Science.gov

Sample records for knock-out reactions

  1. Direct calculation of minimal cut sets involving a specific reaction knock-out.

    PubMed

    Tobalina, Luis; Pey, Jon; Planes, Francisco J

    2016-07-01

    The concept of Minimal Cut Sets (MCSs) is used in metabolic network modeling to describe minimal groups of reactions or genes whose simultaneous deletion eliminates the capability of the network to perform a specific task. Previous work showed that MCSs where closely related to Elementary Flux Modes (EFMs) in a particular dual problem, opening up the possibility to use the tools developed for computing EFMs to compute MCSs. Until recently, however, there existed no method to compute an EFM with some specific characteristic, meaning that, in the case of MCSs, the only strategy to obtain them was to enumerate them using, for example, the standard K-shortest EFMs algorithm. In this work, we adapt the recently developed theory to compute EFMs satisfying several constraints to the calculation of MCSs involving a specific reaction knock-out. Importantly, we emphasize that not all the EFMs in the dual problem correspond to real MCSs, and propose a new formulation capable of correctly identifying the MCS wanted. Furthermore, this formulation brings interesting insights about the relationship between the primal and the dual problem of the MCS computation. A Matlab-Cplex implementation of the proposed algorithm is available as a supplementary material fplanes@ceit.es Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Proton Knock-Out in Hall A

    SciTech Connect

    Kees de Jager

    2002-06-01

    Proton knock-out is studied in a broad program in Hall A at Jefferson Lab. The first experiment performed in Hall A studied the {sup 16}O(e,e'p) reaction. Since then proton knock-out experiments have studied a variety of aspects of that reaction, from single-nucleon properties to its mechanism, such as final-state interactions and two-body currents, in nuclei from {sup 2}H to {sup 16}O. In this review the results of this program will be summarized and an outlook given of future accomplishments.

  3. Transgenes and knock-outs in autoimmunity.

    PubMed

    Benoist, C; Mathis, D

    1993-12-01

    While there have not been any earth-shattering events during the past year relating to the use of germline manipulation in the study of autoimmunity, several new developments have brought interesting insights into the way the immune system deals (or fails to deal) with autoantigens. Several systems described recently have the potential to help us understand what makes an autoantigen, and what events lead to a pathogenic reaction.

  4. Bex1 knock out mice show altered skeletal muscle regeneration

    PubMed Central

    Koo, Jae Hyung; Smiley, Mark A.; Lovering, Richard M.; Margolis, Frank L.

    2008-01-01

    Bex1 and Calmodulin (CaM) are upregulated during skeletal muscle regeneration. We confirm this finding and demonstrate the novel finding that they interact in a calcium-dependent manner. To study the role of Bex1 and its interaction with CaM in skeletal muscle regeneration, we generated Bex1 knock out (Bex1-KO) mice. These mice appeared to develop normally and are fertile, but displayed a functional deficit in exercise performance compared to wild type (WT) mice. After intramuscular injection of cardiotoxin, which causes extensive and reproducible myotrauma followed by recovery, regenerating muscles of Bex1-KO mice exhibited elevated and prolonged cell proliferation, as well as delayed cell differentiation, compared to WT mice. Thus, our results provide the first evidence that Bex1-KO mice show altered muscle regeneration, and allow us to propose that the interaction of Bex1 with Ca2+/CaM may be involved in skeletal muscle regeneration. PMID:17884015

  5. TALEN-induced gene knock out in Drosophila.

    PubMed

    Kondo, Takefumi; Sakuma, Tetsushi; Wada, Housei; Akimoto-Kato, Ai; Yamamoto, Takashi; Hayashi, Shigeo

    2014-01-01

    We report here a case study of TALEN-induced gene knock out of the trachealess gene of Drosophila. Two pairs of TALEN constructs caused targeted mutation in the germ line of 39% and 17% of injected animals, respectively. In the extreme case 100% of the progeny of TALEN-injected fly was mutated, suggesting that highly efficient biallelic germ line mutagenesis was achieved. The mutagenic efficiency of the TALEN pairs paralleled their activity of single strand annealing (SSA) assay in cultured cells. All mutations were deletion of 1 to 20 base pairs. Merit and demerit of TALEN-based gene knockout approach compared to other genome editing technologies is discussed. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  6. Bex1 knock out mice show altered skeletal muscle regeneration

    SciTech Connect

    Koo, Jae Hyung Smiley, Mark A.; Lovering, Richard M.; Margolis, Frank L.

    2007-11-16

    Bex1 and Calmodulin (CaM) are upregulated during skeletal muscle regeneration. We confirm this finding and demonstrate the novel finding that they interact in a calcium-dependent manner. To study the role of Bex1 and its interaction with CaM in skeletal muscle regeneration, we generated Bex1 knock out (Bex1-KO) mice. These mice appeared to develop normally and are fertile, but displayed a functional deficit in exercise performance compared to wild type (WT) mice. After intramuscular injection of cardiotoxin, which causes extensive and reproducible myotrauma followed by recovery, regenerating muscles of Bex1-KO mice exhibited elevated and prolonged cell proliferation, as well as delayed cell differentiation, compared to WT mice. Thus, our results provide the first evidence that Bex1-KO mice show altered muscle regeneration, and allow us to propose that the interaction of Bex1 with Ca{sup 2+}/CaM may be involved in skeletal muscle regeneration.

  7. Accelerated retinal aging in PACAP knock-out mice.

    PubMed

    Kovács-Valasek, Andrea; Szabadfi, Krisztina; Dénes, Viktória; Szalontai, Bálint; Tamás, Andrea; Kiss, Péter; Szabó, Aliz; Setalo, Gyorgy; Reglődi, Dóra; Gábriel, Robert

    2017-02-13

    Pituitary adenylate cyclase activating polypeptide (PACAP) is a neurotrophic and neuroprotective peptide. PACAP and its receptors are widely distributed in the retina. A number of reports provided evidence that PACAP is neuroprotective in retinal degenerations. The current study compared retina cell type-specific differences in young (3-4months) and aged adults (14-16months), of wild-type (WT) mice and knock-out (KO) mice lacking endogenous PACAP production during the course of aging. Histological, immunocytochemical and Western blot examinations were performed. The staining for standard neurochemical markers (tyrosine hydroxylase for dopaminergic cells, calbindin 28 kDa for horizontal cells, protein kinase Cα for rod bipolar cells) of young adult PACAP KO retinas showed no substantial alterations compared to young adult WT retinas, except for the specific PACAP receptor (PAC1-R) staining. We could not detect PAC1-R immunoreactivity in bipolar and horizontal cells in young adult PACAP KO animals. Some other age-related changes were observed only in the PACAP KO mice only. These alterations included horizontal and rod bipolar cell dendritic sprouting into the photoreceptor layer and decreased ganglion cell number. Also, Müller glial cells showed elevated GFAP expression compared to the aging WT retinas. Furthermore, Western blot analyses revealed significant differences between the phosphorylation state of ERK1/2 and JNK in KO mice, indicating alterations in the MAPK signaling pathway. These results support the conclusion that endogenous PACAP contributes to protection against aging of the nervous system.

  8. IL-4 Knock out Mice Display Anxiety-like Behavior

    PubMed Central

    Moon, Morgan L.; Joesting, Jennifer J.; Blevins, Neil A.; Lawson, Marcus A.; Gainey, Stephen J.; Towers, Albert E.; McNeil, Leslie K.; Freund, Gregory G.

    2015-01-01

    Inflammation is a recognized antecedent and coincident factor when examining the biology of anxiety. Little is known, however, about how reductions in endogenous anti-inflammatory mediators impact anxiety. Therefore, mood- cognition- and anxiety-associated/like behaviors were examined in IL-4 knock out (KO) mice and wild-type (WT) mice. In comparison to WT mice, IL-4 KO mice demonstrated decreased burrowing and increased social exploration. No differences were seen in forced swim or saccharine preference testing. IL-4 KO mice had similar performance to WT mice in the Morris water maze and during object location and novel object recognition. In the elevated zero-maze, IL-4 KO mice, in comparison to WT mice, demonstrated anxiety-like behavior. Anxiety-like behavior in IL-4 KO mice was not observed, however, during open-field testing. Taken together, these data indicate that IL-4 KO mice display state, but not trait, anxiety suggesting that reductions in endogenous anti-inflammatory bioactives can engender subtypes of anxiety. PMID:25772794

  9. IL-4 Knock Out Mice Display Anxiety-Like Behavior.

    PubMed

    Moon, Morgan L; Joesting, Jennifer J; Blevins, Neil A; Lawson, Marcus A; Gainey, Stephen J; Towers, Albert E; McNeil, Leslie K; Freund, Gregory G

    2015-07-01

    Inflammation is a recognized antecedent and coincident factor when examining the biology of anxiety. Little is known, however, about how reductions in endogenous anti-inflammatory mediators impact anxiety. Therefore, mood- cognition- and anxiety-associated/like behaviors were examined in IL-4 knock out (KO) mice and wild-type (WT) mice. In comparison to WT mice, IL-4 KO mice demonstrated decreased burrowing and increased social exploration. No differences were seen in forced swim or saccharine preference testing. IL-4 KO mice had similar performance to WT mice in the Morris water maze and during object location and novel object recognition. In the elevated zero-maze, IL-4 KO mice, in comparison to WT mice, demonstrated anxiety-like behavior. Anxiety-like behavior in IL-4 KO mice was not observed, however, during open-field testing. Taken together, these data indicate that IL-4 KO mice display state, but not trait, anxiety suggesting that reductions in endogenous anti-inflammatory bioactives can engender subtypes of anxiety.

  10. Characterization of TG2 and TG1-TG2 double knock-out mouse epidermis.

    PubMed

    Pitolli, Consuelo; Pietroni, Valentina; Marekov, Lyuben; Terrinoni, Alessandro; Yamanishi, Kiyofumi; Mazzanti, Cinzia; Melino, Gerry; Candi, Eleonora

    2017-03-01

    Transglutaminases (TGs) are a family of enzymes that catalyse the formation of isopeptide bonds between the γ-carboxamide groups of glutamine residues and the ε-amino groups of lysine residues leading to cross-linking reactions among proteins. Four members, TG1, TG2, TG3, and TG5, of the nine mammalian enzymes are expressed in the skin. TG1, TG3 and TG5 crosslinking properties are fundamental for cornified envelope assembly. In contrast, the role of TG2 in keratinization has never been studied at biochemical level in vivo. In this study, taking advantage of the TG2 knock-out (KO) and TG1 heterozygous mice, we generated and characterized the epidermis of TG1-TG2 double knock-out (DKO) mice. We performed morphological analysis of the epidermis and evaluation of the expression of differentiation markers. In addition, we performed analysis of the amino acid composition from isolated corneocytes. We found a significant change in amino acid composition in TG1KO cornified cell envelopes (CEs) while TG2KO amino acid composition was similar to wild-type CEs. Our results confirm a key role of TG1 in skin differentiation and CE assembly and demonstrate that TG2 is not essential for CE assembly and skin formation.

  11. Knock-Outs, Stick-Outs, Cut-Outs: Clipping Paths Separate Objects from Background.

    ERIC Educational Resources Information Center

    Wilson, Bradley

    1998-01-01

    Outlines a six-step process that allows computer operators, using Photoshop software, to create "knock-outs" to precisely define the path that will serve to separate the object from the background. (SR)

  12. Photodynamic therapy and knocking out of single tumor cells by multiphoton excitation processes

    NASA Astrophysics Data System (ADS)

    Riemann, Iris; Fischer, Peter; Koenig, Karsten

    2004-09-01

    Near infrared (NIR) ultrashort laser pulses of 780 nm have been used to induce intracellular photodynamic reactions by nonlinear excitation of porphyrin photosensitizers. Intracellular accumulation and photobleaching of the fluorescent photosensitizers protoporphyrin IX and Photofrin (PF) have been studied by non-resonant two-photon fluorescence excitation of PF and aminolevulinic acid (ALA)-labeled Chinese hamster ovary (CHO) cells. To testify the efficacy of both substrates to induce irreversible destructive effects, the cloning efficiency (CE) of cells exposed to femtosecond pulses of a multiphoton laser scanning microscope (40x/1.3) was determined. In the case of Photofrin accumulation, CEs of 50% and 0% were obtained after 17 laserscans (2 mW?, 16 s/ frame) and 50 scans, respectively. All cells exposed to 50 scans died within 48h after laser exposure. 100 scans were required to induce lethal effects in ALA labeled cells. Sensitizer-free control cells could be scanned 250 times (1.1 h) and more without impact on the reproduction behavior, morphology, and vitality. In addition to the slow phototoxic effect by photooxidation processes, another destructive but immediate effect based on optical breakdown was induced when employing high intense NIR femtosecond laser beams. This was used to optically knock out single tumor cells in living mice (solid Ehrlich-Carcinoma) in a depth of 10 to 100 μm.

