterations in Synaptic Vesicle Cycling and Disruption of High-Frequency Synaptic and Network Activity in Prefrontal Cortex

    PubMed Central

    Cottrell, Jeffrey R.; Levenson, Jonathan M.; Kim, Sung Hyun; Gibson, Helen E.; Richardson, Kristen A.; Sivula, Michael; Li, Bing; Ashford, Crystle J.; Heindl, Karen A.; Babcock, Ryan J.; Rose, David M.; Hempel, Chris M.; Wiig, Kjesten A.; Laeng, Pascal; Levin, Margaret E.; Ryan, Timothy A.


    Working memory is an essential component of higher cognitive function, and its impairment is a core symptom of multiple CNS disorders, including schizophrenia. Neuronal mechanisms supporting working memory under normal conditions have been described and include persistent, high-frequency activity of prefrontal cortical neurons. However, little is known about the molecular and cellular basis of working memory dysfunction in the context of neuropsychiatric disorders. To elucidate synaptic and neuronal mechanisms of working memory dysfunction, we have performed a comprehensive analysis of a mouse model of schizophrenia, the forebrain-specific calcineurin knock-out mouse. Biochemical analyses of cortical tissue from these mice revealed a pronounced hyperphosphorylation of synaptic vesicle cycling proteins known to be necessary for high-frequency synaptic transmission. Examination of the synaptic vesicle cycle in calcineurin-deficient neurons demonstrated an impairment of vesicle release enhancement during periods of intense stimulation. Moreover, brain slice and in vivo electrophysiological analyses showed that loss of calcineurin leads to a gene dose-dependent disruption of high-frequency synaptic transmission and network activity in the PFC, correlating with selective working memory impairment. Finally, we showed that levels of dynamin I, a key presynaptic protein and calcineurin substrate, are significantly reduced in prefrontal cortical samples from schizophrenia patients, extending the disease relevance of our findings. Our data provide support for a model in which impaired synaptic vesicle cycling represents a critical node for disease pathologies underlying the cognitive deficits in schizophrenia. PMID:23825400

  16. Knock out of S1P3 receptor signaling attenuates inflammation and fibrosis in bleomycin-induced lung injury mice model.


    Murakami, Ken; Kohno, Masataka; Kadoya, Masatoshi; Nagahara, Hidetake; Fujii, Wataru; Seno, Takahiro; Yamamoto, Aihiro; Oda, Ryo; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Morita, Satoshi; Nakada, Hiroshi; Hla, Timothy; Kawahito, Yutaka


    Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite involved in many critical cellular processes, including proliferation, migration, and angiogenesis, through interaction with a family of five G protein-coupled receptors (S1P1-5). Some reports have implicated S1P as an important inflammatory mediator of the pathogenesis of airway inflammation, but the role of S1P3 in the pathogenesis of lung diseases is not completely understood. We used S1P3-deficient (knockout (KO)) mice to clarify the role of S1P3 receptor signaling in the pathogenesis of pulmonary inflammation and fibrosis using a bleomycin-induced model of lung injury. On the seventh day after bleomycin administration, S1P3 KO mice exhibited significantly less body weight loss and pulmonary inflammation than wild-type (WT) mice. On the 28th day, there was less pulmonary fibrosis in S1P3 KO mice than in WT mice. S1P3 KO mice demonstrated a 56% reduction in total cell count in bronchoalveolar lavage fluid (BALF) collected on the seventh day compared with WT mice; however, the differential white blood cell profiles were similar. BALF analysis on the seventh day showed that connective tissue growth factor (CTGF) levels were significantly decreased in S1P3 KO mice compared with WT mice, although no differences were observed in monocyte chemotactic protein-1 (MCP-1) or transforming growth factor β1 (TGF-β1) levels. Finally, S1P levels in BALF collected on the 7th day after treatment were not significantly different between WT and S1P3 KO mice. Our results indicate that S1P3 receptor signaling plays an important role in pulmonary inflammation and fibrosis and that this signaling occurs via CTGF expression. This suggests that this pathway might be a therapeutic target for pulmonary fibrosis.

  17. Effects of ascorbic acid on carcinogenicity and acute toxicity of nickel subsulfide, and on tumor transplants growth in gulonolactone oxidase knock-out mice and wild-type C57BL mice.


    Kasprzak, Kazimierz S; Diwan, Bhalchandra A; Kaczmarek, Monika Z; Logsdon, Daniel L; Fivash, Mathew J; Salnikow, Konstantin


    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono--lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni₃S₂), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni₃S₂ carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni₃S₂. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni₃S₂ in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni₃S₂ carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni₃S₂ and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies.

  18. Involvement of mitogen-activated protein kinases (MAPKs) during testicular ischemia-reperfusion injury in nuclear factor-kappaB knock-out mice.


    Minutoli, Letteria; Antonuccio, Pietro; Polito, Francesca; Bitto, Alessandra; Fiumara, Tiziana; Squadrito, Francesco; Nicotina, Piero Antonio; Arena, Salvatore; Marini, Herbert; Romeo, Carmelo; Altavilla, Domenica


    Nuclear factor kappa-B (NF-kappaB), extracellular regulated kinase (ERK 1/2) and c-jun-N terminal kinase (JNK) play an important role in testicular ischemia. We investigated the patterns of ERK1/2, JNK and p38 activation in NF-kappaB knockout (KO) mice subjected to testicular torsion. KO and normal littermate wild-type (WT) animals underwent at 1 h testicular ischemia followed by 24 h reperfusion (TI/R). Sham testicular ischemia-reperfusion mice served as controls. ERK 1/2, JNK and p38 expression by western blot analysis, tumor necrosis factor-alpha (TNF-alpha) expression (RT-PCR and western blot analysis) and a complete histological examination were carried out. TI/R caused a greater increase in phosphorylated form of ERK 1/2 in KO mice than in WT animals in either the ischemic testis and the contralateral one. By contrary, active form of JNK and p38 were completely abrogated in both testes of KO mice, while WT animals showed a significant activation of those kinases in both testes. TNF-alpha expression was markedly reduced in KO mice when compared to WT mice either at the mRNA and the protein level. Finally TI/R-induced histological damage was markedly reduced in KO mice. Our data indicate that NF-kappaB plays a pivotal role in the development of testicular ischemia-reperfusion injury and suggest that, in the absence of the transcriptional factor, the up-stream signal JNK and p38 may be abrogated while ERK 1/2 activity is enhanced.

  19. Unexpected Lack of Hypersensitivity in LRRK2 Knock-out Mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)

    PubMed Central

    Andres-Mateos, Eva; Mejias, Rebeca; Sasaki, Masayuki; Li, Xiaojie; Lin, Brian M; Biskup, Saskia; Zhang, Li; Banerjee, Rebecca; Thomas, Bobby; Yang, Lichuan; Liu, Guosheng; Beal, M Flint; Huso, David L; Dawson, Ted M; Dawson, Valina L


    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common known cause of Parkinson's disease (PD). Whether loss of LRRK2 function accounts for neurodegeneration of dopamine neurons in PD is not known, nor is it known whether LRRK2 kinase activity modulates the susceptibility of dopamine (DA) neurons to the selective dopaminergic toxin, 1-methyl-4-phenyl-1,2,3,6 tetrahydropyridine (MPTP). To better understand the role of LRRK2 in DA neuronal survival and its role in the susceptibility of DA neurons to MPTP, we generated LRRK2 knockout (KO) mice lacking the kinase domain of LRRK2. Here we show that LRRK2 KO mice are viable and have no major abnormalities and live to adulthood. The dopaminergic system is normal in LRRK2 KO mice as assessed via HPLC for DA and its metabolites and via stereologic assessment of DA neuron number in young and aged mice. Importantly, there is no significant difference in the susceptibility of LRRK2 KO and wild type (WT) mice to MPTP. These results suggest that LRRK2 plays little if any role in the development and survival of DA neurons under physiologic conditions. Thus, PD due to LRRK2 mutations are likely not due to a loss of function. Moreover, LRRK2 is not required for the susceptibility of DA neurons to MPTP. PMID:20016100

  20. Low 17beta-estradiol levels in CNR1 knock-out mice affect spermatid chromatin remodeling by interfering with chromatin reorganization.


    Cacciola, Giovanna; Chioccarelli, Teresa; Altucci, Lucia; Ledent, Catherine; Mason, J Ian; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda


    The type 1-cannabinoid receptor, CNR1, regulates differentiation of spermatids. Indeed, we have recently reported that the genetic inactivation of Cnr1 in mice influenced chromatin remodeling of spermatids, by reducing histone displacement and then sperm chromatin quality indices (chromatin condensation and DNA integrity). Herein, we have studied, at both central and testicular levels, the molecular signals potentially involved in histone displacement. In particular, investigation of the neuroendocrine axis involved in estrogen production demonstrated down-regulation of the axis supporting FSH/estrogen secretion in Cnr1-knockout male mice. Conversely, Cnr1-knockout male mice treated with 17beta-estradiol showed a weak increase of pituitary Fsh-beta subunit mRNA levels and a rescue of sperm chromatin quality indices demonstrating that estrogens, possibly in combination with FSH secretion, play an important role in regulating chromatin remodeling of spermatids.

  1. Enkephalin levels and the number of neuropeptide Y-containing interneurons in the hippocampus are decreased in female cannabinoid-receptor 1 knock-out mice.


    Rogers, Sophie A; Kempen, Tracey A Van; Pickel, Virginia M; Milner, Teresa A


    Drug addiction requires learning and memory processes that are facilitated by activation of cannabinoid-1 (CB1) and opioid receptors in the hippocampus. This involves activity-dependent synaptic plasticity that is partially regulated by endogenous opioid (enkephalin and dynorphin) and non-opioid peptides, specifically cholecystokinin, parvalbumin and neuropeptide Y, the neuropeptides present in inhibitory interneurons that co-express CB1 or selective opioid receptors. We tested the hypothesis that CB1 receptor expression is a determinant of the availability of one or more of these peptide modulators in the hippocampus. This was achieved by quantitatively analyzing the immunoperoxidase labeling for each of these neuropeptide in the dorsal hippocampus of female wild-type (CB1+/+) and cannabinoid receptor 1 knockout (CB1-/-) C57/BL6 mice. The levels of Leu(5)-enkephalin-immunoreactivity were significantly reduced in the hilus of the dentate gyrus and in stratum lucidum of CA3 in CB1-/- mice. Moreover, the numbers of neuropeptide Y-immunoreactive interneurons in the dentate hilus were significantly lower in the CB1-/- compared to wild-type mice. However, CB1+/+ and CB1-/- mice did not significantly differ in expression levels of either dynorphin or cholecystokinin, and showed no differences in numbers of parvalbumin-containing interneurons. These findings suggest that the cannabinoid and opioid systems have a nuanced, regulatory relationship that could affect the balance of excitation and inhibition in the hippocampus and thus processes such as learning that rely on this balance.

  2. Effects of ascorbic acid on carcinogenicity and acute toxicity of nickel subsulfide, and on tumor transplants growth in gulonolactone oxidase knock-out mice and wild-type C57BL mice

    SciTech Connect

    Kasprzak, Kazimierz S.; Diwan, Bhalchandra A.; Kaczmarek, Monika Z.; Logsdon, Daniel L.; Fivash, Mathew J.; Salnikow, Konstantin


    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono- < gamma > -lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni{sub 3}S{sub 2}), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni{sub 3}S{sub 2} carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni{sub 3}S{sub 2}. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni{sub 3}S{sub 2} in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni{sub 3}S{sub 2} carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni{sub 3}S{sub 2} and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies. -- Highlights: Black-Right-Pointing-Pointer Ascorbate depletion enhances carcinogenicity and acute toxicity of nickel. Black-Right-Pointing-Pointer Gulo-/- mice unable to synthesize ascorbate were used in this study. Black

  3. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice.


    Busby, Ellen R; Sherwood, Nancy M


    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15-28 may account for the altered metabolism in the prepubertal female pups.

  4. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice

    PubMed Central

    Busby, Ellen R.; Sherwood, Nancy M.


    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15–28 may account for the altered metabolism in the prepubertal female pups. PMID:28346489

  5. Meperidine, remifentanil and tramadol but not sufentanil interact with alpha(2)-adrenoceptors in alpha(2A)-, alpha(2B)- and alpha(2C)-adrenoceptor knock out mice brain.


    Höcker, Jan; Weber, Bernd; Tonner, Peter H; Scholz, Jens; Brand, Philipp-Alexander; Ohnesorge, Henning; Bein, Berthold


    alpha(2)-adrenoceptor agonists like clonidine or dexmedetomidine increase the sedative and analgesic actions of opioids. Furthermore opioids like meperidine show potent anti-shivering effects like alpha(2)-adrenoceptor agonists. The underlying molecular mechanisms of these effects are still poorly defined. The authors therefore studied the ability of four different opioids (meperidine, remifentanil, sufentanil and tramadol) to interact with different alpha(2)-adrenoceptor subtypes in mice lacking individual alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptors (alpha(2)-adrenoceptor knock out (alpha(2)-AR KO) mice)). The interaction of opioids with alpha(2)-adrenoceptors was investigated by quantitative receptor autoradiography in brain slices of alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptor deficient mice. Displacement of the radiolabelled alpha(2)-adrenoceptor agonist [(125)I]-paraiodoclonidine ([(125)I]-PIC) from alpha(2)-adrenoceptors in different brain regions by increasing opioid concentrations was measured, and binding affinity of the analysed opioids to alpha(2)-adrenoceptor subtypes in different brain regions was quantified. Meperidine, remifentanil and tramadol but not sufentanil provoked dose dependent displacement of specifically bound [(125)I]-PIC from all alpha(2)-adrenoceptor subtypes in cortex, cerebellum, medulla oblongata, thalamus, hippocampus and pons. Required concentrations of meperidine and remifentanil for [(125)I]-PIC displacement from alpha(2B)- and alpha(2C)-adrenoceptors were lower than from alpha(2A)-adrenoceptors, indicating higher binding affinity for alpha(2B)- and alpha(2C)-adrenoceptors. In contrast, [(125)I]-PIC displacement by tramadol indicated higher binding affinity to alpha(2A)-adrenoceptors than to alpha(2B)- and alpha(2C)-adrenoceptors. Our results indicate that meperidine, remifentanil and tramadol interact with alpha(2)-adrenoceptors in mouse brain showing different affinity for alpha(2A)-, alpha(2B)- and alpha(2C

  6. Attrition of Hepatic Damage Inflicted by Angiotensin II with α-Tocopherol and β-Carotene in Experimental Apolipoprotein E Knock-out Mice.


    Gopal, Kaliappan; Gowtham, Munusamy; Sachin, Singh; Ravishankar Ram, Mani; Shankar, Esaki M; Kamarul, Tunku


    Angiotensin II is one of the key regulatory peptides implicated in the pathogenesis of liver disease. The mechanisms underlying the salubrious role of α-tocopherol and β-carotene on liver pathology have not been comprehensively assessed. Here, we investigated the mechanisms underlying the role of Angiotensin II on hepatic damage and if α-tocopherol and β-carotene supplementation attenuates hepatic damage. Hepatic damage was induced in Apoe(-/-)mice by infusion of Angiotensin II followed by oral administration with α-tocopherol and β-carotene-enriched diet for 60 days. Investigations showed fibrosis, kupffer cell hyperplasia, hepatocyte degeneration and hepatic cell apoptosis; sinusoidal dilatation along with haemorrhages; evidence of fluid accumulation; increased ROS level and increased AST and ALT activities. In addition, tPA and uPA were down-regulated due to 42-fold up-regulation of PAI-1. MMP-2, MMP-9, MMP-12, and M-CSF were down-regulated in Angiotensin II-treated animals. Notably, α-tocopherol and β-carotene treatment controlled ROS, fibrosis, hepatocyte degeneration, kupffer cell hyperplasia, hepatocyte apoptosis, sinusoidal dilatation and fluid accumulation in the liver sinusoids, and liver enzyme levels. In addition, PAI-1, tPA and uPA expressions were markedly controlled by β-carotene treatment. Thus, Angiotensin II markedly influenced hepatic damage possibly by restraining fibrinolytic system. We concluded that α-tocopherol and β-carotene treatment has salubrious role in repairing hepatic pathology.

  7. Comparative hepatic effects of perfluorooctanoic acid and WY 14,643 in PPARa-knocked out and wild-type mice.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is an environmentally persistent chemical commonly found in humans and wildlife. Induction of liver tumors by PFOA in rodents is thought to be mediated by PPARα activation, although hepatic hypertrophy persists in PPARα-null mice. This study evalua...

  8. Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice

    PubMed Central

    Matheu, Victor; Treschow, Alexandra; Teige, Ingrid; Navikas, Vaidrius; Issazadeh-Navikas, Shohreh


    Background CpG oligodeoxynucleotides (CpG-ODN) are capable of inducing high amounts of type I IFNs with many immunomodulatory properties. Furthermore, type-I IFNs have been proposed to play a key role in mediating effects of CpG-ODN. The precise role of IFN-β in the immunomodulatory effects of CpG-ODN is not known. Objective Here, we aimed to elucidate the role of IFN-β in the anti-allergic effect of CpG motifs. Methods We assessed the immune response in OVA-primed/OVA-challenged IFN-β knockout (-/-) mice compared to wild type (WT) control, after intranasal and systemic treatment with synthetic CpG motifs. Results Vaccination with CpG-ODN reduced the number of cells in airways of OVA-sensitized WT but not IFN-β-/- mice. Although airway eosinophilia was reduced in both treated groups, they were significantly higher in IFN-β-/- mice. Other inflammatory cells, such as lymphocytes and macrophages were enhanced in airways by CpG treatment in IFN-β-/- mice. The ratio of IFN-γ/IL-4 cytokines in airways was significantly skewed to a Th1 response in WT compared to IFN-β-/- group. In contrast, IL-4 and IgE were reduced with no differences between groups. Ag-specific T-cell proliferation, Th1-cytokines such as IFN-γ, IL-2 and also IL-12 were significantly lower in IFN-β-/- mice. Surprisingly, we discovered that intranasal treatment of mice with CpG-ODN results in mild synovitis particularly in IFN-β-/- mice. Conclusion Our results indicate that induction of Th1 response by therapy with CpG-ODN is only slightly and partially dependent on IFN-β, while IFN-β is not an absolute requirement for suppression of airway eosinophilia and IgE. Furthermore, our finding of mild synovitis is a warning for possible negative effects of CpG-ODN vaccination. PMID:15748290

  9. Proton Knock-Out in Hall A

    SciTech Connect

    Kees de Jager


    Proton knock-out is studied in a broad program in Hall A at Jefferson Lab. The first experiment performed in Hall A studied the {sup 16}O(e,e'p) reaction. Since then proton knock-out experiments have studied a variety of aspects of that reaction, from single-nucleon properties to its mechanism, such as final-state interactions and two-body currents, in nuclei from {sup 2}H to {sup 16}O. In this review the results of this program will be summarized and an outlook given of future accomplishments.

  10. Relationships among parvalbumin-immunoreactive neuron density, phase-locked gamma oscillations, and autistic/schizophrenic symptoms in PDGFR-β knock-out and control mice.


    Nakamura, Tomoya; Matsumoto, Jumpei; Takamura, Yusaku; Ishii, Yoko; Sasahara, Masakiyo; Ono, Taketoshi; Nishijo, Hisao


    Cognitive deficits and negative symptoms are important therapeutic targets for schizophrenia and autism disorders. Although reduction of phase-locked gamma oscillation has been suggested to be a result of reduced parvalbumin-immunoreactive (putatively, GABAergic) neurons, no direct correlations between these have been established in these disorders. In the present study, we investigated such relationships during pharmacological treatment with a newly synthesized drug, T-817MA, which displays neuroprotective and neurotrophic effects. In this study, we used platelet-derived growth factor receptor-β gene knockout (PDGFR-β KO) mice as an animal model of schizophrenia and autism. These mutant mice display a reduction in social behaviors; deficits in prepulse inhibition (PPI); reduced levels of parvalbumin-immunoreactive neurons in the medical prefrontal cortex, hippocampus, amygdala, and superior colliculus; and a deficit in of auditory phase-locked gamma oscillations. We found that oral administration of T-817MA ameliorated all these symptoms in the PDGFR-β KO mice. Furthermore, phase-locked gamma oscillations were significantly correlated with the density of parvalbumin-immunoreactive neurons, which was, in turn, correlated with PPI and behavioral parameters. These findings suggest that recovery of parvalbumin-immunoreactive neurons by pharmacological intervention relieved the reduction of phase-locked gamma oscillations and, consequently, ameliorated PPI and social behavioral deficits. Thus, our findings suggest that phase-locked gamma oscillations could be a useful physiological biomarker for abnormality of parvalbumin-immunoreactive neurons that may induce cognitive deficits and negative symptoms of schizophrenia and autism, as well as of effective pharmacological interventions in both humans and experimental animals.

  11. Relationships among Parvalbumin-Immunoreactive Neuron Density, Phase-Locked Gamma Oscillations, and Autistic/Schizophrenic Symptoms in PDGFR-β Knock-Out and Control Mice

    PubMed Central

    Nakamura, Tomoya; Matsumoto, Jumpei; Takamura, Yusaku; Ishii, Yoko; Sasahara, Masakiyo; Ono, Taketoshi; Nishijo, Hisao


    Cognitive deficits and negative symptoms are important therapeutic targets for schizophrenia and autism disorders. Although reduction of phase-locked gamma oscillation has been suggested to be a result of reduced parvalbumin-immunoreactive (putatively, GABAergic) neurons, no direct correlations between these have been established in these disorders. In the present study, we investigated such relationships during pharmacological treatment with a newly synthesized drug, T-817MA, which displays neuroprotective and neurotrophic effects. In this study, we used platelet-derived growth factor receptor-β gene knockout (PDGFR-β KO) mice as an animal model of schizophrenia and autism. These mutant mice display a reduction in social behaviors; deficits in prepulse inhibition (PPI); reduced levels of parvalbumin-immunoreactive neurons in the medical prefrontal cortex, hippocampus, amygdala, and superior colliculus; and a deficit in of auditory phase-locked gamma oscillations. We found that oral administration of T-817MA ameliorated all these symptoms in the PDGFR-β KO mice. Furthermore, phase-locked gamma oscillations were significantly correlated with the density of parvalbumin-immunoreactive neurons, which was, in turn, correlated with PPI and behavioral parameters. These findings suggest that recovery of parvalbumin-immunoreactive neurons by pharmacological intervention relieved the reduction of phase-locked gamma oscillations and, consequently, ameliorated PPI and social behavioral deficits. Thus, our findings suggest that phase-locked gamma oscillations could be a useful physiological biomarker for abnormality of parvalbumin-immunoreactive neurons that may induce cognitive deficits and negative symptoms of schizophrenia and autism, as well as of effective pharmacological interventions in both humans and experimental animals. PMID:25803852

  12. Single and Compound Knock-outs of MicroRNA (miRNA)-155 and Its Angiogenic Gene Target CCN1 in Mice Alter Vascular and Neovascular Growth in the Retina via Resident Microglia.


    Yan, Lulu; Lee, Sangmi; Lazzaro, Douglas R; Aranda, Jacob; Grant, Maria B; Chaqour, Brahim


    The response of the retina to ischemic insult typically leads to aberrant retinal neovascularization, a major cause of blindness. The epigenetic regulation of angiogenic gene expression by miRNAs provides new prospects for their therapeutic utility in retinal neovascularization. Here, we focus on miR-155, a microRNA functionally important in inflammation, which is of paramount importance in the pathogenesis of retinal neovascularization. Whereas constitutive miR-155-deficiency in mice results in mild vascular defects, forced expression of miR-155 causes endothelial hyperplasia and increases microglia count and activation. The mouse model of oxygen-induced retinopathy, which recapitulates ischemia-induced aberrant neovessel growth, is characterized by increased expression of miR-155 and localized areas of microglia activation. Interestingly, miR-155 deficiency in mice reduces microglial activation, curtails abnormal vessel growth, and allows for rapid normalization of the retinal vasculature following ischemic insult. miR-155 binds to the 3'-UTR and represses the expression of the CCN1 gene, which encodes an extracellular matrix-associated integrin-binding protein that both promotes physiological angiogenesis and harnesses growth factor-induced abnormal angiogenic responses. Single CCN1 deficiency or double CCN1 and miR-155 knock-out in mice causes retinal vascular malformations typical of faulty maturation, mimicking the vascular alterations of miR-155 gain of function. During development, the miR-155/CCN1 regulatory axis balances the proangiogenic and proinflammatory activities of microglia to allow for their function as guideposts for sprout fusion and anastomosis. Under ischemic conditions, dysregulated miR-155 and CCN1 expression increases the inflammatory load and microglial activation, prompting aberrant angiogenic responses. Thus, miR-155 functions in tandem with CCN1 to modulate inflammation-induced vascular homeostasis and repair.

  13. Dynamics of Sun5 Localization during Spermatogenesis in Wild Type and Dpy19l2 Knock-Out Mice Indicates That Sun5 Is Not Involved in Acrosome Attachment to the Nuclear Envelope

    PubMed Central

    Yassine, Sandra; Escoffier, Jessica; Nahed, Roland Abi; Pierre, Virginie; Karaouzene, Thomas; Ray, Pierre F.; Arnoult, Christophe


    The acrosome is an organelle that is central to sperm physiology and a defective acrosome biogenesis leads to globozoospermia, a severe male infertility. The identification of the actors involved in acrosome biogenesis is therefore particularly important to decipher the molecular pathogeny of globozoospermia. We recently showed that a defect in the DPY19L2 gene is present in more than 70% of globozoospermic men and demonstrated that Dpy19l2, located in the inner nuclear membrane, is the first protein involved in the attachment of the acrosome to the nuclear envelope (NE). SUN proteins serve to link the nuclear envelope to the cytoskeleton and are therefore good candidates to participate in acrosome-nucleus attachment, potentially by interacting with DPY19L2. In order to characterize new actors of acrosomal attachment, we focused on Sun5 (also called Spag4l), which is highly expressed in male germ cells, and investigated its localization during spermatogenesis. Using immunohistochemistry and Western blot experiments in mice, we showed that Sun5 transits through different cellular compartments during meiosis. In pachytene spermatocytes, it is located in a membranous compartment different to the reticulum. In round spermatids, it progresses to the Golgi and the NE before to be located to the tail/head junction in epididymal sperm. Interestingly, we demonstrate that Sun5 is not, as initially reported, facing the acrosome but is in fact excluded from this zone. Moreover, we show that in Dpy19l2 KO spermatids, upon the detachment of the acrosome, Sun5 relocalizes to the totality of the NE suggesting that the acrosome attachment excludes Sun5 from the NE facing the acrosome. Finally, Western-blot experiments demonstrate that Sun5 is glycosylated. Overall, our work, associated with other publications, strongly suggests that the attachment of the acrosome to the nucleus does not likely depend on the formation of SUN complexes. PMID:25775128

  14. Upregulation of the Angiotensin-Converting Enzyme 2/Angiotensin-(1-7)/Mas Receptor Axis in the Heart and the Kidney of Growth Hormone Receptor knock-out Mice

    PubMed Central

    GIANI, Jorge F.; MIQUET, Johanna G.; MUÑOZ, Marina C.; BURGHI, Valeria; TOBLLI, Jorge E.; MASTERNAK, Michal M.; KOPCHIC, John J.; BARTKE, Andrzej; TURYN, Daniel; DOMINICI, Fernando P.


    Objective Growth hormone (GH) resistance leads to enhanced insulin sensitivity, decreased systolic blood pressure and increased lifespan. The aim of this study was to determine if there is a shift in the balance of the renin-angiotensin system (RAS) towards the ACE2/Ang-(1-7)/Mas receptor axis in the heart and the kidney of a model of GH resistance and retarded aging, the GH receptor knockout (GHR−/−) mouse. Design RAS components were evaluated in the heart and the kidney of GHR−/− and control mice by immunohistochemistry and western blotting (n=12 for both groups). Results The immunostaining of Ang-(1-7) was increased in both the heart and the kidney of GHR−/− mice. These changes were concomitant with an increased immunostaining of the Mas receptor and ACE2 in both tissues. The immunostaining of AT1 receptor was reduced in heart and kidney of GHR−/− mice while that of AT2 receptor was increased in the heart and unaltered in the kidney. Ang II, ACE and angiotensinogen levels remained unaltered in the heart and the kidney of GH resistant mice. These results were confirmed by Western Blotting and correlated with a significant increase in the abundance of the endothelial nitric oxide synthase in both tissues. Conclusions The shift within the RAS towards an exacerbation of the ACE2/Ang-(1-7)/Mas receptor axis observed in GHR−/− mice could be related to a protective role in cardiac and renal function; and thus, possibly contribute to the decreased incidence of cardiovascular diseases displayed by this animal model of longevity. PMID:22947377

  15. Global ischemia-induced increases in the gap junctional proteins connexin 32 (Cx32) and Cx36 in hippocampus and enhanced vulnerability of Cx32 knock-out mice.


    Oguro, K; Jover, T; Tanaka, H; Lin, Y; Kojima, T; Oguro, N; Grooms, S Y; Bennett, M V; Zukin, R S


    Gap junctions are conductive channels that connect the interiors of coupled cells. In the hippocampus, GABA-containing hippocampal interneurons are interconnected by gap junctions, which mediate electrical coupling and synchronous firing and thereby promote inhibitory transmission. The present study was undertaken to examine the hypothesis that the gap junctional proteins connexin 32 (Cx32; expressed by oligodendrocytes, interneurons, or both), Cx36 (expressed by interneurons), and Cx43 (expressed by astrocytes) play a role in defining cell-specific patterns of neuronal death in hippocampus after global ischemia in mice. Global ischemia did not significantly alter Cx32 and Cx36 mRNA expression and slightly increased Cx43 mRNA expression in the vulnerable CA1, as assessed by Northern blot analysis and in situ hybridization. Global ischemia induced a selective increase in Cx32 and Cx36 but not Cx43 protein abundance in CA1 before onset of neuronal death, as assessed by Western blot analysis. The increase in Cx32 and Cx36 expression was intense and specific to parvalbumin-positive inhibitory interneurons of CA1, as assessed by double immunofluorescence. Protein abundance was unchanged in CA3 and dentate gyrus. The finding of increase in connexin protein without increase in mRNA suggests regulation of Cx32 and Cx36 expression at the translational or post-translational level. Cx32(Y/-) null mice exhibited enhanced vulnerability to brief ischemic insults, consistent with a role for Cx32 gap junctions in neuronal survival. These findings suggest that Cx32 and Cx36 gap junctions may contribute to the survival and resistance of GABAergic interneurons, thereby defining cell-specific patterns of global ischemia-induced neuronal death.

  16. Mice expressing the human CYP7A1 gene in the mouse CYP7A1 knock-out background lack induction of CYP7A1 expression by cholesterol feeding and have increased hypercholesterolemia when fed a high fat diet.


    Chen, Jean Y; Levy-Wilson, Beatriz; Goodart, Sheryl; Cooper, Allen D


    Cholesterol 7alpha-hydroxylase (CYP7A1) catalyzes the rate-limiting step in the pathway responsible for the formation of the majority of bile acids. Transcription of the gene is regulated by the size of the bile acid pool and dietary and hormonal factors. The farnesoid X receptor and the liver X receptor (LXR) are responsible for regulation by bile acids and cholesterol, respectively. To study the effects of dietary cholesterol and fat upon expression of the human CYP7A1 gene, mice were generated by crossing transgenic mice carrying the human CYP7A1 gene with mice that were homozygous knock-outs (CYP7A1(-/-)). The mice (mCYP7A1(-/-)/hCYP7A1) expressed the human gene at much higher levels than did the transgenics bred in the wild-type background. A diet containing 1% cholic acid reduced the expression of the human gene in mCYP7A1(-/-)/hCYP7A1 mice to undetectable levels. Cholestyramine (5%) increased the level of expression of the human gene and the mouse gene. Thus, farnesoid X receptor-mediated regulation was preserved. A diet containing 2% cholesterol increased expression of the mouse gene in wild-type mice, but it did not affect expression of the human gene in mCYP7A1(-/-)/hCYP7A1 mice. None of the diets altered the serum cholesterol or triglyceride levels in these mice; 1% cholic acid caused a redistribution of cholesterol from the high density lipoprotein to the low density lipoprotein density in the humanized mice but not in wild-type mice. A diet containing 30% saturated fat and 2% cholesterol caused a decrease in CYP7A1 levels in mCYP7A1(-/-)/hCYP7A1 mice. The serum cholesterol levels rose in all mice fed this diet. The increase was greater in the mCYP7A1(-/-)/hCYP7A1 mice. Together, these data suggest that the lack of an LXR element in the region from -56 to -49 of the human CYP7A1 promoter may account for some of the differences in response to diets between humans and rodents.

  17. The Brain Proteome of the Ubiquitin Ligase Peli1 Knock-Out Mouse during Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Lereim, Ragnhild Reehorst; Oveland, Eystein; Xiao, Yichuan; Torkildsen, Øivind; Wergeland, Stig; Myhr, Kjell-Morten; Sun, Shao-Cong; Berven, Frode S


    The ubiquitin ligase Peli1 has previously been suggested as a potential treatment target in multiple sclerosis. In the multiple sclerosis disease model, experimental autoimmune encephalomyelitis, Peli1 knock-out led to less activated microglia and less inflammation in the central nervous system. Despite being important in microglia, Peli1 expression has also been detected in glial and neuronal cells. In the present study the overall brain proteomes of Peli1 knock-out mice and wild-type mice were compared prior to experimental autoimmune encephalomyelitis induction, at onset of the disease and at disease peak. Brain samples from the frontal hemisphere, peripheral from the extensive inflammatory foci, were analyzed using TMT-labeling of sample pools, and the discovered proteins were verified in individual mice using label-free proteomics. The greatest proteomic differences between Peli1 knock-out and wild-type mice were observed at the disease peak. In Peli1 knock-out a higher degree of antigen presentation, increased activity of adaptive and innate immune cells and alterations to proteins involved in iron metabolism were observed during experimental autoimmune encephalomyelitis. These results unravel global effects to the brain proteome when abrogating Peli1 expression, underlining the importance of Peli1 as a regulator of the immune response also peripheral to inflammatory foci during experimental autoimmune encephalomyelitis. The proteomics data is available in PRIDE with accession PXD003710. PMID:27746629

  18. Characterization of TG2 and TG1-TG2 double knock-out mouse epidermis.


    Pitolli, Consuelo; Pietroni, Valentina; Marekov, Lyuben; Terrinoni, Alessandro; Yamanishi, Kiyofumi; Mazzanti, Cinzia; Melino, Gerry; Candi, Eleonora


    Transglutaminases (TGs) are a family of enzymes that catalyse the formation of isopeptide bonds between the γ-carboxamide groups of glutamine residues and the ε-amino groups of lysine residues leading to cross-linking reactions among proteins. Four members, TG1, TG2, TG3, and TG5, of the nine mammalian enzymes are expressed in the skin. TG1, TG3 and TG5 crosslinking properties are fundamental for cornified envelope assembly. In contrast, the role of TG2 in keratinization has never been studied at biochemical level in vivo. In this study, taking advantage of the TG2 knock-out (KO) and TG1 heterozygous mice, we generated and characterized the epidermis of TG1-TG2 double knock-out (DKO) mice. We performed morphological analysis of the epidermis and evaluation of the expression of differentiation markers. In addition, we performed analysis of the amino acid composition from isolated corneocytes. We found a significant change in amino acid composition in TG1KO cornified cell envelopes (CEs) while TG2KO amino acid composition was similar to wild-type CEs. Our results confirm a key role of TG1 in skin differentiation and CE assembly and demonstrate that TG2 is not essential for CE assembly and skin formation.

  19. The Expression of TALEN before Fertilization Provides a Rapid Knock-Out Phenotype in Xenopus laevis Founder Embryos.


    Miyamoto, Kei; Suzuki, Ken-Ichi T; Suzuki, Miyuki; Sakane, Yuto; Sakuma, Tetsushi; Herberg, Sarah; Simeone, Angela; Simpson, David; Jullien, Jerome; Yamamoto, Takashi; Gurdon, J B


    Recent advances in genome editing using programmable nucleases have revolutionized gene targeting in various organisms. Successful gene knock-out has been shown in Xenopus, a widely used model organism, although a system enabling less mosaic knock-out in founder embryos (F0) needs to be explored in order to judge phenotypes in the F0 generation. Here, we injected modified highly active transcription activator-like effector nuclease (TALEN) mRNA to oocytes at the germinal vesicle (GV) stage, followed by in vitro maturation and intracytoplasmic sperm injection, to achieve a full knock-out in F0 embryos. Unlike conventional injection methods to fertilized embryos, the injection of TALEN mRNA into GV oocytes allows expression of nucleases before fertilization, enabling them to work from an earlier stage. Using this procedure, most of developed embryos showed full knock-out phenotypes of the pigmentation gene tyrosinase and/or embryonic lethal gene pax6 in the founder generation. In addition, our method permitted a large 1 kb deletion. Thus, we describe nearly complete gene knock-out phenotypes in Xenopus laevis F0 embryos. The presented method will help to accelerate the production of knock-out frogs since we can bypass an extra generation of about 1 year in Xenopus laevis. Meantime, our method provides a unique opportunity to rapidly test the developmental effects of disrupting those genes that do not permit growth to an adult able to reproduce. In addition, the protocol shown here is considerably less invasive than the previously used host transfer since our protocol does not require surgery. The experimental scheme presented is potentially applicable to other organisms such as mammals and fish to resolve common issues of mosaicism in founders.

  20. Norepinephrine transporter knock-out alters expression of the genes connected with antidepressant drugs action.


    Solich, Joanna; Kolasa, Magdalena; Kusmider, Maciej; Faron-Gorecka, Agata; Pabian, Paulina; Zurawek, Dariusz; Szafran-Pilch, Kinga; Dziedzicka-Wasylewska, Marta


    Norepinephrine transporter knock-out mice (NET-KO) exhibit depression-resistant phenotypes. They manifest significantly shorter immobility times in both the forced swim test and the tail suspension test. Moreover, biochemical studies have revealed the up-regulation of other monoamine transporters (dopamine and serotonin) in the brains of NET-KO mice, similar to the phenomenon observed after the chronic pharmacological blockade of norepinephrine transporter by desipramine in wild-type (WT) animals. NET-KO mice are also resistant to stress, as we demonstrated previously by measuring plasma corticosterone concentration. In the present study, we used a microdissection technique to separate target brain regions and the TaqMan Low Density Array approach to test the expression of a group of genes in the NET-KO mice compared with WT animals. A group of genes with altered expression were identified in four brain structures (frontal and cingulate cortices, dentate gyrus of hippocampus and basal-lateral amygdala) of NET-KO mice compared with WT mice. These genes are known to be altered by antidepressant drugs administration. The most interesting gene is Crh-bp, which modulates the activity of corticotrophin--releasing hormone (CRH) and several CRH-family members. Generally, genetic disturbances within noradrenergic neurons result in biological changes, such as in signal transduction and intercellular communication, and may be linked to changes in noradrenaline levels in the brains of NET-KO mice.

  1. Oxygen Knock-Out and Other Studies in -Irradiated Polycrystalline Bi-2212 Superconductor

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, S. K.; Ghosh, A. K.; Barat, P.; Sen, Pintu; Basu, A. N.; Ghosh, B.


    Bulk polycrystalline samples of Bi2Sr2CaCu2O8+x (Bi-2212) have been irradiated with 40 MeV -particles. Tc increases up to a certain dose. The increase in Tc is correlated with the knock-out of oxygen, which has been verified by the determination of the oxygen contents of the irradiated samples by iodometry. A model of the knock-out of oxygen is proposed on the basis of Monte-Carlo TRIM calculations. Resistivity versus temperature of the irradiated samples shows fairly metallic behaviour up to a certain dose. Excess conductivity analysis shows a cross-over from 2D to 3D behaviour in conductivity for the unirradiated sample. However, for irradiated samples, the critical fluctuation regime sets in. The interlayer coupling strengths decrease with the increase in the irradiation dose. The sample with the highest dose shows a nonmetallic behaviour in resistivity. A detailed analysis shows a conductivity behaviour in the nonmetallic region characteristic of three-dimensional variable range hopping of charge carriers.

  2. Knock-Out Models Reveal New Aquaporin Functions

    PubMed Central

    Verkman, Alan S.


    Knockout mice have been informative in the discovery of unexpected biological functions of aquaporins. Knockout mice have confirmed the predicted roles of aquaporins in transepithelial fluid transport, as in the urinary concentrating mechanism and glandular fluid secretion. A less obvious, though predictable role of aquaporins is in tissue swelling under stress, as in the brain in stroke, tumor and infection. Phenotype analysis of aquaporin knockout mice has revealed several unexpected cellular roles of aquaporins whose mechanisms are being elucidated. Aquaporins facilitate cell migration, as seen in aquaporin-dependent tumor angiogenesis and tumor metastasis, by a mechanism that may involve facilitated water transport in lamellipodia of migrating cells. The ‘aquaglyceroporins’, aquaporins that transport both glycerol and water, regulate glycerol content in epidermis, fat and other tissues, and lead to a multiplicity of interesting consequences of gene disruption including dry skin, resistance to skin carcinogenesis, impaired cell proliferation and altered fat metabolism. An even more surprising role of a mammalian aquaporin is in neural signal transduction in the central nervous system. The many roles of aquaporins might be exploited for clinical benefit by modulation of aquaporin expression/function – as diuretics, and in the treatment of brain swelling, glaucoma, epilepsy, obesity and cancer. PMID:19096787

  3. Pantothenate kinase-associated neurodegeneration: altered mitochondria membrane potential and defective respiration in Pank2 knock-out mouse model.


    Brunetti, Dario; Dusi, Sabrina; Morbin, Michela; Uggetti, Andrea; Moda, Fabio; D'Amato, Ilaria; Giordano, Carla; d'Amati, Giulia; Cozzi, Anna; Levi, Sonia; Hayflick, Susan; Tiranti, Valeria


    Neurodegeneration with brain iron accumulation (NBIA) comprises a group of neurodegenerative disorders characterized by high brain content of iron and presence of axonal spheroids. Mutations in the PANK2 gene, which encodes pantothenate kinase 2, underlie an autosomal recessive inborn error of coenzyme A metabolism, called pantothenate kinase-associated neurodegeneration (PKAN). PKAN is characterized by dystonia, dysarthria, rigidity and pigmentary retinal degeneration. The pathogenesis of this disorder is poorly understood and, although PANK2 is a mitochondrial protein, perturbations in mitochondrial bioenergetics have not been reported. A knock-out (KO) mouse model of PKAN exhibits retinal degeneration and azoospermia, but lacks any neurological phenotype. The absence of a clinical phenotype has partially been explained by the different cellular localization of the human and murine PANK2 proteins. Here we demonstrate that the mouse Pank2 protein localizes to mitochondria, similar to its human orthologue. Moreover, we show that Pank2-defective neurons derived from KO mice have an altered mitochondrial membrane potential, a defect further corroborated by the observations of swollen mitochondria at the ultra-structural level and by the presence of defective respiration.

  4. Mice Lacking Endoglin in Macrophages Show an Impaired Immune Response

    PubMed Central

    Ojeda-Fernández, Luisa; Recio-Poveda, Lucía; Aristorena, Mikel; Lastres, Pedro; Blanco, Francisco J.; Sanz-Rodríguez, Francisco; Gallardo-Vara, Eunate; de las Casas-Engel, Mateo; Corbí, Ángel; Arthur, Helen M.; Bernabeu, Carmelo; Botella, Luisa M.


    Endoglin is an auxiliary receptor for members of the TGF-β superfamily and plays an important role in the homeostasis of the vessel wall. Mutations in endoglin gene (ENG) or in the closely related TGF-β receptor type I ACVRL1/ALK1 are responsible for a rare dominant vascular dysplasia, the Hereditary Hemorrhagic Telangiectasia (HHT), or Rendu-Osler-Weber syndrome. Endoglin is also expressed in human macrophages, but its role in macrophage function remains unknown. In this work, we show that endoglin expression is triggered during the monocyte-macrophage differentiation process, both in vitro and during the in vivo differentiation of blood monocytes recruited to foci of inflammation in wild-type C57BL/6 mice. To analyze the role of endoglin in macrophages in vivo, an endoglin myeloid lineage specific knock-out mouse line (Engfl/flLysMCre) was generated. These mice show a predisposition to develop spontaneous infections by opportunistic bacteria. Engfl/flLysMCre mice also display increased survival following LPS-induced peritonitis, suggesting a delayed immune response. Phagocytic activity is impaired in peritoneal macrophages, altering one of the main functions of macrophages which contributes to the initiation of the immune response. We also observed altered expression of TGF-β1 target genes in endoglin deficient peritoneal macrophages. Overall, the altered immune activity of endoglin deficient macrophages could help to explain the higher rate of infectious diseases seen in HHT1 patients. PMID:27010826

  5. Knock-Outs, Stick-Outs, Cut-Outs: Clipping Paths Separate Objects from Background.

    ERIC Educational Resources Information Center

    Wilson, Bradley


    Outlines a six-step process that allows computer operators, using Photoshop software, to create "knock-outs" to precisely define the path that will serve to separate the object from the background. (SR)

  6. Vaccination with recombinant adenoviruses expressing Ebola virus glycoprotein elicits protection in the interferon alpha/beta receptor knock-out mouse.


    O'Brien, Lyn M; Stokes, Margaret G; Lonsdale, Stephen G; Maslowski, David R; Smither, Sophie J; Lever, Mark S; Laws, Thomas R; Perkins, Stuart D


    The resistance of adult immunocompetent mice to infection with ebolaviruses has led to the development of alternative small animal models that utilise immunodeficient mice, for example the interferon α/β receptor knock-out mouse (IFNR(-/-)). IFNR(-/-) mice have been shown to be susceptible to infection with ebolaviruses by multiple routes but it is not known if this murine model is suitable for testing therapeutics that rely on the generation of an immune response for efficacy. We have tested recombinant adenovirus vectors for their ability to protect IFNR(-/-) mice from challenge with Ebola virus and have analysed the humoral response generated after immunisation. The recombinant vaccines elicited good levels of protection in the knock-out mouse and the antibody response in IFNR(-/-) mice was similar to that observed in vaccinated wild-type mice. These results indicate that the IFNR(-/-) mouse is a relevant small animal model for studying ebolavirus-specific therapeutics.

  7. Selective Photoreceptor Gene Knock-out Reveals a Regulatory Role for the Growth Behavior of Pseudomonas syringae.


    Shah, Rashmi; Pathak, Gopal; Drepper, Thomas; Gärtner, Wolfgang


    The plant pathogen Pseudomonas syringae (Ps) is a well-established model organism for bacterial infection of plants. The genome sequences of two pathovars, pv. syringae and pv. tomato, revealed one gene encoding a blue and two genes encoding red/far red light-sensing photoreceptors. Continuing former molecular characterization of the photoreceptor proteins, we here report selective photoreceptor gene disruption for pv. tomato aiming at identification of potentially regulatory functions of these photoreceptors. Transformation of Ps cells with linear DNA constructs yielded interposon mutations of the corresponding genes. Cell growth studies of the generated photoreceptor knock-out mutants revealed their role in light-dependent regulation of cell growth and motility. Disruption of the blue-light (BL) receptor gene caused a growth deregulation, in line with an observed increased virulence of this mutant (Moriconi et al., Plant J., 2013, 76, 322). Bacterial phytochrome-1 (BphP1) deletion mutant caused unaltered cell growth, but a stronger swarming capacity. Inactivation of its ortholog, BphP2, however, caused reduced growth and remarkably altered dendritic swarming behavior. Combined knock-out of both bacteriophytochromes reproduced the swarming pattern observed for the BphP2 mutant alone. A triple knock-out mutant showed a growth rate between that of the BL (deregulation) and the phytochrome-2 mutant (growth reduction).

  8. Characterization of skeletal muscle in the synemin knock-out mouse

    NASA Astrophysics Data System (ADS)

    García-Pelagio, Karla P.; Muriel, Joaquin; Lovering, Richard M.; Lund, Linda; Bond, Meredith; Bloch, Robert J.


    Diseases linked to intermediate filament (IF) proteins are associated with defects in the organization of the contractile apparatus of skeletal and cardiac muscle and its links to costameres, which connect the sarcomeres to the cell membrane. Synemin is a large IF protein that associates with dystrobrevin, vinculin, and talin at costameres of the cell membrane of striated muscle, as well as with α-actinin and desmin at the Z disks. Synemin can be expressed in either 210 kDa α- or 180 kDa β- alternatively spliced forms. We generated mice null for synemin by homologous recombination to study synemin's function in skeletal muscle. Skeletal muscle in the knock out (syn KO) mouse does not make synemin mRNA or protein. Preliminary characterization of the syn KO mouse suggests that it has a mild skeletal muscle phenotype. The organization of costameres appears to be normal. Treadmill running uphill test results was not significantly affected when compared to controls at any age. More notably, the biomechanical properties of the cell membrane are different in the syn KO, though they are less affected than by the absence of desmin or dystrophin. These results suggest that the viscoelastic properties of the cell membrane-costamere-myofibril complex are significantly influenced by synemin.

  9. Photodynamic therapy and knocking out of single tumor cells by multiphoton excitation processes

    NASA Astrophysics Data System (ADS)

    Riemann, Iris; Fischer, Peter; Koenig, Karsten


    Near infrared (NIR) ultrashort laser pulses of 780 nm have been used to induce intracellular photodynamic reactions by nonlinear excitation of porphyrin photosensitizers. Intracellular accumulation and photobleaching of the fluorescent photosensitizers protoporphyrin IX and Photofrin (PF) have been studied by non-resonant two-photon fluorescence excitation of PF and aminolevulinic acid (ALA)-labeled Chinese hamster ovary (CHO) cells. To testify the efficacy of both substrates to induce irreversible destructive effects, the cloning efficiency (CE) of cells exposed to femtosecond pulses of a multiphoton laser scanning microscope (40x/1.3) was determined. In the case of Photofrin accumulation, CEs of 50% and 0% were obtained after 17 laserscans (2 mW?, 16 s/ frame) and 50 scans, respectively. All cells exposed to 50 scans died within 48h after laser exposure. 100 scans were required to induce lethal effects in ALA labeled cells. Sensitizer-free control cells could be scanned 250 times (1.1 h) and more without impact on the reproduction behavior, morphology, and vitality. In addition to the slow phototoxic effect by photooxidation processes, another destructive but immediate effect based on optical breakdown was induced when employing high intense NIR femtosecond laser beams. This was used to optically knock out single tumor cells in living mice (solid Ehrlich-Carcinoma) in a depth of 10 to 100 μm.

  10. Phospholipase D δ knock-out mutants are tolerant to severe drought stress

    PubMed Central

    Distéfano, Ayelen M; Valiñas, Matías A; Scuffi, Denise; Lamattina, Lorenzo; ten Have, Arjen; García-Mata, Carlos; Laxalt, Ana M


    Phospholipase D (PLD) is involved in different plant processes, ranging from responses to abiotic and biotic stress to plant development. Phospholipase Dδ (PLDδ) is activated in dehydration and salt stress, producing the lipid second messenger phosphatidic acid. In this work we show that pldδ Arabidopsis mutants were more tolerant to severe drought than wild-type plants. PLDδ has been shown to be required for ABA regulation of stomatal closure of isolated epidermal peels. However, there was no significant difference in stomatal conductance at the whole plant level between wild-type and pldδ mutants. Since PLD hydrolyses structural phospholipids, then we looked at membrane integrity. Ion leakage measurements showed that during dehydration of leaf discs pldδ mutant has less membrane degradation compared to the wild-type. We further analyzed the mutants and showed that pldδ have higher mRNA levels of RAB18 and RD29A compared to wild-type plants under normal growth conditions. Transient expression of AtPLDδ in Nicotiana benthamiana plants induced a wilting phenotype. These findings suggest that, in wt plants PLDδ disrupt membranes in severe drought stress and, in the absence of the protein (PLDδ knock-out) might drought-prime the plants, making them more tolerant to severe drought stress. The results are discussed in relation to PLDδ role in guard cell signaling and drought tolerance. PMID:26340512

  11. Phospholipase D δ knock-out mutants are tolerant to severe drought stress.


    Distéfano, Ayelen M; Valiñas, Matías A; Scuffi, Denise; Lamattina, Lorenzo; Ten Have, Arjen; García-Mata, Carlos; Laxalt, Ana M


    Phospholipase D (PLD) is involved in different plant processes, ranging from responses to abiotic and biotic stress to plant development. Phospholipase Dδ (PLDδ) is activated in dehydration and salt stress, producing the lipid second messenger phosphatidic acid. In this work we show that pldδ Arabidopsis mutants were more tolerant to severe drought than wild-type plants. PLDδ has been shown to be required for ABA regulation of stomatal closure of isolated epidermal peels. However, there was no significant difference in stomatal conductance at the whole plant level between wild-type and pldδ mutants. Since PLD hydrolyses structural phospholipids, then we looked at membrane integrity. Ion leakage measurements showed that during dehydration of leaf discs pldδ mutant has less membrane degradation compared to the wild-type. We further analyzed the mutants and showed that pldδ have higher mRNA levels of RAB18 and RD29A compared to wild-type plants under normal growth conditions. Transient expression of AtPLDδ in Nicotiana benthamiana plants induced a wilting phenotype. These findings suggest that, in wt plants PLDδ disrupt membranes in severe drought stress and, in the absence of the protein (PLDδ knock-out) might drought-prime the plants, making them more tolerant to severe drought stress. The results are discussed in relation to PLDδ role in guard cell signaling and drought tolerance.

  12. Multiple Cranial Organ Defects after Conditionally Knocking Out Fgf10 in the Neural Crest

    PubMed Central

    Teshima, Tathyane H. N.; Lourenco, Silvia V.; Tucker, Abigail S.


    Fgf10 is necessary for the development of a number of organs that fail to develop or are reduced in size in the null mutant. Here we have knocked out Fgf10 specifically in the neural crest driven by Wnt1cre. The Wnt1creFgf10fl/fl mouse phenocopies many of the null mutant defects, including cleft palate, loss of salivary glands, and ocular glands, highlighting the neural crest origin of the Fgf10 expressing mesenchyme surrounding these organs. In contrast tissues such as the limbs and lungs, where Fgf10 is expressed by the surrounding mesoderm, were unaffected, as was the pituitary gland where Fgf10 is expressed by the neuroepithelium. The circumvallate papilla of the tongue formed but was hypoplastic in the conditional and Fgf10 null embryos, suggesting that other sources of FGF can compensate in development of this structure. The tracheal cartilage rings showed normal patterning in the conditional knockout, indicating that the source of Fgf10 for this tissue is mesodermal, which was confirmed using Wnt1cre-dtTom to lineage trace the boundary of the neural crest in this region. The thyroid, thymus, and parathyroid glands surrounding the trachea were present but hypoplastic in the conditional mutant, indicating that a neighboring source of mesodermal Fgf10 might be able to partially compensate for loss of neural crest derived Fgf10. PMID:27826253

  13. 'Knock, and it shall be opened': knocking out and knocking in to reveal mechanisms of disease and novel therapies.


    Hacking, Douglas F


    Recent significant advances in molecular biology have generated genetically modified bacteria, yeast, nematodes, fruit flies, and fish. However, it is the genetic modification of mammalian model organisms, particularly the mouse, that has the greatest potential to shed light on human development, physiology and pathology in ways that have significant implications for neonatal and paediatric clinical practice. Here, we review some of the techniques for knocking out (inactivating), mutating and knocking in (inserting) selected genes that are important to neonatology and show how this research will lead both to a better understanding of disease and to novel therapies for infants and children.

  14. The fbpA/sapM Double Knock Out Strain of Mycobacterium tuberculosis Is Highly Attenuated and Immunogenic in Macrophages

    PubMed Central

    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J.; Khan, Arshad; Armitige, Lisa Y.; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian


    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine. PMID:22574140

  15. The fbpA/sapM double knock out strain of Mycobacterium tuberculosis is highly attenuated and immunogenic in macrophages.


    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J; Khan, Arshad; Armitige, Lisa Y; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian


    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine.

  16. Mice with Deficient BK Channel Function Show Impaired Prepulse Inhibition and Spatial Learning, but Normal Working and Spatial Reference Memory

    PubMed Central

    Azzopardi, Erin; Ruettiger, Lukas; Ruth, Peter; Schmid, Susanne


    Genetic variations in the large-conductance, voltage- and calcium activated potassium channels (BK channels) have been recently implicated in mental retardation, autism and schizophrenia which all come along with severe cognitive impairments. In the present study we investigate the effects of functional BK channel deletion on cognition using a genetic mouse model with a knock-out of the gene for the pore forming α-subunit of the channel. We tested the F1 generation of a hybrid SV129/C57BL6 mouse line in which the slo1 gene was deleted in both parent strains. We first evaluated hearing and motor function to establish the suitability of this model for cognitive testing. Auditory brain stem responses to click stimuli showed no threshold differences between knockout mice and their wild-type littermates. Despite of muscular tremor, reduced grip force, and impaired gait, knockout mice exhibited normal locomotion. These findings allowed for testing of sensorimotor gating using the acoustic startle reflex, as well as of working memory, spatial learning and memory in the Y-maze and the Morris water maze, respectively. Prepulse inhibition on the first day of testing was normal, but the knockout mice did not improve over the days of testing as their wild-type littermates did. Spontaneous alternation in the y-maze was normal as well, suggesting that the BK channel knock-out does not impair working memory. In the Morris water maze knock-out mice showed significantly slower acquisition of the task, but normal memory once the task was learned. Thus, we propose a crucial role of the BK channels in learning, but not in memory storage or recollection. PMID:24303038

  17. Fumarylacetoacetate Hydrolase Knock-out Rabbit Model for Hereditary Tyrosinemia Type 1*

    PubMed Central

    Li, Li; Zhang, Quanjun; Yang, Huaqiang; Zou, Qingjian; Lai, Chengdan; Jiang, Fei; Zhao, Ping; Luo, Zhiwei; Yang, Jiayin; Chen, Qian; Wang, Yan; Newsome, Philip N.; Frampton, Jon; Maxwell, Patrick H.; Li, Wenjuan; Chen, Shuhan; Wang, Dongye; Siu, Tak-Shing; Tam, Sidney; Tse, Hung-Fat; Qin, Baoming; Bao, Xichen; Esteban, Miguel A.; Lai, Liangxue


    Hereditary tyrosinemia type 1 (HT1) is a severe human autosomal recessive disorder caused by the deficiency of fumarylacetoacetate hydroxylase (FAH), an enzyme catalyzing the last step in the tyrosine degradation pathway. Lack of FAH causes accumulation of toxic metabolites (fumarylacetoacetate and succinylacetone) in blood and tissues, ultimately resulting in severe liver and kidney damage with onset that ranges from infancy to adolescence. This tissue damage is lethal but can be controlled by administration of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), which inhibits tyrosine catabolism upstream of the generation of fumarylacetoacetate and succinylacetone. Notably, in animals lacking FAH, transient withdrawal of NTBC can be used to induce liver damage and a concomitant regenerative response that stimulates the growth of healthy hepatocytes. Among other things, this model has raised tremendous interest for the in vivo expansion of human primary hepatocytes inside these animals and for exploring experimental gene therapy and cell-based therapies. Here, we report the generation of FAH knock-out rabbits via pronuclear stage embryo microinjection of transcription activator-like effector nucleases. FAH−/− rabbits exhibit phenotypic features of HT1 including liver and kidney abnormalities but additionally develop frequent ocular manifestations likely caused by local accumulation of tyrosine upon NTBC administration. We also show that allogeneic transplantation of wild-type rabbit primary hepatocytes into FAH−/− rabbits enables highly efficient liver repopulation and prevents liver insufficiency and death. Because of significant advantages over rodents and their ease of breeding, maintenance, and manipulation compared with larger animals including pigs, FAH−/− rabbits are an attractive alternative for modeling the consequences of HT1. PMID:28053091

  18. The effect of neuronal conditional knock-out of peroxisome proliferator-activated receptors in the MPTP mouse model of Parkinson’s disease

    PubMed Central

    Mounsey, R.B.; Martin, H.L.; Nelson, M.C.; Evans, R.M.; Teismann, P.


    Activation of peroxisome proliferator-activated receptors (PPARs), namely PPARγ and PPARδ, has been shown to provide neuroprotection in a number of neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease (PD). The observed neuroprotective effects in experimental models of PD have been linked to anti-oxidant and anti-inflammatory actions. This study aimed to analyze the full influence of these receptors in neuroprotection by generating a nerve cell-specific conditional knock-out of these receptors and subjecting these genetically modified mice to the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) neurotoxin to model dopaminergic degeneration. Mice null for both receptors show the lowest levels of tyrosine hydroxylase (TH)-positive cell bodies following MPTP administration. Presence of one or both these receptors show a trend toward protection against this degeneration, as higher dopaminergic cell immunoreactivity and striatal monoamine levels are evident. These data supplement recent studies that have elected to use agonists of the receptors to regulate immune responses. The results place further importance on the activation of PPARs and the neuroprotective roles these have in inflammatory processes linked to neurodegenerative processes. PMID:26028469

  19. Orthogonal gene knock out and activation with a catalytically active Cas9 nuclease

    PubMed Central

    Dahlman, James E.; Abudayyeh, Omar O.; Joung, Julia; Gootenberg, Jonathan S.; Zhang, Feng; Konermann, Silvana


    We have developed a CRISPR-based method that uses catalytically active Cas9 and distinct sgRNA constructs to knock out and activate different genes in the same cell. These sgRNAs, with 14 15 bp target sequences and MS2 binding loops, can activate gene expression using an active Cas9 nuclease, without inducing DSBs. We use these ‘dead RNAs’ to perform orthogonal gene knockout and transcriptional activation in human cells. PMID:26436575

  20. Orexin/hypocretin and histamine: distinct roles in the control of wakefulness demonstrated using knock-out mouse models.


    Anaclet, Christelle; Parmentier, Régis; Ouk, Koliane; Guidon, Gérard; Buda, Colette; Sastre, Jean-Pierre; Akaoka, Hidéo; Sergeeva, Olga A; Yanagisawa, Masashi; Ohtsu, Hiroshi; Franco, Patricia; Haas, Helmut L; Lin, Jian-Sheng


    To determine the respective role played by orexin/hypocretin and histamine (HA) neurons in maintaining wakefulness (W), we characterized the behavioral and sleep-wake phenotypes of orexin (Ox) knock-out (-/-) mice and compared them with those of histidine-decarboxylase (HDC, HA-synthesizing enzyme)-/- mice. While both mouse strains displayed sleep fragmentation and increased paradoxical sleep (PS), they presented a number of marked differences: (1) the PS increase in HDC(-/-) mice was seen during lightness, whereas that in Ox(-/-) mice occurred during darkness; (2) contrary to HDC(-/-), Ox(-/-) mice had no W deficiency around lights-off, nor an abnormal EEG and responded to a new environment with increased W; (3) only Ox(-/-), but not HDC(-/-) mice, displayed narcolepsy and deficient W when faced with motor challenge. Thus, when placed on a wheel, wild-type (WT), but not littermate Ox(-/-) mice, voluntarily spent their time in turning it and as a result, remained highly awake; this was accompanied by dense c-fos expression in many areas of their brains, including Ox neurons in the dorsolateral hypothalamus. The W and motor deficiency of Ox(-/-) mice was due to the absence of Ox because intraventricular dosing of orexin-A restored their W amount and motor performance whereas SB-334867 (Ox1-receptor antagonist, i.p.) impaired W and locomotion of WT mice during the test. These data indicate that Ox, but not HA, promotes W through enhanced locomotion and suggest that HA and Ox neurons exert a distinct, but complementary and synergistic control of W: the neuropeptide being more involved in its behavioral aspects, whereas the amine is mainly responsible for its qualitative cognitive aspects and cortical EEG activation.

  1. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies.


    Lin, F; Fukuoka, Y; Spicer, A; Ohta, R; Okada, N; Harris, C L; Emancipator, S N; Medof, M E


    Decay-accelerating factor (DAF) is a membrane regulator of C3 activation that protects self cells from autologous complement attack. In humans, DAF is uniformly expressed as a glycosylphosphatidylinositol (GPI)-anchored molecule. In mice, both GPI-anchored and transmembrane-anchored DAF proteins are produced, each of which can be derived from two different genes (Daf1 and Daf2). In this report, we describe a Daf1 gene knock-out mouse arising as the first product of a strategy for targeting one or both Daf genes. As part of the work, we characterize recently described monoclonal antibodies against murine DAF protein using deletion mutants synthesized in yeast, and then employ the monoclonal antibodies in conjunction with wild-type and the Daf1 knock-out mice to determine the tissue distribution of the mouse Daf1 and Daf2 gene products. To enhance the immunohistochemical detection of murine DAF protein, we utilized the sensitive tyramide fluorescence method. In wild-type mice, we found strong DAF labelling of glomeruli, airway and gut epithelium, the spleen, vascular endothelium throughout all tissues, and seminiferous tubules of the testis. In Daf1 knock-out mice, DAF labelling was ablated in most tissues, but strong labelling of the testis and splenic dendritic cells remained. In both sites, reverse transcription-polymerase chain reaction analyses identified both GPI and transmembrane forms of Daf2 gene-derived protein. The results have relevance for studies of in vivo murine DAF function and of murine DAF structure.

  2. Monitoring concussion in a knocked-out boxer by CSF biomarker analysis.


    Neselius, Sanna; Brisby, Helena; Granholm, Fredrik; Zetterberg, Henrik; Blennow, Kaj


    Concussion is common in many sports, and the incidence is increasing. The medical consequences after a sport-related concussion have received increased attention in recent years since it is known that concussions cause axonal and glial damage, which disturbs the cerebral physiology and makes the brain more vulnerable for additional concussions. This study reports on a knocked-out amateur boxer in whom cerebrospinal fluid (CSF) neurofilament light (NFL) protein, reflecting axonal damage, was used to identify and monitor brain damage. CSF NFL was markedly increased during 36 weeks, suggesting that neuronal injury persists longer than expected after a concussion. CSF biomarker analysis may be valuable in the medical counselling of concussed athletes and in return-to-play considerations.

  3. Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila.


    Xue, Zhaoyu; Ren, Mengda; Wu, Menghua; Dai, Junbiao; Rong, Yikang S; Gao, Guanjun


    Bacterial Cas9 nuclease induces site-specific DNA breaks using small gRNA as guides. Cas9 has been successfully introduced into Drosophila for genome editing. Here, we improve the versatility of this method by developing a transgenic system that expresses Cas9 in the Drosophila germline. Using this system, we induced inheritable knock-out mutations by injecting only the gRNA into embryos, achieved highly efficient mutagenesis by expressing gRNA from the promoter of a novel non-coding RNA gene, and recovered homologous recombination-based knock-in of a fluorescent marker at a rate of 4.5% by co-injecting gRNA with a circular DNA donor.

  4. Transgenic gene knock-outs: functional genomics and therapeutic target selection.


    Harris, S; Foord, S M


    The completion of the first draft of the human genome presents both a tremendous opportunity and enormous challenge to the pharmaceutical industry since the whole community, with few exceptions, will soon have access to the same pool of candidate gene sequences from which to select future therapeutic targets. The commercial imperative to select and pursue therapeutically relevant genes from within the overall content of the genome will be particularly intense for those gene families that currently represent the chemically tractable or 'drugable' gene targets. As a consequence the emphasis within exploratory research has shifted towards the evaluation and adoption of technology platforms that can add additional value to the gene selection process, either through functional studies or direct/indirect measures of disease alignment e.g., genetics, differential gene expression, proteomics, tissue distribution, comparative species data etc. The selection of biological targets for the development of potential new medicines relies, in part, on the quality of the in vivo biological data that correlates a particular molecular target with the underlying pathophysiology of a disease. Within the pharmaceutical industry, studies employing transgenic animals and, in particular, animals with specific gene deletions are playing an increasingly important role in the therapeutic target gene selection, drug candidate selection and product development phases of the overall drug discovery process. The potential of phenotypic information from gene knock-outs to contribute to a high-throughput target selection/validation strategy has hitherto been limited by the resources required to rapidly generate and characterise a large number of knock-out transgenics in a timely fashion. The offerings of several companies that provide an opportunity to overcome these hurdles, albeit at a cost, are assessed with respect to the strategic business needs of the pharmaceutical industry.

  5. Subregion-Specific p300 Conditional Knock-Out Mice Exhibit Long-Term Memory Impairments

    ERIC Educational Resources Information Center

    Oliveira, Ana M. M.; Estevez, Marcel A.; Hawk, Joshua D.; Grimes, Shannon; Brindle, Paul K.; Abel, Ted


    Histone acetylation plays a critical role during long-term memory formation. Several studies have demonstrated that the histone acetyltransferase (HAT) CBP is required during long-term memory formation, but the involvement of other HAT proteins has not been extensively investigated. The HATs CBP and p300 have at least 400 described interacting…

  6. Age-Dependent Deficits in Fear Learning in Heterozygous BDNF Knock-Out Mice

    ERIC Educational Resources Information Center

    Endres, Thomas; Lessmann, Volkmar


    Beyond its trophic function, the neurotrophin BDNF (brain-derived neurotrophic factor) is well known to crucially mediate synaptic plasticity and memory formation. Whereas recent studies suggested that acute BDNF/TrkB signaling regulates amygdala-dependent fear learning, no impairments of cued fear learning were reported in heterozygous BDNF…

  7. Ammonia excretion in Caenorhabditis elegans: Physiological and molecular characterization of the rhr-2 knock-out mutant.


    Adlimoghaddam, Aida; O'Donnell, Michael J; Kormish, Jay; Banh, Sheena; Treberg, Jason R; Merz, David; Weihrauch, Dirk


    Previous studies have shown the free living soil nematode Caenorhabditis elegans (N2 strain) to be ammonotelic. Ammonia excretion was suggested to take place partially via the hypodermis, involving the Na(+)/K(+)-ATPase (NKA), V-ATPase (VAT), carbonic anhydrase, NHX-3 and a functional microtubule network and at least one Rh-like ammonia transporter RHR-1. In the current study, we show that a second Rh-protein, RHR-2, is highly expressed in the hypodermis, here also in the apical membrane of that tissue. To further characterize the role of RHR-2 in ammonia excretion, a knock-out mutant rhr-2 (ok403), further referred to as ∆rhr-2, was employed. Compared to wild-type worms (N2), this mutant showed a lower rate of ammonia excretion and a lower hypodermal H(+) excretion rate. At the same time rhr-1, nka, vat, and nhx-3 showed higher mRNA expression levels when compared to N2. Also, in contrast to N2 worms, ∆rhr-2 did not show enhanced ammonia excretion rates when exposed to a low pH environment, suggesting that RHR-2 represents the apical NH3 pathway that allows ammonia trapping via the hypodermis in N2 worms. A hypothetical model for the mechanism of hypodermal ammonia excretion is proposed on the basis of data in this and previous investigations.