  13. Glutaminyl Cyclase Knock-out Mice Exhibit Slight Hypothyroidism but No Hypogonadism

    PubMed Central

    Schilling, Stephan; Kohlmann, Stephanie; Bäuscher, Christoph; Sedlmeier, Reinhard; Koch, Birgit; Eichentopf, Rico; Becker, Andreas; Cynis, Holger; Hoffmann, Torsten; Berg, Sabine; Freyse, Ernst-Joachim; von Hörsten, Stephan; Rossner, Steffen; Graubner, Sigrid; Demuth, Hans-Ulrich

    2011-01-01

    Glutaminyl cyclases (QCs) catalyze the formation of pyroglutamate (pGlu) residues at the N terminus of peptides and proteins. Hypothalamic pGlu hormones, such as thyrotropin-releasing hormone and gonadotropin-releasing hormone are essential for regulation of metabolism and fertility in the hypothalamic pituitary thyroid and gonadal axes, respectively. Here, we analyzed the consequences of constitutive genetic QC ablation on endocrine functions and on the behavior of adult mice. Adult homozygous QC knock-out mice are fertile and behave indistinguishably from wild type mice in tests of motor function, cognition, general activity, and ingestion behavior. The QC knock-out results in a dramatic drop of enzyme activity in the brain, especially in hypothalamus and in plasma. Other peripheral organs like liver and spleen still contain QC activity, which is most likely caused by its homolog isoQC. The serum gonadotropin-releasing hormone, TSH, and testosterone concentrations were not changed by QC depletion. The serum thyroxine was decreased by 24% in homozygous QC knock-out animals, suggesting a mild hypothyroidism. QC knock-out mice were indistinguishable from wild type with regard to blood glucose and glucose tolerance, thus differing from reports of thyrotropin-releasing hormone knock-out mice significantly. The results suggest a significant formation of the hypothalamic pGlu hormones by alternative mechanisms, like spontaneous cyclization or conversion by isoQC. The different effects of QC depletion on the hypothalamic pituitary thyroid and gonadal axes might indicate slightly different modes of substrate conversion of both enzymes. The absence of significant abnormalities in QC knock-out mice suggests the presence of a therapeutic window for suppression of QC activity in current drug development. PMID:21330373

  14. Hyperactivity of Newborn Pten Knock-out Neurons Results from Increased Excitatory Synaptic Drive

    PubMed Central

    Williams, Michael R.; DeSpenza, Tyrone; Li, Meijie; Gulledge, Allan T.

    2015-01-01

    Developing neurons must regulate morphology, intrinsic excitability, and synaptogenesis to form neural circuits. When these processes go awry, disorders, including autism spectrum disorder (ASD) or epilepsy, may result. The phosphatase Pten is mutated in some patients having ASD and seizures, suggesting that its mutation disrupts neurological function in part through increasing neuronal activity. Supporting this idea, neuronal knock-out of Pten in mice can cause macrocephaly, behavioral changes similar to ASD, and seizures. However, the mechanisms through which excitability is enhanced following Pten depletion are unclear. Previous studies have separately shown that Pten-depleted neurons can drive seizures, receive elevated excitatory synaptic input, and have abnormal dendrites. We therefore tested the hypothesis that developing Pten-depleted neurons are hyperactive due to increased excitatory synaptogenesis using electrophysiology, calcium imaging, morphological analyses, and modeling. This was accomplished by coinjecting retroviruses to either “birthdate” or birthdate and knock-out Pten in granule neurons of the murine neonatal dentate gyrus. We found that Pten knock-out neurons, despite a rapid onset of hypertrophy, were more active in vivo. Pten knock-out neurons fired at more hyperpolarized membrane potentials, displayed greater peak spike rates, and were more sensitive to depolarizing synaptic input. The increased sensitivity of Pten knock-out neurons was due, in part, to a higher density of synapses located more proximal to the soma. We determined that increased synaptic drive was sufficient to drive hypertrophic Pten knock-out neurons beyond their altered action potential threshold. Thus, our work contributes a developmental mechanism for the increased activity of Pten-depleted neurons. PMID:25609613

  15. Naloxone fails to produce conditioned place aversion in mu-opioid receptor knock-out mice.

    PubMed

    Skoubis, P D; Matthes, H W; Walwyn, W M; Kieffer, B L; Maidment, N T

    2001-01-01

    There is growing evidence that tonic activity of the opioid system may be important in the modulation of affective state. Naloxone produces a conditioned place aversion in rodents, an effect that is centrally mediated. Previous pharmacological data using antagonists with preferential actions at mu-, delta-, and kappa-opioid receptors indicate the importance of the mu-opioid receptor in mediating this effect. We sought to test the mu-opioid receptor selectivity of naloxone aversion using mu-opioid receptor knock-out mice. mu-Opioid receptor knock-out and wild-type mice were tested for naloxone (10 mg/kg, s.c.) aversion using a place conditioning paradigm. As a positive control for associative learning, knock-out mice were tested for conditioned place aversion to a kappa agonist, U50,488H (2 mg/kg, s.c.). Naloxone produced a significant place aversion in wild-type mice, but failed to have any effect in mu-opioid receptor knock-out mice. On the other hand, both knock-out and wild-type mice treated with U50,488H spent significantly less time in the drug-paired chamber compared to their respective vehicle controls. We conclude that the mu-opioid receptor is crucial for the acquisition of naloxone-induced conditioned place aversion. Furthermore, in a separate experiment using C57BL/6 mice, the delta-selective antagonist naltrindole (10 or 30 mg/kg, s.c.) failed to produce conditioned place aversion.Taken together, these data further support the notion that naloxone produces aversion by antagonizing tonic opioid activity at the mu-opioid receptor.

  16. Orthogonal gene knock out and activation with a catalytically active Cas9 nuclease

    PubMed Central

    Dahlman, James E.; Abudayyeh, Omar O.; Joung, Julia; Gootenberg, Jonathan S.; Zhang, Feng; Konermann, Silvana

    2015-01-01

    We have developed a CRISPR-based method that uses catalytically active Cas9 and distinct sgRNA constructs to knock out and activate different genes in the same cell. These sgRNAs, with 14 15 bp target sequences and MS2 binding loops, can activate gene expression using an active Cas9 nuclease, without inducing DSBs. We use these ‘dead RNAs’ to perform orthogonal gene knockout and transcriptional activation in human cells. PMID:26436575

  17. Knock-out drugs: their prevalence, modes of action, and means of detection.

    PubMed

    Madea, Burkhard; Musshoff, Frank

    2009-05-01

    Knock-out drugs are used to facilitate the commission of a crime, generally either robbery or sexual assault. Although media reports on the use of knock-out drugs have become more frequent, there are no robust epidemiological data on the incidence of drug-facilitated robbery or sexual assault, presumably because many crimes of these types do not enter into official statistics. The authors describe the modes of action and toxicological means of detection of the substances most frequently used as knock-out drugs on the basis of a selective literature research on the terms "drug-facilitated sexual assaults" (DFSA) and "drug-facilitated crimes" (DFC). The most frequently used drug in cases of sexual assault is still alcohol (ca. 40% to 60%), followed by illegal drugs (cannabis, cocaine). The presence of involuntarily consumed medications and drugs of abuse is demonstrated by routine toxicological analysis only in relatively few cases (ca. 2%). The substances most commonly found are benzodiazepines, followed by other hypnotics. In Europe, the illegal substance gamma-hydroxybutyric acid (GHB, "Liquid Ecstasy"), often mentioned as a "date-rape drug," is only rarely detected with sufficient medicolegal certainty. This may be due to its rapid elimination (it is detectable in blood for up to 8 hours, in urine for up to 12 hours) as well as its physiological occurrence in the body. If the toxicological analysis of blood and urine is negative in a case of suspected DFSA, then the analysis of a hair sample about four weeks after the assault can detect the presence of drugs consumed at that time. If the victim has long hair, it may be possible to detect knock-out drugs taken more than four weeks earlier. In Europe, convictions for drug-facilitated crimes are comparatively rare, mainly because of the difficulty of demonstrating conclusive evidence. A careful medical history and physical examination and the careful taking of biological samples for toxicological analysis form the

  18. Oxygen Knock-Out and Other Studies in -Irradiated Polycrystalline Bi-2212 Superconductor

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, S. K.; Ghosh, A. K.; Barat, P.; Sen, Pintu; Basu, A. N.; Ghosh, B.

    1997-08-01

    Bulk polycrystalline samples of Bi2Sr2CaCu2O8+x (Bi-2212) have been irradiated with 40 MeV -particles. Tc increases up to a certain dose. The increase in Tc is correlated with the knock-out of oxygen, which has been verified by the determination of the oxygen contents of the irradiated samples by iodometry. A model of the knock-out of oxygen is proposed on the basis of Monte-Carlo TRIM calculations. Resistivity versus temperature of the irradiated samples shows fairly metallic behaviour up to a certain dose. Excess conductivity analysis shows a cross-over from 2D to 3D behaviour in conductivity for the unirradiated sample. However, for irradiated samples, the critical fluctuation regime sets in. The interlayer coupling strengths decrease with the increase in the irradiation dose. The sample with the highest dose shows a nonmetallic behaviour in resistivity. A detailed analysis shows a conductivity behaviour in the nonmetallic region characteristic of three-dimensional variable range hopping of charge carriers.

  19. Mildly Increased Mechanical Nociceptive Sensitivity in REV-ERBα Knock-out Mice

    PubMed Central

    Lee, Jaehyun; Ko, Hyoung-Gon; Kim, Kyungjin

    2016-01-01

    Nociception is one of the most complex senses that is affected not only by external stimulation but also internal conditions. Previous studies have suggested that circadian rhythm is important in modulating nociception. REV-ERBα knock-out (KO) mice have disrupted circadian rhythm and altered mood-related phenotypes. In this study, we examined the role of REV-ERBα in inflammatory nociception. We found that the nociceptive sensitivity of KO mice was partially enhanced in mechanical nociception. However, this partial alteration was independent of the circadian rhythm. Taken together, deletion of REV-ERBα induced a mild change in mechanical nociceptive sensitivity but this alteration was not dependent on the circadian rhythm. PMID:28035185

  20. Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila.

    PubMed

    Xue, Zhaoyu; Ren, Mengda; Wu, Menghua; Dai, Junbiao; Rong, Yikang S; Gao, Guanjun

    2014-03-21

    Bacterial Cas9 nuclease induces site-specific DNA breaks using small gRNA as guides. Cas9 has been successfully introduced into Drosophila for genome editing. Here, we improve the versatility of this method by developing a transgenic system that expresses Cas9 in the Drosophila germline. Using this system, we induced inheritable knock-out mutations by injecting only the gRNA into embryos, achieved highly efficient mutagenesis by expressing gRNA from the promoter of a novel non-coding RNA gene, and recovered homologous recombination-based knock-in of a fluorescent marker at a rate of 4.5% by co-injecting gRNA with a circular DNA donor.

  1. Monitoring concussion in a knocked-out boxer by CSF biomarker analysis.

    PubMed

    Neselius, Sanna; Brisby, Helena; Granholm, Fredrik; Zetterberg, Henrik; Blennow, Kaj

    2015-09-01

    Concussion is common in many sports, and the incidence is increasing. The medical consequences after a sport-related concussion have received increased attention in recent years since it is known that concussions cause axonal and glial damage, which disturbs the cerebral physiology and makes the brain more vulnerable for additional concussions. This study reports on a knocked-out amateur boxer in whom cerebrospinal fluid (CSF) neurofilament light (NFL) protein, reflecting axonal damage, was used to identify and monitor brain damage. CSF NFL was markedly increased during 36 weeks, suggesting that neuronal injury persists longer than expected after a concussion. CSF biomarker analysis may be valuable in the medical counselling of concussed athletes and in return-to-play considerations.

  2. Zika virus infection of adult and fetal STAT2 knock-out hamsters.

    PubMed

    Siddharthan, Venkatraman; Van Wettere, Arnaud J; Li, Rong; Miao, Jinxin; Wang, Zhongde; Morrey, John D; Julander, Justin G

    2017-07-01

    Zika virus (ZIKV) infection was investigated in adult and fetal STAT2 knock-out (KO) hamsters. Subcutaneous injection of ZIKV of adults resulted in morbidity, mortality, and infection of the uterus, placenta, brain, spinal cord, and testicles, thus providing an opportunity to evaluate congenital ZIKV infection in a second rodent species besides mice. ZIKV-infected cells with morphologies of Sertoli cells and spermatogonia were observed in the testes, which may have implications for sexual transmission and male sterility. Neonates exposed as fetuses to ZIKV at 8 days post-coitus were not smaller than controls. Nevertheless, infectious virus and ZIKV RNA was detected in some, but not all, placentas and fetal brains of KO hamsters. STAT2 KO hamsters may be useful for addressing sexual transmission, pathogenesis, routes of fetal infection, and neurological disease outcomes, and may also be used in antiviral or vaccine studies to identify intervention strategies. Copyright © 2017. Published by Elsevier Inc.