  8. Enhancement in colonization of bovine spermatogonial stem cells following addition of knock-out serum replacement to culture medium

    PubMed Central

    Youssefi, Reza; Tajik, Parviz; Movahedin, Mansoureh; Akbarinejad, Vahid


    Enrichment of cell suspension with germ cells prior to injection into recipient seminiferous tubules is of importance in spermatogonial stem cells (SSCs) transplantation. Knock-out serum replacement (KSR) has been reported to enhance the proliferation of murine SSCs and human embryonic stem cells. The aim of the present study was to investigate the effect of KSR versus fetal bovine serum (FBS) and their interaction on colonization of bovine SSCs in vitro. When FBS (10%) was replaced with KSR (10%), a significant increase in the colonization of SSCs and the expression of Thy1, as marker for enrichment of SSCs, was observed. It was revealed that the lesser proliferative effect of FBS as well as the greater proliferative impact of KSR on SSCs colonization were not irreversible as cells having been cultured with FBS (10%) for three days with low colonization showed high rate of colonization in response to KSR (10%) and cells having been cultured with KSR (10%) with high colonization experienced low rate of colonization in response to FBS (10%). Further, it was shown that FBS did not contain factors inhibiting SSCs colonization and it simply lacked factors essential for SSCs proliferation because the combination of FBS (5%) and KSR (5%) resulted in even greater rate of colonization than did KSR (10%). In conclusion, the present study showed that addition of KSR to culture medium would significantly increase SSCs proliferation. PMID:28144417

  9. Arterial Remodeling in B-Type Natriuretic Peptide Knock-Out Females

    PubMed Central

    Holditch, Sara J.; Schreiber, Claire A.; Burnett, John C.; Ikeda, Yasuhiro


    Sexual dimorphisms are recognized in cardiovascular conditions such as hypertension, stroke, thrombosis and vasculitis. B-type natriuretic peptide (BNP) is a guanylyl cyclase A (GC-A) agonist. The anti-hypertensive, vasodilatory, anti-fibrotic, and anti-hypertrophic properties of BNP are well established in male animal models. Although circulating BNP levels are higher in women, when compared to age-matched men, the cardiovascular protective propensity of BNP in females is poorly understood. We assessed the cardiovascular consequences of BNP deletion in genetically null (Nppb−/−) female rat lines. Throughout the study, blood pressure (BP) remained uninfluenced by genotype, and cardiorenal consequences of BNP knock out remained minor. Unexpectedly, approximately 60% of Nppb−/− females developed mesenteric polyarteritis-nodosa (PAN)-like vasculitis in their life span, some as early as 4 months of age. Mesenteric lesions involved intense arterial remodeling, progressive inflammation, occluded lumens, and less frequently intestinal necrosis and multiple visceral arterial aneurysms. Cumulative pathologies resulted in a significant decline in survival of the Nppb−/− female. This study highlights BNP’s vasoprotective propensity, bringing to light a possible sex specific difference in the cardiovascular protection provided by BNP. Defects in the BNP/GC-A/cGMP pathway may play a role in arteriopathies in women, while GC-A agonists may provide effective therapy for arteritis. PMID:27162120

  10. Granulin Knock Out Zebrafish Lack Frontotemporal Lobar Degeneration and Neuronal Ceroid Lipofuscinosis Pathology

    PubMed Central

    Solchenberger, Barbara; Russell, Claire; Kremmer, Elisabeth; Haass, Christian; Schmid, Bettina


    Loss of function mutations in granulin (GRN) are linked to two distinct neurological disorders, frontotemporal lobar degeneration (FTLD) and neuronal ceroid lipofuscinosis (NCL). It is so far unknown how a complete loss of GRN in NCL and partial loss of GRN in FTLD can result in such distinct diseases. In zebrafish, there are two GRN homologues, Granulin A (Grna) and Granulin B (Grnb). We have generated stable Grna and Grnb loss of function zebrafish mutants by zinc finger nuclease mediated genome editing. Surprisingly, the grna and grnb single and double mutants display neither spinal motor neuron axonopathies nor a reduced number of myogenic progenitor cells as previously reported for Grna and Grnb knock down embryos. Additionally, grna−/−;grnb−/− double mutants have no obvious FTLD- and NCL-related biochemical and neuropathological phenotypes. Taken together, the Grna and Grnb single and double knock out zebrafish lack any obvious morphological, pathological and biochemical phenotypes. Loss of zebrafish Grna and Grnb might therefore either be fully compensated or only become symptomatic upon additional challenge. PMID:25785851

  11. Reduced levels of dopamine and altered metabolism in brains of HPRT knock-out rats: a new rodent model of Lesch-Nyhan Disease

    PubMed Central

    Meek, Stephen; Thomson, Alison J.; Sutherland, Linda; Sharp, Matthew G. F.; Thomson, Julie; Bishop, Valerie; Meddle, Simone L.; Gloaguen, Yoann; Weidt, Stefan; Singh-Dolt, Karamjit; Buehr, Mia; Brown, Helen K.; Gill, Andrew C.; Burdon, Tom


    Lesch-Nyhan disease (LND) is a severe neurological disorder caused by loss-of-function mutations in the gene encoding hypoxanthine phosphoribosyltransferase (HPRT), an enzyme required for efficient recycling of purine nucleotides. Although this biochemical defect reconfigures purine metabolism and leads to elevated levels of the breakdown product urea, it remains unclear exactly how loss of HPRT activity disrupts brain function. As the rat is the preferred rodent experimental model for studying neurobiology and diseases of the brain, we used genetically-modified embryonic stem cells to generate an HPRT knock-out rat. Male HPRT-deficient rats were viable, fertile and displayed normal caged behaviour. However, metabolomic analysis revealed changes in brain biochemistry consistent with disruption of purine recycling and nucleotide metabolism. Broader changes in brain biochemistry were also indicated by increased levels of the core metabolite citrate and reduced levels of lipids and fatty acids. Targeted MS/MS analysis identified reduced levels of dopamine in the brains of HPRT-deficient animals, consistent with deficits noted previously in human LND patients and HPRT knock-out mice. The HPRT-deficient rat therefore provides a new experimental platform for future investigation of how HPRT activity and disruption of purine metabolism affects neural function and behaviour. PMID:27185277

  12. NCAM-deficient mice show prominent abnormalities in serotonergic and BDNF systems in brain - Restoration by chronic amitriptyline.


    Aonurm-Helm, Anu; Anier, Kaili; Zharkovsky, Tamara; Castrén, Eero; Rantamäki, Tomi; Stepanov, Vladimir; Järv, Jaak; Zharkovsky, Alexander


    Mood disorders are associated with alterations in serotonergic system, deficient BDNF (brain-derived neurotrophic factor) signaling and abnormal synaptic plasticity. Increased degradation and reduced functions of NCAM (neural cell adhesion molecule) have recently been associated with depression and NCAM deficient mice show depression-related behavior and impaired learning. The aim of the present study was to investigate potential changes in serotonergic and BDNF systems in NCAM knock-out mice. Serotonergic nerve fiber density and SERT (serotonin transporter) protein levels were robustly reduced in the hippocampus, prefrontal cortex and basolateral amygdala of adult NCAM(-)(/-) mice. This SERT reduction was already evident during early postnatal development. [(3)H]MADAM binding experiments further demonstrated reduced availability of SERT in cell membranes of NCAM(-)(/-) mice. Moreover, the levels of serotonin and its major metabolite 5-HIAA were down regulated in the brains of NCAM(-)(/-) mice. NCAM(-)(/-) mice also showed a dramatic reduction in the BDNF protein levels in the hippocampus and prefrontal cortex. This BDNF deficiency was associated with reduced phosphorylation of its receptor TrkB. Importantly, chronic administration of antidepressant amitriptyline partially or completely restored these changes in serotonergic and BDNF systems, respectively. In conclusion, NCAM deficiency lead to prominent and persistent abnormalities in brain serotonergic and BDNF systems, which likely contributes to the behavioral and neurobiological phenotype of NCAM(-/-) mice.

  13. Evaluation of cimi-shield knock-out bed bug eliminator against house fly (Musca domestica) adults.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cimi-Shield Knock-Out (CSKO) Bed Bug Eliminator is a green treatment labeled for use against bed bugs, carpet beetles, ants, roaches, fleas, ticks, silverfish, millipedes and centipedes. The active ingredient is soybean oil. If CSKO is formulated according to label instructions and sprayed directly ...

  14. Evaluation of cimi-shield knock-out bed bug eliminator against house fly (Musca domestica) adults

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cimi-Shield Knock-Out (CSKO) Bed Bug Eliminator is a green treatment labeled for use against bed bugs, carpet beetles, ants, roaches, fleas, ticks, silverfish, millipedes and centipedes. The active ingredient is soybean oil. If CSKO is formulated according to label instructions and sprayed directly ...

  15. Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues.


    Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou


    Cross-talk between tissues plays key roles in development of organisms; however, there are few researches on cross-talk between tissues in insects. Our previous studies showed that the pupal body weight was elevated after knocking out the fibroin heavy chain gene (BmFib-H), whereas the gene specifically expressed in silk glands of silkworm. Hence, the mutant is a good material for studying the cross-talk between tissues. It is considered that the fat body of silkworm during larval stage is used to store nutrients for pupal development. Herein, comparative proteomic of fat body on the 5th day of fifth instar was performed between BmFib-H gene knock-out Bombyx mori line (FGKO) and its wide-type Dazao. These results revealed that a single gene knock-out in silk gland triggered large-scale metabolic pathways changes in fat body. The levels of proteins involved in glycolysis/gluconeogenesis, pentose phosphate pathway, and glycine-serine biosynthetic pathway were down-regulated in the FGKO fat body. In contrast, the abundances of many proteins participating in protein synthesis, including ribosomal proteins, eukaryotic translation initiation factor, and elongation factor, were up-regulated. Moreover, the concentrations of glycogen and proteins in the FGKO fat body were greatly increased. These findings provided a novel insight into the cross-talk between silk gland and fat body in silkworm, and the presence of cross-talk between silk gland and fat body could regulate the redistribution of nutrients in the FGKO fat body leading to the increase of the pupal weight.

  16. Use of zinc-finger nucleases to knock out the WAS gene in K562 cells: a human cellular model for Wiskott-Aldrich syndrome.


    Toscano, Miguel G; Anderson, Per; Muñoz, Pilar; Lucena, Gema; Cobo, Marién; Benabdellah, Karim; Gregory, Philip D; Holmes, Michael C; Martin, Francisco


    Mutations in the WAS gene cause Wiskott-Aldrich syndrome (WAS), which is characterized by eczema, immunodeficiency and microthrombocytopenia. Although the role of WASP in lymphocytes and myeloid cells is well characterized, its role on megakaryocyte (MK) development is poorly understood. In order to develop a human cellular model that mimics the megakaryocytic-derived defects observed in WAS patients we used K562 cells, a well-known model for study of megakaryocytic development. We knocked out the WAS gene in K562 cells using a zinc-finger nuclease (ZFN) pair targeting the WAS intron 1 and a homologous donor DNA that disrupted WASP expression. Knockout of WASP on K562 cells (K562WASKO cells) resulted in several megakaryocytic-related defects such as morphological alterations, lower expression of CD41, lower increments in F-actin polymerization upon stimulation, reduced CD43 expression and increased phosphatidylserine exposure. All these defects have been previously described either in WAS-knockout mice or in WAS patients, validating K562WASKO as a cell model for WAS. However, K562WASPKO cells showed also increased basal F-actin and adhesion, increased expression of CD61 and reduced expression of TGFβ and Factor VIII, defects that have never been described before for WAS-deficient cells. Interestingly, these phenotypic alterations correlate with different roles for WASP in megakaryocytic differentiation. All phenotypic alterations observed in K562WASKO cells were alleviated upon expression of WAS following lentiviral transduction, confirming the role of WASP in these phenotypes. In summary, in this work we have validated a human cellular model, K562WASPKO, that mimics the megakaryocytic-related defects found in WAS-knockout mice and have found evidences for a role of WASP as regulator of megakaryocytic differentiation. We propose the use of K562WASPKO cells as a tool to study the molecular mechanisms involved in the megakaryocytic-related defects observed in WAS

  17. Use of zinc-finger nucleases to knock out the WAS gene in K562 cells: a human cellular model for Wiskott-Aldrich syndrome

    PubMed Central

    Toscano, Miguel G.; Anderson, Per; Muñoz, Pilar; Lucena, Gema; Cobo, Marién; Benabdellah, Karim; Gregory, Philip D.; Holmes, Michael C.; Martin, Francisco


    SUMMARY Mutations in the WAS gene cause Wiskott-Aldrich syndrome (WAS), which is characterized by eczema, immunodeficiency and microthrombocytopenia. Although the role of WASP in lymphocytes and myeloid cells is well characterized, its role on megakaryocyte (MK) development is poorly understood. In order to develop a human cellular model that mimics the megakaryocytic-derived defects observed in WAS patients we used K562 cells, a well-known model for study of megakaryocytic development. We knocked out the WAS gene in K562 cells using a zinc-finger nuclease (ZFN) pair targeting the WAS intron 1 and a homologous donor DNA that disrupted WASP expression. Knockout of WASP on K562 cells (K562WASKO cells) resulted in several megakaryocytic-related defects such as morphological alterations, lower expression of CD41ɑ, lower increments in F-actin polymerization upon stimulation, reduced CD43 expression and increased phosphatidylserine exposure. All these defects have been previously described either in WAS-knockout mice or in WAS patients, validating K562WASKO as a cell model for WAS. However, K562WASPKO cells showed also increased basal F-actin and adhesion, increased expression of CD61 and reduced expression of TGFβ and Factor VIII, defects that have never been described before for WAS-deficient cells. Interestingly, these phenotypic alterations correlate with different roles for WASP in megakaryocytic differentiation. All phenotypic alterations observed in K562WASKO cells were alleviated upon expression of WAS following lentiviral transduction, confirming the role of WASP in these phenotypes. In summary, in this work we have validated a human cellular model, K562WASPKO, that mimics the megakaryocytic-related defects found in WAS-knockout mice and have found evidences for a role of WASP as regulator of megakaryocytic differentiation. We propose the use of K562WASPKO cells as a tool to study the molecular mechanisms involved in the megakaryocytic-related defects observed

  18. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes.


    Crispo, M; Mulet, A P; Tesson, L; Barrera, N; Cuadro, F; dos Santos-Neto, P C; Nguyen, T H; Crénéguy, A; Brusselle, L; Anegón, I; Menchaca, A


    While CRISPR/Cas9 technology has proven to be a valuable system to generate gene-targeted modified animals in several species, this tool has been scarcely reported in farm animals. Myostatin is encoded by MSTN gene involved in the inhibition of muscle differentiation and growth. We determined the efficiency of the CRISPR/Cas9 system to edit MSTN in sheep and generate knock-out (KO) animals with the aim to promote muscle development and body growth. We generated CRISPR/Cas9 mRNAs specific for ovine MSTN and microinjected them into the cytoplasm of ovine zygotes. When embryo development of CRISPR/Cas9 microinjected zygotes (n = 216) was compared with buffer injected embryos (n = 183) and non microinjected embryos (n = 173), cleavage rate was lower for both microinjected groups (P<0.05) and neither was affected by CRISPR/Cas9 content in the injected medium. Embryo development to blastocyst was not affected by microinjection and was similar among the experimental groups. From 20 embryos analyzed by Sanger sequencing, ten were mutant (heterozygous or mosaic; 50% efficiency). To obtain live MSTN KO lambs, 53 blastocysts produced after zygote CRISPR/Cas9 microinjection were transferred to 29 recipient females resulting in 65.5% (19/29) of pregnant ewes and 41.5% (22/53) of newborns. From 22 born lambs analyzed by T7EI and Sanger sequencing, ten showed indel mutations at MSTN gene. Eight showed mutations in both alleles and five of them were homozygous for indels generating out-of frame mutations that resulted in premature stop codons. Western blot analysis of homozygous KO founders confirmed the absence of myostatin, showing heavier body weight than wild type counterparts. In conclusion, our results demonstrate that CRISPR/Cas9 system was a very efficient tool to generate gene KO sheep. This technology is quick and easy to perform and less expensive than previous techniques, and can be applied to obtain genetically modified animal models of interest for biomedicine and

  19. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes

    PubMed Central

    Crispo, M.; Mulet, A. P.; Tesson, L.; Barrera, N.; Cuadro, F.; dos Santos-Neto, P. C.; Nguyen, T. H.; Crénéguy, A.; Brusselle, L.; Anegón, I.; Menchaca, A.


    While CRISPR/Cas9 technology has proven to be a valuable system to generate gene-targeted modified animals in several species, this tool has been scarcely reported in farm animals. Myostatin is encoded by MSTN gene involved in the inhibition of muscle differentiation and growth. We determined the efficiency of the CRISPR/Cas9 system to edit MSTN in sheep and generate knock-out (KO) animals with the aim to promote muscle development and body growth. We generated CRISPR/Cas9 mRNAs specific for ovine MSTN and microinjected them into the cytoplasm of ovine zygotes. When embryo development of CRISPR/Cas9 microinjected zygotes (n = 216) was compared with buffer injected embryos (n = 183) and non microinjected embryos (n = 173), cleavage rate was lower for both microinjected groups (P<0.05) and neither was affected by CRISPR/Cas9 content in the injected medium. Embryo development to blastocyst was not affected by microinjection and was similar among the experimental groups. From 20 embryos analyzed by Sanger sequencing, ten were mutant (heterozygous or mosaic; 50% efficiency). To obtain live MSTN KO lambs, 53 blastocysts produced after zygote CRISPR/Cas9 microinjection were transferred to 29 recipient females resulting in 65.5% (19/29) of pregnant ewes and 41.5% (22/53) of newborns. From 22 born lambs analyzed by T7EI and Sanger sequencing, ten showed indel mutations at MSTN gene. Eight showed mutations in both alleles and five of them were homozygous for indels generating out-of frame mutations that resulted in premature stop codons. Western blot analysis of homozygous KO founders confirmed the absence of myostatin, showing heavier body weight than wild type counterparts. In conclusion, our results demonstrate that CRISPR/Cas9 system was a very efficient tool to generate gene KO sheep. This technology is quick and easy to perform and less expensive than previous techniques, and can be applied to obtain genetically modified animal models of interest for biomedicine and

  20. Accelerated Human Mutant Tau Aggregation by Knocking Out Murine Tau in a Transgenic Mouse Model

    PubMed Central

    Ando, Kunie; Leroy, Karelle; Héraud, Céline; Yilmaz, Zehra; Authelet, Michèle; Suain, Valèrie; De Decker, Robert; Brion, Jean-Pierre


    Many models of human tauopathies have been generated in mice by expression of a human mutant tau with maintained expression of mouse endogenous tau. Because murine tau might interfere with the toxic effects of human mutant tau, we generated a model in which a pathogenic human tau protein is expressed in the absence of wild-type tau protein, with the aim of facilitating the study of the pathogenic role of the mutant tau and to reproduce more faithfully a human tauopathy. The Tg30 line is a tau transgenic mouse model overexpressing human 1N4R double-mutant tau (P301S and G272V) that develops Alzheimer's disease-like neurofibrillary tangles in an age-dependent manner. By crossing Tg30 mice with mice invalidated for their endogenous tau gene, we obtained Tg30xtau−/− mice that express only exogenous human double-mutant 1N4R tau. Although Tg30xtau−/− mice express less tau protein compared with Tg30, they exhibit signs of decreased survival, increased proportion of sarkosyl-insoluble tau in the brain and in the spinal cord, increased number of Gallyas-positive neurofibrillary tangles in the hippocampus, increased number of inclusions in the spinal cord, and a more severe motor phenotype. Deletion of murine tau accelerated tau aggregation during aging of this mutant tau transgenic model, suggesting that murine tau could interfere with the development of tau pathology in transgenic models of human tauopathies. PMID:21281813

  1. Life-long norepinephrine transporter (NET) knock-out leads to the increase in the NET mRNA in brain regions rich in norepinephrine terminals.


    Solich, Joanna; Kolasa, Magdalena; Kusmider, Maciej; Pabian, Paulina; Faron-Gorecka, Agata; Zurawek, Dariusz; Szafran-Pilch, Kinga; Kedracka-Krok, Sylwia; Jankowska, Urszula; Swiderska, Bianka; Dziedzicka-Wasylewska, Marta


    These studies aimed to identify the genes differentially expressed in the frontal cortex of mice bearing a life-long norepinephrine transporter knock-out (NET-KO) and wild-type animals (WT). Differences in gene expression in the mouse frontal cortex were studied using a whole-genome microarray approach. Using an alternative approach, i.e. RT-PCR (reverse transcription polymerase chain reaction) with primers complementary to various exons of the NET gene, as well as TaqMan arrays, the level of mRNA encoding the NET in other brain regions of the NET-KO mice was also examined. The analyses revealed a group of 92 transcripts (27 genes) that differentiated the NET-KO mice from the WT mice. Surprisingly, the studies have shown that the mRNA encoding NET accumulated in the brain regions rich in norepinephrine nerve endings in the NET-KO mice. Because there is no other source of NET mRNA besides the noradrenergic terminals in the brain regions studied, these results might speak in favor of the presence of mRNA in axon terminals. RNA-Binding Protein Immunoprecipitation approach indicated that mRNA encoding NET was detected in the Ago2 protein/mRNA complex. In addition, the amount of Ago2 protein in the frontal cortex was significantly higher in NET-KO mice as compared with that of the WT animals. These results are important for further characterization of the NET-KO mice, which - besides other merits - might serve as a good model to study the fate of truncated mRNA in neurons.

  2. Taurine depletion caused by knocking out the taurine transporter gene leads to cardiomyopathy with cardiac atrophy.


    Ito, Takashi; Kimura, Yasushi; Uozumi, Yoriko; Takai, Mika; Muraoka, Satoko; Matsuda, Takahisa; Ueki, Kei; Yoshiyama, Minoru; Ikawa, Masahito; Okabe, Masaru; Schaffer, Stephen W; Fujio, Yasushi; Azuma, Junichi


    The sulfur-containing beta-amino acid, taurine, is the most abundant free amino acid in cardiac and skeletal muscle. Although its physiological function has not been established, it is thought to play an important role in ion movement, calcium handling, osmoregulation and cytoprotection. To begin examining the physiological function of taurine, we generated taurine transporter- (TauT-) knockout mice (TauTKO), which exhibited a deficiency in myocardial and skeletal muscle taurine content compared with their wild-type littermates. The TauTKO heart underwent ventricular remodeling, characterized by reductions in ventricular wall thickness and cardiac atrophy accompanied with the smaller cardiomyocytes. Associated with the structural changes in the heart was a reduction in cardiac output and increased expression of heart cardiac failure (fetal) marker genes, such as ANP, BNP and beta-MHC. Moreover, ultrastructural damage to the myofilaments and mitochondria was observed. Further, the skeletal muscle of the TauTKO mice also exhibited decreased cell volume, structural defects and a reduction of exercise endurance capacity. Importantly, the expression of Hsp70, ATA2 and S100A4, which are upregulated by osmotic stress, was elevated in both heart and skeletal muscle of the TauTKO mice. Taurine depletion causes cardiomyocyte atrophy, mitochondrial and myofiber damage and cardiac dysfunction, effects likely related to the actions of taurine. Our data suggest that multiple actions of taurine, including osmoregulation, regulation of mitochondrial protein expression and inhibition of apoptosis, collectively ensure proper maintenance of cardiac and skeletal muscular structure and function.

  3. Knock out of the PHOSPHATE 2 Gene TaPHO2-A1 Improves Phosphorus Uptake and Grain Yield under Low Phosphorus Conditions in Common Wheat

    PubMed Central

    Ouyang, Xiang; Hong, Xia; Zhao, Xueqiang; Zhang, Wei; He, Xue; Ma, Wenying; Teng, Wan; Tong, Yiping


    MiR399 and its target PHOSPHATE2 (PHO2) play pivotal roles in phosphate signaling in plants. Loss of function mutation in PHO2 leads to excessive Pi accumulation in shoots and growth retardation in diploid plants like Arabidopsis thaliana and rice (Oryza sativa). Here we isolated three PHO2 homologous genes TaPHO2-A1, -B1 and -D1 from hexaploid wheat (Triticum aestivum). These TaPHO2 genes all contained miR399-binding sites and were able to be degraded by tae-miR399. TaPHO2-D1 was expressed much more abundantly than TaPHO2-A1 and -B1. The ion beam-induced deletion mutants were used to analyze the effects of TaPHO2s on phosphorus uptake and plant growth. The tapho2-a1, tapho2-b1 and tapho2-d1 mutants all had significant higher leaf Pi concentrations than did the wild type, with tapho2-d1 having the strongest effect, and tapho2-b1 the weakest. Two consecutive field experiments showed that knocking out TaPHO2-D1 reduced plant height and grain yield under both low and high phosphorus conditions. However, knocking out TaPHO2-A1 significantly increased phosphorus uptake and grain yield under low phosphorus conditions, with no adverse effect on grain yield under high phosphorus conditions. Our results indicated that TaPHO2s involved in phosphorus uptake and translocation, and molecular engineering TaPHO2 shows potential in improving wheat yield with less phosphorus fertilizer. PMID:27416927

  4. Investigation of olfactory function in a Panx1 knock out mouse model

    PubMed Central

    Kurtenbach, Stefan; Whyte-Fagundes, Paige; Gelis, Lian; Kurtenbach, Sarah; Brazil, Émerson; Zoidl, Christiane; Hatt, Hanns; Shestopalov, Valery I.; Zoidl, Georg


    Pannexin 1 (Panx1), the most extensively investigated member of a channel-forming protein family, is able to form pores conducting molecules up to 1.5 kDa, like ATP, upon activation. In the olfactory epithelium (OE), ATP modulates olfactory responsiveness and plays a role in proliferation and differentiation of olfactory sensory neurons (OSNs). This process continuously takes place in the OE, as neurons are replaced throughout the whole lifespan. The recent discovery of Panx1 expression in the OE raises the question whether Panx1 mediates ATP release responsible for modulating chemosensory function. In this study, we analyzed pannexin expression in the OE and a possible role of Panx1 in olfactory function using a Panx1−/− mouse line with a global ablation of Panx1. This mouse model has been previously used to investigate Panx1 functions in the retina and adult hippocampus. Here, qPCR, in-situ hybridization, and immunohistochemistry (IHC) demonstrated that Panx1 is expressed in axon bundles deriving from sensory neurons of the OE. The localization, distribution, and expression of major olfactory signal transduction proteins were not significantly altered in Panx1−/− mice. Further, functional analysis of Panx1−/− animals does not reveal any major impairment in odor perception, indicated by electroolfactogram (EOG) measurements and behavioral testing. However, ATP release evoked by potassium gluconate application was reduced in Panx1−/− mice. This result is consistent with previous reports on ATP release in isolated erythrocytes and spinal or lumbar cord preparations from Panx1−/− mice, suggesting that Panx1 is one of several alternative pathways to release ATP in the olfactory system. PMID:25309319

  5. Aryl hydrocarbon receptor knock-out exacerbates choroidal neovascularization via multiple pathogenic pathways

    PubMed Central

    Choudhary, Mayur; Kazmin, Dmitri; Hu, Peng; Thomas, Russell S; McDonnell, Donald P; Malek, Goldis


    The aryl hydrocarbon receptor (AhR) is a heterodimeric transcriptional regulator with pleiotropic functions in xenobiotic metabolism and detoxification, vascular development and cancer. Herein, we report a previously undescribed role for the AhR signalling pathway in the pathogenesis of the wet, neovascular subtype of age-related macular degeneration (AMD), the leading cause of vision loss in the elderly in the Western world. Comparative analysis of gene expression profiles of aged AhR−/− and wild-type (wt) mice, using high-throughput RNA sequencing, revealed differential modulation of genes belonging to several AMD-related pathogenic pathways, including inflammation, angiogenesis and extracellular matrix regulation. To investigate AhR regulation of these pathways in wet AMD, we experimentally induced choroidal neovascular lesions in AhR−/− mice and found that they measured significantly larger in area and volume compared to age-matched wt mice. Furthermore, these lesions displayed a higher number of ionized calcium-binding adaptor molecule 1-positive (Iba1+) microglial cells and a greater amount of collagen type IV deposition, events also seen in human wet AMD pathology specimens. Consistent with our in vivo observations, AhR knock-down was sufficient to increase choroidal endothelial cell migration and tube formation in vitro. Moreover, AhR knock-down caused an increase in collagen type IV production and secretion in both retinal pigment epithelial (RPE) and choroidal endothelial cell cultures, increased expression of angiogenic and inflammatory molecules, including vascular endothelial growth factor A (VEGFA) and chemokine (C–C motif) ligand 2 (CCL2) in RPE cells, and increased expression of secreted phosphoprotein 1 (SPP1) and transforming growth factor-β1 (TGFβ1) in choroidal endothelial cells. Collectively, our findings identify AhR as a regulator of multiple pathogenic pathways in experimentally induced choroidal neovascularization, findings that

  6. Loss of Bace2 in zebrafish affects melanocyte migration and is distinct from Bace1 knock out phenotypes.


    van Bebber, Frauke; Hruscha, Alexander; Willem, Michael; Schmid, Bettina; Haass, Christian


    Alzheimer's disease is the most frequent dementia. Pathologically, Alzheimer's disease is characterized by the accumulation of senile plaques composed of amyloid β-peptide (Aβ). Two proteases, β- and γ-secretase proteolytically generate Aβ from its precursor, the ß-amyloid precursor protein (APP). Inhibition of β-secretase, also referred to as beta-site APP cleaving enzyme (BACE1) or γ-secretase is therefore of prime interest for the development of amyloid-lowering drugs. To assess the in vivo function of zebrafish Bace1 (zBace1), we generated zBace1 knock out fish by zinc finger nuclease-mediated genome editing. bace1 mutants (bace1-/-) are hypomyelinated in the PNS while the CNS is not affected. Moreover, the number of mechanosensory neuromasts is elevated in bace1-/-. Mutations in zebrafish Bace2 (zBace2) revealed a distinct melanocyte migration phenotype, which is not observed in bace1-/-. Double homozygous bace1-/-; bace2-/- fish do not enhance the single mutant phenotypes indicating non-redundant distinct physiological functions. Single homozygous bace1 mutants as well as double homozygous bace1 and bace2 mutants are viable and fertile suggesting that Bace1 is a promising drug target without major side effects. The identification of a specific bace2 -/- associated phenotype further allows improving selective Bace1 inhibitors and to distinguish between Bace 1 and Bace 2 inhibition in vivo. Inhibition of BACE1 protease activity has therapeutic importance for Alzheimer's disease. Analysis of BACE1 and BACE2 knock-out zebrafish revealed that they exhibit distinct phenotypes. bace1 mutants display hypomyelination in the PNS and supernumerary neuromasts while in bace2 mutants the shape and migration of melanocytes is affected. These phenotypes are not further enhanced in the viable double mutants. Our data suggest that blocking BACE1 activity is a safe therapeutic approach.

  7. Generation of α-1,3-galactosyltransferase knocked-out transgenic cloned pigs with knocked-in five human genes.


    Kwon, Dae-Jin; Kim, Dong-Hwan; Hwang, In-Sul; Kim, Dong-Ern; Kim, Hyung-Joo; Kim, Jang-Seong; Lee, Kichoon; Im, Gi-Sun; Lee, Jeong-Woong; Hwang, Seongsoo


    Recent progress in genetic manipulation of pigs designated for xenotransplantation ha6s shown considerable promise on xenograft survival in primates. However, genetic modification of multiple genes in donor pigs by knock-out and knock-in technologies, aiming to enhance immunological tolerance against transplanted organs in the recipients, has not been evaluated for health issues of donor pigs. We produced transgenic Massachusetts General Hospital piglets by knocking-out the α-1,3-galactosyltransferase (GT) gene and by simultaneously knocking-in an expression cassette containing five different human genes including, DAF, CD39, TFPI, C1 inhibitor (C1-INH), and TNFAIP3 (A20) [GT(-(DAF/CD39/TFPI/C1-INH/TNFAIP3)/+)] that are connected by 2A peptide cleavage sequences to release individual proteins from a single translational product. All five individual protein products were successfully produced as determined by western blotting of umbilical cords from the newborn transgenic pigs. Although gross observation and histological examination revealed no significant pathological abnormality in transgenic piglets, hematological examination found that the transgenic piglets had abnormally low numbers of platelets and WBCs, including neutrophils, eosinophils, basophils, and lymphocytes. However, transgenic piglets had similar numbers of RBC and values of parameters related to RBC compared to the control littermate piglets. These data suggest that transgenic expression of those human genes in pigs impaired hematopoiesis except for erythropoiesis. In conclusion, our data suggest that transgenic expression of up to five different genes can be efficiently achieved and provide the basis for determining optimal dosages of transgene expression and combinations of the transgenes to warrant production of transgenic donor pigs without health issues.

  8. Production of heterozygous alpha 1,3-galactosyltransferase (GGTA1) knock-out transgenic miniature pigs expressing human CD39.


    Choi, Kimyung; Shim, Joohyun; Ko, Nayoung; Eom, Heejong; Kim, Jiho; Lee, Jeong-Woong; Jin, Dong-Il; Kim, Hyunil


    Production of transgenic pigs for use as xenotransplant donors is a solution to the severe shortage of human organs for transplantation. The first barrier to successful xenotransplantation is hyperacute rejection, a rapid, massive humoral immune response directed against the pig carbohydrate GGTA1 epitope. Platelet activation, adherence, and clumping, all major features of thrombotic microangiopathy, are inevitable results of immune-mediated transplant rejection. Human CD39 rapidly hydrolyzes ATP and ADP to AMP; AMP is hydrolyzed by ecto-5'-nucleotidase (CD73) to adenosine, an anti-thrombotic and cardiovascular protective mediator. In this study, we developed a vector-based strategy for ablation of GGTA1 function and concurrent expression of human CD39 (hCD39). An hCD39 expression cassette was constructed to target exon 4 of GGTA1. We established heterozygous GGTA1 knock-out cell lines expressing hCD39 from pig ear fibroblasts for somatic cell nuclear transfer (SCNT). We also described production of heterozygous GGTA1 knock-out piglets expressing hCD39 and analyzed expression and function of the transgene. Human CD39 was expressed in heart, kidney and aorta. Human CD39 knock-in heterozygous ear fibroblast from transgenic cloned pigs, but not in non-transgenic pig's cells. Expression of GGTA1 gene was lower in the knock-in heterozygous ear fibroblast from transgenic pigs compared to the non-transgenic pig's cell. The peripheral blood mononuclear cells (PBMC) from the transgenic pigs were more resistant to lysis by pooled complement-preserved normal human serum than that from wild type (WT) pig. Accordingly, GGTA1 mutated piglets expressing hCD39 will provide a new organ source for xenotransplantation research.

  9. Automated pipeline to analyze non-contact infrared images of the paraventricular nucleus specific leptin receptor knock-out mouse model

    NASA Astrophysics Data System (ADS)

    Diaz Martinez, Myriam; Ghamari-Langroudi, Masoud; Gifford, Aliya; Cone, Roger; Welch, E. B.


    Evidence of leptin resistance is indicated by elevated leptin levels together with other hallmarks of obesity such as a defect in energy homeostasis.1 As obesity is an increasing epidemic in the US, the investigation of mechanisms by which leptin resistance has a pathophysiological impact on energy is an intensive field of research.2 However, the manner in which leptin resistance contributes to the dysregulation of energy, specifically thermoregulation,3 is not known. The aim of this study was to investigate whether the leptin receptor expressed in paraventricular nucleus (PVN) neurons plays a role in thermoregulation at different temperatures. Non-contact infrared (NCIR) thermometry was employed to measure surface body temperature (SBT) of nonanesthetized mice with a specific deletion of the leptin receptor in the PVN after exposure to room (25 °C) and cold (4 °C) temperature. Dorsal side infrared images of wild type (LepRwtwt/sim1-Cre), heterozygous (LepRfloxwt/sim1-Cre) and knock-out (LepRfloxflox/sim1-Cre) mice were collected. Images were input to an automated post-processing pipeline developed in MATLAB to calculate average and maximum SBTs. Linear regression was used to evaluate the relationship between sex, cold exposure and leptin genotype with SBT measurements. Findings indicate that average SBT has a negative relationship to the LepRfloxflox/sim1-Cre genotype, the female sex and cold exposure. However, max SBT is affected by the LepRfloxflox/sim1-Cre genotype and the female sex. In conclusion this data suggests that leptin within the PVN may have a neuroendocrine role in thermoregulation and that NCIR thermometry combined with an automated imaging-processing pipeline is a promising approach to determine SBT in non-anesthetized mice.

  10. Knock-out of Arabidopsis AtNHX4 gene enhances tolerance to salt stress

    SciTech Connect

    Li, Hong-Tao; Liu, Hua; Gao, Xiao-Shu; Zhang, Hongxia


    AtNHX4 belongs to the monovalent cation:proton antiporter-1 (CPA1) family in Arabidopsis. Several members of this family have been shown to be critical for plant responses to abiotic stress, but little is known on the biological functions of AtNHX4. Here, we provide the evidence that AtNHX4 plays important roles in Arabidopsis responses to salt stress. Expression of AtNHX4 was responsive to salt stress and abscisic acid. Experiments with CFP-AtNHX4 fusion protein indicated that AtNHX4 is vacuolar localized. The nhx4 mutant showed enhanced tolerance to salt stress, and lower Na{sup +} content under high NaCl stress compared with wild-type plants. Furthermore, heterologous expression of AtNHX4 in Escherichia coli BL21 rendered the transformants hypersensitive to NaCl. Deletion of the hydrophilic C-terminus of AtNHX4 dramatically increased the hypersensitivity of transformants, indicating that AtNHX4 may function in Na{sup +} homeostasis in plant cell, and its C-terminus plays a role in regulating the AtNHX4 activity.

  11. Knocking out the dopamine reuptake transporter (DAT) does not change the baseline brain arachidonic acid signal in the mouse

    PubMed Central

    Ramadan, Epolia; Chang, Lisa; Chen, Mei; Ma, Kaizong; Hall, F. Scott; Uhl, George R.; Rapoport, Stanley I.; Basselin, Mireille


    Background Dopamine transporter (DAT) homozygous knockout (DAT−/−) mice have a 10-fold higher extracellular DA concentration in the caudate-putamen and nucleus accumbens than do wildtype (DAT+/+) mice, but show reduced presynaptic DA synthesis and fewer postsynaptic D2 receptors. One aspect of neurotransmission involves DA binding to postsynaptic D2-like receptors coupled to cytosolic phospholipase A2 (cPLA2), releasing second messenger arachidonic acid (AA) from synaptic membrane phospholipid. We hypothesized that tonic overactivation of D2-like receptors in DAT−/− mice due to elevated DA would not increase brain AA signaling, because of compensatory downregulation of postsynaptic signaling mechanisms. Methods [1-14C]AA was infused intravenously for 3 min in unanesthetized DAT+/+, heterozygous (DAT+/−) and DAT−/− mice. AA incorporation coefficients k* and rates Jin, markers of AA metabolism and signaling, were imaged in 83 brain regions using quantitative autoradiography brain cPLA2-IV activity also was measured. Results Neither k* nor Jin for AA in any brain region, or in brain cPLA2-IV activity, differed significantly between DAT−/−, DAT+/− and DAT+/+ mice. Conclusions These results differ from reported increases in k* and Jin for AA, and brain cPLA2 expression, in serotonin reuptake transporter (5-HTT) knockout mice, and suggest that postsynaptic dopaminergic neurotransmission mechanisms involving AA are downregulated despite elevated DA in DAT−/− mice. PMID:22376027


    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a fluorinated organic chemical widely used in consumer and industrial products. Its persistence in the environment and presence in humans and wildlife have raised considerable concerns. PFOA induces liver tumors in rodents, which is thought to be ...

  13. 1,3-propanediol production with Citrobacter werkmanii DSM17579: effect of a dhaD knock-out

    PubMed Central


    Background 1,3-propanediol (PDO) is a substantially industrial metabolite used in the polymer industry. Although several natural PDO production hosts exist, e.g. Klebsiella sp., Citrobacter sp. and Clostridium sp., the PDO yield on glycerol is insufficient for an economically viable bio-process. Enhancing this yield via strain improvement can be achieved by disconnecting the production and growth pathways. In the case of PDO formation, this approach results in a microorganism metabolizing glycerol strictly for PDO production, while catabolizing a co-substrate for growth and maintenance. We applied this strategy to improve the PDO production with Citrobacter werkmanii DSM17579. Results Genetic tools were developed and used to create Citrobacter werkmanii DSM17579 ∆dhaD in which dhaD, encoding for glycerol dehydrogenase, was deleted. Since this strain was unable to grow on glycerol anaerobically, both pathways were disconnected. The knock-out strain was perturbed with 13 different co-substrates for growth and maintenance. Glucose was the most promising, although a competition between NADH-consuming enzymes and 1,3-propanediol dehydrogenase emerged. Conclusion Due to the deletion of dhaD in Citrobacter werkmanii DSM17579, the PDO production and growth pathway were split. As a consequence, the PDO yield on glycerol was improved 1,5 times, strengthening the idea that Citrobacter werkmanii DSM17579 could become an industrially interesting host for PDO production. PMID:24885849

  14. The Phospholipase D2 Knock Out Mouse Has Ectopic Purkinje Cells and Suffers from Early Adult-Onset Anosmia

    PubMed Central

    Zhang, Qifeng; Smethurst, Elizabeth; Segonds-Pichon, Anne; Schrewe, Heinrich; Wakelam, Michael J. O.


    Phospholipase D2 (PLD2) is an enzyme that produces phosphatidic acid (PA), a lipid messenger molecule involved in a number of cellular events including, through its membrane curvature properties, endocytosis. The PLD2 knock out (PLD2KO) mouse has been previously reported to be protected from insult in a model of Alzheimer's disease. We have further analysed a PLD2KO mouse using mass spectrophotometry of its lipids and found significant differences in PA species throughout its brain. We have examined the expression pattern of PLD2 which allowed us to define which region of the brain to analyse for defect, notably PLD2 was not detected in glial-rich regions. The expression pattern lead us to specifically examine the mitral cells of olfactory bulbs, the Cornus Amonis (CA) regions of the hippocampus and the Purkinje cells of the cerebellum. We find that the change to longer PA species correlates with subtle architectural defect in the cerebellum, exemplified by ectopic Purkinje cells and an adult-onset deficit of olfaction. These observations draw parallels to defects in the reelin heterozygote as well as the effect of high fat diet on olfaction. PMID:27658289

  15. Reconstructing gene regulatory networks from knock-out data using Gaussian Noise Model and Pearson Correlation Coefficient.


    Mohamed Salleh, Faridah Hani; Arif, Shereena Mohd; Zainudin, Suhaila; Firdaus-Raih, Mohd


    A gene regulatory network (GRN) is a large and complex network consisting of interacting elements that, over time, affect each other's state. The dynamics of complex gene regulatory processes are difficult to understand using intuitive approaches alone. To overcome this problem, we propose an algorithm for inferring the regulatory interactions from knock-out data using a Gaussian model combines with Pearson Correlation Coefficient (PCC). There are several problems relating to GRN construction that have been outlined in this paper. We demonstrated the ability of our proposed method to (1) predict the presence of regulatory interactions between genes, (2) their directionality and (3) their states (activation or suppression). The algorithm was applied to network sizes of 10 and 50 genes from DREAM3 datasets and network sizes of 10 from DREAM4 datasets. The predicted networks were evaluated based on AUROC and AUPR. We discovered that high false positive values were generated by our GRN prediction methods because the indirect regulations have been wrongly predicted as true relationships. We achieved satisfactory results as the majority of sub-networks achieved AUROC values above 0.5.

  16. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system.


    Guo, Rihong; Wan, Yongjie; Xu, Dan; Cui, Libin; Deng, Mingtian; Zhang, Guomin; Jia, Ruoxin; Zhou, Wenjun; Wang, Zhen; Deng, Kaiping; Huang, Mingrui; Wang, Feng; Zhang, Yanli


    Myostatin (Mstn) is a conserved negative regulator of skeletal muscle mass in mammals. However, whether precise disruption of Mstn in livestock can be achieved and safely used to improve meat productivity has not been proven. We applied CRISPR/Cas9 system to generate Mstn knock-out (KO) rabbits and goats and then analyzed the changes in their phenotypes to answer this question. We efficiently generated 24 Mstn KO rabbits out of 32 newborn infants after embryo injection with two sgRNAs targeting rabbit Mstn, and found that the Mstn KO rabbits exhibited increased birthweight and a significantly increase in the weight ratios of the quadriceps and biceps muscles to the whole body. Mstn KO also caused high probability of enlarged tongue phenomenon and severe health problems such as stillbirth and early stage death. Using the same method, one out of four goats was generated with edition at Mstn locus. The early stage growth rate of this goat outperformed the control goats. In conclusion, we efficiently generated Mstn KO rabbits and goats using CRISPR/Cas9 technology. However, Mstn KO causes severe health problems and may also have the same effects on other species. This safety issue must be studied further before applied to animal reproduction processes.

  17. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system

    PubMed Central

    Guo, Rihong; Wan, Yongjie; Xu, Dan; Cui, Libin; Deng, Mingtian; Zhang, Guomin; Jia, Ruoxin; Zhou, Wenjun; Wang, Zhen; Deng, Kaiping; Huang, Mingrui; Wang, Feng; Zhang, Yanli


    Myostatin (Mstn) is a conserved negative regulator of skeletal muscle mass in mammals. However, whether precise disruption of Mstn in livestock can be achieved and safely used to improve meat productivity has not been proven. We applied CRISPR/Cas9 system to generate Mstn knock-out (KO) rabbits and goats and then analyzed the changes in their phenotypes to answer this question. We efficiently generated 24 Mstn KO rabbits out of 32 newborn infants after embryo injection with two sgRNAs targeting rabbit Mstn, and found that the Mstn KO rabbits exhibited increased birthweight and a significantly increase in the weight ratios of the quadriceps and biceps muscles to the whole body. Mstn KO also caused high probability of enlarged tongue phenomenon and severe health problems such as stillbirth and early stage death. Using the same method, one out of four goats was generated with edition at Mstn locus. The early stage growth rate of this goat outperformed the control goats. In conclusion, we efficiently generated Mstn KO rabbits and goats using CRISPR/Cas9 technology. However, Mstn KO causes severe health problems and may also have the same effects on other species. This safety issue must be studied further before applied to animal reproduction processes. PMID:27417210

  18. The phenotypes of ATG9, ATG16 and ATG9/16 knock-out mutants imply autophagy-dependent and -independent functions

    PubMed Central

    Xiong, Qiuhong; Ünal, Can; Matthias, Jan; Steinert, Michael; Eichinger, Ludwig


    Macroautophagy is a highly conserved intracellular bulk degradation system of all eukaryotic cells. It is governed by a large number of autophagy proteins (ATGs) and is crucial for many cellular processes. Here, we describe the phenotypes of Dictyostelium discoideum ATG16− and ATG9−/16− cells and compare them to the previously reported ATG9− mutant. ATG16 deficiency caused an increase in the expression of several core autophagy genes, among them atg9 and the two atg8 paralogues. The single and double ATG9 and ATG16 knock-out mutants had complex phenotypes and displayed severe and comparable defects in pinocytosis and phagocytosis. Uptake of Legionella pneumophila was reduced. In addition, ATG9− and ATG16− cells had dramatic defects in autophagy, development and proteasomal activity which were much more severe in the ATG9−/16− double mutant. Mutant cells showed an increase in poly-ubiquitinated proteins and contained large ubiquitin-positive protein aggregates which partially co-localized with ATG16-GFP in ATG9−/16− cells. The more severe autophagic, developmental and proteasomal phenotypes of ATG9−/16− cells imply that ATG9 and ATG16 probably function in parallel in autophagy and have in addition autophagy-independent functions in further cellular processes. PMID:25878144

  19. Comparative N-linked glycan analysis of wild-type and α1,3-galactosyltransferase gene knock-out pig fibroblasts using mass spectrometry approaches.


    Park, Hae-Min; Kim, Yoon-Woo; Kim, Kyoung-Jin; Kim, Young June; Yang, Yung-Hun; Jin, Jang Mi; Kim, Young Hwan; Kim, Byung-Gee; Shim, Hosup; Kim, Yun-Gon


    Carbohydrate antigens expressed on pig cells are considered to be major barriers in pig-to-human xenotransplantation. Even after α1,3-galactosyltransferase gene knock-out (GalT-KO) pigs are generated, potential non-Gal antigens are still existed. However, to the best of our knowledge there is no extensive study analyzing N-glycans expressed on the GalT-KO pig tissues or cells. Here, we identified and quantified totally 47 N-glycans from wild-type (WT) and GalT-KO pig fibroblasts using mass spectrometry. First, our results confirmed the absence of galactose-alpha-1,3-galactose (α-Gal) residue in the GalT-KO pig cells. Interestingly, we showed that the level of overall fucosylated N-glycans from GalT-KO pig fibroblasts is much higher than from WT pig fibroblasts. Moreover, the relative quantity of the N-glycolylneuraminic acid (NeuGc) antigen is slightly higher in the GalT-KO pigs. Thus, this study will contribute to a better understanding of cellular glycan alterations on GalT-KO pigs for successful xenotransplantation.

  20. The GAD65 knock out mouse - a model for GABAergic processes in fear- and stress-induced psychopathology.


    Müller, Iris; Çalışkan, Gürsel; Stork, Oliver


    The γ-amino butyric acid (GABA) synthetic enzyme glutamic acid decarboxylase (GAD)65 is critically involved in the activity-dependent regulation of GABAergic inhibition in the central nervous system. It is also required for the maturation of the GABAergic system during adolescence, a phase that is critical for the development of several neuropsychiatric diseases. Mice bearing a null mutation of the GAD65 gene develop hyperexcitability of the amygdala and hippocampus, and a phenotype of increased anxiety and pathological fear memory reminiscent of posttraumatic stress disorder. Although genetic association of GAD65 in human has not yet been reported, these findings are in line with observations of reduced GABAergic function in these brain regions of anxiety disorder patients. The particular value of GAD65(-/-) mice thus lies in modeling the effects of reduced GABAergic function in the mature nervous system. The expression of GAD65 and a second GAD isozyme, GAD67, are differentially regulated in response to stress in limbic brain areas suggesting that by controlling GABAergic inhibition these enzymes determine the vulnerability for the development of pathological anxiety and other stress-induced phenotypes. In fact, we could recently show that GAD65 haplodeficiency, which results in delayed postnatal increase of GABA levels, provides resilience to juvenile-stress-induced anxiety to GAD65(+/-) mice thus foiling the increased fear and anxiety in homozygous GAD65(-/-) mice.

  1. Orexin/Hypocretin and Histamine: Distinct Roles in the Control of Wakefulness Demonstrated Using Knock-Out Mouse Models

    PubMed Central

    Anaclet, Christelle; Parmentier, Régis; Ouk, Koliane; Guidon, Gérard; Buda, Colette; Sastre, Jean-Pierre; Akaoka, Hidéo; Sergeeva, Olga A.; Yanagisawa, Masashi; Ohtsu, Hiroshi; Franco, Patricia; Haas, Helmut L.; Lin, Jian Sheng


    To determine the respective role played by orexin/hypocretin and histamine (HA) neurons in maintaining wakefulness (W), we characterized the behavioral and sleep-wake phenotypes of orexin(Ox) knockout(−/−) mice and compared them with those of histidine-decarboxylase(HDC, HA-synthesizing enzyme)−/−mice. While both mouse strains displayed sleep fragmentation and increased paradoxical sleep(PS), they presented a number of marked differences: 1) The PS-increase in HDC−/−mice was seen during lightness, whereas that in Ox−/−mice occurred during darkness; 2) Contrary to HDC−/−, Ox−/−mice had no W deficiency around lights-off, nor an abnormal EEG and responded to a new environment with increased W; 3) Only Ox−/−, but not HDC−/−mice, displayed narcolepsy and deficient W when faced with motor challenge. Thus, when placed on a wheel, WT, but not littermate Ox−/−mice, voluntarily spent their time in turning it and as a result, remained highly awake; this was accompanied by dense c-fos expression in many areas of their brains, including Ox-neurons in the dorsolateral hypothalamus. The W and motor deficiency of Ox−/−mice was due to the absence of Ox because intraventricular dosing of Ox-A restored their W amount and motor performance whereas SB-334867 (Ox1-receptor antagonist, i.p.) impaired W and locomotion of WT mice during the test. These data indicate that Ox, but not HA, promotes W through enhanced locomotion and suggest that HA and Ox neurons exert a distinct, but complementary and synergistic control of W: the neuropeptide being more involved in its behavioral aspects, whereas the amine is mainly responsible for its qualitative cognitive aspects and cortical-EEG activation. PMID:19923277

  2. A network-based approach for predicting Hsp27 knock-out targets in mouse skeletal muscles

    PubMed Central

    Kammoun, Malek; Picard, Brigitte; Henry-Berger, Joëlle; Cassar-Malek, Isabelle


    Thanks to genomics, we have previously identified markers of beef tenderness, and computed a bioinformatic analysis that enabled us to build an interactome in which we found Hsp27 at a crucial node. Here, we have used a network-based approach for understanding the contribution of Hsp27 to tenderness through the prediction of its interactors related to tenderness. We have revealed the direct interactors of Hsp27. The predicted partners of Hsp27 included proteins involved in different functions, e.g. members of Hsp families (Hsp20, Cryab, Hsp70a1a, and Hsp90aa1), regulators of apoptosis (Fas, Chuk, and caspase-3), translation factors (Eif4E, and Eif4G1), cytoskeletal proteins (Desmin) and antioxidants (Sod1). The abundances of 15 proteins were quantified by Western blotting in two muscles of HspB1-null mice and their controls. We observed changes in the amount of most of the Hsp27 predicted targets in mice devoid of Hsp27 mainly in the most oxidative muscle. Our study demonstrates the functional links between Hsp27 and its predicted targets. It suggests that Hsp status, apoptotic processes and protection against oxidative stress are crucial for post-mortem muscle metabolism, subsequent proteolysis, and therefore for beef tenderness. PMID:24688716

  3. Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    PubMed Central



    Background: Leishmaniasis represents a major public health concern in tropical and sub-tropical countries. At present, there is no efficacious vaccine against the disease and new control methods are needed. One way to access this important goal is to knock out genes of specific macromolecules to evaluate the effect of deletion on the growth, multiplication, pathogenesis and immunity of the parasite. The aim of this study was to design and clone molecular constructs to knock out N-acetylglucosamine phosphatidylinositol de-N-acetylase (GPI12) gene in Leishmania major. Methods: For designing and making molecular constructs, we used pLEXSY-neo2 and pLEXSY-hyg2 vectors. The molecular constructs were cloned in E. coli strain Top10. The molecular constructs were transfected by electroporation into L. major in two stages. Results: The molecular constructs were confirmed by Colony PCR and sequencing. The recombinant strains were isolated by selective antibiotics, after which they were confirmed by PCR, Southern and Western blots. Conclusion: Recombinant parasites were created and examined for subsequent study. With the use of molecular constructs, it was possible to remove and study gene GPI12 and to achieve a live recombinant Leishmania parasite that maintained the original form of the antigenic parasites. This achievement can be used as an experimental model for vaccine development studies. Further investigations are essential to check this model in a suitable host. PMID:28127356

  4. Croton grewioides Baill. (Euphorbiaceae) Shows Antidiarrheal Activity in Mice

    PubMed Central

    da Silva, Anne Dayse Soares; de Melo e Silva, Karoline; Neto, José Clementino; Costa, Vicente Carlos de Oliveira; Pessôa, Hilzeth de Luna F.; Tavares, Josean Fechine; da Silva, Marcelo Sobral; Cavalcante, Fabiana de Andrade


    Based on chemotaxonomy, we decided to investigate the possible antidiarrheal activity in mice of a crude ethanolic extract obtained from aerial parts of Croton grewioides (CG-EtOH). We tested for any possible toxicity in rat erythrocytes and acute toxicity in mice. Antidiarrheal activity was assessed by determining the effect of CG-EtOH on defecation frequency, liquid stool, intestinal motility and intestinal fluid accumulation. CG-EtOH showed no in vitro cytotoxicity and was not orally lethal. In contrast, the extract given intraperitoneally (at 2000 mg/kg) was lethal, but only in females. CG-EtOH produced a significant and equipotent antidiarrheal activity, both in defecation frequency (ED50 = 106.0 ± 8.1 mg/kg) and liquid stools (ED50 = 105.0 ± 9.2 mg/kg). However, CG-EtOH (125 mg/kg) decreased intestinal motility by only 22.7% ± 4.4%. Moreover, extract markedly inhibited the castor oil-induced intestinal contents (ED50 = 34.6 ± 5.4 mg/kg). We thus conclude that CG-EtOH is not orally lethal and contains active principles with antidiarrheal activity, and this effect seems to involve mostly changes in intestinal secretion. SUMMARY CG-EtOH showed no in vitro cytotoxicity and was not orally lethal. In contrast, the extract given intraperitoneally (at 2000 mg/kg) was lethal, but only in females.CG-EtOH probably contains active metabolites with antidiarrheal activity.CG-EtOH reduced the frequency and number of liquid stools.Metabolites presents in the CG-EtOH act mainly by reducing intestinal fluid and, to a lesser extent, reducing intestinal motility. Abbreviations Used: CG-EtOH: crude ethanolic extract obtained from the aerial parts of C. grewioides; WHO: World Health Organization; ED50: dose of a drug that produces 50% of its maximum effect; Emax: maximum effect PMID:27365990

  5. Mice Lacking Brinp2 or Brinp3, or Both, Exhibit Behaviors Consistent with Neurodevelopmental Disorders

    PubMed Central

    Berkowicz, Susan R.; Featherby, Travis J.; Whisstock, James C.; Bird, Phillip I.


    Background: Brinps 1–3, and Astrotactins (Astn) 1 and 2, are members of the Membrane Attack Complex/Perforin (MACPF) superfamily that are predominantly expressed in the mammalian brain during development. Genetic variation at the human BRINP2/ASTN1 and BRINP1/ASTN2 loci has been implicated in neurodevelopmental disorders. We, and others, have previously shown that Brinp1−/− mice exhibit behavior reminiscent of autism spectrum disorder (ASD) and attention deficit hyperactivity disorder (ADHD). Method: We created Brinp2−/− mice and Brinp3−/− mice via the Cre-mediated LoxP system to investigate the effect of gene deletion on anatomy and behavior. Additionally, Brinp2−/−Brinp3−/− double knock-out mice were generated by interbreeding Brinp2−/− and Brinp3−/− mice. Genomic validation was carried out for each knock-out line, followed by histological, weight and behavioral examination. Brinp1−/−Brinp2−/−Brinp3−/− triple knock-out mice were also generated by crossing Brinp2/3 double knock-out mice with previously generated Brinp1−/− mice, and examined by weight and histological analysis. Results: Brinp2−/− and Brinp3−/− mice differ in their behavior: Brinp2−/− mice are hyperactive, whereas Brinp3−/− mice exhibit marked changes in anxiety-response on the elevated plus maze. Brinp3−/− mice also show evidence of altered sociability. Both Brinp2−/− and Brinp3−/− mice have normal short-term memory, olfactory responses, pre-pulse inhibition, and motor learning. The double knock-out mice show behaviors of Brinp2−/− and Brinp3−/− mice, without evidence of new or exacerbated phenotypes. Conclusion: Brinp3 is important in moderation of anxiety, with potential relevance to anxiety disorders. Brinp2 dysfunction resulting in hyperactivity may be relevant to the association of ADHD with chromosome locus 1q25.2. Brinp2−/− and Brinp3−/− genes do not compensate in the mammalian brain and likely have

  6. Towards in vivo mutation analysis: knock-out of specific chlorophylls bound to the light-harvesting complexes of Arabidopsis thaliana - the case of CP24 (Lhcb6).


    Passarini, Francesca; Xu, Pengqi; Caffarri, Stefano; Hille, Jacques; Croce, Roberta


    In the last ten years, a large series of studies have targeted antenna complexes of plants (Lhc) with the aim of understanding the mechanisms of light harvesting and photoprotection. Combining spectroscopy, modeling and mutation analyses, the role of individual pigments in these processes has been highlighted in vitro. In plants, however, these proteins are associated with multiple complexes of the photosystems and function within this framework. In this work, we have envisaged a way to bridge the gap between in vitro and in vivo studies by knocking out in vivo pigments that have been proposed to play an important role in excitation energy transfer between the complexes or in photoprotection. We have complemented a CP24 knock-out mutant of Arabidopsis thaliana with the CP24 (Lhcb6) gene carrying a His-tag and with a mutated version lacking the ligand for chlorophyll 612, a specific pigment that in vitro experiments have indicated as the lowest energy site of the complex. Both complexes efficiently integrated into the thylakoid membrane and assembled into the PSII supercomplexes, indicating that the His-tag does not impair the organization in vivo. The presence of the His-tag allowed the purification of CP24-WT and of CP24-612 mutant in their native states. It is shown that CP24-WT coordinates 10 chlorophylls and 2 carotenoid molecules and has properties identical to those of the reconstituted complex, demonstrating that the complex self-assembled in vitro assumes the same folding as in the plant. The absence of the ligand for chlorophyll 612 leads to the loss of one Chl a and of lutein, again as in vitro, indicating the feasibility of the method. This article is part of a special issue entitled: photosynthesis research for sustainability: keys to produce clean energy.

  7. Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects.


    Henriques, Rossana; Jásik, Ján; Klein, Markus; Martinoia, Enrico; Feller, Urs; Schell, Jeff; Pais, Maria S; Koncz, Csaba


    IRT1 and IRT2 are members of the Arabidopsis ZIP metal transporter family that are specifically induced by iron deprivation in roots and act as heterologous suppressors of yeast mutations inhibiting iron and zinc uptake. Although IRT1 and IRT2 are thought to perform redundant functions as root-specific metal transporters, insertional inactivation of the IRT1 gene alone results in typical symptoms of iron deficiency causing severe leaf chlorosis and lethality in soil. The irt1 mutation is characterized by specific developmental defects, including a drastic reduction of chloroplast thylakoid stacking into grana and lack of palisade parenchyma differentiation in leaves, reduced number of vascular bundles in stems, and irregular patterns of enlarged endodermal and cortex cells in roots. Pulse labeling with 59Fe through the root system shows that the irt1 mutation reduces iron accumulation in the shoots. Short-term labeling with 65Zn reveals no alteration in spatial distribution of zinc, but indicates a lower level of zinc accumulation. In comparison to wild-type, the irt1 mutant responds to iron and zinc deprivation by altered expression of certain zinc and iron transporter genes, which results in the activation of ZIP1 in shoots, reduction of ZIP2 transcript levels in roots, and enhanced expression of IRT2 in roots. These data support the conclusion that IRT1 is an essential metal transporter required for proper development and regulation of iron and zinc homeostasis in Arabidopsis.

  8. Broken or knocked out tooth


    ... Geme JW, Schor NF, eds. Nelson Textbook of Pediatrics . 20th ed. Philadelphia, PA: Elsevier; 2016:chap 314. Read More Root canal Review Date 2/22/2016 Updated by: Michael Kapner, DDS, general and aesthetic dentistry, Norwalk Medical Center, Norwalk, CT. Review provided by ...

  9. Establishment of Immortalized BMP2/4 Double Knock-Out Osteoblastic Cells Is Essential for Study of Osteoblast Growth, Differentiation, and Osteogenesis.


    Wu, Li-An; Wang, Feng; Donly, Kevin J; Baker, Andrew; Wan, Chunyan; Luo, Daoshu; MacDougall, Mary; Chen, Shuo


    Bone morphogenetic proteins 2 and 4 (BMP2/4) are essential for osteoblast differentiation and osteogenesis. Generation of a BMP2/4 dual knock-out ((ko/ko)) osteoblastic cell line is a valuable asset for studying effects of BMP2/4 on skeletal development. In this study, our goal was to create immortalized mouse deleted BMP2/4 osteoblasts by infecting adenoviruses with Cre recombinase and green fluorescent protein genes into immortalized murine floxed BMP2/4 osteoblasts. Transduced BMP2/4(ko/ko) cells were verified by green immunofluorescence and PCR. BMP2/4(ko/ko) osteoblasts exhibited small size, slow cell proliferation rate and cell growth was arrested in G1 and G2 phases. Expression of bone-relate genes was reduced in the BMP2/4(ko/ko) cells, resulting in delay of cell differentiation and mineralization. Importantly, extracellular matrix remodeling was impaired in the BMP2/4(ko/ko) osteoblasts as reflected by decreased Mmp-2 and Mmp-9 expressions. Cell differentiation and mineralization were rescued by exogenous BMP2 and/or BMP4. Therefore, we for the first time described establishment of an immortalized deleted BMP2/4 osteoblast line useful for study of mechanisms in regulating osteoblast lineages.

  10. Intradermal Immunization of Leishmania donovani Centrin Knock-Out Parasites in Combination with Salivary Protein LJM19 from Sand Fly Vector Induces a Durable Protective Immune Response in Hamsters

    PubMed Central

    Fiuza, Jacqueline Araújo; Dey, Ranadhir; Davenport, Dwann; Abdeladhim, Maha; Meneses, Claudio; Oliveira, Fabiano; Kamhawi, Shaden; Valenzuela, Jesus G.; Gannavaram, Sreenivas; Nakhasi, Hira L.


    Background Visceral leishmaniasis (VL) is a neglected tropical disease and is fatal if untreated. There is no vaccine available against leishmaniasis. The majority of patients with cutaneous leishmaniasis (CL) or VL develop a long-term protective immunity after cure from infection, which indicates that development of an effective vaccine against leishmaniasis is possible. Such protection may also be achieved by immunization with live attenuated parasites that do not cause disease. We have previously reported a protective response in mice, hamsters and dogs with Leishmania donovani centrin gene knock-out parasites (LdCen-/-), a live attenuated parasite with a cell division specific centrin1 gene deletion. In this study we have explored the effects of salivary protein LJM19 as an adjuvant and intradermal (ID) route of immunization on the efficacy of LdCen-/- parasites as a vaccine against virulent L. donovani. Methodology/Principal Findings To explore the potential of a combination of LdCen-/- parasites and salivary protein LJM19 as vaccine antigens, LdCen-/- ID immunization followed by ID challenge with virulent L. donovani were performed in hamsters in a 9-month follow up study. We determined parasite burden (serial dilution), antibody production (ELISA) and cytokine expression (qPCR) in these animals. Compared to controls, animals immunized with LdCen-/- + LJM19 induced a strong antibody response, a reduction in spleen and liver parasite burden and a higher expression of pro-inflammatory cytokines after immunization and one month post-challenge. Additionally, a low parasite load in lymph nodes, spleen and liver, and a non-inflamed spleen was observed in immunized animals 9 months after the challenge infection. Conclusions Our results demonstrate that an ID vaccination using LdCen-/-parasites in combination with sand fly salivary protein LJM19 has the capability to confer long lasting protection against visceral leishmaniasis that is comparable to intravenous or

  11. Production of superoxide from photosystem II-light harvesting complex II supercomplex in STN8 kinase knock-out rice mutants under photoinhibitory illumination.


    Poudyal, Roshan Sharma; Nath, Krishna; Zulfugarov, Ismayil S; Lee, Choon-Hwan


    When phosphorylation of Photosystem (PS) II core proteins is blocked in STN8 knock-out mutants of rice (Oryza sativa) under photoinhibitory illumination, the mobilization of PSII supercomplex is prevented. We have previously proposed that more superoxide (O2(-)) is produced from PSII in the mutant (Nath et al., 2013, Plant J. 76, 675-686). Here, we clarify the type and site for the generation of reactive oxygen species (ROS). Using both histochemical and fluorescence probes, we observed that, compared with wild-type (WT) leaves, levels of ROS, including O2(-) and hydrogen peroxide (H2O2), were increased when leaves from mutant plants were illuminated with excess light. However, singlet oxygen production was not enhanced under such conditions. When superoxide dismutase was inhibited, O2(-) production was increased, indicating that it is the initial event prior to H2O2 production. In thylakoids isolated from WT leaves, kinase was active in the presence of ATP, and spectrophotometric analysis of nitrobluetetrazolium absorbance for O2(-) confirmed that PSII-driven superoxide production was greater in the mutant thylakoids than in the WT. This contrast in levels of PSII-driven superoxide production between the mutants and the WT plants was confirmed by conducting protein oxidation assays of PSII particles from osstn8 leaves under strong illumination. Those assays also demonstrated that PSII-LHCII supercomplex proteins were oxidized more in the mutant, thereby implying that PSII particles incur greater damage even though D1 degradation during PSII-supercomplex mobilization is partially blocked in the mutant. These results suggest that O2(-) is the major form of ROS produced in the mutant, and that the damaged PSII in the supercomplex is the primary source of O2(-).

  12. Mouse Pet-1 knock-out induced 5-HT disruption results in a lack of cognitive deficits and an anxiety phenotype complicated by hypoactivity and defensiveness

    PubMed Central

    Schaefer, Tori L.; Vorhees, Charles V.; Williams, Michael T.


    Serotonin (5-HT) is involved in many developmental processes and influences behaviors including anxiety, aggression, and cognition. Disruption of the serotonergic system has been implicated in human disorders including autism, depression, schizophrenia, and ADHD. Although pharmacological, neurotoxin, and dietary manipulation of 5-HT and tryptophan hydroxylase has added to our understanding of the serotonergic system, the results are complicated by multiple factors. A newly identified ETS domain transcription factor, Pet-1, has direct control of major aspects of 5-HT neuronal development. Pet-1 is the only known factor that is restricted in the brain to 5-HT neurons during development and adulthood and exerts dominant control over 5-HT neuronal phenotype. Disruption of Pet-1 produces an ∼80% loss of 5-HT neurons and content and results in increased aggression in male Pet-1-/- mice (Hendricks et al., 2003). We hypothesized that Pet-1-/- mice would also exhibit changes in anxiety and cognition. Pet-1-/- mice were hypoactive which may have affected the observed lack of anxious behavior in the elevated zero maze and light-dark test. Pet-1-/- mice, however, were more defensive during marble burying and showed acoustic startle hyper-reactivity. No deficits in spatial, egocentric, or novel object recognition learning were found in Pet-1-/- mice. These findings were unexpected given that 5-HT depleting drugs given to adult or developing animals result in learning deficits (Mazer et al., 1997;Morford et al., 2002;Vorhees et al., 2007). Lack of differences may be the result of compensatory mechanisms in reaction to a constitutive knockout of Pet-1 or 5-HT may not be as important in learning and memory as previously suspected. PMID:19786075

  13. Narp knockout mice show normal reactivity to novelty but attenuated recovery from neophobia.


    Blouin, Ashley M; Lee, Jongah J; Tao, Bo; Smith, Dani R; Johnson, Alexander W; Baraban, Jay M; Reti, Irving M


    Narp knockout (KO) mice demonstrate cognitive inflexibility and addictive behavior, which are associated with abnormal reactivity to a novel stimulus. To assess reactivity to novelty, we tested Narp KO and wild-type (WT) mice on a neophobia procedure. Both Narp KO and WT mice showed a similar decrease in consumption upon initial exposure to a novel flavor, but Narp KO mice did not increase consumption with subsequent exposures to the novel flavor like the WT mice. Therefore, Narp KO mice do not have abnormal reactivity to novelty but show deficits in adapting behavior to reflect the updated value of a stimulus.

  14. The alpha-fetoprotein knock-out mouse model suggests that parental behavior is sexually differentiated under the influence of prenatal estradiol.


    Keller, Matthieu; Pawluski, Jodi L; Brock, Olivier; Douhard, Quentin; Bakker, Julie


    In rodent species, sexual differentiation of the brain for many reproductive processes depends largely on estradiol. This was recently confirmed again by using the alpha-fetoprotein knockout (AFP-KO) mouse model, which lacks the protective actions of alpha-fetoprotein against maternal estradiol and as a result represents a good model to determine the contribution of prenatal estradiol to the sexual differentiation of the brain and behavior. Female AFP-KO mice were defeminized and masculinized with regard to their neuroendocrine responses as well as sexual behavior. Since parental behavior is also strongly sexually differentiated in mice, we used the AFP-KO mouse model here to ask whether parental responses are differentiated prenatally under the influence of estradiol. It was found that AFP-KO females showed longer latencies to retrieve pups to the nest and also exhibited lower levels of crouching over the pups in the nest in comparison to WT females. In fact, they resembled males (WT and AFP-KO). Other measures of maternal behavior, for example the incidence of infanticide, tended to be higher in AFP-KO females than in WT females but this increase failed to reach statistical significance. The deficits observed in parental behavior of AFP-KO females could not be explained by any changes in olfactory function, novelty recognition or anxiety. Thus our results suggest that prenatal estradiol defeminizes the parental brain in mice.

  15. Molecular Cloning, Genomic Organization, Developmental Regulation, and a Knock-out Mutant of a Novel Leu-rich Repeats-containing G Protein-coupled Receptor (DLGR-2) from Drosophila melanogaster

    PubMed Central

    Eriksen, Kathrine Krageskov; Hauser, Frank; Schiøtt, Morten; Pedersen, Karen-Marie; Søndergaard, Leif; Grimmelikhuijzen, Cornelis J.P.


    After screening the Berkeley Drosophila Genome Project database with sequences from a recently characterized Leu-rich repeats-containing G protein-coupled receptor (LGR) from Drosophila (DLGR-1), we identified a second gene for a different LGR (DLGR-2) and cloned its cDNA. DLGR-2 is 1360 amino acid residues long and shows a striking structural homology with members of the glycoprotein hormone [thyroid-stimulating hormone (TSH); follicle-stimulating hormone (FSH); luteinizing hormone/choriogonadotropin (LH/CG)] receptor family from mammals and with two additional, recently identified mammalian orphan LGRs (LGR-4 and LGR-5). This homology includes the seven transmembrane region (e.g., 49% amino acid identity with the human TSH receptor) and the very large extracellular amino terminus. This amino terminus contains 18 Leu-rich repeats—in contrast with the 3 mammalian glycoprotein hormone receptors and DLGR-1 that contain 9 Leu-rich repeats, but resembling the mammalian LGR-4 and LGR-5 that each have 17 Leu-rich repeats in their amino termini. The DLGR-2 gene is >18.6 kb pairs long and contains 15 exons and 14 introns. Four intron positions coincide with the intron positions of the three mammalian glycoprotein hormone receptors and have the same intron phasing, showing that DLGR-2 is evolutionarily related to these mammalian receptors. The DLGR-2 gene is located at position 34E-F on the left arm of the second chromosome and is expressed in embryos and pupae but not in larvae and adult flies. Homozygous knock-out mutants, where the DLGR-2 gene is interrupted by a P element insertion, die around the time of hatching. This finding, together with the expression data, strongly suggests that DLGR-2 is exclusively involved in development. [The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL database with accession no. AF142343.] PMID:10899142

  16. Reduced acute nociception and chronic pain in Shank2-/- mice.


    Ko, Hyoung-Gon; Oh, Seog-Bae; Zhuo, Min; Kaang, Bong-Kiun


    Autism spectrum disorder is a debilitating mental illness and social issue. Autism spectrum disorder patients suffer from social isolation, cognitive deficits, compulsive behavior, and sensory deficits, including hyposensitivity to pain. However, recent studies argued that autism spectrum disorder patients show physiological pain response and, in some cases, even extremely intense pain response to harmless stimulation. Recently, Shank gene family was reported as one of the genetic risk factors of autism spectrum disorder. Thus, in this study, we used Shank2(-) (/) (-) (Shank2 knock-out, KO) mice to investigate the controversial pain sensitivity issue and found that Shank2 KO mice showed reduced tactile perception and analgesia to chronic pain.

  17. Conditional knock-out reveals a requirement for O-linked N-Acetylglucosaminase (O-GlcNAcase) in metabolic homeostasis.


    Keembiyehetty, Chithra; Love, Dona C; Harwood, Katryn R; Gavrilova, Oksana; Comly, Marcella E; Hanover, John A


    O-GlcNAc cycling is maintained by the reciprocal activities of the O-GlcNAc transferase and the O-GlcNAcase (OGA) enzymes. O-GlcNAc transferase is responsible for O-GlcNAc addition to serine and threonine (Ser/Thr) residues and OGA for its removal. Although the Oga gene (MGEA5) is a documented human diabetes susceptibility locus, its role in maintaining insulin-glucose homeostasis is unclear. Here, we report a conditional disruption of the Oga gene in the mouse. The resulting homozygous Oga null (KO) animals lack OGA enzymatic activity and exhibit elevated levels of the O-GlcNAc modification. The Oga KO animals showed nearly complete perinatal lethality associated with low circulating glucose and low liver glycogen stores. Defective insulin-responsive GSK3β phosphorylation was observed in both heterozygous (HET) and KO Oga animals. Although Oga HET animals were viable, they exhibited alterations in both transcription and metabolism. Transcriptome analysis using mouse embryonic fibroblasts revealed deregulation in the transcripts of both HET and KO animals specifically in genes associated with metabolism and growth. Additionally, metabolic profiling showed increased fat accumulation in HET and KO animals compared with WT, which was increased by a high fat diet. Reduced insulin sensitivity, glucose tolerance, and hyperleptinemia were also observed in HET and KO female mice. Notably, the respiratory exchange ratio of the HET animals was higher than that observed in WT animals, indicating the preferential utilization of glucose as an energy source. These results suggest that the loss of mouse OGA leads to defects in metabolic homeostasis culminating in obesity and insulin resistance.

  18. Conditional Knock-out Reveals a Requirement for O-Linked N-Acetylglucosaminase (O-GlcNAcase) in Metabolic Homeostasis*

    PubMed Central

    Keembiyehetty, Chithra; Love, Dona C.; Harwood, Katryn R.; Gavrilova, Oksana; Comly, Marcella E.; Hanover, John A.


    O-GlcNAc cycling is maintained by the reciprocal activities of the O-GlcNAc transferase and the O-GlcNAcase (OGA) enzymes. O-GlcNAc transferase is responsible for O-GlcNAc addition to serine and threonine (Ser/Thr) residues and OGA for its removal. Although the Oga gene (MGEA5) is a documented human diabetes susceptibility locus, its role in maintaining insulin-glucose homeostasis is unclear. Here, we report a conditional disruption of the Oga gene in the mouse. The resulting homozygous Oga null (KO) animals lack OGA enzymatic activity and exhibit elevated levels of the O-GlcNAc modification. The Oga KO animals showed nearly complete perinatal lethality associated with low circulating glucose and low liver glycogen stores. Defective insulin-responsive GSK3β phosphorylation was observed in both heterozygous (HET) and KO Oga animals. Although Oga HET animals were viable, they exhibited alterations in both transcription and metabolism. Transcriptome analysis using mouse embryonic fibroblasts revealed deregulation in the transcripts of both HET and KO animals specifically in genes associated with metabolism and growth. Additionally, metabolic profiling showed increased fat accumulation in HET and KO animals compared with WT, which was increased by a high fat diet. Reduced insulin sensitivity, glucose tolerance, and hyperleptinemia were also observed in HET and KO female mice. Notably, the respiratory exchange ratio of the HET animals was higher than that observed in WT animals, indicating the preferential utilization of glucose as an energy source. These results suggest that the loss of mouse OGA leads to defects in metabolic homeostasis culminating in obesity and insulin resistance. PMID:25596529

  19. Mice deficient in PAPP-A show resistance to the development of diabetic nephropathy.


    Mader, Jessica R; Resch, Zachary T; McLean, Gary R; Mikkelsen, Jakob H; Oxvig, Claus; Marler, Ronald J; Conover, Cheryl A


    We investigated pregnancy-associated plasma protein-A (PAPP-A) in diabetic nephropathy. Normal human kidney showed specific staining for PAPP-A in glomeruli, and this staining was markedly increased in diabetic kidney. To assess the possible contribution of PAPP-A in the development of diabetic nephropathy, we induced diabetes with streptozotocin in 14-month-old WT and Papp-A knockout (KO) mice. Renal histopathology was evaluated after 4 months of stable hyperglycemia. Kidneys from diabetic WT mice showed multiple abnormalities including thickening of Bowman's capsule (100% of mice), increased glomerular size (80% of mice), tubule dilation (80% of mice), and mononuclear cell infiltration (90% of mice). Kidneys of age-matched non-diabetic WT mice had similar evidence of tubule dilation and mononuclear cell infiltration to those of diabetic WT mice, indicating that these changes were predominantly age-related. However, thickened Bowman's capsule and increased glomerular size appeared specific for the experimental diabetes. Kidneys from diabetic Papp-A KO mice had significantly reduced or no evidence of changes in Bowman's capsule thickening and glomerular size. There was also a shift to larger mesangial area and increased macrophage staining in diabetic WT mice compared with Papp-A KO mice. In summary, elevated PAPP-A expression in glomeruli is associated with diabetic nephropathy in humans and absence of PAPP-A is associated with resistance to the development of indicators of diabetic nephropathy in mice. These data suggest PAPP-A as a potential therapeutic target for diabetic nephropathy.

  20. Establishment of Immortalized Mouse Bmp2 Knock-Out Dental Papilla Mesenchymal Cells Necessary for Study of Odontoblastic Differentiation and Odontogenesis.


    Wu, Lian; Wang, Feng; Donly, Kevin J; Wan, Chunyan; Luo, Daoshu; Harris, Stephen E; MacDougall, Mary; Chen, Shuo


    Bmp2 is essential for dentin formation. Bmp2 cKO mice exhibited similar phenotype to dentinogenesis imperfecta, showing dental pulp exposure, hypomineralized dentin, and delayed odontoblast differentiation. As it is relatively difficult to obtain lot of primary Bmp2 cKO dental papilla mesenchymal cells and to maintain a long-term culture of these primary cells, availability of immortalized deleted Bmp2 dental papilla mesenchymal cells is critical for studying the underlying mechanism of Bmp2 signal in odontogenesis. In this study, our goal was to generate an immortalized deleted Bmp2 dental papilla mesenchymal (iBmp2(ko/ko)dp) cell line by introducing Cre recombinase and green fluorescent protein (GFP) into the immortalized mouse floxed Bmp2 dental papilla mesenchymal (iBmp2(fx/fx)dp) cells. iBmp2(ko/ko)dp cells were confirmed by GFP and PCR. The deleted Bmp2 cells exhibited slow cell proliferation rate and cell growth was arrested in G2 phase. Expression of tooth-related marker genes and cell differentiation were decreased in the deleted cells. Importantly, extracellular matrix remodeling was impaired in the iBmp2(ko/ko)dp cells as reflected by the decreased Mmp-9 expression. In addition, with exogenous Bmp2 induction, these cell differentiation and mineralization were rescued as well as extracellular matrix remodeling was enhanced. Therefore, we for the first time described establishment of iBmp(ko/ko) cells that are useful for study of mechanisms in regulating dental papilla mesenchymal cell lineages.

  1. Establishment of Immortalized Mouse Bmp2 Knock-Out Dental Papilla Mesenchymal Cells Necessary for Study of Odontoblastic Differentiation and Odontogenesis

    PubMed Central

    Wu, Lian; Wang, Feng; Donly, Kevin J.; Wan, Chunyan; Luo, Daoshu; Harris, Stephen E.; Macdougall, Mary; Chen, Shuo


    Bmp2 is essential for dentin formation. Bmp2 cKO mice exhibited similar phenotype to dentinogenesis imperfecta, showing dental pulp exposure, hypomineralized dentin, and delayed odontoblast differentiation. As it is relatively difficult to obtain lot of primary Bmp2 cKO dental papilla mesenchymal cells and to maintain a long-term culture of these primary cells, availability of immortalized deleted Bmp2 dental papilla mesenchymal cells is critical for studying the underlying mechanism of Bmp2 signal in odontogenesis. In this study, our goal was to generate an immortalized deleted Bmp2 dental papilla mesenchymal (iBmp2ko/ko dp) cell line by introducing Cre fluorescent protein (GFP) into the immortalized mouse floxed Bmp2 dental papilla mesenchymal (iBmp2fx/fx dp) cells. iBmp2ko/ko dp cells were confirmed by GFP and PCR. The deleted Bmp2 cells exhibited slow cell proliferation rate and cell growth was arrested in G2 phase. Expression of tooth-related marker genes and cell differentiation were decreased in the deleted cells. Importantly, extracellular matrix remodeling was impaired in the iBmp2ko/ko dp cells as reflected by the decreased Mmp-9 expression. In addition, with exogenous Bmp2 induction, these cell differentiation and mineralization were rescued as well as extracellular matrix remodeling was enhanced. Therefore, we for the first time described establishment of iBmpko/ko cells that are useful for study of mechanisms in regulating dental papilla mesenchymal cell lineages. PMID:26037045

  2. Comparative Analysis of the Effects of Hydroxysafflor Yellow A and Anhydrosafflor Yellow B in Safflower Series of Herb Pairs Using Prep-HPLC and a Selective Knock-Out Approach.


    Qu, Cheng; Wang, Lin-Yan; Jin, Wen-Tao; Tang, Yu-Ping; Jin, Yi; Shi, Xu-Qin; Shang, Li-Li; Shang, Er-Xin; Duan, Jin-Ao


    The flower of Carthamus tinctorius L. (Carthami Flos, safflower), important in traditional Chinese medicine (TCM), is known for treating blood stasis, coronary heart disease, hypertension, and cerebrovascular disease in clinical and experimental studies. It is widely accepted that hydroxysafflor yellow A (HSYA) and anhydrosafflor yellow B (ASYB) are the major bioactive components of many formulae comprised of safflower. In this study, selective knock-out of target components such as HSYA and ASYB by using preparative high performance liquid chromatography (prep-HPLC) followed by antiplatelet and anticoagulation activities evaluation was used to investigate the roles of bioactive ingredients in safflower series of herb pairs. The results showed that both HSYA and ASYB not only played a direct role in activating blood circulation, but also indirectly made a contribution to the total bioactivity of safflower series of herb pairs. The degree of contribution of HSYA in the safflower and its series herb pairs was as follows: Carthami Flos-Ginseng Radix et Rhizoma Rubra (CF-GR) > Carthami Flos-Sappan Lignum (CF-SL) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Astragali Radix (CF-AR) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Glycyrrhizae Radix et Rhizoma (CF-GL) > Carthami Flos-Salviae Miltiorrhizae Radix et Rhizoma (CF-SM) > Carthami Flos (CF), and the contribution degree of ASYB in the safflower and its series herb pairs: CF-GL > CF-PS > CF-AS > CF-SL > CF-SM > CF-AR > CF-GR > CF. So, this study provided a significant and effective approach to elucidate the contribution of different herbal components to the bioactivity of the herb pair, and clarification of the variation of herb-pair compatibilities. In addition, this study provides guidance for investigating the relationship between herbal compounds and the bioactivities of herb pairs. It also provides a scientific basis for reasonable clinical applications and new drug

  3. Developmental Toxicity of Perfluorononanoic Acid in the Wild-Type and PPAR-alpha Knock-out Mouse After Gestational Exposure

    EPA Science Inventory

    Perfluorononanoic acid (PFNA) is a perfluoroalkyl acid detected in the environment and in tissues of humans and wildlife, and its concentration in human serum has increased in the past few years. PFNA negatively affects development and survival of CD1 mice and activates peroxisom...

  4. Mice lacking components of adaptive immunity show increased Brucella abortus virB mutant colonization.


    Rolán, Hortensia García; Tsolis, Renée M


    The Brucella abortus type IV secretion system (T4SS), encoded by the virB genes, is essential for survival in mononuclear phagocytes in vitro. In the mouse model, a B. abortus virB mutant was initially able to colonize the spleen at the level of the wild type for approximately 3 to 5 days, which coincided with the development of adaptive immunity. To investigate the relationship between survival in macrophages cultivated in vitro and persistence in tissues in vivo, we tested the ability of mutant mice lacking components of adaptive immunity to eliminate the virB mutant from the spleen during a mixed infection with the B. abortus wild type. Ifng(-/-) or beta(2)m(-/-) mice were able to clear the virB mutant to the same degree as control mice. However, spleens of Rag1(-/-) mice and Igh6(-/-) mice were more highly colonized by the virB mutant than control mice after 14 to 21 days, suggesting that, in these mice, there is not an absolute requirement for the T4SS to mediate persistence of B. abortus in the spleen. Macrophages isolated from Igh6(-/-) mice killed the virB mutant to the same extent as macrophages from control mice, showing that the reduced ability of these mice to clear the virB mutant from the spleen does not correlate with diminished macrophage function in vitro. These results show that in the murine model host, the T4SS is required for persistence beyond 3 to 5 days after infection and suggest that the T4SS may contribute to evasion of adaptive immune mechanisms by B. abortus.

  5. Localized brain differences in Arc expression between mice showing low vs. high propensity to ethanol sensitization.


    Nona, Christina N; Lam, Marcus; Nobrega, José N


    Behavioral sensitization to ethanol (EtOH) manifests as a progressive and enduring increase in locomotor activity with repeated drug exposure. However, not all mice sensitize to EtOH and the neuronal mechanisms mediating vulnerability and resistance to EtOH sensitization remain unclear. We examined regional brain expression of the immediate early gene activity-regulated cytoskeleton-associated protein (Arc) in order to identify brain areas in which neuroplastic changes may contribute to the development and expression of EtOH sensitization. Male DBA/2J mice received 5 biweekly injections of EtOH (2.2g/kg, i.p.) or saline (SAL). They were categorized as high- (HS) or low-sensitized (LS) on the basis of final locomotor activity scores. In both LS and HS mice sacrificed after the last sensitization injection, Arc expression was decreased throughout the brain in comparison to SAL animals. A similar pattern was seen in mice sacrificed after an EtOH challenge two weeks after the last sensitization injection. However in this cohort, Arc expression was significantly increased in the central amygdala (CeA) in LS mice and in SAL mice receiving EtOH for the first time. No significant increases in Arc expression were seen in brains of sensitized (HS) animals. These results indicate an acute EtOH challenge results in different patterns of Arc expression in brains of LS, HS, and SAL mice. The dramatic increases in Arc expression in the CeA in LS and SAL mice showing little or no behavioral activation suggests that neural activity in this region may serve to inhibit the stimulant effects of EtOH. The observation that HS mice do not show increases in Arc expression with an EtOH challenge suggests the possibility that increased tolerance to the Arc-inducing effects of EtOH may be a factor in behavioral sensitization.

  6. Mice lacking the galanin gene show decreased sensitivity to nicotine conditioned place preference.


    Neugebauer, Nichole M; Henehan, Robert M; Hales, Claire A; Picciotto, Marina R


    Previous work has indicated that the neuropeptide galanin decreases sensitivity to the rewarding effects of morphine and cocaine, but increases alcohol drinking. The aim of the current study was to examine the role of galanin signaling in nicotine reward by testing the effects of nicotine in mice lacking galanin peptide (GAL-/-) as compared to wild-type (GAL+/+) controls. Using an unbiased, three-chamber conditioned place preference (CPP) paradigm the dose-response function for nicotine CPP was tested in GAL-/- and GAL+/+ mice. Since activation of extracellular signal-related kinase (ERK2) is involved in the rewarding effects of several classes of drugs of abuse, we then measured the level of ERK2 phosphorylation in the nucleus accumbens shell (NACsh) and core (NACco) of GAL-/- and GAL+/+ mice following re-exposure to the CPP chamber previously paired with nicotine as a marker of mesolimbic system activation. Finally, we examined whether acute nicotine administration affects ERK2 activity in GAL-/- and GAL+/+ mice. GAL-/- mice required a higher dose of nicotine to induce a significant CPP compared to GAL+/+ mice. In the conditioning groups showing significant expression of nicotine CPP, only GAL+/+ mice showed ERK2 activation in the NACsh. This suggests that the nicotine CPP observed in GAL+/+ mice resulted in differential recruitment of ERK signaling in the NACsh compared to GAL-/- mice. In addition, no activation of ERK2 was observed following acute nicotine administration in either genotype. These data, along with prior results, suggest that galanin alters sensitivity to drugs of abuse differentially, with morphine, cocaine and amphetamine place preference suppressed, and nicotine and alcohol preference increased, by galanin signaling.

  7. Deficits in axonal transport in hippocampal-based circuitry and the visual pathway in APP knock-out animals witnessed by manganese enhanced MRI.


    Gallagher, Joseph J; Zhang, Xiaowei; Ziomek, Gregory J; Jacobs, Russell E; Bearer, Elaine L


    Mounting evidence implicates axonal transport defects, typified by the presence of axonal varicosities with aberrant accumulations of cargo, as an early event in Alzheimer's disease (AD) pathogenesis. Work identifying amyloid precursor protein (APP) as a vesicular motor receptor for anterograde axonal transport further implicates axonal transport in AD. Manganese-enhanced MRI (MEMRI) detects axonal transport dynamics in preclinical studies. Here we pursue an understanding of the role of APP in axonal transport in the central nervous system by applying MEMRI to hippocampal circuitry and to the visual pathway in living mice homozygous for either wild type or a deletion in the APP gene (n=12 for each genotype). Following intra-ocular or stereotaxic hippocampal injection, we performed time-lapse MRI to detect Mn(2+) transport. Three dimensional whole brain datasets were compared on a voxel-wise basis using within-group pair-wise analysis. Quantification of transport to structures connected to injection sites via axonal fiber tracts was also performed. Histology confirmed consistent placement of hippocampal injections and no observable difference in glial-response to the injections. APP-/- mice had significantly reduced transport from the hippocampus to the septal nuclei and amygdala after 7h and reduced transport to the contralateral hippocampus after 25 h; axonal transport deficits in the APP-/- animals were also identified in the visual pathway. These data support a system-wide role for APP in axonal transport within the central nervous system and demonstrate the power of MEMRI for assessing neuronal circuitry involved in memory and learning.

  8. Heterozygous Che-1 KO mice show deficiencies in object recognition memory persistence.


    Zalcman, Gisela; Corbi, Nicoletta; Di Certo, Maria Grazia; Mattei, Elisabetta; Federman, Noel; Romano, Arturo


    Transcriptional regulation is a key process in the formation of long-term memories. Che-1 is a protein involved in the regulation of gene transcription that has recently been proved to bind the transcription factor NF-κB, which is known to be involved in many memory-related molecular events. This evidence prompted us to investigate the putative role of Che-1 in memory processes. For this study we newly generated a line of Che-1(+/-) heterozygous mice. Che-1 homozygous KO mouse is lethal during development, but Che-1(+/-) heterozygous mouse is normal in its general anatomical and physiological characteristics. We analyzed the behavioral characteristic and memory performance of Che-1(+/-) mice in two NF-κB dependent types of memory. We found that Che-1(+/-) mice show similar locomotor activity and thigmotactic behavior than wild type (WT) mice in an open field. In a similar way, no differences were found in anxiety-like behavior between Che-1(+/-) and WT mice in an elevated plus maze as well as in fear response in a contextual fear conditioning (CFC) and object exploration in a novel object recognition (NOR) task. No differences were found between WT and Che-1(+/-) mice performance in CFC training and when tested at 24h or 7days after training. Similar performance was found between groups in NOR task, both in training and 24h testing performance. However, we found that object recognition memory persistence at 7days was impaired in Che-1(+/-) heterozygous mice. This is the first evidence showing that Che-1 is involved in memory processes.

  9. Pancreas-specific aquaporin 12 null mice showed increased susceptibility to caerulein-induced acute pancreatitis.


    Ohta, Eriko; Itoh, Tomohiro; Nemoto, Tomomi; Kumagai, Jiro; Ko, Shigeru B H; Ishibashi, Kenichi; Ohno, Mayuko; Uchida, Keiko; Ohta, Akihito; Sohara, Eisei; Uchida, Shinichi; Sasaki, Sei; Rai, Tatemitsu


    Aquaporin 12 (AQP12) is the most recently identified member of the mammalian AQP family and is specifically expressed in pancreatic acinar cells. In vitro expression studies have revealed that AQP12 is localized at intracellular sites. To determine the physiological roles of AQP12 in the pancreas, we generated knockout mice for this gene (AQP12-KO). No obvious differences were observed under normal conditions between wild-type (WT) and AQP12-KO mice in terms of growth, blood chemistry, pancreatic fluid content, or histology. However, when we induced pancreatitis through the administration of a cholecystokinin-8 (CCK-8) analog, the AQP12-KO mice showed more severe pathological damage to this organ than WT mice. Furthermore, when we analyzed exocytosis in the pancreatic acini using a two-photon excitation imaging method, the results revealed larger exocytotic vesicles (vacuoles) in the acini of AQP12-KO mice at a high CCK-8 dose (100 nM). From these results, we conclude that AQP12 may function in the mechanisms that control the proper secretion of pancreatic fluid following rapid and intense stimulation.

  10. Differential proteome-metabolome profiling of YCA1-knock-out and wild type cells reveals novel metabolic pathways and cellular processes dependent on the yeast metacaspase.


    Ždralević, Maša; Longo, Valentina; Guaragnella, Nicoletta; Giannattasio, Sergio; Timperio, Anna Maria; Zolla, Lello


    The yeast Saccharomyces cerevisiae expresses one member of the metacaspase Cys protease family, encoded by the YCA1 gene. Combination of proteomics and metabolomics data showed that YCA1 deletion down-regulated glycolysis, the TCA cycle and alcoholic fermentation as compared with WT cells. Δyca1 cells also showed a down-regulation of the pentose phosphate pathway and accumulation of pyruvate, correlated with higher levels of certain amino acids found in these cells. Accordingly, there is a decrease in protein biosynthesis, and up-regulation of specific stress response proteins like Ahp1p, which possibly provides these cells with a better protection against stress. Moreover, in agreement with the down-regulation of protein biosynthesis machinery in Δyca1 cells, we have found that regulation of transcription, co-translational protein folding and protein targeting to different subcellular locations were also down-regulated. Metabolomics analysis of the nucleotide content showed a significant reduction in Δyca1 cells in comparison with the WT, except for GTP content which remained unchanged. Thus, our combined proteome-metabolome approach added a new dimension to the non-apoptotic function of yeast metacaspase, which can specifically affect cell metabolism through as yet unknown mechanisms and possibly stress-response pathways, like HOG and cell wall integrity pathways. Certainly, YCA1 deletion may induce compensatory changes in stress response proteins offering a better protection against apoptosis to Δyca1 cells rather than a loss in pro-apoptotic YCA1-associated activity.

  11. Ghrelin knockout mice show decreased voluntary alcohol consumption and reduced ethanol-induced conditioned place preference.


    Bahi, Amine; Tolle, Virginie; Fehrentz, Jean-Alain; Brunel, Luc; Martinez, Jean; Tomasetto, Catherine-Laure; Karam, Sherif M


    Recent work suggests that stomach-derived hormone ghrelin receptor (GHS-R1A) antagonism may reduce motivational aspects of ethanol intake. In the current study we hypothesized that the endogenous GHS-R1A agonist ghrelin modulates alcohol reward mechanisms. For this purpose ethanol-induced conditioned place preference (CPP), ethanol-induced locomotor stimulation and voluntary ethanol consumption in a two-bottle choice drinking paradigm were examined under conditions where ghrelin and its receptor were blocked, either using ghrelin knockout (KO) mice or the specific ghrelin receptor (GHS-R1A) antagonist "JMV2959". We showed that ghrelin KO mice displayed lower ethanol-induced CPP than their wild-type (WT) littermates. Consistently, when injected during CPP-acquisition, JMV2959 reduced CPP-expression in C57BL/6 mice. In addition, ethanol-induced locomotor stimulation was lower in ghrelin KO mice. Moreover, GHS-R1A blockade, using JMV2959, reduced alcohol-stimulated locomotion only in WT but not in ghrelin KO mice. When alcohol consumption and preference were assessed using the two-bottle choice test, both genetic deletion of ghrelin and pharmacological antagonism of the GHS-R1A (JMV2959) reduced voluntary alcohol consumption and preference. Finally, JMV2959-induced reduction of alcohol intake was only observed in WT but not in ghrelin KO mice. Taken together, these results suggest that ghrelin neurotransmission is necessary for the stimulatory effect of ethanol to occur, whereas lack of ghrelin leads to changes that reduce the voluntary intake as well as conditioned reward by ethanol. Our findings reveal a major, novel role for ghrelin in mediating ethanol behavior, and add to growing evidence that ghrelin is a key mediator of the effects of multiple abused drugs.

  12. Effects of NV gene knock-out recombinant viral hemorrhagic septicemia virus (VHSV) on Mx gene expression in Epithelioma papulosum cyprini (EPC) cells and olive flounder (Paralichthys olivaceus).


    Kim, Min Sun; Kim, Ki Hong


    To determine whether the NV gene of viral hemorrhagic septicemia virus (VHSV) is related to the type I interferon response of hosts, expression of Mx gene in Epithelioma papulosum cyprini (EPC) cells and in olive flounder (Paralichthys olivaceus) in response to infection with either wild-type VHSV or recombinant VHSVs (rVHSV-ΔNV-EGFP and rVHSV-wild) was investigated. A reporter vector was constructed for measuring Mx gene expression using olive flounder Mx promoter, in which the reporter Metridia luciferase was designed to be excreted to culture medium to facilitate measurement. The highest increase of luciferase activity was detected from supernatant of cells infected with rVHSV-ΔNV-EGFP. In contrast cells infected with wild-type VHSV showed a slight increase of the luciferase activity. Interestingly, cells infected with rVHSV-wild that has artificially changed nucleotides just before and after the NV gene ORF, also showed highly increased luciferase activity, but the increased amplitude was lower than that by rVHSV-ΔNV-EGFP. These results strongly suggest that the NV protein of VHSV plays an important role in suppressing interferon response in host cells, which provides a condition for the viruses to efficiently proliferate in host cells. In an in vivo experiment, the Mx gene expression in olive flounder challenged with the rVHSV-ΔNV-EGFP was clearly higher than fish challenged with rVHSV-wild or wild-type VHSV, suggesting that lacking of the NV gene in the genome of rVHSV-ΔNV-EGFP brought to strong interferon response that subsequently inhibit viral replication in fish.

  13. Ferulic Acid Orchestrates Anti-Oxidative Properties of Danggui Buxue Tang, an Ancient Herbal Decoction: Elucidation by Chemical Knock-Out Approach

    PubMed Central

    Gong, Amy G. W.; Huang, Vincent Y.; Wang, Huai Y.; Lin, Huang Q.; Dong, Tina T. X.; Tsim, Karl W. K.


    Ferulic acid, a phenolic acid derived mainly from a Chinese herb Angelica Sinensis Radix (ASR), was reported to reduce the formation of free radicals. Danggui Buxue Tang (DBT), a herbal decoction composing of Astragali Radix (AR) and ASR, has been utilized for more than 800 years in China having known anti-oxidative property. Ferulic acid is a major active ingredient in DBT; however, the role of ferulic acid within the herbal mixture has not been resolved. In order to elucidate the function of ferulic acid within this herbal decoction, a ferulic acid-depleted herbal decoction was created and named as DBTΔfa. The anti-oxidative properties of chemically modified DBT decoction were systemically compared in cultured H9C2 rat cardiomyoblast cell line. The application of DBT and DBTΔfa into the cultures showed functions in (i) decreasing the reactive oxygen species (ROS) formation, detected by laser confocal; (ii) increasing of the activation of Akt; (iii) increasing the transcriptional activity of anti-oxidant response element (ARE); and (iv) increasing the expressions of anti-oxidant enzymes, i.e. NQO1 and GCLM. In all scenario, the aforementioned anti-oxidative properties of DBTΔfa in H9C2 cells were significantly reduced, as compared to authentic DBT. Thus, ferulic acid could be an indispensable chemical in DBT to orchestrate multi-components of DBT as to achieve maximal anti-oxidative functions. PMID:27824860

  14. The knock-out of ARP3a gene affects F-actin cytoskeleton organization altering cellular tip growth, morphology and development in moss Physcomitrella patens.


    Finka, Andrija; Saidi, Younousse; Goloubinoff, Pierre; Neuhaus, Jean-Marc; Zrÿd, Jean-Pierre; Schaefer, Didier G


    The seven subunit Arp2/3 complex is a highly conserved nucleation factor of actin microfilaments. We have isolated the genomic sequence encoding a putative Arp3a protein of the moss Physcomitrella patens. The disruption of this ARP3A gene by allele replacement has generated loss-of-function mutants displaying a complex developmental phenotype. The loss-of function of ARP3A gene results in shortened, almost cubic chloronemal cells displaying affected tip growth and lacking differentiation to caulonemal cells. In moss arp3a mutants, buds differentiate directly from chloronemata to form stunted leafy shoots having differentiated leaves similar to wild type. Yet, rhizoids never differentiate from stem epidermal cells. To characterize the F-actin organization in the arp3a-mutated cells, we disrupted ARP3A gene in the previously described HGT1 strain expressing conditionally the GFP-talin marker. In vivo observation of the F-actin cytoskeleton during P. patens development demonstrated that loss-of-function of Arp3a is associated with the disappearance of specific F-actin cortical structures associated with the establishment of localized cellular growth domains. Finally, we show that constitutive expression of the P. patens Arp3a and its Arabidopsis thaliana orthologs efficiently complement the mutated phenotype indicating a high degree of evolutionary conservation of the Arp3 function in land plants.

  15. Metabolic consequences of knocking out UGT85B1, the gene encoding the glucosyltransferase required for synthesis of dhurrin in Sorghum bicolor (L. Moench).


    Blomstedt, Cecilia K; O'Donnell, Natalie H; Bjarnholt, Nanna; Neale, Alan D; Hamill, John D; Møller, Birger Lindberg; Gleadow, Roslyn M


    Many important food crops produce cyanogenic glucosides as natural defense compounds to protect against herbivory or pathogen attack. It has also been suggested that these nitrogen-based secondary metabolites act as storage reserves of nitrogen. In sorghum, three key genes, CYP79A1, CYP71E1 and UGT85B1, encode two Cytochrome P450s and a glycosyltransferase, respectively, the enzymes essential for synthesis of the cyanogenic glucoside dhurrin. Here, we report the use of targeted induced local lesions in genomes (TILLING) to identify a line with a mutation resulting in a premature stop codon in the N-terminal region of UGT85B1. Plants homozygous for this mutation do not produce dhurrin and are designated tcd2 (totally cyanide deficient 2) mutants. They have reduced vigor, being dwarfed, with poor root development and low fertility. Analysis using liquid chromatography-mass spectrometry (LC-MS) shows that tcd2 mutants accumulate numerous dhurrin pathway-derived metabolites, some of which are similar to those observed in transgenic Arabidopsis expressing the CYP79A1 and CYP71E1 genes. Our results demonstrate that UGT85B1 is essential for formation of dhurrin in sorghum with no co-expressed endogenous UDP-glucosyltransferases able to replace it. The tcd2 mutant suffers from self-intoxication because sorghum does not have a feedback mechanism to inhibit the initial steps of dhurrin biosynthesis when the glucosyltransferase activity required to complete the synthesis of dhurrin is lacking. The LC-MS analyses also revealed the presence of metabolites in the tcd2 mutant which have been suggested to be derived from dhurrin via endogenous pathways for nitrogen recovery, thus indicating which enzymes may be involved in such pathways.

  16. Aged mice receiving caffeine since adulthood show distinct patterns of anxiety-related behavior.


    Botton, Paulo Henrique S; Pochmann, Daniela; Rocha, Andreia S; Nunes, Fernanda; Almeida, Amanda S; Marques, Daniela M; Porciúncula, Lisiane O


    Caffeine is the psychostimulant most consumed worldwide. Anxiogenic effects of caffeine have been described in adult animals with controversial findings about its anxiogenic potential. Besides, the effects of caffeine on anxiety with aging are still poorly known. In this study, adult mice (6months old) started to receive caffeine (0.3 and 1.0mg/mL, drinking water) during 12-14months only in the light cycle and at weekdays. The open field (OF) and elevated plus maze (EPM) testing were used to determine the effects of caffeine on anxiety-related behavior in adult and aged mice (18-20months old). Because aging alters synaptic proteins, we also evaluated SNAP-25 (as a nerve terminals marker), GFAP (as an astrocyte marker) and adenosine A1 and A2A receptors levels in the cortex. According to the OF analysis, caffeine did not change both hypolocomotion and anxiety with aging. However, aged mice showed less anxiety behavior in the EPM, but after receiving caffeine (0.3mg/mL) during adulthood they were anxious as adult mice. While SNAP-25 and adenosine A2A receptors increased with aging, both GFAP and adenosine A1 receptors were not affected. Caffeine at moderate dose prevented the age-related increase of the SNAP-25, with no effect on adenosine A2A receptors. The absence of effect for the highest dose suggests that tolerance to caffeine may have developed over time. Aged mice showed high responsiveness to the OF, being difficult to achieve any effect of caffeine. On the other hand this substance sustained the adult anxious behavior over time in a less stressful paradigm, and this effect was coincident with changes in the SNAP-25, suggesting the involvement of this synaptic protein in the ability of caffeine to preserve changes related to emotionality with aging.

  17. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation.


    Chidgey, M; Brakebusch, C; Gustafsson, E; Cruchley, A; Hail, C; Kirk, S; Merritt, A; North, A; Tselepis, C; Hewitt, J; Byrne, C; Fassler, R; Garrod, D


    The desmosomal cadherin desmocollin (Dsc)1 is expressed in upper epidermis where strong adhesion is required. To investigate its role in vivo, we have genetically engineered mice with a targeted disruption in the Dsc1 gene. Soon after birth, null mice exhibit flaky skin and a striking punctate epidermal barrier defect. The epidermis is fragile, and acantholysis in the granular layer generates localized lesions, compromising skin barrier function. Neutrophils accumulate in the lesions and further degrade the tissue, causing sloughing (flaking) of lesional epidermis, but rapid wound healing prevents the formation of overt lesions. Null epidermis is hyperproliferative and overexpresses keratins 6 and 16, indicating abnormal differentiation. From 6 wk, null mice develop ulcerating lesions resembling chronic dermatitis. We speculate that ulceration occurs after acantholysis in the fragile epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human blistering diseases is discussed. These results show that Dsc1 is required for strong adhesion and barrier maintenance in epidermis and contributes to epidermal differentiation.

  18. Mice deficient in dihydrolipoyl succinyltransferase show increased vulnerability to mitochondrial toxins

    PubMed Central

    Yang, Lichuan; Shi, Qingli; Ho, Daniel J.; Starkov, Anatoly A.; Wille, Elizabeth J.; Xu, Hui; Chen, HL; Zhang, Steven; Stack, Cliona M.; Calingasan, Noel Y.; Gibson, Gary E.; Beal, M. Flint


    The activity of a key mitochondrial tricarboxylic acid cycle enzyme, α-ketoglutarate dehydrogenase complex (KGDHC), declines in many neurodegenerative diseases. KGDHC consists of three subunits. The dihydrolipoyl succinyltransferase (DLST) component is unique to KGDHC. DLST+/- mice showed reduced mRNA and protein levels and decreased brain mitochondrial KGDHC activity. Neurotoxic effects of mitochondrial toxins were exacerbated in DLST+/- mice. MPTP produced a significantly greater reduction of striatal dopamine and tyrosine hydroxylase-positive neurons in the substantia nigra pars compacta of DLST+/- mice. DLST deficiency enhanced the severity of lipid peroxidation in the substantia nigra after MPTP treatment. Striatal lesions induced by either malonate or 3-nitropropionic acid (3-NP) were significantly larger in DLST+/- mice than in wildtype controls. DLST deficiency enhanced the 3-NP inhibition of mitochondria enzymes, and 3-NP induced protein and DNA oxidations. These observations support the hypothesis that reductions in KGDHC may impair the adaptability of the brain and contribute to the pathogenesis of neurodegenerative diseases. PMID:19660549

  19. Juvenile mice show greater flexibility in multiple choice reversal learning than adults

    PubMed Central

    Johnson, Carolyn; Wilbrecht, Linda


    We hypothesized that decision-making strategies in juvenile animals, rather than being immature, are optimized to navigate the uncertainty and instability likely to be encountered in the environment at the time of the animal’s transition to independence. We tested juvenile and young adult mice on discrimination and reversal of a 4-choice and 2-choice odor-based foraging task. Juvenile mice (P26–27) learned a 4-choice discrimination and reversal faster than adults (P60–70), making fewer perseverative and distraction errors. Juvenile mice had shorter choice latencies and more focused search strategies. In both ages, performance of the task was significantly impaired by a lesion of the dorsomedial frontal cortex. Our data show that the frontal cortex can support highly flexible behavior in juvenile mice at a time coincident with weaning and first independence. The unexpected developmental decline in flexibility of behavior one month later suggests that frontal cortex based executive function may not inevitably become more flexible with age, but rather may be developmentally tuned to optimize exploratory and exploitative behavior for each life stage. PMID:21949556

  20. Ghrelin O-acyltransferase knockout mice show resistance to obesity when fed high-sucrose diet.


    Kouno, Tetsuya; Akiyama, Nobuteru; Ito, Takahito; Okuda, Tomohiko; Nanchi, Isamu; Notoya, Mitsuru; Oka, Shogo; Yukioka, Hideo


    Ghrelin is an appetite-stimulating hormone secreted from stomach. Since the discovery that acylation of the serine-3 residue by ghrelin O-acyltransferase (GOAT) is essential for exerting its functions, GOAT has been regarded as an therapeutic target for attenuating appetite, and thus for the treatment of obesity and diabetes. However, contrary to the expectations, GOAT-knockout (KO) mice have not shown meaningful body weight reduction, under high-fat diet. Here, in this study, we sought to determine whether GOAT has a role in body weight regulation and glucose metabolism with a focus on dietary sucrose, because macronutrient composition of diet is important for appetite regulation. We found that peripherally administered acylated-ghrelin, but not unacylated one, stimulated sucrose consumption in a two-bottle-drinking test. The role of acylated-ghrelin in sucrose preference was further supported by the finding that GOAT KO mice consumed less sucrose solution compared with WT littermates. Then, we investigated the effect of dietary composition of sucrose on food intake and body weight in GOAT KO and WT mice. As a result, when fed on high-fat diet, food intake and body weight were similar between GOAT KO and WT mice. However, when fed on high-fat, high-sucrose diet, GOAT KO mice showed significantly reduced food intake and marked resistance to obesity, leading to amelioration of glucose metabolism. These results suggest that blockade of acylated-ghrelin production offers therapeutic potential for obesity and metabolic disorders caused by overeating of palatable food.

  1. Aged PrP null mice show defective processing of neuregulins in the peripheral nervous system.


    Benvegnù, Stefano; Gasperini, Lisa; Legname, Giuseppe


    A prion, a protease-resistant conformer of the cellular prion protein (PrP(C)), is the causative agent of transmissible spongiform encephalopathies or prion diseases. While this property is well established for the aberrantly folded protein, the physiological function of PrP(C) remains elusive. Among different putative functions, the non-pathogenic protein isoform PrP(C) is involved in several cellular processes. Here, we show that PrP(C) regulates the cleavage of neuregulin-1 proteins (NRG1). Neuregulins provide key axonal signals that regulate several processes, including glial cells proliferation, survival and myelination. Interestingly, mice devoid of PrP(C) (Prnp⁰/⁰) were recently shown to have a late-onset demyelinating disease in the peripheral nervous system (PNS) but not in the central nervous system (CNS). We found that NRG1 processing is developmentally regulated in the PNS and, by comparing wildtype and Prnp⁰/⁰ mice, that PrP(C) influences NRG1 processing in old, but not in young, animals. In addition, we found that also the processing of neuregulin-3, another neuregulin family member, is altered in the PNS of Prnp⁰/⁰ mice. These differences in neuregulin proteins processing are not paralleled in the CNS, thus suggesting a different cellular function for PrP(C) between the CNS and the PNS.

  2. Immunization with recombinant leucine aminopeptidase showed protection against Fasciola gigantica in mice.


    Changklungmoa, Narin; Kueakhai, Pornanan; Riengrojpitak, Suda; Chaithirayanon, Kulathida; Chaichanasak, Pannigan; Preyavichyapugdee, Narin; Chantree, Pathanin; Sansri, Veerawat; Itagaki, Tadashi; Sobhon, Prasert


    Leucine aminopeptidase (LAP) is expressed in all stages of Fasciola gigantica and, hence, is considered as a potential vaccine candidate. In this study, we have tested a vaccine potential of LAP and the types of immune responses it elicited in vaccinated mice. Recombinant F. gigantica leucine aminopeptidase (rFgLAP) was expressed in Escherichia coli, BL21 (DE3). The imprinting control region mice subcutaneously immunized with 50 μg of rFgLAP combined with Freund's adjuvant (n = 10) exhibited a significant reduction in worm recoveries when compared with non-immunized and Freund's adjuvant controls at 60.8 and 64.3%, respectively, and both T helper (Th)1 and Th2 humoral immune responses were elicited in the hosts as reflected by the levels of IgG1 and IgG2a, with Th2 predominating. The levels of IgG1- and IgG2a-specific antibodies to rFgLAP were inversely and significantly correlated with the numbers of worm recoveries. The rFgLAP-vaccinated mice showed significantly reduced levels of serum glutamic oxaloacetic transaminase and serum glutamic pyruvic transaminase and liver damage. These indicated that rFgLAP has a potential as a vaccine candidate against F. gigantica, whose efficacy will be studied further in economic animals including cattle, sheep, and goat.

  3. Spontaneous colitis occurrence in transgenic mice with altered B7-mediated costimulation.


    Kim, Gisen; Turovskaya, Olga; Levin, Matthew; Byrne, Fergus R; Whoriskey, John S; McCabe, James G; Kronenberg, Mitchell


    The B7 costimulatory molecules govern many aspects of T cell immune responses by interacting with CD28 for costimulation, but also with CTLA-4 for immune suppression. Although blockade of CTLA-4 with Ab in humans undergoing cancer immune therapy has led to some cases of inflammatory bowel disease, spontaneous animal models of colitis that depend upon modulation of B7 interactions have not been previously described. In this study, we demonstrate that mice expressing a soluble B7-2 Ig Fc chimeric protein spontaneously develop colitis that is dependent on CD28-mediated costimulation of CD4(+) T cells. We show that the chimeric protein has mixed agonistic/antagonist properties, and that it acts in part by blocking the cell intrinsic effects on T cell activation of engagement of CTLA-4. Disease occurred in transgenic mice that lack expression of the endogenous B7 molecules (B7 double knock-out mice), because of the relatively weak costimulatory delivered by the chimeric protein. Surprisingly, colitis was more severe in this context, which was associated with the decreased number of Foxp3(+) regulatory T cells in transgenic B7 double knock-out mice. This model provides an important tool for examining how B7 molecules and their effects on CTLA-4 modulate T cell function and the development of inflammatory diseases.

  4. Mice lacking brain-type creatine kinase activity show defective thermoregulation

    PubMed Central

    Streijger, Femke; Pluk, Helma; Oerlemans, Frank; Beckers, Gaby; Bianco, Antonio C.; Ribeiro, Miriam O.; Wieringa, Bé; Van der Zee, Catharina E.E.M.


    The cytosolic brain-type creatine kinase and mitochondrial ubiquitous creatine kinase (CK-B and UbCKmit) are expressed during the prepubescent and adult period of mammalian life. These creatine kinase (CK) isoforms are present in neural cell types throughout the central and peripheral nervous system and in smooth muscle containing tissues, where they have an important role in cellular energy homeostasis. Here, we report on the coupling of CK activity to body temperature rhythm and adaptive thermoregulation in mice. With both brain-type CK isoforms being absent, the body temperature reproducibly drops ~1.0°C below normal during every morning (inactive) period in the daily cycle. Facultative non-shivering thermogenesis is also impaired, since CK−−/−− mice develop severe hypothermia during 24 h cold exposure. A relationship with fat metabolism was suggested because comparison of CK−−/−− mice with wildtype controls revealed decreased weight gain associated with less white and brown fat accumulation and smaller brown adipocytes. Also, circulating levels of glucose, triglycerides and leptin are reduced. Extensive physiological testing and uncoupling protein1 analysis showed, however, that the thermogenic problems are not due to abnormal responsiveness of brown adipocytes, since noradrenaline infusion produced a normal increase of body temperature. Moreover, we demonstrate that the cyclic drop in morning temperature is also not related to altered rhythmicity with reduced locomotion, diminished food intake or increased torpor sensitivity. Although several integral functions appear altered when CK is absent in the brain, combined findings point into the direction of inefficient neuronal transmission as the dominant factor in the thermoregulatory defect. PMID:19419668

  5. MRL/MpJ-Fas(lpr) mice show abnormalities in ovarian function and morphology with the progression of autoimmune disease.


    Otani, Yuki; Ichii, Osamu; Otsuka-Kanazawa, Saori; Chihara, Masataka; Nakamura, Teppei; Kon, Yasuhiro


    The immune system is known to affect reproductive function, and maternal-fetal immune tolerance is essential for a successful pregnancy. To investigate the relationship between autoimmune disease and female reproductive function, we performed a comparative analysis of the ovarian phenotypes for C57BL/6 mice, autoimmune disease-prone MRL/MpJ (MRL/+) mice and congenic MRL/MpJ-Fas(lpr) (MRL/lpr) mice harboring a mutation in the Fas gene that speeds disease onset. Both MRL-background strains showed earlier vaginal opening than C57BL/6 mice. The estrous cycle became irregular by 6 and 12 months of age in MRL/lpr mice and mice of the other two strains, respectively. Histological analysis at 3 months revealed that the number of primordial follicles was smaller in MRL-background mice than in C57BL/6 mice after 3 months. In addition, MRL/lpr and MRL/+ mice displayed lower numbers of ovarian follicles and corpora lutea at 3 and 6 months, and 6 and 12 months, respectively, than that in age-matched C57BL/6 mice. MRL/lpr and MRL/+ mice developed ovarian interstitial glands after 3 and 6 months, respectively. In particular, MRL/lpr mice showed numerous infiltrating lymphocytes within the ovarian interstitia, and partially stratified ovarian surface epithelia with more developed microvilli than that observed in C57BL/6 mice at 6 months. No significant differences in serum hormone levels were observed between the strains. In conclusion, MRL/lpr mice display altered ovarian development, morphology and function consistent with the progression of severe autoimmune disease, as these findings are less severe in MRL/+ counterparts.

  6. Two Genetically Similar H9N2 Influenza A Viruses Show Different Pathogenicity in Mice

    PubMed Central

    Liu, Qingtao; Liu, Yuzhuo; Yang, Jing; Huang, Xinmei; Han, Kaikai; Zhao, Dongmin; Bi, Keran; Li, Yin


    H9N2 Avian influenza virus has repeatedly infected humans and other mammals, which highlights the need to determine the pathogenicity and the corresponding mechanism of this virus for mammals. In this study, we found two H9N2 viruses with similar genetic background but with different pathogenicity in mice. The A/duck/Nanjing/06/2003 (NJ06) virus was highly pathogenic for mice, with a 50% mouse lethal dose (MLD50) of 102.83 50% egg infectious dose (EID50), whereas the A/duck/Nanjing/01/1999 (NJ01) virus was low pathogenic for mice, with a MLD50 of >106.81 EID50. Further studies showed that the NJ06 virus grew faster and reached significantly higher titers than NJ01 in vivo and in vitro. Moreover, the NJ06 virus induced more severe lung lesions, and higher levels of inflammatory cellular infiltration and cytokine response in lungs than NJ01 did. However, only 12 different amino acid residues (HA-K157E, NA-A9T, NA-R435K, PB2-T149P, PB2-K627E, PB1-R187K, PA-L548M, PA-M550L, NP-G127E, NP-P277H, NP-D340N, NS1-D171N) were found between the two viruses, and all these residues except for NA-R435K were located in the known functional regions involved in interaction of viral proteins or between the virus and host factors. Summary, our results suggest that multiple amino acid differences may be responsible for the higher pathogenicity of the NJ06 virus for mice, resulting in lethal infection, enhanced viral replication, severe lung lesions, and excessive inflammatory cellular infiltration and cytokine response in lungs. These observations will be helpful for better understanding the pathogenic potential and the corresponding molecular basis of H9N2 viruses that might pose threats to human health in the future. PMID:27867373

  7. "Binge" drinking experience in adolescent mice shows sex differences and elevated ethanol intake in adulthood.


    Strong, Moriah N; Yoneyama, Naomi; Fretwell, Andrea M; Snelling, Chris; Tanchuck, Michelle A; Finn, Deborah A


    Binge drinking, defined as achieving blood ethanol concentrations (BEC) of 80 mg%, has been increasing in adolescents and was reported to predispose later physical dependence. The present experiments utilized an animal model of binge drinking to compare the effect of ethanol "binge" experience during adolescence or adulthood on subsequent ethanol intake in male and female C57BL/6 mice. Adolescent and adult mice were initially exposed to the scheduled high alcohol consumption procedure, which produces BECs that exceed the levels for binge drinking following a 30-min ethanol session every third day. Ethanol intake and BECs were significantly higher in the adolescent ( approximately 3 g/kg, 199 mg%) versus adult ( approximately 2 g/kg, 135 mg%) mice during the first three ethanol sessions, but were more equivalent during the final two ethanol sessions (1.85-2.0 g/kg, 129-143 mg%). Then, separate groups of the ethanol-experienced mice were tested with ethanol naïve adolescent and adult mice for 2-h limited access (10% and 20% solutions) or 24-h (5%, 10% and 20% solutions) ethanol preference drinking. Limited access ethanol intake was significantly higher in female versus male mice, but was not altered by age or ethanol experience. In contrast, 24-h ethanol intake was significantly higher in the adolescent versus adult mice and in female versus male mice. Furthermore, binge drinking experience in the adolescent mice significantly increased subsequent ethanol intake, primarily due to intake in female mice. Thus, adolescent binge drinking significantly increased unlimited ethanol intake during adulthood, with female mice more susceptible to this effect.

  8. Ceruloplasmin gene-deficient mice with experimental autoimmune encephalomyelitis show attenuated early disease evolution.


    Gresle, Melissa M; Schulz, Katrin; Jonas, Anna; Perreau, Victoria M; Cipriani, Tania; Baxter, Alan G; Miranda-Hernandez, Socorro; Field, Judith; Jokubaitis, Vilija G; Cherny, Robert; Volitakis, Irene; David, Samuel; Kilpatrick, Trevor J; Butzkueven, Helmut


    We conducted a microarray study to identify genes that are differentially regulated in the spinal cords of mice with the inflammatory disease experimental autoimmune encephalomyelitis (EAE) relative to healthy mice. In total 181 genes with at least a two-fold increase in expression were identified, and most of these genes were associated with immune function. Unexpectedly, ceruloplasmin (Cp), a ferroxidase that converts toxic ferrous iron to its nontoxic ferric form and also promotes the efflux of iron from astrocytes in the CNS, was shown to be highly upregulated (13.2-fold increase) in EAE spinal cord. Expression of Cp protein is known to be increased in several neurological conditions, but the role of Cp regulation in CNS autoimmune disease is not known. To investigate this, we induced EAE in Cp gene knockout, heterozygous, and wild-type mice. Cp knockout mice were found to have slower disease evolution than wild-type mice (EAE days 13-17; P = 0.05). Interestingly, Cp knockout mice also exhibited a significant increase in the number of astrocytes with reactive morphology in early EAE compared with wild-type mice at the same stage of disease. CNS iron levels were not increased with EAE in these mice. Based on these observations, we propose that an increase in Cp expression could contribute to tissue damage in early EAE. In addition, endogenous CP either directly or indirectly inhibits astrocyte reactivity during early disease, which could also worsen early disease evolution.

  9. Apolipoprotein E-knockout mice on high-fat diet show autoimmune injury on kidney and aorta

    SciTech Connect

    Wang, Yuehai; Lu, Huixia; Huang, Ziyang; Lin, Huili; Lei, Zhenmin; Tang, Mengxiong; Gao, Fei; Dong, Mei; Li, Rongda; Lin, Ling


    Highlights: • Titers of ANA and anti-dsDNA antibodies were similar in ApoE{sup −/−} and Fas{sup −/−} mice. • The spleen weights and glomerular areas were similar in ApoE{sup −/−} and Fas{sup −/−} mice. • Expressions of IgG and C3 in glomeruli were similar in ApoE{sup −/−} and Fas{sup −/−} mice. • IgG, C3 and macrophage infiltration in aortic plaques were found in ApoE{sup −/−} mice. - Abstract: Background: Apolipoprotein E-knockout (ApoE{sup −/−}) mice is a classic model of atherosclerosis. We have found that ApoE{sup −/−} mice showed splenomegaly, higher titers of serum anti-nuclear antibody (ANA) and anti-dsDNA antibody compared with C57B6/L (B6) mice. However, whether ApoE{sup −/−} mice show autoimmune injury remains unclear. Methods and results: Six females and six males in each group, ApoE{sup −/−}, Fas{sup −/−} and B6 mice, were used in this study. The titers of serum ANA, anti-dsDNA antibody and creatinine and urine protein were measured by ELISA after 4 months of high-fat diet. The spleen weight and the glomerular area were determined. The expressions of IgG, C3 and macrophage in kidney and atherosclerotic plaque were detected by immunostaining followed by morphometric analysis. Similar to the characteristics of Fas{sup −/−} mice, a model of systemic lupus erythematosus (SLE), ApoE{sup −/−} mice, especially female, displayed significant increases of spleen weight and glomerular area when compared to B6 mice. Also, elevated titers of serum ANA, anti-dsDNA antibody and creatinine and urine protein. Moreover, the expressions of IgG, C3 and macrophage in glomeruli and aortic plaques were found in ApoE{sup −/−} mice. In addition, the IgG and C3 expressions in glomeruli and plaques significantly increased (or a trend of increase) in female ApoE{sup −/−} mice compared with males. Conclusions: Apolipoprotein E-knockout mice on high-fat diet show autoimmune injury on kidney and aorta.

  10. Hepatic Farnesoid X-Receptor Isoforms α2 and α4 Differentially Modulate Bile Salt and Lipoprotein Metabolism in Mice

    PubMed Central

    Boesjes, Marije; Bloks, Vincent W.; Hageman, Jurre; Bos, Trijnie; van Dijk, Theo H.; Havinga, Rick; Wolters, Henk; Jonker, Johan W.; Kuipers, Folkert; Groen, Albert K.


    The nuclear receptor FXR acts as an intracellular bile salt sensor that regulates synthesis and transport of bile salts within their enterohepatic circulation. In addition, FXR is involved in control of a variety of crucial metabolic pathways. Four FXR splice variants are known, i.e. FXRα1-4. Although these isoforms show differences in spatial and temporal expression patterns as well as in transcriptional activity, the physiological relevance hereof has remained elusive. We have evaluated specific roles of hepatic FXRα2 and FXRα4 by stably expressing these isoforms using liver-specific self-complementary adeno-associated viral vectors in total body FXR knock-out mice. The hepatic gene expression profile of the FXR knock-out mice was largely normalized by both isoforms. Yet, differential effects were also apparent; FXRα2 was more effective in reducing elevated HDL levels and transrepressed hepatic expression of Cyp8b1, the regulator of cholate synthesis. The latter coincided with a switch in hydrophobicity of the bile salt pool. Furthermore, FXRα2-transduction caused an increased neutral sterol excretion compared to FXRα4 without affecting intestinal cholesterol absorption. Our data show, for the first time, that hepatic FXRα2 and FXRα4 differentially modulate bile salt and lipoprotein metabolism in mice. PMID:25506828

  11. Ultrasonic Vocalizations of Male Mice Differ among Species and Females Show Assortative Preferences for Male Calls

    PubMed Central

    Musolf, Kerstin; Meindl, Stefanie; Larsen, Angela L.; Kalcounis-Rueppell, Matina C.; Penn, Dustin J.


    Male house mice (Mus musculus) emit ultrasonic vocalizations (USVs) during courtship, which attract females, and we aimed to test whether females use these vocalizations for species or subspecies recognition of potential mates. We recorded courtship USVs of males from different Mus species, Mus musculus subspecies, and populations (F1 offspring of wild-caught Mus musculus musculus, Mus musculus domesticus (and F1 hybrid crosses), and Mus spicilegus), and we conducted playback experiments to measure female preferences for male USVs. Male vocalizations contained at least seven distinct syllable types, whose frequency of occurrence varied among species, subspecies, and populations. Detailed analyses of multiple common syllable types indicated that Mus musculus and Mus spicilegus could be discriminated based on spectral and temporal characteristics of their vocalizations, and populations of Mus musculus were also distinctive regardless of the classification model used. Females were able to discriminate USVs from different species, and showed assortative preferences for conspecific males. We found no evidence that females discriminate USVs of males from a different subspecies or separate populations of the same species, even though our spectral analyses identified acoustic features that differ between species, subspecies, and populations of the same species. Our results provide the first comparison of USVs between Mus species or between Mus musculus subspecies, and the first evidence that male USVs potentially facilitate species recognition. PMID:26309246

  12. IL-1 receptor-antagonist (IL-1Ra) knockout mice show anxiety-like behavior by aging.


    Wakabayashi, Chisato; Numakawa, Tadahiro; Odaka, Haruki; Ooshima, Yoshiko; Kiyama, Yuji; Manabe, Toshiya; Kunugi, Hiroshi; Iwakura, Yoichiro


    Interleukin 1 (IL-1) plays a critical role in stress responses, and its mRNA is induced in the brain by restraint stress. Previously, we reported that IL-1 receptor antagonist (IL-1Ra) knockout (KO) mice, which lacked IL-1Ra molecules that antagonize the IL-1 receptor, showed anti-depression-like behavior via adrenergic modulation at the age of 8 weeks. Here, we report that IL-1Ra KO mice display an anxiety-like phenotype that is induced spontaneously by aging in the elevated plus-maze (EPM) test. This anxiety-like phenotype was improved by the administration of diazepam. The expression of the anxiety-related molecule glucocorticoid receptor (GR) was significantly reduced in 20-week-old but not in 11-week-old IL-1Ra KO mice compared to wild-type (WT) littermates. The expression of the mineralocorticoid receptor (MR) was not altered between IL-1Ra KO mice and WT littermates at either 11 or 20 weeks old. Analysis of monoamine concentration in the hippocampus revealed that tryptophan, the serotonin metabolite 5-hydroxyindole acetic acid (5-HIAA), and the dopamine metabolite homovanillic acid (HVA) were significantly increased in 20-week-old IL-1Ra KO mice compared to littermate WT mice. These findings strongly suggest that the anxiety-like behavior observed in older mice was caused by the complicated alteration of monoamine metabolism and/or GR expression in the hippocampus.

  13. Young MLP deficient mice show diastolic dysfunction before the onset of dilated cardiomyopathy

    PubMed Central

    Lorenzen-Schmidt, Ilka; Stuyvers, Bruno D.; ter Keurs, Henk E.D.J.; Date, Moto-o; Hoshijima, Masahiko; Chien, Kenneth R.; McCulloch, Andrew D.; Omens, Jeffrey H.


    Targeted deletion of cytoskeletal muscle LIM protein (MLP) in mice consistently leads to dilated cardiomyopathy (DCM) after one or more months. However, next to nothing is known at present about the mechanisms of this process. We investigated whether diastolic performance including passive mechanics and systolic behavior are altered in 2-week-old MLP knockout (MLPKO) mice, in which heart size, fractional shortening and ejection fraction are still normal. Right ventricular trabeculae were isolated from 2-week-old MLPKO and wildtype mice and placed in an apparatus that allowed force measurements and sarcomere length measurements using laser diffraction. During a twitch from the unloaded state at 1 Hz, MLPKO muscles relengthened to slack length more slowly than controls, although the corresponding force relaxation time was unchanged. Active developed stress at a diastolic sarcomere length of 2.00 μm was preserved in MLPKO trabeculae over a wide range of pacing frequencies. Force relaxation under the same conditions was consistently prolonged compared with wildtype controls, whereas time to peak and maximum rate of force generation were not significantly altered. Ca2+ content of the sarcoplasmic reticulum (SR) and the quantities of Ca2+ handling proteins were similar in both genotypes. In summary, young MLPKO mice revealed substantial alterations in passive myocardial properties and relaxation time, but not in most systolic characteristics. These results indicate that the progression to heart failure in the MLPKO model may be driven by diastolic myocardial dysfunction and abnormal passive properties rather than systolic dysfunction. PMID:15978612

  14. Apolipoprotein E-knockout mice show increased titers of serum anti-nuclear and anti-dsDNA antibodies

    SciTech Connect

    Wang, Yuehai; Huang, Ziyang; Lu, Huixia; Lin, Huili; Wang, Zhenhua; Chen, Xiaoqing; Ouyang, Qiufang; Tang, Mengxiong; Hao, Panpan; Ni, Jingqin; Xu, Dongming; Zhang, Mingxiang; Zhang, Qunye; Lin, Ling; and others


    Highlights: Black-Right-Pointing-Pointer Titers of ANA and anti-dsDNA antibodies were higher in ApoE{sup -/-} than C57B6/L mice. Black-Right-Pointing-Pointer Spleen was greater and splenocyte apoptosis lower in ApoE{sup -/-} than B6 mice. Black-Right-Pointing-Pointer Level of TLR4 was lower in spleen tissue of ApoE{sup -/-} than B6 mice. Black-Right-Pointing-Pointer The TLR4 pathway may participate in maintaining the balance of splenocyte apoptosis. Black-Right-Pointing-Pointer The TLR4 pathway may participate in antibody production in spleen tissue. -- Abstract: Apolipoprotein E-knockout (ApoE{sup -/-}) mice, atherosclerosis-prone mice, show an autoimmune response, but the pathogenesis is not fully understood. We investigated the pathogenesis in female and male ApoE{sup -/-} mice. The spleens of all ApoE{sup -/-} and C57BL/6 (B6) mice were weighed. The serum IgG level and titers of anti-nuclear antibody (ANA) and anti-double-stranded DNA (anti-dsDNA) antibody were assayed by ELISA. Apoptosis of spleen tissue was evaluated by TUNEL. TLR4 level in spleen tissue was tested by immunohistochemistry and Western blot analysis. Levels of MyD88, p38, phosphorylated p38 (pp38), interferon regulatory factor 3 (IRF3) and Bcl-2-associated X protein (Bax) in spleen tissue were detected by Western blot analysis. We also survey the changes of serum autoantibodies, spleen weight, splenocyte apoptosis and the expressions of TLR4, MyD88, pp38, IRF3 and Bax in spleen tissue in male ApoE{sup -/-} mice after 4 weeks of lipopolysaccharide (LPS), Toll-like receptor 4 ligand, administration. ApoE{sup -/-} mice showed splenomegaly and significantly increased serum level of IgG and titers of ANA and anti-dsDNA antibody as compared with B6 mice. Splenocyte apoptosis and the expression of TLR4, MyD88, pp38, IRF3 and Bax in spleen tissue were significantly lower in ApoE{sup -/-} than B6 mice. The expression of TLR4, MyD88, IRF3, pp38, and Bax differed by sex in ApoE{sup -/-} spleen tissue. The

  15. PACAP-deficient mice show attenuated corticosterone secretion and fail to develop depressive behavior during chronic social defeat stress.


    Lehmann, Michael L; Mustafa, Tomris; Eiden, Adrian M; Herkenham, Miles; Eiden, Lee E


    The neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) regulates activation of the hypothalamic-pituitary-adrenal (HPA) axis and the adrenal gland in response to various stressors. We previously found that in response to acute psychological stress (restraint), elevated corticotrophin-releasing hormone (CRH) mRNA levels in the hypothalamic paraventricular nucleus (PVN) as well as elevated plasma corticosterone (CORT) were profoundly attenuated in PACAP-deficient mice. To determine whether HPA axis responses and stress-induced depressive-like behaviors in a chronic stress paradigm are affected by PACAP deficiency, we subjected mice to 14 days of social defeat stress. Defeat-exposed PACAP-/- mice showed a marked attenuation of stress-induced increases in serum CORT levels, cellular PVN ΔFosB immunostaining, and depressive-like behaviors (social interaction and forced swim tests) compared to wild-type control mice. The PACAP-/- mice showed reduced PVN FosB-positive cell numbers, but relatively elevated cell counts in several forebrain areas including the medial prefrontal cortex, after social stress. PACAP appears to be specific for mediating HPA activation only in psychological stress because marked elevations in plasma CORT after a systemic stressor (lipopolysaccharide administration) occurred regardless of genotype. We conclude that chronically elevated CORT is a key component of depressive effects of social defeat, and that attenuation of the CORT response at the level of the PVN, as well as extrahypothalamic forebrain regions, in PACAP-deficient mice protects from development of depressive behavior.

  16. Mice lacking hypertension candidate gene ATP2B1 in vascular smooth muscle cells show significant blood pressure elevation.


    Kobayashi, Yusuke; Hirawa, Nobuhito; Tabara, Yasuharu; Muraoka, Hidenori; Fujita, Megumi; Miyazaki, Nobuko; Fujiwara, Akira; Ichikawa, Yasuhiro; Yamamoto, Yuichiro; Ichihara, Naoaki; Saka, Sanae; Wakui, Hiromichi; Yoshida, Shin-ichiro; Yatsu, Keisuke; Toya, Yoshiyuki; Yasuda, Gen; Kohara, Katsuhiko; Kita, Yoshikuni; Takei, Kohtaro; Goshima, Yoshio; Ishikawa, Yoshihiro; Ueshima, Hirotsugu; Miki, Tetsuro; Umemura, Satoshi


    We reported previously that ATP2B1 was one of the genes for hypertension receptivity in a large-scale Japanese population, which has been replicated recently in Europeans and Koreans. ATP2B1 encodes the plasma membrane calcium ATPase isoform 1, which plays a critical role in intracellular calcium homeostasis. In addition, it is suggested that ATP2B1 plays a major role in vascular smooth muscle contraction. Because the ATP2B1 knockout (KO) mouse is embryo-lethal, we generated mice with vascular smooth muscle cell-specific KO of ATP2B1 using the Cre-loxP system to clarify the relationship between ATP2B1 and hypertension. The KO mice expressed significantly lower levels of ATP2B1 mRNA and protein in the aorta compared with control mice. KO mice showed significantly higher systolic blood pressure as measured by tail-cuff method and radiotelemetric method. Similar to ATP2B1, the expression of the Na(+)-Ca(2+) exchanger isoform 1 mRNA was decreased in vascular smooth muscle cells of KO mice. However, ATP2B4 expression was increased in KO mice. The cultured vascular smooth muscle cells of KO mice showed increased intracellular calcium concentration not only in basal condition but also in phenylephrine-stimulated condition. Furthermore, phenylephrine-induced vasoconstriction was significantly increased in vascular rings of the femoral artery of KO mice. These results suggest that ATP2B1 plays important roles in the regulation of blood pressure through alteration of calcium handling and vasoconstriction in vascular smooth muscle cells.

  17. Female mice lacking Xist RNA show partial dosage compensation and survive to term

    PubMed Central

    Yang, Lin; Kirby, James E.; Sunwoo, Hongjae; Lee, Jeannie T.


    X-chromosome inactivation (XCI) compensates for differences in X-chromosome number between male and female mammals. XCI is orchestrated by Xist RNA, whose expression in early development leads to transcriptional silencing of one X chromosome in the female. Knockout studies have established a requirement for Xist with inviability of female embryos that inherit an Xist deletion from the father. Here, we report that female mice lacking Xist RNA can, surprisingly, develop and survive to term. Xist-null females are born at lower frequency and are smaller at birth, but organogenesis is mostly normal. Transcriptomic analysis indicates significant overexpression of hundreds of X-linked genes across multiple tissues. Therefore, Xist-null mice can develop to term in spite of a deficiency of dosage compensation. However, the degree of X-autosomal dosage imbalance was less than anticipated (1.14-fold to 1.36-fold). Thus, partial dosage compensation can be achieved without Xist, supporting the idea of inherent genome balance. Nevertheless, to date, none of the mutant mice has survived beyond weaning stage. Sudden death is associated with failure of postnatal organ maturation. Our data suggest Xist-independent mechanisms of dosage compensation and demonstrate that small deviations from X-autosomal balance can have profound effects on overall fitness. PMID:27542829

  18. Behavioral characterization of cereblon forebrain-specific conditional null mice: a model for human non-syndromic intellectual disability.


    Rajadhyaksha, Anjali M; Ra, Stephen; Kishinevsky, Sarah; Lee, Anni S; Romanienko, Peter; DuBoff, Mariel; Yang, Chingwen; Zupan, Bojana; Byrne, Maureen; Daruwalla, Zeeba R; Mark, Willie; Kosofsky, Barry E; Toth, Miklos; Higgins, Joseph J


    A nonsense mutation in the human cereblon gene (CRBN) causes a mild type of autosomal recessive non-syndromic intellectual disability (ID). Animal studies show that crbn is a cytosolic protein with abundant expression in the hippocampus (HPC) and neocortex (CTX). Its diverse functions include the developmental regulation of ion channels at the neuronal synapse, the mediation of developmental programs by ubiquitination, and a target for herpes simplex type I virus in HPC neurons. To test the hypothesis that anomalous CRBN expression leads to HPC-mediated memory and learning deficits, we generated germ-line crbn knock-out mice (crbn(-/-)). We also inactivated crbn in forebrain neurons in conditional knock-out mice in which crbn exons 3 and 4 are deleted by cre recombinase under the direction of the Ca(2+)/calmodulin-dependent protein kinase II alpha promoter (CamKII(cre/+), crbn(-/-)). crbn mRNA levels were negligible in the HPC, CTX, and cerebellum (CRBM) of the crbn(-/-) mice. In contrast, crbn mRNA levels were reduced 3- to 4-fold in the HPC, CTX but not in the CRBM in CamKII(cre/+), crbn(-/-) mice as compared to wild type (CamKII(cre/+), crbn(+/+)). Contextual fear conditioning showed a significant decrease in the percentage of freezing time in CamKII(cre/+), crbn(-/-) and crbn(-/-) mice while motor function, exploratory motivation, and anxiety-related behaviors were normal. These findings suggest that CamKII(cre/+), crbn(-/-) mice exhibit selective HPC-dependent deficits in associative learning and supports the use of these mice as in vivo models to study the functional consequences of CRBN aberrations on memory and learning in humans.

  19. IL1RAPL1 knockout mice show spine density decrease, learning deficiency, hyperactivity and reduced anxiety-like behaviours.


    Yasumura, Misato; Yoshida, Tomoyuki; Yamazaki, Maya; Abe, Manabu; Natsume, Rie; Kanno, Kouta; Uemura, Takeshi; Takao, Keizo; Sakimura, Kenji; Kikusui, Takefumi; Miyakawa, Tsuyoshi; Mishina, Masayoshi


    IL-1 receptor accessory protein-like 1 (IL1RAPL1) is responsible for nonsyndromic intellectual disability and is associated with autism. IL1RAPL1 mediates excitatory synapse formation through trans-synaptic interaction with PTPδ. Here, we showed that the spine density of cortical neurons was significantly reduced in IL1RAPL1 knockout mice. The spatial reference and working memories and remote fear memory were mildly impaired in IL1RAPL1 knockout mice. Furthermore, the behavioural flexibility was slightly reduced in the T-maze test. Interestingly, the performance of IL1RAPL1 knockout mice in the rotarod test was significantly better than that of wild-type mice. Moreover, IL1RAPL1 knockout mice consistently exhibited high locomotor activity in all the tasks examined. In addition, open-space and height anxiety-like behaviours were decreased in IL1RAPL1 knockout mice. These results suggest that IL1RAPL1 ablation resulted in spine density decrease and affected not only learning but also behavioural flexibility, locomotor activity and anxiety.

  20. IL1RAPL1 knockout mice show spine density decrease, learning deficiency, hyperactivity and reduced anxiety-like behaviours

    PubMed Central

    Yasumura, Misato; Yoshida, Tomoyuki; Yamazaki, Maya; Abe, Manabu; Natsume, Rie; Kanno, Kouta; Uemura, Takeshi; Takao, Keizo; Sakimura, Kenji; Kikusui, Takefumi; Miyakawa, Tsuyoshi; Mishina, Masayoshi


    IL-1 receptor accessory protein-like 1 (IL1RAPL1) is responsible for nonsyndromic intellectual disability and is associated with autism. IL1RAPL1 mediates excitatory synapse formation through trans-synaptic interaction with PTPδ. Here, we showed that the spine density of cortical neurons was significantly reduced in IL1RAPL1 knockout mice. The spatial reference and working memories and remote fear memory were mildly impaired in IL1RAPL1 knockout mice. Furthermore, the behavioural flexibility was slightly reduced in the T-maze test. Interestingly, the performance of IL1RAPL1 knockout mice in the rotarod test was significantly better than that of wild-type mice. Moreover, IL1RAPL1 knockout mice consistently exhibited high locomotor activity in all the tasks examined. In addition, open-space and height anxiety-like behaviours were decreased in IL1RAPL1 knockout mice. These results suggest that IL1RAPL1 ablation resulted in spine density decrease and affected not only learning but also behavioural flexibility, locomotor activity and anxiety. PMID:25312502

  1. Factor XIII-A transglutaminase deficient mice show signs of metabolically healthy obesity on high fat diet

    PubMed Central

    Myneni, Vamsee D.; Mousa, Aisha; Kaartinen, Mari T.