  3. Transgenic gene knock-outs: functional genomics and therapeutic target selection.

    PubMed

    Harris, S; Foord, S M

    2000-11-01

    The completion of the first draft of the human genome presents both a tremendous opportunity and enormous challenge to the pharmaceutical industry since the whole community, with few exceptions, will soon have access to the same pool of candidate gene sequences from which to select future therapeutic targets. The commercial imperative to select and pursue therapeutically relevant genes from within the overall content of the genome will be particularly intense for those gene families that currently represent the chemically tractable or 'drugable' gene targets. As a consequence the emphasis within exploratory research has shifted towards the evaluation and adoption of technology platforms that can add additional value to the gene selection process, either through functional studies or direct/indirect measures of disease alignment e.g., genetics, differential gene expression, proteomics, tissue distribution, comparative species data etc. The selection of biological targets for the development of potential new medicines relies, in part, on the quality of the in vivo biological data that correlates a particular molecular target with the underlying pathophysiology of a disease. Within the pharmaceutical industry, studies employing transgenic animals and, in particular, animals with specific gene deletions are playing an increasingly important role in the therapeutic target gene selection, drug candidate selection and product development phases of the overall drug discovery process. The potential of phenotypic information from gene knock-outs to contribute to a high-throughput target selection/validation strategy has hitherto been limited by the resources required to rapidly generate and characterise a large number of knock-out transgenics in a timely fashion. The offerings of several companies that provide an opportunity to overcome these hurdles, albeit at a cost, are assessed with respect to the strategic business needs of the pharmaceutical industry.

  4. Uptake and catabolism of modified LDL in scavenger-receptor class A type I/II knock-out mice.

    PubMed Central

    Van Berkel, T J; Van Velzen, A; Kruijt, J K; Suzuki, H; Kodama, T

    1998-01-01

    The liver is the major organ responsible for the uptake of modified low-density lipoprotein (LDL) from the blood circulation, with endothelial and Kupffer cells as major cellular uptake sites. Scavenger-receptors, which include various classes, are held responsible for this uptake. Mice deficient in scavenger-receptor class A types I and II were created and the fate of acetylated LDL (Ac-LDL) in vivo and its interaction with liver endothelial, Kupffer and peritoneal macrophages was characterized. Surprisingly, the decay in vivo (t12 < 2 min), tissue distribution and liver uptake (at 5 min it was 77.4 +/- 4.6% of the injected dose) of Ac-LDL in the knock-out mice were not significantly different from control mice (t12 < 2 min and liver uptake 79.1 +/- 4.6% of the injected dose). A separation of mice liver cells into parenchymal, endothelial and Kupffer cells 10 min after injection of Ac-LDL indicated that in both control and knock-out mice the liver endothelial cells were responsible for more than 70% of the liver uptake. Both in control and knock-out mice, preinjection of polyinosinic acid (poly I, 200 microg) completely blocked the liver uptake, indicating that both in control and knock-out mice the scavenger-receptors are sensitive to poly I. Preinjection of suboptimal poly I concentrations (20 and 50 microg) provided evidence that the serum decay and liver uptake of Ac-LDL is more readily inhibited in the knock-out mice as compared with the control mice, indicating less efficient removal of Ac-LDL in vivo in the knock-out mice under these conditions. Studies in vitro with isolated liver endothelial and Kupffer cells from knock-out mice indicate that the cell association of Ac-LDL during 2 h at 37 degrees C is 50 and 53% of the control, respectively, whereas the degradation reaches values of 58 and 63%. For peritoneal macrophages from knock-out mice the cell association of Ac-LDL was identical to the control mice whereas the Ac-LDL degradation in cells from the

  5. Multiple Cranial Organ Defects after Conditionally Knocking Out Fgf10 in the Neural Crest

    PubMed Central

    Teshima, Tathyane H. N.; Lourenco, Silvia V.; Tucker, Abigail S.

    2016-01-01

    Fgf10 is necessary for the development of a number of organs that fail to develop or are reduced in size in the null mutant. Here we have knocked out Fgf10 specifically in the neural crest driven by Wnt1cre. The Wnt1creFgf10fl/fl mouse phenocopies many of the null mutant defects, including cleft palate, loss of salivary glands, and ocular glands, highlighting the neural crest origin of the Fgf10 expressing mesenchyme surrounding these organs. In contrast tissues such as the limbs and lungs, where Fgf10 is expressed by the surrounding mesoderm, were unaffected, as was the pituitary gland where Fgf10 is expressed by the neuroepithelium. The circumvallate papilla of the tongue formed but was hypoplastic in the conditional and Fgf10 null embryos, suggesting that other sources of FGF can compensate in development of this structure. The tracheal cartilage rings showed normal patterning in the conditional knockout, indicating that the source of Fgf10 for this tissue is mesodermal, which was confirmed using Wnt1cre-dtTom to lineage trace the boundary of the neural crest in this region. The thyroid, thymus, and parathyroid glands surrounding the trachea were present but hypoplastic in the conditional mutant, indicating that a neighboring source of mesodermal Fgf10 might be able to partially compensate for loss of neural crest derived Fgf10. PMID:27826253

  6. Impaired sensorimotor gating in Fmr1 knock out and Fragile X premutation model mice.

    PubMed

    Renoux, A J; Sala-Hamrick, K J; Carducci, N M; Frazer, M; Halsey, K E; Sutton, M A; Dolan, D F; Murphy, G G; Todd, P K

    2014-07-01

    Fragile X syndrome (FXS) is a common inherited cause of intellectual disability that results from a CGG repeat expansion in the FMR1 gene. Large repeat expansions trigger both transcriptional and translational suppression of Fragile X protein (FMRP) production. Fragile X-associated Tremor/Ataxia Syndrome (FXTAS) is an allelic neurodegenerative disease caused by smaller "pre-mutation" CGG repeat expansions that enhance FMR1 transcription but lead to translational inefficiency and reduced FMRP expression in animal models. Sensorimotor gating as measured by pre-pulse inhibition (PPI) is altered in both FXS patients and Fmr1 knock out (KO) mice. Similarly, FXTAS patients have demonstrated PPI deficits. Recent work suggests there may be overlapping synaptic defects between Fmr1 KO and CGG knock-in premutation mouse models (CGG KI). We therefore sought to interrogate PPI in CGG KI mice. Using a quiet PPI protocol more akin to human testing conditions, we find that Fmr1 KO animals have significantly impaired PPI. Using this same protocol, we find CGG KI mice demonstrate an age-dependent impairment in PPI compared to wild type (WT) controls. This study describes a novel phenotype in CGG KI mice that can be used in future therapeutic development targeting premutation associated symptoms.

  7. Age-dependent deficits in fear learning in heterozygous BDNF knock-out mice.

    PubMed

    Endres, Thomas; Lessmann, Volkmar

    2012-11-15

    Beyond its trophic function, the neurotrophin BDNF (brain-derived neurotrophic factor) is well known to crucially mediate synaptic plasticity and memory formation. Whereas recent studies suggested that acute BDNF/TrkB signaling regulates amygdala-dependent fear learning, no impairments of cued fear learning were reported in heterozygous BDNF knock-out mice (BDNF(+/-)). Since brain BDNF levels are known to decline with aging, we hypothesized that BDNF(+/-) mice might show reduced fear learning at older ages. Indeed, BDNF(+/-) animals revealed an age-dependent deficit in fear learning 3 mo after birth and beyond. Since there were no alterations between the two genotypes during the conditioning training and when testing short-term memory, this learning deficit most likely reflects a deficit in memory consolidation. Importantly, there were no differences in spontaneous motor behavior and baseline anxiety in BDNF(+/-) animals at any age tested. Following behavioral testing quantification of BDNF levels in the basolateral amygdala with a sensitive BDNF ELISA revealed a positive correlation between the levels of BDNF in the amygdala and the individual learning performance. However, the age-dependent decline in the efficiency of fear conditioning in BDNF(+/-) mice was not accompanied by reduced BDNF expression in the amygdala. Thus, while reduced BDNF levels in general correlate with less efficient fear learning, this lack of BDNF can be compensated in young but not in older animals, suggesting that the cellular mechanisms responsible for fear learning consolidation become BDNF-dependent 3 mo after birth.

  8. Effects of cinnarizine, a calcium antagonist that produces human parkinsonism, in parkin knock out mice.

    PubMed

    Serrano, A; Menéndez, J; Casarejos, M J; Solano, R M; Gallego, E; Sánchez, M; Mena, M A; García de Yebenes, J

    2005-08-01

    Cinnarizine, a calcium antagonist that produces parkinsonism in humans, induces behavioural changes such as alopecia, buco-lingual dyskinesia and reduction of motor activity in female parkin knock out (PK-KO) mice but not in wild-type (WT) controls. PK-KO mice have high striatal dopamine levels and increased dopamine metabolism in spite of low reduced tyrosine hydroxylase protein. Cinnarizine, which blocks dopamine receptors and increases dopamine release, further increased dopamine metabolism. PK-KO mice increased GSH levels as a compensatory mechanism against enhanced free radical production related to acceleration of dopamine turnover. Neuronal markers, such as beta-tubulin slightly increased in PK-KO and furthermore with cinnarizine. Astroglial markers were decreased in PK-KO mice, and this effect was potentiated by cinnarizine, suggesting abnormal glia in these animals. Microglia was hyperactivated in PK-KO midbrain, suggesting inflammation in these animals. Proapoptotic proteins were increased by cinnarizine and, to a lesser extent, in PK-KO mice. Our data indicate that mutation of parkin is a risk factor for drug-induced parkinsonism.

  9. Subregion-specific p300 conditional knock-out mice exhibit long-term memory impairments.

    PubMed

    Oliveira, Ana M M; Estévez, Marcel A; Hawk, Joshua D; Grimes, Shannon; Brindle, Paul K; Abel, Ted

    2011-01-01

    Histone acetylation plays a critical role during long-term memory formation. Several studies have demonstrated that the histone acetyltransferase (HAT) CBP is required during long-term memory formation, but the involvement of other HAT proteins has not been extensively investigated. The HATs CBP and p300 have at least 400 described interacting proteins including transcription factors known to play a role in long-term memory formation. Thus, CBP and p300 constitute likely candidates for transcriptional coactivators in memory formation. In this study, we took a loss-of-function approach to evaluate the role of p300 in long-term memory formation. We used conditional knock-out mice in which the deletion of p300 is restricted to the postnatal phase and to subregions of the forebrain. We found that p300 is required for the formation of long-term recognition memory and long-term contextual fear memory in the CA1 area of the hippocampus and cortical areas.

  10. Characterization of skeletal muscle in the synemin knock-out mouse

    NASA Astrophysics Data System (ADS)

    García-Pelagio, Karla P.; Muriel, Joaquin; Lovering, Richard M.; Lund, Linda; Bond, Meredith; Bloch, Robert J.

    2014-11-01

    Diseases linked to intermediate filament (IF) proteins are associated with defects in the organization of the contractile apparatus of skeletal and cardiac muscle and its links to costameres, which connect the sarcomeres to the cell membrane. Synemin is a large IF protein that associates with dystrobrevin, vinculin, and talin at costameres of the cell membrane of striated muscle, as well as with α-actinin and desmin at the Z disks. Synemin can be expressed in either 210 kDa α- or 180 kDa β- alternatively spliced forms. We generated mice null for synemin by homologous recombination to study synemin's function in skeletal muscle. Skeletal muscle in the knock out (syn KO) mouse does not make synemin mRNA or protein. Preliminary characterization of the syn KO mouse suggests that it has a mild skeletal muscle phenotype. The organization of costameres appears to be normal. Treadmill running uphill test results was not significantly affected when compared to controls at any age. More notably, the biomechanical properties of the cell membrane are different in the syn KO, though they are less affected than by the absence of desmin or dystrophin. These results suggest that the viscoelastic properties of the cell membrane-costamere-myofibril complex are significantly influenced by synemin.

  11. Norepinephrine transporter knock-out alters expression of the genes connected with antidepressant drugs action.

    PubMed

    Solich, Joanna; Kolasa, Magdalena; Kusmider, Maciej; Faron-Gorecka, Agata; Pabian, Paulina; Zurawek, Dariusz; Szafran-Pilch, Kinga; Dziedzicka-Wasylewska, Marta

    2015-01-12

    Norepinephrine transporter knock-out mice (NET-KO) exhibit depression-resistant phenotypes. They manifest significantly shorter immobility times in both the forced swim test and the tail suspension test. Moreover, biochemical studies have revealed the up-regulation of other monoamine transporters (dopamine and serotonin) in the brains of NET-KO mice, similar to the phenomenon observed after the chronic pharmacological blockade of norepinephrine transporter by desipramine in wild-type (WT) animals. NET-KO mice are also resistant to stress, as we demonstrated previously by measuring plasma corticosterone concentration. In the present study, we used a microdissection technique to separate target brain regions and the TaqMan Low Density Array approach to test the expression of a group of genes in the NET-KO mice compared with WT animals. A group of genes with altered expression were identified in four brain structures (frontal and cingulate cortices, dentate gyrus of hippocampus and basal-lateral amygdala) of NET-KO mice compared with WT mice. These genes are known to be altered by antidepressant drugs administration. The most interesting gene is Crh-bp, which modulates the activity of corticotrophin--releasing hormone (CRH) and several CRH-family members. Generally, genetic disturbances within noradrenergic neurons result in biological changes, such as in signal transduction and intercellular communication, and may be linked to changes in noradrenaline levels in the brains of NET-KO mice.