    F13A1 gene, which encodes for Factor XIII-A blood clotting factor and a transglutaminase enzyme, was recently identified as a potential causative gene for obesity in humans. In our previous in vitro work, we showed that FXIII-A regulates preadipocyte differentiation and modulates insulin signaling via promoting plasma fibronectin assembly into the extracellular matrix. To understand the role of FXIII-A in whole body energy metabolism, here we have characterized the metabolic phenotype of F13a1−/− mice. F13a1−/− and F13a1+/+ type mice were fed chow or obesogenic, high fat diet for 20 weeks. Weight gain, total fat mass and fat pad mass, glucose handling, insulin sensitivity, energy expenditure and, morphological and biochemical analysis of adipose tissue was performed. We show that mice lacking FXIII-A gain weight on obesogenic diet, similarly as wild type mice, but exhibit a number of features of metabolically healthy obesity such as protection from developing diet-induced insulin resistance and hyperinsulinemia. Mice also show normal fasting glucose levels, larger adipocytes, decreased extracellular matrix accumulation and inflammation of adipose tissue, as well as decreased circulating triglycerides. This study reveals that FXIII-A transglutaminase can regulate whole body insulin sensitivity and may have a role in the development of diet-induced metabolic disturbances. PMID:27759118

  2. Proteomic Analysis of Aortae from Human Lipoprotein(a) Transgenic Mice Shows an Early Metabolic Response Independent of Atherosclerosis

    PubMed Central

    Rodger, Euan J.; Suetani, Rachel J.; Jones, Gregory T.; Kleffmann, Torsten; Carne, Alan; Legge, Michael; McCormick, Sally P. A.


    Background Elevated low density lipoprotein (LDL) and lipoprotein(a) are independent risk factors for the development of atherosclerosis. Using a proteomic approach we aimed to determine early changes in arterial protein expression in transgenic mice containing both human LDL and lipoprotein(a) in circulation. Methods and Results Plasma lipid analyses showed the lipoprotein(a) transgenic mice had significantly higher lipid levels than wildtype, including a much increased LDL and high density lipoprotein (HDL) cholesterol. Analysis of aortae from lipoprotein(a) mice showed lipoprotein(a) accumulation but no lipid accumulation or foam cells, leaving the arteries essentially atherosclerosis free. Using two-dimensional gel electrophoresis and mass spectrometry, we identified 34 arterial proteins with significantly altered abundance (P<0.05) in lipoprotein(a) transgenic mice compared to wildtype including 17 that showed a ≥2 fold difference. Some proteins of interest showed a similarly altered abundance at the transcript level. These changes collectively indicated an initial metabolic response that included a down regulation in energy, redox and lipid metabolism proteins and changes in structural proteins at a stage when atherosclerosis had not yet developed. Conclusions Our study shows that human LDL and lipoprotein(a) promote changes in the expression of a unique set of arterial proteins which may be early indicators of the metabolic disturbances preceding atherosclerosis. PMID:22276189

  3. ASIC1a Deficient Mice Show Unaltered Neurodegeneration in the Subacute MPTP Model of Parkinson Disease

    PubMed Central

    Komnig, Daniel; Imgrund, Silke; Reich, Arno; Gründer, Stefan; Falkenburger, Björn H.


    Inflammation contributes to the death of dopaminergic neurons in Parkinson disease and can be accompanied by acidification of extracellular pH, which may activate acid-sensing ion channels (ASIC). Accordingly, amiloride, a non-selective inhibitor of ASIC, was protective in an acute 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson disease. To complement these findings we determined MPTP toxicity in mice deficient for ASIC1a, the most common ASIC isoform in neurons. MPTP was applied i.p. in doses of 30 mg per kg on five consecutive days. We determined the number of dopaminergic neurons in the substantia nigra, assayed by stereological counting 14 days after the last MPTP injection, the number of Nissl positive neurons in the substantia nigra, and the concentration of catecholamines in the striatum. There was no difference between ASIC1a-deficient mice and wildtype controls. We are therefore not able to confirm that ASIC1a are involved in MPTP toxicity. The difference might relate to the subacute MPTP model we used, which more closely resembles the pathogenesis of Parkinson disease, or to further targets of amiloride. PMID:27820820

  4. Central administration of obestatin fails to show inhibitory effects on food and water intake in mice.


    Van Dijck, Annemie; Annemie, Van Dijck; Van Dam, Debby; Debby, Van Dam; Vergote, Valentijn; Valentijn, Vergote; De Spiegeleer, Bart; Bart, De Spiegeleer; Luyten, Walter; Walter, Luyten; Schoofs, Liliane; Liliane, Schoofs; De Deyn, Peter Paul; Peter Paul, De Deyn


    Obestatin is a ghrelin-associated peptide hormone with presumed anorexigenic and inhibitory effect on gastric propulsive motility activity. Recent literature, however, discloses much contestation over satiety and gastrointestinal motility-related functionalities of obestatin. In addition, antidipsinogenic effects in rodents by obestatin were recently reported. The present study was set up to bring more clarity into the contested effects of obestatin on food and water intake. Additionally, the stability of obestatin in brain tissue homogenate was investigated. The in vitro incubation of obestatin in brain homogenates revealed disappearance half-life times of 19 min for crude brain homogenate to 27 min for brain membrane homogenate. For the behavioural studies, male C57Bl/6 mice were intracerebroventricularly treated with 0.2 nmol murine amidated obestatin or vehicle at the age of 3 months. An additional group of mice was treated with 0.3 nmol of corticotropin releasing factor (CRF) as a positive control of suppression of food intake. Food and water intake were studied over a period of 5 h in metabolic cages. Under our experimental conditions, no suppressive effects of obestatin on food or water intake were observed, whereas CRF evoked a significant suppression of food intake, which proves the internal validity of the study design.

  5. Habituation under stress: shocked mice show nonassociative learning in a T-maze.


    Mitchell, D; Osborne, E W; O'Boyle, M W


    Conflicting predictions of reinforcement and neophobia-arousal theories were evaluated in a simple choice task. Four groups of C57BL/6J mice were administered daily two-trial tests in a uniform T-maze for 10 consecutive days. For three groups, the contingencies of footshock treatments were manipulated to reinforce alternation, perseveration, or both. A control group that was not administered footshock alternated, but all three groups that were stressed perseverated more and more across tests, despite the differences in reinforcement contingencies. These results are inconsistent with the predictions of reinforcement theory but consistent with the view that stressed or aroused animals are neophobic and use nonassociative learning (habituation) to distinguish between novel and familiar alternatives.

  6. Nanoemulsified green tea extract shows improved hypocholesterolemic effects in C57BL/6 mice.


    Kim, Young Jun; Houng, Soung-Jin; Kim, Jae Hoon; Kim, Young-Rok; Ji, Hong Geun; Lee, Sung-Joon


    Nanoemulsification of nutrients could improve bioavailability by enhancing intestinal uptake. We investigated the antioxidant and hypolipidemic effects of nanoemulsified green tea extract (NGTE). Antioxidant effect was measured by 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) radical scavenging assay and dichlorofluorescein diacetate (DCFH-DA) assay. C57BL/6 mice were fed a control high-fat diet, green tea extract (GTE), or NGTE diet for 4 weeks. In composition analysis, GTE and NGTE contained similar total catechin concentrations. The antioxidative effect of GTE was comparable with that of NGTE. In the ABTS assay, GTE had a marked effect, although NGTE was more effective than GTE in the DCFH-DA assay. In the mouse feeding experiment, total and low-density lipoprotein (LDL) cholesterol concentrations were significantly reduced after NGTE treatment in comparison with GTE treatment in high-fat-fed C57BL/6J mice over the course of 4 weeks. The hypocholesterolemic effects were greater in the NGTE group compared with the GTE group (24% vs. 15.4% LDL cholesterol reduction compared with the control). Expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase was significantly down-regulated. Protein expression of LDL receptor was significantly increased in the livers of both the GTE- and NGTE-treated groups (+234.1%, P<.01 and +274.7%, P<.001), with a greater effect in the NGTE than in the GTE group. Cholesterol 7α-hydroxylase gene expression was similarly increased in both the GTE and NGTE groups. These results suggest that nanoemulsification significantly increased hypocholesterolemic effects of GTE in vivo due to increased bioavailability.

  7. MRL/MpJ mice show unique pathological features after experimental kidney injury.


    Shiozuru, Daichi; Ichii, Osamu; Kimura, Junpei; Nakamura, Teppei; Elewa, Yaser Hosny Ali; Otsuka-Kanazawa, Saori; Kon, Yasuhiro


    Clarification of the renal repair process is crucial for developing novel therapeutic strategies for kidney injury. MRL/MpJ mice have a unique repair process characterized by low scar formation. The pathological features of experimentally injured MRL/MpJ and C57BL/6 mouse kidneys were compared to examine the renal repair process. The dilation and atrophy of renal tubules were observed in folic acid (FA)-induced acute kidney injury (AKI) in both strains, and the histopathological injury scores and number of interleukin (IL)-1F6-positive damaged distal tubules and kidney injury molecule 1 (KIM-1)-positive damaged proximal tubules drastically increased 1 day after AKI induction. However, KIM-1-positive tubules and the elevation of serum renal function markers were significantly fewer and lower, respectively, in MRL/MpJ mice at days 2 and 7 after AKI. After traumatic kidney injury (TKI) via needle puncture, severe tubular necrotic lesions in the punctured area and fibrosis progressed in both strains. Indices for fibrosis such as aniline blue-positive area, number of alpha smooth muscle actin-positive myofibroblasts, and messenger RNA expression levels of Tgfb1 and Mmp2 indicated lower fibrotic activity in MRL/MpJ kidneys. Characteristically, only MRL/MpJ kidneys manifested remarkable calcification around the punctured area beginning 7 days after TKI. The pathological features of injured MRL/MpJ and C57BL/6 kidneys differed, especially those of kidneys with mild proximal tubular injuries after FA-induced AKI. Lower fibrotic activity and increased calcification after TKI were observed in MRL/MpJ kidneys. These findings clarified the unique pathological characteristics of MRL/MpJ mouse kidneys and contribute to understanding of the renal repair process after kidney injury.

  8. CD38 Knockout Mice Show Significant Protection Against Ischemic Brain Damage Despite High Level Poly-ADP-Ribosylation.


    Long, Aaron; Park, Ji H; Klimova, Nina; Fowler, Carol; Loane, David J; Kristian, Tibor


    Several enzymes in cellular bioenergetics metabolism require NAD(+) as an essential cofactor for their activity. NAD(+) depletion following ischemic insult can result in cell death and has been associated with over-activation of poly-ADP-ribose polymerase PARP1 as well as an increase in NAD(+) consuming enzyme CD38. CD38 is an NAD(+) glycohydrolase that plays an important role in inflammatory responses. To determine the contribution of CD38 activity to the mechanisms of post-ischemic brain damage we subjected CD38 knockout (CD38KO) mice and wild-type (WT) mice to transient forebrain ischemia. The CD38KO mice showed a significant amelioration in both histological and neurologic outcome following ischemic insult. Decrease of hippocampal NAD(+) levels detected during reperfusion in WT mice was only transient in CD38KO animals, suggesting that CD38 contributes to post-ischemic NAD(+) catabolism. Surprisingly, pre-ischemic poly-ADP-ribose (PAR) levels were dramatically higher in CD38KO animals compared to WT animals and exhibited reduction post-ischemia in contrast to the increased levels in WT animals. The high PAR levels in CD38 mice were due to reduced expression levels of poly-ADP-ribose glycohydrolase (PARG). Thus, the absence of CD38 activity can not only directly affect inflammatory response, but also result in unpredicted alterations in the expression levels of enzymes participating in NAD(+) metabolism. Although the CD38KO mice showed significant protection against ischemic brain injury, the changes in enzyme activity related to NAD(+) metabolism makes the determination of the role of CD38 in mechanisms of ischemic brain damage more complex.

  9. PACAP-deficient mice show attenuated corticosterone secretion and fail to develop depressive behavior during chronic social defeat stress

    PubMed Central

    Lehmann, Michael L.; Mustafa, Tomris; Eiden, Adrian M.; Herkenham, Miles; Eiden, Lee E.


    Summary The neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) regulates activation of the hypothalamic-pituitary-adrenal (HPA) axis and the adrenal gland in response to various stressors. We previously found that in response to acute psychological stress (restraint), elevated corticotrophin-releasing hormone (CRH) mRNA levels in the hypothalamic paraventricular nucleus (PVN) as well as elevated plasma corticosterone (CORT) were profoundly attenuated in PACAP-deficient mice. To determine whether HPA axis responses and stress-induced depressive-like behaviors in a chronic stress paradigm are affected by PACAP deficiency, we subjected mice to 14 days of social defeat stress. Defeat-exposed PACAP−/− mice showed a marked attenuation of stress-induced increases in serum CORT levels, cellular PVN ΔFosB immunostaining, and depressive-like behaviors (social interaction and forced swim tests) compared to wild-type control mice. The PACAP−/− mice showed reduced PVN FosB-positive cell numbers, but relatively elevated cell counts in several forebrain areas including the medial prefrontal cortex, after social stress. PACAP appears to be specific for mediating HPA activation only in psychological stress because marked elevations in plasma CORT after a systemic stressor (lipopolysaccharide administration) occurred regardless of genotype. We conclude that chronically elevated CORT is a key component of depressive effects of social defeat, and that attenuation of the CORT response at the level of the PVN, as well as extrahypothalamic forebrain regions, in PACAP-deficient mice protects from development of depressive behavior. PMID:23062748

  10. Absence of TI-VAMP/Vamp7 leads to increased anxiety in mice.


    Danglot, Lydia; Zylbersztejn, Kathleen; Petkovic, Maja; Gauberti, Maxime; Meziane, Hamid; Combe, Roy; Champy, Marie-France; Birling, Marie-Christine; Pavlovic, Guillaume; Bizot, Jean-Charles; Trovero, Fabrice; Della Ragione, Floriana; Proux-Gillardeaux, Véronique; Sorg, Tania; Vivien, Denis; D'Esposito, Maurizio; Galli, Thierry


    Vesicular (v)- and target (t)-SNARE proteins assemble in SNARE complex to mediate membrane fusion. Tetanus neurotoxin-insensitive vesicular-associated membrane protein (TI-VAMP/VAMP7), a vesicular SNARE expressed in several cell types including neurons, was previously shown to play a major role in exocytosis involved in neurite growth in cultured neurons. Here we generated a complete constitutive knock-out by deleting the exon 3 of Vamp7. Loss of TI-VAMP expression did not lead to any striking developmental or neurological defect. Knock-out mice displayed decreased brain weight and increased third ventricle volume. Axon growth appeared normal in cultured knock-out neurons. Behavioral characterization unraveled that TI-VAMP knock-out was associated with increased anxiety. Our results thus suggest compensatory mechanisms allowing the TI-VAMP knock-out mice to fulfill major developmental processes. The phenotypic traits unraveled here further indicate an unexpected role of TI-VAMP-mediated vesicular traffic in anxiety and suggest a role for TI-VAMP in higher brain functions.

  11. Otx1 null mutant mice show partial segregation of sensory epithelia comparable to lamprey ears

    NASA Technical Reports Server (NTRS)

    Fritzsch, B.; Signore, M.; Simeone, A.


    We investigated the development of inner ear innervation in Otx1 null mutants, which lack a horizontal canal, between embryonic day 12 (E12) and postnatal day 7 (P7) with DiI and immunostaining for acetylated tubulin. Comparable to control animals, horizontal crista-like fibers were found to cross over the utricle in Otx1 null mice. In mutants these fibers extend toward an area near the endolymphatic duct, not to a horizontal crista. Most Otx1 null mutants had a small patch of sensory hair cells at this position. Measurement of the area of the utricular macula suggested it to be enlarged in Otx1 null mutants. We suggest that parts of the horizontal canal crista remain incorporated in the utricular sensory epithelium in Otx1 null mutants. Other parts of the horizontal crista appear to be variably segregated to form the isolated patch of hair cells identifiable by the unique fiber trajectory as representing the horizontal canal crista. Comparison with lamprey ear innervation reveals similarities in the pattern of innervation with the dorsal macula, a sensory patch of unknown function. SEM data confirm that all foramina are less constricted in Otx1 null mutants. We propose that Otx1 is not directly involved in sensory hair cell formation of the horizontal canal but affects the segregation of the horizontal canal crista from the utricle. It also affects constriction of the two main foramina in the ear, but not their initial formation. Otx1 is thus causally related to horizontal canal morphogenesis as well as morphogenesis of these foramina.

  12. Mice doubly-deficient in lysosomal hexosaminidase A and neuraminidase 4 show epileptic crises and rapid neuronal loss.


    Seyrantepe, Volkan; Lema, Pablo; Caqueret, Aurore; Dridi, Larbi; Bel Hadj, Samar; Carpentier, Stephane; Boucher, Francine; Levade, Thierry; Carmant, Lionel; Gravel, Roy A; Hamel, Edith; Vachon, Pascal; Di Cristo, Graziella; Michaud, Jacques L; Morales, Carlos R; Pshezhetsky, Alexey V


    Tay-Sachs disease is a severe lysosomal disorder caused by mutations in the HexA gene coding for the α-subunit of lysosomal β-hexosaminidase A, which converts G(M2) to G(M3) ganglioside. Hexa(-/-) mice, depleted of β-hexosaminidase A, remain asymptomatic to 1 year of age, because they catabolise G(M2) ganglioside via a lysosomal sialidase into glycolipid G(A2), which is further processed by β-hexosaminidase B to lactosyl-ceramide, thereby bypassing the β-hexosaminidase A defect. Since this bypass is not effective in humans, infantile Tay-Sachs disease is fatal in the first years of life. Previously, we identified a novel ganglioside metabolizing sialidase, Neu4, abundantly expressed in mouse brain neurons. Now we demonstrate that mice with targeted disruption of both Neu4 and Hexa genes (Neu4(-/-);Hexa(-/-)) show epileptic seizures with 40% penetrance correlating with polyspike discharges on the cortical electrodes of the electroencephalogram. Single knockout Hexa(-/-) or Neu4(-/-) siblings do not show such symptoms. Further, double-knockout but not single-knockout mice have multiple degenerating neurons in the cortex and hippocampus and multiple layers of cortical neurons accumulating G(M2) ganglioside. Together, our data suggest that the Neu4 block exacerbates the disease in Hexa(-/-) mice, indicating that Neu4 is a modifier gene in the mouse model of Tay-Sachs disease, reducing the disease severity through the metabolic bypass. However, while disease severity in the double mutant is increased, it is not profound suggesting that Neu4 is not the only sialidase contributing to the metabolic bypass in Hexa(-/-) mice.

  13. Transgenic Mice with Increased Astrocyte Expression of IL-6 Show Altered Effects of Acute Ethanol on Synaptic Function

    PubMed Central

    Hernandez, Ruben V.; Puro, Alana C.; Manos, Jessica C.; Huitron-Resendiz, Salvador; Reyes, Kenneth C.; Liu, Kevin; Vo, Khanh; Roberts, Amanda J.; Gruol, Donna L.


    A growing body of evidence has revealed that resident cells of the central nervous system (CNS), and particularly the glial cells, comprise a neuroimmune system that serves a number of functions in the normal CNS and during adverse conditions. Cells of the neuroimmune system regulate CNS functions through the production of signaling factors, referred to as neuroimmune factors. Recent studies show that ethanol can activate cells of the neuroimmune system, resulting in the elevated production of neuroimmune factors, including the cytokine interleukin-6 (IL-6). Here we analyzed the consequences of this CNS action of ethanol using transgenic mice that express elevated levels of IL-6 through increased astrocyte expression (IL-6-tg) to model the increased IL-6 expression that occurs with ethanol use. Results show that increased IL-6 expression induces neuroadaptive changes that alter the effects of ethanol. In hippocampal slices from non-transgenic (non-tg) littermate control mice, synaptically evoked dendritic field excitatory postsynaptic potential (fEPSP) and somatic population spike (PS) at the Schaffer collateral to CA1 pyramidal neuron synapse were reduced by acute ethanol (20 or 60 mM). In contrast, acute ethanol enhanced the fEPSP and PS in hippocampal slices from IL-6 tg mice. Long-term synaptic plasticity of the fEPSP (i.e., LTP) showed the expected dose-dependent reduction by acute ethanol in non-tg hippocampal slices, whereas LTP in the IL-6 tg hippocampal slices was resistant to this depressive effect of acute ethanol. Consistent with altered effects of acute ethanol on synaptic function in the IL-6 tg mice, EEG recordings showed a higher level of CNS activity in the IL-6 tg mice than in the non-tg mice during the period of withdrawal from an acute high dose of ethanol. These results suggest a potential role for neuroadaptive effects of ethanol-induced astrocyte production of IL-6 as a mediator or modulator of the actions of ethanol on the CNS, including

  14. Transgenic mice with increased astrocyte expression of IL-6 show altered effects of acute ethanol on synaptic function.


    Hernandez, Ruben V; Puro, Alana C; Manos, Jessica C; Huitron-Resendiz, Salvador; Reyes, Kenneth C; Liu, Kevin; Vo, Khanh; Roberts, Amanda J; Gruol, Donna L


    A growing body of evidence has revealed that resident cells of the central nervous system (CNS), and particularly the glial cells, comprise a neuroimmune system that serves a number of functions in the normal CNS and during adverse conditions. Cells of the neuroimmune system regulate CNS functions through the production of signaling factors, referred to as neuroimmune factors. Recent studies show that ethanol can activate cells of the neuroimmune system, resulting in the elevated production of neuroimmune factors, including the cytokine interleukin-6 (IL-6). Here we analyzed the consequences of this CNS action of ethanol using transgenic mice that express elevated levels of IL-6 through increased astrocyte expression (IL-6-tg) to model the increased IL-6 expression that occurs with ethanol use. Results show that increased IL-6 expression induces neuroadaptive changes that alter the effects of ethanol. In hippocampal slices from non-transgenic (non-tg) littermate control mice, synaptically evoked dendritic field excitatory postsynaptic potential (fEPSP) and somatic population spike (PS) at the Schaffer collateral to CA1 pyramidal neuron synapse were reduced by acute ethanol (20 or 60 mM). In contrast, acute ethanol enhanced the fEPSP and PS in hippocampal slices from IL-6 tg mice. Long-term synaptic plasticity of the fEPSP (i.e., LTP) showed the expected dose-dependent reduction by acute ethanol in non-tg hippocampal slices, whereas LTP in the IL-6 tg hippocampal slices was resistant to this depressive effect of acute ethanol. Consistent with altered effects of acute ethanol on synaptic function in the IL-6 tg mice, EEG recordings showed a higher level of CNS activity in the IL-6 tg mice than in the non-tg mice during the period of withdrawal from an acute high dose of ethanol. These results suggest a potential role for neuroadaptive effects of ethanol-induced astrocyte production of IL-6 as a mediator or modulator of the actions of ethanol on the CNS, including

  15. Mice devoid of interferon regulatory factor 1 (IRF-1) show normal expression of type I interferon genes.

    PubMed Central

    Reis, L F; Ruffner, H; Stark, G; Aguet, M; Weissmann, C


    The transcription factor interferon regulatory factor 1 (IRF-1) binds tightly to the interferon (IFN)-beta promoter and has been implicated in the induction of type I IFNs. We generated mice devoid of functional IRF-1 by targeted gene disruption. As reported by others, IRF-1-deficient mice showed a discrete phenotype: the CD4/CD8 ratio was increased and IFN-gamma-induced levels of macrophage iNO synthase mRNA were strongly diminished. However, type I IFN induction in vivo by virus or double-stranded RNA was unimpaired, as evidenced by serum IFN titers and IFN mRNA levels in spleen, liver and lung. There was also no impairment in the response of type I IFN-inducible genes. Therefore, IRF-1 is not essential for these processes in vivo. Images PMID:7957048

  16. Chronic methadone treatment shows a better cost/benefit ratio than chronic morphine in mice.


    Enquist, Johan; Ferwerda, Madeline; Milan-Lobo, Laura; Whistler, Jennifer L


    Chronic treatment of pain with opiate drugs can lead to analgesic tolerance and drug dependence. Although all opiate drugs can promote tolerance and dependence in practice, the severity of those unwanted side effects differs depending on the drug used. Although each opiate drug has its own unique set of pharmacological profiles, methadone is the only clinically used opioid drug that produces substantial receptor endocytosis at analgesic doses. Here, we examined whether moderate doses of methadone carry any benefits over chronic use of equianalgesic morphine, the prototypical opioid. Our data show that chronic administration of methadone produces significantly less analgesic tolerance than morphine. Furthermore, we found significantly reduced precipitated withdrawal symptoms after chronic methadone treatment than after chronic morphine treatment. Finally, using a novel animal model with a degrading μ-opioid receptor we showed that, although endocytosis seems to protect against tolerance development, endocytosis followed by receptor degradation produces a rapid onset of analgesic tolerance to methadone. Together, these data indicated that opioid drugs that promote receptor endocytosis and recycling, such as methadone, may be a better choice for chronic pain treatment than morphine and its derivatives that do not.

  17. The delta 6 desaturase knock out mouse reveals that immunomodulatory effects of essential n-6 and n-3 polyunsaturated fatty acids are both independent of and dependent upon conversion.


    Monk, Jennifer M; Liddle, Danyelle M; Cohen, Daniel J A; Tsang, Denis H; Hillyer, Lyn M; Abdelmagid, Salma A; Nakamura, Manabu T; Power, Krista A; Ma, David W L; Robinson, Lindsay E


    Typically fatty acids (FA) exert differential immunomodulatory effects with n-3 [α-linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)] and n-6 [linoleic acid (LA) and arachidonic acid (AA)] exerting anti- and pro-inflammatory effects, respectively. This over-simplified interpretation is confounded by a failure to account for conversion of the parent FA (LA and ALA) to longer-chain bioactive products (AA and EPA/DHA, respectively), thereby precluding discernment of the immunomodulatory potential of specific FA. Therefore, we utilized the Δ6-desaturase model, wherein knockout mice (D6KO) lack the Fads2 gene encoding for the rate-limiting enzyme that initiates FA metabolism, thereby providing a model to determine specific FA immunomodulatory effects. Wild-type (WT) and D6KO mice were fed one of four isocaloric diets differing in FA source (9weeks): corn oil (LA-enriched), arachidonic acid single cell oil (AA-enriched), flaxseed oil (ALA-enriched) or menhaden fish oil (EPA/DHA-enriched). Splenic mononuclear cell cytokine production in response to lipopolysaccharide (LPS), T-cell receptor (TCR) and anti-CD40 stimulation was determined. Following LPS stimulation, AA was more bioactive compared to LA, by increasing inflammatory cytokine production of IL-6 (1.2-fold) and TNFα (1.3-fold). Further, LPS-stimulated IFNγ production in LA-fed D6KO mice was reduced 5-fold compared to LA-fed WT mice, indicating that conversion of LA to AA was necessary for cytokine production. Conversely, ALA exerted an independent immunomodulatory effect from EPA/DHA and all n-3 FA increased LPS-stimulated IL-10 production versus LA and AA. These data definitively identify specific immunomodulatory effects of individual FA and challenge the simplified view of the immunomodulatory effects of n-3 and n-6 FA.

  18. Heterozygous caveolin-3 mice show increased susceptibility to palmitate-induced insulin resistance.


    Talukder, M A Hassan; Preda, Marilena; Ryzhova, Larisa; Prudovsky, Igor; Pinz, Ilka M


    Insulin resistance and diabetes are comorbidities of obesity and affect one in 10 adults in the United States. Despite the high prevalence, the mechanisms of cardiac insulin resistance in obesity are still unclear. We test the hypothesis that the insulin receptor localizes to caveolae and is regulated through binding to caveolin-3 (CAV3). We further test whether haploinsufficiency forCAV3 increases the susceptibility to high-fat-induced insulin resistance. We used in vivo and in vitro studies to determine the effect of palmitate exposure on global insulin resistance, contractile performance of the heart in vivo, glucose uptake in the heart, and on cellular signaling downstream of theIR We show that haploinsufficiency forCAV3 increases susceptibility to palmitate-induced global insulin resistance and causes cardiomyopathy. On the basis of fluorescence energy transfer (FRET) experiments, we show thatCAV3 andIRdirectly interact in cardiomyocytes. Palmitate impairs insulin signaling by a decrease in insulin-stimulated phosphorylation of Akt that corresponds to an 87% decrease in insulin-stimulated glucose uptake inHL-1 cardiomyocytes. Despite loss of Akt phosphorylation and lower glucose uptake, palmitate increased insulin-independent serine phosphorylation ofIRS-1 by 35%. In addition, we found lipid induced downregulation ofCD36, the fatty acid transporter associated with caveolae. This may explain the problem the diabetic heart is facing with the simultaneous impairment of glucose uptake and lipid transport. Thus, these findings suggest that loss ofCAV3 interferes with downstream insulin signaling and lipid uptake, implicatingCAV3 as a regulator of theIRand regulator of lipid uptake in the heart.

  19. Plgf-/-eNos-/- mice show defective angiogenesis associated with increased oxidative stress in response to tissue ischemia.


    Gigante, Bruna; Morlino, Giulia; Gentile, Maria Teresa; Persico, Maria Graziella; De Falco, Sandro


    Neo-angiogenesis is a complex phenomenon modulated by the concerted action of several molecular factors. We have generated a congenic line of knockout mice carrying null mutations of both placental growth factor (PlGF) and endothelial nitric oxide synthase (eNOS), two genes that play a pivotal role in the regulation of pathological angiogenesis. In the present study, we describe the phenotype of this new experimental animal model after surgically induced hind-limb ischemia. Plgf-/-, eNos-/-, Plgf-/- eNos-/-, and wild-type C57BL/6J mice were studied. Plgf-/- eNos-/- mice showed the most severe phenotype: self-amputation, and death occurred in up to 47% of the animals studied; in ischemic legs, capillary density was severely reduced; macrophage infiltration and oxidative stress increased as compared to the other groups of animals. These changes were associated with an up-regulation of both inducible NOS (iNOS) expression and vascular endothelial growth factor (VEGF) protein levels in ischemic limbs, and to an increased extent of protein nitration. Our results demonstrate that the deletion of these two genes, Plgf, which acts in synergism with VEGF, and eNos, a downstream mediator of VEGF, determines a significant change in the vascular response to an ischemic stimulus and that oxidative stress within the ischemic tissue represents a crucial factor to maintain tissue homeostasis.

  20. The APOE4 allele shows opposite sex bias in microbleeds and Alzheimer’s Disease of humans and mice

    PubMed Central

    Cacciottolo, Mafalda; Christensen, Amy; Moser, Alexandra; Liu, Jiahui; Pike, Christian J.; Sullivan, Patrick M.; Morgan, Todd E.; Dolzhenko, Egor; Charidimou, Andreas; Wahlund, Lars-Olaf; Wiberg, Maria Kristofferson; Shams, Sara; Chiang, Gloria Chia-Yi; Finch, Caleb E.


    The APOE4 allele confers greater risk of Alzheimer’s Disease (AD) for women than men, in conjunction with greater clinical deficits per unit of AD neuropathology (plaques, tangles). Cerebral microbleeds, which contribute to cognitive dysfunctions during AD, also show APOE4 excess, but sex-APOE allele interactions are not described. We report that elderly men diagnosed for mild cognitive impairment (MCI) and AD showed a higher risk of cerebral cortex microbleeds with APOE4 allele dose effect in two clinical cohorts (ADNI and KIDS). Sex-APOE interactions were further analyzed in EFAD mice carrying human APOE alleles and familial AD genes. At 7 months, E4FAD mice had cerebral cortex microbleeds with female excess, in contrast to humans. Cerebral amyloid angiopathy (CAA), plaques, and soluble Aβ also showed female excess. Both the cerebral microbleeds and CAA increased in proportion to individual Aβ load. In humans, the opposite sex bias of APOE4 allele for microbleeds vs the plaques and tangles is the first example of organ-specific, sex-linked APOE allele effects, and further shows AD as a uniquely human condition. PMID:26686669

  1. A novel BET bromodomain inhibitor, RVX-208, shows reduction of atherosclerosis in hyperlipidemic ApoE deficient mice.


    Jahagirdar, Ravi; Zhang, Haiyan; Azhar, Salman; Tobin, Jennifer; Attwell, Sarah; Yu, Raymond; Wu, Jin; McLure, Kevin G; Hansen, Henrik C; Wagner, Gregory S; Young, Peter R; Srivastava, Rai Ajit K; Wong, Norman C W; Johansson, Jan


    Despite the benefit of statins in reducing cardiovascular risk, a sizable proportion of patients still remain at risk. Since HDL reduces CVD risk through a process that involves formation of pre-beta particles that facilitates the removal of cholesterol from the lipid-laden macrophages in the arteries, inducing pre-beta particles, may reduce the risk of CVD. A novel BET bromodomain antagonist, RVX-208, was reported to raise apoA-I and increase preβ-HDL particles in non-human primates and humans. In the present study, we investigated the effect of RVX-208 on aortic lesion formation in hyperlipidemic apoE(-/-) mice. Oral treatments of apoE(-/-) mice with 150 mg/kg b.i.d RVX-208 for 12 weeks significantly reduced aortic lesion formation, accompanied by 2-fold increases in the levels of circulating HDL-C, and ∼50% decreases in LDL-C, although no significant changes in plasma apoA-I were observed. Circulating adhesion molecules as well as cytokines also showed significant reduction. Haptoglobin, a proinflammatory protein, known to bind with HDL/apoA-I, decreased >2.5-fold in the RVX-208 treated group. With a therapeutic dosing regimen in which mice were fed Western diet for 10 weeks to develop lesions followed by switching to a low fat diet and concurrent treatment with RVX-208 for 14 weeks, RVX-208 similarly reduced lesion formation by 39% in the whole aorta without significant changes in the plasma lipid parameters. RVX-208 significantly reduced the proinflammatory cytokines IP-10, MIP1(®) and MDC. These results show that the antiatherogenic activity of BET inhibitor, RVX-208, occurs via a combination of lipid changes and anti-inflammatory activities.

  2. Dynamic studies of positron-emitting putative tumor marker /sup 132/Cs in mice show differential tumor and regional uptake

    SciTech Connect

    McKee, J.S.; Durocher, J.J.; Bose, R.; Gusdal, M.I.; Sharma, G.P.; Pinsky, C.; Gallop, D.


    Positron-emitting /sup 132/Cs (t1/2 = 6.47 days) was generated from stable /sup 133/CsCl via the /sup 133/Cs (p,pn) /sup 132/Cs reaction. BALB/c mice, bearing implanted MT296 mammary tumors, were given 4.6 mEq kg-1 of /sup 132/CsCl via a single intraperitoneal injection. Postinjection uptake of /sup 132/Cs into body regions was monitored in vivo with external detectors. Positron emission from the tumor region was continuously greater than that from the head, the numerical ratio of mean emission intensities being fourfold at 10 min postinjection. Tissues excised from these mice postmortem showed sequence of relative tissue cesium uptake rates to be kidney 1.8, small intestine 1.7, tumor 1.0, skin 0.75, liver 0.75, skeletal muscle 0.4, and brain 0.28. Comparative studies with multiple injections of stable cesium and rubidium showed this sequence to be ion-specific. These observations suggest that positron-emitting isotopes of cesium could provide useful markers for tumors of several tissues.

  3. HIV-1 Nef mutations abrogating downregulation of CD4 affect other Nef functions and show reduced pathogenicity in transgenic mice

    SciTech Connect

    Hanna, Zaher . E-mail:; Priceputu, Elena; Hu, Chunyan; Vincent, Patrick; Jolicoeur, Paul


    HIV-1 Nef has the ability to downmodulate CD4 cell surface expression. Several studies have shown that CD4 downregulation is required for efficient virus replication and high infectivity. However, the pathophysiological relevance of this phenomenon in vivo, independently of its role in sustaining high virus loads, remains unclear. We studied the impact of the CD4 downregulation function of Nef on its pathogenesis in vivo, in the absence of viral replication, in the CD4C/HIV transgenic (Tg) mouse model. Two independent Nef mutants (RD35/36AA and D174K), known to abrogate CD4 downregulation, were tested in Tg mice. Flow cytometry analysis showed that downregulation of murine CD4 was severely decreased or abrogated on Tg T cells expressing respectively Nef{sup RD35/36AA} and Nef{sup D174K}. Similarly, the severe depletion of double-positive CD4{sup +}CD8{sup +} and of single-positive CD4{sup +}CD8{sup -} thymocytes, usually observed with Nef{sup Wt}, was not detected in Nef{sup RD35/36AA} and Nef{sup D174K} Tg mice. However, both mutant Tg mice showed a partial depletion of peripheral CD4{sup +} T cells. This was accompanied, as previously reported for Net{sup Wt} Tg mice, by the presence of an activated/memory-like phenotype (CD69{sup +}, CD25{sup +}, CD44{sup +}, CD45RB{sup Low}, CD62{sup Low}) of CD4{sup +} T cells expressing Nef{sup RD35/36AA} and to a lesser extent Nef{sup D174K}. In addition, both mutants retained the ability to block CD4{sup +} T cell proliferation in vitro after anti-CD3 stimulation, but not to enhance apoptosis/death of CD4{sup +} T cells. Therefore, it appears that Nef-mediated CD4 downregulation is associated with thymic defects, but segregates independently of the activated/memory-like phenotype, of the partial depletion and of the impaired in vitro proliferation of peripheral CD4{sup +} T cells. Histopathological assessment revealed the total absence of or decrease severity and frequency of organ AIDS-like diseases (lung, heart and kidney

  4. HIV-1 Nef mutations abrogating downregulation of CD4 affect other Nef functions and show reduced pathogenicity in transgenic mice.


    Hanna, Zaher; Priceputu, Elena; Hu, Chunyan; Vincent, Patrick; Jolicoeur, Paul


    HIV-1 Nef has the ability to downmodulate CD4 cell surface expression. Several studies have shown that CD4 downregulation is required for efficient virus replication and high infectivity. However, the pathophysiological relevance of this phenomenon in vivo, independently of its role in sustaining high virus loads, remains unclear. We studied the impact of the CD4 downregulation function of Nef on its pathogenesis in vivo, in the absence of viral replication, in the CD4C/HIV transgenic (Tg) mouse model. Two independent Nef mutants (RD35/36AA and D174K), known to abrogate CD4 downregulation, were tested in Tg mice. Flow cytometry analysis showed that downregulation of murine CD4 was severely decreased or abrogated on Tg T cells expressing respectively Nef(RD35/36AA) and Nef(D174K). Similarly, the severe depletion of double-positive CD4+CD8+ and of single-positive CD4+CD8- thymocytes, usually observed with Nef(Wt), was not detected in Nef(RD35/36AA) and Nef(D174K) Tg mice. However, both mutant Tg mice showed a partial depletion of peripheral CD4+ T cells. This was accompanied, as previously reported for Net(Wt) Tg mice, by the presence of an activated/memory-like phenotype (CD69+, CD25+, CD44+, CD45RB(Low), CD62(Low)) of CD4+ T cells expressing Nef(RD35/36AA) and to a lesser extent Nef(D174K). In addition, both mutants retained the ability to block CD4+ T cell proliferation in vitro after anti-CD3 stimulation, but not to enhance apoptosis/death of CD4+ T cells. Therefore, it appears that Nef-mediated CD4 downregulation is associated with thymic defects, but segregates independently of the activated/memory-like phenotype, of the partial depletion and of the impaired in vitro proliferation of peripheral CD4+ T cells. Histopathological assessment revealed the total absence of or decrease severity and frequency of organ AIDS-like diseases (lung, heart and kidney pathologies) in respectively Nef(RD35/36AA) and Nef(D174K) Tg mice, relative to those developing in Nef(Wt) Tg

  5. Genetic Evidence That Captured Retroviral Envelope syncytins Contribute to Myoblast Fusion and Muscle Sexual Dimorphism in Mice

    PubMed Central

    Vernochet, Cécile; Mariot, Virginie; Gache, Vincent; Charrin, Stéphanie; Tiret, Laurent; Dumonceaux, Julie; Dupressoir, Anne; Heidmann, Thierry


    Syncytins are envelope genes from endogenous retroviruses, “captured” for a role in placentation. They mediate cell-cell fusion, resulting in the formation of a syncytium (the syncytiotrophoblast) at the fetomaternal interface. These genes have been found in all placental mammals in which they have been searched for. Cell-cell fusion is also pivotal for muscle fiber formation and repair, where the myotubes are formed from the fusion of mononucleated myoblasts into large multinucleated structures. Here we show, taking advantage of mice knocked out for syncytins, that these captured genes contribute to myoblast fusion, with a >20% reduction in muscle mass, mean muscle fiber area and number of nuclei per fiber in knocked out mice for one of the two murine syncytin genes. Remarkably, this reduction is only observed in males, which subsequently show muscle quantitative traits more similar to those of females. In addition, we show that syncytins also contribute to muscle repair after cardiotoxin-induced injury, with again a male-specific effect on the rate and extent of regeneration. Finally, ex vivo experiments carried out on murine myoblasts demonstrate the direct involvement of syncytins in fusion, with a >40% reduction in fusion index upon addition of siRNA against both syncytins. Importantly, similar effects are observed with primary myoblasts from sheep, dog and human, with a 20–40% reduction upon addition of siRNA against the corresponding syncytins. Altogether, these results show a direct contribution of the fusogenic syncytins to myogenesis, with a demonstrated male-dependence of the effect in mice, suggesting that these captured genes could be responsible for the muscle sexual dimorphism observed in placental mammals. PMID:27589388

  6. MUCI Facilitation of Growth in Chemically Induced Mammary Gland Tumors in Muc-1 Mutant and MUCI Transgenic Mice.

    DTIC Science & Technology


    Mice PRINCIPAL INVESTIGATOR: Russell J. Vanderboom, Ph.D. CONTRACTING ORGANIZATION: Mayo Foundation Rochester, Minnesota 55905 REPORT DATE: August 1998...mucin Mucl on tumor growth in the mammary glands of mice, a chemical carcinogenic combination of medroxyprogesteone acetate (MPA) and nitroso...methylurea was administered to wildtype C57BL/6 mice and mutant knock-out C57BL/6 mice unable to express Mucl . One week after implantation of time release MPA

  7. Atf3 mutant mice show reduced axon regeneration and impaired regeneration-associated gene induction after peripheral nerve injury

    PubMed Central

    Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T.; Sinske, Daniela


    Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce ‘effector’ RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653

  8. Development of a murine model for aerosolized ebolavirus infection using a panel of recombinant inbred mice.


    Zumbrun, Elizabeth E; Abdeltawab, Nourtan F; Bloomfield, Holly A; Chance, Taylor B; Nichols, Donald K; Harrison, Paige E; Kotb, Malak; Nalca, Aysegul


    Countering aerosolized filovirus infection is a major priority of biodefense research. Aerosol models of filovirus infection have been developed in knock-out mice, guinea pigs and non-human primates; however, filovirus infection of immunocompetent mice by the aerosol route has not been reported. A murine model of aerosolized filovirus infection in mice should be useful for screening vaccine candidates and therapies. In this study, various strains of wild-type and immunocompromised mice were exposed to aerosolized wild-type (WT) or mouse-adapted (MA) Ebola virus (EBOV). Upon exposure to aerosolized WT-EBOV, BALB/c, C57BL/6 (B6), and DBA/2 (D2) mice were unaffected, but 100% of severe combined immunodeficiency (SCID) and 90% of signal transducers and activators of transcription (Stat1) knock-out (KO) mice became moribund between 7-9 days post-exposure (dpe). Exposure to MA-EBOV caused 15% body weight loss in BALB/c, but all mice recovered. In contrast, 10-30% lethality was observed in B6 and D2 mice exposed to aerosolized MA-EBOV, and 100% of SCID, Stat1KO, interferon (IFN)-γ KO and Perforin KO mice became moribund between 7-14 dpe. In order to identify wild-type, inbred, mouse strains in which exposure to aerosolized MA-EBOV is uniformly lethal, 60 BXD (C57BL/6 crossed with DBA2) recombinant inbred (RI) and advanced RI (ARI) mouse strains were exposed to aerosolized MA-EBOV, and monitored for disease severity. A complete spectrum of disease severity was observed. All BXD strains lost weight but many recovered. However, infection was uniformly lethal within 7 to 12 days post-exposure in five BXD strains. Aerosol exposure of these five BXD strains to 10-fold less MA-EBOV resulted in lethality ranging from 0% in two strains to 90-100% lethality in two strains. Analysis of post-mortem tissue from BXD strains that became moribund and were euthanized at the lower dose of MA-EBOV, showed liver damage in all mice as well as lung lesions in two of the three strains. The two

  9. Mice overexpressing 70-kDa heat shock protein show increased resistance to malonate and 3-nitropropionic acid.


    Dedeoglu, Alpaslan; Ferrante, Robert J; Andreassen, Ole A; Dillmann, Wolfgang H; Beal, M Flint


    Heat shock proteins (HSPs) are induced in response to oxidative stress, hypoxia-ischemia, and neuronal injury and play a protective role. Malonate and 3-nitropropionic acid (3-NP) are well-characterized animal models of Huntington's Disease (HD). They inhibit succinate dehydrogenase, inducing mitochondrial dysfunction, which triggers the generation of superoxide radicals, secondary excitotoxicity, and apoptosis. In this study, we examined whether the 70-kDa heat shock protein (HSP-70) is protective against neurotoxicity induced by malonate and 3-NP. Homozygous and heterozygous HSP-70 overexpressing mice (HSP-70+/+, HSP-70+/-) and wild-type controls received 3-NP or malonate and striatal lesion sizes were evaluated by stereology. Compared to HSP-70+/+ and HSP-70+/-, wild-type controls showed significantly larger striatal lesions following 3-NP or malonate injections. These findings support the idea that HSP-70 has a neuroprotective role that may be useful in the treatment of neurodegenerative diseases.

  10. Deep phosphorus fertiliser placement and reduced irrigation methods for rice (Oryza sativa L.) combine to knock-out competition from its nemesis, barnyard grass (Echinochloa crus-galli (L.) P.Beauv)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Productivity of rice is increasingly being constrained by limitations in the quantity, quality, and cost of water and nutrients, and competition from weeds. This is a ‘commentary’ on the recent work of Weerarathne et al. (2015). They reported new discoveries from greenhouse experiments that showed...

  11. Knock-out of metacaspase and/or cytochrome c results in the activation of a ROS-independent acetic acid-induced programmed cell death pathway in yeast.


    Guaragnella, Nicoletta; Passarella, Salvatore; Marra, Ersilia; Giannattasio, Sergio


    To gain further insight into yeast acetic acid-induced programmed cell death (AA-PCD) we analyzed the effects of the antioxidant N-acetyl-L-cysteine (NAC) on cell viability, hydrogen peroxide (H(2)O(2)) production, DNA fragmentation, cytochrome c (cyt c) release and caspase-like activation in wild type (wt) and metacaspase and/or cyt c-lacking cells. We found that NAC prevents AA-PCD in wt cells, by scavenging H(2)O(2) and by inhibiting both cyt c release and caspase-like activation. This shows the occurrence of a reactive oxygen species (ROS)-dependent AA-PCD. Contrarily no NAC dependent change in AA-PCD of mutant cells was detectable, showing that a ROS-independent AA-PCD can also occur.

  12. Plasma cholesterol-lowering and transient liver dysfunction in mice lacking squalene synthase in the liver.


    Nagashima, Shuichi; Yagyu, Hiroaki; Tozawa, Ryuichi; Tazoe, Fumiko; Takahashi, Manabu; Kitamine, Tetsuya; Yamamuro, Daisuke; Sakai, Kent; Sekiya, Motohiro; Okazaki, Hiroaki; Osuga, Jun-ichi; Honda, Akira; Ishibashi, Shun


    Squalene synthase (SS) catalyzes the biosynthesis of squalene, the first specific intermediate in the cholesterol biosynthetic pathway. To test the feasibility of lowering plasma cholesterol by inhibiting hepatic SS, we generated mice in which SS is specifically knocked out in the liver (L-SSKO) using Cre-loxP technology. Hepatic SS activity of L-SSKO mice was reduced by >90%. In addition, cholesterol biosynthesis in the liver slices was almost eliminated. Although the hepatic squalene contents were markedly reduced in L-SSKO mice, the hepatic contents of cholesterol and its precursors distal to squalene were indistinguishable from those of control mice, indicating the presence of sufficient centripetal flow of cholesterol and/or its precursors from the extrahepatic tissues. L-SSKO mice showed a transient liver dysfunction with moderate hepatomegaly presumably secondary to increased farnesol production. In a fed state, the plasma total cholesterol and triglyceride were significantly reduced in L-SSKO mice, primarily owing to reduced hepatic VLDL secretion. In a fasted state, the hypolipidemic effect was lost. mRNA expression of liver X receptor α target genes was reduced, while that of sterol-regulatory element binding protein 2 target genes was increased. In conclusion, liver-specific ablation of SS inhibits hepatic cholesterol biosynthesis and induces hypolipidemia without increasing significant mortality.

  13. Somatostatin receptor subtypes 2 and 4 affect seizure susceptibility and hippocampal excitatory neurotransmission in mice.


    Moneta, D; Richichi, C; Aliprandi, M; Dournaud, P; Dutar, P; Billard, J M; Carlo, A S; Viollet, C; Hannon, J P; Fehlmann, D; Nunn, C; Hoyer, D; Epelbaum, J; Vezzani, A


    We have investigated the role of somatostatin receptor subtypes sst2 and sst4 in limbic seizures and glutamate-mediated neurotransmission in mouse hippocampus. As compared to wild-type littermates, homozygous mice lacking sst2 receptors showed a 52% reduction in EEG ictal activity induced by intrahippocampal injection of 30 ng kainic acid (P < 0.05). The number of behavioural tonic-clonic seizures was reduced by 50% (P < 0.01) and the time to onset of seizures was doubled on average (P < 0.05). Seizure-associated neurodegeneration was found in the injected hippocampus (CA1, CA3 and hilar interneurons) and sporadically in the ipsilateral latero-dorsal thalamus. This occurred to a similar extent in wild-type and sst2 knock-out mice. Intrahippocampal injection of three selective sst2 receptor agonists in wild-type mice (Octreotide, BIM 23120 and L-779976, 1.5-6.0 nmol) did not affect kainate seizures while the same compounds significantly reduced seizures in rats. L-803087 (5 nmol), a selective sst4 receptor agonist, doubled seizure activity in wild-type mice on average. Interestingly, this effect was blocked by 3 nmol octreotide. It was determined, in both radioligand binding and cAMP accumulation, that octreotide had no direct agonist or antagonist action at mouse sst4 receptors expressed in CCl39 cells, up to micromolar concentrations. In hippocampal slices from wild-type mice, octreotide (2 micro m) did not modify AMPA-mediated synaptic responses while facilitation occurred with L-803087 (2 micro m). Similarly to what was observed in seizures, the effect of L-803087 was reduced by octreotide. In hippocampal slices from sst2 knock-out mice, both octreotide and L-803087 were ineffective on synaptic responses. Our findings show that, unlike in rats, sst2 receptors in mice do not mediate anticonvulsant effects. Moreover, stimulation of sst4 receptors in the hippocampus of wild-type mice induced excitatory effects which appeared to depend on the presence of sst2

  14. Severe SMA mice show organ impairment that cannot be rescued by therapy with the HDACi JNJ-26481585.


    Schreml, Julia; Riessland, Markus; Paterno, Mario; Garbes, Lutz; Roßbach, Kristina; Ackermann, Bastian; Krämer, Jan; Somers, Eilidh; Parson, Simon H; Heller, Raoul; Berkessel, Albrecht; Sterner-Kock, Anja; Wirth, Brunhilde


    Spinal muscular atrophy (SMA) is the leading genetic cause of early childhood death worldwide and no therapy is available today. Many drugs, especially histone deacetylase inhibitors (HDACi), increase SMN levels. As all HDACi tested so far only mildly ameliorate the SMA phenotype or are unsuitable for use in humans, there is still need to identify more potent drugs. Here, we assessed the therapeutic power of the pan-HDACi JNJ-26481585 for SMA, which is currently used in various clinical cancer trials. When administered for 64 h at 100 nM, JNJ-26481585 upregulated SMN levels in SMA fibroblast cell lines, including those from non-responders to valproic acid. Oral treatment of Taiwanese SMA mice and control littermates starting at P0 showed no overt extension of lifespan, despite mild improvements in motor abilities and weight progression. Many treated and untreated animals showed a very rapid decline or unexpected sudden death. We performed exploratory autopsy and histological assessment at different disease stages and found consistent abnormalities in the intestine, heart and lung and skeletal muscle vasculature of SMA animals, which were not prevented by JNJ-26481585 treatment. Interestingly, some of these features may be only indirectly caused by α-motoneuron function loss but may be major life-limiting factors in the course of disease. A better understanding of - primary or secondary - non-neuromuscular organ involvement in SMA patients may improve standard of care and may lead to reassessment of how to investigate SMA patients clinically.

  15. Abnormal Mammary Adipose Tissue Environment of Brca1 Mutant Mice Show a Persistent Deposition of Highly Vascularized Multilocular Adipocytes.


    Jones, Laundette P; Buelto, Destiney; Tago, Elaine; Owusu-Boaitey, Kwadwo E


    A major challenge to breast cancer research is the identification of alterations in the architecture and composition of the breast that are associated with breast cancer progression. The aim of the present investigation was to characterize the mammary adipose phenotype from Brca1 mutant mice in the expectation that this would shed light on the role of the mammary tissue environment in the early stages of breast tumorigenesis. We observed that histological sections of mammary tissue from adult Brca1 mutant mice abnormally display small, multilocular adipocytes that are reminiscent of brown adipose tissue (BAT) as compared to wildtype mice. Using a marker for BAT, the uncoupling protein 1 (UCP1), we demonstrated that these multilocular adipose regions in Brca1 mutant mice stain positive for UCP1. Transcriptionally, UCP1 mRNA levels in the Brca1 mutant mice were elevated greater than 50-fold compared to age-matched mammary glands from wildtype mice. Indeed, BAT has characteristics that are favorable for tumor growth, including high vascularity. Therefore, we also demonstrated that the multilocular brown adipose phenotype in the mammary fat pad of Brca1 mutant mice displayed regions of increased vascularity as evidenced by a significant increase in the protein expression of CD31, a marker for angiogenesis. This Brca1 mutant mouse model should provide a physiologically relevant context to determine whether brown adipose tissue can play a role in breast cancer development.

  16. T cells from baxalpha transgenic mice show accelerated apoptosis in response to stimuli but do not show restored DNA damage-induced cell death in the absence of p53.

    PubMed Central

    Brady, H J; Salomons, G S; Bobeldijk, R C; Berns, A J


    Baxalpha was isolated due to its interaction with Bcl-2. Baxalpha overexpression in an interleukin (IL)-3 dependent cell line accelerates apoptosis upon removal of the cytokine. The ratio of Baxalpha to Bcl-2 appears to be crucial for the effect. To study the action of the bax gene product in vivo, we have generated transgenic mice overexpressing Baxalpha specifically in T cells. Such T cells show accelerated apoptosis in response to gamma-radiation, dexamethasone and etoposide. By crossing baxalpha mice with bcl-2 transgenics we show that the critical nature of the Baxalpha:Bcl-2 ratio holds in primary T cells and that it can be manipulated to elicit a strong response to previously resisted stimuli. p53 has a role in the regulation of apoptosis in response to DNA-damaging agents. p53 directly activates transcription of the bax gene. The presence of the baxalpha transgene accelerated apoptosis in thymocytes from both p53-l- and p53+l- mice in response to dexamethasone. Thymocytes from p53-l- mice with the baxalpha transgene showed similar resistance to apoptosis by DNA-damaging agents as did p53-l- mice without the transgene. Baxalpha overexpression alone cannot restore the DNA damage apoptosis pathway, suggesting that p53 is required to induce or activate other factor(s) to reconstitute the response fully. Images PMID:8635454

  17. Long term expression of Drosophila melanogaster nucleoside kinase in thymidine kinase 2-deficient mice with no lethal effects caused by nucleotide pool imbalances.


    Krishnan, Shuba; Paredes, João A; Zhou, Xiaoshan; Kuiper, Raoul V; Hultenby, Kjell; Curbo, Sophie; Karlsson, Anna


    Mitochondrial DNA depletion caused by thymidine kinase 2 (TK2) deficiency can be compensated by a nucleoside kinase from Drosophila melanogaster (Dm-dNK) in mice. We show that transgene expression of Dm-dNK in Tk2 knock-out (Tk2(-/-)) mice extended the life span of Tk2(-/-) mice from 3 weeks to at least 20 months. The Dm-dNK(+/-)Tk2(-/-) mice maintained normal mitochondrial DNA levels throughout the observation time. A significant difference in total body weight due to the reduction of subcutaneous and visceral fat in the Dm-dNK(+/-)Tk2(-/-) mice was the only visible difference compared with control mice. This indicates an effect on fat metabolism mediated through residual Tk2 deficiency because Dm-dNK expression was low in both liver and fat tissues. Dm-dNK expression led to increased dNTP pools and an increase in the catabolism of purine and pyrimidine nucleotides but these alterations did not apparently affect the mice during the 20 months of observation. In conclusion, Dm-dNK expression in the cell nucleus expanded the total dNTP pools to levels required for efficient mitochondrial DNA synthesis, thereby compensated the Tk2 deficiency, during a normal life span of the mice. The Dm-dNK(+/-) mouse serves as a model for nucleoside gene or enzyme substitutions, nucleotide imbalances, and dNTP alterations in different tissues.

  18. Moon formation: Punch combo or knock-out blow?

    NASA Astrophysics Data System (ADS)

    Collins, Gareth S.


    The twin isotopic signatures of the Moon and Earth are difficult to explain by a single giant impact. Impact simulations suggest that making the Moon by a combination of multiple, smaller moonlet-forming impacts may work better.

  19. Proton knock-out from tensor polarized deuterium

    SciTech Connect

    E. Passchier; M. Ferro-Luzzi; Z.-L. Zhou; T. Botto; M. Bouwhuis; J. F. J. van den Brand; D. Dimitroyannis; M. Doets; Kees de Jager; J. Konijn; D. J. J. de Lange; G. J. Nooren; N. Papadakis; I. Passchier; P. Salle; J. J. M. Steijger; N. Vodinas; H. de Vries; C. Zegers; Ricardo Alarcon; Seonho Choi; Joseph Comfort; D. M. Nikolenko; S. G. Popov; Igor Rachek; J. Lang; H. Arenhoevel; Rolf Ent; W. Leidemann; M. Bucholz; H. J. Bulten; Mike Miller; J. S. Neal; O. Unal


    A status report is given on experiment 91-12, which is the first internal target experiment performed at the internal target facility of NIKHEF. The aim of this experiment is to measure the asymmetry in the (e,e'p) reaction from a tensor polarized deuterium target with unpolarized electrons. An update on the experimental setup and results of an extensive set of test measurements are presented.

  20. Transmembrane domain Nrg1 mutant mice show altered susceptibility to the neurobehavioural actions of repeated THC exposure in adolescence.


    Long, Leonora E; Chesworth, Rose; Huang, Xu-Feng; McGregor, Iain S; Arnold, Jonathon C; Karl, Tim


    Heavy cannabis abuse increases the risk of developing schizophrenia. Adolescents appear particularly vulnerable to the development of psychosis-like symptoms after cannabis use. To test whether the schizophrenia candidate gene neuregulin 1 (NRG1) modulates the effects of cannabinoids in adolescence, we tested male adolescent heterozygous transmembrane domain Nrg1 mutant (Nrg1 TM HET) mice and wild type-like littermates (WT) for their neurobehavioural response to repeated Δ(9)-tetrahydrocannabinol (THC, 10 mg/kg i.p. for 21 d starting on post-natal day 31). During treatment and 48 h after treatment withdrawal, we assessed several behavioural parameters relevant to schizophrenia. After behavioural testing we measured autoradiographic CB(1), 5-HT(2A) and NMDA receptor binding. The hyperlocomotor phenotype typical of Nrg1 mutants emerged after drug withdrawal and was more pronounced in vehicle than THC-treated Nrg1 TM HET mice. All mice were equally sensitive to THC-induced suppression of locomotion. However, mutant mice appeared protected against inhibiting effects of repeated THC on investigative social behaviours. Neither THC nor Nrg1 genotype altered prepulse inhibition. Repeated adolescent THC promoted differential effects on CB(1) and 5-HT(2A) receptor binding in the substantia nigra and insular cortex respectively, decreasing binding in WT while increasing it in Nrg1 TM HET mice. THC also selectively affected 5-HT(2A) receptor binding in several other regions in WT mice, whereas NMDA receptor binding was only affected in mutant mice. Overall, Nrg1 mutation does not appear to increase the induction of psychotomimetic symptoms by repeated adolescent THC exposure but may attenuate some of its actions on social behaviour and schizophrenia-relevant neurotransmitter receptor profiles.

  1. Transgenic mice overexpressing glia maturation factor-β, an oxidative stress inducible gene, show premature aging due to Zmpste24 down-regulation.


    Imai, Rika; Asai, Kanae; Hanai, Jun-ichi; Takenaka, Masaru


    Glia Maturation Factor-β (GMF), a brain specific protein, is induced by proteinuria in renal tubules. Ectopic GMF overexpression causes apoptosisin vitro via cellular vulnerability to oxidative stress. In order to examine the roles of GMF in non-brain tissue, we constructed transgenic mice overexpressing GMF (GMF-TG). The GMF-TG mice exhibited appearance phenotypes associated with premature aging. The GMF-TG mice also demonstrated short lifespans and reduced hair regrowth, suggesting an accelerated aging process. The production of an abnormal lamin A, a nuclear envelope protein, plays a causal role in both normal aging and accelerated aging diseases, known as laminopathies. Importantly, we identified the abnormal lamin A (prelamin A), accompanied by a down-regulation of a lamin A processing enzyme (Zmpste24) in the kidney of the GMF-TG mice. The GMF-TG mice showed accelerated aging in the kidney, compared with wild-type mice, showing increased TGF-β1, CTGF gene and serum creatinine. The gene expression of p21/waf1 was increased at an earlier stage of life, at 10 weeks, which was in turn down-regulated at a later stage, at 60 weeks. In conclusion, we propose that GMF-TG mice might be a novel mouse model of accelerated aging, due to the abnormal lamin A.

  2. Elastin-insufficient mice show normal cardiovascular remodeling in 2K1C hypertension despite higher baseline pressure and unique cardiovascular architecture.


    Wagenseil, Jessica E; Knutsen, Russell H; Li, Dean Y; Mecham, Robert P


    Mice heterozygous for the elastin gene (ELN(+/-)) show unique cardiovascular properties, including increased blood pressure and smaller, thinner arteries with an increased number of lamellar units. Some of these properties are also observed in humans with supravalvular aortic stenosis, a disease caused by functional heterozygosity of the elastin gene. The arterial geometry in ELN(+/-) mice is contrary to the increased thickness that would be expected in an animal demonstrating hypertensive remodeling. To determine whether this is due to a decreased capability for cardiovascular remodeling or to a novel adaptation of the ELN(+/-) cardiovascular system, we increased blood pressure in adult ELN(+/+) and ELN(+/-) mice using the two-kidney, one-clip Goldblatt model of hypertension. Successfully clipped mice have a systolic pressure increase of at least 15 mmHg over sham-operated animals. ELN(+/+) and ELN(+/-)-clipped mice show significant increases over sham-operated mice in cardiac weight, arterial thickness, and arterial cross-sectional area with no changes in lamellar number. There are no significant differences in most mechanical properties with clipping in either genotype. These results indicate that ELN(+/+) and ELN(+/-) hearts and arteries remodel similarly in response to adult induced hypertension. Therefore, the cardiovascular properties of ELN(+/-) mice are likely due to developmental remodeling in response to altered hemodynamics and reduced elastin levels.

  3. Lectin-like, oxidized low-density lipoprotein receptor-1-deficient mice show resistance to age-related knee osteoarthritis

    PubMed Central

    Hashimoto, Kazuhiko; Oda, Yutaka; Nakamura, Fumihisa; Kakinoki, Ryosuke; Akagi, Masao


    The lectin-like, oxidized low-density lipoprotein (ox-LDL) receptor-1 (LOX-1)/ox-LDL system contributes to atherosclerosis and may be involved in cartilage degeneration. The purpose of this study was to determine whether the LOX-1/ox-LDL system contributes to age-related osteoarthritis (OA) in vivo, using LOX-1 knockout (LOX-1 KO) mice. Knee cartilage from 6, 12, and 18-month old (n = 10/group) C57Bl/6 wild-type (WT) and LOX-1 KO mice was evaluated by determining the Osteoarthritis Research Society International (OARSI) score of Safranin-O stained samples. The prevalence of knee OA in both mouse strains was also investigated. Expression levels of LOX-1, ox-LDL, runt-related transcription factor-2 (Runx2), type-X collagen (COL X), and matrix metalloproteinase-13 (MMP-13) in the articular chondrocytes were analyzed immunohistologically. No significant difference was observed in the mean scores of WT (2.00±0.61) and LOX-1 KO mice (2.00±0.49) at 6 months of age (P=1.00, n=10). At 12 and 18 months of age, the mean scores of LOX-1 KO mice (3.75±0.93 and 5.50±0.78) were significantly lower than those of WT mice (5.25±1.14 and 9.00±1.01; P<0.001 in both cases; n=10). The prevalence of OA in LOX-1 KO mice was lower than that in WT mice at 12 and 18 months of age (40 vs 70%, 70 vs 90%, respectively; n=10). The expression levels of Runx2, COL X, and MMP-13 in articular chondrocytes significantly decreased in LOX-1 KO, mice compared with those in WT mice. The study indicated that the LOX-1/ox-LDL system in chondrocytes plays a role in the pathogenesis of age-related knee OA, which is potentially a target for preventing OA progression. PMID:28348422

  4. Lipid abnormalities in alpha/beta2-syntrophin null mice are independent from ABCA1

    PubMed Central

    Hebel, Tobias; Eisinger, Kristina; Neumeier, Markus; Rein-Fischboeck, Lisa; Pohl, Rebekka; Meier, Elisabeth M.; Boettcher, Alfred; Froehner, Stanley C.; Adams, Marvin E.; Liebisch, Gerhard; Krautbauer, Sabrina; Buechler, Christa


    The syntrophins alpha (SNTA) and beta 2 (SNTB2) are molecular adaptor proteins shown to stabilize ABCA1, an essential regulator of HDL cholesterol. Furthermore, SNTB2 is involved in glucose stimulated insulin release. Hyperglycemia and dyslipidemia are characteristic features of the metabolic syndrome, a serious public health problem with rising prevalence. Therefore, it is important to understand the role of the syntrophins herein. Mice deficient for both syntrophins (SNTA/B2−/−) have normal insulin and glucose tolerance, hepatic ABCA1 protein and cholesterol. When challenged with a HFD, wild type and SNTA/B2−/− mice have similar weight gain, adiposity, serum and liver triglycerides. Hepatic ABCA1, serum insulin and insulin sensitivity are normal while glucose tolerance is impaired. Liver cholesterol is reduced, and expression of SREBP2 and HMG-CoA-R is increased in the knockout mice. Scavenger receptor-BI (SR-BI) protein is strongly diminished in the liver of SNTA/B2−/− mice while SR-BI binding protein NHERF1 is not changed and PDZK1 is even induced. Knock-down of SNTA, SNTB2 or both has no effect on hepatocyte SR-BI and PDZK1 proteins. Further, SR-BI levels are not reduced in brown adipose tissue of SNTA/B2−/− mice excluding that syntrophins directly stabilize SR-BI. SR-BI stability is regulated by MAPK and phosphorylated ERK2 is induced in the liver of the knock-out mice. Blockage of ERK activity upregulates hepatocyte SR-BI showing that increased MAPK activity contributes to low SR-BI. Sphingomyelin which is well described to regulate cholesterol metabolism is reduced in the liver and serum of the knock-out mice while the size of serum lipoproteins is not affected. Current data exclude a major function of these syntrophins in ABCA1 activity and insulin release but suggest a role in regulating glucose uptake, ERK and SR-BI levels, and sphingomyelin metabolism in obesity. PMID:25625330

  5. Astrocytic β2 Adrenergic Receptor Gene Deletion Affects Memory in Aged Mice

    PubMed Central

    Jensen, Cathy Joanna; Demol, Frauke; Bauwens, Romy; Kooijman, Ron; Massie, Ann; Villers, Agnès; Ris, Laurence; De Keyser, Jacques


    In vitro and in vivo studies suggest that the astrocytic adrenergic signalling enhances glycogenolysis which provides energy to be transported to nearby cells and in the form of lactate. This energy source is important for motor and cognitive functioning. While it is suspected that the β2-adrenergic receptor on astrocytes might contribute to this energy balance, it has not yet been shown conclusively in vivo. Inducible astrocyte specific β2-adrenergic receptor knock-out mice were generated by crossing homozygous β2-adrenergic receptor floxed mice (Adrb2flox) and mice with heterozygous tamoxifen-inducible Cre recombinase-expression driven by the astrocyte specific L-glutamate/L-aspartate transporter promoter (GLAST-CreERT2). Assessments using the modified SHIRPA (SmithKline/Harwell/Imperial College/Royal Hospital/Phenotype Assessment) test battery, swimming ability test, and accelerating rotarod test, performed at 1, 2 and 4 weeks, 6 and 12 months after tamoxifen (or vehicle) administration did not reveal any differences in physical health or motor functions between the knock-out mice and controls. However deficits were found in the cognitive ability of aged, but not young adult mice, reflected in impaired learning in the Morris Water Maze. Similarly, long-term potentiation (LTP) was impaired in hippocampal brain slices of aged knock-out mice maintained in low glucose media. Using microdialysis in cerebellar white matter we found no significant differences in extracellular lactate or glucose between the young adult knock-out mice and controls, although trends were detected. Our results suggest that β2-adrenergic receptor expression on astrocytes in mice may be important for maintaining cognitive health at advanced age, but is dispensable for motor function. PMID:27776147

  6. Olfactory discrimination varies in mice with different levels of α7-nicotinic acetylcholine receptor expression

    PubMed Central

    Hellier, Jennifer L.; Arevalo, Nicole L.; Blatner, Megan J.; Dang, An K.; Clevenger, Amy C.; Adams, Catherine E.; Restrepo, Diego


    Previous studies have shown that schizophrenics have decreased expression of α7-nicotinic acetylcholine (α7) receptors in the hippocampus and other brain regions, paranoid delusions, disorganized speech, deficits in auditory gating (i.e., inability to inhibit neuronal responses to repetitive auditory stimuli), and difficulties in odor discrimination and detection. Here we use mice with decreased α7 expression that also show a deficit in auditory gating to determine if these mice have similar deficits in olfaction. In the adult mouse olfactory bulb (OB), α7 expression localizes in the glomerular layer; however, the functional role of α7 is unknown. We show that inbred mouse strains (i.e., C3H and C57) with varying α7 expression (e.g., α7 wild-type [α7+/+], α7 heterozygous knock-out [α7+/−] and α7 homozygous knockout mice [α7−/−]) significantly differ in odor discrimination and detection of chemically related odorant pairs. Using [125I] α-bungarotoxin (α-BGT) autoradiography, α7 expression was measured in the OB. As previously demonstrated, α-BGT binding was localized to the glomerular layer. Significantly more expression of α7 was observed in C57 α7+/+ mice compared to C3H α7+/+ mice. Furthermore, C57 α7+/+ mice were able to detect a significantly lower concentration of an odor in a mixture compared to C3H α7+/+ mice. Both C57 and C3H α7+/+ mice discriminated between chemically related odorants sooner than α7+/− or α7−/− mice. These data suggest that α7-nicotinic-receptors contribute strongly to olfactory discrimination and detection in mice and may be one of the mechanisms producing olfactory dysfunction in schizophrenics. PMID:20713028

  7. Forebrain-specific constitutively active CaMKKα transgenic mice show deficits in hippocampus-dependent long-term memory.


    Kaitsuka, Taku; Li, Sheng-Tian; Nakamura, Kenji; Takao, Keizo; Miyakawa, Tsuyoshi; Matsushita, Masayuki


    The Ca(2+)/calmodulin (CaM) kinase cascade is activated by Ca(2+) influx through the voltage-dependent Ca(2+) channels and the NMDA receptor. CaM kinase kinase (CaMKK), the most upstream kinase of the CaM kinase cascade, phosphorylates and activates both CaM kinase I (CaMKI) and CaMKIV, resulting in activation of cyclic AMP-responsive element binding protein (CREB)-dependent gene transcription. Using transgenic techniques, we created mutant mice in which a constitutively active form of CaMKK1, the autoinhibitory domain truncated protein, is over-expressed specifically in the forebrain. In these mice, although performance was normal in basal activity and short-term memory, specific impairments were shown in hippocampus-dependent long-term memory after training in spatial memory tasks and after contextual fear conditioning. In cultured neurons of these mice, phosphorylation of CaMKI was significantly increased in basal states, whereas the activity range of CaMKI phosphorylation by brain-derived neurotrophic factor (BDNF) and KCl stimulation was significantly diminished in mutant mice. Our results define a critical role for CaMKKα in synaptic plasticity and the retention of hippocampus-dependent long-term memory.

  8. Differential effects of genes of the Rb1 signalling pathway on osteosarcoma incidence and latency in alpha-particle irradiated mice.


    Gonzalez-Vasconcellos, Iria; Domke, Tanja; Kuosaite, Virginija; Esposito, Irene; Sanli-Bonazzi, Bahar; Nathrath, Michaela; Atkinson, Michael J; Rosemann, Michael


    Osteosarcoma is the most frequent secondary malignancy following radiotherapy of patients with bilateral retinoblastoma. This suggests that the Rb1 tumour suppressor gene might confer genetic susceptibility towards radiation-induced osteosarcoma. To define the contribution of the Rb1 pathway in the multistep process of radiation carcinogenesis, we evaluated somatic allelic changes affecting the Rb1 gene itself as well as its upstream regulator p16 in murine osteosarcoma induced by (227)Th incorporation. To distinguish between the contribution of germline predisposition and the effect of a 2-hit allelic loss, two mouse models harbouring heterozygote germline Rb1 and p16 defects were tested for the incidence and latency of osteosarcoma following irradiation. We could show that all tumours arising in BALB/c×CBA/CA hybrid mice (wild-type for Rb1 and for p16) carried a somatic allelic loss of either the Rb1 gene (76.5%) or the p16 gene (59%). In none of the tumours, we found concordant retention of heterozygosity at both loci. Heterozygote knock-out mice for Rb1 exhibit a significant increase in the incidence of osteosarcoma following (227)Th incorporation (11/24 [corrected] in Rb1+/- vs. 2/18 in Rb1+/+, p=4×10(-5)), without affecting tumour latency. In contrast, heterozygote knock-out mice for p16 had no significant change in tumour incidence, but a pronounced reduction of latency (LT(50%) =355 days in p16+/- vs. 445 days in p16+/+, p=8×10(-3)). These data suggest that Rb1 germline defects influence early steps of radiation osteosarcomagenesis, whereas alterations in p16 mainly affect later stages of tumour promotion and growth.

  9. Deficiency of pantothenate kinase 2 (Pank2) in mice leads to retinal degeneration and azoospermia.


    Kuo, Yien-Ming; Duncan, Jacque L; Westaway, Shawn K; Yang, Haidong; Nune, George; Xu, Eugene Yujun; Hayflick, Susan J; Gitschier, Jane


    Pantothenate kinase-associated neurodegeneration (PKAN, formerly known as Hallervorden-Spatz syndrome) is a rare but devastating neurodegenerative disorder, resulting from an inherited defect in coenzyme A biosynthesis. As pathology in the human condition is limited to the central nervous system, specifically the retina and globus pallidus, we have generated a mouse knock-out of the orthologous murine gene (Pank2) to enhance our understanding of the mechanisms of disease and to serve as a testing ground for therapies. Over time, the homozygous null mice manifest retinal degeneration, as evidenced by electroretinography, light microscopy and pupillometry response. Specifically, Pank2 mice show progressive photoreceptor decline, with significantly lower scotopic a- and b-wave amplitudes, decreased cell number and disruption of the outer segment and reduced pupillary constriction response when compared with those of wild-type littermates. Additionally, the homozygous male mutants are infertile due to azoospermia, a condition that was not appreciated in the human. Arrest occurs in spermiogenesis, with complete absence of elongated and mature spermatids. In contrast to the human, however, no changes were observed in the basal ganglia by MRI or by histological exam, nor were there signs of dystonia, even after following the mice for one year. Pank2 mice are 20% decreased in weight when compared with their wild-type littermates; however, dysphagia was not apparent. Immunohistochemistry shows staining consistent with localization of Pank2 to the mitochondria in both the retina and the spermatozoa.

  10. Strain-dependent differences in LTP and hippocampus-dependent memory in inbred mice.


    Nguyen, P V; Abel, T; Kandel, E R; Bourtchouladze, R


    Many studies have used "reverse" genetics to produce "knock-out" and transgenic mice to explore the roles of various molecules in long-term potentiation (LTP) and spatial memory. The existence of a variety of inbred strains of mice provides an additional way of exploring the genetic bases of learning and memory. We examined behavioral memory and LTP expression in area CA1 of hippocampal slices prepared from four different inbred strains of mice: C57BL/6J, CBA/J, DBA/2J, and 129/SvEms-+(Ter?)/J. We found that LTP induced by four 100-Hz trains of stimulation was robust and long-lasting in C57BL/6J and DBA/2J mice but decayed in CBA/J and 129/SvEms-+(Ter?)/J mice. LTP induced by one 100-Hz train was significantly smaller after 1 hr in the 129/SvEms-+(Ter?)/J mice than in the other three strains. Theta-burst LTP was shorter lasting in CBA/J, DBA/2J, and 129/SvEms-+(Ter?)/J mice than in C57BL/6J mice. We also observed specific memory deficits, among particular mouse strains, in spatial and nonspatial tests of hippocampus-dependent memory. CBA/J mice showed defective learning in the Morris water maze, and both DBA/2J and CBA/J strains displayed deficient long-term memory in contextual and cued fear conditioning tests. Our findings provide strong support for a genetic basis for some forms of synaptic plasticity that are linked to behavioral long-term memory and suggest that genetic background can influence the electrophysiological and behavioral phenotypes observed in genetically modified mice generated for elucidating the molecular bases of learning, memory, and LTP.

  11. Generation of ER{alpha}-floxed and knockout mice using the Cre/LoxP system

    SciTech Connect

    Antonson, P.; Omoto, Y.; Humire, P.; Gustafsson, J.-A.


    Highlights: Black-Right-Pointing-Pointer ER{alpha} floxed and knockout mice were generated. Black-Right-Pointing-Pointer Disruption of the ER{alpha} gene results in sterility in both male and female mice. Black-Right-Pointing-Pointer ER{alpha}{sup -/-} mice have ovaries with hemorrhagic follicles and hypoplastic uterus. Black-Right-Pointing-Pointer Female ER{alpha}{sup -/-} mice develop obesity. -- Abstract: Estrogen receptor alpha (ER{alpha}) is a nuclear receptor that regulates a range of physiological processes in response to estrogens. In order to study its biological role, we generated a floxed ER{alpha} mouse line that can be used to knock out ER{alpha} in selected tissues by using the Cre/LoxP system. In this study, we established a new ER{alpha} knockout mouse line by crossing the floxed ER{alpha} mice with Cre deleter mice. Here we show that genetic disruption of the ER{alpha} gene in all tissues results in sterility in both male and female mice. Histological examination of uterus and ovaries revealed a dramatically atrophic uterus and hemorrhagic cysts in the ovary. These results suggest that infertility in female mice is the result of functional defects of the reproductive tract. Moreover, female knockout mice are hyperglycemic, develop obesity and at the age of 4 months the body weight of these mice was more than 20% higher compared to wild type littermates and this difference increased over time. Our results demonstrate that ER{alpha} is necessary for reproductive tract development and has important functions as a regulator of metabolism in females.

  12. Enzyme-treated Asparagus officinalis extract shows neuroprotective effects and attenuates cognitive impairment in senescence-accelerated mice.


    Sakurai, Takuya; Ito, Tomohiro; Wakame, Koji; Kitadate, Kentaro; Arai, Takashi; Ogasawara, Junetsu; Kizaki, Takako; Sato, Shogo; Ishibashi, Yoshinaga; Fujiwara, Tomonori; Akagawa, Kimio; Ishida, Hitoshi; Ohno, Hideki


    Increases in the number of patients with dementia involving Alzheimer's disease (AD) are seen as a grave public health problem. In neurodegenerative disorders involving AD, biological stresses, such as oxidative and inflammatory stress, induce neural cell damage. Asparagus (Asparagus officinalis) is a popular vegetable, and an extract prepared from this reportedly possesses various beneficial biological activities. In the present study, we investigated the effects of enzyme-treated asparagus extract (ETAS) on neuronal cells and early cognitive impairment of senescence-accelerated mouse prone 8 (SAMP8) mice. The expression of mRNAs for factors that exert cytoprotective and anti-apoptotic functions, such as heat-shock protein 70 and heme oxygenase-1, was upregulated in NG108-15 neuronal cells by treatment with ETAS. Moreover, when release of lactate dehydrogenase from damaged NG108-15 cells was increased for cells cultured in medium containing either the nitric oxide donor sodium nitroprusside or the hypoxia mimic reagent cobalt chloride, ETAS significantly attenuated this cell damage. Also, when contextual fear memory, which is considered to be a hippocampus-dependent memory, was significantly impaired in SAMP8 mice, ETAS attenuated the cognitive impairment. These results suggest that ETAS produces cytoprotective effects in neuronal cells and attenuates the effects on the cognitive impairment of SAMP8 mice.

  13. Mice Deficient in GEM GTPase Show Abnormal Glucose Homeostasis Due to Defects in Beta-Cell Calcium Handling

    PubMed Central

    Gunton, Jenny E.; Sisavanh, Mary; Stokes, Rebecca A.; Satin, Jon; Satin, Leslie S.; Zhang, Min; Liu, Sue M.; Cai, Weikang; Cheng, Kim; Cooney, Gregory J.; Laybutt, D. Ross; So, Trina; Molero, Juan-Carlos; Grey, Shane T.; Andres, Douglas A.


    Aims and Hypothesis Glucose-stimulated insulin secretion from beta-cells is a tightly regulated process that requires calcium flux to trigger exocytosis of insulin-containing vesicles. Regulation of calcium handling in beta-cells remains incompletely understood. Gem, a member of the RGK (Rad/Gem/Kir) family regulates calcium channel handling in other cell types, and Gem over-expression inhibits insulin release in insulin-secreting Min6 cells. The aim of this study was to explore the role of Gem in insulin secretion. We hypothesised that Gem may regulate insulin secretion and thus affect glucose tolerance in vivo. Methods Gem-deficient mice were generated and their metabolic phenotype characterised by in vivo testing of glucose tolerance, insulin tolerance and insulin secretion. Calcium flux was measured in isolated islets. Results Gem-deficient mice were glucose intolerant and had impaired glucose stimulated insulin secretion. Furthermore, the islets of Gem-deficient mice exhibited decreased free calcium responses to glucose and the calcium oscillations seen upon glucose stimulation were smaller in amplitude and had a reduced frequency. Conclusions These results suggest that Gem plays an important role in normal beta-cell function by regulation of calcium signalling. PMID:22761801

  14. Experimental Chagas disease in Balb/c mice previously vaccinated with T. rangeli. II. The innate immune response shows immunological memory: reality or fiction?


    Basso, B; Marini, V


    Trypanosoma cruzi is a real challenge to the host's immune system, because it requires strong humoral and cellular immune response to remove circulating trypomastigote forms, and to prevent the replication of amastigote forms in tissues, involving many regulator and effector components. This protozoan is responsible for Chagas disease, a major public health problem in Latinamerica. We have developed a model of vaccination with Trypanosoma rangeli, a parasite closely related to T. cruzi, but nonpathogenic to humans, which reduces the infectiousness in three different species of animals, mice, dogs and guinea pigs, against challenge with T. cruzi. In a previous work, we demonstrated that mice vaccinated with T. rangeli showed important soluble mediators that stimulate phagocytic activity versus only infected groups. The aim of this work was to study the innate immune response in mice vaccinated or not with T. rangeli. Different population cells and some soluble mediators (cytokines) in peritoneal fluid and plasma in mice vaccinated-infected and only infected with T. cruzi were studied. In the first hours of challenge vaccinated mice showed an increase of macrophages, NK, granulocytes, and regulation of IL6, IFNγ, TNFα and IL10, with an increase of IL12, with respect to only infected mice. Furthermore an increase was observed of Li T, Li B responsible for adaptative response. Finally the findings showed that the innate immune response plays an important role in vaccinated mice for the early elimination of the parasites, complementary with the adaptative immune response, suggesting that vaccination with T. rangeli modulates the innate response, which develops some kind of immunological memory, recognizing shared antigens with T. cruzi. These results could contribute to the knowledge of new mechanisms which would have an important role in the immune response to Chagas disease.

  15. Mice lacking acid-sensing ion channels (ASIC) 1 or 2, but not ASIC3, show increased pain behaviour in the formalin test.


    Staniland, Amelia A; McMahon, Stephen B


    Extracellular acidification is a component of the inflammatory process and may be a factor driving the pain accompanying it. Acid-sensing ion channels (ASICs) are neuronal proton sensors and evidence suggests they are involved in signalling inflammatory pain. The aims of this study were to (1) clarify the role of ASICs in nociception and (2) confirm their involvement in inflammatory pain and determine whether this was subunit specific. This was achieved by (1) direct comparison of the sensitivity of ASIC1, ASIC2, ASIC3 and TRPV1 knockout mice versus wildtype littermates to acute thermal and mechanical noxious stimuli and (2) studying the behavioural responses of each transgenic strain to hind paw inflammation with either complete Freund's adjuvant (CFA) or formalin. Naïve ASIC1(-/-) and ASIC2(-/-) mice responded normally to acute noxious stimuli, whereas ASIC3(-/-) mice were hypersensitive to high intensity thermal stimuli. CFA injection decreased mechanical and thermal withdrawal thresholds for up to 8 days. ASIC2(-/-) mice had increased mechanical sensitivity on day 1 post-CFA compared to wildtype controls. TRPV1(-/-) mice had significantly reduced thermal, but not mechanical, hyperalgesia on all days after inflammation. Following formalin injection, ASIC1(-/-) and ASIC2(-/-), but not ASIC3(-/-) or TRPV1(-/-), mice showed enhanced pain behaviour, predominantly in the second phase of the test. These data suggest that whilst ASICs may play a role in mediating inflammatory pain, this role is likely to be modulatory and strongly dependent on channel subtype.

  16. Use of the Open Field Maze to measure locomotor and anxiety-like behavior in mice.


    Seibenhener, Michael L; Wooten, Michael C


    Animal models have proven to be invaluable to researchers trying to answer questions regarding the mechanisms of behavior. The Open Field Maze is one of the most commonly used platforms to measure behaviors in animal models. It is a fast and relatively easy test that provides a variety of behavioral information ranging from general ambulatory ability to data regarding the emotionality of the subject animal. As it relates to rodent models, the procedure allows the study of different strains of mice or rats both laboratory bred and wild-captured. The technique also readily lends itself to the investigation of different pharmacological compounds for anxiolytic or anxiogenic effects. Here, a protocol for use of the open field maze to describe mouse behaviors is detailed and a simple analysis of general locomotor ability and anxiety-related emotional behaviors between two strains of C57BL/6 mice is performed. Briefly, using the described protocol we show Wild Type mice exhibited significantly less anxiety related behaviors than did age-matched Knock Out mice while both strains exhibited similar ambulatory ability.

  17. Use of the Open Field Maze to Measure Locomotor and Anxiety-like Behavior in Mice

    PubMed Central

    Seibenhener, Michael L.; Wooten, Michael C.


    Animal models have proven to be invaluable to researchers trying to answer questions regarding the mechanisms of behavior. The Open Field Maze is one of the most commonly used platforms to measure behaviors in animal models. It is a fast and relatively easy test that provides a variety of behavioral information ranging from general ambulatory ability to data regarding the emotionality of the subject animal. As it relates to rodent models, the procedure allows the study of different strains of mice or rats both laboratory bred and wild-captured. The technique also readily lends itself to the investigation of different pharmacological compounds for anxiolytic or anxiogenic effects. Here, a protocol for use of the open field maze to describe mouse behaviors is detailed and a simple analysis of general locomotor ability and anxiety-related emotional behaviors between two strains of C57BL/6 mice is performed. Briefly, using the described protocol we show Wild Type mice exhibited significantly less anxiety related behaviors than did age-matched Knock Out mice while both strains exhibited similar ambulatory ability. PMID:25742564

  18. Nerve injury induces robust allodynia and ectopic discharges in Nav1.3 null mutant mice

    PubMed Central

    Nassar, Mohammed A; Baker, Mark D; Levato, Alessandra; Ingram, Rachel; Mallucci, Giovanna; McMahon, Stephen B; Wood, John N


    Changes in sodium channel activity and neuronal hyperexcitability contribute to neuropathic pain, a major clinical problem. There is strong evidence that the re-expression of the embryonic voltage-gated sodium channel subunit Nav1.3 underlies neuronal hyperexcitability and neuropathic pain. Here we show that acute and inflammatory pain behaviour is unchanged in global Nav1.3 mutant mice. Surprisingly, neuropathic pain also developed normally in the Nav1.3 mutant mouse. To rule out any genetic compensation mechanisms that may have masked the phenotype, we investigated neuropathic pain in two conditional Nav1.3 mutant mouse lines. We used Nav1.8-Cre mice to delete Nav1.3 in nociceptors at E14 and NFH-Cre mice to delete Nav1.3 throughout the nervous system postnatally. Again normal levels of neuropathic pain developed after nerve injury in both lines. Furthermore, ectopic discharges from damaged nerves were unaffected by the absence of Nav1.3 in global knock-out mice. Our data demonstrate that Nav1.3 is neither necessary nor sufficient for the development of nerve-injury related pain. PMID:17052333

  19. Postsynaptic D2 dopamine receptor supersensitivity in the striatum of mice lacking TAAR1.


    Espinoza, Stefano; Ghisi, Valentina; Emanuele, Marco; Leo, Damiana; Sukhanov, Ilya; Sotnikova, Tatiana D; Chieregatti, Evelina; Gainetdinov, Raul R


    Trace Amine-Associated Receptor 1 (TAAR1) is a G protein-coupled receptor (GPCR) known to modulate dopaminergic system through several mechanisms. Mice lacking this receptor show a higher sensitivity to dopaminergic stimuli, such as amphetamine; however, it is not clear whether D1 or D2 dopamine receptors and which associated intracellular signaling events are involved in this modulation. In the striatum of TAAR1 knock out (TAAR1-KO mice) we found that D2, but not D1, dopamine receptors were over-expressed, both in terms of mRNA and protein levels. Moreover, the D2 dopamine receptor-related G protein-independent AKT/GSK3 signaling pathway was selectively activated, as indicated by the decrease of phosphorylation of AKT and GSK3β. The decrease in phospho-AKT levels, suggesting an increase in D2 dopamine receptor activity in basal conditions, was associated with an increase of AKT/PP2A complex, as revealed by co-immunoprecipitation experiments. Finally, we found that the locomotor activation induced by the D2 dopamine receptor agonist quinpirole, but not by the full D1 dopamine receptor agonist SKF-82958, was increased in TAAR1-KO mice. These data demonstrate pronounced supersensitivity of postsynaptic D2 dopamine receptors in the striatum of TAAR1-KO mice and indicate that a close interaction of TAAR1 and D2 dopamine receptors at the level of postsynaptic structures has important functional consequences.

  20. Mice Homozygous for a Deletion in the Glaucoma Susceptibility Locus INK4 Show Increased Vulnerability of Retinal Ganglion Cells to Elevated Intraocular Pressure.


    Gao, Shan; Jakobs, Tatjana C


    A genomic region located on chromosome 9p21 is associated with primary open-angle glaucoma and normal tension glaucoma in genome-wide association studies. The genomic region contains the gene for a long noncoding RNA called CDKN2B-AS, two genes that code for cyclin-dependent kinase inhibitors 2A and 2B (CDKN2A/p16(INK4A) and CDKN2B/p15(INK4B)) and an additional protein (p14(ARF)). We used a transgenic mouse model in which 70 kb of murine chromosome 4, syntenic to human chromosome 9p21, are deleted to study whether this deletion leads to a discernible phenotype in ocular structures implicated in glaucoma. Homozygous mice of this strain were previously reported to show persistent hyperplastic primary vitreous. Fundus photography and optical coherence tomography confirmed that finding but showed no abnormalities for heterozygous mice. Optokinetic response, eletroretinogram, and histology indicated that the heterozygous and mutant retinas were normal functionally and morphologically, whereas glial cells were activated in the retina and optic nerve head of mutant eyes. In quantitative PCR, CDKN2B expression was reduced by approximately 50% in the heterozygous mice and by 90% in the homozygous mice, which suggested that the CDKN2B knock down had no deleterious consequences for the retina under normal conditions. However, compared with wild-type and heterozygous animals, the homozygous mice are more vulnerable to retinal ganglion cell loss in response to elevated intraocular pressure.

  1. Sensory defects in Necdin deficient mice result from a loss of sensory neurons correlated within an increase of developmental programmed cell death

    PubMed Central

    Andrieu, David; Meziane, Hamid; Marly, Fabienne; Angelats, Corinne; Fernandez, Pierre-Alain; Muscatelli, Françoise


    Background The human NECDIN gene is involved in a neurodevelopmental disorder, Prader-Willi syndrome (PWS). Previously we reported a mouse Necdin knock-out model with similar defects to PWS patients. Despite the putative roles attributed to Necdin, mainly from in vitro studies, its in vivo function remains unclear. In this study, we investigate sensory-motor behaviour in Necdin deficient mice. We reveal cellular defects and analyse their cause. Results We report sensory differences in Necdin deficient mice compared to wild type animals. These differences led us to investigate sensory neuron development in Necdin deficient mouse embryos. First, we describe the expression pattern of Necdin in developing DRGs and report a reduction of one-third in specified sensory neurons in dorsal roots ganglia and show that this neuronal loss is achieved by E13.5, when DRGs sensory neurons are specified. In parallel, we observed an increase of 41% in neuronal apoptosis during the wave of naturally occurring cell death at E12.5. Since it is assumed that Necdin is a P75NTR interactor, we looked at the P75NTR-expressing cell population in Necdin knock-out embryos. Unexpectedly, Necdin loss of function has no effect on p75NTR expressing neurons suggesting no direct genetic interaction between Necdin and P75NTR in this context. Although we exclude a role of Necdin in axonal outgrowth from spinal sensory neurons in early developmental stages; such a role could occur later in neuronal differentiation. Finally we also exclude an anti-proliferative role of Necdin in developing sensory neurons. Conclusion Overall, our data show clearly that, in early development of the nervous system, Necdin is an anti-apoptotic or survival factor. PMID:17116257

  2. Neuropeptide Y Overexpressing Female and Male Mice Show Divergent Metabolic but Not Gut Microbial Responses to Prenatal Metformin Exposure

    PubMed Central

    Salomäki-Myftari, Henriikka; Vähätalo, Laura H.; Ailanen, Liisa; Pietilä, Sami; Laiho, Asta; Hänninen, Arno; Pursiheimo, Juha-Pekka; Munukka, Eveliina; Rintala, Anniina; Savontaus, Eriika; Pesonen, Ullamari; Koulu, Markku


    Background Prenatal metformin exposure has been shown to improve the metabolic outcome in the offspring of high fat diet fed dams. However, if this is evident also in a genetic model of obesity and whether gut microbiota has a role, is not known. Methods The metabolic effects of prenatal metformin exposure were investigated in a genetic model of obesity, mice overexpressing neuropeptide Y in the sympathetic nervous system and in brain noradrenergic neurons (OE-NPYDβH). Metformin was given for 18 days to the mated female mice. Body weight, body composition, glucose tolerance and serum parameters of the offspring were investigated on regular diet from weaning and sequentially on western diet (at the age of 5–7 months). Gut microbiota composition was analysed by 16S rRNA sequencing at 10–11 weeks. Results In the male offspring, metformin exposure inhibited weight gain. Moreover, weight of white fat depots and serum insulin and lipids tended to be lower at 7 months. In contrast, in the female offspring, metformin exposure impaired glucose tolerance at 3 months, and subsequently increased body weight gain, fat mass and serum cholesterol. In the gut microbiota, a decline in Erysipelotrichaceae and Odoribacter was detected in the metformin exposed offspring. Furthermore, the abundance of Sutterella tended to be decreased and Parabacteroides increased. Gut microbiota composition of the metformin exposed male offspring correlated to their metabolic phenotype. Conclusion Prenatal metformin exposure caused divergent metabolic phenotypes in the female and male offspring. Nevertheless, gut microbiota of metformin exposed offspring was similarly modified in both genders. PMID:27681875

  3. Mandibular coronoid process in parathyroid hormone-related protein-deficient mice shows ectopic cartilage formation accompanied by abnormal bone modeling.


    Shibata, Shunichi; Suda, Naoto; Fukada, Kenji; Ohyama, Kimie; Yamashita, Yasuo; Hammond, Vicki E


    Parathyroid hormone-related protein (PTHrP) null mutant mice were analyzed to investigate an additional role for PTHrP in cell differentiation. We found ectopic cartilage formation in the mandibular coronoid process in newborn mice. While many previous studies involving PTHrP gene knockout mouse have shown that the cartilage in various regions becomes smaller, this is the first report showing an "increase" of cartilage volume. Investigations of mandibular growth using normal mice indicated that coronoid secondary cartilage never formed from E 15 to d 4, but small amount of cartilage temporally formed at d 7, and this also applies to PTHrP-wild type mice. Therefore, PTHrP deficiency consequently advanced the secondary cartilage formation, which is a novel role of PTHrP in chondrocyte differentiation. In situ hybridization of matrix proteins showed that this coronoid cartilage had characteristics of the lower hypertrophic cell zone usually present at the site of endochondral bone formation and/or "chondroid bone" occasionally found in distraction osteogenesis. In addition, the coronoid process in the PTHrP-deficient mouse also showed abnormal expansion of bone marrow and an increase in the number of multinucleated osteoclasts, an indication of abnormal bone modeling. These results indicate that PTHrP is involved in bone modeling as well as in chondrocyte differentiation. In situ hybridization of matrix protein mRNAs in the abnormal mandibular condylar cartilage revealed that this cartilage was proportionally smaller, supporting previous immunohistochemical results.

  4. GABA type B receptor signaling in proopiomelanocortin neurons protects against obesity, insulin resistance, and hypothalamic inflammation in male mice on a high-fat diet.


    Ito, Yoshihiro; Banno, Ryoichi; Shibata, Miyuki; Adachi, Koichi; Hagimoto, Shigeru; Hagiwara, Daisuke; Ozawa, Yoshiharu; Goto, Motomitsu; Suga, Hidetaka; Sugimura, Yoshihisa; Bettler, Bernhard; Oiso, Yutaka; Arima, Hiroshi


    There is evidence suggesting that the GABA system in the arcuate nucleus, where orexigenic neuropeptide Y and agouti-related peptide as well as anorexigenic proopiomelanocortin (POMC) are expressed, plays an important role in energy balance. In this study, we generated POMC-specific GABAB receptor-deficient [knock-out (KO)] mice. Male KO mice on a high-fat diet (HFD) showed mild increases in body weight (BW) at the age of 9 weeks compared to wild-type (WT) mice, and the differences remained significant until 16 weeks old. However, there was no difference in BW in females between genotypes. While food intake was similar between genotypes, oxygen consumption was significantly decreased in the male KO mice. The insulin tolerance test revealed that the male KO mice were less insulin sensitive compared to WT mice at the age of 8 weeks, when there was no significant difference in BW between genotypes. Despite increased BW, POMC mRNA expression in the arcuate nucleus was significantly decreased in the KO mice compared to WT mice at the age of 16 weeks. Furthermore, the expression of TNFα as well as IL-6, proinflammatory markers in the hypothalamus, was significantly increased in the KO mice on a HFD compared to WT mice. This demonstrates that the deletion of GABAB receptors in POMC neurons in the male mice on a HFD results in obesity, insulin resistance, and hypothalamic inflammation. Furthermore, the decreased POMC expression in the obese KO mice suggests that the regulation of POMC expression through GABAB receptors is essential for proper energy balance.

  5. Loss of epithelial FAM20A in mice causes amelogenesis imperfecta, tooth eruption delay and gingival overgrowth

    PubMed Central

    Li, Li-Li; Liu, Pei-Hong; Xie, Xiao-Hua; Ma, Su; Liu, Chao; Chen, Li; Qin, Chun-Lin


    FAM20A has been studied to a very limited extent. Mutations in human FAM20A cause amelogenesis imperfecta, gingival fibromatosis and kidney problems. It would be desirable to systemically analyse the expression of FAM20A in dental tissues and to assess the pathological changes when this molecule is specifically nullified in individual tissues. Recently, we generated mice with a Fam20A-floxed allele containing the beta-galactosidase reporter gene. We analysed FAM20A expression in dental tissues using X-Gal staining, immunohistochemistry and in situ hybridization, which showed that the ameloblasts in the mouse mandibular first molar began to express FAM20A at 1 day after birth, and the reduced enamel epithelium in erupting molars expressed a significant level of FAM20A. By breeding K14-Cre mice with Fam20Aflox/flox mice, we created K14-Cre;Fam20Aflox/flox (conditional knock out, cKO) mice, in which Fam20A was inactivated in the epithelium. We analysed the dental tissues of cKO mice using X-ray radiography, histology and immunohistochemistry. The molar enamel matrix in cKO mice was much thinner than normal and was often separated from the dentinoenamel junction. The Fam20A-deficient ameloblasts were non-polarized and disorganized and were detached from the enamel matrix. The enamel abnormality in cKO mice was consistent with the diagnosis of amelogenesis imperfecta. The levels of enamelin and matrix metalloproteinase 20 were lower in the ameloblasts and enamel of cKO mice than the normal mice. The cKO mice had remarkable delays in the eruption of molars and hyperplasia of the gingival epithelium. The findings emphasize the essential roles of FAM20A in the development of dental and oral tissues. PMID:27281036

  6. Loss of epithelial FAM20A in mice causes amelogenesis imperfecta, tooth eruption delay and gingival overgrowth.


    Li, Li-Li; Liu, Pei-Hong; Xie, Xiao-Hua; Ma, Su; Liu, Chao; Chen, Li; Qin, Chun-Lin


    FAM20A has been studied to a very limited extent. Mutations in human FAM20A cause amelogenesis imperfecta, gingival fibromatosis and kidney problems. It would be desirable to systemically analyse the expression of FAM20A in dental tissues and to assess the pathological changes when this molecule is specifically nullified in individual tissues. Recently, we generated mice with a Fam20A-floxed allele containing the beta-galactosidase reporter gene. We analysed FAM20A expression in dental tissues using X-Gal staining, immunohistochemistry and in situ hybridization, which showed that the ameloblasts in the mouse mandibular first molar began to express FAM20A at 1 day after birth, and the reduced enamel epithelium in erupting molars expressed a significant level of FAM20A. By breeding K14-Cre mice with Fam20A(flox/flox) mice, we created K14-Cre;Fam20A(flox/flox) (conditional knock out, cKO) mice, in which Fam20A was inactivated in the epithelium. We analysed the dental tissues of cKO mice using X-ray radiography, histology and immunohistochemistry. The molar enamel matrix in cKO mice was much thinner than normal and was often separated from the dentinoenamel junction. The Fam20A-deficient ameloblasts were non-polarized and disorganized and were detached from the enamel matrix. The enamel abnormality in cKO mice was consistent with the diagnosis of amelogenesis imperfecta. The levels of enamelin and matrix metalloproteinase 20 were lower in the ameloblasts and enamel of cKO mice than the normal mice. The cKO mice had remarkable delays in the eruption of molars and hyperplasia of the gingival epithelium. The findings emphasize the essential roles of FAM20A in the development of dental and oral tissues.

  7. Anxious and Nonanxious Mice Show Similar Hippocampal Sensory Evoked Oscillations under Urethane Anesthesia: Difference in the Effect of Buspirone

    PubMed Central

    Horváth, János; Barkóczi, Balázs; Müller, Géza


    Hippocampal oscillations recorded under urethane anesthesia are proposed to be modulated by anxiolytics. All classes of clinically effective anxiolytics were reported to decrease the frequency of urethane theta; however, recent findings raise concerns about the direct correlation of anxiolysis and the frequency of hippocampal theta. Here, we took advantage of our two inbred mouse strains displaying extremes of anxiety (anxious (AX) and nonanxious (nAX)) to compare the properties of hippocampal activity and to test the effect of an anxiolytic drugs. No difference was observed in the peak frequency or in the peak power between AX and nAX strains. Buspirone (Bus) applied in 2.5 mg/kg decreased anxiety of AX but did not have any effect on nAX as was tested by elevated plus maze and open field. Interestingly, Bus treatment increased hippocampal oscillatory frequency in the AX but left it unaltered in nAX mice. Saline injection did not have any effect on the oscillation. Paired-pulse facilitation was enhanced by Bus in the nAX, but not in the AX strain. Collectively, these results do not support the hypothesis that hippocampal activity under urethane may serve as a marker for potential anxiolytic drugs. Moreover, we could not confirm the decrease of frequency after anxiolytic treatment. PMID:25949829

  8. Ninjurin1 deficiency attenuates susceptibility of experimental autoimmune encephalomyelitis in mice.


    Ahn, Bum Ju; Le, Hoang; Shin, Min Wook; Bae, Sung-Jin; Lee, Eun Ji; Wee, Hee-Jun; Cha, Jong-Ho; Lee, Hyo-Jong; Lee, Hye Shin; Kim, Jeong Hun; Kim, Chang-Yeon; Seo, Ji Hae; Lo, Eng H; Jeon, Sejin; Lee, Mi-Ni; Oh, Goo Taeg; Yin, Guo Nan; Ryu, Ji-Kan; Suh, Jun-Kyu; Kim, Kyu-Won


    Ninjurin1 is a homotypic adhesion molecule that contributes to leukocyte trafficking in experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis. However, in vivo gene deficiency animal studies have not yet been done. Here, we constructed Ninjurin1 knock-out (KO) mice and investigated the role of Ninjurin1 on leukocyte trafficking under inflammation conditions such as EAE and endotoxin-induced uveitis. Ninjurin1 KO mice attenuated EAE susceptibility by reducing leukocyte recruitment into the injury regions of the spinal cord and showed less adhesion of leukocytes on inflamed retinal vessels in endotoxin-induced uveitis mice. Moreover, the administration of a custom-made antibody (Ab26-37) targeting the Ninjurin1 binding domain ameliorated the EAE symptoms, showing the contribution of its adhesion activity to leukocyte trafficking. In addition, we addressed the transendothelial migration (TEM) activity of bone marrow-derived macrophages and Raw264.7 cells according to the expression level of Ninjurin1. TEM activity was decreased in Ninjurin1 KO bone marrow-derived macrophages and siNinj1 Raw264.7 cells. Consistent with this, GFP-tagged mNinj1-overexpressing Raw264.7 cells increased their TEM activity. Taken together, we have clarified the contribution of Ninjurin1 to leukocyte trafficking in vivo and delineated its direct functions to TEM, emphasizing Ninjurin1 as a beneficial therapeutic target against inflammatory diseases such as multiple sclerosis.

  9. Mice Lacking Pannexin 1 Release ATP and Respond Normally to All Taste Qualities

    PubMed Central

    Anderson, Catherine B.; Kinnamon, Sue C.


    Adenosine triphosphate (ATP) is required for the transmission of all taste qualities from taste cells to afferent nerve fibers. ATP is released from Type II taste cells by a nonvesicular mechanism and activates purinergic receptors containing P2X2 and P2X3 on nerve fibers. Several ATP release channels are expressed in taste cells including CALHM1, Pannexin 1, Connexin 30, and Connexin 43, but whether all are involved in ATP release is not clear. We have used a global Pannexin 1 knock out (Panx1 KO) mouse in a series of in vitro and in vivo experiments. Our results confirm that Panx1 channels are absent in taste buds of the knockout mice and that other known ATP release channels are not upregulated. Using a luciferin/luciferase assay, we show that circumvallate taste buds from Panx1 KO mice normally release ATP upon taste stimulation compared with wild type (WT) mice. Gustatory nerve recordings in response to various tastants applied to the tongue and brief-access behavioral testing with SC45647 also show no difference between Panx1 KO and WT. These results confirm that Panx1 is not required for the taste evoked release of ATP or for neural and behavioral responses to taste stimuli. PMID:26136251

  10. Mice Lacking Pannexin 1 Release ATP and Respond Normally to All Taste Qualities.


    Vandenbeuch, Aurelie; Anderson, Catherine B; Kinnamon, Sue C


    Adenosine triphosphate (ATP) is required for the transmission of all taste qualities from taste cells to afferent nerve fibers. ATP is released from Type II taste cells by a nonvesicular mechanism and activates purinergic receptors containing P2X2 and P2X3 on nerve fibers. Several ATP release channels are expressed in taste cells including CALHM1, Pannexin 1, Connexin 30, and Connexin 43, but whether all are involved in ATP release is not clear. We have used a global Pannexin 1 knock out (Panx1 KO) mouse in a series of in vitro and in vivo experiments. Our results confirm that Panx1 channels are absent in taste buds of the knockout mice and that other known ATP release channels are not upregulated. Using a luciferin/luciferase assay, we show that circumvallate taste buds from Panx1 KO mice normally release ATP upon taste stimulation compared with wild type (WT) mice. Gustatory nerve recordings in response to various tastants applied to the tongue and brief-access behavioral testing with SC45647 also show no difference between Panx1 KO and WT. These results confirm that Panx1 is not required for the taste evoked release of ATP or for neural and behavioral responses to taste stimuli.

  11. Effects of Pin1 Loss in HdhQ111 Knock-in Mice

    PubMed Central

    Agostoni, Elena; Michelazzi, Silvia; Maurutto, Marta; Carnemolla, Alisia; Ciani, Yari; Vatta, Paolo; Roncaglia, Paola; Zucchelli, Silvia; Leanza, Giampiero; Mantovani, Fiamma; Gustincich, Stefano; Santoro, Claudio; Piazza, Silvano; Del Sal, Giannino; Persichetti, Francesca


    Huntington’s disease (HD) is a fatal, dominantly inherited, neurodegenerative disorder due to a pathological expansion of the CAG repeat in the coding region of the HTT gene. In the quest for understanding the molecular basis of neurodegeneration, we have previously demonstrated that the prolyl isomerase Pin1 plays a crucial role in mediating p53-dependent apoptosis triggered by mutant huntingtin (mHtt) in vitro. To assess the effects of the lack of Pin1 in vivo, we have bred Pin1 knock-out mice with HdhQ111 knock-in mice, a genetically precise model of HD. We show that Pin1 genetic ablation modifies a portion of HdhQ111 phenotypes in a time-dependent fashion. As an early event, Pin1 activity reduces the DNA damage response (DDR). In midlife mice, by taking advantage of next-generation sequencing technology, we show that Pin1 activity modulates a portion of the alterations triggered by mHtt, extending the role of Pin1 to two additional HdhQ111 phenotypes: the unbalance in the “synthesis/concentration of hormones”, as well as the alteration of “Wnt/β-catenin signaling”. In aging animals, Pin1 significantly increases the number of mHtt-positive nuclear inclusions while it reduces gliosis. In summary, this work provides further support for a role of Pin1 in HD pathogenesis. PMID:27199664

  12. Size does not always matter: Ts65Dn Down syndrome mice show cerebellum-dependent motor learning deficits that cannot be rescued by postnatal SAG treatment.


    Gutierrez-Castellanos, Nicolas; Winkelman, Beerend H J; Tolosa-Rodriguez, Leonardo; Devenney, Benjamin; Reeves, Roger H; De Zeeuw, Chris I


    Humans with Down syndrome (DS) and Ts65Dn mice both show a reduced volume of the cerebellum due to a significant reduction in the density of granule neurons. Recently, cerebellar hypoplasia in Ts65Dn mice was rescued by a single treatment with SAG, an agonist of the Sonic hedgehog pathway, administered on the day of birth. In addition to normalizing cerebellar morphology, this treatment restored the ability to learn a spatial navigation task, which is associated with hippocampal function. It is not clear to what extent this improved performance results from restoration of the cerebellar architecture or a yet undefined role of Sonic hedgehog (Shh) in perinatal hippocampal development. The absence of a clearly demonstrated deficit in cerebellar function in trisomic mice exacerbates the problem of discerning how SAG acts to improve learning and memory. Here we show that phase reversal adaptation and consolidation of the vestibulo-ocular reflex is significantly impaired in Ts65Dn mice, providing for the first time a precise characterization of cerebellar functional deficits in this murine model of DS. However, these deficits do not benefit from the normalization of cerebellar morphology following treatment with SAG. Together with the previous observation that the synaptic properties of Purkinje cells are also unchanged by SAG treatment, this lack of improvement in a region-specific behavioral assay supports the possibility that a direct effect of Shh pathway stimulation on the hippocampus might explain the benefits of this potential approach to the improvement of cognition in DS.

  13. Lack of the Matricellular Protein SPARC (Secreted Protein, Acidic and Rich in Cysteine) Attenuates Liver Fibrogenesis in Mice

    PubMed Central

    Atorrasagasti, Catalina; Kippes, Néstor; Malvicini, Mariana; Alaniz, Laura; Garcia, Mariana; Piccioni, Flavia; Fiore, Esteban J.; Bayo, Juan; Bataller, Ramón; Guruceaga, Elizabeth; Corrales, Fernando; Podhajcer, Osvaldo; Mazzolini, Guillermo


    Introduction Secreted Protein, Acidic and Rich in Cysteine (SPARC) is a matricellular protein involved in many biological processes and found over-expressed in cirrhotic livers. By mean of a genetic approach we herein provide evidence from different in vivo liver disease models suggesting a profibrogenic role for SPARC. Methods Two in vivo models of liver fibrosis, based on TAA administration and bile duct ligation, were developed on SPARC wild-type (SPARC+/+) and knock-out (SPARC−/−) mice. Hepatic SPARC expression was analyzed by qPCR. Fibrosis was assessed by Sirius Red staining, and the maturation state of collagen fibers was analyzed using polarized light. Necroinflammatory activity was evaluated by applying the Knodell score and liver inflammatory infiltration was characterized by immunohistochemistry. Hepatic stellate cell activation was assessed by α-SMA immunohistochemistry. In addition, pro-fibrogenic genes and inflammatory cytokines were measured by qPCR and/or ELISA. Liver gene expression profile was analyzed in SPARC−/− and SPARC+/+ mice using Affymetrix Mouse Gene ST 1.0 array. Results SPARC expression was found induced in fibrotic livers of mouse and human. SPARC−/− mice showed a reduction in the degree of inflammation, mainly CD4+ cells, and fibrosis. Consistently, collagen deposits and mRNA expression levels were decreased in SPARC−/− mice when compared to SPARC+/+ mice; in addition, MMP-2 expression was increased in SPARC−/− mice. A reduction in the number of activated myofibroblasts was observed. Moreover, TGF-β1 expression levels were down-regulated in the liver as well as in the serum of TAA-treated knock-out animals. Ingenuity Pathway Analysis (IPA) analysis suggested several gene networks which might involve protective mechanisms of SPARC deficiency against liver fibrogenesis and a better established machinery to repair DNA and detoxify from external chemical stimuli. Conclusions Overall our data suggest that SPARC plays

  14. Vaccination of mice with a modified Vaccinia Ankara (MVA) virus expressing the African horse sickness virus (AHSV) capsid protein VP2 induces virus neutralising antibodies that confer protection against AHSV upon passive immunisation.


    Calvo-Pinilla, Eva; de la Poza, Francisco; Gubbins, Simon; Mertens, Peter Paul Clement; Ortego, Javier; Castillo-Olivares, Javier


    In previous studies we showed that a recombinant Modified Vaccinia Ankara (MVA) virus expressing the protein VP2 of AHSV serotype 4 (MVA-VP2) induced virus neutralising antibodies in horses and protected interferon alpha receptor gene knock-out mice (IFNAR-/-) against challenge. We continued these studies and determined, in the IFNAR-/- mouse model, whether the antibody responses induced by MVA-VP2 vaccination play a key role in protection against AHSV. Thus, groups of mice were vaccinated with wild type MVA (MVA-wt) or MVA-VP2 and the antisera from these mice were used in a passive immunisation experiment. Donor antisera from (a) MVA-wt; (b) MVA-VP2 vaccinated; or (c) MVA-VP2 vaccinated and AHSV infected mice, were transferred to AHSV non-immune recipient mice. The recipients were challenged with virulent AHSV together with MVA-VP2 vaccinated and MVA-wt vaccinated control animals and the levels of protection against AHSV-4 were compared between all these groups. The results showed that following AHSV challenge, mice that were passively immunised with MVA-VP2 vaccinated antisera were highly protected against AHSV disease and had lower levels of viraemia than recipients of MVA-wt antisera. Our study indicates that MVA-VP2 vaccination induces a highly protective humoral immune response against AHSV.

  15. FosB Null Mutant Mice Show Enhanced Methamphetamine Neurotoxicity: Potential Involvement of FosB in Intracellular Feedback Signaling and Astroglial Function

    PubMed Central

    Kuroda, Kumi O; Ornthanalai, Veravej G; Kato, Tadafumi; Murphy, Niall P


    Previous studies show that (1) two members of fos family transcription factors, c-Fos and FosB, are induced in frontal brain regions by methamphetamine; (2) null mutation of c-Fos exacerbates methamphetamine-induced neurotoxicity; and (3) null mutation of FosB enhances behavioral responses to cocaine. Here we sought a role of FosB in responses to methamphetamine by studying FosB null mutant (−/−) mice. After a 10 mg/kg methamphetamine injection, FosB(−/−) mice were more prone to self-injury. Concomitantly, the intracellular feedback regulators of Sprouty and Rad-Gem-Kir (RGK) family transcripts had lower expression profiles in the frontoparietal cortex and striatum of the FosB(−/−) mice. Three days after administration of four 10 mg/kg methamphetamine injections, the frontoparietal cortex and striatum of FosB(−/−) mice contained more degenerated neurons as determined by Fluoro-Jade B staining. The abundance of the small neutral amino acids, serine, alanine, and glycine, was lower and/or was poorly induced after methamphetamine administration in the frontoparietal cortex and striatum of FosB(−/−) mice. In addition, methamphetamine-treated FosB(−/−) frontoparietal and piriform cortices showed more extravasation of immunoglobulin, which is indicative of blood–brain barrier dysfunction. Methamphetamine-induced hyperthermia, brain dopamine content, and loss of tyrosine hydroxylase immunoreactivity in the striatum, however, were not different between genotypes. These data indicate that FosB is involved in thermoregulation-independent protective functions against methamphetamine neurotoxicity in postsynaptic neurons. Our findings suggest two possible mechanisms of FosB-mediated neuroprotection: one is induction of negative feedback regulation within postsynaptic neurons through Sprouty and RGK. Another is supporting astroglial function such as maintenance of the blood–brain barrier, and metabolism of serine and glycine, which are important

  16. FosB null mutant mice show enhanced methamphetamine neurotoxicity: potential involvement of FosB in intracellular feedback signaling and astroglial function.


    Kuroda, Kumi O; Ornthanalai, Veravej G; Kato, Tadafumi; Murphy, Niall P


    Previous studies show that (1) two members of fos family transcription factors, c-Fos and FosB, are induced in frontal brain regions by methamphetamine; (2) null mutation of c-Fos exacerbates methamphetamine-induced neurotoxicity; and (3) null mutation of FosB enhances behavioral responses to cocaine. Here we sought a role of FosB in responses to methamphetamine by studying FosB null mutant (-/-) mice. After a 10 mg/kg methamphetamine injection, FosB(-/-) mice were more prone to self-injury. Concomitantly, the intracellular feedback regulators of Sprouty and Rad-Gem-Kir (RGK) family transcripts had lower expression profiles in the frontoparietal cortex and striatum of the FosB(-/-) mice. Three days after administration of four 10 mg/kg methamphetamine injections, the frontoparietal cortex and striatum of FosB(-/-) mice contained more degenerated neurons as determined by Fluoro-Jade B staining. The abundance of the small neutral amino acids, serine, alanine, and glycine, was lower and/or was poorly induced after methamphetamine administration in the frontoparietal cortex and striatum of FosB(-/-) mice. In addition, methamphetamine-treated FosB(-/-) frontoparietal and piriform cortices showed more extravasation of immunoglobulin, which is indicative of blood-brain barrier dysfunction. Methamphetamine-induced hyperthermia, brain dopamine content, and loss of tyrosine hydroxylase immunoreactivity in the striatum, however, were not different between genotypes. These data indicate that FosB is involved in thermoregulation-independent protective functions against methamphetamine neurotoxicity in postsynaptic neurons. Our findings suggest two possible mechanisms of FosB-mediated neuroprotection: one is induction of negative feedback regulation within postsynaptic neurons through Sprouty and RGK. Another is supporting astroglial function such as maintenance of the blood-brain barrier, and metabolism of serine and glycine, which are important glial modulators of nerve cells.

  17. Vitamin B1-deficient mice show impairment of hippocampus-dependent memory formation and loss of hippocampal neurons and dendritic spines: potential microendophenotypes of Wernicke-Korsakoff syndrome.


    Inaba, Hiroyoshi; Kishimoto, Takuya; Oishi, Satoru; Nagata, Kan; Hasegawa, Shunsuke; Watanabe, Tamae; Kida, Satoshi


    Patients with severe Wernicke-Korsakoff syndrome (WKS) associated with vitamin B1 (thiamine) deficiency (TD) show enduring impairment of memory formation. The mechanisms of memory impairment induced by TD remain unknown. Here, we show that hippocampal degeneration is a potential microendophenotype (an endophenotype of brain disease at the cellular and synaptic levels) of WKS in pyrithiamine-induced thiamine deficiency (PTD) mice, a rodent model of WKS. PTD mice show deficits in the hippocampus-dependent memory formation, although they show normal hippocampus-independent memory. Similarly with WKS, impairments in memory formation did not recover even at 6 months after treatment with PTD. Importantly, PTD mice exhibit a decrease in neurons in the CA1, CA3, and dentate gyrus (DG) regions of the hippocampus and reduced density of wide dendritic spines in the DG. Our findings suggest that TD induces hippocampal degeneration, including the loss of neurons and spines, thereby leading to enduring impairment of hippocampus-dependent memory formation.

  18. Vitamin B1-deficient mice show impairment of hippocampus-dependent memory formation and loss of hippocampal neurons and dendritic spines: potential microendophenotypes of Wernicke–Korsakoff syndrome

    PubMed Central

    Inaba, Hiroyoshi; Kishimoto, Takuya; Oishi, Satoru; Nagata, Kan; Hasegawa, Shunsuke; Watanabe, Tamae; Kida, Satoshi


    Patients with severe Wernicke–Korsakoff syndrome (WKS) associated with vitamin B1 (thiamine) deficiency (TD) show enduring impairment of memory formation. The mechanisms of memory impairment induced by TD remain unknown. Here, we show that hippocampal degeneration is a potential microendophenotype (an endophenotype of brain disease at the cellular and synaptic levels) of WKS in pyrithiamine-induced thiamine deficiency (PTD) mice, a rodent model of WKS. PTD mice show deficits in the hippocampus-dependent memory formation, although they show normal hippocampus-independent memory. Similarly with WKS, impairments in memory formation did not recover even at 6 months after treatment with PTD. Importantly, PTD mice exhibit a decrease in neurons in the CA1, CA3, and dentate gyrus (DG) regions of the hippocampus and reduced density of wide dendritic spines in the DG. Our findings suggest that TD induces hippocampal degeneration, including the loss of neurons and spines, thereby leading to enduring impairment of hippocampus-dependent memory formation. PMID:27576603

  19. SPARC (secreted protein acidic and rich in cysteine) knockdown protects mice from acute liver injury by reducing vascular endothelial cell damage

    PubMed Central

    Peixoto, E; Atorrasagasti, C; Aquino, JB; Militello, R; Bayo, J; Fiore, E; Piccioni, F; Salvatierra, E; Alaniz, L; García, MG; Bataller, R; Corrales, F; Gidekel, M; Podhajcer, O; Colombo, MI; Mazzolini, G


    Secreted protein, acidic and rich in cysteine (SPARC) is involved in many biological process including liver fibrogenesis, but its role in acute liver damage is unknown. To examine the role of SPARC in acute liver injury, we used SPARC knock-out (SPARC−/−) mice. Two models of acute liver damage were used: concanavalin A (Con A) and the agonistic anti-CD95 antibody Jo2. SPARC expression levels were analyzed in liver samples from patients with acute-on-chronic alcoholic hepatitis (AH). SPARC expression is increased on acute-on-chronic AH patients. Knockdown of SPARC decreased hepatic damage in the two models of liver injury. SPARC−/− mice showed a marked reduction in Con A-induced necroinflammation. Infiltration by CD4+ T cells, expression of tumor necrosis factor-α and interleukin-6 and apoptosis were attenuated in SPARC−/− mice. Sinusoidal endothelial cell monolayer was preserved and was less activated in Con A-treated SPARC−/− mice. SPARC knockdown reduced Con A-induced autophagy of cultured human microvascular endothelial cells (HMEC-1). Hepatic transcriptome analysis revealed several gene networks that may have a role in the attenuated liver damaged found in Con A-treated SPARC−/− mice. SPARC has a significant role in the development of Con A-induced severe liver injury. These results suggest that SPARC could represent a therapeutic target in acute liver injury. PMID:25410742

  20. Distinct motor impairments of dopamine D1 and D2 receptor knockout mice revealed by three types of motor behavior.


    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Momiyama, Toshihiko; Yamamori, Tetsuo; Sasaoka, Toshikuni


    Both D1R and D2R knock out (KO) mice of the major dopamine receptors show significant motor impairments. However, there are some discrepant reports, which may be due to the differences in genetic background and experimental procedures. In addition, only few studies directly compared the motor performance of D1R and D2R KO mice. In this paper, we examined the behavioral difference among N10 congenic D1R and D2R KO, and wild type (WT) mice. First, we examined spontaneous motor activity in the home cage environment for consecutive 5 days. Second, we examined motor performance using the rota-rod task, a standard motor task in rodents. Third, we examined motor ability with the Step-Wheel task in which mice were trained to run in a motor-driven turning wheel adjusting their steps on foothold pegs to drink water. The results showed clear differences among the mice of three genotypes in three different types of behavior. In monitoring spontaneous motor activities, D1R and D2R KO mice showed higher and lower 24 h activities, respectively, than WT mice. In the rota-rod tasks, at a low speed, D1R KO mice showed poor performance but later improved, whereas D2R KO mice showed a good performance at early days without further improvement. When first subjected to a high speed task, the D2R KO mice showed poorer rota-rod performance at a low speed than the D1R KO mice. In the Step-Wheel task, across daily sessions, D2R KO mice increased the duration that mice run sufficiently close to the spout to drink water, and decreased time to touch the floor due to missing the peg steps and number of times the wheel was stopped, which performance was much better than that of D1R KO mice. These incongruent results between the two tasks for D1R and D2R KO mice may be due to the differences in the motivation for the rota-rod and Step-Wheel tasks, aversion- and reward-driven, respectively. The Step-Wheel system may become a useful tool for assessing the motor ability of WT and mutant mice.

  1. Caveolin-1-deficient Mice Show Accelerated Mammary Gland Development During Pregnancy, Premature Lactation, and Hyperactivation of the Jak-2/STAT5a Signaling Cascade

    PubMed Central

    Park, David S.; Lee, Hyangkyu; Frank, Philippe G.; Razani, Babak; Nguyen, Andrew V.; Parlow, Albert F.; Russell, Robert G.; Hulit, James; Pestell, Richard G.; Lisanti, Michael P.


    It is well established that mammary gland development and lactation are tightly controlled by prolactin signaling. Binding of prolactin to its cognate receptor (Prl-R) leads to activation of the Jak-2 tyrosine kinase and the recruitment/tyrosine phosphorylation of STAT5a. However, the mechanisms for attenuating the Prl-R/Jak-2/STAT5a signaling cascade are just now being elucidated. Here, we present evidence that caveolin-1 functions as a novel suppressor of cytokine signaling in the mammary gland, akin to the SOCS family of proteins. Specifically, we show that caveolin-1 expression blocks prolactin-induced activation of a STAT5a-responsive luciferase reporter in mammary epithelial cells. Furthermore, caveolin-1 expression inhibited prolactin-induced STAT5a tyrosine phosphorylation and DNA binding activity, suggesting that caveolin-1 may negatively regulate the Jak-2 tyrosine kinase. Because the caveolin-scaffolding domain bears a striking resemblance to the SOCS pseudosubstrate domain, we examined whether Jak-2 associates with caveolin-1. In accordance with this homology, we demonstrate that Jak-2 cofractionates and coimmunoprecipitates with caveolin-1. We next tested the in vivo relevance of these findings using female Cav-1 (−/−) null mice. If caveolin-1 normally functions as a suppressor of cytokine signaling in the mammary gland, then Cav-1 null mice should show premature development of the lobuloalveolar compartment because of hyperactivation of the prolactin signaling cascade via disinhibition of Jak-2. In accordance with this prediction, Cav-1 null mice show accelerated development of the lobuloalveolar compartment, premature milk production, and hyperphosphorylation of STAT5a (pY694) at its Jak-2 phosphorylation site. In addition, the Ras-p42/44 MAPK cascade is hyper-activated. Because a similar premature lactation phenotype is observed in SOCS1 (−/−) null mice, we conclude that caveolin-1 is a novel suppressor of cytokine signaling. PMID:12388746

  2. Adolescent mice show anxiety- and aggressive-like behavior and the reduction of long-term potentiation in mossy fiber-CA3 synapses after neonatal maternal separation.


    Shin, S Y; Han, S H; Woo, R-S; Jang, S H; Min, S S


    Exposure to maternal separation (MS) during early life is an identified risk factor for emotional disorders such as anxiety and depression later in life. This study investigated the effects of neonatal MS on the behavior and long-term potentiation (LTP) as well as basic synaptic transmission at hippocampal CA3-CA1 and mossy fiber (MF)-CA3 synapses in adolescent mice for 19days. When mice were adolescents, we measured depression, learning, memory, anxious and aggressive behavior using the forced swimming test (FST), Y-maze, Morris water maze (MWM), elevated plus maze (EPM), three consecutive days of the open field test, the social interaction test, the tube-dominance test and the resident-intruder test. The results showed that there was no difference in FST, Y-maze, and MWM performance. However, MS mice showed more anxiety-like behavior in the EPM test and aggressive-like behavior in the tube-dominance and resident-intruder tests. In addition, the magnitude of LTP and release probability in the MF-CA3 synapses was reduced in the MS group but not in the CA3-CA1 synapse. Our results indicate that early life stress due to MS may induce anxiety- and aggressive-like behavior during adolescence, and these effects are associated with synaptic plasticity at the hippocampal MF-CA3 synapses.

  3. The characterization of the first anti-mouse Muc6 antibody shows an increased expression of the mucin in pancreatic tissue of Cftr-knockout mice.


    Gouyer, Valérie; Leir, Shih-Hsing; Tetaert, Daniel; Liu, Yamin; Gottrand, Frédéric; Harris, Ann; Desseyn, Jean-Luc


    Gel-forming mucins are large high-molecular weight secreted O-glycoproteins responsible for the gel-properties of the mucus blanket. Five orthologous gel-forming mucins have been cloned in human and mouse. Among them, the mucin MUC6 has been less studied, particularly in rodents and no anti rodent-Muc6 antibody has been reported yet. In order to further study Muc6 in mice, our aims were to obtain a specific Muc6 antibody, to validate it and to test it in Cftr deficient mice. A polyclonal serum named CP4 was isolated from a rabbit immunized by a mouse Muc6 peptide. In Western blot experiments, the antibody detected a high-molecular weight molecule secreted by the gastric tissue. Using immunohistochemistry, we showed that the antibody reacted strongly with deep glands of duodenum and ileum and mucous neck cells of gastric body. CP4 also recognized Muc6 protein secreted at the surface of the stomach and renal collecting tubules. The centroacinar cells of pancreatic tissue also reacted with the antibody. Cftr-/- mice showed a higher expression of Muc6 at both protein and RNA levels compared with their control Cftr+/+ littermates suggesting that as in the human disease, Muc6 may contribute to the formation of materials that block pancreatic acini and ducts in mouse models of cystic fibrosis. The rabbit anti-mouse Muc6 polyclonal antibody seems highly specific to the mouse mucin and will be useful to study pancreatic pathology in cystic fibrosis.

  4. Viable RNaseH1 knockout mice show RNaseH1 is essential for R loop processing, mitochondrial and liver function

    PubMed Central

    Lima, Walt F.; Murray, Heather M.; Damle, Sagar S.; Hart, Christopher E.; Hung, Gene; De Hoyos, Cheryl Li; Liang, Xue-Hai; Crooke, Stanley T.


    Viable constitutive and tamoxifen inducible liver-specific RNase H1 knockout mice that expressed no RNase H1 activity in hepatocytes showed increased R-loop levels and reduced mitochondrial encoded DNA and mRNA levels, suggesting impaired mitochondrial R-loop processing, transcription and mitochondrial DNA replication. These changes resulted in mitochondrial dysfunction with marked changes in mitochondrial fusion, fission, morphology and transcriptional changes reflective of mitochondrial damage and stress. Liver degeneration ensued, as indicated by apoptosis, fibrosis and increased transaminase levels. Antisense oligonucleotides (ASOs) designed to serve as substrates for RNase H1 were inactive in the hepatocytes from the RNase H1 knockout mice and in vivo, demonstrating that RNase H1 is necessary for the activity of DNA-like ASOs. During liver regeneration, a clone of hepatocytes that expressed RNase H1 developed and partially restored mitochondrial and liver function. PMID:27131367

  5. Pharmacological BACE1 and BACE2 inhibition induces hair depigmentation by inhibiting PMEL17 processing in mice

    PubMed Central

    Shimshek, Derya R.; Jacobson, Laura H.; Kolly, Carine; Zamurovic, Natasa; Balavenkatraman, Kamal Kumar; Morawiec, Laurent; Kreutzer, Robert; Schelle, Juliane; Jucker, Mathias; Bertschi, Barbara; Theil, Diethilde; Heier, Annabelle; Bigot, Karine; Beltz, Karen; Machauer, Rainer; Brzak, Irena; Perrot, Ludovic; Neumann, Ulf


    Melanocytes of the hair follicle produce melanin and are essential in determining the differences in hair color. Pigment cell-specific MELanocyte Protein (PMEL17) plays a crucial role in melanogenesis. One of the critical steps is the amyloid-like functional oligomerization of PMEL17. Beta Site APP Cleaving Enzyme-2 (BACE2) and γ-secretase have been shown to be key players in generating the proteolytic fragments of PMEL17. The β-secretase (BACE1) is responsible for the generation of amyloid-β (Aβ) fragments in the brain and is therefore proposed as a therapeutic target for Alzheimer’s disease (AD). Currently BACE1 inhibitors, most of which lack selectivity over BACE2, have demonstrated efficacious reduction of amyloid-β peptides in animals and the CSF of humans. BACE2 knock-out mice have a deficiency in PMEL17 proteolytic processing leading to impaired melanin storage and hair depigmentation. Here, we confirm BACE2-mediated inhibition of PMEL17 proteolytic processing in vitro in mouse and human melanocytes. Furthermore, we show that wildtype as well as bace2+/− and bace2−/− mice treated with a potent dual BACE1/BACE2 inhibitor NB-360 display dose-dependent appearance of irreversibly depigmented hair. Retinal pigmented epithelium showed no morphological changes. Our data demonstrates that BACE2 as well as additional BACE1 inhibition affects melanosome maturation and induces hair depigmentation in mice. PMID:26912421

  6. Pharmacological BACE1 and BACE2 inhibition induces hair depigmentation by inhibiting PMEL17 processing in mice.


    Shimshek, Derya R; Jacobson, Laura H; Kolly, Carine; Zamurovic, Natasa; Balavenkatraman, Kamal Kumar; Morawiec, Laurent; Kreutzer, Robert; Schelle, Juliane; Jucker, Mathias; Bertschi, Barbara; Theil, Diethilde; Heier, Annabelle; Bigot, Karine; Beltz, Karen; Machauer, Rainer; Brzak, Irena; Perrot, Ludovic; Neumann, Ulf


    Melanocytes of the hair follicle produce melanin and are essential in determining the differences in hair color. Pigment cell-specific MELanocyte Protein (PMEL17) plays a crucial role in melanogenesis. One of the critical steps is the amyloid-like functional oligomerization of PMEL17. Beta Site APP Cleaving Enzyme-2 (BACE2) and γ-secretase have been shown to be key players in generating the proteolytic fragments of PMEL17. The β-secretase (BACE1) is responsible for the generation of amyloid-β (Aβ) fragments in the brain and is therefore proposed as a therapeutic target for Alzheimer's disease (AD). Currently BACE1 inhibitors, most of which lack selectivity over BACE2, have demonstrated efficacious reduction of amyloid-β peptides in animals and the CSF of humans. BACE2 knock-out mice have a deficiency in PMEL17 proteolytic processing leading to impaired melanin storage and hair depigmentation. Here, we confirm BACE2-mediated inhibition of PMEL17 proteolytic processing in vitro in mouse and human melanocytes. Furthermore, we show that wildtype as well as bace2(+/-) and bace2(-/-) mice treated with a potent dual BACE1/BACE2 inhibitor NB-360 display dose-dependent appearance of irreversibly depigmented hair. Retinal pigmented epithelium showed no morphological changes. Our data demonstrates that BACE2 as well as additional BACE1 inhibition affects melanosome maturation and induces hair depigmentation in mice.

  7. Life-long in vivo cell-lineage tracing shows that no oogenesis originates from putative germline stem cells in adult mice.


    Zhang, Hua; Liu, Lian; Li, Xin; Busayavalasa, Kiran; Shen, Yan; Hovatta, Outi; Gustafsson, Jan-Åke; Liu, Kui


    Whether or not oocyte regeneration occurs in adult life has been the subject of much debate. In this study, we have traced germ-cell lineages over the life spans of three genetically modified mouse models and provide direct evidence that oogenesis does not originate from any germline stem cells (GSCs) in adult mice. By selective ablation of all existing oocytes in a Gdf9-Cre;iDTR mouse model, we have demonstrated that no new germ cells were ever regenerated under pathological conditions. By in vivo tracing of oocytes and follicles in the Sohlh1-CreER(T2);R26R and Foxl2-CreER(T2);mT/mG mouse models, respectively, we have shown that the initial pool of oocytes is the only source of germ cells throughout the life span of the mice and that no adult oogenesis ever occurs under physiological conditions. Our findings clearly show that there are no GSCs that contribute to adult oogenesis in mice and that the initial pool of oocytes formed in early life is the only source of germ cells throughout the entire reproductive life span.

  8. Characterization of the insulin sensitivity of ghrelin receptor KO mice using glycemic clamps

    PubMed Central


    Background We and others have demonstrated previously that ghrelin receptor (GhrR) knock out (KO) mice fed a high fat diet (HFD) have increased insulin sensitivity and metabolic flexibility relative to WT littermates. A striking feature of the HFD-fed GhrR KO mouse is the dramatic decrease in hepatic steatosis. To characterize further the underlying mechanisms of glucose homeostasis in GhrR KO mice, we conducted both hyperglycemic (HG) and hyperinsulinemic-euglycemic (HI-E) clamps. Additionally, we investigated tissue glucose uptake and specifically examined liver insulin sensitivity. Results Consistent with glucose tolerance-test data, in HG clamp experiments, GhrR KO mice showed a reduction in glucose-stimulated insulin release relative to WT littermates. Nevertheless, a robust 1st phase insulin secretion was still achieved, indicating that a healthy β-cell response is maintained. Additionally, GhrR KO mice demonstrated both a significantly increased glucose infusion rate and significantly reduced insulin requirement for maintenance of the HG clamp, consistent with their relative insulin sensitivity. In HI-E clamps, both LFD-fed and HFD-fed GhrR KO mice showed higher peripheral insulin sensitivity relative to WT littermates as indicated by a significant increase in insulin-stimulated glucose disposal (Rd), and decreased hepatic glucose production (HGP). HFD-fed GhrR KO mice showed a marked increase in peripheral tissue glucose uptake in a variety of tissues, including skeletal muscle, brown adipose tissue and white adipose tissue. GhrR KO mice fed a HFD also showed a modest, but significant decrease in conversion of pyruvate to glucose, as would be anticipated if these mice displayed increased liver insulin sensitivity. Additionally, the levels of UCP2 and UCP1 were reduced in the liver and BAT, respectively, in GhrR KO mice relative to WT mice. Conclusions These results indicate that improved glucose homeostasis of GhrR KO mice is characterized by robust

  9. YAC128 Huntington's disease transgenic mice show enhanced short-term hippocampal synaptic plasticity early in the course of the disease.


    Ghilan, Mohamed; Bostrom, Crystal A; Hryciw, Brett N; Simpson, Jessica M; Christie, Brian R; Gil-Mohapel, Joana


    Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by a polyglutamine expansion in the gene encoding the protein huntingtin. The disease progresses over decades, but often patients develop cognitive impairments that precede the onset of the classical motor symptoms. Similar to the disease progression in humans, the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive dysfunction that precedes the onset of the neuropathological and motor impairments characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and long-term synaptic plasticity in the hippocampus, two related biological models of learning and memory processes, were altered in YAC128 mice in early stages of disease progression. We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced post-tetanic and short-term potentiation are apparent in YAC128 mice after high-frequency stimulation at this time. Early and late forms of long-term plasticity were not altered at this stage. Together these findings indicate that there may be elevated neurotransmitter release in response to synaptic stimulation in YAC128 mice during the initial phase of disease progression. These abnormalities in short-term plasticity detected at this stage in YAC128 HD transgenic mice indicate that aberrant information processing at the level of the synapses may contribute, at least in part, to the early onset of cognitive deficits that are characteristic of this devastating neurodegenerative disorder.

  10. Male mice housed in groups engage in frequent fighting and show a lower response to additional bone loading than females or individually housed males that do not fight.


    Meakin, Lee B; Sugiyama, Toshihiro; Galea, Gabriel L; Browne, William J; Lanyon, Lance E; Price, Joanna S


    Experiments to investigate bone's physiological adaptation to mechanical loading frequently employ models that apply dynamic loads to bones in vivo and assess the changes in mass and architecture that result. It is axiomatic that bones will only show an adaptive response if the applied artificial loading environment differs in a significant way from that to which the bones have been habituated by normal functional loading. It is generally assumed that this normal loading is similar between experimental groups. In the study reported here we found that this was not always the case. Male and female 17-week-old C57BL/6 mice were housed in groups of six, and a single episode (40 cycles) of non-invasive axial loading, engendering 2,200 με on the medial surface of the proximal tibiae in sample mice, was applied to right tibiae on alternate days for two weeks. This engendered an adaptive increase in bone mass in females, but not males. Observation revealed the main difference in behaviour between males and females was that males were involved in fights 1.3 times per hour, whereas the females never fought. We therefore housed all mice individually. In females, there was a similar significant osteogenic response to loading in cortical and trabecular bone of both grouped and individual mice. In contrast, in males, adaptive increases in the loaded compared with non-loaded control bones was only apparent in animals housed individually. Our interpretation of these findings is that the frequent vigorous fighting that occurs between young adult males housed in groups could be sufficient to engender peak strains and strain rates that equal or exceed the stimulus derived from artificial loading. This indicates the importance of ensuring that physical activity is consistent between groups. Reducing the background level of the naturally engendered strain environment allows adaptive responses to artificial loading to be demonstrated at lower loads.

  11. Impaired Reality Testing in Mice Lacking Phospholipase Cβ1: Observed by Persistent Representation-Mediated Taste Aversion.


    Kim, Hea-Jin; Koh, Hae-Young


    Hallucinations and delusions are the most prominent symptoms of schizophrenia and characterized by impaired reality testing. Representation-mediated taste aversion (RMTA) has been proposed as a potential behavioral assessment of reality testing and has been applied to a neurodevelopmental rat model of schizophrenia. However, the theory underlying this approach has not been generalized yet with any demonstration of impaired reality testing in other animal models of schizophrenia, such as genetically-modified mice. We devised a RMTA procedure for mice that combines a Pavlovian association protocol pairing odor conditioned stimulus (CS) with sugar reward unconditioned stimulus (US), and a conditioned taste aversion (CTA) method. In this RMTA paradigm, we compared performances of wild-type (PLCβ1+/+) mice and phospholipase C β1 knock-out (PLCβ1-/-) mice which are known as one of the genetic models for schizophrenia. With a minimal amount of initial odor-sugar associative training, both PLCβ1+/+ and PLCβ1-/- mice were able to form an aversion to the sugar reward when the odor CS predicting sugar was paired with nausea. With an extended initial training, however, only PLCβ1-/- mice could form a RMTA. This persistent RMTA displayed by PLCβ1-/- mice shows their inability to distinguish real sugar from the CS-evoked representation of sugar at a stage in associative learning where wild-type mice normally could differentiate the two. These results demonstrate an impaired reality testing first observed in a genetic mouse model of schizophrenia, and suggest that RMTA paradigm may, with general applicability, allow diverse biological approaches to impaired reality testing.

  12. Impaired Reality Testing in Mice Lacking Phospholipase Cβ1: Observed by Persistent Representation-Mediated Taste Aversion

    PubMed Central

    Kim, Hea-jin; Koh, Hae-Young


    Hallucinations and delusions are the most prominent symptoms of schizophrenia and characterized by impaired reality testing. Representation-mediated taste aversion (RMTA) has been proposed as a potential behavioral assessment of reality testing and has been applied to a neurodevelopmental rat model of schizophrenia. However, the theory underlying this approach has not been generalized yet with any demonstration of impaired reality testing in other animal models of schizophrenia, such as genetically-modified mice. We devised a RMTA procedure for mice that combines a Pavlovian association protocol pairing odor conditioned stimulus (CS) with sugar reward unconditioned stimulus (US), and a conditioned taste aversion (CTA) method. In this RMTA paradigm, we compared performances of wild-type (PLCβ1+/+) mice and phospholipase C β1 knock-out (PLCβ1-/-) mice which are known as one of the genetic models for schizophrenia. With a minimal amount of initial odor-sugar associative training, both PLCβ1+/+ and PLCβ1-/- mice were able to form an aversion to the sugar reward when the odor CS predicting sugar was paired with nausea. With an extended initial training, however, only PLCβ1-/- mice could form a RMTA. This persistent RMTA displayed by PLCβ1-/- mice shows their inability to distinguish real sugar from the CS-evoked representation of sugar at a stage in associative learning where wild-type mice normally could differentiate the two. These results demonstrate an impaired reality testing first observed in a genetic mouse model of schizophrenia, and suggest that RMTA paradigm may, with general applicability, allow diverse biological approaches to impaired reality testing. PMID:26731530

  13. 55P0110, a Novel Synthetic Compound Developed from a Plant Derived Backbone Structure, Shows Promising Anti-Hyperglycaemic Activity in Mice.