  12. Arterial Remodeling in B-Type Natriuretic Peptide Knock-Out Females

    PubMed Central

    Holditch, Sara J.; Schreiber, Claire A.; Burnett, John C.; Ikeda, Yasuhiro

    2016-01-01

    Sexual dimorphisms are recognized in cardiovascular conditions such as hypertension, stroke, thrombosis and vasculitis. B-type natriuretic peptide (BNP) is a guanylyl cyclase A (GC-A) agonist. The anti-hypertensive, vasodilatory, anti-fibrotic, and anti-hypertrophic properties of BNP are well established in male animal models. Although circulating BNP levels are higher in women, when compared to age-matched men, the cardiovascular protective propensity of BNP in females is poorly understood. We assessed the cardiovascular consequences of BNP deletion in genetically null (Nppb−/−) female rat lines. Throughout the study, blood pressure (BP) remained uninfluenced by genotype, and cardiorenal consequences of BNP knock out remained minor. Unexpectedly, approximately 60% of Nppb−/− females developed mesenteric polyarteritis-nodosa (PAN)-like vasculitis in their life span, some as early as 4 months of age. Mesenteric lesions involved intense arterial remodeling, progressive inflammation, occluded lumens, and less frequently intestinal necrosis and multiple visceral arterial aneurysms. Cumulative pathologies resulted in a significant decline in survival of the Nppb−/− female. This study highlights BNP’s vasoprotective propensity, bringing to light a possible sex specific difference in the cardiovascular protection provided by BNP. Defects in the BNP/GC-A/cGMP pathway may play a role in arteriopathies in women, while GC-A agonists may provide effective therapy for arteritis. PMID:27162120

  13. CRISPR knock out CTLA-4 enhances the anti-tumor activity of cytotoxic T lymphocytes.

    PubMed

    Shi, Long; Meng, Tongyu; Zhao, Zhilong; Han, Jinsheng; Zhang, Wei; Gao, Fei; Cai, Jianhui

    2017-09-06

    T cell-mediated anti-tumor immunity plays a pivotal role in cancer immune surveillance. Cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) is a protein receptor mainly expressed in activated T cells and regulatory T cells. CTLA-4 competes with CD28 for ligand binding and generates inhibitory signals to attenuate T cell activation. The blockade of CTLA-4 mediated immune inhibitory checkpoint has been associated with enhanced anti-tumor immunity. In this study, we use CRISPR-Cas9 system to knock out (KO) CTLA-4 from cytotoxic T lymphocytes (CTLs) and evaluate its effect on the anti-tumor activity of the CTLs. CTLA-4 KO CTLs robustly enhanced tumor cell death by 40% compared to the control and facilitated apoptosis and caspase activities in tumor cells. The knockout of CTLA-4 also increased TNF-α and IFN-γ secretion of the CTLs by approximately 2-fold. The effectiveness of CTLA-4 KO in enhancing anti-tumor activity of the CTLs was verified in vivo using mouse xenograft model. The xenografted mice treated with CTLA-4 KO CTLs demonstrated repressed tumor growth and prolonged survival compared to the control group. Our data suggest that CRISPR targeting CTLA-4 immune checkpoint could significantly improve the anti-tumor activity of CTLs. Copyright © 2017. Published by Elsevier B.V.

  14. Schmallenberg virus infection of adult type I interferon receptor knock-out mice.

    PubMed

    Wernike, Kerstin; Breithaupt, Angele; Keller, Markus; Hoffmann, Bernd; Beer, Martin; Eschbaumer, Michael

    2012-01-01

    Schmallenberg virus (SBV), a novel orthobunyavirus, was discovered in Europe in late 2011. It causes mild and transient disease in adult ruminants, but fetal infection can lead to abortion or severe malformations. There is considerable demand for SBV research, but in vivo studies in large animals are complicated by their long gestation periods and the cost of high containment housing. The goal of this study was to investigate whether type I interferon receptor knock-out (IFNAR(-/-)) mice are a suitable small animal model for SBV. Twenty IFNAR(-/-) mice were inoculated with SBV, four were kept as controls. After inoculation, all were observed and weighed daily; two mice per day were sacrificed and blood, brain, lungs, liver, spleen, and intestine were harvested. All but one inoculated mouse lost weight, and two mice died spontaneously at the end of the first week, while another two had to be euthanized. Real-time RT-PCR detected large amounts of SBV RNA in all dead or sick mice; the controls were healthy and PCR-negative. IFNAR(-/-) mice are susceptible to SBV infection and can develop fatal disease, making them a handy and versatile tool for SBV vaccine research.

  15. Granulin Knock Out Zebrafish Lack Frontotemporal Lobar Degeneration and Neuronal Ceroid Lipofuscinosis Pathology

    PubMed Central

    Solchenberger, Barbara; Russell, Claire; Kremmer, Elisabeth; Haass, Christian; Schmid, Bettina

    2015-01-01

    Loss of function mutations in granulin (GRN) are linked to two distinct neurological disorders, frontotemporal lobar degeneration (FTLD) and neuronal ceroid lipofuscinosis (NCL). It is so far unknown how a complete loss of GRN in NCL and partial loss of GRN in FTLD can result in such distinct diseases. In zebrafish, there are two GRN homologues, Granulin A (Grna) and Granulin B (Grnb). We have generated stable Grna and Grnb loss of function zebrafish mutants by zinc finger nuclease mediated genome editing. Surprisingly, the grna and grnb single and double mutants display neither spinal motor neuron axonopathies nor a reduced number of myogenic progenitor cells as previously reported for Grna and Grnb knock down embryos. Additionally, grna−/−;grnb−/− double mutants have no obvious FTLD- and NCL-related biochemical and neuropathological phenotypes. Taken together, the Grna and Grnb single and double knock out zebrafish lack any obvious morphological, pathological and biochemical phenotypes. Loss of zebrafish Grna and Grnb might therefore either be fully compensated or only become symptomatic upon additional challenge. PMID:25785851

  16. Phospholipase D δ knock-out mutants are tolerant to severe drought stress

    PubMed Central

    Distéfano, Ayelen M; Valiñas, Matías A; Scuffi, Denise; Lamattina, Lorenzo; ten Have, Arjen; García-Mata, Carlos; Laxalt, Ana M

    2015-01-01

    Phospholipase D (PLD) is involved in different plant processes, ranging from responses to abiotic and biotic stress to plant development. Phospholipase Dδ (PLDδ) is activated in dehydration and salt stress, producing the lipid second messenger phosphatidic acid. In this work we show that pldδ Arabidopsis mutants were more tolerant to severe drought than wild-type plants. PLDδ has been shown to be required for ABA regulation of stomatal closure of isolated epidermal peels. However, there was no significant difference in stomatal conductance at the whole plant level between wild-type and pldδ mutants. Since PLD hydrolyses structural phospholipids, then we looked at membrane integrity. Ion leakage measurements showed that during dehydration of leaf discs pldδ mutant has less membrane degradation compared to the wild-type. We further analyzed the mutants and showed that pldδ have higher mRNA levels of RAB18 and RD29A compared to wild-type plants under normal growth conditions. Transient expression of AtPLDδ in Nicotiana benthamiana plants induced a wilting phenotype. These findings suggest that, in wt plants PLDδ disrupt membranes in severe drought stress and, in the absence of the protein (PLDδ knock-out) might drought-prime the plants, making them more tolerant to severe drought stress. The results are discussed in relation to PLDδ role in guard cell signaling and drought tolerance. PMID:26340512

  17. Phospholipase D δ knock-out mutants are tolerant to severe drought stress.

    PubMed

    Distéfano, Ayelen M; Valiñas, Matías A; Scuffi, Denise; Lamattina, Lorenzo; Ten Have, Arjen; García-Mata, Carlos; Laxalt, Ana M

    2015-01-01

    Phospholipase D (PLD) is involved in different plant processes, ranging from responses to abiotic and biotic stress to plant development. Phospholipase Dδ (PLDδ) is activated in dehydration and salt stress, producing the lipid second messenger phosphatidic acid. In this work we show that pldδ Arabidopsis mutants were more tolerant to severe drought than wild-type plants. PLDδ has been shown to be required for ABA regulation of stomatal closure of isolated epidermal peels. However, there was no significant difference in stomatal conductance at the whole plant level between wild-type and pldδ mutants. Since PLD hydrolyses structural phospholipids, then we looked at membrane integrity. Ion leakage measurements showed that during dehydration of leaf discs pldδ mutant has less membrane degradation compared to the wild-type. We further analyzed the mutants and showed that pldδ have higher mRNA levels of RAB18 and RD29A compared to wild-type plants under normal growth conditions. Transient expression of AtPLDδ in Nicotiana benthamiana plants induced a wilting phenotype. These findings suggest that, in wt plants PLDδ disrupt membranes in severe drought stress and, in the absence of the protein (PLDδ knock-out) might drought-prime the plants, making them more tolerant to severe drought stress. The results are discussed in relation to PLDδ role in guard cell signaling and drought tolerance.

  18. The Expression of TALEN before Fertilization Provides a Rapid Knock-Out Phenotype in Xenopus laevis Founder Embryos.

    PubMed

    Miyamoto, Kei; Suzuki, Ken-Ichi T; Suzuki, Miyuki; Sakane, Yuto; Sakuma, Tetsushi; Herberg, Sarah; Simeone, Angela; Simpson, David; Jullien, Jerome; Yamamoto, Takashi; Gurdon, J B

    2015-01-01

    Recent advances in genome editing using programmable nucleases have revolutionized gene targeting in various organisms. Successful gene knock-out has been shown in Xenopus, a widely used model organism, although a system enabling less mosaic knock-out in founder embryos (F0) needs to be explored in order to judge phenotypes in the F0 generation. Here, we injected modified highly active transcription activator-like effector nuclease (TALEN) mRNA to oocytes at the germinal vesicle (GV) stage, followed by in vitro maturation and intracytoplasmic sperm injection, to achieve a full knock-out in F0 embryos. Unlike conventional injection methods to fertilized embryos, the injection of TALEN mRNA into GV oocytes allows expression of nucleases before fertilization, enabling them to work from an earlier stage. Using this procedure, most of developed embryos showed full knock-out phenotypes of the pigmentation gene tyrosinase and/or embryonic lethal gene pax6 in the founder generation. In addition, our method permitted a large 1 kb deletion. Thus, we describe nearly complete gene knock-out phenotypes in Xenopus laevis F0 embryos. The presented method will help to accelerate the production of knock-out frogs since we can bypass an extra generation of about 1 year in Xenopus laevis. Meantime, our method provides a unique opportunity to rapidly test the developmental effects of disrupting those genes that do not permit growth to an adult able to reproduce. In addition, the protocol shown here is considerably less invasive than the previously used host transfer since our protocol does not require surgery. The experimental scheme presented is potentially applicable to other organisms such as mammals and fish to resolve common issues of mosaicism in founders.

  19. Citrin/mitochondrial glycerol-3-phosphate dehydrogenase double knock-out mice recapitulate features of human citrin deficiency.

    PubMed

    Saheki, Takeyori; Iijima, Mikio; Li, Meng Xian; Kobayashi, Keiko; Horiuchi, Masahisa; Ushikai, Miharu; Okumura, Fumihiko; Meng, Xiao Jian; Inoue, Ituro; Tajima, Atsushi; Moriyama, Mitsuaki; Eto, Kazuhiro; Kadowaki, Takashi; Sinasac, David S; Tsui, Lap-Chee; Tsuji, Mihoko; Okano, Akira; Kobayashi, Tsuyoshi

    2007-08-24

    Citrin is the liver-type mitochondrial aspartate-glutamate carrier that participates in urea, protein, and nucleotide biosynthetic pathways by supplying aspartate from mitochondria to the cytosol. Citrin also plays a role in transporting cytosolic NADH reducing equivalents into mitochondria as a component of the malate-aspartate shuttle. In humans, loss-of-function mutations in the SLC25A13 gene encoding citrin cause both adult-onset type II citrullinemia and neonatal intrahepatic cholestasis, collectively referred to as human citrin deficiency. Citrin knock-out mice fail to display features of human citrin deficiency. Based on the hypothesis that an enhanced glycerol phosphate shuttle activity may be compensating for the loss of citrin function in the mouse, we have generated mice with a combined disruption of the genes for citrin and mitochondrial glycerol 3-phosphate dehydrogenase. The resulting double knock-out mice demonstrated citrullinemia, hyperammonemia that was further elevated by oral sucrose administration, hypoglycemia, and a fatty liver, all features of human citrin deficiency. An increased hepatic lactate/pyruvate ratio in the double knock-out mice compared with controls was also further elevated by the oral sucrose administration, suggesting that an altered cytosolic NADH/NAD(+) ratio is closely associated with the hyperammonemia observed. Microarray analyses identified over 100 genes that were differentially expressed in the double knock-out mice compared with wild-type controls, revealing genes potentially involved in compensatory or downstream effects of the combined mutations. Together, our data indicate that the more severe phenotype present in the citrin/mitochondrial glycerol-3-phosphate dehydrogenase double knock-out mice represents a more accurate model of human citrin deficiency than citrin knock-out mice.