    Brunmair, Barbara; Lehner, Zsuzsanna; Stadlbauer, Karin; Adorjan, Immanuel; Frobel, Klaus; Scherer, Thomas; Luger, Anton; Bauer, Leonhardt; Fürnsinn, Clemens


    Starting off with a structure derived from the natural compound multiflorine, a derivatisation program aimed at the discovery and initial characterisation of novel compounds with antidiabetic potential. Design and discovery of the structures was guided by oral bioactivities obtained in oral glucose tolerance tests in mice. 55P0110, one among several new compounds with distinct anti-hyperglycaemic activity, was further examined to characterise its pharmacology and mode of action. Whereas a single oral dose of 55P0110 did not affect basal glycaemia, it markedly improved the glucose tolerance of healthy and diabetic mice (peak blood glucose in glucose tolerance test, mmol/l: healthy mice with 90 mg/kg 55P0110, 17.0 ± 1.2 vs. 10.1 ± 1.1; diabetic mice with 180 mg/kg 55P0110, 23.1 ± 0.9 vs. 11.1 ± 1.4; p<0.001 each). Closer examination argued against retarded glucose resorption from the gut, increased glucose excretion in urine, acute insulin-like or insulin sensitising properties, and direct inhibition of dipeptidyl peptidase-4 as the cause of glucose lowering. Hence, 55P0110 seems to act via a target not exploited by any drug presently approved for the treatment of diabetes mellitus. Whereas the insulinotropic sulfonylurea gliclazide (16 mg/kg) distinctly increased the circulating insulin-per-glucose ratio under basal conditions, 55P0110 (90 mg/kg) lacked such an effect (30 min. after dosing, nmol/mol: vehicle, 2.49 ± 0.27; 55P0110, 2.99 ± 0.35; gliclazide, 8.97 ± 0.49; p<0.001 each vs. gliclazide). Under an exogenous glucose challenge, however, 55P0110 increased this ratio to the same extent as gliclazide (20 min. after glucose feeding: vehicle, 2.53 ± 0.41; 55P0110, 3.80 ± 0.46; gliclazide, 3.99 ± 0.26; p<0.05 each vs. vehicle). By augmenting the glucose stimulated increase in plasma insulin, 55P0110 thus shows distinct anti-hyperglycaemic action in combination with low risk for fasting hypoglycaemia in mice. In summary, we have discovered a novel class of

  14. Selective Activation of Nociceptor TRPV1 Channel and Reversal of Inflammatory Pain in Mice by a Novel Coumarin Derivative Muralatin L from Murraya alata*

    PubMed Central

    Wei, Ning-Ning; Lv, Hai-Ning; Wu, Yang; Yang, Shi-Long; Sun, Xiao-Ying; Lai, Ren; Jiang, Yong; Wang, KeWei


    Coumarin and its derivatives are fragrant natural compounds isolated from the genus Murraya that are flowering plants widely distributed in East Asia, Australia, and the Pacific Islands. Murraya plants have been widely used as medicinal herbs for relief of pain, such as headache, rheumatic pain, toothache, and snake bites. However, little is known about their analgesic components and the molecular mechanism underlying pain relief. Here, we report the bioassay-guided fractionation and identification of a novel coumarin derivative, named muralatin L, that can specifically activate the nociceptor transient receptor potential vanilloid 1 (TRPV1) channel and reverse the inflammatory pain in mice through channel desensitization. Muralatin L was identified from the active extract of Murraya alata against TRPV1 transiently expressed in HEK-293T cells in fluorescent calcium FlexStation assay. Activation of TRPV1 current by muralatin L and its selectivity were further confirmed by whole-cell patch clamp recordings of TRPV1-expressing HEK-293T cells and dorsal root ganglion neurons isolated from mice. Furthermore, muralatin L could reverse inflammatory pain induced by formalin and acetic acid in mice but not in TRPV1 knock-out mice. Taken together, our findings show that muralatin L specifically activates TRPV1 and reverses inflammatory pain, thus highlighting the potential of coumarin derivatives from Murraya plants for pharmaceutical and medicinal applications such as pain therapy. PMID:26515068

  15. Selective Activation of Nociceptor TRPV1 Channel and Reversal of Inflammatory Pain in Mice by a Novel Coumarin Derivative Muralatin L from Murraya alata.


    Wei, Ning-Ning; Lv, Hai-Ning; Wu, Yang; Yang, Shi-Long; Sun, Xiao-Ying; Lai, Ren; Jiang, Yong; Wang, KeWei


    Coumarin and its derivatives are fragrant natural compounds isolated from the genus Murraya that are flowering plants widely distributed in East Asia, Australia, and the Pacific Islands. Murraya plants have been widely used as medicinal herbs for relief of pain, such as headache, rheumatic pain, toothache, and snake bites. However, little is known about their analgesic components and the molecular mechanism underlying pain relief. Here, we report the bioassay-guided fractionation and identification of a novel coumarin derivative, named muralatin L, that can specifically activate the nociceptor transient receptor potential vanilloid 1 (TRPV1) channel and reverse the inflammatory pain in mice through channel desensitization. Muralatin L was identified from the active extract of Murraya alata against TRPV1 transiently expressed in HEK-293T cells in fluorescent calcium FlexStation assay. Activation of TRPV1 current by muralatin L and its selectivity were further confirmed by whole-cell patch clamp recordings of TRPV1-expressing HEK-293T cells and dorsal root ganglion neurons isolated from mice. Furthermore, muralatin L could reverse inflammatory pain induced by formalin and acetic acid in mice but not in TRPV1 knock-out mice. Taken together, our findings show that muralatin L specifically activates TRPV1 and reverses inflammatory pain, thus highlighting the potential of coumarin derivatives from Murraya plants for pharmaceutical and medicinal applications such as pain therapy.

  16. Triptolide inhibits the progression of atherosclerosis in apolipoprotein E−/− mice

    PubMed Central

    Luo, Longfeng; Yang, Tianlun


    Atherosclerosis, the major cause of cardiovascular disease, is accompanied by a chronic inflammatory response during the disease. Triptolide (TPL) is an active natural compound that has been demonstrated to possess anti-inflammatory activities in various cell types. However, the effects of TPL on atherosclerosis have not yet been studied. The goal of the present study was to determine the effects of TPL on apolipoprotein E knock-out (ApoE−/−) mice fed with a high-fat diet and to analyze the changes in lipid metabolism and inflammatory cytokines to clarify the underlying molecular mechanisms. Firstly, the genotypes of ApoE−/− mice and corresponding wild-type mice were identified using polymerase chain reaction. The ApoE−/− mice were randomly divided into four groups: ApoE−/− model mice, and ApoE−/− mice treated with 25, 50 or 100 µg/kg TPL every twice day. Wild-type mice with the same genetic background constituted the fifth group. The mice in each group were given a high-fat diet from week 8 after birth until week 20. Total cholesterol and total triglyceride levels were determined at 16 and 20 weeks. The results demonstrated that the levels of total cholesterol and total triglyceride in the plasma were highly increased in ApoE−/− mice models, compared with those of wild-type mice, and the ApoE−/− mice treated with TPL had decreased levels of total cholesterol and total triglyceride in plasma, which exhibited a dose-dependent reduction as the dose of TPL increased. Moreover, the effects of TPL on the production of inflammatory cytokines in macrophages were determined by ELISA. The results demonstrated that the macrophages from ApoE−/− mice produced high levels of the inflammatory cytokines tumor necrosis factor-α, interleukin (IL)-1β, IL-6 and IL-8. However, following treatment with TPL doses of 25, 50 and 100 µg/kg, the cytokine levels were significantly decreased in a dose-dependent manner. Additionally, proteins associated with

  17. Mice repeatedly exposed to Group-A β-Haemolytic Streptococcus show perseverative behaviors, impaired sensorimotor gating, and immune activation in rostral diencephalon.


    Macrì, Simone; Ceci, Chiara; Onori, Martina Proietti; Invernizzi, Roberto William; Bartolini, Erika; Altabella, Luisa; Canese, Rossella; Imperi, Monica; Orefici, Graziella; Creti, Roberta; Margarit, Immaculada; Magliozzi, Roberta; Laviola, Giovanni


    Repeated exposure to Group-A β-Haemolytic Streptococcus (GAS) may constitute a vulnerability factor in the onset and course of pediatric motor disturbances. GAS infections/colonization can stimulate the production of antibodies, which may cross the blood brain barrier, target selected brain areas (e.g. basal ganglia), and exacerbate motor alterations. Here, we exposed developing SJL male mice to four injections with a GAS homogenate and evaluated the following domains: motor coordination; general locomotion; repetitive behaviors; perseverative responses; and sensorimotor gating (pre-pulse inhibition, PPI). To demonstrate that behavioral changes were associated with immune-mediated brain alterations, we analyzed, in selected brain areas, the presence of infiltrates and microglial activation (immunohistochemistry), monoamines (HPLC), and brain metabolites (in vivo Magnetic Resonance Spectroscopy). GAS-exposed mice showed increased repetitive and perseverative behaviors, impaired PPI, and reduced concentrations of serotonin in prefrontal cortex, a brain area linked to the behavioral domains investigated, wherein they also showed remarkable elevations in lactate. Active inflammatory processes were substantiated by the observation of infiltrates and microglial activation in the white matter of the anterior diencephalon. These data support the hypothesis that repeated GAS exposure may elicit inflammatory responses in brain areas involved in motor control and perseverative behavior, and result in phenotypic abnormalities.

  18. Mice repeatedly exposed to Group-A β-Haemolytic Streptococcus show perseverative behaviors, impaired sensorimotor gating, and immune activation in rostral diencephalon

    PubMed Central

    Macrì, Simone; Ceci, Chiara; Onori, Martina Proietti; Invernizzi, Roberto William; Bartolini, Erika; Altabella, Luisa; Canese, Rossella; Imperi, Monica; Orefici, Graziella; Creti, Roberta; Margarit, Immaculada; Magliozzi, Roberta; Laviola, Giovanni


    Repeated exposure to Group-A β-Haemolytic Streptococcus (GAS) may constitute a vulnerability factor in the onset and course of pediatric motor disturbances. GAS infections/colonization can stimulate the production of antibodies, which may cross the blood brain barrier, target selected brain areas (e.g. basal ganglia), and exacerbate motor alterations. Here, we exposed developing SJL male mice to four injections with a GAS homogenate and evaluated the following domains: motor coordination; general locomotion; repetitive behaviors; perseverative responses; and sensorimotor gating (pre-pulse inhibition, PPI). To demonstrate that behavioral changes were associated with immune-mediated brain alterations, we analyzed, in selected brain areas, the presence of infiltrates and microglial activation (immunohistochemistry), monoamines (HPLC), and brain metabolites (in vivo Magnetic Resonance Spectroscopy). GAS-exposed mice showed increased repetitive and perseverative behaviors, impaired PPI, and reduced concentrations of serotonin in prefrontal cortex, a brain area linked to the behavioral domains investigated, wherein they also showed remarkable elevations in lactate. Active inflammatory processes were substantiated by the observation of infiltrates and microglial activation in the white matter of the anterior diencephalon. These data support the hypothesis that repeated GAS exposure may elicit inflammatory responses in brain areas involved in motor control and perseverative behavior, and result in phenotypic abnormalities. PMID:26304458

  19. Islets of Langerhans from prohormone convertase-2 knockout mice show α-cell hyperplasia and tumorigenesis with elevated α-cell neogenesis.


    Jones, Huw B; Reens, Jaimini; Brocklehurst, Simon R; Betts, Catherine J; Bickerton, Sue; Bigley, Alison L; Jenkins, Richard P; Whalley, Nicky M; Morgan, Derrick; Smith, David M


    Antagonism of the effects of glucagon as an adjunct therapy with other glucose-lowering drugs in the chronic treatment of diabetes has been suggested to aggressively control blood glucose levels. Antagonism of glucagon effects, by targeting glucagon secretion or disabling the glucagon receptor, is associated with α-cell hyperplasia. We evaluated the influence of total glucagon withdrawal on islets of Langerhans using prohormone convertase-2 knockout mice (PC2-ko), in which α-cell hyperplasia is present from a young age and persists throughout life, in order to understand whether or not sustained glucagon deficit would lead to islet tumorigenesis. PC2-ko and wild-type (WT) mice were maintained drug-free, and cohorts of these groups sampled at 3, 12 and 18 months for plasma biochemical and morphological (histological, immunohistochemical, electron microscopical and image analytical) assessments. WT mice showed no islet tumours up to termination of the study, but PC2-ko animals displayed marked changes in islet morphology from α-cell hypertrophy/hyperplasia/atypical hyperplasia, to adenomas and carcinomas, these latter being first encountered at 6-8 months. Islet hyperplasias and tumours primarily consisted of α-cells associated to varying degrees with other islet endocrine cell types. In addition to substantial increases in islet neoplasia, increased α-cell neogenesis associated primarily with pancreatic duct(ule)s was present. We conclude that absolute blockade of the glucagon signal results in tumorigenesis and that the PC2-ko mouse represents a valuable model for investigation of islet tumours and pancreatic ductal neogenesis.

  20. Modulation of behavior by the histaminergic system: lessons from H(1)R-and H(2)R-deficient mice.


    Schneider, Erich H; Neumann, Detlef; Seifert, Roland


    Besides acting in the immune system, histamine is also a neurotransmitter in the central nervous system. The H1R causes central side effects, e.g. of first generation antihistamines, antidepressants or antipsychotics and represents the component of the central histaminergic system most extensively studied in behavior experiments with knock-out mice. Central effects of H2R are similar, but only few behavioral results from knockout models are available. We summarize the behavior phenotype of H1R- and H2R-deficient mice, revealing histaminergic modulation of behaviors like locomotor activity, cognition, emotional states, arousal, sleep and wakefulness, circadian rhythm, pain perception, food intake and energy consumption, respiration and susceptibility to seizures. Knock-out models demonstrate several central effects of H1R and H2R that are not clinically and therapeutically exploited to date. We critically discuss problems and pitfalls of both the knock-out mouse technique and the pharmacological approach with receptor-selective ligands. The behavioral characterization of Hrh1(-/-)- and Hrh2(-/-)-mice is crucial, because many pharmacological agents lack the required selectivity to unequivocally address the functions of a single histamine receptor subtype.

  1. Remodelling of motor nerve terminals in demyelinating axons of periaxin null mutant mice

    PubMed Central

    Court, Felipe A; Brophy, Peter J; Ribchester, Richard R


    Myelin formation around axons increases nerve conduction velocity and regulates phenotypic characteristics of the myelinated axon. In the peripheral nervous system, demyelinating forms of hereditary Charcot-Marie-Tooth (CMT) diseases, due to Schwann-cell intrinsic molecular defects, leads to reduced nerve conduction velocity and changes in the axonal phenotype. Several mouse models of CMT diseases have been generated, allowing the study of consequences of demyelination in peripheral nerve fibres. Nevertheless, the effect of demyelination at the level of the neuromuscular synapse has been largely overlooked. Here we show that in the periaxin knock-out mice, a model of CMT condition, neuromuscular junctions develop profound morphological changes in pre-terminal region of motoraxons. These changes include extensive preterminal branches which originate in demyelinated regions of the nerve fibre and axonal swellings associated with residually-myelinated regions of the fibre. Using intracellular recording from muscle fibres we detected asynchronous failure of action potential transmission at high but not low stimulation frequencies, a phenomenon consistent with branch point failure. Taken together, our morphological and electrophysiological findings suggest that preterminal branching due to segmental demyelination near the neuromuscular synapse in periaxin KO mice may underlie phenotypic disabilities present in this mouse model of CMT disease. These results opens a new avenue of research in order to understand the cellular changes responsible for clinical disabilities in demyelinating conditions. PMID:18205176

  2. Glutamate input in the dorsal raphe nucleus as a determinant of escalated aggression in male mice.


    Takahashi, Aki; Lee, Ray X; Iwasato, Takuji; Itohara, Shigeyoshi; Arima, Hiroshi; Bettler, Bernhard; Miczek, Klaus A; Koide, Tsuyoshi


    Although the dorsal raphe nucleus (DRN) has long been linked to neural control of aggression, little is known about the regulatory influences of the DRN when an animal engages in either adaptive species-typical aggressive behavior or escalated aggression. Therefore it is important to explore which neurotransmitter inputs into the DRN determine the escalation of aggression in male mice. Previously, we observed that microinjection of the GABAB receptor agonist baclofen into the DRN escalates aggressive behavior in male mice. Here, we used a serotonin (5-HT) neuron-specific GABAB receptor knock-out mouse to demonstrate that baclofen acts on nonserotonergic neurons to escalate aggression. Intra-DRN baclofen administration increased glutamate release, but did not alter GABA release, within the DRN. Microinjection of l-glutamate into the DRN escalated dose-dependently attack bites toward an intruder. In vivo microdialysis showed that glutamate release increased in the DRN during an aggressive encounter, and the level of glutamate was further increased when the animal was engaged in escalated aggressive behavior after social instigation. Finally, 5-HT release was increased within the DRN and also in the medial prefrontal cortex when animals were provoked by social instigation, and during escalated aggression after social instigation, but this increase in 5-HT release was not observed when animals were engaged in species-typical aggression. In summary, glutamate input into the DRN is enhanced during escalated aggression, which causes a phasic increase of 5-HT release from the DRN 5-HT neurons.

  3. Comprehensive Behavioral Analysis of Male Ox1r (-/-) Mice Showed Implication of Orexin Receptor-1 in Mood, Anxiety, and Social Behavior.


    Abbas, Md G; Shoji, Hirotaka; Soya, Shingo; Hondo, Mari; Miyakawa, Tsuyoshi; Sakurai, Takeshi


    Neuropeptides orexin A and orexin B, which are exclusively produced by neurons in the lateral hypothalamic area, play an important role in the regulation of a wide range of behaviors and homeostatic processes, including regulation of sleep/wakefulness states and energy homeostasis. The orexin system has close anatomical and functional relationships with systems that regulate the autonomic nervous system, emotion, mood, the reward system, and sleep/wakefulness states. Recent pharmacological studies using selective antagonists have suggested that orexin receptor-1 (OX1R) is involved in physiological processes that regulate emotion, the reward system, and autonomic nervous system. Here, we examined Ox1r (-/-) mice with a comprehensive behavioral test battery to screen additional OX1R functions. Ox1r (-/-) mice showed increased anxiety-like behavior, altered depression-like behavior, slightly decreased spontaneous locomotor activity, reduced social interaction, increased startle response, and decreased prepulse inhibition. These results suggest that OX1R plays roles in social behavior and sensory motor gating in addition to roles in mood and anxiety.

  4. Cannabinoid receptor 1 antagonist treatment induces glucagon release and shows an additive therapeutic effect with GLP-1 agonist in diet-induced obese mice.


    Patel, Kartikkumar Navinchandra; Joharapurkar, Amit Arvind; Patel, Vishal; Kshirsagar, Samadhan Govind; Bahekar, Rajesh; Srivastava, Brijesh Kumar; Jain, Mukul R


    Cannabinoid 1 (CB1) receptor antagonists reduce body weight and improve insulin sensitivity. Preclinical data indicates that an acute dose of CB1 antagonist rimonabant causes an increase in blood glucose. A stable analog of glucagon-like peptide 1 (GLP-1), exendin-4 improves glucose-stimulated insulin secretion in pancreas, and reduces appetite through activation of GLP-1 receptors in the central nervous system and liver. We hypothesized that the insulin secretagogue effect of GLP-1 agonist exendin-4 may synergize with the insulin-sensitizing action of rimonabant. Intraperitoneal as well as intracerebroventricular administration of rimonabant increased serum glucose upon glucose challenge in overnight fasted, diet-induced obese C57 mice, with concomitant rise in serum glucagon levels. Exendin-4 reversed the acute hyperglycemia induced by rimonabant. The combination of exendin-4 and rimonabant showed an additive effect in the food intake, and sustained body weight reduction upon repeated dosing. The acute efficacy of both the compounds was additive for inducing nausea-like symptoms in conditioned aversion test in mice, whereas exendin-4 treatment antagonized the effect of rimonabant on forced swim test upon chronic dosing. Thus, the addition of exendin-4 to rimonabant produces greater reduction in food intake owing to increased aversion, but reduces the other central nervous system side effects of rimonabant. The hyperglucagonemia induced by rimonabant is partially responsible for enhancing the antiobesity effect of exendin-4.

  5. Artificial sweetener neohesperidin dihydrochalcone showed antioxidative, anti-inflammatory and anti-apoptosis effects against paraquat-induced liver injury in mice.


    Shi, Qiong; Song, Xiufang; Fu, Juanli; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang


    The present study evaluated the protective effect of artificial sweetener neohesperidin dihydrochalcone (NHDC) against paraquat (PQ)-induced acute liver injury in mice. A single dose of PQ (75mg/kg body weight, i.p.) induced acute liver toxicity with the evidences of increased liver damage biomarkers, aspartate transaminase (AST) and alanine transaminase (ALT) activities in serum. Consistently, PQ decreased the antioxidant capacity by reducing glutathione peroxidase (GP-X), glutathione-S-transferase (GST) and catalase (CAT) activities, glutathione (GSH) level and total antioxidant capacity (T-AOC), as well as increasing reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) levels. Histopathological examination revealed that PQ induced numerous changes in the liver tissues. Immunochemical staining assay indicated the upregulation of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) expressions. However, NHDC ameliorates PQ-induced hepatic toxicity in mice by reversing these parameters. Additionally, NHDC significantly inhibited PQ-induced nuclear factor-kappa B (NF-κB) expression and mitochondrial-driven apoptotic signaling. TUNEL assay confirmed that PQ-induced apoptosis was relieved by NHDC. In conclusion, these findings suggested that NHDC showed potent antioxidant, anti-inflammatory and anti-apoptotic effects against PQ-induced acute liver damage.

  6. T-type calcium channel Cav3.2 deficient mice show elevated anxiety, impaired memory and reduced sensitivity to psychostimulants

    PubMed Central

    Gangarossa, Giuseppe; Laffray, Sophie; Bourinet, Emmanuel; Valjent, Emmanuel


    The fine-tuning of neuronal excitability relies on a tight control of Ca2+ homeostasis. The low voltage-activated (LVA) T-type calcium channels (Cav3.1, Cav3.2 and Cav3.3 isoforms) play a critical role in regulating these processes. Despite their wide expression throughout the central nervous system, the implication of T-type Cav3.2 isoform in brain functions is still poorly characterized. Here, we investigate the effect of genetic ablation of this isoform in affective disorders, including anxiety, cognitive functions as well as sensitivity to drugs of abuse. Using a wide range of behavioral assays we show that genetic ablation of the cacna1h gene results in an anxiety-like phenotype, whereas novelty-induced locomotor activity is unaffected. Deletion of the T-type channel Cav3.2 also triggers impairment of hippocampus-dependent recognition memories. Acute and sensitized hyperlocomotion induced by d-amphetamine and cocaine are dramatically reduced in T-type Cav3.2 deficient mice. In addition, the administration of the T-type blocker TTA-A2 prevented the expression of locomotor sensitization observed in wildtype mice. In conclusion, our data reveal that physiological activity of this specific Ca2+ channel is required for affective and cognitive behaviors. Moreover, our work highlights the interest of T-type channel blockers as therapeutic strategies to reverse drug-associated alterations. PMID:24672455

  7. Octaphlorethol A: a potent α-glucosidase inhibitor isolated from Ishige foliacea shows an anti-hyperglycemic effect in mice with streptozotocin-induced diabetes.


    Lee, Seung-Hong; Kang, Sung-Myung; Ko, Seok-Chun; Moon, Sang-Ho; Jeon, Byong-Tae; Lee, Dae Ho; Jeon, You-Jin


    α-Glucosidase inhibitors are important agents for decreasing postprandial hyperglycemia. The current study examined the inhibitory effects of octaphlorethol A (OPA) isolated from Ishige foliacea, a brown alga, on α-glucosidase, and analyzed the inhibitor's binding modes using the crystal structure of α-glucosidase. The effects of OPA on postprandial blood glucose levels after meals were also investigated. The IC50 value of OPA against α-glucosidase was 0.11 mM, which is higher than that of the commercial inhibitor acarbose. For further insights, we predicted the 3D structure of α-glucosidase and used a docking algorithm to simulate binding between α-glucosidase and OPA. These molecular modeling studies were successful, and indicated that OPA interacts with Phe575, His600, Arg526, Met444, Asp542, Tyr605, Ser448, Asp203, Lys480, and Phe450. Furthermore, increases in postprandial blood glucose levels were significantly suppressed in the OPA-treated group compared with those in the streptozotocin-induced diabetic or normal mice. Additionally, the area under the curve was significantly reduced following OPA administration (907 versus 1034 mg h dL(-1)) in the diabetic mice, along with a delay in the absorption of dietary carbohydrates. Collectively, these results indicated that OPA is a potent inhibitor of α-glucosidase, and shows potential to be used as an anti-diabetic agent.

  8. Mice deficient for the type II topoisomerase-like DNA transesterase Spo11 show normal immunoglobulin somatic hypermutation and class switching.


    Klein, Ulf; Esposito, Gloria; Baudat, Frédéric; Keeney, Scott; Jasin, Maria


    Somatic hypermutation in B cells undergoing T cell dependent immune responses generates high affinity antibodies that provide protective immunity. B cells also switch from the expression of immunoglobulin (Ig) M and IgD to that of other Ig classes through somatic DNA recombination. Recent work has implicated DNA strand breaks, possibly DNA double strand breaks (DSB), as the initiating lesions in both class switch recombination and hypermutation, although the etiology of these lesions is not understood. Spo11, a protein structurally related to archaeal type II topoisomerases, generates DSB that initiate meiotic recombination. This characteristic, together with its expression pattern, marks this enzyme as a potential candidate for the initiation of hypermutation, and perhaps also for Ig class switching. To investigate whether Spo11 is involved in these processes, we studied the T cell dependent immune response of Spo11-deficient (Spo11(-/-)) mice against the hapten nitrophenyl (NP). We found that V186.2-bearing IgG1 transcripts had normal levels and patterns of somatic hypermutation. Furthermore, Spo11(-/-) mice showed normal serum levels of all Ig isotypes. These results indicate that Spo11 is not required for Ig hypermutation or class switch recombination.

  9. The environmental chemical tributyltin chloride (TBT) shows both estrogenic and adipogenic activities in mice which might depend on the exposure dose

    SciTech Connect

    Penza, M.; Jeremic, M.; Marrazzo, E.; Maggi, A.; Ciana, P.; Rando, G.; Grigolato, P.G.; Di Lorenzo, D.


    Exposure during early development to chemicals with hormonal action may be associated with weight gain during adulthood because of altered body homeostasis. It is known that organotins affect adipose mass when exposure occurs during fetal development, although no knowledge of effects are available for exposures after birth. Here we show that the environmental organotin tributyltin chloride (TBT) exerts adipogenic action when peripubertal and sexually mature mice are exposed to the chemical. The duration and extent of these effects depend on the sex and on the dose of the compound, and the effects are relevant at doses close to the estimated human intake (0.5 {mu}g/kg). At higher doses (50-500 {mu}g/kg), TBT also activated estrogen receptors (ERs) in adipose cells in vitro and in vivo, based on results from acute and longitudinal studies in ERE/luciferase reporter mice. In 3T3-L1 cells (which have no ERs), transiently transfected with the ERE-dependent reporter plus or minus ER{alpha} or ER{beta}, TBT (in a dose range of 1-100 nM) directly targets each ER subtype in a receptor-specific manner through a direct mechanism mediated by ER{alpha} in undifferentiated preadipocytic cells and by ER{beta} in differentiating adipocytes. The ER antagonist ICI-182,780 inhibits this effect. In summary, the results of this work suggest that TBT is adipogenic at all ages and in both sexes and that it might be an ER activator in fat cells. These findings might help to resolve the apparent paradox of an adipogenic chemical being also an estrogen receptor activator by showing that the two apparently opposite actions are separated by the different doses to which the organism is exposed. - Research Highlights: > The environmental organotin tributyltin chloride shows dose-dependent estrogenic and adipogenic activities in mice. > The duration and extent of these effects depend on the sex and the dose of the compound. > The estrogenic and adipogenic effects of TBT occur at doses closed to

  10. p47phox-Nox2-dependent ROS Signaling Inhibits Early Bone Development in Mice but Protects against Skeletal Aging.


    Chen, Jin-Ran; Lazarenko, Oxana P; Blackburn, Michael L; Mercer, Kelly E; Badger, Thomas M; Ronis, Martin J J


    Bone remodeling is age-dependently regulated and changes dramatically during the course of development. Progressive accumulation of reactive oxygen species (ROS) has been suspected to be the leading cause of many inflammatory and degenerative diseases, as well as an important factor underlying many effects of aging. In contrast, how reduced ROS signaling regulates inflammation and remodeling in bone remains unknown. Here, we utilized a p47(phox) knock-out mouse model, in which an essential cytosolic co-activator of Nox2 is lost, to characterize bone metabolism at 6 weeks and 2 years of age. Compared with their age-matched wild type controls, loss of Nox2 function in p47(phox-/-) mice resulted in age-related switch of bone mass and strength. Differences in bone mass were associated with increased bone formation in 6-week-old p47(phox-/-) mice but decreased in 2-year-old p47(phox-/-) mice. Despite decreases in ROS generation in bone marrow cells and p47(phox)-Nox2 signaling in osteoblastic cells, 2-year-old p47(phox-/-) mice showed increased senescence-associated secretory phenotype in bone compared with their wild type controls. These in vivo findings were mechanistically recapitulated in ex vivo cell culture of primary fetal calvarial cells from p47(phox-/-) mice. These cells showed accelerated cell senescence pathway accompanied by increased inflammation. These data indicate that the observed age-related switch of bone mass in p47(phox)-deficient mice occurs through an increased inflammatory milieu in bone and that p47(phox)-Nox2-dependent physiological ROS signaling suppresses inflammation in aging.

  11. Uncoupling of interleukin-6 from its signalling pathway by dietary n-3-polyunsaturated fatty acid deprivation alters sickness behaviour in mice

    PubMed Central

    Mingam, Rozenn; Moranis, Aurélie; Bluthé, Rose-Marie; De Smedt-Peyrusse, Véronique; Kelley, Keith W.; Guesnet, Philippe; Lavialle, Monique; Dantzer, Robert; Layé, Sophie


    Sickness behaviour is an adaptive behavioural response to the activation of the innate immune system. It is mediated by brain cytokine production and action, especially interleukin-6 (IL-6). Polyunsaturated fatty acids (PUFA) are essential fatty acids that are highly incorporated in brain cells membranes and display immunomodulating properties. We hypothesized that a decrease in n-3 PUFA brain level by dietary means impacts on lipopolysaccharide (LPS)-induced IL-6 production and sickness behaviour. Our results show that mice exposed throughout life to a diet containing n-3 PUFA (n-3/n-6 diet) display a decrease in social interaction that does not occur in mice submitted to a diet devoid of n-3 PUFA (n-6 diet). LPS induced high IL-6 plasma levels as well as expression of IL-6 mRNA in the hippocampus and cFos mRNA in the brainstem of mice fed either diet, indicating intact immune-to-brain communication. However, STAT3 and STAT1 activation, a hallmark of IL-6 signalling pathway, was lower in the hippocampus of LPS-treated n-6 mice as compared to n-3/n-6 mice. In addition, LPS did not reduce social interaction in IL-6 knock-out (IL-6 KO) mice and failed to induce STAT3 activation in the brain of IL-6 KO mice. Altogether, these findings point to alteration in brain STAT3 as a key mechanism for the lack of effect of LPS on social interaction in mice fed with the n-6 PUFA diet. The relative deficiency of Western diets in n-3 PUFA could impact on behavioural aspects of the host response to infection. PMID:18973601

  12. Hyperoxia-induced immature brain injury through the TLR4 signaling pathway in newborn mice.


    Liu, Yang; Jiang, Pu; Du, Min; Chen, Kun; Chen, Amber; Wang, Yang; Cao, Fei; Deng, Shixiong; Xu, Ying


    Toll-like receptor 4 (TLR4), a pathogen-associated molecular pattern receptor, is known to initiate an inflammatory cascade in response to certain stimuli within the central nervous system (CNS). Although TLR4 activation is known to be a first-line response of the innate immune system, whether and how hyperoxia influences TLR4 signaling in an immature brain remains unclear. In this study, TLR4 wild-type (W) and TLR4 knock-out(M) mice were exposed to 100% oxygen (the WO2 and MO2 groups, respectively), and control groups were exposed to ambient air (the WA and MA groups, respectively) for 48 h after postnatal-day (PND) 3. Next, neuronal apoptosis was quantified, and Morris water maze assays were conducted. The WO2 mice showed increased TLR4 expression compared with the WA mice, additionally, the expression level of Tumor Necrosis Factor-α (TNF-α) in the WO2 mice was significantly increased compared with the levels in the WA, MA and MO2 mice. Electron microscopy and terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) assays showed a significant increase, compared to the WO2 mice, in neuronal apoptosis within the prefrontal cortex and hippocampal CA1 region in the WO2 mice. In contrast, there were no obvious differences in neuronal apoptosis between the MO2 and MA groups. The results of the Morris water maze tests demonstrated marked deficits in learning and memory in the WO2 mice but much milder deficits in the MO2 mice compared to the WA and MA groups, respectively. Moreover, cultured N9 (TLR4 wild-type, derived from ICR/CD1 mice) microglia exposed to hyperoxia showed an immediate increase in the expression of TLR4 mRNA, followed by an increase in the expression of both TNF-α and reactive oxygen species (ROS), but this increase was abrogated by the loss of TLR4 signaling in TLR4-knockout microglia (primary cells from a C3H/HeJ strain defective in TLR4). Taken together, these data suggest that 1) TLR4 signaling is involved in

  13. The environmental chemical tributyltin chloride (TBT) shows both estrogenic and adipogenic activities in mice which might depend on the exposure dose.


    Penza, M; Jeremic, M; Marrazzo, E; Maggi, A; Ciana, P; Rando, G; Grigolato, P G; Di Lorenzo, D


    Exposure during early development to chemicals with hormonal action may be associated with weight gain during adulthood because of altered body homeostasis. It is known that organotins affect adipose mass when exposure occurs during fetal development, although no knowledge of effects are available for exposures after birth. Here we show that the environmental organotin tributyltin chloride (TBT) exerts adipogenic action when peripubertal and sexually mature mice are exposed to the chemical. The duration and extent of these effects depend on the sex and on the dose of the compound, and the effects are relevant at doses close to the estimated human intake (0.5μg/kg). At higher doses (50-500μg/kg), TBT also activated estrogen receptors (ERs) in adipose cells in vitro and in vivo, based on results from acute and longitudinal studies in ERE/luciferase reporter mice. In 3T3-L1 cells (which have no ERs), transiently transfected with the ERE-dependent reporter plus or minus ERα or ERβ, TBT (in a dose range of 1-100nM) directly targets each ER subtype in a receptor-specific manner through a direct mechanism mediated by ERα in undifferentiated preadipocytic cells and by ERβ in differentiating adipocytes. The ER antagonist ICI-182,780 inhibits this effect. In summary, the results of this work suggest that TBT is adipogenic at all ages and in both sexes and that it might be an ER activator in fat cells. These findings might help to resolve the apparent paradox of an adipogenic chemical being also an estrogen receptor activator by showing that the two apparently opposite actions are separated by the different doses to which the organism is exposed.

  14. Phenobarbital and propiconazole toxicogenomic profiles in mice show major similarities consistent with the key role that constitutive androstane receptor (CAR) activation plays in their mode of action.


    Currie, Richard A; Peffer, Richard C; Goetz, Amber K; Omiecinski, Curtis J; Goodman, Jay I


    Toxicogenomics (TGx) is employed frequently to investigate underlying molecular mechanisms of the compound of interest and, thus, has become an aid to mode of action determination. However, the results and interpretation of a TGx dataset are influenced by the experimental design and methods of analysis employed. This article describes an evaluation and reanalysis, by two independent laboratories, of previously published TGx mouse liver microarray data for a triazole fungicide, propiconazole (PPZ), and the anticonvulsant drug phenobarbital (PB). Propiconazole produced an increase incidence of liver tumors in male CD-1 mice only at a dose that exceeded the maximum tolerated dose (2500 ppm). Firstly, we illustrate how experimental design differences between two in vivo studies with PPZ and PB may impact the comparisons of TGx results. Secondly, we demonstrate that different researchers using different pathway analysis tools can come to different conclusions on specific mechanistic pathways, even when using the same datasets. Finally, despite these differences the results across three different analyses also show a striking degree of similarity observed for PPZ and PB treated livers when the expression data are viewed as major signaling pathways and cell processes affected. Additional studies described here show that the postulated key event of hepatocellular proliferation was observed in CD-1 mice for both PPZ and PB, and that PPZ is also a potent activator of the mouse CAR nuclear receptor. Thus, with regard to the events which are hallmarks of CAR-induced effects that are key events in the mode of action (MOA) of mouse liver carcinogenesis with PB, PPZ-induced tumors can be viewed as being promoted by a similar PB-like CAR-dependent MOA.

  15. Deletion of CD73 in mice leads to Aortic Valve Dysfunction.


    Zukowska, P; Kutryb-Zajac, B; Jasztal, A; Toczek, M; Zabielska, M; Borkowski, T; Khalpey, Z; Smolenski, R T; Slominska, E M


    Aortic stenosis is known to involve inflammation and thrombosis. Changes in activity of extracellular enzyme - ecto-5'-nucleotidase (referred also as CD73) can alter inflammatory and thrombotic responses. This study aimed to evaluate the effect of CD73 deletion in mice on development of aortic valve dysfunction and to compare it to the effect of high-fat diet. Four groups of mice (normal-diet Wild Type (WT), high-fat diet WT, normal diet CD73-/-, high-fat diet CD73-/-) were maintained for 15weeks followed by echocardiographic analysis of aortic valve function, measurement of aortic surface activities of nucleotide catabolism enzymes as well as alkaline phosphatase activity, mineral composition and histology of aortic valve leaflets. CD73-/- knock out led to an increase in peak aortic flow (1.06±0.26m/s) compared to WT (0.79±0.26m/s) indicating obstruction. Highest values of peak aortic flow (1.26±0.31m/s) were observed in high-fat diet CD73-/- mice. Histological analysis showed morphological changes in CD73-/- including thickening and accumulation of dark deposits, proved to be melanin. Concentrations of Ca(2+), Mg(2+) and PO4(3-) in valve leaflets were elevated in CD73-/- mice. Alkaline phosphatase (ALP) activity was enhanced after ATP treatment and reduced after adenosine treatment in aortas incubated in osteogenic medium. AMP hydrolysis in CD73-/- was below 10% of WT. Activity of ecto-adenosine deaminase (eADA), responsible for adenosine deamination, in the CD73-/- was 40% lower when compared to WT. Deletion of CD73 in mice leads to aortic valve dysfunction similar to that induced by high-fat diet suggesting important role of this surface protein in maintaining heart valve integrity.

  16. Chitosan dressing promotes healing in third degree burns in mice: gene expression analysis shows biphasic effects for rapid tissue regeneration and decreased fibrotic signaling.


    Baxter, Ruth M; Dai, Tianhong; Kimball, Jess; Wang, Eugenia; Hamblin, Michael R; Wiesmann, William P; McCarthy, Simon J; Baker, Shenda M


    Burns are a significant health challenge and healing can result in scar formation. Chitosan, a derivative of chitin, has been used to promote wound healing. In this study we used gene expression profiling in a mouse model of full thickness cutaneous burn to assess the benefits of treating with a chitosan lactate dressing. Three days after wounding mice treated with chitosan showed increased expression of genes associated with formation of granulation tissue. At a later time point, seven days after wounding, genes that initially showed increased expression were now down-regulated, and there was increased expression of genes involved in remodeling suggesting that the chitosan treatment results in accelerated healing. Quantitative RT-PCR showed modulated mRNA levels for TGFβ1 by the chitosan dressing. TGFβ1 initially promotes healing but extended activity can result in scarring. Importantly we found that expression was elevated at day three, but decreased at day seven suggesting that chitosan treatment will not result in scar formation, and may even be beneficial in preventing scar formation. Additionally, the biphasic regulation of expression of TGFβ1 could be a powerful biomarker for future studies of the wound-healing potential of chitosan based and other treatments for burn wounds.

  17. iNOS null MRL+/+ mice show attenuation of trichloroethene-mediated autoimmunity: contribution of reactive nitrogen species and lipid-derived reactive aldehydes

    PubMed Central

    Wang, Gangduo; Wakamiya, Maki; Wang, Jianling; Ansari, G.A.S.; Khan, M. Firoze


    Earlier studies from our laboratory in MRL+/+ mice suggest that free radicals, especially overproduction of reactive nitrogen species (RNS) and lipid-derived reactive aldehydes (LDRAs), are associated with trichloroethene (TCE)-mediated autoimmune response. The current study was undertaken to further assess the contribution of RNS and LDRAs in TCE-mediated autoimmunity by using iNOS-null MRL+/+ mice. iNOS-null MRL+/+ mice were obtained by backcrossing iNOS-null mice (B6.129P2-Nos2tm1Lau/J) to MRL +/+ mice. Female MRL+/+ and iNOS-null MRL+/+ mice were given TCE (10 mmol/kg, i.p., every 4th day) for 6 weeks; their respective controls received corn oil only. TCE exposure led to significantly increased iNOS mRNA in livers, iNOS protein in livers and sera, increased nitrotyrosine (NT) formation in both livers and sera, induction of MDA-/HNE-protein adducts in livers and their respective antibodies in sera along with significant increases in serum antinuclear antibodies (ANA) and anti-dsDNA in MRL+/+ mice. Even though in iNOS-null MRL+/+ mice, the iNOS and NT levels were negligible in both TCE-treated and untreated groups, TCE treatment still led to significant increases in MDA-/HNE-protein adducts and their respective antibodies along with increases in serum ANA and anti-dsDNA compared to controls. Most remarkably, the increases in serum ANA and anti-dsDNA induced by TCE in the iNOS-null MRL+/+ mice were significantly less pronounced compared to that in MRL+/+ mice. Our results provide further evidence that both RNS and LDRAs contribute to TCE-induced autoimmunity in MRL+/+ mice, and iNOS deficiency attenuates this autoimmune response. PMID:26472195

  18. iNOS null MRL+/+ mice show attenuation of trichloroethene-mediated autoimmunity: contribution of reactive nitrogen species and lipid-derived reactive aldehydes.


    Wang, Gangduo; Wakamiya, Maki; Wang, Jianling; Ansari, G A S; Firoze Khan, M


    Earlier studies from our laboratory in MRL+/+ mice suggest that free radicals, especially overproduction of reactive nitrogen species (RNS) and lipid-derived reactive aldehydes (LDRAs), are associated with trichloroethene (TCE)-mediated autoimmune response. The current study was undertaken to further assess the contribution of RNS and LDRAs in TCE-mediated autoimmunity by using iNOS-null MRL+/+ mice. iNOS-null MRL+/+ mice were obtained by backcrossing iNOS-null mice (B6.129P2-Nos2(tm1Lau)/J) to MRL +/+ mice. Female MRL+/+ and iNOS-null MRL+/+ mice were given TCE (10 mmol/kg, i.p., every 4(th) day) for 6 weeks; their respective controls received corn oil only. TCE exposure led to significantly increased iNOS mRNA in livers, iNOS protein in livers and sera, increased nitrotyrosine (NT) formation in both livers and sera, induction of MDA-/HNE-protein adducts in livers and their respective antibodies in sera along with significant increases in serum antinuclear antibodies (ANA) and anti-dsDNA in MRL+/+ mice. Even though in iNOS-null MRL+/+ mice, the iNOS and NT levels were negligible in both TCE-treated and untreated groups, TCE treatment still led to significant increases in MDA-/HNE-protein adducts and their respective antibodies along with increases in serum ANA and anti-dsDNA compared to controls. Most remarkably, the increases in serum ANA and anti-dsDNA induced by TCE in the iNOS-null MRL+/+ mice were significantly less pronounced compared to that in MRL+/+ mice. Our results provide further evidence that both RNS and LDRAs contribute to TCE-induced autoimmunity in MRL+/+ mice, and iNOS deficiency attenuates this autoimmune response.

  19. Role of heat shock factor-1 activation in the doxorubicin-induced heart failure in mice.


    Vedam, Kaushik; Nishijima, Yoshinori; Druhan, Lawrence J; Khan, Mahmood; Moldovan, Nicanor I; Zweier, Jay L; Ilangovan, Govindasamy


    Treating cancer patients with chemotherapeutics, such as doxorubicin (Dox), cause dilated cardiomyopathy and congestive heart failure because of oxidative stress. On the other hand, heat shock factor-1 (HSF-1), a transcription factor for heat shock proteins (Hsps), is also known to be activated in response to oxidative stress. However, the possible role of HSF-1 activation and the resultant Hsp25 in chemotherapeutic-induced heart failure has not been investigated. Using HSF-1 wild-type (HSF-1(+/+)) and knock-out (HSF-1(-/-)) mice, we tested the hypothesis that activation of HSF-1 plays a role in the development of Dox-induced heart failure. Higher levels of Hsp25 and its phosphorylated forms were found in the failing hearts of Dox-treated HSF-1(+/+) mice. More than twofold increase in Hsp25 mRNA level was found in Dox-treated hearts. Proteomic analysis showed that there is accumulation and aggregation of Hsp25 in Dox-treated failing hearts. Additionally, Hsp25 was found to coimmunoprecipitate with p53 and vice versa. Further studies indicated that the Dox-induced higher levels of Hsp25 transactivated p53 leading to higher levels of the pro-apoptotic protein Bax, but other p53-related proteins remained unaltered. Moreover, HSF-1(-/-) mice showed significantly reduced Dox-induced heart failure and higher survival rate, and there was no change in Bax upon treating with Dox in HSF-1(-/-) mice. From these results we propose a novel mechanism for Dox-induced heart failure: increased expression of Hsp25 because of oxidant-induced activation of HSF-1 transactivates p53 to increase Bax levels, which leads to heart failure.

  20. Both pre- and post-synaptic alterations contribute to aberrant cholinergic transmission in superior cervical ganglia of APP(-/-) mice.


    Cai, Zhao-Lin; Zhang, Jia-Jia; Chen, Ming; Wang, Jin-Zhao; Xiao, Peng; Yang, Li; Long, Cheng


    Though amyloid precursor protein (APP) can potentially be cleaved to generate the pathological amyloid β peptide (Aβ), APP itself plays an important role in regulating neuronal activity. APP deficiency causes functional impairment in cholinergic synaptic transmission and cognitive performance. However, the mechanisms underlying altered cholinergic synaptic transmission in APP knock-out mice (APP(-/-)) are poorly understood. In this study, we conducted in vivo extracellular recording to investigate cholinergic compound action potentials (CAPs) of the superior cervical ganglion (SCG) in APP(-/-) and littermate wild-type (WT) mice. Our results demonstrate that APP not only regulates presynaptic activity, but also affects postsynaptic function at cholinergic synapses in SCG. APP deficiency reduces the number of vesicles in presynaptic terminalsand attenuatesthe amplitude of CAPs, likely due to dysfunction of high-affinity choline transporters. Pharmacological and biochemical examination showed that postsynaptic responsesmediated by α4β2 and α7 nicotinic acetylcholine receptors are reduced in the absence of APP. Our research provides evidences on how APP regulates cholinergic function and therefore may help to identify potential therapeutic targets to treat cholinergic dysfunction associated with Alzheimer's disease pathogenesis.

  1. Mice lacking the serotonin 5-HT2B receptor as an animal model of resistance to selective serotonin reuptake inhibitors antidepressants.


    Diaz, Silvina Laura; Narboux-Nême, Nicolas; Boutourlinsky, Katia; Doly, Stéphane; Maroteaux, Luc


    Depressive disorders are among the most prevalent neuropsychiatric dysfunctions worldwide, with high rates of resistance to antidepressant treatment. Genetic factors clearly contribute to the manifestation of depression as well as to the response to antidepressants. Transgenic mouse models appear as seminal tools to disentangle this complex disorder. Here, we analyzed new key aspects of the phenotype of knock-out mice for the gene encoding the serotonin 2B receptor (Htr(2B)(-/-)), including basal phenotype, ability to develop a depressive-like phenotype upon chronic isolation, and effect of chronic exposure to fluoxetine on chronically stressed Htr(2B)(-/-) mice. We find, here, that Htr(2B)(-/-) mice display an antidepressant-like phenotype, which includes reduced latency to feed in the novelty suppressed feeding test, basal increase in hippocampal BDNF levels, no change in TrkB and p75 protein levels, and an increased preference for sucrose consumption compared to wild type (Htr(2B)(+/+)) mice. Nevertheless, we show that these mice can develop depressive-like behaviors when socially isolated during four weeks. Selective serotonin reuptake inhibitors (SSRI) have been previously shown to be ineffective in non-stressed Htr(2B)(-/-) mice. We evaluated, here, the effects of the SSRI fluoxetine in chronically stressed Htr(2B)(-/-) mice and similarly no behavioral or plastic effect was induced by this antidepressant. All together, these results highlight the suitability to study resistance to SSRI antidepressants of this mouse model displaying panoply of conditions among which behavioral, neurotrophic and plastic causative factors can be analyzed.

  2. Conditional ablation of myeloid TNF increases lesion volume after experimental stroke in mice, possibly via altered ERK1/2 signaling

    PubMed Central

    Clausen, Bettina Hjelm; Degn, Matilda; Sivasaravanaparan, Mithula; Fogtmann, Torben; Andersen, Maria Gammelstrup; Trojanowsky, Michelle D.; Gao, Han; Hvidsten, Svend; Baun, Christina; Deierborg, Tomas; Finsen, Bente; Kristensen, Bjarne Winther; Bak, Sara Thornby; Meyer, Morten; Lee, Jae; Nedospasov, Sergei A.; Brambilla, Roberta; Lambertsen, Kate Lykke


    Microglia are activated following cerebral ischemia and increase their production of the neuro- and immunomodulatory cytokine tumor necrosis factor (TNF). To address the function of TNF from this cellular source in focal cerebral ischemia we used TNF conditional knock out mice (LysMcreTNFfl/fl) in which the TNF gene was deleted in cells of the myeloid lineage, including microglia. The deletion reduced secreted TNF levels in lipopolysaccharide-stimulated cultured primary microglia by ~93%. Furthermore, phosphorylated-ERK/ERK ratios were significantly decreased in naïve LysMcreTNFfl/fl mice demonstrating altered ERK signal transduction. Micro-PET using 18[F]-fluorodeoxyglucose immediately after focal cerebral ischemia showed increased glucose uptake in LysMcreTNFfl/fl mice, representing significant metabolic changes, that translated into increased infarct volumes at 24 hours and 5 days compared to littermates (TNFfl/fl). In naïve LysMcreTNFfl/fl mice cytokine levels were low and comparable to littermates. At 6 hours, TNF producing microglia were reduced by 56% in the ischemic cortex in LysMcreTNFfl/fl mice compared to littermate mice, whereas no TNF+ leukocytes were detected. At 24 hours, pro-inflammatory cytokine (TNF, IL-1β, IL-6, IL-5 and CXCL1) levels were significantly lower in LysMcreTNFfl/fl mice, despite comparable infiltrating leukocyte populations. Our results identify microglial TNF as beneficial and neuroprotective in the acute phase and as a modulator of neuroinflammation at later time points after experimental ischemia, which may contribute to regenerative recovery. PMID:27384243

  3. In Situ Fluorescence Measurement of Tear Film [Na+], [K+], [Cl−], and pH in Mice Shows Marked Hypertonicity in Aquaporin-5 Deficiency

    PubMed Central

    Ruiz-Ederra, Javier; Levin, Marc H.; Verkman, A. S.


    Purpose Tear film composition depends on water and ion transport across ocular surface epithelia and on fluid secretion by lacrimal glands. The purpose of this study was to establish in situ fluorescence methods to measure tear film ionic concentrations and pH in mice and to determine whether tear film composition is sensitive to deficiency of the major ocular surface aquaporin water channels. Methods Tear film ionic concentrations and pH were measured in anesthetized mice by ratio imaging fluorescence microscopy after topical application of ion/pH-sensing, dual-wavelength fluorescent indicators. [Na+], [K+], and [Cl−] were measured with membrane-impermeant indicators developed by our laboratory, and pH was measured with bis(carboxyethyl)-carboxyfluorescein fluorescence-conjugated dextran. Measurements were performed on wild-type mice and on knockout mice lacking aquaporins AQP1, AQP3, and AQP5. Results In wild-type mice, tear film [Na+] was 139 ± 8 mM, [K+] was 48 ± 1 mM, [Cl−] was 127 ± 4 mM, and pH was 7.59 ± 0.2 (SE; n = 5–8). pH did not differ significantly in the AQP knockout mice. [Na+] was increased by approximately twofold in AQP5 null mice (230 ± 20 mM) and was greatly reduced after exposure of the ocular surface to a humidified atmosphere. [K+] was mildly reduced in AQP1 null mice. Conclusions These results establish an in situ optical methodology to measure tear film [Na+], [K+], [Cl−], and pH in living mice, without the need for fluid sampling. Tear film hypertonicity in AQP5 deficiency is likely caused by reduced transcorneal water secretion in response to evaporative water loss. PMID:19136711

  4. Genotoxicity and gene expression modulation of silver and titanium dioxide nanoparticles in mice.


    Asare, Nana; Duale, Nur; Slagsvold, Hege H; Lindeman, Birgitte; Olsen, Ann Karin; Gromadzka-Ostrowska, Joanna; Meczynska-Wielgosz, Sylwia; Kruszewski, Marcin; Brunborg, Gunnar; Instanes, Christine


    Recently, we showed that silver nanoparticles (AgNPs) caused apoptosis, necrosis and DNA strand breaks in different cell models in vitro. These findings warranted analyses of their relevance in vivo. We investigated the genotoxic potential and gene expression profiles of silver particles of nano- (Ag20, 20 nm) and submicron- (Ag200, 200 nm) size and titanium dioxide nanoparticles (TiO2-NPs, 21 nm) in selected tissues from exposed male mice including the gonades. A single dose of 5 mg/kg bw nanoparticles was administered intravenously to male mice derived from C57BL6 (WT) and 8-oxoguanine DNA glycosylase knock-out (Ogg1(-/-) KO). Testis, lung and liver were harvested one and seven days post-exposure and analyzed for DNA strand breaks and oxidized purines employing the Comet assay with Formamidopyrimidine DNA glycosylase (Fpg) treatment, and sperm DNA fragmentation by the sperm chromatin structure assay (SCSA). Based on an initial screening of a panel of 21 genes, seven genes were selected and their expression levels were analyzed in all lung and testis tissues sampled from all animals (n = 6 mice/treatment group) using qPCR. AgNPs, in particular Ag200, caused significantly increased levels of DNA strand breaks and alkali labile sites in lung, seven days post-exposure. Fpg-sensitive lesions were significantly induced in both testis and lung. The transcript level of some key genes; Atm, Rad51, Sod1, Fos and Mmp3, were significantly induced compared to controls, particularly in lung samples from Ag200-exposed KO mice. We conclude that the Ag200 causes genotoxicity and distinct gene expression patterns in selected DNA damage response and repair related genes.

  5. Involvement of estrogen receptor alpha, beta and oxytocin in social discrimination: A detailed behavioral analysis with knockout female mice.


    Choleris, E; Ogawa, S; Kavaliers, M; Gustafsson, J-A; Korach, K S; Muglia, L J; Pfaff, D W


    Social recognition, processing, and retaining information about conspecific individuals is crucial for the development of normal social relationships. The neuropeptide oxytocin (OT) is necessary for social recognition in male and female mice, with its effects being modulated by estrogens in females. In previous studies, mice whose genes for the estrogen receptor-alpha (alpha-ERKO) and estrogen receptor-beta (beta-ERKO) as well as OTKO were knocked out failed to habituate to a repeatedly presented conspecific and to dishabituate when the familiar mouse is replaced by a novel animal (Choleris et al. 2003, Proc Natl Acad Sci USA 100, 6192-6197). However, a binary social discrimination assay, where animals are given a simultaneous choice between a familiar and a previously unknown individual, offers a more direct test of social recognition. Here, we used alpha-ERKO, beta-ERKO, and OTKO female mice in the binary social discrimination paradigm. Differently from their wild-type controls, when given a choice, the KO mice showed either reduced (beta-ERKO) or completely impaired (OTKO and alpha-ERKO) social discrimination. Detailed behavioral analyses indicate that all of the KO mice have reduced anxiety-related stretched approaches to the social stimulus with no overall impairment in horizontal and vertical activity, non-social investigation, and various other behaviors such as, self-grooming, digging, and inactivity. Therefore, the OT, ER-alpha, and ER-beta genes are necessary, to different degrees, for social discrimination and, thus, for the modulation of social behavior (e.g. aggression, affiliation).

  6. Mouse Cytomegalovirus Infection in BALB/c Mice Resembles Virus-Associated Secondary Hemophagocytic Lymphohistiocytosis and Shows a Pathogenesis Distinct from Primary Hemophagocytic Lymphohistiocytosis.


    Brisse, Ellen; Imbrechts, Maya; Put, Karen; Avau, Anneleen; Mitera, Tania; Berghmans, Nele; Rutgeerts, Omer; Waer, Mark; Ninivaggi, Marisa; Kelchtermans, Hilde; Boon, Louis; Snoeck, Robert; Wouters, Carine H; Andrei, Graciela; Matthys, Patrick


    Hemophagocytic lymphohistiocytosis (HLH) is a life-threatening immunological disorder that is characterized by systemic inflammation, widespread organ damage, and hypercytokinemia. Primary HLH is caused by mutations in granule-mediated cytotoxicity, whereas secondary HLH occurs, without a known genetic background, in a context of infections, malignancies, or autoimmune and autoinflammatory disorders. Clinical manifestations of both HLH subtypes are often precipitated by a viral infection, predominantly with Herpesviridae. Exploiting this knowledge, we established an animal model of virus-associated secondary HLH by infecting immunocompetent wild-type mice with the β-herpesvirus murine CMV. C57BL/6 mice developed a mild inflammatory phenotype, whereas BALB/c mice displayed the clinicopathologic features of HLH, as set forth in the Histiocyte Society diagnostic guidelines: fever, cytopenia, hemophagocytosis, hyperferritinemia, and elevated serum levels of soluble CD25. BALB/c mice also developed lymphadenopathy, liver dysfunction, and decreased NK cell numbers. Lymphoid and myeloid cells were in a hyperactivated state. Nonetheless, depletion of CD8(+) T cells could not inhibit or cure the HLH-like syndrome, highlighting a first dissimilarity from mouse models of primary HLH. Immune cell hyperactivation in BALB/c mice was accompanied by a cytokine storm. Notably, plasma levels of IFN-γ, a key pathogenic cytokine in models of primary HLH, were the highest. Nevertheless, murine CMV-infected IFN-γ-deficient mice still developed the aforementioned HLH-like symptoms. In fact, IFN-γ-deficient mice displayed a more complete spectrum of HLH, including splenomegaly, coagulopathy, and decreased NK cell cytotoxicity, indicating a regulatory role for IFN-γ in the pathogenesis of virus-associated secondary HLH as opposed to its central pathogenic role in primary HLH.

  7. Generation and Characterization of Transgenic Mice Expressing Mouse Ins1 Promoter for Pancreatic β-Cell-Specific Gene Overexpression and Knockout.


    Cheng, Yulong; Su, Yutong; Shan, Aijing; Jiang, Xiuli; Ma, Qinyun; Wang, Weiqing; Ning, Guang; Cao, Yanan


    The technologies for pancreatic β-cell-specific gene overexpression or knockout are fundamental for investigations of functional genes in vivo. Here we generated the Ins1-Cre-Dsred and Ins1-rtTA mouse models, which expressed the Cre recombinase or reverse tetracycline regulatable transactivator (rtTA) without hGH minigene under the control of mouse Ins1 promoter. Our data showed that the Cre-mediated recombination and rtTA-mediated activation could be efficiently detected at embryonic day 13.5 when these models were crossed with the reporter mice (ROSA(mT/mG) or tetO-HIST1H2BJ/GFP). The Cre and rtTA expression was restricted to β-cells without leakage in the brain and other tissues. Moreover, both the transgenic lines showed normal glucose tolerance and insulin secretion. These results suggested that the Ins1-Cre-Dsred and Ins1-rtTA mice could be used to knock out or overexpress target genes in embryos and adults to facilitate β-cell researches.

  8. Trim37-deficient mice recapitulate several features of the multi-organ disorder Mulibrey nanism

    PubMed Central

    Kettunen, Kaisa M.; Karikoski, Riitta; Hämäläinen, Riikka H.; Toivonen, Teija T.; Antonenkov, Vasily D.; Kulesskaya, Natalia; Voikar, Vootele; Hölttä-Vuori, Maarit; Ikonen, Elina; Sainio, Kirsi; Jalanko, Anu; Karlberg, Susann; Karlberg, Niklas; Lipsanen-Nyman, Marita; Toppari, Jorma; Jauhiainen, Matti; Hiltunen, J. Kalervo; Jalanko, Hannu; Lehesjoki, Anna-Elina


    ABSTRACT Mulibrey nanism (MUL) is a rare autosomal recessive multi-organ disorder characterized by severe prenatal-onset growth failure, infertility, cardiopathy, risk for tumors, fatty liver, and type 2 diabetes. MUL is caused by loss-of-function mutations in TRIM37, which encodes an E3 ubiquitin ligase belonging to the tripartite motif (TRIM) protein family and having both peroxisomal and nuclear localization. We describe a congenic Trim37 knock-out mouse (Trim37−/−) model for MUL. Trim37−/− mice were viable and had normal weight development until approximately 12 months of age, after which they started to manifest increasing problems in wellbeing and weight loss. Assessment of skeletal parameters with computer tomography revealed significantly smaller skull size, but no difference in the lengths of long bones in Trim37−/− mice as compared with wild-type. Both male and female Trim37−/− mice were infertile, the gonads showing germ cell aplasia, hilus and Leydig cell hyperplasia and accumulation of lipids in and around Leydig cells. Male Trim37−/− mice had elevated levels of follicle-stimulating and luteinizing hormones, but maintained normal levels of testosterone. Six-month-old Trim37−/− mice had elevated fasting blood glucose and low fasting serum insulin levels. At 1.5 years Trim37−/− mice showed non-compaction cardiomyopathy, hepatomegaly, fatty liver and various tumors. The amount and morphology of liver peroxisomes seemed normal in Trim37−/− mice. The most consistently seen phenotypes in Trim37−/− mice were infertility and the associated hormonal findings, whereas there was more variability in the other phenotypes observed. Trim37−/− mice recapitulate several features of the human MUL disease and thus provide a good model to study disease pathogenesis related to TRIM37 deficiency, including infertility, non-alcoholic fatty liver disease, cardiomyopathy and tumorigenesis. PMID:27044324

  9. Osteopontin Affects Insulin Vesicle Localization and Ca2+ Homeostasis in Pancreatic Beta Cells from Female Mice

    PubMed Central

    Mollet, Inês G.; Knutsson, Anki; Bolmgren, Victor S.; Hultgårdh-Nilsson, Anna; Gomez, Maria F.; Eliasson, Lena


    Type 2 diabetic patients suffer from insulin resistance and reduced insulin secretion. Osteopontin (OPN), a versatile protein expressed in several tissues throughout the body including the islets of Langerhans, has previously been implicated in the development of insulin resistance. Here we have investigated the role of OPN in insulin secretion using an OPN knock out mouse model (OPN-/-). Ultra-structural analyzes of islets from OPN-/- and WT mice indicated weaker cell-cell connections between the islet cells in the OPN-/- mouse compared to WT. Analysis of the insulin granule distribution in the beta cells showed that although OPN-/- and WT beta cells have the same number of insulin granules OPN-/- beta cells have significantly fewer docked granules. Both OPN-/- and WT islets displayed synchronized Ca2+ oscillations indicative of an intact beta cell communication. OPN-/- islets displayed higher intracellular Ca2+ concentrations when stimulated with 16.7 mM glucose than WT islets and the initial dip upon elevated glucose concentrations (which is associated with Ca2+ uptake into ER) was significantly lower in these islets. Glucose-induced insulin secretion was similar in OPN-/- and WT islets. Likewise, non-fasted blood glucose levels were the same in both groups. In summary, deletion of OPN results in several minor beta-cell defects that can be compensated for in a healthy system. PMID:28107503

  10. Infection of mice with oocysts of Toxoplasma gondii by oral route showed differences of virulence from Brazilian RFLP genotypes BrI and BrIII.


    Chiebao, Daniela Pontes; Pena, Hilda Fátima de Jesus; Cabral, Aline Diniz; Rocca, Mayra Pereira; Lopes, Estela Gallucci; Valadas, Samantha Yuri Oshiro Branco; Keid, Lara Borges; Grisi Filho, José Henrique Hildebrand; Soares, Rodrigo Martins


    South American strains of Toxoplasma gondii present higher genetic diversity than classical European strains. We compared the virulence of two non-archetypal Brazilian genotypes of T. gondii to mice. Oocysts of four isolates, two genotype BrI (TgCatBr71 and TgShBr11) and two BrIII (TgCatBr74 and TgCatBr60) were obtained from cats fed experimentally infected mice. After sporulation, 5.0×10(1) and 1.0×10(2) oocysts were orally administrated to Swiss albine mice in Experiments #1 and #2, respectively (4-10 mice/group). Humoral response from dead and surviving mice was analyzed on days 9 to 35 post-infection. Microscopic observations of lungs and brains were performed for tachyzoites and cysts visualization in fresh preparations. Negative results were tested by PCR. Virulence after infection with oocysts is dose dependent for genotype BrIII isolates, but not for BrI. Differences in mortality were observed among isolates from genotype BrIII on Experiment #1. Intra-genotype phenotypic variation related to the parasite stage of infection was demonstrated and this characteristic should be further studied and may influence future work regarding the role of virulence amid hosts.

  11. ILDR1 null mice, a model of human deafness DFNB42, show structural aberrations of tricellular tight junctions and degeneration of auditory hair cells.


    Morozko, Eva L; Nishio, Ayako; Ingham, Neil J; Chandra, Rashmi; Fitzgerald, Tracy; Martelletti, Elisa; Borck, Guntram; Wilson, Elizabeth; Riordan, Gavin P; Wangemann, Philine; Forge, Andrew; Steel, Karen P; Liddle, Rodger A; Friedman, Thomas B; Belyantseva, Inna A


    In the mammalian inner ear, bicellular and tricellular tight junctions (tTJs) seal the paracellular space between epithelial cells. Tricellulin and immunoglobulin-like (Ig-like) domain containing receptor 1 (ILDR1, also referred to as angulin-2) localize to tTJs of the sensory and non-sensory epithelia in the organ of Corti and vestibular end organs. Recessive mutations of TRIC (DFNB49) encoding tricellulin and ILDR1 (DFNB42) cause human nonsyndromic deafness. However, the pathophysiology of DFNB42 deafness remains unknown. ILDR1 was recently reported to be a lipoprotein receptor mediating the secretion of the fat-stimulated cholecystokinin (CCK) hormone in the small intestine, while ILDR1 in EpH4 mouse mammary epithelial cells in vitro was shown to recruit tricellulin to tTJs. Here we show that two different mouse Ildr1 mutant alleles have early-onset severe deafness associated with a rapid degeneration of cochlear hair cells (HCs) but have a normal endocochlear potential. ILDR1 is not required for recruitment of tricellulin to tTJs in the cochlea in vivo; however, tricellulin becomes mislocalized in the inner ear sensory epithelia of ILDR1 null mice after the first postnatal week. As revealed by freeze-fracture electron microscopy, ILDR1 contributes to the ultrastructure of inner ear tTJs. Taken together, our data provide insight into the pathophysiology of human DFNB42 deafness and demonstrate that ILDR1 is crucial for normal hearing by maintaining the structural and functional integrity of tTJs, which are critical for the survival of auditory neurosensory HCs.

  12. The C57BL/6J mice offspring originated from a parental generation exposed to tannery effluents shows object recognition deficits.


    Guimarães, Abraão Tiago Batista; Ferreira, Raíssa de Oliveira; Rabelo, Letícia Martins; E Silva, Bianca Costa; de Souza, Joyce Moreira; da Silva, Wellington Alves Mizael; de Menezes, Ivandilson Pessoa Pinto; Rodrigues, Aline Sueli de Lima; Vaz, Boniek Gontijo; de Oliveira Costa, Denys Ribeiro; Pereira, Igor; da Silva, Anderson Rodrigo; Malafaia, Guilherme


    The main aim of the present paper is to assess whether the parental generation exposure to such discharges could cause object recognition deficits in their offspring. Male and female C57Bl/6J mice were put to mate after they were exposed to 7.5% and 15% tannery effluents or water (control group), for 60 days. The male mice were withdrawn from the boxes after 15 days and the female mice remained exposed to the treatment during the gestation and lactation periods. The offspring were subjected to the object recognition test after weaning in order to assess possible cognition losses. The results of the analysis of the novel object recognition index found in the testing session (performed 1 h after the training session) applied to offspring from different experimental groups appeared to be statistically different. The novel object recognition index of the offspring from female mice exposed to tannery effluents (7.5% and 15% groups) was lower than that of the control group, and it demonstrated object recognition deficit in the studied offspring. The present study is the first to report evidences that parental exposure to effluent of tannery (father and mother) can cause object recognition deficit in the offspring, which is related to problems in the central nervous system.

  13. PrP0\\0 mice show behavioral abnormalities that suggest PrPC has a role in maintaining the cytoskeleton.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background/Introduction. PrPC is highly conserved among mammals, but its natural function is unclear. Prnp ablated mice (PrP0/0) appear to develop normally and are able to reproduce. These observations seem to indicate that the gene is not essential for viability, in spite of it being highly conse...

  14. Anorexia and cachexia in prostaglandin EP1 and EP3 subtype receptor knockout mice bearing a tumor with high intrinsic PGE2 production and prostaglandin related cachexia.


    Wang, W; Andersson, M; Lönnroth, C; Svanberg, E; Lundholm, K


    Previous studies in our laboratory have suggested that prostaglandin (PG) E2 is involved in anorexia/cachexia development in MCG 101 tumor-bearing mice. However, the role of COX pathways in the pathogenesis of cancer anorexia/cachexia is not fully resolved. In the present study, we investigated the role of PGE receptors subtype EP1 and EP3 on the development of anorexia in MCG 101-bearing mice. Our results show that the absence of host EP1 or EP3 receptors did not alter the magnitude of anorexia in tumor-bearers. However, anorexia in tumor-bearing EP1 and EP3 knockouts was not improved by indomethacin treatment as observed in wild type tumor-bearers. By contrast, indomethacin improved body composition similar in EP1 and EP3 knockouts as well as in wild type tumor-bearing animals and tumor growth was retarded in EP1 and promoted in EP3 knock outs. Our results demonstrate that host EP1 and EP3 receptors are involved in the control of local tumor growth, which translates into anorexia, this being the main cause of metabolic adaptive alterations to explain weight loss in this model. Brain EP1 and EP3 subtype receptors do not seem to directly control anorexia, which leaves EP2 and EP4 as potential candidates.

  15. Striatal damage and oxidative stress induced by the mitochondrial toxin malonate are reduced in clorgyline-treated rats and MAO-A deficient mice.


    Maragos, William F; Young, Kristie L; Altman, Chris S; Pocernich, Chava B; Drake, Jennifer; Butterfield, D Allan; Seif, Isabelle; Holschneider, Daniel P; Chen, Kevin; Shih, Jean C


    Intrastriatal administration of the succinate dehydrogenase (SDH) inhibitor malonate produces neuronal injury by a "secondary excitotoxic" mechanism involving the generation of reactive oxygen species (ROS). Recent evidence indicates dopamine may contribute to malonate-induced striatal neurodegeneration; infusion of malonate causes a pronounced increase in extracellular dopamine and dopamine deafferentation attenuates malonate toxicity. Inhibition of the catabolic enzyme monoamine oxidase (MAO) also attenuates striatal lesions induced by malonate. In addition to forming 3,4-dihydroxyphenylacetic acid, metabolism of dopamine by MAO generates H2O2, suggesting that dopamine metabolism may be a source of ROS in malonate toxicity. There are two isoforms of MAO, MAO-A and MAO-B. In this study, we have investigated the role of each isozyme in malonate-induced striatal injury using both pharmacological and genetic approaches. In rats treated with either of the specific MAO-A or -B inhibitors, clorgyline or deprenyl, respectively, malonate lesion volumes were reduced by 30% compared to controls. In knock-out mice lacking the MAO-A isoform, malonate-induced lesions were reduced by 50% and protein carbonyls, an index ROS formation, were reduced by 11%, compared to wild-type animals. In contrast, mice deficient in MAO-B showed highly variable susceptibility to malonate toxicity precluding us from determining the precise role of MAO-B in this form of brain damage. These findings indicate that normal levels of MAO-A participate in expression of malonate toxicity by a mechanism involving oxidative stress.