  20. TRP vanilloid 2 knock-out mice are susceptible to perinatal lethality but display normal thermal and mechanical nociception.

    PubMed

    Park, Una; Vastani, Nisha; Guan, Yun; Raja, Srinivasa N; Koltzenburg, Martin; Caterina, Michael J

    2011-08-10

    TRP vanilloid 2 (TRPV2) is a nonselective cation channel expressed prominently in medium- to large-diameter sensory neurons that can be activated by extreme heat (>52°C). These features suggest that TRPV2 might be a transducer of noxious heat in vivo. TRPV2 can also be activated by hypoosmolarity or cell stretch, suggesting potential roles in mechanotransduction. To address the physiological functions of TRPV2 in somatosensation, we generated TRPV2 knock-out mice and examined their behavioral and electrophysiological responses to heat and mechanical stimuli. TRPV2 knock-out mice showed reduced embryonic weight and perinatal viability. As adults, surviving knock-out mice also exhibited a slightly reduced body weight. TRPV2 knock-out mice showed normal behavioral responses to noxious heat over a broad range of temperatures and normal responses to punctate mechanical stimuli, both in the basal state and under hyperalgesic conditions such as peripheral inflammation and L5 spinal nerve ligation. Moreover, behavioral assays of TRPV1/TRPV2 double knock-out mice or of TRPV2 knock-out mice treated with resiniferatoxin to desensitize TRPV1-expressing afferents revealed no thermosensory consequences of TRPV2 absence. In line with behavioral findings, electrophysiological recordings from skin afferents showed that C-fiber responses to heat and C- and Aδ-fiber responses to noxious mechanical stimuli were unimpaired in the absence of TRPV2. The prevalence of thermosensitive Aδ-fibers was too low to permit comparison between genotypes. Thus, TRPV2 is important for perinatal viability but is not essential for heat or mechanical nociception or hypersensitivity in the adult mouse.

  1. Glutaminyl cyclase knock-out mice exhibit slight hypothyroidism but no hypogonadism: implications for enzyme function and drug development.

    PubMed

    Schilling, Stephan; Kohlmann, Stephanie; Bäuscher, Christoph; Sedlmeier, Reinhard; Koch, Birgit; Eichentopf, Rico; Becker, Andreas; Cynis, Holger; Hoffmann, Torsten; Berg, Sabine; Freyse, Ernst-Joachim; von Hörsten, Stephan; Rossner, Steffen; Graubner, Sigrid; Demuth, Hans-Ulrich

    2011-04-22

    Glutaminyl cyclases (QCs) catalyze the formation of pyroglutamate (pGlu) residues at the N terminus of peptides and proteins. Hypothalamic pGlu hormones, such as thyrotropin-releasing hormone and gonadotropin-releasing hormone are essential for regulation of metabolism and fertility in the hypothalamic pituitary thyroid and gonadal axes, respectively. Here, we analyzed the consequences of constitutive genetic QC ablation on endocrine functions and on the behavior of adult mice. Adult homozygous QC knock-out mice are fertile and behave indistinguishably from wild type mice in tests of motor function, cognition, general activity, and ingestion behavior. The QC knock-out results in a dramatic drop of enzyme activity in the brain, especially in hypothalamus and in plasma. Other peripheral organs like liver and spleen still contain QC activity, which is most likely caused by its homolog isoQC. The serum gonadotropin-releasing hormone, TSH, and testosterone concentrations were not changed by QC depletion. The serum thyroxine was decreased by 24% in homozygous QC knock-out animals, suggesting a mild hypothyroidism. QC knock-out mice were indistinguishable from wild type with regard to blood glucose and glucose tolerance, thus differing from reports of thyrotropin-releasing hormone knock-out mice significantly. The results suggest a significant formation of the hypothalamic pGlu hormones by alternative mechanisms, like spontaneous cyclization or conversion by isoQC. The different effects of QC depletion on the hypothalamic pituitary thyroid and gonadal axes might indicate slightly different modes of substrate conversion of both enzymes. The absence of significant abnormalities in QC knock-out mice suggests the presence of a therapeutic window for suppression of QC activity in current drug development.

  2. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies.

    PubMed

    Lin, F; Fukuoka, Y; Spicer, A; Ohta, R; Okada, N; Harris, C L; Emancipator, S N; Medof, M E

    2001-10-01

    Decay-accelerating factor (DAF) is a membrane regulator of C3 activation that protects self cells from autologous complement attack. In humans, DAF is uniformly expressed as a glycosylphosphatidylinositol (GPI)-anchored molecule. In mice, both GPI-anchored and transmembrane-anchored DAF proteins are produced, each of which can be derived from two different genes (Daf1 and Daf2). In this report, we describe a Daf1 gene knock-out mouse arising as the first product of a strategy for targeting one or both Daf genes. As part of the work, we characterize recently described monoclonal antibodies against murine DAF protein using deletion mutants synthesized in yeast, and then employ the monoclonal antibodies in conjunction with wild-type and the Daf1 knock-out mice to determine the tissue distribution of the mouse Daf1 and Daf2 gene products. To enhance the immunohistochemical detection of murine DAF protein, we utilized the sensitive tyramide fluorescence method. In wild-type mice, we found strong DAF labelling of glomeruli, airway and gut epithelium, the spleen, vascular endothelium throughout all tissues, and seminiferous tubules of the testis. In Daf1 knock-out mice, DAF labelling was ablated in most tissues, but strong labelling of the testis and splenic dendritic cells remained. In both sites, reverse transcription-polymerase chain reaction analyses identified both GPI and transmembrane forms of Daf2 gene-derived protein. The results have relevance for studies of in vivo murine DAF function and of murine DAF structure.

  3. Oral rapamycin inhibits growth of atherosclerotic plaque in apoE knock-out mice

    SciTech Connect

    Waksman, Ron; Pakala, Rajbabu; Burnett, Mary S.; Gulick, Cindy P.; Leborgne, Laurent; Fournadjiev, Jana; Wolfram, Roswitha; Hellinga, David

    2003-03-01

    Introduction: Inflammatory and immunological responses of vascular cells are known to play significant roles in atherosclerotic plaque development. Rapamycin with antiinflammatory, immunosuppressive and antiproliferative properties has been shown to reduce neointima formation when coated on stents. This study is designed to test the potential of oral rapamycin to inhibit atherosclerotic plaque development. Methods: Eight-week-old apoE knock-out mice were fed with 0.25% cholesterol supplemented diet (control diet), control diet containing 50 {mu}g/kg rapamycin (low-dose rapamycin) or 100 {mu}g/kg rapamycin (high-dose rapamycin) for 4 or 8 weeks. Subsets of mice from each group (n=10) were weighed and euthanized. Whole blood rapamycin levels were determined using HPLC-MS/MS, and histological analyses of atherosclerotic lesions in the aortic root were performed. Results: Mice fed with high-dose rapamycin did not gain weight (18.5{+-}1.5 vs. 20.6{+-}0.9 g, P=.01). Blood levels of rapamycin 117{+-}7 pg/ml were detected in the blood of mice fed with high-dose rapamycin for 8 weeks. The plaque area in mice fed with high dose oral rapamycin is significantly less as compared to control (0.168{+-}0.008 vs. 0.326{+-}0.013 mm{sup 2}, P=.001 at 4 weeks; 0.234{+-}0.013 vs. 0.447{+-}0.011 mm{sup 2}, P=.001 at 8 weeks). Lumen area was inversely proportional to the plaque area. Conclusions: The results indicate that oral rapamycin is effective in attenuating the progression of atherosclerotic plaque in the mice.

  4. Reduced cortical BDNF expression and aberrant memory in Carf knock-out mice.

    PubMed

    McDowell, Kelli A; Hutchinson, Ashley N; Wong-Goodrich, Sarah J E; Presby, Matthew M; Su, Dan; Rodriguiz, Ramona M; Law, Krystal C; Williams, Christina L; Wetsel, William C; West, Anne E

    2010-06-02

    Transcription factors are a key point of convergence between the cell-intrinsic and extracellular signals that guide synaptic development and brain plasticity. Calcium-response factor (CaRF) is a unique transcription factor first identified as a binding protein for a calcium-response element in the gene encoding brain-derived neurotrophic factor (Bdnf). We have now generated Carf knock-out (KO) mice to characterize the function of this factor in vivo. Intriguingly, Carf KO mice have selectively reduced expression of Bdnf exon IV-containing mRNA transcripts and BDNF protein in the cerebral cortex, whereas BDNF levels in the hippocampus and striatum remain unchanged, implicating CaRF as a brain region-selective regulator of BDNF expression. At the cellular level, Carf KO mice show altered expression of GABAergic proteins at striatal synapses, raising the possibility that CaRF may contribute to aspects of inhibitory synapse development. Carf KO mice show normal spatial learning in the Morris water maze and normal context-dependent fear conditioning. However they have an enhanced ability to find a new platform location on the first day of reversal training in the water maze and they extinguish conditioned fear more slowly than their wild-type littermates. Finally, Carf KO mice show normal short-term (STM) and long-term memory (LTM) in a novel object recognition task, but exhibit impairments during the remote memory phase of testing. Together, these data reveal novel roles for CaRF in the organization and/or function of neural circuits that underlie essential aspects of learning and memory.

  5. Fumarylacetoacetate Hydrolase Knock-out Rabbit Model for Hereditary Tyrosinemia Type 1.

    PubMed

    Li, Li; Zhang, Quanjun; Yang, Huaqiang; Zou, Qingjian; Lai, Chengdan; Jiang, Fei; Zhao, Ping; Luo, Zhiwei; Yang, Jiayin; Chen, Qian; Wang, Yan; Newsome, Philip N; Frampton, Jon; Maxwell, Patrick H; Li, Wenjuan; Chen, Shuhan; Wang, Dongye; Siu, Tak-Shing; Tam, Sidney; Tse, Hung-Fat; Qin, Baoming; Bao, Xichen; Esteban, Miguel A; Lai, Liangxue

    2017-03-17

    Hereditary tyrosinemia type 1 (HT1) is a severe human autosomal recessive disorder caused by the deficiency of fumarylacetoacetate hydroxylase (FAH), an enzyme catalyzing the last step in the tyrosine degradation pathway. Lack of FAH causes accumulation of toxic metabolites (fumarylacetoacetate and succinylacetone) in blood and tissues, ultimately resulting in severe liver and kidney damage with onset that ranges from infancy to adolescence. This tissue damage is lethal but can be controlled by administration of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), which inhibits tyrosine catabolism upstream of the generation of fumarylacetoacetate and succinylacetone. Notably, in animals lacking FAH, transient withdrawal of NTBC can be used to induce liver damage and a concomitant regenerative response that stimulates the growth of healthy hepatocytes. Among other things, this model has raised tremendous interest for the in vivo expansion of human primary hepatocytes inside these animals and for exploring experimental gene therapy and cell-based therapies. Here, we report the generation of FAH knock-out rabbits via pronuclear stage embryo microinjection of transcription activator-like effector nucleases. FAH(-/-) rabbits exhibit phenotypic features of HT1 including liver and kidney abnormalities but additionally develop frequent ocular manifestations likely caused by local accumulation of tyrosine upon NTBC administration. We also show that allogeneic transplantation of wild-type rabbit primary hepatocytes into FAH(-/-) rabbits enables highly efficient liver repopulation and prevents liver insufficiency and death. Because of significant advantages over rodents and their ease of breeding, maintenance, and manipulation compared with larger animals including pigs, FAH(-/-) rabbits are an attractive alternative for modeling the consequences of HT1. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Fumarylacetoacetate Hydrolase Knock-out Rabbit Model for Hereditary Tyrosinemia Type 1*

    PubMed Central

    Li, Li; Zhang, Quanjun; Yang, Huaqiang; Zou, Qingjian; Lai, Chengdan; Jiang, Fei; Zhao, Ping; Luo, Zhiwei; Yang, Jiayin; Chen, Qian; Wang, Yan; Newsome, Philip N.; Frampton, Jon; Maxwell, Patrick H.; Li, Wenjuan; Chen, Shuhan; Wang, Dongye; Siu, Tak-Shing; Tam, Sidney; Tse, Hung-Fat; Qin, Baoming; Bao, Xichen; Esteban, Miguel A.; Lai, Liangxue