  16. Sterilizing Immunity Elicited by Neisseria meningitidis Carriage Shows Broader Protection than Predicted by Serum Antibody Cross-Reactivity in CEACAM1-Humanized Mice

    PubMed Central

    McCaw, Shannon E.; Strobel, Lea; Frosch, Matthias


    Neisseria meningitidis asymptomatically colonizes the human upper respiratory tract but is also the cause of meningitis and severe septicemia. Carriage or disease evokes an immune response against the infecting strain. Hitherto, we have known little about the breadth of immunity induced by natural carriage of a single strain or its implications for subsequent infectious challenge. In this study, we establish that transgenic mice expressing human CEACAM1 support nasal colonization by a variety of strains of different capsular types. Next, we nasally challenged these mice with either of the N. meningitidis strains H44/76 (serogroup B, ST-32) and 90/18311 (serogroup C, ST-11), while following the induction of strain-specific immunoglobulin. When these antisera were tested for reactivity with a diverse panel of N. meningitidis strains, very low levels of antibody were detected against all meningococcal strains, yet a mutually exclusive “fingerprint” of high-level cross-reactivity toward certain strains became apparent. To test the efficacy of these responses for protection against subsequent challenge, CEACAM1-humanized mice exposed to strain 90/18311 were then rechallenged with different N. meningitidis strains. As expected, the mice were immune to challenge with the same strain and with a closely related ST-11 strain, 38VI, while H44/76 (ST-32) could still colonize these animals. Notably, however, despite the paucity of detectable humoral response against strain 196/87 (ST-32), this strain was unable to colonize the 90/18311-exposed mice. Combined, our data suggest that current approaches may underestimate the actual breadth of mucosal protection gained through natural exposure to N. meningitidis strains. PMID:25368118

  17. A cascade of cytokines mediates mechanical inflammatory hypernociception in mice

    PubMed Central

    Cunha, T. M.; Verri, W. A.; Silva, J. S.; Poole, S.; Cunha, F. Q.; Ferreira, S. H.


    The hypernociceptive effects of cytokines [TNF-α, keratinocyte-derived chemokine (KC), and IL-1β] and their participation in carrageenan (Cg)-induced inflammatory hypernociception in mice were investigated. Nociceptor sensitization (hypernociception) was quantified with an electronic version of the von Frey filament test in WT and TNF receptor type 1 knockout mice (TNF-R1–/–). TNF-α-induced hypernociception was abolished in TNF-R1–/– mice, partially inhibited by pretreatment with IL-1 receptor antagonist (IL-1ra) or indomethacin and unaffected by Ab against KC (AbKC) or guanethidine. IL-1ra and indomethacin pretreatment strongly inhibited the hypernociception induced by IL-1β, which was not altered by AbKC or guanethidine or by knocking out TNF-R1. KC-induced hypernociception was abolished by AbKC, inhibited by pretreatment with indomethacin plus guanethidine, and partially inhibited by IL-1ra, indomethacin, or guanethidine. In contrast, KC-induced hypernociception was not altered by knocking out TNF-R1. Cg-induced hypernociception was abolished by administration of indomethacin plus guanethidine, diminished in TNF-R1–/– mice, and partially inhibited in WT mice pretreated with AbKC, IL-1ra, indomethacin, or guanethidine. TNF-α, KC, and IL-1β concentrations were elevated in the skin of Cg-injected paws. The TNF-α and KC concentrations rose concomitantly and peaked before that of IL-1β. In mice, the cytokine cascade begins with the release of TNF-α (acting on TNF-R1 receptor) and KC, which stimulate the release of IL-1β. As in rats, the final mediators of this cascade were prostaglandins released by IL-1β and sympathetic amines released by KC. These results extend to mice the concept that the release of primary mediators responsible for hypernociception is preceded by a cascade of cytokines. PMID:15665080

  18. In Utero and Lactational Exposure to PCBs in Mice: Adult Offspring Show Altered Learning and Memory Depending on Cyp1a2 and Ahr Genotypes

    PubMed Central

    Curran, Christine P.; Genter, Mary Beth; Patel, Krishna V.; Schaefer, Tori L.; Skelton, Matthew R.; Williams, Michael T.; Vorhees, Charles V.


    Background: Both coplanar and noncoplanar polychlorinated biphenyls (PCBs) exhibit neurotoxic effects in animal studies, but individual congeners do not always produce the same effects as PCB mixtures. Humans genetically have > 60-fold differences in hepatic cytochrome P450 1A2 (CYP1A2)-uninduced basal levels and > 12-fold variability in aryl hydrocarbon receptor (AHR)affinity; because CYP1A2 is known to sequester coplanar PCBs and because AHR ligands include coplanar PCBs, both genotypes can affect PCB response. Objectives: We aimed to develop a mouse paradigm with extremes in Cyp1a2 and Ahr genotypes to explore genetic susceptibility to PCB-induced developmental neurotoxicity using an environmentally relevant mixture of PCBs. Methods: We developed a mixture of eight PCBs to simulate human exposures based on their reported concentrations in human tissue, breast milk, and food supply. We previously characterized specific differences in PCB congener pharmacokinetics and toxicity, comparing high-affinity–AHR Cyp1a2 wild-type [Ahrb1_Cyp1a2(+/+)], poor-affinity–AHR Cyp1a2 wild-type [Ahrd_Cyp1a2(+/+)], and high-affinity–AHR Cyp1a2 knockout [Ahrb1_Cyp1a2(–/–)] mouse lines [Curran CP, Vorhees CV, Williams MT, Genter MB, Miller ML, Nebert DW. 2011. In utero and lactational exposure to a complex mixture of polychlorinated biphenyls: toxicity in pups dependent on the Cyp1a2 and Ahr genotypes. Toxicol Sci 119:189–208]. Dams received a mixture of three coplanar and five noncoplanar PCBs on gestational day 10.5 and postnatal day (PND) 5. In the present study we conducted behavioral phenotyping of exposed offspring at PND60, examining multiple measures of learning, memory, and other behaviors. Results: We observed the most significant deficits in response to PCB treatment in Ahrb1_Cyp1a2(–/–) mice, including impaired novel object recognition and increased failure rate in the Morris water maze. However, all PCB-treated genotypes showed significant differences on

  19. RAG2−/−γc−/− Mice Transplanted with CD34+ Cells from Human Cord Blood Show Low Levels of Intestinal Engraftment and Are Resistant to Rectal Transmission of Human Immunodeficiency Virus▿

    PubMed Central

    Hofer, Ursula; Baenziger, Stefan; Heikenwalder, Mathias; Schlaepfer, Erika; Gehre, Nadine; Regenass, Stephan; Brunner, Thomas; Speck, Roberto F.


    Rectal transmission is one of the main routes of infection by human immunodeficiency virus type 1 (HIV-1). To efficiently study transmission mechanisms and prevention strategies, a small animal model permissive for rectal transmission of HIV is mandatory. We tested the susceptibility of RAG2−/−γc−/− mice transplanted with human cord blood hematopoietic stem cells to rectal infection with HIV. We rectally exposed these humanized mice to cell-free and cell-associated HIV. All mice remained HIV negative as assessed by plasma viral load. The same mice infected intraperitoneally showed high levels of HIV replication. In the gut-associated lymphatic tissue, we found disproportionately smaller numbers of human cells than in other lymphoid organs. This finding may explain the observed resistance to rectal transmission of HIV. To increase the numbers of local HIV target cells and the likelihood of HIV transmission, we treated mice with different proinflammatory stimuli: local application of interleukin-1β, addition of seminal plasma to the inoculum, or induction of colitis with dextran sodium sulfate. These procedures attracted some human leukocytes, but the transmission rate was still very low. The humanized mice showed low levels of human engraftment in the intestinal tract and seem to be resistant to rectal transmission of HIV, and thus they are an unsuitable model for this application. PMID:18842716

  20. Essential role of the coxsackie- and adenovirus receptor (CAR) in development of the lymphatic system in mice.


    Mirza, Momina; Pang, Mei-Fong; Zaini, Mohamad Amr; Haiko, Paula; Tammela, Tuomas; Alitalo, Kari; Philipson, Lennart; Fuxe, Jonas; Sollerbrant, Kerstin


    The coxsackie- and adenovirus receptor (CAR) is a cell adhesion molecule predominantly associated with epithelial tight junctions in adult tissues. CAR is also expressed in cardiomyocytes and essential for heart development up to embryonic day 11.5, but not thereafter. CAR is not expressed in vascular endothelial cells but was recently detected in neonatal lymphatic vessels, suggesting that CAR could play a role in the development of the lymphatic system. To address this, we generated mice carrying a conditional deletion of the CAR gene (Cxadr) and knocked out CAR in the mouse embryo at different time points during post-cardiac development. Deletion of Cxadr from E12.5, but not from E13.5, resulted in subcutaneous edema, hemorrhage and embryonic death. Subcutaneous lymphatic vessels were dilated and structurally abnormal with gaps and holes present at lymphatic endothelial cell-cell junctions. Furthermore, lymphatic vessels were filled with erythrocytes showing a defect in the separation between the blood and lymphatic systems. Regionally, erythrocytes leaked out into the interstitium from leaky lymphatic vessels explaining the hemorrhage detected in CAR-deficient mouse embryos. The results show that CAR plays an essential role in development of the lymphatic vasculature in the mouse embryo by promoting appropriate formation of lymphatic endothelial cell-cell junctions.

  1. The G Protein-coupled Receptor P2Y14 Influences Insulin Release and Smooth Muscle Function in Mice*

    PubMed Central

    Meister, Jaroslawna; Le Duc, Diana; Ricken, Albert; Burkhardt, Ralph; Thiery, Joachim; Pfannkuche, Helga; Polte, Tobias; Grosse, Johannes; Schöneberg, Torsten; Schulz, Angela


    UDP sugars were identified as extracellular signaling molecules, assigning a new function to these compounds in addition to their well defined role in intracellular substrate metabolism and storage. Previously regarded as an orphan receptor, the G protein-coupled receptor P2Y14 (GPR105) was found to bind extracellular UDP and UDP sugars. Little is known about the physiological functions of this G protein-coupled receptor. To study its physiological role, we used a gene-deficient mouse strain expressing the bacterial LacZ reporter gene to monitor the physiological expression pattern of P2Y14. We found that P2Y14 is mainly expressed in pancreas and salivary glands and in subpopulations of smooth muscle cells of the gastrointestinal tract, blood vessels, lung, and uterus. Among other phenotypical differences, knock-out mice showed a significantly impaired glucose tolerance following oral and intraperitoneal glucose application. An unchanged insulin tolerance suggested altered pancreatic islet function. Transcriptome analysis of pancreatic islets showed that P2Y14 deficiency significantly changed expression of components involved in insulin secretion. Insulin secretion tests revealed a reduced insulin release from P2Y14-deficient islets, highlighting P2Y14 as a new modulator of proper insulin secretion. PMID:24993824

  2. Role of muscle IL-6 in gender-specific metabolism in mice

    PubMed Central

    Fernandez-Perez, Antonio; Mogas, Aina; Giralt, Mercedes; Comes, Gemma; Fernandez-Gayol, Olaya; Vallejo, Mario; Hidalgo, Juan


    The aim of the present work was to further explore the physiological roles of muscle-derived IL-6. Adult-floxed and conditional skeletal muscle IL-6 knock out male and female mice were used to study energy expenditure (indirect calorimetry at rest and during treadmill exercise, and body temperature cycle during the light phase) and energy intake (response to fast/refeeding). We also evaluated the responses to leptin and the activity of the insulin signalling pathway in skeletal muscle and liver by phosphorylation of Akt at Ser 473. The stress response was also studied. Results indicate a relevant role of muscle IL-6 in maintaining energy homeostasis, especially in males. Absence of muscle IL-6 in male mice results in lower core body temperature in the light phase, increased respiratory exchange ratio (RER) both at rest and during exercise, increased expression of TCA cycle marked gene, citrate synthase in muscle, reduced fat storage and decreased body weight and food consumption in response to leptin. In females, muscle IL-6 deficiency increases VO2 and CO2 levels similarly. Also in contrast to males, energy expenditure (EE) measured over 48h reveals a significant elevation in female mice with muscle IL-6 deficiency; moreover, they show a modified response to fasting-refeeding and to restraint stress. The present results contribute to the understanding of the role of muscle IL-6 in male and female mouse metabolism, not only during exercise but also in the basal state and in situations where energy balance is altered. PMID:28319140

  3. Novel dual agonist peptide analogues derived from dogfish glucagon show promising in vitro insulin releasing actions and antihyperglycaemic activity in mice.


    O'Harte, F P M; Ng, M T; Lynch, A M; Conlon, J M; Flatt, P R


    The antidiabetic potential of thirteen novel dogfish glucagon derived analogues were assessed in vitro and in acute in vivo studies. Stable peptide analogues enhanced insulin secretion from BRIN-BD11 β-cells (p < 0.001) and reduced acute glycaemic responses following intraperitoneal glucose (25 nmol/kg) in healthy NIH Swiss mice (p < 0.05-p<0.001). The in vitro insulinotropic actions of [S2a]dogfish glucagon, [S2a]dogfish glucagon-exendin-4(31-39) and [S2a]dogfish glucagon-Lys(30)-γ-glutamyl-PAL, were blocked (p < 0.05-p<0.001) by the specific GLP-1 and glucagon receptor antagonists, exendin-4(9-39) and (desHis(1)Pro(4)Glu(9))glucagon amide but not by (Pro(3))GIP, indicating lack of GIP receptor involvement. These analogues dose-dependently stimulated cAMP production in GLP-1 and glucagon (p < 0.05-p<0.001) but not GIP-receptor transfected cells. They improved acute glycaemic and insulinotropic responses in high-fat fed diabetic mice and in wild-type C57BL/6J and GIPR-KO mice (p < 0.05-p<0.001), but not GLP-1R-KO mice, confirming action on GLP-1 but not GIP receptors. Overall, dogfish glucagon analogues have potential for diabetes therapy, exerting beneficial metabolic effects via GLP-1 and glucagon receptors.

  4. [Genetically engineered mice: mouse models for cancer research].


    Szymańska, Hanna


    Genetically engineered mice (GEM) have been extensively used to model human cancer. Mouse models mimic the morphology, histopathology, phenotype, and genotype of the corresponding cancer in humans. GEM mice are created by random integration of a transgene into the genome, which results in gene overexpression (transgenic mice); gene deletion (knock-out mice); or targeted insertion of the transgene in a selected locus (knock-in mice). Knock-out may be constitutive, i.e. total inactivation of the gene of interest in any cell, or conditional, i.e. tissue-specific inactivation of the gene. Gene knock-down (RNAi) and humanization of the mouse are more sophisticated models of GEM mice. RNA interference (RNAi) is a mechanism in which double-stranded RNAs inhibits the respective gene expression by inducing degradation of its mRNA. Humanization is based on replacing a mouse gene by its human counterpart. The alterations in genes in GEM have to be heritable. The opportunities provided by employing GEM cancer models are: analysis of the role of specific cancer genes and modifier genes, evaluation of conventional cancer therapies and new drugs, identification of cancer markers of tumor growth, analysis of the influence of the tumor's microenvironment on tumor formation, and the definition of the pre-clinical, discrete steps of tumorigenesis. The validation of mouse models of human cancer is the task of the MMHCC (Mouse Models of Human Cancer Consortium). The GEM models of breast, pancreatic, intestinal and colon, and prostate cancer are the most actively explored. In contrast, the models of brain tumors and ovary, cervical, and skin cancer are in the early stage of investigation.

  5. Carcinogenicity study of 3-monochloropropane-1, 2-diol (3-MCPD) administered by drinking water to B6C3F1 mice showed no carcinogenic potential.


    Jeong, Jayoung; Han, Beom Seok; Cho, Wan-Seob; Choi, Mina; Ha, Chang-Su; Lee, Byoung-Seok; Kim, Yong-Bum; Son, Woo-Chan; Kim, Choong-Yong


    3-Monochloropropane-1, 2-diol (or 3-chloro-1,2-propanediol, 3-MCPD) is a well-known food processing contaminant found in a wide range of foods and ingredients. It has been classified as non-genotoxic carcinogen but its carcinogenic potential in the rodents has been controversial. The carcinogenicity to B6C3F1 mice by drinking water administration was assessed over a period of 104 weeks. Three groups, each comprising 50 male and 50 female mice received 3-MCPD at dosages of 30, 100 or 300 ppm up to Day 100 and 200 ppm onward (4.2, 14.3 and 33.0 mg/kg for males; 3.7, 12.2, and 31.0 mg/kg for females), were allocated. Survival was good, with at least 80% of males and 72% of females in each group surviving 104 weeks. Body weights and body weight gain were decreased in males and females receiving 200 ppm. Water and food consumptions of both sexes at 300/200 ppm were lowered. Emaciated or crouching position was observed for animals of both sexes exposed to 200 ppm. There were some differences in hematology and serum biochemistry compared with controls, although there was no histopathological evidence to support those changes. Histopathological examination did not reveal any neoplastic or non-neoplastic findings attributable to treatment with 3-MCPD. It is concluded that drinking water administration of 3-MCPD for 104 weeks revealed no evidence of carcinogenic potential.

  6. Acute Heat-Evoked Temperature Sensation Is Impaired but Not Abolished in Mice Lacking TRPV1 and TRPV3 Channels

    PubMed Central

    Reynders, Ana; Gaillard, Stéphane; Moqrich, Aziz


    The discovery of heat-sensitive Transient Receptor Potential Vanilloid ion channels (ThermoTRPVs) greatly advanced our molecular understanding of acute and injury-evoked heat temperature sensation. ThermoTRPV channels are activated by partially overlapping temperatures ranging from warm to supra-threshold noxious heat. TRPV1 is activated by noxious heat temperature whereas TRPV3 can be activated by warm as well as noxious heat temperatures. Loss-of-function studies in single TRPV1 and TRPV3 knock-out mice have shown that heat temperature sensation is not completely abolished suggesting functional redundancies among these two channels and highlighting the need of a detailed analysis of TRPV1::TRPV3 double knock-out mice (V1V3dKO) which is hampered by the close proximity of the loci expressing the two channels. Here we describe the generation of a novel mouse model in which trpv1 and trpv3 genes have been inactivated using bacterial artificial chromosome (BAC)-based homologous recombination in embryonic stem cells. In these mice, using classical thermosensory tests such hot plate, tail flick and the thermotaxis gradient paradigms, we confirm that TRPV1 is the master channel for sensing noxious heat temperatures and identify a cooperative role of TRPV1 and TRPV3 for sensing a well-defined window of acute moderate heat temperature. Using the dynamic hot plate assay, we unravel an intriguing and unexpected pronounced escape behavior in TRPV1 knock-out mice that was attenuated in the V1V3dKO. Together, and in agreement with the temperature activation overlap between TRPV1 and TRPV3 channels, our data provide in vivo evidence of a cooperative role between skin-derived TRPV3 and primary sensory neurons-enriched TRPV1 in modulation of moderate and noxious heat temperature sensation and suggest that other mechanisms are required for heat temperature sensation. PMID:24925072

  7. Acute heat-evoked temperature sensation is impaired but not abolished in mice lacking TRPV1 and TRPV3 channels.


    Marics, Irène; Malapert, Pascale; Reynders, Ana; Gaillard, Stéphane; Moqrich, Aziz


    The discovery of heat-sensitive Transient Receptor Potential Vanilloid ion channels (ThermoTRPVs) greatly advanced our molecular understanding of acute and injury-evoked heat temperature sensation. ThermoTRPV channels are activated by partially overlapping temperatures ranging from warm to supra-threshold noxious heat. TRPV1 is activated by noxious heat temperature whereas TRPV3 can be activated by warm as well as noxious heat temperatures. Loss-of-function studies in single TRPV1 and TRPV3 knock-out mice have shown that heat temperature sensation is not completely abolished suggesting functional redundancies among these two channels and highlighting the need of a detailed analysis of TRPV1::TRPV3 double knock-out mice (V1V3dKO) which is hampered by the close proximity of the loci expressing the two channels. Here we describe the generation of a novel mouse model in which trpv1 and trpv3 genes have been inactivated using bacterial artificial chromosome (BAC)-based homologous recombination in embryonic stem cells. In these mice, using classical thermosensory tests such hot plate, tail flick and the thermotaxis gradient paradigms, we confirm that TRPV1 is the master channel for sensing noxious heat temperatures and identify a cooperative role of TRPV1 and TRPV3 for sensing a well-defined window of acute moderate heat temperature. Using the dynamic hot plate assay, we unravel an intriguing and unexpected pronounced escape behavior in TRPV1 knock-out mice that was attenuated in the V1V3dKO. Together, and in agreement with the temperature activation overlap between TRPV1 and TRPV3 channels, our data provide in vivo evidence of a cooperative role between skin-derived TRPV3 and primary sensory neurons-enriched TRPV1 in modulation of moderate and noxious heat temperature sensation and suggest that other mechanisms are required for heat temperature sensation.

  8. Decreased Nociceptive Sensitization in Mice Lacking the Fragile X Mental Retardation Protein: Role of mGluR1/5 and mTOR

    PubMed Central

    Price, Theodore J.; Rashid, Md Harunor; Millecamps, Magali; Sanoja, Raul; Entrena, Jose M.; Cervero, Fernando


    Fragile X mental retardation is caused by silencing of the gene (FMR1) that encodes the RNA-binding protein (FMRP) that influences translation in neurons. A prominent feature of the human disorder is self-injurious behavior, suggesting an abnormality in pain processing. Moreover, FMRP regulates group I metabotropic glutamate receptor (mGluR1/5)-dependent plasticity, which is known to contribute to nociceptive sensitization. We demonstrate here, using the Fmr1 knock-out (KO) mouse, that FMRP plays an important role in pain processing because Fmr1 KO mice showed (1) decreased (∼50%) responses to ongoing nociception (phase 2, formalin test), (2) a 3 week delay in the development of peripheral nerve injury-induced allodynia, and (3) a near absence of wind-up responses in ascending sensory fibers after repetitive C-fiber stimulation. We provide evidence that the behavioral deficits are related to a mGluR1/5- and mammalian target of rapamycin (mTOR)-mediated mechanism because (1) spinal mGluR5 antagonism failed to inhibit the second phase of the formalin test, and we observed a marked reduction in nociceptive response to an intrathecal injection of an mGluR1/5 agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) in Fmr1 KO mice; (2) peripheral DHPG injection had no effect in KO mice yet evoked thermal hyperalgesia in wild types; and (3) the mTOR inhibitor rapamycin inhibited formalin- and DHPG-induced nociception in wild-type but not Fmr1 KO mice. These experiments show that translation regulation via FMRP and mTOR is an important feature of nociceptive plasticity. These observations also support the hypothesis that the persistence of self-injurious behavior observed in fragile X mental retardation patients could be related to deficits in nociceptive sensitization. PMID:18094233

  9. Microbial Anti-Inflammatory Molecule (MAM) from Faecalibacterium prausnitzii Shows a Protective Effect on DNBS and DSS-Induced Colitis Model in Mice through Inhibition of NF-κB Pathway

    PubMed Central

    Breyner, Natalia M.; Michon, Cristophe; de Sousa, Cassiana S.; Vilas Boas, Priscilla B.; Chain, Florian; Azevedo, Vasco A.; Langella, Philippe; Chatel, Jean M.


    Faecalibacterium prausnitzii and its supernatant showed protective effects in different chemically-induced colitis models in mice. Recently, we described 7 peptides found in the F. prausnitzii supernatant, all belonging to a protein called Microbial Anti-inflammatory Molecule (MAM). These peptides were able to inhibit NF-κB pathway in vitro and showed anti-inflammatory properties in vivo in a DiNitroBenzene Sulfate (DNBS)-induced colitis model. In this current proof we tested MAM effect on NF-κB pathway in vivo, using a transgenic model of mice producing luciferase under the control of NF-κB promoter. Moreover, we tested this protein on Dextran Sodium Sulfate (DSS)-induced colitis in mice. To study the effect of MAM we orally administered to the mice a Lactococcus lactis strain carrying a plasmid containing the cDNA of MAM under the control of a eukaryotic promoter. L. lactis delivered plasmids in epithelial cells of the intestinal membrane allowing thus the production of MAM directly by host. We showed that MAM administration inhibits NF-κB pathway in vivo. We confirmed the anti-inflammatory properties of MAM in DNBS-induced colitis but also in DSS model. In DSS model MAM was able to inhibit Th1 and Th17 immune response while in DNBS model MAM reduced Th1, Th2, and Th17 immune response and increased TGFβ production. PMID:28203226

  10. Microbial Anti-Inflammatory Molecule (MAM) from Faecalibacterium prausnitzii Shows a Protective Effect on DNBS and DSS-Induced Colitis Model in Mice through Inhibition of NF-κB Pathway.


    Breyner, Natalia M; Michon, Cristophe; de Sousa, Cassiana S; Vilas Boas, Priscilla B; Chain, Florian; Azevedo, Vasco A; Langella, Philippe; Chatel, Jean M


    Faecalibacterium prausnitzii and its supernatant showed protective effects in different chemically-induced colitis models in mice. Recently, we described 7 peptides found in the F. prausnitzii supernatant, all belonging to a protein called Microbial Anti-inflammatory Molecule (MAM). These peptides were able to inhibit NF-κB pathway in vitro and showed anti-inflammatory properties in vivo in a DiNitroBenzene Sulfate (DNBS)-induced colitis model. In this current proof we tested MAM effect on NF-κB pathway in vivo, using a transgenic model of mice producing luciferase under the control of NF-κB promoter. Moreover, we tested this protein on Dextran Sodium Sulfate (DSS)-induced colitis in mice. To study the effect of MAM we orally administered to the mice a Lactococcus lactis strain carrying a plasmid containing the cDNA of MAM under the control of a eukaryotic promoter. L. lactis delivered plasmids in epithelial cells of the intestinal membrane allowing thus the production of MAM directly by host. We showed that MAM administration inhibits NF-κB pathway in vivo. We confirmed the anti-inflammatory properties of MAM in DNBS-induced colitis but also in DSS model. In DSS model MAM was able to inhibit Th1 and Th17 immune response while in DNBS model MAM reduced Th1, Th2, and Th17 immune response and increased TGFβ production.

  11. AAV2/8-humanFOXP3 gene therapy shows robust anti-atherosclerosis efficacy in LDLR-KO mice on high cholesterol diet.


    Cao, M; Theus, S A; Straub, K D; Figueroa, J A; Mirandola, L; Chiriva-Internati, M; Hermonat, P L


    Inflammation is a key etiologic component in atherogenesis. Previously we demonstrated that adeno-associated virus (AAV) 2/8 gene delivery of Netrin1 inhibited atherosclerosis in the low density lipoprotein receptor knockout mice on high-cholesterol diet (LDLR-KO/HCD). One important finding from this study was that FOXP3 was strongly up-regulated in these Netrin1-treated animals, as FOXP3 is an anti-inflammatory gene, being the master transcription factor of regulatory T cells. These results suggested that the FOXP3 gene might potentially be used, itself, as an agent to limit atherosclerosis. To test this hypothesis AAV2/8 (AAV)/hFOXP3 or AAV/Neo (control) gene therapy virus were tail vein injected into the LDLR-KO/HCD animal model. It was found that hFOXP3 gene delivery was associated with significantly lower HCD-induced atherogenesis, as measured by larger aortic lumen cross sectional area, thinner aortic wall thickness, and lower aortic systolic blood velocity compared with Neo gene-HCD-treated controls. Moreover these measurements taken from the hFOXP3/HCD-treated animals very closely matched those measurements taken from the normal diet (ND) control animals. These data strongly suggest that AAV/hFOXP3 delivery gave a robust anti-atherosclerosis therapeutic effect and further suggest that FOXP3 be examined more stringently as a therapeutic gene for clinical use.

  12. Mice deficient for the extracellular matrix glycoprotein tenascin-r show physiological and structural hallmarks of increased hippocampal excitability, but no increased susceptibility to seizures in the pilocarpine model of epilepsy.


    Brenneke, F; Bukalo, O; Dityatev, A; Lie, A A


    Recognition molecules provide important cues for neuronal survival, axonal fasciculation, axonal pathfinding, synaptogenesis, synaptic plasticity, and regeneration. Our previous studies revealed a link between perisomatic inhibition and the extracellular matrix glycoprotein tenascin-R (TN-R). Therefore, we here studied neuronal excitability and epileptic susceptibility in mice constitutively deficient in TN-R. In vitro analysis of populational spikes in hippocampal slices of TN-R-deficient mice revealed a significant increase in multiple spikes in the CA1 region, as compared with wild-type mice. This difference between genotypes was only partially reduced after blockade of GABA(A) receptors with picrotoxin, indicating a deficit in GABAergic inhibition and an increase in intrinsic excitability of CA1 pyramidal cells in TN-R-deficient mice. Using a battery of immunohistochemical markers and histological stainings, we were able to identify two abnormalities in the hippocampus of TN-R-deficient mice possibly related to increased excitability: the high number of glial fibrillary acidic protein-positive astrocytes and low number of calretinin-positive interneurons in the CA1 and CA3 regions. In order to test whether the revealed abnormalities give rise to increased susceptibility to seizures in TN-R-deficient mice, we used the pilocarpine model of epilepsy. No genotype-specific differences were found with regard to the time-course of pilocarpine-induced and spontaneous seizures, neuronal cell loss, aberrant sprouting and distribution of synaptic and inhibitory interneuron markers. However, pilocarpine-induced astrogliosis and reduction in calretinin-positive interneurons were less pronounced in TN-R mutants, thereby resulting in an occlusion of effects induced by TN-R deficiency and pilocarpine. Thus, TN-R-deficient mutants show several electrophysiological and morphological hallmarks of increased neuronal excitability, which, however, do not give rise to more

  13. Efficient Production of Gene-Modified Mice using Staphylococcus aureus Cas9

    PubMed Central

    Zhang, Xiya; Liang, Puping; Ding, Chenhui; Zhang, Zhen; Zhou, Jianwen; Xie, Xiaowei; Huang, Rui; Sun, Ying; Sun, Hongwei; Zhang, Jinran; Xu, Yanwen; Songyang, Zhou; Huang, Junjiu


    The CRISPR/Cas system is an efficient genome-editing tool to modify genes in mouse zygotes. However, only the Streptococcus pyogenes Cas9 (SpCas9) has been systematically tested for generating gene-modified mice. The protospacer adjacent motif (PAM, 5′-NGG-3′) recognized by SpCas9 limits the number of potential target sites for this system. Staphylococcus aureus Cas9 (SaCas9), with its smaller size and unique PAM (5′-NNGRRT-3′) preferences, presents an alternative for genome editing in zygotes. Here, we showed that SaCas9 could efficiently and specifically edit the X-linked gene Slx2 and the autosomal gene Zp1 in mouse zygotes. SaCas9-mediated disruption of the tyrosinase (Tyr) gene led to C57BL/6J mice with mosaic coat color. Furthermore, multiplex targeting proved efficient multiple genes disruption when we co-injected gRNAs targeting Slx2, Zp1, and Tyr together with SaCas9 mRNA. We were also able to insert a Flag tag at the C-terminus of histone H1c, when a Flag-encoding single-stranded DNA oligo was co-introduced into mouse zygotes with SaCas9 mRNA and the gRNA. These results indicate that SaCas9 can specifically cleave the target gene locus, leading to successful gene knock-out and precise knock-in in mouse zygotes, and highlight the potential of using SaCas9 for genome editing in preimplantation embryos and producing gene-modified animal models. PMID:27586692

  14. Inflammation neither increases hepatic hepcidin nor affects intestinal (59)Fe-absorption in two murine models of bowel inflammation, hemizygous TNF(ΔARE/+) and homozygous IL-10(-/-) mice.


    Buffler, M; Becker, C; Windisch, W; Schümann, K


    Hepcidin-synthesis was reported to be stimulated by inflammation. In contrast, hepcidin synthesis was inhibited by TNFα and serum hepcidin was low. To elucidate these contradictions, we compare data on hepcidin expression, on iron absorption and homoeostasis and markers of inflammation between two murine models of intestinal inflammation and corresponding wild-types as determined by standard methods. In TNF(ΔARE/+) and IL-10(-/-)-mice hepatic hepcidin expression and protein content was significantly lower than in corresponding wild-types. However, (59)Fe whole-body retention showed no difference between knock-outs and corresponding wild-types 7d after gavage, in neither strain. Compared to wild-types, body weight, hepatic non-haem iron content, hemoglobin and hematocrit were significantly decreased in TNF(ΔARE/+) mice, while erythropoiesis increased. These differences were not seen in IL-10(-/-) mice. Duodenal IL-6 and TNFα content increased significantly in TNF(ΔARE/+) mice, while ferritin-H decreased along with hepatic hepcidin expression, ferritin L, and non-haem iron. In IL-10(-/-) mice, these changes were less marked or missing for non-haem iron. Duodenal ferritin-L and ferroportin increased significantly, while HFE decreased. Our results corroborate the conflicting combination of low hepcidin with inflammation and without increased intestinal iron absorption. Speculating on underlying mechanism, decreased hepcidin may result from stimulated erythropoiesis. Unaltered intestinal iron-absorption may compromise between the stimulation by increased erythropoiesis and inhibition by local and systemic inflammation. The findings suggest intense interaction between counterproductive mechanisms and ask for further research.

  15. Intracranial administration of vaccinia virus complement control protein in Mo/Hu APPswe PS1dE9 transgenic mice at an early age shows enhanced performance at a later age using a cheese board maze test.


    Kulkarni, Amod P; Pillay, Nirvana S; Kellaway, Lauriston A; Kotwal, Girish J


    One of the key pro-inflammatory mediators activated by amyloid protein in neurodegenerative disorders of the brain, such as Alzheimer's disease is the complement system. Vaccinia virus complement control protein secreted by vaccinia virus, commonly known as VCP, was found to inhibit amyloid protein mediated up-regulation of complement system in vitro. In the current research investigation, VCP was administered twice (First dose at 3 weeks and the second dose at 6-7 months) intracranially into the parietal cortical area of Mo/Hu APPswe transgenic mice. At the age of 2 years or more, the same mice were subjected to cued-learning, spatial learning, probe and reverse probe trial paradigms of cheese board maze tasks for cognitive assessment. A significant difference was observed between VCP treated mice and the transgenic controls on days two and three of the cued trials and probe trials. The VCP treated group showed a similar trend as revealed during the spatial learning trial and reverse probe trial. A differential pattern of thioflavine S staining was observed in the VCP treated group. These results suggest that administration of VCP at an early age in transgenic mice may be effective in regulating the progression to the familial form of Alzheimer's disease at a later age.

  16. Conjunctival instillation of plasminogen eliminates ocular lesion in B6.129P2-Plg(tm1Jld) transgenic mice, a model of ligneous conjunctivitis.


    Pignataro, G; Vinciguerra, A; Cuomo, O; Sirabella, R; Di Renzo, G F; Scorziello, A


    Ligneous conjunctivitis is a severe and rare chronic "idiopathic membraneous" conjunctivitis, characterized by the formation of pseudomembranes mostly on the palpebral surfaces that progressively replace the normal mucosa. Evidence has been provided that ligneous conjunctivitis is caused by a severe systemic plasminogen deficiency with decreased plasminogen antigen and decreased plasminogen functional activities. Objective of the present study is to verify the hypothesis that a topical eye application of plasminogen is able to ameliorate the consequences of this disease. Here we report the results of pre-clinical studies performed to investigate the therapeutic effectiveness of an eye-drop plasminogen preparation in B6.129P2-Plg(tm1Jld) transgenic mice, a model of ligneous conjunctivitis. The entity of protection mediated by plasminogen was evaluated by measuring the extent of the eye lesion by means of a computerized system and dedicated software. The results of the present study clearly showed that the administration for six times a day of plasminogen eye-drop solution in the lesioned eye of animals knock-out for plasminogen gene and developing ligneous conjunctivitis caused a dose and time related reduction of the extent of the ocular lesion. These findings may pave the road for the pharmacological treatment of the ocular lesion associated to the ligneous conjunctivitis that at the present is surgically treated by removing the pseudomembranes generated on the eye.

  17. Moraxella catarrhalis activates murine macrophages through multiple toll like receptors and has reduced clearance in lungs from TLR4 mutant mice.


    Hassan, Ferdaus; Ren, Dabin; Zhang, Wenhong; Merkel, Tod J; Gu, Xin-Xing


    Moraxella catarrhalis is a gram negative bacterium and a leading causative agent of otitis media (OM) in children. Several recent reports have provided strong evidence for an association between toll like receptors and OM. It has been found that both Streptococcus pneumoniae and nontypeable Haemophilus influenzae activate host protective immune responses through toll like receptors (TLRs), however, the precise mechanism by which Moraxella catarrhalis initiates the host immune response is currently unknown. In this report, using murine macrophages generated from a series of knock-out mice, we have demonstrated that M. catarrhalis lipooligosaccharide (LOS) and either heat killed or live bacteria are recognized by one or more TLRs. LOS activates the host immune response through a membrane bound CD14-TLR4 complex, while both heat killed and live require recognition by multiple toll like receptors such as TLR2, TLR4 and TLR9 without the requirement of CD14. We have also shown that stimuli are capable of triggering the host innate immune response by both MyD88- and TRIF- dependent signaling pathways. We further showed that induced activation of mitogen activated protein kinase (MAPK) is essential in order to achieve optimal secretion of pro-inflammatory cytokine TNF-α. We finally showed that TLR4 mutant C3H/HeJ mice produce significantly lower levels of pro-inflammatory cytokines TNF-α and IL-6 in vivo, An increased bacterial loads at 12 and 24 hours (P<0.001) in their lungs upon challenge with live in an aerosol chamber compared to wild-type (WT) control mice. These data suggest that TLRs are crucial for an effective innate immune response induced by The results of these studies contribute to an increased understanding of molecular mechanism and possible novel treatment strategies for diseases caused by by specifically targeting TLRs and their signaling pathways.

  18. Severe Hypomyelination and Developmental Defects Are Caused in Mice Lacking Protein Arginine Methyltransferase 1 (PRMT1) in the Central Nervous System*

    PubMed Central

    Hashimoto, Misuzu; Murata, Kazuya; Ishida, Junji; Kanou, Akihiko; Kasuya, Yoshitoshi; Fukamizu, Akiyoshi


    Protein arginine methyltransferase 1 (PRMT1) is involved in cell proliferation, DNA damage response, and transcriptional regulation. Although PRMT1 is extensively expressed in the CNS at embryonic and perinatal stages, the physiological role of PRMT1 has been poorly understood. Here, to investigate the primary function of PRMT1 in the CNS, we generated CNS-specific PRMT1 knock-out mice by the Cre-loxP system. These mice exhibited postnatal growth retardation with tremors, and most of them died within 2 weeks after birth. Brain histological analyses revealed prominent cell reduction in the white matter tracts of the mutant mice. Furthermore, ultrastructural analysis demonstrated that myelin sheath was almost completely ablated in the CNS of these animals. In agreement with hypomyelination, we also observed that most major myelin proteins including myelin basic protein (MBP), 2′,3′-cyclic-nucleotide 3′-phosphodiesterase (CNPase), and myelin-associated glycoprotein (MAG) were dramatically decreased, although neuronal and astrocytic markers were preserved in the brain of CNS-specific PRMT1 knock-out mice. These animals had a reduced number of OLIG2+ oligodendrocyte lineage cells in the white matter. We found that expressions of transcription factors essential for oligodendrocyte specification and further maturation were significantly suppressed in the brain of the mutant mice. Our findings provide evidence that PRMT1 is required for CNS development, especially for oligodendrocyte maturation processes. PMID:26637354

  19. "The Show"

    ERIC Educational Resources Information Center

    Gehring, John


    For the past 16 years, the blue-collar city of Huntington, West Virginia, has rolled out the red carpet to welcome young wrestlers and their families as old friends. They have come to town chasing the same dream for a spot in what many of them call "The Show". For three days, under the lights of an arena packed with 5,000 fans, the…

  20. New Hippocampal Neurons Are Not Obligatory for Memory Formation; Cyclin D2 Knockout Mice with No Adult Brain Neurogenesis Show Learning

    ERIC Educational Resources Information Center

    Jaholkowski, Piotr; Kiryk, Anna; Jedynak, Paulina; Abdallah, Nada M. Ben; Knapska, Ewelina; Kowalczyk, Anna; Piechal, Agnieszka; Blecharz-Klin, Kamilla; Figiel, Izabela; Lioudyno, Victoria; Widy-Tyszkiewicz, Ewa; Wilczynski, Grzegorz M.; Lipp, Hans-Peter; Kaczmarek, Leszek; Filipkowski, Robert K.


    The role of adult brain neurogenesis (generating new neurons) in learning and memory appears to be quite firmly established in spite of some criticism and lack of understanding of what the new neurons serve the brain for. Also, the few experiments showing that blocking adult neurogenesis causes learning deficits used irradiation and various drugs…

  1. Increased EPO Levels Are Associated With Bone Loss in Mice Lacking PHD2 in EPO-Producing Cells.


    Rauner, Martina; Franke, Kristin; Murray, Marta; Singh, Rashim Pal; Hiram-Bab, Sahar; Platzbecker, Uwe; Gassmann, Max; Socolovsky, Merav; Neumann, Drorit; Gabet, Yankel; Chavakis, Triantafyllos; Hofbauer, Lorenz C; Wielockx, Ben


    The main oxygen sensor hypoxia inducible factor (HIF) prolyl hydroxylase 2 (PHD2) is a critical regulator of tissue homeostasis during erythropoiesis, hematopoietic stem cell maintenance, and wound healing. Recent studies point toward a role for the PHD2-erythropoietin (EPO) axis in the modulation of bone remodeling, even though the studies produced conflicting results. Here, we used a number of mouse strains deficient of PHD2 in different cell types to address the role of PHD2 and its downstream targets HIF-1α and HIF-2α in bone remodeling. Mice deficient for PHD2 in several cell lineages, including EPO-producing cells, osteoblasts, and hematopoietic cells (CD68:cre-PHD2(f/f) ) displayed a severe reduction of bone density at the distal femur as well as the vertebral body due to impaired bone formation but not bone resorption. Importantly, using osteoblast-specific (Osx:cre-PHD2(f/f) ) and osteoclast-specific PHD2 knock-out mice (Vav:cre- PHD2(f/f) ), we show that this effect is independent of the loss of PHD2 in osteoblast and osteoclasts. Using different in vivo and in vitro approaches, we show here that this bone phenotype, including the suppression of bone formation, is directly linked to the stabilization of the α-subunit of HIF-2, and possibly to the subsequent moderate induction of serum EPO, which directly influenced the differentiation and mineralization of osteoblast progenitors resulting in lower bone density. Taken together, our data identify the PHD2:HIF-2α:EPO axis as a so far unknown regulator of osteohematology by controlling bone homeostasis. Further, these data suggest that patients treated with PHD inhibitors or EPO should be monitored with respect to their bone status. © 2016 American Society for Bone and Mineral Research.

  2. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer

    PubMed Central

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang


    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth. PMID:27654750

  3. Knock-out mouse models of proprotein convertases: unique functions or redundancy?


    Creemers, John W M; Khatib, Abdel-Majid


    The members of the proprotein convertase family play a central role in the processing and/or activation of various protein precursors involved in many physiological processes and various pathologies. The proteolysis of these precursors that occur at basic residues within the general motif (K/R)-(X)-(K/R) is mediated by the proprotein convertases PC1/3, PC2, Furin, PACE4, PC4, PC5 and PC7, whereas the proteolysis of precursors within hydrophobic residues performed by the convertase S1P/SKI-1 and the convertase NARC-1/PCSK9 seems to prefer cleavages at the motif LVFAQSIP. Here we provide a comprehensive overview of their remarkable complex roles as revealed by disruption of their genes individually using generalized or conditional approaches.

  4. Knock-out and Transgenic Strategies to Improve Neural Transplantation Therapy for Parkinson’s Disease

    DTIC Science & Technology


    Parkinson’s disease (PD) are 1) poor survival of grafted fetal neurons and 2) insufficient axonal outgrowth and functional recovery. We carried out experiments aimed at by short-term inhibition by pre-treatment of fetal cells with pharmacological inhibitors of caspases. In our second objective of enhancing axonal growth leading to optimal functional recovery by neuronal transplants, we employed transgenic bcl-2 overexpressing donor cells and similar molecules influencing the growth of axons in the fetal and adult CNS. Use of such molecules could significantly improve

  5. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer.


    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang


    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth.

  6. How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    NASA Technical Reports Server (NTRS)

    Ladbury, Ray


    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  7. [Progress in preparation of small monoclonal antibodies of knock out technique].


    Liu, Jing; Mao, Xin-min; Li, Lin-lin; Li, Xin-xia; Wang, Ye; Lan, Yi


    With the application of monoclonal antibody technology more and more widely, its production technology is becoming more and more perfect. Small molecule monoclonal antibody technology is becoming a hot research topic for people. The application of traditional Chinese medicine small molecule monoclonal antibody technology has been more and more widely, the technology for effective Chinese medicine component knockout provide strong technical support. The preparation of monoclonal antibodies and small molecule knockout technology are reviewed in this paper. The preparation of several steps, such as: in the process of preparation of antigen, hapten carrier coupling, coupling ratio determination and identification of artificial antigen and establishment of animal immunization and hybridoma cell lines of monoclonal antibody, the large-scale preparation; small molecule monoclonal antibody on Immune in affinity chromatography column method is discussed in detail. The author believes that this technology will make the traditional Chinese medicine research on a higher level, and improve the level of internationalization of Chinese medicine research.

  8. Stathmin is dispensable for tumor onset in mice.


    D'Andrea, Sara; Berton, Stefania; Segatto, Ilenia; Fabris, Linda; Canzonieri, Vincenzo; Colombatti, Alfonso; Vecchione, Andrea; Belletti, Barbara; Baldassarre, Gustavo


    The microtubule-destabilizing protein stathmin is highly expressed in several types of tumor, thus deserving the name of oncoprotein 18. High levels of stathmin expression and/or activity favor the metastatic spreading and mark the most aggressive tumors, thus representing a realistic marker of poor prognosis. Stathmin is a downstream target of many signaling pathways, including Ras-MAPK, PI3K and p53, involved in both tumor onset and progression. We thus hypothesized that stathmin could also play a role during the early stages of tumorigenesis, an issue completely unexplored. In order to establish whether stathmin expression is necessary for tumor initiation, we challenged wild type (WT), stathmin heterozygous and stathmin knock-out (KO) mice with different carcinogens. Using well-defined mouse models of carcinogenesis of skin, bladder and muscle by the means of 7,12-dimethylbenz[α]antracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA), N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN) and 3-methylcholanthrylene (3MC) treatments, respectively, we demonstrated that knock-out of stathmin has no impact on the onset of cancer in mice. No significant difference was noticed either when the Ras oncogene was mutated (skin carcinogenesis model) or when the p53 pathway was inactivated (bladder carcinomas and fibrosarcomas). Finally, we concomitantly impinged on p53 and Ras pathways, by generating WT and stathmin KO mouse embryo fibroblasts transformed with papilloma virus large T antigen (LgTAg) plus the K-Ras(G12V) oncogene. In vivo growth of xenografts from these transformed fibroblasts did not highlight any significant difference depending on the presence or absence of stathmin. Overall, our work demonstrates that stathmin expression is dispensable for tumor onset, at least in mice, thus making stathmin a virtually exclusive marker of aggressive disease and a promising therapeutic target for advanced cancers.

  9. Stathmin Is Dispensable for Tumor Onset in Mice

    PubMed Central

    D’Andrea, Sara; Berton, Stefania; Segatto, Ilenia; Fabris, Linda; Canzonieri, Vincenzo; Colombatti, Alfonso; Vecchione, Andrea; Belletti, Barbara; Baldassarre, Gustavo


    The microtubule-destabilizing protein stathmin is highly expressed in several types of tumor, thus deserving the name of oncoprotein 18. High levels of stathmin expression and/or activity favor the metastatic spreading and mark the most aggressive tumors, thus representing a realistic marker of poor prognosis. Stathmin is a downstream target of many signaling pathways, including Ras-MAPK, PI3K and p53, involved in both tumor onset and progression. We thus hypothesized that stathmin could also play a role during the early stages of tumorigenesis, an issue completely unexplored. In order to establish whether stathmin expression is necessary for tumor initiation, we challenged wild type (WT), stathmin heterozygous and stathmin knock-out (KO) mice with different carcinogens. Using well-defined mouse models of carcinogenesis of skin, bladder and muscle by the means of 7,12-dimethylbenz[α]antracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA), N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN) and 3-methylcholanthrylene (3MC) treatments, respectively, we demonstrated that knock-out of stathmin has no impact on the onset of cancer in mice. No significant difference was noticed either when the Ras oncogene was mutated (skin carcinogenesis model) or when the p53 pathway was inactivated (bladder carcinomas and fibrosarcomas). Finally, we concomitantly impinged on p53 and Ras pathways, by generating WT and stathmin KO mouse embryo fibroblasts transformed with papilloma virus large T antigen (LgTAg) plus the K-RasG12V oncogene. In vivo growth of xenografts from these transformed fibroblasts did not highlight any significant difference depending on the presence or absence of stathmin. Overall, our work demonstrates that stathmin expression is dispensable for tumor onset, at least in mice, thus making stathmin a virtually exclusive marker of aggressive disease and a promising therapeutic target for advanced cancers. PMID:23029098

  10. Differential Activation of Calpain-1 and Calpain-2 following Kainate-Induced Seizure Activity in Rats and Mice

    PubMed Central

    Seinfeld, Jeff; Xu, Xiaobo; Bi, Xiaoning


    Systemic injection of kainate produces repetitive seizure activity in both rats and mice. It also results in short-term synaptic modifications as well as delayed neurodegeneration. The signaling cascades involved in both short-term and delayed responses are not clearly defined. The calcium-dependent protease calpain is activated in various brain structures following systemic kainate injection, although the precise involvement of the two major brain calpain isoforms, calpain-1 and calpain-2, remains to be defined. It has recently been reported that calpain-1 and calpain-2 play opposite roles in NMDA receptor-mediated neuroprotection or neurodegeneration, with calpain-1 being neuroprotective and calpain-2 being neurodegenerative. In the present study, we determined the activation pattern of calpain-1 and calpain-2 by analyzing changes in levels of different calpain substrates, including spectrin, drebrin, and PTEN (phosphatase and tensin homolog; a specific calpain-2 substrate) in both rats, and wild-type and calpain-1 knock-out mice. The results indicate that, while calpain-2 is rapidly activated in pyramidal cells throughout CA1 and CA3, rapid calpain-1 activation is restricted to parvalbumin-positive and to a lesser extent CCK-positive, but not somatostatin-positive, interneurons. In addition, calpain-1 knock-out mice exhibit increased long-term neurodegeneration in CA1, reinforcing the notion that calpain-1 activation is neuroprotective. PMID:27622212

  11. Induction of Heat-Shock Protein 70 Expression by Geranylgeranylacetone Shows Cytoprotective Effects in Cardiomyocytes of Mice under Humid Heat Stress

    PubMed Central

    Wang, Xiaowu; Yuan, Binbin; Dong, Wenpeng; Yang, Bo; Yang, Yongchao; Lin, Xi; Gong, Gu


    Background Increasing evidence has revealed that humid heat stress (HHS) causes considerable damage to human health. The cardiovascular system has been suggested to be the primary target of heat stress, which results in serious cardiovascular diseases. However, there is still a lack of effective approaches for the prevention and treatment of cardiovascular diseases induced by HHS. Objective Heat-shock proteins (Hsps), especially Hsp70, are reported to provide effective cytoprotection under various stress stimuli. In the present study, we evaluated the cytoprotective effect of geranylgeranylacetone (GGA), which was previously been reported to induce Hsp70 expression in cardiomyocytes under HHS. Methods and Principal Findings Using a mouse model of HHS, we showed that the pretreatment of GGA enhanced Hsp70 expression under HHS, as examined by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot. We then examined the effect of GGA pretreatment on the cardiomyocyte apoptosis induced by HHS using terminal-deoxynucleoitidyl transferase mediated nick end labeling (TUNEL) staining, and found that GGA pretreatment inhibited mitochondria-mediated apoptosis. GGA pretreatment could reverse the effect of HHS on cell apoptosis by increasing expression of Bcl-2, decreasing cytochrome c in cytosol, and increasing cytochrome c in mitochondria. However, GGA pretreatment had no effect on the oxidative stress induced by HHS as determined by levels of superoxide dismutase (SOD), malondialdehyde (MDA), and glutathione (GSH). Conclusion We have demonstrated that GGA pretreatment suppressed HHS-induced apoptosis of cardiomyocytes through the induction of Hsp70 overexpression. PMID:24695789

  12. Postnatal Loss of P/Q-type Channels Confined to Rhombic Lip Derived Neurons Alters Synaptic Transmission at the Parallel Fiber to Purkinje Cell Synapse and Replicates Genomic Cacna1a Mutation Phenotype of Ataxia and Seizures in Mice

    PubMed Central

    Maejima, Takashi; Wollenweber, Patric; Teusner, Lena U. C.; Noebels, Jeffrey L.; Herlitze, Stefan; Mark, Melanie D.


    Ataxia, episodic dyskinesia and thalamocortical seizures are associated with an inherited loss of P/Q-type voltage-gated Ca2+ channel function. P/Q-type channels are widely expressed throughout the neuraxis, obscuring identification of the critical networks underlying these complex neurological disorders. We recently showed that the conditional postnatal loss of P/Q-type channels in cerebellar Purkinje cells (PCs) in mice (purky) leads to these aberrant phenotypes, suggesting that intrinsic alteration in PC output is a sufficient pathogenic factor for disease initiation. The question arises whether P/Q-type channel deletion confined to a single upstream cerebellar synapse might induce the pathophysiological abnormality of genomically inherited P/Q-type channel disorders. PCs integrate two excitatory inputs, climbing fibers from inferior olive and parallel fibers (PFs) from granule cells (GCs) that receive mossy fiber (MF) input derived from precerebellar nuclei. In this paper, we introduce a new mouse model with a selective knock-out of P/Q-type channels in rhombic lip derived neurons including PF- and MF-pathways (quirky). We found that in quirky mice, PF-PC synaptic transmission is reduced during low-frequency stimulation. Using focal light stimulation of GCs that express optogenetic light-sensitive channels, channelrhodopsin-2, we found that modulation of PC firing via GC input is reduced in quirky mice. Phenotypic analysis revealed that quirky mice display ataxia, dyskinesia and absence epilepsy. These results suggest that developmental alteration of patterned input confined to only one of the main afferent cerebellar excitatory synaptic pathways has a significant role in generating the neurological phenotype associated with the global genomic loss of P/Q-type channel function. PMID:23516282

  13. Fossil Mice and Rats Show Isotopic Evidence of Niche Partitioning and Change in Dental Ecomorphology Related to Dietary Shift in Late Miocene of Pakistan

    PubMed Central

    Kimura, Yuri; Jacobs, Louis L.; Cerling, Thure E.; Uno, Kevin T.; Ferguson, Kurt M.; Flynn, Lawrence J.; Patnaik, Rajeev


    Stable carbon isotope analysis in tooth enamel is a well-established approach to infer C3 and C4 dietary composition in fossil mammals. The bulk of past work has been conducted on large herbivorous mammals. One important finding is that their dietary habits of fossil large mammals track the late Miocene ecological shift from C3 forest and woodland to C4 savannah. However, few studies on carbon isotopes of fossil small mammals exist due to limitations imposed by the size of rodent teeth, and the isotopic ecological and dietary behaviors of small mammals to climate change remain unknown. Here we evaluate the impact of ecological change on small mammals by fine-scale comparisons of carbon isotope ratios (δ13C) with dental morphology of murine rodents, spanning 13.8 to ∼2.0 Ma, across the C3 to C4 vegetation shift in the Miocene Siwalik sequence of Pakistan. We applied in-situ laser ablation GC-IRMS to lower first molars and measured two grazing indices on upper first molars. Murine rodents yield a distinct, but related, record of past ecological conditions from large herbivorous mammals, reflecting available foods in their much smaller home ranges. In general, larger murine species show more positive δ13C values and have higher grazing indices than smaller species inhabiting the same area at any given age. Two clades of murine rodents experienced different rates of morphological change. In the faster-evolving clade, the timing and trend of morphological innovations are closely tied to consumption of C4 diet during the vegetation shift. This study provides quantitative evidence of linkages among diet, niche partitioning, and dental morphology at a more detailed level than previously possible. PMID:23936324

  14. Fossil mice and rats show isotopic evidence of niche partitioning and change in dental ecomorphology related to dietary shift in Late Miocene of Pakistan.


    Kimura, Yuri; Jacobs, Louis L; Cerling, Thure E; Uno, Kevin T; Ferguson, Kurt M; Flynn, Lawrence J; Patnaik, Rajeev


    Stable carbon isotope analysis in tooth enamel is a well-established approach to infer C3 and C4 dietary composition in fossil mammals. The bulk of past work has been conducted on large herbivorous mammals. One important finding is that their dietary habits of fossil large mammals track the late Miocene ecological shift from C3 forest and woodland to C4 savannah. However, few studies on carbon isotopes of fossil small mammals exist due to limitations imposed by the size of rodent teeth, and the isotopic ecological and dietary behaviors of small mammals to climate change remain unknown. Here we evaluate the impact of ecological change on small mammals by fine-scale comparisons of carbon isotope ratios (δ(13)C) with dental morphology of murine rodents, spanning 13.8 to ∼2.0 Ma, across the C3 to C4 vegetation shift in the Miocene Siwalik sequence of Pakistan. We applied in-situ laser ablation GC-IRMS to lower first molars and measured two grazing indices on upper first molars. Murine rodents yield a distinct, but related, record of past ecological conditions from large herbivorous mammals, reflecting available foods in their much smaller home ranges. In general, larger murine species show more positive δ(13)C values and have higher grazing indices than smaller species inhabiting the same area at any given age. Two clades of murine rodents experienced different rates of morphological change. In the faster-evolving clade, the timing and trend of morphological innovations are closely tied to consumption of C4 diet during the vegetation shift. This study provides quantitative evidence of linkages among diet, niche partitioning, and dental morphology at a more detailed level than previously possible.

  15. Fumosorinone, a novel PTP1B inhibitor, activates insulin signaling in insulin-resistance HepG2 cells and shows anti-diabetic effect in diabetic KKAy mice.


    Liu, Zhi-Qin; Liu, Ting; Chen, Chuan; Li, Ming-Yan; Wang, Zi-Yu; Chen, Ruo-Song; Wei, Gui-Xiang; Wang, Xiao-Yi; Luo, Du-Qiang


    Insulin resistance is a characteristic feature of type 2 diabetes mellitus (T2DM) and is characterized by defects in insulin signaling. Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of the insulin signaling pathways, and its increased activity and expression are implicated in the pathogenesis of insulin resistance. Therefore, the inhibition of PTP1B is anticipated to become a potential therapeutic strategy to treat T2DM. Fumosorinone (FU), a new natural product isolated from insect fungi Isaria fumosorosea, was found to inhibit PTP1B activity in our previous study. Herein, the effects of FU on insulin resistance and mechanism in vitro and in vivo were investigated. FU increased the insulin-provoked glucose uptake in insulin-resistant HepG2 cells, and also reduced blood glucose and lipid levels of type 2 diabetic KKAy mice. FU decreased the expression of PTP1B both in insulin-resistant HepG2 cells and in liver tissues of diabetic KKAy mice. Furthermore, FU increased the phosphorylation of IRβ, IRS-2, Akt, GSK3β and Erk1/2 in insulin-resistant HepG2 cells, as well as the phosphorylation of IRβ, IRS-2, Akt in liver tissues of diabetic KKAy mice. These results showed that FU increased glucose uptake and improved insulin resistance by down-regulating the expression of PTP1B and activating the insulin signaling pathway, suggesting that it may possess antidiabetic properties.

  16. Endogenously determined restriction of food intake overcomes excitation-contraction uncoupling in JP45KO mice with aging.


    Delbono, Osvaldo; Messi, Maria Laura; Wang, Zhong-Min; Treves, Susan; Mosca, Barbara; Bergamelli, Leda; Nishi, Miyuki; Takeshima, Hiroshi; Shi, Hang; Xue, Bingzhong; Zorzato, Francesco


    The decline in muscular strength with age is disproportionate to the loss in total muscle mass that causes it. Knocking out JP45, an integral protein of the junctional face membrane of the skeletal muscle sarcoplasmic reticulum (SR), results in decreased expression of the voltage-gated Ca(2+) channel, Ca(v)1.1; excitation-contraction uncoupling (ECU); and loss of muscle force (Delbono et al., 2007). Here, we show that Ca(v)1.1 expression, charge movement, SR Ca(2+) release, in vitro contractile force, and sustained forced running remain stable in male JP45KO mice at 12 and 18 months. They also exhibit the level of ECU reported for 3-4-month mice (Delbono et al., 2007). No further decline at later ages was recorded. Preserved ECC was not related to increased expression of any protein that directly or indirectly interacts with JP45 at the triad junction. However, maintained muscle force and physical performance were associated with ablation of JP45 expression in the brain, spontaneous and significantly diminished food intake and less tendency toward obesity when exposed to a high-fat diet compared to WT. We propose that (1) endogenously generated restriction in food intake overcomes the deleterious effects of JP45 ablation on ECC and skeletal muscle force mainly through downregulation of neuropeptide-Y expression in the hypothalamic arcuate nucleus; and (2) the JP45KO mouse constitutes an invaluable model to examine the mechanisms controlling food intake as well as skeletal muscle function with aging.

  17. Profiling Trait Anxiety: Transcriptome Analysis Reveals Cathepsin B (Ctsb) as a Novel Candidate Gene for Emotionality in Mice

    PubMed Central

    Czibere, Ludwig; Baur, Laura A.; Wittmann, Anke; Gemmeke, Katja; Steiner, Andrea; Weber, Peter; Pütz, Benno; Ahmad, Nafees; Bunck, Mirjam; Graf, Cornelia; Widner, Regina; Kühne, Claudia; Panhuysen, Markus; Hambsch, Boris; Rieder, Gabriele; Reinheckel, Thomas; Peters, Christoph; Holsboer, Florian; Landgraf, Rainer; Deussing, Jan M.


    Behavioral endophenotypes are determined by a multitude of counteracting but precisely balanced molecular and physiological mechanisms. In this study, we aim to identify potential novel molecular targets that contribute to the multigenic trait “anxiety”. We used microarrays to investigate the gene expression profiles of different brain regions within the limbic system of mice which were selectively bred for either high (HAB) or low (LAB) anxiety-related behavior, and also show signs of comorbid depression-like behavior. We identified and confirmed sex-independent differences in the basal expression of 13 candidate genes, using tissue from the entire brain, including coronin 7 (Coro7), cathepsin B (Ctsb), muscleblind-like 1 (Mbnl1), metallothionein 1 (Mt1), solute carrier family 25 member 17 (Slc25a17), tribbles homolog 2 (Trib2), zinc finger protein 672 (Zfp672), syntaxin 3 (Stx3), ATP-binding cassette, sub-family A member 2 (Abca2), ectonucleotide pyrophosphatase/phosphodiesterase 5 (Enpp5), high mobility group nucleosomal binding domain 3 (Hmgn3) and pyruvate dehydrogenase beta (Pdhb). Additionally, we confirmed brain region-specific differences in the expression of synaptotagmin 4 (Syt4). Our identification of about 90 polymorphisms in Ctsb suggested that this gene might play a critical role in shaping our mouse model's behavioral endophenotypes. Indeed, the assessment of anxiety-related and depression-like behaviors of Ctsb knock-out mice revealed an increase in depression-like behavior in females. Altogether, our results suggest that Ctsb has significant effects on emotionality, irrespective of the tested mouse strain, making it a promising target for future pharmacotherapy. PMID:21897848

  18. Lamellipodin-Deficient Mice: A Model of Rectal Carcinoma

    PubMed Central

    Miller, Cassandra L.; Muthupalani, Sureshkumar; Shen, Zeli; Drees, Frauke; Ge, Zhongming; Feng, Yan; Chen, Xiaowei; Gong, Guanyu; Nagar, Karan K.; Wang, Timothy C.; Gertler, Frank B.; Fox, James G.


    During a survey of clinical rectal prolapse (RP) cases in the mouse population at MIT animal research facilities, a high incidence of RP in the lamellipodin knock-out strain, C57BL/6-Raph1tm1Fbg (Lpd-/-) was documented. Upon further investigation, the Lpd-/- colony was found to be infected with multiple endemic enterohepatic Helicobacter species (EHS). Lpd-/- mice, a transgenic mouse strain produced at MIT, have not previously shown a distinct immune phenotype and are not highly susceptible to other opportunistic infections. Predominantly male Lpd-/- mice with RP exhibited lesions consistent with invasive rectal carcinoma concomitant to clinically evident RP. Multiple inflammatory cytokines, CD11b+Gr1+ myeloid-derived suppressor cell (MDSC) populations, and epithelial cells positive for a DNA damage biomarker, H2AX, were elevated in affected tissue, supporting their role in the neoplastic process. An evaluation of Lpd-/- mice with RP compared to EHS-infected, but clinically normal (CN) Lpd-/- animals indicated that all of these mice exhibit some degree of lower bowel inflammation; however, mice with prolapses had significantly higher degree of focal lesions at the colo-rectal junction. When Helicobacter spp. infections were eliminated in Lpd-/- mice by embryo transfer rederivation, the disease phenotype was abrogated, implicating EHS as a contributing factor in the development of rectal carcinoma. Here we describe lesions in Lpd-/- male mice consistent with a focal inflammation-induced neoplastic transformation and propose this strain as a mouse model of rectal carcinoma. PMID:27045955

  19. Auditory Hair Cell-Specific Deletion of p27Kip1 in Postnatal Mice Promotes Cell-Autonomous Generation of New Hair Cells and Normal Hearing

    PubMed Central

    Walters, Bradley J.; Liu, Zhiyong; Crabtree, Mark; Coak, Emily; Cox, Brandon C.


    Hearing in mammals relies upon the transduction of sound by hair cells (HCs) in the organ of Corti within the cochlea of the inner ear. Sensorineural hearing loss is a widespread and permanent disability due largely to a lack of HC regeneration in mammals. Recent studies suggest that targeting the retinoblastoma (Rb)/E2F pathway can elicit proliferation of auditory HCs. However, previous attempts to induce HC proliferation in this manner have resulted in abnormal cochlear morphology, HC death, and hearing loss. Here we show that cochlear HCs readily proliferate and survive following neonatal, HC-specific, conditional knock-out of p27Kip1 (p27CKO), a tumor suppressor upstream of Rb. Indeed, HC-specific p27CKO results in proliferation of these cells without the upregulation of the supporting cell or progenitor cell proteins, Prox1 or Sox2, suggesting that they remain HCs. Furthermore, p27CKO leads to a significant addition of postnatally derived HCs that express characteristic synaptic and stereociliary markers and survive to adulthood, although a portion of the newly derived inner HCs exhibit cytocauds and lack VGlut3 expression. Despite this, p27CKO mice exhibit normal hearing as measured by evoked auditory brainstem responses, which suggests that the newly generated HCs may contribute to, or at least do not greatly detract from, function. These results show that p27Kip1 actively maintains HC quiescence in postnatal mice, and suggest that inhibition of p27Kip1 in residual HCs represents a potential strategy for cell-autonomous auditory HC regeneration. PMID:25411503

  20. Auditory hair cell-specific deletion of p27Kip1 in postnatal mice promotes cell-autonomous generation of new hair cells and normal hearing.


    Walters, Bradley J; Liu, Zhiyong; Crabtree, Mark; Coak, Emily; Cox, Brandon C; Zuo, Jian


    Hearing in mammals relies upon the transduction of sound by hair cells (HCs) in the organ of Corti within the cochlea of the inner ear. Sensorineural hearing loss is a widespread and permanent disability due largely to a lack of HC regeneration in mammals. Recent studies suggest that targeting the retinoblastoma (Rb)/E2F pathway can elicit proliferation of auditory HCs. However, previous attempts to induce HC proliferation in this manner have resulted in abnormal cochlear morphology, HC death, and hearing loss. Here we show that cochlear HCs readily proliferate and survive following neonatal, HC-specific, conditional knock-out of p27(Kip1) (p27CKO), a tumor suppressor upstream of Rb. Indeed, HC-specific p27CKO results in proliferation of these cells without the upregulation of the supporting cell or progenitor cell proteins, Prox1 or Sox2, suggesting that they remain HCs. Furthermore, p27CKO leads to a significant addition of postnatally derived HCs that express characteristic synaptic and stereociliary markers and survive to adulthood, although a portion of the newly derived inner HCs exhibit cytocauds and lack VGlut3 expression. Despite this, p27CKO mice exhibit normal hearing as measured by evoked auditory brainstem responses, which suggests that the newly generated HCs may contribute to, or at least do not greatly detract from, function. These results show that p27(Kip1) actively maintains HC quiescence in postnatal mice, and suggest that inhibition of p27(Kip1) in residual HCs represents a potential strategy for cell-autonomous auditory HC regeneration.

  1. Fumosorinone, a novel PTP1B inhibitor, activates insulin signaling in insulin-resistance HepG2 cells and shows anti-diabetic effect in diabetic KKAy mice

    SciTech Connect

    Liu, Zhi-Qin; Liu, Ting; Chen, Chuan; Li, Ming-Yan; Wang, Zi-Yu; Chen, Ruo-song; Wei, Gui-xiang; Wang, Xiao-yi; Luo, Du-Qiang


    Insulin resistance is a characteristic feature of type 2 diabetes mellitus (T2DM) and is characterized by defects in insulin signaling. Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of the insulin signaling pathways, and its increased activity and expression are implicated in the pathogenesis of insulin resistance. Therefore, the inhibition of PTP1B is anticipated to become a potential therapeutic strategy to treat T2DM. Fumosorinone (FU), a new natural product isolated from insect fungi Isaria fumosorosea, was found to inhibit PTP1B activity in our previous study. Herein, the effects of FU on insulin resistance and mechanism in vitro and in vivo were investigated. FU increased the insulin-provoked glucose uptake in insulin-resistant HepG2 cells, and also reduced blood glucose and lipid levels of type 2 diabetic KKAy mice. FU decreased the expression of PTP1B both in insulin-resistant HepG2 cells and in liver tissues of diabetic KKAy mice. Furthermore, FU increased the phosphorylation of IRβ, IRS-2, Akt, GSK3β and Erk1/2 in insulin-resistant HepG2 cells, as well as the phosphorylation of IRβ, IRS-2, Akt in liver tissues of diabetic KKAy mice. These results showed that FU increased glucose uptake and improved insulin resistance by down-regulating the expression of PTP1B and activating the insulin signaling pathway, suggesting that it may possess antidiabetic properties. - Highlights: • Fumosorinone is a new PTP1B inhibitor isolated from insect pathogenic fungi. • Fumosorinone attenuated the insulin resistance both in vitro and in vivo. • Fumosorinone decreased the expression of PTP1B both in vitro and in vivo. • Fumosorinone activated the insulin signaling pathway both in vitro and in vivo.

  2. Effect of bezafibrate treatment on late-onset mitochondrial myopathy in mice.


    Yatsuga, Shuichi; Suomalainen, Anu


    Mitochondrial dysfunction is an important cause of metabolic disorders of children and adults, with no effective therapy options. Recently, induction of mitochondrial biogenesis, by transgenic overexpression of PGC1-alpha [peroxisome proliferator-activated receptor (PPAR)-gamma coactivator 1-alpha], was reported to delay progression of early-onset cytochrome-c-oxidase (COX) deficiency in skeletal muscle of two mouse models: a muscle-specific knock-out of COX10 (COX10-mKO) and a constitutive knock-out of Surf1 (Surf1-KO). A pan-PPAR agonist, bezafibrate, could similarly delay myopathy progression in COX10-mKOs, but not in SURF1-KOs. We asked whether bezafibrate affected disease progression in late-onset adult-type mitochondrial myopathy mice. These 'Deletor mice' express a dominant patient mutation in Twinkle-helicase, leading to accumulation of multiple mtDNA deletions and subsequent progressive respiratory chain (RC) deficiency with COX-negative muscle fibers at 12 months of age. The primary and secondary molecular findings in Deletor mice mimic closely those in patients with Twinkle myopathy. We applied 0.5% bezafibrate diet to Deletors for 22 weeks, starting at disease manifestation, mimicking patient treatment after diagnosis. Bezafibrate delayed significantly the accumulation of COX-negative fibers and multiple mtDNA deletions. However, mitochondrial biogenesis was not induced: mitochondrial DNA copy number, transcript and RC protein amounts decreased in both Deletors and wild-type mice. Furthermore, bezafibrate induced severe lipid oxidation effects, with hepatomegaly and loss of adipose tissue, the mechanism involving lipid mobilization by high hepatic expression of FGF21 cytokine. However, as bezafibrate has been tolerated well by humans, the beneficial muscle findings in Deletor mice support consideration of bezafibrate trials on adult patients with mitochondrial myopathy.

  3. Selective Disruption of Metabotropic Glutamate Receptor 5-Homer Interactions Mimics Phenotypes of Fragile X Syndrome in Mice

    PubMed Central

    Guo, Weirui; Molinaro, Gemma; Collins, Katie A.; Hays, Seth A.; Paylor, Richard; Worley, Paul F.; Szumlinski, Karen K.


    Altered function of the Gq-coupled, Group 1 metabotropic glutamate receptors, specifically mGlu5, is implicated in multiple mouse models of autism and intellectual disability. mGlu5 dysfunction has been most well characterized in the fragile X syndrome mouse model, the Fmr1 knock-out (KO) mouse, where pharmacological and genetic reduction of mGlu5 reverses many phenotypes. mGlu5 is less associated with its scaffolding protein Homer in Fmr1 KO mice, and restoration of mGlu5-Homer interactions by genetic deletion of a short, dominant negative of Homer, H1a, rescues many phenotypes of Fmr1 KO mice. These results suggested that disruption of mGlu5-Homer leads to phenotypes of FXS. To test this idea, we examined mice with a knockin mutation of mGlu5 (F1128R; mGlu5R/R) that abrogates binding to Homer. Although FMRP levels were normal, mGlu5R/R mice mimicked multiple phenotypes of Fmr1 KO mice, including reduced mGlu5 association with the postsynaptic density, enhanced constitutive mGlu5 signaling to protein synthesis, deficits in agonist-induced translational control, protein synthesis-independent LTD, neocortical hyperexcitability, audiogenic seizures, and altered behaviors, including anxiety and sensorimotor gating. These results reveal new roles for the Homer scaffolds in regulation of mGlu5 function and implicate a specific molecular mechanism in a complex brain disease. SIGNIFICANCE STATEMENT Abnormal function of the metabotropic, or Gq-coupled, glutamate receptor 5 (mGlu5) has been implicated in neurodevelopmental disorders, including a genetic cause of intellectual disability and autism called fragile X syndrome. In brains of a mouse model of fragile X, mGlu5 is less associated with its binding partner Homer, a scaffolding protein that regulates mGlu5 localization to synapses and its ability to activate biochemical signaling pathways. Here we show that a mouse expressing a mutant mGlu5 that cannot bind to Homer is sufficient to mimic many of the biochemical

  4. Late Onset Neuropathy with Spontaneous Clinical Remission in Mice Lacking the POZ Domain of the Transcription Factor Myc-interacting Zinc Finger Protein 1 (Miz1) in Schwann Cells*

    PubMed Central

    Sanz-Moreno, Adrián; Fuhrmann, David; Zankel, Armin; Reingruber, Herbert; Kern, Lara; Meijer, Dies; Niemann, Axel; Elsässer, Hans-Peter


    The transcription factor Miz1 (Myc-interacting zinc finger 1) is a known regulator of the cell cycle but also has cell cycle-independent functions. Here we analyzed the role of Miz1 in the peripheral nervous system, using an early embryonic conditional knock-out model in which the Miz1 POZ domain is ablated in Schwann cells. Although the development of myelinated nerve fibers was not impaired, Miz1ΔPOZ mice acquired behavioral signs of a peripheral neuropathy at the age of 3 months. At this time, ultrastructural analysis of the sciatic nerve showed de- and dysmyelination of fibers, with massive outfoldings and a focal infiltration of macrophages. Although the expression of genes encoding structural myelin proteins, such as periaxin, myelin basic protein, and myelin protein zero, was decreased, genes associated with a negative regulation of myelination, including c-Jun, Sox2, and Id2, were up-regulated in Miz1ΔPOZ mice compared with controls. In animals older than 4 months, the motor disabilities vanished, and the ultrastructure of the sciatic nerve exhibited numerous tomacula and remyelinated fibers, as indicated by thinner myelin. No second acute attack was observed up to the age of 1 year. Thus, the deletion of the Miz1 POZ domain in Schwann cells induces an acute neuropathy with a subsequent regeneration in which there is ongoing balancing between de- and remyelination. Miz1ΔPOZ mice are impaired in the maintenance of myelinated fibers and are a promising model for studying remyelination in adult peripheral nerves. PMID:25416780

  5. Magnesium carbonate-containing phosphate binder prevents connective tissue mineralization in Abcc6(-/-) mice-potential for treatment of pseudoxanthoma elasticum.


    Li, Qiaoli; Larusso, Jennifer; Grand-Pierre, Alix E; Uitto, Jouni


    Pseudoxanthoma elasticum (PXE) is a heritable disorder characterized by ectopic mineralization of connective tissues primarily in the skin, eyes, and the cardiovascular system. PXE is caused by mutations in the ABCC6 gene. While PXE is associated with considerable morbidity and mortality, there is currently no effective or specific treatment. In this study, we tested oral phosphate binders for treatment of a mouse model of PXE which we have developed by targeted ablation of the corresponding mouse gene (Abcc6(-/-)). This "knock-out" (KO) mouse model recapitulates features of PXE and demonstrates mineralization of a number of tissues, including the connective tissue capsule surrounding vibrissae in the muzzle skin which serves as an early biomarker of the mineralization process. Treatment of these mice with a magnesium carbonate-enriched diet (magnesium concentration being 5-fold higher than in the control diet) completely prevented mineralization of the vibrissae up to 6 months of age, as demonstrated by computerized morphometric analysis of histopathology as well as by calcium and phosphate chemical assays. The magnesium carbonate-enriched diet also prevented the progression of mineralization when the mice were placed on that experimental diet at 3 months of age and followed up to 6 months of age. Treatment with magnesium carbonate was associated with a slight increase in the serum concentration of magnesium, with no effect on serum calcium and phosphorus levels. In contrast, concentration of calcium in the urine was increased over 10-fold while the concentration of phosphorus was markedly decreased, being essentially undetectable after long-term (> 4 month) treatment. No significant changes were noted in the serum parathyroid hormone levels. Computerized axial tomography scan of bones in mice placed on magnesium carbonate-enriched diet showed no differences in the bone density compared to mice on the control diet, and chemical assays showed a small increase in

  6. Genetic determinants of emotionality and stress response in AcB/BcA recombinant congenic mice and in silico evidence of convergence with cardiovascular candidate genes.


    Thifault, Stéphane; Ondrej, Seda; Sun, Yulin; Fortin, Anny; Skamene, Emil; Lalonde, Robert; Tremblay, Johanne; Hamet, Pavel


    Genomic loci bearing stress-related phenotypes were dissected in recombinant congenic strains (RCS) of mice with C57BL/6J (B6) and A/J progenitors. Adult male mice from 14 A/J and 22 B6 background lines were evaluated for emotional reactivity in open-field (OF) and elevated plus-maze tests. Core temperature was monitored by radio telemetry during immobilization and on standard as well as salt-enriched diets. In addition, urinary electrolytes were measured. Genome-wide linkage analysis of the parameters revealed over 20 significant quantitative trait loci (QTL). The highest logarithm of odds (LOD) scores were within the previously-reported OF emotionality locus on Chr 1 (LOD = 4.6), in the dopa decarboxylase region on Chr 11 for the plus-maze (LOD = 4.7), and within a novel region of calmodulin 1 on Chr 12 for Ca++ excretion after a 24-h salt load (LOD = 4.6). RCS stress QTL overlapped with several candidate loci for cardiovascular (CV) disease. In silico evidence of functional polymorphisms by comparative sequence analysis of progenitor strains assisted to ascertain this convergence. The anxious BcA70 strain showed down regulation of Atp1a2 gene expression in the heart (P < 0.001) and brain (P < 0.05) compared with its parental B6 strain, compatible with the enhanced emotionality described in knock out animals for this gene, also involved in the salt-sensitive component of hypertension. Functional polymorphisms in regulatory elements of candidate genes of the CV/inflammatory/immune systems support the hypothesis of genetically-altered environmental susceptibility in CV disease development.

  7. Skeletal muscle alterations and exercise performance decrease in erythropoietin-deficient mice: a comparative study

    PubMed Central


    Background Erythropoietin (EPO) is known to improve exercise performance by increasing oxygen blood transport and thus inducing a higher maximum oxygen uptake (VO2max). Furthermore, treatment with (or overexpression of) EPO induces protective effects in several tissues, including the myocardium. However, it is not known whether EPO exerts this protective effect when present at physiological levels. Given that EPO receptors have been identified in skeletal muscle, we hypothesized that EPO may have a direct, protective effect on this tissue. Thus, the objectives of the present study were to confirm a decrease in exercise performance and highlight muscle transcriptome alterations in a murine EPO functional knock-out model (the EPO-d mouse). Methods We determined VO2max peak velocity and critical speed in exhaustive runs in 17 mice (9 EPO-d animals and 8 inbred controls), using treadmill enclosed in a metabolic chamber. Mice were sacrificed 24h after a last exhaustive treadmill exercise at critical speed. The tibialis anterior and soleus muscles were removed and total RNA was extracted for microarray gene expression analysis. Results The EPO-d mice’s hematocrit was about 50% lower than that of controls (p < 0.05) and their performance level was about 25% lower (p < 0.001). A total of 1583 genes exhibited significant changes in their expression levels. However, 68 genes were strongly up-regulated (normalized ratio > 1.4) and 115 were strongly down-regulated (normalized ratio < 0.80). The transcriptome data mining analysis showed that the exercise in the EPO-d mice induced muscle hypoxia, oxidative stress and proteolysis associated with energy pathway disruptions in glycolysis and mitochondrial oxidative phosphorylation. Conclusions Our results showed that the lack of functional EPO induced a decrease in the aerobic exercise capacity. This decrease was correlated with the hematocrit and reflecting poor oxygen supply to the muscles. The observed

  8. Histidine Decarboxylase Deficiency Prevents Autoimmune Diabetes in NOD Mice

    PubMed Central

    Alkan, Manal; Machavoine, François; Rignault, Rachel; Dam, Julie; Dy, Michel; Thieblemont, Nathalie


    Recent evidence has highlighted the role of histamine in inflammation. Since this monoamine has also been strongly implicated in the pathogenesis of type-1 diabetes, we assessed its effect in the nonobese diabetic (NOD) mouse model. To this end, we used mice (inactivated) knocked out for the gene encoding histidine decarboxylase, the unique histamine-forming enzyme, backcrossed on a NOD genetic background. We found that the lack of endogenous histamine in NOD HDC−/− mice decreased the incidence of diabetes in relation to their wild-type counterpart. Whereas the proportion of regulatory T and myeloid-derived suppressive cells was similar in both strains, histamine deficiency was associated with increased levels of immature macrophages, as compared with wild-type NOD mice. Concerning the cytokine pattern, we found a decrease in circulating IL-12 and IFN-γ in HDC−/− mice, while IL-6 or leptin remained unchanged, suggesting that histamine primarily modulates the inflammatory environment. Paradoxically, exogenous histamine given to NOD HDC−/− mice provided also protection against T1D. Our study supports the notion that histamine is involved in the pathogenesis of diabetes, thus providing additional evidence for its role in the regulation of the immune response. PMID:26090474

  9. Low Cytochrome Oxidase 1 Links Mitochondrial Dysfunction to Atherosclerosis in Mice and Pigs

    PubMed Central

    Vanhaverbeke, Maarten; Geeraert, Benjamine; De Keyzer, Dieuwke; Hulsmans, Maarten; Janssens, Stefan


    Background Cytochrome oxidase IV complex regulates energy production in mitochondria. Therefore, we determined the relation of COX genes with atherosclerosis in mice and pigs. Methods and results First, we compared atherosclerosis in the aortic arch of age-matched (24 weeks) C57BL/6J control (n = 10), LDL-receptor deficient (n = 8), leptin-deficient ob/ob (n = 10), and double knock-out (lacking LDL-receptor and leptin) mice (n = 12). Low aortic mitochondria-encoded cytochrome oxidase 1 in obese diabetic double knock-out mice was associated with a larger plaque area and higher propensity of M1 macrophages and oxidized LDL. Caloric restriction increased mitochondria-encoded cytochrome oxidase 1 and reduced plaque area and oxidized LDL. This was associated with a reduction of titer of anti-oxidized LDL antibodies, a proxy of systemic oxidative stress. Low of mitochondria-encoded cytochrome oxidase 1 was related to low expression of peroxisome proliferative activated receptors α, δ, and γ and of peroxisome proliferative activated receptor, gamma, co-activator 1 alpha reflecting mitochondrial dysfunction. Caloric restriction increased them. To investigate if there was a diabetic/obesity requirement for mitochondria-encoded cytochrome oxidase 1 to be down-regulated, we then studied atherosclerosis in LAD of hypercholesterolemic pigs (n = 37). Pigs at the end of the study were divided in three groups based on increasing LAD plaque complexity according to Stary (Stary I: n = 12; Stary II: n = 13; Stary III: n = 12). Low mitochondria-encoded cytochrome oxidase 1 in isolated plaque macrophages was associated with more complex coronary plaques and oxidized LDL. Nucleus-encoded cytochrome oxidase 4I1 and cytochrome oxidase 10 did not correlate with plaque complexity and oxidative stress. In mice and pigs, MT-COI was inversely related to insulin resistance. Conclusions Low MT-COI is related to mitochondrial dysfunction, oxidative stress and atherosclerosis and plaque

  10. Tissue taurine depletion alters metabolic response to exercise and reduces running capacity in mice.


    Ito, Takashi; Yoshikawa, Natsumi; Schaffer, Stephen W; Azuma, Junichi


    Taurine is a sulfur-containing amino acid found in very high concentration in skeletal muscle. Taurine deficient mice engineered by knocking out the taurine transporter gene exhibit skeletal muscle wasting, structural defects, and exercise intolerance. In the present study, we investigated the mechanism underlying the development of metabolic abnormalities and exercise intolerance in muscle of the TauTKO phenotype. Running speed and endurance time of TauTKO mice were lower than those of control mice. Blood lactate level was elevated by >3-fold during treadmill running in TauTKO mice but remained largely unaltered by exercise in WT mice. Blood glucose was cleared faster during treadmill running in TauTKO mice than WT mice. AMP-activated kinase (AMPK) β-2 subunit was reduced in TauTKO muscle concomitant with a reduction in α1 and α2 subunits of AMPK. The level of PPARα and its targets, Gpx3, Cpt2, and Echs1, were also decreased in TauTKO muscle. Collectively, taurine depletion impairs metabolic adaptation to exercise in skeletal muscle, a phenomenon associated with a downregulation of AMPK and diminished NADH utilization by the mitochondrial respiratory chain. These findings suggest a crucial role of taurine in regulating energy metabolism in skeletal muscle of exercising TauTKO mice, changes that contribute to impaired exercise endurance.

  11. Tissue Taurine Depletion Alters Metabolic Response to Exercise and Reduces Running Capacity in Mice

    PubMed Central

    Yoshikawa, Natsumi; Schaffer, Stephen W.


    Taurine is a sulfur-containing amino acid found in very high concentration in skeletal muscle. Taurine deficient mice engineered by knocking out the taurine transporter gene exhibit skeletal muscle wasting, structural defects, and exercise intolerance. In the present study, we investigated the mechanism underlying the development of metabolic abnormalities and exercise intolerance in muscle of the TauTKO phenotype. Running speed and endurance time of TauTKO mice were lower than those of control mice. Blood lactate level was elevated by >3-fold during treadmill running in TauTKO mice but remained largely unaltered by exercise in WT mice. Blood glucose was cleared faster during treadmill running in TauTKO mice than WT mice. AMP-activated kinase (AMPK) β-2 subunit was reduced in TauTKO muscle concomitant with a reduction in α1 and α2 subunits of AMPK. The level of PPARα and its targets, Gpx3, Cpt2, and Echs1, were also decreased in TauTKO muscle. Collectively, taurine depletion impairs metabolic adaptation to exercise in skeletal muscle, a phenomenon associated with a downregulation of AMPK and diminished NADH utilization by the mitochondrial respiratory chain. These findings suggest a crucial role of taurine in regulating energy metabolism in skeletal muscle of exercising TauTKO mice, changes that contribute to impaired exercise endurance. PMID:25478210

  12. Collagen Fibril Ultrastructure in Mice Lacking Discoidin Domain Receptor 1.


    Tonniges, Jeffrey R; Albert, Benjamin; Calomeni, Edward P; Roy, Shuvro; Lee, Joan; Mo, Xiaokui; Cole, Susan E; Agarwal, Gunjan


    The quantity and quality of collagen fibrils in the extracellular matrix (ECM) have a pivotal role in dictating biological processes. Several collagen-binding proteins (CBPs) are known to modulate collagen deposition and fibril diameter. However, limited studies exist on alterations in the fibril ultrastructure by CBPs. In this study, we elucidate how the collagen receptor, discoidin domain receptor 1 (DDR1) regulates the collagen content and ultrastructure in the adventitia of DDR1 knock-out (KO) mice. DDR1 KO mice exhibit increased collagen deposition as observed using Masson's trichrome. Collagen ultrastructure was evaluated in situ using transmission electron microscopy, scanning electron microscopy, and atomic force microscopy. Although the mean fibril diameter was not significantly different, DDR1 KO mice had a higher percentage of fibrils with larger diameter compared with their wild-type littermates. No significant differences were observed in the length of D-periods. In addition, collagen fibrils from DDR1 KO mice exhibited a small, but statistically significant, increase in the depth of the fibril D-periods. Consistent with these observations, a reduction in the depth of D-periods was observed in collagen fibrils reconstituted with recombinant DDR1-Fc. Our results elucidate how DDR1 modulates collagen fibril ultrastructure in vivo, which may have important consequences in the functional role(s) of the underlying ECM.

  13. Collagen Fibril Ultrastructure in Mice Lacking Discoidin Domain Receptor 1

    PubMed Central

    Tonniges, Jeffrey R.; Albert, Benjamin; Calomeni, Edward P.; Roy, Shuvro; Lee, Joan; Mo, Xiaokui; Cole, Susan E.; Agarwal, Gunjan


    The quantity and quality of collagen fibrils in the extracellular matrix (ECM) have a pivotal role in dictating biological processes. Several collagen-binding proteins (CBPs) are known to modulate collagen deposition and fibril diameter. However, limited studies exist on alterations in the fibril ultrastructure by CBPs. In this study, we elucidate how the collagen receptor, discoidin domain receptor 1 (DDR1) regulates the collagen content and ultrastructure in the adventitia of DDR1 knock-out (KO) mice. DDR1 KO mice exhibit increased collagen deposition as observed using Masson’s trichrome. Collagen ultrastructure was evaluated in situ using transmission electron microscopy, scanning electron microscopy, and atomic force microscopy. Although the mean fibril diameter was not significantly different, DDR1 KO mice had a higher percentage of fibrils with larger diameter compared with their wild-type littermates. No significant differences were observed in the length of D-periods. In addition, collagen fibrils from DDR1 KO mice exhibited a small, but statistically significant, increase in the depth of the fibril D-periods. Consistent with these observations, a reduction in the depth of D-periods was observed in collagen fibrils reconstituted with recombinant DDR1-Fc. Our results elucidate how DDR1 modulates collagen fibril ultrastructure in vivo, which may have important consequences in the functional role(s) of the underlying ECM. PMID:27329311

  14. Development and persistence of kindling epilepsy are impaired in mice lacking glial cell line-derived neurotrophic factor family receptor α2

    PubMed Central

    Nanobashvili, Avtandil; Airaksinen, Matti S.; Kokaia, Merab; Rossi, Jari; Asztély, Fredrik; Olofsdotter, Klara; Mohapel, Paul; Saarma, Mart; Lindvall, Olle; Kokaia, Zaal


    Seizure activity regulates gene expression for glial cell line-derived neurotrophic factor (GDNF) and neurturin (NRTN), and their receptor components, the transmembrane c-Ret tyrosine kinase and the glycosylphosphatidylinositol-anchored GDNF family receptor (GFR) α1 and α2 in limbic structures. We demonstrate here that epileptogenesis, as assessed in the hippocampal kindling model, is markedly suppressed in mice lacking GFRα2. Moreover, at 6 to 8 wk after having reached the epileptic state, the hyperexcitability is lower in GFRα2 knock-out mice as compared with wild-type mice. These results provide evidence that signaling through GFRα2 is involved in mechanisms regulating the development and persistence of kindling epilepsy. Our data suggest that GDNF and NRTN may modulate seizure susceptibility by altering the function of hilar neuropeptide Y-containing interneurons and entorhinal cortical afferents at dentate granule cell synapses. PMID:11050250

  15. Identification of a male meiosis-specific gene, Tcte2, which is differentially spliced in species that form sterile hybrids with laboratory mice and deleted in t chromosomes showing meiotic drive.


    Braidotti, G; Barlow, D P


    Tcte2 (t complex testes expressed 2) is a male meiosis-specific gene that maps to band 3.3 of mouse chromosome 17. Two distinct male fertility defects, hybrid sterility and transmission ratio distortion, have previously been mapped to this region. Hybrid sterility arises in crosses between different mouse species and the F1 generation males have defects in the first meiotic division and are sterile. Transmission ratio distortion is shown by males heterozygous for the t haplotype form of chromosome 17 and is a type of meiotic drive in which male gametes function unequally at fertilization. The Tcte2 gene expresses a coding mRNA and a number of putative non-ORF transcripts in meiosis I. A deletion of the 5' part of the locus abolishes Tcte2 expression on the t haplotype form of chromosome 17. Additionally, the series of putative non-ORF RNAs at the Tcte2 locus are differentially spliced in species that show hybrid sterility when crossed to laboratory mice. The identification of polymorphisms in t haplotypes and in different mouse species allows alleles of Tcte2 to be proposed as candidates for loci which contribute to both meiotic drive and hybrid sterility phenotypes. While theoretical considerations have previously been used to propose that speciation and meiotic drive involve alleles of the same genes, Tcte2 is the first cloned candidate gene to support this link at a molecular level.

  16. Increased Atherosclerosis and Endothelial Dysfunction in Mice Bearing Constitutively Deacetylated Alleles of Foxo1 Gene*

    PubMed Central

    Qiang, Li; Tsuchiya, Kyoichiro; Kim-Muller, Ja-Young; Lin, Hua V.; Welch, Carrie; Accili, Domenico


    Complications of atherosclerosis are the leading cause of death of patients with type 2 (insulin-resistant) diabetes. Understanding the mechanisms by which insulin resistance and hyperglycemia contribute to atherogenesis in key target tissues (liver, vessel wall, hematopoietic cells) can assist in the design of therapeutic approaches. We have shown that hyperglycemia induces FoxO1 deacetylation and that targeted knock-in of alleles encoding constitutively deacetylated FoxO1 in mice (Foxo1KR/KR) improves hepatic lipid metabolism and decreases macrophage inflammation, setting the stage for a potential anti-atherogenic effect of this mutation. Surprisingly, we report here that when Foxo1KR/KR mice are intercrossed with low density lipoprotein receptor knock-out mice (Ldlr−/−), they develop larger aortic root atherosclerotic lesions than Ldlr−/− controls despite lower plasma cholesterol and triglyceride levels. The phenotype is unaffected by transplanting bone marrow from Ldlr−/− mice into Foxo1KR/KR mice, indicating that it is independent of hematopoietic cells and suggesting that the primary lesion in Foxo1KR/KR mice occurs in the vessel wall. Experiments in isolated endothelial cells from Foxo1KR/KR mice indicate that deacetylation favors FoxO1 nuclear accumulation and exerts target gene-specific effects, resulting in higher Icam1 and Tnfα expression and increased monocyte adhesion. The data indicate that FoxO1 deacetylation can promote vascular endothelial changes conducive to atherosclerotic plaque formation. PMID:22389493

  17. Genetically engineered mice in understanding the basis of neonatal lung disease.


    Glasser, Stephan W; Nogee, Lawrence M


    Advances in genetic engineering have allowed the creation of animals with additional or deleted genes. New genes may be inserted in mice, specific genes inactivated or "knocked out," and more complex animals created in which genes can be turned on or off at different times in development or in different tissues. These animal models allow for more detailed studies of the proteins encoded by the manipulated gene, an improved understanding of the pathophysiology of diseases resulting from the genetic alterations, and model organisms in which to study potential new therapies. Multiple mouse models involving genes important in surfactant production and regulation relevant to lung disease observed in human newborns have been created. This review will discuss the creation of such animals and illustrate their utility in understanding human disease.

  18. Absence of apolipoprotein E protects mice from cerebral malaria.


    Kassa, Fikregabrail Aberra; Van Den Ham, Kristin; Rainone, Anthony; Fournier, Sylvie; Boilard, Eric; Olivier, Martin


    Cerebral malaria claims the life of millions of people each year, particularly those of children, and is a major global public health problem. Thus, the identification of novel malaria biomarkers that could be utilized as diagnostic or therapeutic targets is becoming increasingly important. Using a proteomic approach, we previously identified unique biomarkers in the sera of malaria-infected individuals, including apolipoprotein E (ApoE). ApoE is the dominant apolipoprotein in the brain and has been implicated in several neurological disorders; therefore, we were interested in the potential role of ApoE in cerebral malaria. Here we report the first demonstration that cerebral malaria is markedly attenuated in ApoE(-/-) mice. The protection provided by the absence of ApoE was associated with decreased sequestration of parasites and T cells within the brain, and was determined to be independent from the involvement of ApoE receptors and from the altered lipid metabolism associated with the knock-out mice. Importantly, we demonstrated that treatment of mice with the ApoE antagonist heparin octasaccharide significantly decreased the incidence of cerebral malaria. Overall, our study indicates that the reduction of ApoE could be utilized in the development of therapeutic treatments aimed at mitigating the neuropathology of cerebral malaria.

  19. Absence of apolipoprotein E protects mice from cerebral malaria

    PubMed Central

    Kassa, Fikregabrail Aberra; Van Den Ham, Kristin; Rainone, Anthony; Fournier, Sylvie; Boilard, Eric; Olivier, Martin


    Cerebral malaria claims the life of millions of people each year, particularly those of children, and is a major global public health problem. Thus, the identification of novel malaria biomarkers that could be utilized as diagnostic or therapeutic targets is becoming increasingly important. Using a proteomic approach, we previously identified unique biomarkers in the sera of malaria-infected individuals, including apolipoprotein E (ApoE). ApoE is the dominant apolipoprotein in the brain and has been implicated in several neurological disorders; therefore, we were interested in the potential role of ApoE in cerebral malaria. Here we report the first demonstration that cerebral malaria is markedly attenuated in ApoE−/− mice. The protection provided by the absence of ApoE was associated with decreased sequestration of parasites and T cells within the brain, and was determined to be independent from the involvement of ApoE receptors and from the altered lipid metabolism associated with the knock-out mice. Importantly, we demonstrated that treatment of mice with the ApoE antagonist heparin octasaccharide significantly decreased the incidence of cerebral malaria. Overall, our study indicates that the reduction of ApoE could be utilized in the development of therapeutic treatments aimed at mitigating the neuropathology of cerebral malaria. PMID:27647324

  20. Mice lacking brain/kidney phosphate-activated glutaminase (GLS1) have impaired glutamatergic synaptic transmission, altered breathing, disorganized goal-directed behavior and die shortly after birth

    PubMed Central

    Masson, Justine; Darmon, Michèle; Conjard, Agnès; Chuhma, Nao; Ropert, Nicole; Thoby-Brisson, Muriel; Foutz, Arthur S.; Parrot, Sandrine; Miller, Gretchen M.; Jorisch, Renée; Polan, Jonathan; Hamon, Michel; Hen, René; Rayport, Stephen


    Neurotransmitter glutamate has been thought to derive mainly from glutamine via the action of glutaminase type 1 (GLS1). To address the importance of this pathway in glutamatergic transmission, we knocked out GLS1 in mice. The insertion of a STOP cassette by homologous recombination produced a null allele that blocked transcription, encoded no immunoreactive protein and abolished GLS1 enzymatic activity. Null mutants were slightly smaller, were deficient in goal-directed behavior, hypoventilated and died in the first post-natal day. No gross or microscopic defects were detected in peripheral organs or in the central nervous system. In cultured neurons from the null mutants, miniature EPSC amplitude and duration were normal; however, the amplitude of evoked EPSCs decayed more rapidly with sustained 10 Hz stimulation, consistent with an observed reduction in depolarization-evoked glutamate release. Because of this activity-dependent impairment in glutamatergic transmission, we surmised that respiratory networks, which require temporal summation of synaptic input, would be particularly affected. We found that the amplitude of inspirations was decreased in vivo, chemosensitivity to CO2 was severely altered, and the frequency of pacemaker activity recorded in the respiratory generator in the Pre-Bötzinger complex, a glutamatergic brainstem network that can be isolated in vitro, was increased. Our results show that while alternate pathways to GLS1 glutamate synthesis support baseline glutamatergic transmission, the GLS1 pathway is essential for maintaining the function of active synapses, and so the mutation is associated with impaired respiratory function, abnormal goal-directed behavior and neonatal demise. PMID:16641247

  1. Loss of the Max-interacting protein Mnt in mice results in decreased viability, defective embryonic growth and craniofacial defects: relevance to Miller-Dieker syndrome.


    Toyo-oka, Kazuhito; Hirotsune, Shinji; Gambello, Michael J; Zhou, Zi-Qiang; Olson, Lorin; Rosenfeld, Michael G; Eisenman, Robert; Hurlin, Peter; Wynshaw-Boris, Anthony


    The Mnt gene encodes a Mad-family bHLH transcription factor located on human 17p13.3. Mnt is one of 20 genes deleted in a heterozygous fashion in Miller-Dieker syndrome (MDS), a contiguous gene syndrome that consists of severe neuronal migration defects and craniofacial dysmorphic features. Mnt can inhibit Myc-dependent cell transformation and is hypothesized to counterbalance the effects of c-Myc on growth and proliferation in vivo by competing with Myc for binding to Max and by repressing target genes activated by Myc : Max heterodimers. Unlike the related Mad family members, Mnt is expressed ubiquitously and Mnt/Max heterodimers are found in proliferating cells that contain Myc/Max heterodimers, suggesting a unique role for Mnt during proliferation. To examine the role of Mnt in vivo, we produced mice with null (Mnt(KO)) and loxP-flanked conditional knock-out (Mnt(CKO)) alleles of Mnt. Virtually all Mnt(KO/KO) mutants in a mixed (129S6 x NIH Black Swiss) or inbred (129S6) genetic background died perinatally. Mnt-deficient embryos exhibited small size throughout development and showed reduced levels of c-Myc and N-Myc. In addition, 37% of the mixed background mutants displayed cleft palate as well as retardation of skull development, a phenotype not observed in the inbred mutants. These results demonstrate an important role for Mnt in embryonic development and survival, and suggest that Mnt may play a role in the craniofacial defects displayed by MDS patients.

  2. Antidepressant-like effects of oxytocin in mice are dependent on the presence of insulin-regulated aminopeptidase.


    Loyens, Ellen; De Bundel, Dimitri; Demaegdt, Heidi; Chai, Siew Yeen; Vanderheyden, Patrick; Michotte, Yvette; Gard, Paul; Smolders, Ilse


    Oxytocin is a neuromodulator with antidepressant-like effects. In vitro, oxytocin is rapidly cleaved by insulin-regulated aminopeptidase (IRAP). Oxytocin metabolites are known to exert strong central activities that are different from the effects of the parent molecule. Our goal is to investigate in vivo whether IRAP deletion modifies the antidepressant-like effects of oxytocin. Male and female C57Bl/6 mice, IRAP wild-type (IRAP(+/+)) and knock-out (IRAP(-/-)) mice were injected subcutaneously with saline, oxytocin or oxytocin combined with angiotensin IV. One hour after injection, immobility was timed during a 5 min forced swim that was preceded by an open field to study locomotor behaviour. Oxytocin induced antidepressant-like effects in male (0.25 mg/kg oxytocin) and female (0.15 mg/kg oxytocin) C57Bl/6 mice subjected to the forced swim test. Oxytocin did not influence locomotor behaviour in mice, as shown with the open field. These findings were reproduced in transgenic male (aged 3-6 months) and female (aged 12-18 months) IRAP(+/+) mice. However, the major findings of our study were that the antidepressant-like effect was reversed in angiotensin IV treated IRAP(+/+) mice and was completely absent in age- and gender-matched IRAP(-/-) mice. The lack of an antidepressant-like effect of oxytocin in young male and middle-aged female IRAP(-/-) mice attributes an important role to IRAP in mediating this effect.

  3. NewsMars: Express journey to Mars ASE 2003: Knocked out by meteorites Events: Sun-Earth Day ASE 2003: Fun Physics - popular as ever Appointments: Sykes to bring science to the people UK Science Education: The future's bright, the future's science ASE 2003: A grand finale for Catherine Teaching Resources: UK goes to the planets Cambridge Physics Update: Basement physics Conferences: Earth Science Teachers' Association Conference 2003 New Website: JESEI sets sail GIREP: Teacher education seminar Malaysia: Rewards for curriculum change Cambridge Physics Update: My boomerang will come back! Teaching Resources: Widening particiption through ideas and evidence with the University of Surrey Wales: First Ffiseg Events: Nuna: Solar car on tour Physics on Stage: Physics on Stage 3 embraces life Symposium: In what sense a nuclear 'debate'? Gifted and Talented: Able pupils experiencing challenging science Australia: ISS flies high Down Under

    NASA Astrophysics Data System (ADS)


    Mars: Express journey to Mars ASE 2003: Knocked out by meteorites Events: Sun-Earth Day ASE 2003: Fun Physics - popular as ever Appointments: Sykes to bring science to the people UK Science Education: The future's bright, the future's science ASE 2003: A grand finale for Catherine Teaching Resources: UK goes to the planets Cambridge Physics Update: Basement physics Conferences: Earth Science Teachers' Association Conference 2003 New Website: JESEI sets sail GIREP: Teacher education seminar Malaysia: Rewards for curriculum change Cambridge Physics Update: My boomerang will come back! Teaching Resources: Widening particiption through ideas and evidence with the University of Surrey Wales: First Ffiseg Events: Nuna: Solar car on tour Physics on Stage: Physics on Stage 3 embraces life Symposium: In what sense a nuclear 'debate'? Gifted and Talented: Able pupils experiencing challenging science Australia: ISS flies high Down Under

  4. Disruption of the lecithin:retinol acyltransferase gene makes mice more susceptible to vitamin A deficiency.


    Liu, Limin; Gudas, Lorraine J


    Lecithin:retinol acyltransferase (LRAT) catalyzes the esterification of retinol (vitamin A) in the liver and in some extrahepatic tissues, including the lung. We produced an LRAT gene knock-out mouse strain and assessed whether LRAT-/- mice were more susceptible to vitamin A deficiency than wild type (WT) mice. After maintenance on a vitamin A-deficient diet for 6 weeks, the serum retinol level was 1.34 +/- 0.32 microM in WT mice versus 0.13 +/- 0.06 microM in LRAT-/- mice (p < 0.05). In liver, lung, eye, kidney, brain, tongue, adipose tissue, skeletal muscle, and pancreas, the retinol levels ranged from 0.05 pmol/mg (muscle and tongue) to 17.35 +/- 2.66 pmol/mg (liver) in WT mice. In contrast, retinol was not detectable (<0.007 pmol/mg) in most tissues from LRAT-/- mice after maintenance on a vitamin A-deficient diet for 6 weeks. Cyp26A1 mRNA was not detected in hepatic tissue samples from LRAT-/- mice but was detected in WT mice fed the vitamin A-deficient diet. These data indicate that LRAT-/- mice are much more susceptible to vitamin A deficiency and should be an excellent animal model of vitamin A deficiency. In addition, the retinol levels in serum rapidly increased in the LRAT-/- mice upon re-addition of vitamin A to the diet, indicating that serum retinol levels in LRAT-/- mice can be conveniently modulated by the quantitative manipulation of dietary retinol.

  5. Role of Keap1-Nrf2 signaling in depression and dietary intake of glucoraphanin confers stress resilience in mice

    PubMed Central

    Yao, Wei; Zhang, Ji-chun; Ishima, Tamaki; Dong, Chao; Yang, Chun; Ren, Qian; Ma, Min; Han, Mei; Wu, Jin; Suganuma, Hiroyuki; Ushida, Yusuke; Yamamoto, Masayuki; Hashimoto, Kenji


    The transcription factor Keap1-Nrf2 system plays a key role in inflammation which is involved in depression. We found lower expression of Keap1 and Nrf2 proteins in the prefrontal cortex (PFC), CA3 and dentate gyrus (DG) of hippocampus in mice with depression-like phenotype compared to control mice. Serum levels of pro-inflammatory cytokines in Nrf2 knock-out (KO) mice were higher than those of wild-type mice, suggestive of enhanced inflammation in KO mice. Decreased brain-derived neurotrophic factor (BDNF) and its receptor tropomyosin-receptor-kinase B (TrkB) signaling in the PFC, CA3 and DG plays a role in the depression-like phenotype of Nrf2 KO mice. TrkB agonist 7,8-dihydroxyflavone, but not antagonist ANA-12, produced antidepressant effects in Nrf2 KO mice, by stimulating TrkB in the PFC, CA3 and DG. Pretreatment with Nrf2 activator sulforaphane (SFN) prevented the depression-like phenotype induced after repeated social defeat stress. Interestingly, dietary intake of 0.1% glucoraphanin (a precursor of SFN) containing food during juvenile and adolescent stages also prevented the depression-like phenotype evoked in adulthood, after repeated social defeat stress. These findings suggest that Keap1-Nrf2 system plays a key role in depression and that dietary intake of SFN-rich food during juvenile stages and adolescence can confer stress resilience in adulthood. PMID:27470577

  6. Role of Keap1-Nrf2 signaling in depression and dietary intake of glucoraphanin confers stress resilience in mice.


    Yao, Wei; Zhang, Ji-Chun; Ishima, Tamaki; Dong, Chao; Yang, Chun; Ren, Qian; Ma, Min; Han, Mei; Wu, Jin; Suganuma, Hiroyuki; Ushida, Yusuke; Yamamoto, Masayuki; Hashimoto, Kenji


    The transcription factor Keap1-Nrf2 system plays a key role in inflammation which is involved in depression. We found lower expression of Keap1 and Nrf2 proteins in the prefrontal cortex (PFC), CA3 and dentate gyrus (DG) of hippocampus in mice with depression-like phenotype compared to control mice. Serum levels of pro-inflammatory cytokines in Nrf2 knock-out (KO) mice were higher than those of wild-type mice, suggestive of enhanced inflammation in KO mice. Decreased brain-derived neurotrophic factor (BDNF) and its receptor tropomyosin-receptor-kinase B (TrkB) signaling in the PFC, CA3 and DG plays a role in the depression-like phenotype of Nrf2 KO mice. TrkB agonist 7,8-dihydroxyflavone, but not antagonist ANA-12, produced antidepressant effects in Nrf2 KO mice, by stimulating TrkB in the PFC, CA3 and DG. Pretreatment with Nrf2 activator sulforaphane (SFN) prevented the depression-like phenotype induced after repeated social defeat stress. Interestingly, dietary intake of 0.1% glucoraphanin (a precursor of SFN) containing food during juvenile and adolescent stages also prevented the depression-like phenotype evoked in adulthood, after repeated social defeat stress. These findings suggest that Keap1-Nrf2 system plays a key role in depression and that dietary intake of SFN-rich food during juvenile stages and adolescence can confer stress resilience in adulthood.

  7. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1.


    Singaraja, R R; Bocher, V; James, E R; Clee, S M; Zhang, L H; Leavitt, B R; Tan, B; Brooks-Wilson, A; Kwok, A; Bissada, N; Yang, Y Z; Liu, G; Tafuri, S R; Fievet, C; Wellington, C L; Staels, B; Hayden, M R


    By using BAC transgenic mice, we have shown that increased human ABCA1 protein expression results in a significant increase in cholesterol efflux in different tissues and marked elevation in high density lipoprotein (HDL)-cholesterol levels associated with increases in apoAI and apoAII. Three novel ABCA1 transcripts containing three different transcription initiation sites that utilize sequences in intron 1 have been identified. In BAC transgenic mice there is an increased expression of ABCA1 protein, but the distribution of the ABCA1 product in different cells remains similar to wild type mice. An internal promoter in human intron 1 containing liver X response elements is functional in vivo and directly contributes to regulation of the human ABCA1 gene in multiple tissues and to raised HDL cholesterol, apoAI, and apoAII levels. A highly significant relationship between raised protein levels, increased efflux, and level of HDL elevation is evident. These data provide proof of the principle that increased human ABCA1 efflux activity is associated with an increase in HDL levels in vivo.

  8. Progressive Secondary Neurodegeneration and Microcalcification Co-Occur in Osteopontin-Deficient Mice

    PubMed Central

    Maetzler, Walter; Berg, Daniela; Funke, Claudia; Sandmann, Freya; Stünitz, Holger; Maetzler, Corina; Nitsch, Cordula


    In the brain, osteopontin (OPN) may function in a variety of pathological conditions, including neurodegeneration, microcalcification, and inflammation. In this study, we addressed the role of OPN in primary and secondary neurodegeneration, microcalcification, and inflammation after an excitotoxic lesion by examining OPN knock-out (KO) mice. Two, four, and ten weeks after injection of the glutamate analogue ibotenate into the corticostriatal boundary, the brains of 12 mice per survival time and strain were evaluated. OPN was detectable in neuron-shaped cells, in microglia, and at the surface of dense calcium deposits. At this primary lesion site, although the glial reaction was attenuated in OPN-KO mice, lesion size and presence of microcalcification were comparable between OPN-KO and wild-type mice. In contrast, secondary neurodegeneration at the thalamus was more prominent in OPN-KO mice, and this difference increased over time. This was paralleled by a dramatic rise in the regional extent of dense microcalcification. Despite these differences, the numbers of glial cells did not significantly differ between the two strains. This study demonstrates for the first time a genetic model with co-occurrence of neurodegeneration and microcalcification, mediated by the lack of OPN, and suggests a basic involvement of OPN action in these conditions. In the case of secondary retrograde or transneuronal degeneration, OPN may have a protective role as intracellular actor. PMID:20522649

  9. Persistent hepatitis C virus infections and hepatopathological manifestations in immune-competent humanized mice

    PubMed Central

    Chen, Jizheng; Zhao, Yang; Zhang, Chao; Chen, Hairong; Feng, Jin; Chi, Xiumei; Pan, Yu; Du, Jun; Guo, Min; Cao, Huang; Chen, Honghe; Wang, Zilong; Pei, Rongjuan; Wang, Qian; Pan, Lei; Niu, Junqi; Chen, Xinwen; Tang, Hong


    The majority of hepatitis C virus (HCV) infection develops chronic infection, which causes steatosis, cirrhosis and hepatocellular carcinoma. However, understanding HCV chronicity and pathogenesis is hampered by its narrow host range, mostly restricted to human and chimpanzee. Recent endeavour to infect a variety of humanized mice has not been able to achieve persistent HCV infection unless the essential innate immune responsive genes are knocked out. Nevertheless, such immune-compromised humanized mice still lacked HCV infection-induced hepatopathogenesis. Here we report that transgenic mice in ICR background harboring both human CD81 and occludin genes (C/OTg) are permissive to HCV infection at a chronicity rate comparable to humans. In this mouse model, HCV accomplishes its replication cycle, leading to sustained viremia and infectivity for more than 12 months post infection with expected fibrotic and cirrhotic progression. Host factors favorable for HCV replication, and inadequate innate immune-response may contribute to the persistence. Lastly, NS3/4 protease inhibitor telaprevir can effectively inhibit de novo RNA synthesis and acute HCV infection of C/OTg mice. Thus, chronic HCV infection with complete replication cycle and hepatopathologic manifestations is recapitulated, for the first time, in immune-competent mice. This model will open a new venue to study the mechanisms of chronic hepatitis C and develop better treatments. PMID:25155355

  10. Osteopontin Deficiency Accelerates Spontaneous Colitis in Mice with Disrupted Gut Microbiota and Macrophage Phagocytic Activity

    PubMed Central

    Toyonaga, Takahiko; Nakase, Hiroshi; Ueno, Satoru; Matsuura, Minoru; Yoshino, Takuya; Honzawa, Yusuke; Itou, Ayako; Namba, Kazuyoshi; Minami, Naoki; Yamada, Satoshi; Koshikawa, Yorimitsu; Uede, Toshimitsu; Chiba, Tsutomu; Okazaki, Kazuichi


    Background Osteopontin (OPN) is a multifunctional protein expressed in a variety of tissues and cells. Recent studies revealed increased OPN expression in the inflamed intestinal tissues of patients with inflammatory bowel disease (IBD). The role of OPN in the pathophysiology of IBD, however, remains unclear. Aims To investigate the role of OPN in the development of intestinal inflammation using a murine model of IBD, interleukin-10 knock out (IL-10 KO) mice. Methods We compared the development of colitis between IL-10 KO and OPN/IL-10 double KO (DKO) mice. OPN expression in the colonic tissues of IL-10 KO mice was examined by fluorescence in situ hybridization (FISH) analysis. Enteric microbiota were compared between IL-10 KO and OPN/IL-10 DKO mice by terminal restriction fragment length polymorphism analysis. The effect of OPN on macrophage phagocytic function was evaluated by phagocytosis assay. Results OPN/IL-10 DKO mice had an accelerated onset of colitis compared to IL-10 KO mice. FISH analysis revealed enhanced OPN synthesis in the colonic epithelial cells of IL-10 KO mice. OPN/IL-10 DKO mice had a distinctly different enteric bacterial profile with a significantly lower abundance of Clostridium subcluster XIVa and a greater abundance of Clostridium cluster XVIII compared to IL-10 KO mice. Intracellular OPN deletion in macrophages impaired phagocytosis of fluorescence particle-conjugated Escherichia coli in vitro. Exogenous OPN enhanced phagocytosis by OPN-deleted macrophages when administered at doses of 1 to 100 ng/ml, but not 1000 ng/ml. Conclusions OPN deficiency accelerated the spontaneous development of colitis in mice with disrupted gut microbiota and macrophage phagocytic activity. PMID:26274807

  11. Disruption of Protein Processing in the Endoplasmic Reticulum of DYT1 Knock-in Mice Implicates Novel Pathways in Dystonia Pathogenesis

    PubMed Central

    Beauvais, Genevieve; Bode, Nicole M.; Watson, Jaime L.; Wen, Hsiang; Glenn, Kevin A.; Kawano, Hiroyuki; Harata, N. Charles; Ehrlich, Michelle E.


    Dystonia type 1 (DYT1) is a dominantly inherited neurological disease caused by mutations in TOR1A, the gene encoding the endoplasmic reticulum (ER)-resident protein torsinA. Previous work mostly completed in cell-based systems suggests that mutant torsinA alters protein processing in the secretory pathway. We hypothesized that inducing ER stress in the mammalian brain in vivo would trigger or exacerbate mutant torsinA-induced dysfunction. To test this hypothesis, we crossed DYT1 knock-in with p58(IPK)-null mice. The ER co-chaperone p58(IPK) interacts with BiP and assists in protein maturation by helping to fold ER cargo. Its deletion increases the cellular sensitivity to ER stress. We found a lower generation of DYT1 knock-in/p58 knock-out mice than expected from this cross, suggesting a developmental interaction that influences viability. However, surviving animals did not exhibit abnormal motor function. Analysis of brain tissue uncovered dysregulation of eiF2α and Akt/mTOR translational control pathways in the DYT1 brain, a finding confirmed in a second rodent model and in human brain. Finally, an unbiased proteomic analysis identified relevant changes in the neuronal protein landscape suggesting abnormal ER protein metabolism and calcium dysregulation. Functional studies confirmed the interaction between the DYT1 genotype and neuronal calcium dynamics. Overall, these findings advance our knowledge on dystonia, linking translational control pathways and calcium physiology to dystonia pathogenesis and identifying potential new pharmacological targets. SIGNIFICANCE STATEMENT Dystonia type 1 (DYT1) is one of the different forms of inherited dystonia, a neurological disorder characterized by involuntary, disabling movements. DYT1 is caused by mutations in the gene that encodes the endoplasmic reticulum (ER)-resident protein torsinA. How mutant torsinA causes neuronal dysfunction remains unknown. Here, we show the behavioral and molecular consequences of stressing

  12. Humanized mice dually challenged with R5 and X4 HIV-1 show preferential R5 viremia and restricted X4 infection of CCR5(+)CD4(+) T cells.


    Terahara, Kazutaka; Ishige, Masayuki; Ikeno, Shota; Okada, Seiji; Kobayashi-Ishihara, Mie; Ato, Manabu; Tsunetsugu-Yokota, Yasuko


    CCR5-tropic (R5) immunodeficiency virus type 1 (HIV-1) strains are highly transmissible during the early stage of infection in humans, whereas CXCR4-tropic (X4) strains are less transmissible. This study aimed to explore the basis for early phase R5 and X4 HIV-1 infection in vivo by using humanized mice dually challenged with R5 HIV-1NLAD8-D harboring DsRed and X4 HIV-1(NL-E) harboring EGFP. Whereas R5 HIV-1 replicated well, X4 HIV-1 caused only transient viremia with variable kinetics; however, this was distinct from the low level but persistent viremia observed in mice challenged with X4 HIV-1 alone. Flow cytometric analysis of HIV-1-infected cells revealed that X4 HIV-1 infection of CCR5(+)CD4(+) T cells was significantly suppressed in the presence of R5 HIV-1. X4 HIV-1 was more cytopathic than R5 HIV-1; however, this was not the cause of restricted X4 HIV-1 infection because there were no significant differences in the mortality rates of CCR5(+) and CCR5(-) cells within the X4 HIV-1-infected cell populations. Taken together, these results suggest that restricted infection of CCR5(+)CD4(+) T cells by X4 HIV-1 (occurring via a still-to-be-identified mechanism) might contribute to the preferential transmission of R5 HIV-1 during the early phase of infection.

  13. Patients with chronic pancreatitis have islet progenitor cells in their ducts, but reversal of overt diabetes in NOD mice by anti-CD3 shows no evidence for islet regeneration.


    Phillips, Jenny M; O'Reilly, Lorraine; Bland, Chris; Foulis, Alan K; Cooke, Anne


    Monoclonal antibodies to T-cell coreceptors have been shown to tolerise autoreactive T-cells and prevent or even reverse autoimmune pathology. In type 1 diabetes, there is a loss of insulin-secreting beta-cells, and a cure for type 1 diabetes would require not only tolerance induction but also recovery of the functional beta-cell mass. Although we have previously shown that diabetic mice have increased numbers of ductal progenitors in the pancreas, there is no evidence of any increase of insulin-secreting cells in the ducts. In contrast, in the adult human pancreas of patients with chronic pancreatitis, we can demonstrate, in the ducts, increased numbers of insulin-containing cells, as well as cells containing other endocrine and exocrine markers. There are also significantly increased numbers of cells expressing the homeodomain protein, pancreatic duodenal homeobox-1. Anti-CD3 has been shown to reverse overt diabetes in NOD mice; thus, we have used this model to ask whether monoclonal antibody-mediated inhibition of ongoing beta-cell destruction enables islet regeneration to occur. We find no evidence that such monoclonal antibody therapy results in either regeneration of insulin-secreting beta-cells or of increased proliferation of islet beta-cells.

  14. Knockout of the abetalipoproteinemia gene in mice: reduced lipoprotein secretion in heterozygotes and embryonic lethality in homozygotes.


    Raabe, M; Flynn, L M; Zlot, C H; Wong, J S; Véniant, M M; Hamilton, R L; Young, S G


    Abetalipoproteinemia, an inherited human disease characterized by a near-complete absence of the apolipoprotein (apo) B-containing lipoproteins in the plasma, is caused by mutations in the gene for microsomal triglyceride transfer protein (MTP). We used gene targeting to knock out the mouse MTP gene (Mttp). In heterozygous knockout mice (Mttp+/- ), the MTP mRNA, protein, and activity levels were reduced by 50%, in both liver and intestine. Compared with control mice (Mttp+/+), chow-fed Mttp+/- mice had reduced plasma levels of low-density lipoprotein cholesterol and had a 28% reduction in plasma apoB100 levels. On a high-fat diet, the Mttp+/- mice exhibited a marked reduction in total plasma cholesterol levels, compared with those in Mttp+/+ mice. Both the livers of adult Mttp+/- mice and the visceral endoderm of the yolk sacs from Mttp+/- embryos manifested an accumulation of cytosolic fat. All homozygous embryos (Mttp-/-) died during embryonic development. In the visceral endoderm of Mttp-/- yolk sacs, lipoprotein synthesis was virtually absent, and there was a marked accumulation of cytosolic fat droplets. In summary, half-normal MTP levels do not support normal levels of lipoprotein synthesis and secretion, and a complete deficiency of MTP causes lethal developmental abnormalities, perhaps because of an impaired capacity of the yolk sac to export lipids to the developing embryo.

  15. Macrophage peroxisome proliferator-activated receptor γ deficiency delays skin wound healing through impairing apoptotic cell clearance in mice.


    Chen, H; Shi, R; Luo, B; Yang, X; Qiu, L; Xiong, J; Jiang, M; Liu, Y; Zhang, Z; Wu, Y


    Skin wound macrophages are key regulators of skin repair and their dysfunction causes chronic, non-healing skin wounds. Peroxisome proliferator-activated receptor gamma (PPARγ) regulates pleiotropic functions of macrophages, but its contribution in skin wound healing is poorly defined. We observed that macrophage PPARγ expression was upregulated during skin wound healing. Furthermore, macrophage PPARγ deficiency (PPARγ-knock out (KO)) mice exhibited impaired skin wound healing with reduced collagen deposition, angiogenesis and granulation formation. The tumor necrosis factor alpha (TNF-α) expression in wounds of PPARγ-KO mice was significantly increased and local restoration of TNF-α reversed the healing deficit in PPARγ-KO mice. Wound macrophages produced higher levels of TNF-α in PPARγ-KO mice compared with control. In vitro, the higher production of TNF-α by PPARγ-KO macrophages was associated with impaired apoptotic cell clearance. Correspondingly, increased apoptotic cell accumulation was found in skin wound of PPARγ-KO mice. Mechanically, peritoneal and skin wound macrophages expressed lower levels of various phagocytosis-related molecules. In addition, PPARγ agonist accelerated wound healing and reduced local TNF-α expression and wound apoptotic cells accumulation in wild type but not PPARγ-KO mice. Therefore, PPARγ has a pivotal role in controlling wound macrophage clearance of apoptotic cells to ensure efficient skin wound healing, suggesting a potential new therapeutic target for skin wound healing.

  16. Knock-out of the plastid ribosomal protein L11 in Arabidopsis: effects on mRNA translation and photosynthesis.


    Pesaresi, P; Varotto, C; Meurer, J; Jahns, P; Salamini, F; Leister, D


    The prpl11-1 mutant of Arabidopsis thaliana was identified among a collection of T-DNA tagged lines on the basis of a decrease in the effective quantum yield of photosystem II. The mutation responsible was localized to Prpl11, a single-copy nuclear gene that encodes PRPL11, a component of the large subunit of the plastid ribosome. The amino acid sequence of Arabidopsis PRPL11 is very similar to those of L11 proteins from spinach and prokaryotes. In the prpl11-1 mutant, photosensitivity and chlorophyll fluorescence parameters are significantly altered owing to changes in the levels of thylakoid protein complexes and stromal proteins. The abundance of most plastome transcripts examined, such as those of genes coding for the photosystem II core complex and RbcL, is not decreased. Plastid ribosomal RNA accumulates in wild-type amounts, and the assembly of plastid polysomes on the transcripts of the rbcL, psbA and psbE genes remains mainly unchanged in mutant plants, indicating that lack of PRPL11 affects neither the abundance of plastid ribosomes nor their assembly into polysomes. However, in vivo translation assays demonstrate that the rate of translation of the large subunit of Rubisco (RbcL) is significantly reduced in prpl11-1 plastids. Our data suggest a major role for PRPL11 in plastid ribosome activity per se, consistent with its location near the GTPase-binding centre of the chloroplast 50S ribosomal subunit. Additional effects of the mutation, including the pale green colour of the leaves and a drastic reduction in growth rate under greenhouse conditions, are compatible with reduced levels of protein synthesis in plastids.

  17. Knocking out consumer concerns and regulator's rules: efficient use of CRISPR/Cas ribonucleoprotein complexes for genome editing in cereals.


    Wolter, Felix; Puchta, Holger


    Selection-free genome editing using Cas9 ribonucleoprotein embryo bombardment has been achieved for maize and wheat. This is a breakthrough that should make new breeding technologies more acceptable for worldwide use.

  18. A Novel Knock-Out Animal Model to Analyze Transcriptional Signaling by p53 Tumor Suppressor Protein in Breast Cancer

    DTIC Science & Technology


    p2lpcna genes was obtained from Celera mouse database. DNA sequences identified from the database and the sequence of the 40 bp overgo probe for screening...aagaccagagggagcctgaagactgtgatggggtagtttccatagtgacccgggtccttcttgtgtttcagccacagcgac c Complete overgo sequence for P21 5_UTR2 AGCCTGAAGACTGTGATGGGGTAGTTTCCATAGTGACCCG >pcna_5_UTR (highly specific...UNPUBLISHED Complete overgo sequence for PCNA 5_UTR CGCGGAAACTTCCTAAGGATGGAAACTGCAGCCTAAACTC Initial screen of the BAC library was performed by

  19. Development of Accelerated Coronary Atherosclerosis Model Using Low Density Lipoprotein Receptor Knock-Out Swine with Balloon Injury

    PubMed Central

    Ogita, Manabu; Miyauchi, Katsumi; Onishi, Akira; Tsuboi, Shuta; Wada, Hideki; Konishi, Hirokazu; Naito, Ryo; Dohi, Tomotaka; Kasai, Takatoshi; Kojima, Yuko; Schwartz, Robert S.; Daida, Hiroyuki


    Background Several animal models have facilitated the evaluation and pathological understanding of atherosclerosis, but a definitive animal model of coronary atherosclerosis is not available. We therefore developed low density lipoprotein receptor knockout (LDLR-KO) pigs with hypercholesterolemia, a model which rapidly developed coronary atherosclerosis following balloon injury. Methods and Results We deleted LDLR exon regions from cultured porcine fetal fibroblasts and cloned LDLR knockout (LDLR-KO) embryos microinjecting fetal fibroblast nuclei into enucleated oocytes. Twelve LDLR-KO pigs were fed a 2.0% cholesterol and 20% fat diet. Baseline serum LDL cholesterol level was 510.0±86.1 mg/dL. Balloon injury was created in 46 coronary segments and necropsy were obtained 2, 4, 8 and 12 weeks later. Coronary artery sections were reviewed to evaluate lesion progression. We found lipid accumulation with foam cells and inflammatory cells beginning four weeks after balloon injury. The mean ratio of macrophages to plaque area was significantly higher in the four- weeks and eight-week animals compared with those at 2-weeks (8.79% ± 5.98% and 17.00% ± 10.38% vs. 1.14% ± 1.88%, P < 0.0001). At 12 weeks the ratio decreased toward the level at 2 week level (4.00% ± 4.56%, P = 0.66 vs. baseline). Advanced coronary atherosclerotic lesions contained lipid pools at eight-weeks with fibrous components beginning at 12 weeks. Conclusions We developed a model of rapid coronary atherosclerosis using LDLR KO pigs with balloon injury. This model may be useful for preclinical evaluation of medication or devices, and may also help investigate mechanisms of plaque progression. PMID:27631974

  20. Sun-Earth Connections: How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    NASA Technical Reports Server (NTRS)

    Ladbury, Raymond L.


    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  1. Asian plantain (Plantago asiatica) essential oils suppress 3-hydroxy-3-methyl-glutaryl-co-enzyme A reductase expression in vitro and in vivo and show hypocholesterolaemic properties in mice.


    Chung, Mi Ja; Park, Kuen Woo; Kim, Kyoung Heon; Kim, Cheong-Tae; Baek, Jun Pill; Bang, Kyong-Hwan; Choi, Young-Mi; Lee, Sung-Joon


    Asian plantain (Plantago asiatica) essential oil (PAEO) contains multiple bioactive compounds, but its potential effects on lipid metabolism have not been examined. PAEO was found to be mostly composed of oxygenated monoterpenes, with linalool as the major component (82.5 %, w/w), measured using GC-MS. Incubation of 0-200 microg PAEO/ml with HepG2 cells for 24 h resulted in no significant toxicity. Incubation with 0.2 mg PAEO/ml altered the expression of LDL receptor (+83 %; P < 0.05) and 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA) reductase ( - 37 %; P < 0.05), as assessed using RT-PCR. LDL oxidation was markedly inhibited by PAEO treatment due to the prevalence of linalool compounds in PAEO. Oral administration of PAEO for 3 weeks in C57BL/6 mice significantly reduced plasma total cholesterol and TAG concentrations by 29 and 46 %, respectively. The mRNA (+58 %; P < 0.05), but not protein, levels of the LDL receptor were significantly higher, whereas both mRNA and protein levels of HMG-CoA reductase were significantly lower ( - 46 and - 11 %, respectively; P < 0.05) in the liver of PAEO-fed than of control mice. The mRNA levels of CYP7A1 were marginally reduced in HepG2 cells, but not in mouse liver after PAEO treatment. Thus, PAEO may have hypocholesterolaemic effects by altering the expression of HMG-CoA reductase. Reduced TAG and oxidised LDL may provide additional cardiovascular protective benefits.

  2. Laminin α4 Deficient Mice Exhibit Decreased Capacity for Adipose Tissue Expansion and Weight Gain

    PubMed Central

    Movérare-Skrtic, Sofia; Kortesmaa, Jarkko; Soininen, Raija; Bergström, Göran; Ohlsson, Claes; Chong, Li Yen; Rozell, Björn; Emont, Margo; Cohen, Ronald N.; Brey, Eric M.; Tryggvason, Karl


    Obesity is a global epidemic that contributes to the increasing medical burdens related to type 2 diabetes, cardiovascular disease and cancer. A better understanding of the mechanisms regulating adipose tissue expansion could lead to therapeutics that eliminate or reduce obesity-associated morbidity and mortality. The extracellular matrix (ECM) has been shown to regulate the development and function of numerous tissues and organs. However, there is little understanding of its function in adipose tissue. In this manuscript we describe the role of laminin α4, a specialized ECM protein surrounding adipocytes, on weight gain and adipose tissue function. Adipose tissue accumulation, lipogenesis, and structure were examined in mice with a null mutation of the laminin α4 gene (Lama4−/−) and compared to wild-type (Lama4+/+) control animals. Lama4−/− mice exhibited reduced weight gain in response to both age and high fat diet. Interestingly, the mice had decreased adipose tissue mass and altered lipogenesis in a depot-specific manner. In particular, epididymal adipose tissue mass was specifically decreased in knock-out mice, and there was also a defect in lipogenesis in this depot as well. In contrast, no such differences were observed in subcutaneous adipose tissue at 14 weeks. The results suggest that laminin α4 influences adipose tissue structure and function in a depot-specific manner. Alterations in laminin composition offers insight into the roll the ECM potentially plays in modulating cellular behavior in adipose tissue expansion. PMID:25310607

  3. Toll-like receptor-2 deficiency induces schizophrenia-like behaviors in mice

    PubMed Central

    Park, Se Jin; Lee, Jee Youn; Kim, Sang Jeong; Choi, Se-Young; Yune, Tae Young; Ryu, Jong Hoon


    Dysregulation of the immune system contributes to the pathogenesis of neuropsychiatric disorders including schizophrenia. Here, we demonstrated that toll-like receptor (TLR)-2, a family of pattern-recognition receptors, is involved in the pathogenesis of schizophrenia-like symptoms. Psychotic symptoms such as hyperlocomotion, anxiolytic-like behaviors, prepulse inhibition deficits, social withdrawal, and cognitive impairments were observed in TLR-2 knock-out (KO) mice. Ventricle enlargement, a hallmark of schizophrenia, was also observed in TLR-2 KO mouse brains. Levels of p-Akt and p-GSK-3α/β were markedly higher in the brain of TLR-2 KO than wild-type (WT) mice. Antipsychotic drugs such as haloperidol or clozapine reversed behavioral and biochemical alterations in TLR-2 KO mice. Furthermore, p-Akt and p-GSK-3α/β were decreased by treatment with a TLR-2 ligand, lipoteichoic acid, in WT mice. Thus, our data suggest that the dysregulation of the innate immune system by a TLR-2 deficiency may contribute to the development and/or pathophysiology of schizophrenia-like behaviors via Akt-GSK-3α/β signaling. PMID:25687169

  4. Glial glycine transporter 1 function is essential for early postnatal survival but dispensable in adult mice.


    Eulenburg, Volker; Retiounskaia, Marina; Papadopoulos, Theofilos; Gomeza, Jesús; Betz, Heinrich


    The glycine transporter 1 (GlyT1) is expressed in astrocytes and selected neurons of the mammalian CNS. In newborn mice, GlyT1 is crucial for efficient termination of glycine-mediated inhibitory neurotransmission. Furthermore, GlyT1 has been implicated in the regulation of excitatory N-methyl-D-asparate (NMDA) receptors. To evaluate whether glial and neuronal GlyT1 have distinct roles at inhibitory synapses, we inactivated the GlyT1 gene cell type-specifically using mice carrying floxed GlyT1 alleles GlyT1((+)/+)). GlyT1((+)/(+)) mice expressing Cre recombinase in glial cells developed severe neuromotor deficits during the first postnatal week, which mimicked the phenotype of conventional GlyT1 knock-out mice and are consistent with glycinergic over-inhibition. In contrast, Cre-mediated inactivation of the GlyT1 gene in neuronal cells did not result in detectable motor impairment. Notably, some animals deficient for glial GlyT1 survived the first postnatal week and did not develop neuromotor deficits throughout adulthood, although GlyT1 expression was efficiently reduced. Thus, glial GlyT1 is critical for the regulation of glycine levels at inhibitory synapses only during early postnatal life.

  5. Allele Compensation in Tip60+/− Mice Rescues White Adipose Tissue Function In Vivo

    PubMed Central

    Gao, Yuan; Hamers, Nicole; Rakhshandehroo, Maryam; Berger, Ruud; Lough, John; Kalkhoven, Eric


    Adipose tissue is a key regulator of energy homestasis. The amount of adipose tissue is largely determined by adipocyte differentiation (adipogenesis), a process that is regulated by the concerted actions of multiple transcription factors and cofactors. Based on in vitro studies in murine 3T3-L1 preadipocytes and human primary preadipocytes, the transcriptional cofactor and acetyltransferase Tip60 was recently identified as an essential adipogenic factor. We therefore investigated the role of Tip60 on adipocyte differentiation and function, and possible consequences on energy homeostasis, in vivo. Because homozygous inactivation results in early embryonic lethality, Tip60+/− mice were used. Heterozygous inactivation of Tip60 had no effect on body weight, despite slightly higher food intake by Tip60+/− mice. No major effects of heterozygous inactivation of Tip60 were observed on adipose tissue and liver, and Tip60+/− displayed normal glucose tolerance, both on a low fat and a high fat diet. While Tip60 mRNA was reduced to 50% in adipose tissue, the protein levels were unaltered, suggesting compensation by the intact allele. These findings indicate that the in vivo role of Tip60 in adipocyte differentiation and function cannot be properly addressed in Tip60+/− mice, but requires the generation of adipose tissue-specific knock out animals or specific knock-in mice. PMID:24870614

  6. Allele compensation in tip60+/- mice rescues white adipose tissue function in vivo.


    Gao, Yuan; Hamers, Nicole; Rakhshandehroo, Maryam; Berger, Ruud; Lough, John; Kalkhoven, Eric


    Adipose tissue is a key regulator of energy homestasis. The amount of adipose tissue is largely determined by adipocyte differentiation (adipogenesis), a process that is regulated by the concerted actions of multiple transcription factors and cofactors. Based on in vitro studies in murine 3T3-L1 preadipocytes and human primary preadipocytes, the transcriptional cofactor and acetyltransferase Tip60 was recently identified as an essential adipogenic factor. We therefore investigated the role of Tip60 on adipocyte differentiation and function, and possible consequences on energy homeostasis, in vivo. Because homozygous inactivation results in early embryonic lethality, Tip60+/- mice were used. Heterozygous inactivation of Tip60 had no effect on body weight, despite slightly higher food intake by Tip60+/- mice. No major effects of heterozygous inactivation of Tip60 were observed on adipose tissue and liver, and Tip60+/- displayed normal glucose tolerance, both on a low fat and a high fat diet. While Tip60 mRNA was reduced to 50% in adipose tissue, the protein levels were unaltered, suggesting compensation by the intact allele. These findings indicate that the in vivo role of Tip60 in adipocyte differentiation and function cannot be properly addressed in Tip60+/- mice, but requires the generation of adipose tissue-specific knock out animals or specific knock-in mice.

  7. Rapid depletion of muscle progenitor cells in dystrophic mdx/utrophin-/- mice.


    Lu, Aiping; Poddar, Minakshi; Tang, Ying; Proto, Jonathan D; Sohn, Jihee; Mu, Xiaodong; Oyster, Nicholas; Wang, Bing; Huard, Johnny


    Duchenne muscular dystrophy (DMD) patients lack dystrophin from birth; however, muscle weakness becomes apparent only at 3-5 years of age, which happens to coincide with the depletion of the muscle progenitor cell (MPC) pools. Indeed, MPCs isolated from older DMD patients demonstrate impairments in myogenic potential. To determine whether the progression of muscular dystrophy is a consequence of the decline in functional MPCs, we investigated two animal models of DMD: (i) dystrophin-deficient mdx mice, the most commonly utilized model of DMD, which has a relatively mild dystrophic phenotype and (ii) dystrophin/utrophin double knock-out (dKO) mice, which display a similar histopathologic phenotype to DMD patients. In contrast to age-matched mdx mice, we observed that both the number and regeneration potential of dKO MPCs rapidly declines during disease progression. This occurred in MPCs at both early and late stages of myogenic commitment. In fact, early MPCs isolated from 6-week-old dKO mice have reductions in proliferation, resistance to oxidative stress and multilineage differentiation capacities compared with age-matched mdx MPCs. This effect may potentially be mediated by fibroblast growth factor overexpression and/or a reduction in telomerase activity. Our results demonstrate that the rapid disease progression in the dKO model is associated, at least in part, with MPC depletion. Therefore, alleviating MPC depletion could represent an approach to delay the onset of the histopathologies associated with DMD patients.

  8. Multiple sleep alterations in mice lacking cannabinoid type 1 receptors.


    Silvani, Alessandro; Berteotti, Chiara; Bastianini, Stefano; Lo Martire, Viviana; Mazza, Roberta; Pagotto, Uberto; Quarta, Carmelo; Zoccoli, Giovanna


    Cannabinoid type 1 (CB1) receptors are highly expressed in the brain and play a role in behavior control. Endogenous cannabinoid signaling is modulated by high-fat diet (HFD). We investigated the consequences of congenital lack of CB1 receptors on sleep in mice fed standard diet (SD) and HFD. CB1 cannabinoid receptor knock-out (KO) and wild-type (WT) mice were fed SD or HFD for 4 months (n = 9-10 per group). Mice were instrumented with electroencephalographic (EEG) and electromyographic electrodes. Recordings were performed during baseline (48 hours), sleep deprivation (gentle handling, 6 hours), sleep recovery (18 hours), and after cage switch (insomnia model paradigm, 6 hours). We found multiple significant effects of genotype on sleep. In particular, KO spent more time awake and less time in non-rapid-eye-movement sleep (NREMS) and rapid-eye-movement sleep (REMS) than WT during the dark (active) period but not during the light (rest) period, enhancing the day-night variation of wake-sleep amounts. KO had slower EEG theta rhythm during REMS. REMS homeostasis after sleep deprivation was less effective in KO than in WT. Finally, KO habituated more rapidly to the arousing effect of the cage-switch test than WT. We did not find any significant effects of diet or of diet x genotype interaction on sleep. The occurrence of multiple sleep alterations in KO indicates important roles of CB1 cannabinoid receptors in limiting arousal during the active period of the day, in sleep regulation, and in sleep EEG in mice.

  9. Maximal Oxygen Consumption Is Reduced in Aquaporin-1 Knockout Mice

    PubMed Central

    Al-Samir, Samer; Goossens, Dominique; Cartron, Jean-Pierre; Nielsen, Søren; Scherbarth, Frank; Steinlechner, Stephan; Gros, Gerolf; Endeward, Volker


    We have measured maximal oxygen consumption (V˙O2,max) of mice lacking one or two of the established mouse red-cell CO2 channels AQP1, AQP9, and Rhag. We intended to study whether these proteins, by acting as channels for O2, determine O2 exchange in the lung and in the periphery. We found that V˙O2,max as determined by the Helox technique is reduced by ~16%, when AQP1 is knocked out, but not when AQP9 or Rhag are lacking. This figure holds for animals respiring normoxic as well as hypoxic gas mixtures. To see whether the reduction of V˙O2,max is due to impaired O2 uptake in the lung, we measured carotid arterial O2 saturation (SO2) by pulse oximetry. Neither under normoxic (inspiratory O2 21%) nor under hypoxic conditions (11% O2) is there a difference in SO2 between AQP1null and WT mice, suggesting that AQP1 is not critical for O2 uptake in the lung. The fact that the % reduction of V˙O2,max is identical in normoxia and hypoxia indicates moreover that the limitation of V˙O2,max is not due to an O2 diffusion problem, neither in the lung nor in the periphery. Instead, it appears likely that AQP1null animals exhibit a reduced V˙O2,max due to the reduced wall thickness and muscle mass of the left ventricles of their hearts, as reported previously. We conclude that very likely the properties of the hearts of AQP1 knockout mice cause a reduced maximal cardiac output and thus cause a reduced V˙O2,max, which constitutes a new phenotype of these mice. PMID:27559317

  10. Neutrophils and neutrophil serine proteases are increased in the spleens of estrogen-treated C57BL/6 mice and several strains of spontaneous lupus-prone mice

    PubMed Central

    Dai, Rujuan; Cowan, Catharine; Heid, Bettina; Khan, Deena; Liang, Zhihong; Pham, Christine T. N.; Ahmed, S. Ansar


    Estrogen, a natural immunomodulator, regulates the development and function of diverse immune cell types. There is now renewed attention on neutrophils and neutrophil serine proteases (NSPs) such as neutrophil elastase (NE), proteinase 3 (PR3), and cathepsin G (CG) in inflammation and autoimmunity. In this study, we found that although estrogen treatment significantly reduced total splenocytes number, it markedly increased the splenic neutrophil absolute numbers in estrogen-treated C57BL/6 (B6) mice when compared to placebo controls. Concomitantly, the levels of NSPs and myeloperoxidase (MPO) were highly upregulated in the splenocytes from estrogen-treated mice. Despite the critical role of NSPs in the regulation of non-infectious inflammation, by employing NE-/-/PR3-/-/CG-/- triple knock out mice, we demonstrated that the absence of NSPs affected neither estrogen’s ability to increase splenic neutrophils nor the induction of inflamm