    2017-01-01

    Hereditary tyrosinemia type 1 (HT1) is a severe human autosomal recessive disorder caused by the deficiency of fumarylacetoacetate hydroxylase (FAH), an enzyme catalyzing the last step in the tyrosine degradation pathway. Lack of FAH causes accumulation of toxic metabolites (fumarylacetoacetate and succinylacetone) in blood and tissues, ultimately resulting in severe liver and kidney damage with onset that ranges from infancy to adolescence. This tissue damage is lethal but can be controlled by administration of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), which inhibits tyrosine catabolism upstream of the generation of fumarylacetoacetate and succinylacetone. Notably, in animals lacking FAH, transient withdrawal of NTBC can be used to induce liver damage and a concomitant regenerative response that stimulates the growth of healthy hepatocytes. Among other things, this model has raised tremendous interest for the in vivo expansion of human primary hepatocytes inside these animals and for exploring experimental gene therapy and cell-based therapies. Here, we report the generation of FAH knock-out rabbits via pronuclear stage embryo microinjection of transcription activator-like effector nucleases. FAH−/− rabbits exhibit phenotypic features of HT1 including liver and kidney abnormalities but additionally develop frequent ocular manifestations likely caused by local accumulation of tyrosine upon NTBC administration. We also show that allogeneic transplantation of wild-type rabbit primary hepatocytes into FAH−/− rabbits enables highly efficient liver repopulation and prevents liver insufficiency and death. Because of significant advantages over rodents and their ease of breeding, maintenance, and manipulation compared with larger animals including pigs, FAH−/− rabbits are an attractive alternative for modeling the consequences of HT1. PMID:28053091

  7. Decreased Superoxide Production in Macrophages of Long-lived p66Shc Knock-out Mice*

    PubMed Central

    Tomilov, Alexey A.; Bicocca, Vincent; Schoenfeld, Robert A.; Giorgio, Marco; Migliaccio, Enrica; Ramsey, Jon J.; Hagopian, Kevork; Pelicci, Pier Giuseppe; Cortopassi, Gino A.

    2010-01-01

    A decrease in reactive oxygen species (ROS) production has been associated with extended life span in animal models of longevity. Mice deficient in the p66Shc gene are long-lived, and their cells are both resistant to oxidative stress and produce less ROS. Our microarray analysis of p66Shc(−/−) mouse tissues showed alterations in transcripts involved in heme and superoxide production and insulin signaling. Thus, we carried out analysis of ROS production by NADPH oxidase (PHOX) in macrophages of control and p66Shc knock-out mice. p66Shc(−/−) mice had a 40% reduction in PHOX-dependent superoxide production. To confirm whether the defect in superoxide production was a direct consequence of p66Shc deficiency, p66Shc was knocked down with siRNA in the macrophage cell line RAW264, and a 30% defect in superoxide generation was observed. The pathway of PHOX-dependent superoxide generation was investigated. PHOX protein levels were not decreased in mutant macrophages; however, the rate and extent of phosphorylation of p47phox was decreased in mutants, as was membrane translocation of the complex. Consistently, phosphorylation of protein kinase Cδ, Akt, and ERK (the kinases responsible for phosphorylation of p47phox) was decreased. Thus, p66Shc deficiency causes a defect in activation of the PHOX complex that results in decreased superoxide production. p66Shc-deficient mice have recently been observed to be resistant to atherosclerosis and to oxidant injury in kidney and brain. Because phagocyte-derived superoxide is often a component of oxidant injury and inflammation, we suggest that the decreased superoxide production by PHOX in p66Shc-deficient mice could contribute significantly to their relative protection from oxidant injury and consequent longevity. PMID:19892704

  8. Motivational effects of ethanol in DARPP-32 knock-out mice.

    PubMed

    Risinger, F O; Freeman, P A; Greengard, P; Fienberg, A A

    2001-01-01

    DARPP-32 (dopamine and adenosine 3',5'-monophosphate-regulated phosphoprotein, 32 kDa) is an important component of dopaminergic function in brain areas thought to be important for drug and alcohol addiction. The present experiments characterized the acquisition of ethanol-induced conditioned taste aversion, ethanol-induced conditioned place preference, and ethanol self-administration in DARPP-32 knock-out (KO) mice compared to wild-type (WT) controls. For taste conditioning, KO and WT mice received access to 0.2 m NaCl solution followed immediately by intraperitoneal injection of 0-4 gm/kg ethanol. Ethanol produced dose-dependent conditioned taste aversion that was the same in both genotypes. For place conditioning, KO and WT mice received eight pairings of a tactile stimulus with ethanol (2 gm/kg, i.p.), and a different stimulus with saline. Ethanol produced increases in locomotor activity during conditioning, with KO mice showing higher activity levels after ethanol compared to WT mice. WT mice, but not KO mice, acquired conditioned preference for the ethanol-paired stimulus. In the self-administration procedure, KO and WT mice were trained to lever press for access to 10% v/v ethanol. Subsequently, the mice had 23 hr/d access to food, ethanol, and water. Response patterns were determined using 0-30% v/v ethanol concentrations. WT mice displayed concentration-dependent responding for ethanol. Responding on the ethanol lever by KO mice did not change as a function of ethanol concentration. Saccharin (0.2% w/v) was subsequently added to the ethanol mixture, and responding was examined at 0, 5, 10, and 20% ethanol concentrations. Ethanol responding increased in both genotypes, although WT mice showed higher rates at all concentrations.

  9. Knock-out of nexilin in mice leads to dilated cardiomyopathy and endomyocardial fibroelastosis.

    PubMed

    Aherrahrou, Zouhair; Schlossarek, Saskia; Stoelting, Stephanie; Klinger, Matthias; Geertz, Birgit; Weinberger, Florian; Kessler, Thorsten; Aherrahrou, Redouane; Moreth, Kristin; Bekeredjian, Raffi; Hrabě de Angelis, Martin; Just, Steffen; Rottbauer, Wolfgang; Eschenhagen, Thomas; Schunkert, Heribert; Carrier, Lucie; Erdmann, Jeanette

    2016-01-01

    Cardiomyopathy is one of the most common causes of chronic heart failure worldwide. Mutations in the gene encoding nexilin (NEXN) occur in patients with both hypertrophic and dilated cardiomyopathy (DCM); however, little is known about the pathophysiological mechanisms and relevance of NEXN to these disorders. Here, we evaluated the functional role of NEXN using a constitutive Nexn knock-out (KO) mouse model. Heterozygous (Het) mice were inter-crossed to produce wild-type (WT), Het, and homozygous KO mice. At birth, 32, 46, and 22 % of the mice were WT, Het, and KO, respectively, which is close to the expected Mendelian ratio. After postnatal day 6, the survival of the Nexn KO mice decreased dramatically and all of the animals died by day 8. Phenotypic characterizations of the WT and KO mice were performed at postnatal days 1, 2, 4, and 6. At birth, the relative heart weights of the WT and KO mice were similar; however, at day 4, the relative heart weight of the KO group was 2.3-fold higher than of the WT group. In addition, the KO mice developed rapidly progressive cardiomyopathy with left ventricular dilation and wall thinning and decreased cardiac function. At day 6, the KO mice developed a fulminant DCM phenotype characterized by dilated ventricular chambers and systolic dysfunction. At this stage, collagen deposits and some elastin deposits were observed within the left ventricle cavity, which resembles the features of endomyocardial fibroelastosis (EFE). Overall, these results further emphasize the role of NEXN in DCM and suggest a novel role in EFE.

  10. Systemic and Cerebral Iron Homeostasis in Ferritin Knock-Out Mice

    PubMed Central

    Li, Wei; Garringer, Holly J.; Goodwin, Charles B.; Richine, Briana; Acton, Anthony; VanDuyn, Natalia; Muhoberac, Barry B.; Irimia-Dominguez, Jose; Chan, Rebecca J.; Peacock, Munro; Nass, Richard; Ghetti, Bernardino; Vidal, Ruben

    2015-01-01

    Ferritin, a 24-mer heteropolymer of heavy (H) and light (L) subunits, is the main cellular iron storage protein and plays a pivotal role in iron homeostasis by modulating free iron levels thus reducing radical-mediated damage. The H subunit has ferroxidase activity (converting Fe(II) to Fe(III)), while the L subunit promotes iron nucleation and increases ferritin stability. Previous studies on the H gene (Fth) in mice have shown that complete inactivation of Fth is lethal during embryonic development, without ability to compensate by the L subunit. In humans, homozygous loss of the L gene (FTL) is associated with generalized seizure and atypical restless leg syndrome, while mutations in FTL cause a form of neurodegeneration with brain iron accumulation. Here we generated mice with genetic ablation of the Fth and Ftl genes. As previously reported, homozygous loss of the Fth allele on a wild-type Ftl background was embryonic lethal, whereas knock-out of the Ftl allele (Ftl-/-) led to a significant decrease in the percentage of Ftl-/- newborn mice. Analysis of Ftl-/- mice revealed systemic and brain iron dyshomeostasis, without any noticeable signs of neurodegeneration. Our findings indicate that expression of the H subunit can rescue the loss of the L subunit and that H ferritin homopolymers have the capacity to sequester iron in vivo. We also observed that a single allele expressing the H subunit is not sufficient for survival when both alleles encoding the L subunit are absent, suggesting the need of some degree of complementation between the subunits as well as a dosage effect. PMID:25629408

  11. Relevant feature set estimation with a knock-out strategy and random forests.

    PubMed

    Ganz, Melanie; Greve, Douglas N; Fischl, Bruce; Konukoglu, Ender

    2015-11-15

    Group analysis of neuroimaging data is a vital tool for identifying anatomical and functional variations related to diseases as well as normal biological processes. The analyses are often performed on a large number of highly correlated measurements using a relatively smaller number of samples. Despite the correlation structure, the most widely used approach is to analyze the data using univariate methods followed by post-hoc corrections that try to account for the data's multivariate nature. Although widely used, this approach may fail to recover from the adverse effects of the initial analysis when local effects are not strong. Multivariate pattern analysis (MVPA) is a powerful alternative to the univariate approach for identifying relevant variations. Jointly analyzing all the measures, MVPA techniques can detect global effects even when individual local effects are too weak to detect with univariate analysis. Current approaches are successful in identifying variations that yield highly predictive and compact models. However, they suffer from lessened sensitivity and instabilities in identification of relevant variations. Furthermore, current methods' user-defined parameters are often unintuitive and difficult to determine. In this article, we propose a novel MVPA method for group analysis of high-dimensional data that overcomes the drawbacks of the current techniques. Our approach explicitly aims to identify all relevant variations using a "knock-out" strategy and the Random Forest algorithm. In evaluations with synthetic datasets the proposed method achieved substantially higher sensitivity and accuracy than the state-of-the-art MVPA methods, and outperformed the univariate approach when the effect size is low. In experiments with real datasets the proposed method identified regions beyond the univariate approach, while other MVPA methods failed to replicate the univariate results. More importantly, in a reproducibility study with the well-known ADNI dataset

  12. Progressive deafness and altered cochlear innervation in knock-out mice lacking prosaposin.

    PubMed

    Akil, Omar; Chang, Jolie; Hiel, Hakim; Kong, Jee-Hyun; Yi, Eunyoung; Glowatzki, Elisabeth; Lustig, Lawrence R

    2006-12-13

    After a yeast two-hybrid screen identified prosaposin as a potential interacting protein with the nicotinic acetylcholine receptor (nAChR) subunit alpha10, studies were performed to characterize prosaposin in the normal rodent inner ear. Prosaposin demonstrates diffuse organ of Corti expression at birth, with gradual localization to the inner hair cells (IHCs) and its supporting cells, inner pillar cells, and synaptic region of the outer hair cells (OHCs) and Deiters' cells (DCs) by postnatal day 21 (P21). Microdissected OHC and DC quantitative reverse transcriptase-PCR and immunohistology localizes prosaposin mRNA to DCs and OHCs, and protein predominantly to the apex of the DCs. Subsequent studies in a prosaposin knock-out (KO) (-/-) mouse showed intact but slightly reduced hearing through P19, but deafness by P25 and reduced distortion product otoacoustic emissions from P15 onward. Beginning at P12, the prosaposin KO mice showed histologic organ of Corti changes including cellular hypertrophy in the region of the IHC and greater epithelial ridge, a loss of OHCs from cochlear apex, and vacuolization of OHCs. Immunofluorescence revealed exuberant overgrowth of auditory afferent neurites in the region of the IHCs and proliferation of auditory efferent neurites in the region of the tunnel of Corti. IHC recordings from these KO mice showed normal I-V curves and responses to applied acetylcholine. Together, these results suggest that prosaposin helps maintain normal innervation patterns to the organ of Corti. Furthermore, prosaposin's overlapping developmental expression pattern and binding capacity toward the nAChR alpha10 suggest that alpha10 may also play a role in this function.

  13. The Brain Proteome of the Ubiquitin Ligase Peli1 Knock-Out Mouse during Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Lereim, Ragnhild Reehorst; Oveland, Eystein; Xiao, Yichuan; Torkildsen, Øivind; Wergeland, Stig; Myhr, Kjell-Morten; Sun, Shao-Cong; Berven, Frode S

    2016-01-01

    The ubiquitin ligase Peli1 has previously been suggested as a potential treatment target in multiple sclerosis. In the multiple sclerosis disease model, experimental autoimmune encephalomyelitis, Peli1 knock-out led to less activated microglia and less inflammation in the central nervous system. Despite being important in microglia, Peli1 expression has also been detected in glial and neuronal cells. In the present study the overall brain proteomes of Peli1 knock-out mice and wild-type mice were compared prior to experimental autoimmune encephalomyelitis induction, at onset of the disease and at disease peak. Brain samples from the frontal hemisphere, peripheral from the extensive inflammatory foci, were analyzed using TMT-labeling of sample pools, and the discovered proteins were verified in individual mice using label-free proteomics. The greatest proteomic differences between Peli1 knock-out and wild-type mice were observed at the disease peak. In Peli1 knock-out a higher degree of antigen presentation, increased activity of adaptive and innate immune cells and alterations to proteins involved in iron metabolism were observed during experimental autoimmune encephalomyelitis. These results unravel global effects to the brain proteome when abrogating Peli1 expression, underlining the importance of Peli1 as a regulator of the immune response also peripheral to inflammatory foci during experimental autoimmune encephalomyelitis. The proteomics data is available in PRIDE with accession PXD003710. PMID:27746629

  14. Evaluation of cimi-shield knock-out bed bug eliminator against house fly (Musca domestica) adults.

    USDA-ARS?s Scientific Manuscript database

    Cimi-Shield Knock-Out (CSKO) Bed Bug Eliminator is a green treatment labeled for use against bed bugs, carpet beetles, ants, roaches, fleas, ticks, silverfish, millipedes and centipedes. The active ingredient is soybean oil. If CSKO is formulated according to label instructions and sprayed directly ...

  15. Evaluation of cimi-shield knock-out bed bug eliminator against house fly (Musca domestica) adults

    USDA-ARS?s Scientific Manuscript database

    Cimi-Shield Knock-Out (CSKO) Bed Bug Eliminator is a green treatment labeled for use against bed bugs, carpet beetles, ants, roaches, fleas, ticks, silverfish, millipedes and centipedes. The active ingredient is soybean oil. If CSKO is formulated according to label instructions and sprayed directly ...

  16. Purinergic neuromuscular transmission is absent in the colon of P2Y1 knocked out mice

    PubMed Central

    Gallego, Diana; Gil, Víctor; Martínez-Cutillas, Míriam; Mañé, Noemí; Martín, Maria Teresa; Jiménez, Marcel

    2012-01-01

    Purinergic and nitrergic co-transmission is the dominant mechanism responsible for neural-mediated smooth muscle relaxation in the gastrointestinal tract. The aim of the present paper was to test whether or not P2Y1 receptors are involved in purinergic neurotransmission using P2Y1−/− knock-out mice. Tension and microelectrode recordings were performed on colonic strips. In wild type (WT) animals, electrical field stimulation (EFS) caused an inhibitory junction potential (IJP) that consisted of a fast IJP (MRS2500 sensitive, 1 μm) followed by a sustained IJP (Nω-nitro-l-arginine (l-NNA) sensitive, 1 mm). The fast component of the IJP was absent in P2Y1−/− mice whereas the sustained IJP (l-NNA sensitive) was recorded. In WT animals, EFS-induced inhibition of spontaneous motility was blocked by the consecutive addition of l-NNA and MRS2500. In P2Y1−/− mice, EFS responses were completely blocked by l-NNA. In WT and P2Y1−/− animals, l-NNA induced a smooth muscle depolarization but ‘spontaneous’ IJP (MRS2500 sensitive) could be recorded in WT but not in P2Y1−/− animals. Finally, in WT animals, 1 μm MRS2365 caused a smooth muscle hyperpolarization that was blocked by 1 μm MRS2500. In contrast, 1 μm MRS2365 did not modify smooth muscle resting membrane potential in P2Y1−/− mice. β-Nicotinamide adenine dinucleotide (β-NAD, 1 mm) partially mimicked the effect of MRS2365. We conclude that P2Y1 receptors mediate purinergic neurotransmission in the gastrointestinal tract and β-NAD partially fulfils the criteria to participate in rodent purinergic neurotransmission. The P2Y1−/− mouse is a useful animal model to study the selective loss of purinergic neurotransmission. PMID:22371472

  17. Selective Photoreceptor Gene Knock-out Reveals a Regulatory Role for the Growth Behavior of Pseudomonas syringae.

    PubMed

    Shah, Rashmi; Pathak, Gopal; Drepper, Thomas; Gärtner, Wolfgang

    2016-07-01

    The plant pathogen Pseudomonas syringae (Ps) is a well-established model organism for bacterial infection of plants. The genome sequences of two pathovars, pv. syringae and pv. tomato, revealed one gene encoding a blue and two genes encoding red/far red light-sensing photoreceptors. Continuing former molecular characterization of the photoreceptor proteins, we here report selective photoreceptor gene disruption for pv. tomato aiming at identification of potentially regulatory functions of these photoreceptors. Transformation of Ps cells with linear DNA constructs yielded interposon mutations of the corresponding genes. Cell growth studies of the generated photoreceptor knock-out mutants revealed their role in light-dependent regulation of cell growth and motility. Disruption of the blue-light (BL) receptor gene caused a growth deregulation, in line with an observed increased virulence of this mutant (Moriconi et al., Plant J., 2013, 76, 322). Bacterial phytochrome-1 (BphP1) deletion mutant caused unaltered cell growth, but a stronger swarming capacity. Inactivation of its ortholog, BphP2, however, caused reduced growth and remarkably altered dendritic swarming behavior. Combined knock-out of both bacteriophytochromes reproduced the swarming pattern observed for the BphP2 mutant alone. A triple knock-out mutant showed a growth rate between that of the BL (deregulation) and the phytochrome-2 mutant (growth reduction). © 2016 The American Society of Photobiology.

  18. Phenotypic and Molecular Alterations in the Mammary Tissue of R-Spondin1 Knock-Out Mice during Pregnancy

    PubMed Central

    Chadi, Sead; Polyte, Jacqueline; Lefevre, Lucas; Castille, Johan; Ehanno, Aude; Laubier, Johann; Jaffrézic, Florence; Le Provost, Fabienne

    2016-01-01

    R-spondin1 (Rspo1) is a member of a secreted protein family which has pleiotropic functions in development and stem cell growth. Rspo1 knock-out mice are sex-reversed, but some remain sub-fertile, so they fail to nurse their pups. A lack of Rspo1 expression in the mammary gland results in an absence of duct side-branching development and defective alveolar formation. The aim of this study was to characterize the phenotypic and molecular alterations of mammary gland due to Rspo1 knock-out. Using the transcriptional profiling of mammary tissues, we identified misregulated genes in the mammary gland of Rspo1 knock-out mice during pregnancy. A stronger expression of mesenchymal markers was observed, without modifications to the structure of mammary epithelial tissue. Mammary epithelial cell immunohistochemical analysis revealed a persistence of virgin markers, which signify a delay in cell differentiation. Moreover, serial transplantation experiments showed that Rspo1 is associated with a regenerative potential of mammary epithelial cell control. Our finding also highlights the negatively regulated expression of Rspo1’s partners, Lgr4 and RNF43, in the mammary gland during pregnancy. Moreover, we offer evidence that Tgf-β signalling is modified in the absence of Rspo1. Taken together, our results show an abrupt halt or delay to mammary development during pregnancy due to the loss of a further differentiated function. PMID:27611670

  19. [Construction of genetically engineered strain producing 5- oxomilbemycin by knocking out milF in Steptomyces hygroscopicus HS023].

    PubMed

    Huang, Jun; Lin, Jiatan; Zhou, Min; Bai, Hua

    2015-01-04

    To construct a 5-oxomilbemycin producing strain by knocking out milF gene in Streptomyces hygroscopicus HS023. Plasmid pMSST-ΔmilF was constructed and introduced into milbemycin industrial strain Streptomyces hygroscopicus HS023, and milF mutant F2-18 was selected by PCR amplification. Fermentation experiments showed that no milbemycins was produced in F2-18, but 5-ketomilbemycin, the intermediate of milbemycin, was obviously accumulated, and the fermentation titer was enhanced. Genetically engineered strain can simplify the synthesis of milbemycin oxime and lepimectin chemical from milbemycin.

  20. 'Knock, and it shall be opened': knocking out and knocking in to reveal mechanisms of disease and novel therapies.

    PubMed

    Hacking, Douglas F

    2008-12-01

    Recent significant advances in molecular biology have generated genetically modified bacteria, yeast, nematodes, fruit flies, and fish. However, it is the genetic modification of mammalian model organisms, particularly the mouse, that has the greatest potential to shed light on human development, physiology and pathology in ways that have significant implications for neonatal and paediatric clinical practice. Here, we review some of the techniques for knocking out (inactivating), mutating and knocking in (inserting) selected genes that are important to neonatology and show how this research will lead both to a better understanding of disease and to novel therapies for infants and children.

  1. METTL21B is a novel human lysine methyltransferase of translation elongation factor 1A: discovery by CRISPR/Cas9 knock out.

    PubMed

    Hamey, Joshua J; Wienert, Beeke; Quinlan, Kate G R; Wilkins, Marc R

    2017-06-29

    Lysine methylation is widespread on human proteins, however the enzymes that catalyse its addition remain largely unknown. This limits our capacity to study the function and regulation of this modification. Here we used the CRISPR/Cas9 system to knock out putative protein methyltransferases METTL21B and METTL23 in K562 cells, to determine if they methylate elongation factor eEF1A. The known eEF1A methyltransferase EEF1AKMT1 was also knocked out as a control. Targeted mass spectrometry revealed the loss of lysine 165 methylation upon knock out of METTL21B, and the expected loss of lysine 79 methylation on knock out of EEF1AKMT1. No loss of eEF1A methylation was seen in the METTL23 knock out. Recombinant METTL21B was shown in vitro to catalyse methylation on lysine 165 in eEF1A1 and eEF1A2, confirming it as the methyltransferase responsible for this methylation site. Proteomic analysis by SILAC revealed specific upregulation of large ribosomal subunit proteins in the METTL21B knock out, and changes to further processes related to eEF1A function in knock outs of both METTL21B and EEF1AKMT1. This indicates that the methylation of lysine 165 in human eEF1A has a very specific role. METTL21B exists only in vertebrates, with its target lysine showing similar evolutionary conservation. We suggest METTL21B be renamed eEF1A-KMT3. This is the first study to specifically generate CRISPR/Cas9 knock outs of putative protein methyltransferase genes, for the purpose of substrate discovery and site mapping. Our approach should prove useful for the discovery of further novel methyltransferases, and more generally for the discovery of sites for other protein-modifying enzymes. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  2. The inflammation paradigm and coronary artery disease: What Celsus, Virchow and gene knock outs have taught us.

    PubMed

    Krishnaswamy, Guha

    2010-12-01

    Atherosclerotic vascular disease is a major cause of morbidity and mortality throughout the world. The clinical manifestations include coronary artery disease and myocardial infarction, cerebrovascular disease, renovascular disease and peripheral vascular disease. Initially considered a bland occlusive disease mediated to a great extent by lipids, atherosclerosis can now be considered an inflammatory disease, in its own right. This has led to a paradigm shift in disease management. We have come a long way since the time of Celsus, Galen, Virchow, Rokitansky and others when the components of the inflammatory cascade were first described. The development of mouse knock out models, improved molecular approaches to studying atheromatous blood vessels and development of sophisticated imaging and biomarker studies have enhanced our understanding of the molecular pathways in atherosclerosis. This brief review will attempt to weave together the historical, biochemical, immunological and molecular developments that have led to our current understanding of a deadly but treatable and potentially preventable disease.

  3. Generation of α-1,3-galactosyltransferase knocked-out transgenic cloned pigs with knocked-in five human genes.

    PubMed

    Kwon, Dae-Jin; Kim, Dong-Hwan; Hwang, In-Sul; Kim, Dong-Ern; Kim, Hyung-Joo; Kim, Jang-Seong; Lee, Kichoon; Im, Gi-Sun; Lee, Jeong-Woong; Hwang, Seongsoo

    2017-02-01

    Recent progress in genetic manipulation of pigs designated for xenotransplantation ha6s shown considerable promise on xenograft survival in primates. However, genetic modification of multiple genes in donor pigs by knock-out and knock-in technologies, aiming to enhance immunological tolerance against transplanted organs in the recipients, has not been evaluated for health issues of donor pigs. We produced transgenic Massachusetts General Hospital piglets by knocking-out the α-1,3-galactosyltransferase (GT) gene and by simultaneously knocking-in an expression cassette containing five different human genes including, DAF, CD39, TFPI, C1 inhibitor (C1-INH), and TNFAIP3 (A20) [GT(-(DAF/CD39/TFPI/C1-INH/TNFAIP3)/+)] that are connected by 2A peptide cleavage sequences to release individual proteins from a single translational product. All five individual protein products were successfully produced as determined by western blotting of umbilical cords from the newborn transgenic pigs. Although gross observation and histological examination revealed no significant pathological abnormality in transgenic piglets, hematological examination found that the transgenic piglets had abnormally low numbers of platelets and WBCs, including neutrophils, eosinophils, basophils, and lymphocytes. However, transgenic piglets had similar numbers of RBC and values of parameters related to RBC compared to the control littermate piglets. These data suggest that transgenic expression of those human genes in pigs impaired hematopoiesis except for erythropoiesis. In conclusion, our data suggest that transgenic expression of up to five different genes can be efficiently achieved and provide the basis for determining optimal dosages of transgene expression and combinations of the transgenes to warrant production of transgenic donor pigs without health issues.

  4. Production of heterozygous alpha 1,3-galactosyltransferase (GGTA1) knock-out transgenic miniature pigs expressing human CD39.

    PubMed

    Choi, Kimyung; Shim, Joohyun; Ko, Nayoung; Eom, Heejong; Kim, Jiho; Lee, Jeong-Woong; Jin, Dong-Il; Kim, Hyunil

    2017-04-01

    Production of transgenic pigs for use as xenotransplant donors is a solution to the severe shortage of human organs for transplantation. The first barrier to successful xenotransplantation is hyperacute rejection, a rapid, massive humoral immune response directed against the pig carbohydrate GGTA1 epitope. Platelet activation, adherence, and clumping, all major features of thrombotic microangiopathy, are inevitable results of immune-mediated transplant rejection. Human CD39 rapidly hydrolyzes ATP and ADP to AMP; AMP is hydrolyzed by ecto-5'-nucleotidase (CD73) to adenosine, an anti-thrombotic and cardiovascular protective mediator. In this study, we developed a vector-based strategy for ablation of GGTA1 function and concurrent expression of human CD39 (hCD39). An hCD39 expression cassette was constructed to target exon 4 of GGTA1. We established heterozygous GGTA1 knock-out cell lines expressing hCD39 from pig ear fibroblasts for somatic cell nuclear transfer (SCNT). We also described production of heterozygous GGTA1 knock-out piglets expressing hCD39 and analyzed expression and function of the transgene. Human CD39 was expressed in heart, kidney and aorta. Human CD39 knock-in heterozygous ear fibroblast from transgenic cloned pigs, but not in non-transgenic pig's cells. Expression of GGTA1 gene was lower in the knock-in heterozygous ear fibroblast from transgenic pigs compared to the non-transgenic pig's cell. The peripheral blood mononuclear cells (PBMC) from the transgenic pigs were more resistant to lysis by pooled complement-preserved normal human serum than that from wild type (WT) pig. Accordingly, GGTA1 mutated piglets expressing hCD39 will provide a new organ source for xenotransplantation research.

  5. Loss of Bace2 in zebrafish affects melanocyte migration and is distinct from Bace1 knock out phenotypes.

    PubMed

    van Bebber, Frauke; Hruscha, Alexander; Willem, Michael; Schmid, Bettina; Haass, Christian

    2013-11-01

    Alzheimer's disease is the most frequent dementia. Pathologically, Alzheimer's disease is characterized by the accumulation of senile plaques composed of amyloid β-peptide (Aβ). Two proteases, β- and γ-secretase proteolytically generate Aβ from its precursor, the ß-amyloid precursor protein (APP). Inhibition of β-secretase, also referred to as beta-site APP cleaving enzyme (BACE1) or γ-secretase is therefore of prime interest for the development of amyloid-lowering drugs. To assess the in vivo function of zebrafish Bace1 (zBace1), we generated zBace1 knock out fish by zinc finger nuclease-mediated genome editing. bace1 mutants (bace1-/-) are hypomyelinated in the PNS while the CNS is not affected. Moreover, the number of mechanosensory neuromasts is elevated in bace1-/-. Mutations in zebrafish Bace2 (zBace2) revealed a distinct melanocyte migration phenotype, which is not observed in bace1-/-. Double homozygous bace1-/-; bace2-/- fish do not enhance the single mutant phenotypes indicating non-redundant distinct physiological functions. Single homozygous bace1 mutants as well as double homozygous bace1 and bace2 mutants are viable and fertile suggesting that Bace1 is a promising drug target without major side effects. The identification of a specific bace2 -/- associated phenotype further allows improving selective Bace1 inhibitors and to distinguish between Bace 1 and Bace 2 inhibition in vivo. Inhibition of BACE1 protease activity has therapeutic importance for Alzheimer's disease. Analysis of BACE1 and BACE2 knock-out zebrafish revealed that they exhibit distinct phenotypes. bace1 mutants display hypomyelination in the PNS and supernumerary neuromasts while in bace2 mutants the shape and migration of melanocytes is affected. These phenotypes are not further enhanced in the viable double mutants. Our data suggest that blocking BACE1 activity is a safe therapeutic approach.

  6. Mouse nuclear myosin I knock-out shows interchangeability and redundancy of myosin isoforms in the cell nucleus.

    PubMed

    Venit, Tomáš; Dzijak, Rastislav; Kalendová, Alžběta; Kahle, Michal; Rohožková, Jana; Schmidt, Volker; Rülicke, Thomas; Rathkolb, Birgit; Hans, Wolfgang; Bohla, Alexander; Eickelberg, Oliver; Stoeger, Tobias; Wolf, Eckhard; Yildirim, Ali Önder; Gailus-Durner, Valérie; Fuchs, Helmut; de Angelis, Martin Hrabě; Hozák, Pavel

    2013-01-01

    Nuclear myosin I (NM1) is a nuclear isoform of the well-known "cytoplasmic" Myosin 1c protein (Myo1c). Located on the 11(th) chromosome in mice, NM1 results from an alternative start of transcription of the Myo1c gene adding an extra 16 amino acids at the N-terminus. Previous studies revealed its roles in RNA Polymerase I and RNA Polymerase II transcription, chromatin remodeling, and chromosomal movements. Its nuclear localization signal is localized in the middle of the molecule and therefore directs both Myosin 1c isoforms to the nucleus. In order to trace specific functions of the NM1 isoform, we generated mice lacking the NM1 start codon without affecting the cytoplasmic Myo1c protein. Mutant mice were analyzed in a comprehensive phenotypic screen in cooperation with the German Mouse Clinic. Strikingly, no obvious phenotype related to previously described functions has been observed. However, we found minor changes in bone mineral density and the number and size of red blood cells in knock-out mice, which are most probably not related to previously described functions of NM1 in the nucleus. In Myo1c/NM1 depleted U2OS cells, the level of Pol I transcription was restored by overexpression of shRNA-resistant mouse Myo1c. Moreover, we found Myo1c interacting with Pol II. The ratio between Myo1c and NM1 proteins were similar in the nucleus and deletion of NM1 did not cause any compensatory overexpression of Myo1c protein. We observed that Myo1c can replace NM1 in its nuclear functions. Amount of both proteins is nearly equal and NM1 knock-out does not cause any compensatory overexpression of Myo1c. We therefore suggest that both isoforms can substitute each other in nuclear processes.

  7. Mouse Nuclear Myosin I Knock-Out Shows Interchangeability and Redundancy of Myosin Isoforms in the Cell Nucleus

    PubMed Central

    Venit, Tomáš; Dzijak, Rastislav; Kalendová, Alžběta; Kahle, Michal; Rohožková, Jana; Schmidt, Volker; Rülicke, Thomas; Rathkolb, Birgit; Hans, Wolfgang; Bohla, Alexander; Eickelberg, Oliver; Stoeger, Tobias; Wolf, Eckhard; Yildirim, Ali Önder; Gailus-Durner, Valérie; Fuchs, Helmut; de Angelis, Martin Hrabě; Hozák, Pavel

    2013-01-01

    Background Nuclear myosin I (NM1) is a nuclear isoform of the well-known “cytoplasmic” Myosin 1c protein (Myo1c). Located on the 11th chromosome in mice, NM1 results from an alternative start of transcription of the Myo1c gene adding an extra 16 amino acids at the N-terminus. Previous studies revealed its roles in RNA Polymerase I and RNA Polymerase II transcription, chromatin remodeling, and chromosomal movements. Its nuclear localization signal is localized in the middle of the molecule and therefore directs both Myosin 1c isoforms to the nucleus. Methodology/Principal Findings In order to trace specific functions of the NM1 isoform, we generated mice lacking the NM1 start codon without affecting the cytoplasmic Myo1c protein. Mutant mice were analyzed in a comprehensive phenotypic screen in cooperation with the German Mouse Clinic. Strikingly, no obvious phenotype related to previously described functions has been observed. However, we found minor changes in bone mineral density and the number and size of red blood cells in knock-out mice, which are most probably not related to previously described functions of NM1 in the nucleus. In Myo1c/NM1 depleted U2OS cells, the level of Pol I transcription was restored by overexpression of shRNA-resistant mouse Myo1c. Moreover, we found Myo1c interacting with Pol II. The ratio between Myo1c and NM1 proteins were similar in the nucleus and deletion of NM1 did not cause any compensatory overexpression of Myo1c protein. Conclusion/Significance We observed that Myo1c can replace NM1 in its nuclear functions. Amount of both proteins is nearly equal and NM1 knock-out does not cause any compensatory overexpression of Myo1c. We therefore suggest that both isoforms can substitute each other in nuclear processes. PMID:23593477

  8. Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

    SciTech Connect

    Malur, Anagha; Huizar, Isham; Wells, Greg; Barna, Barbara P.; Malur, Achut G.; Thomassen, Mary Jane

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Lentivirus-ABCG1 reduces lipid accumulation in lungs of GM-CSF knock-out mice. Black-Right-Pointing-Pointer Up-regulation of ABCG1 improves lung function. Black-Right-Pointing-Pointer Upregulation of ABCG1 improves surfactant metabolism. -- Abstract: We have shown decreased expression of the nuclear transcription factor, peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) and the PPAR{gamma}-regulated ATP-binding cassette transporter G1 (ABCG1) in alveolar macrophages from patients with pulmonary alveolar proteinosis (PAP). PAP patients also exhibit neutralizing antibodies to granulocyte-macrophage colony stimulating factor (GM-CSF), an upregulator of PPAR{gamma}. In association with functional GM-CSF deficiency, PAP lung is characterized by surfactant-filled alveolar spaces and lipid-filled alveolar macrophages. Similar pathology characterizes GM-CSF knock-out (KO) mice. We reported previously that intratracheal instillation of a lentivirus (lenti)-PPAR{gamma} plasmid into GM-CSF KO animals elevated ABCG1 and reduced alveolar macrophage lipid accumulation. Here, we hypothesized that instillation of lenti-ABCG1 might be sufficient to decrease lipid accumulation and improve pulmonary function in GM-CSF KO mice. Animals received intratracheal instillation of lenti-ABCG1 or control lenti-enhanced Green Fluorescent Protein (eGFP) plasmids and alveolar macrophages were harvested 10 days later. Alveolar macrophage transduction efficiency was 79% as shown by lenti-eGFP fluorescence. Quantitative PCR analyses indicated a threefold (p = 0.0005) increase in ABCG1 expression with no change of PPAR{gamma} or ABCA1 in alveolar macrophages of lenti-ABCG1 treated mice. ABCG1 was unchanged in control lenti-eGFP and PBS-instilled groups. Oil Red O staining detected reduced intracellular neutral lipid in alveolar macrophages from lenti-ABCG1 treated mice. Extracellular cholesterol and phospholipids were also decreased as shown by

  9. Selective Attention to Visual Stimuli Using Auditory Distractors Is Altered in Alpha-9 Nicotinic Receptor Subunit Knock-Out Mice.

    PubMed

    Terreros, Gonzalo; Jorratt, Pascal; Aedo, Cristian; Elgoyhen, Ana Belén; Delano, Paul H

    2016-07-06

    During selective attention, subjects voluntarily focus their cognitive resources on a specific stimulus while ignoring others. Top-down filtering of peripheral sensory responses by higher structures of the brain has been proposed as one of the mechanisms responsible for selective attention. A prerequisite to accomplish top-down modulation of the activity of peripheral structures is the presence of corticofugal pathways. The mammalian auditory efferent system is a unique neural network that originates in the auditory cortex and projects to the cochlear receptor through the olivocochlear bundle, and it has been proposed to function as a top-down filter of peripheral auditory responses during attention to cross-modal stimuli. However, to date, there is no conclusive evidence of the involvement of olivocochlear neurons in selective attention paradigms. Here, we trained wild-type and α-9 nicotinic receptor subunit knock-out (KO) mice, which lack cholinergic transmission between medial olivocochlear neurons and outer hair cells, in a two-choice visual discrimination task and studied the behavioral consequences of adding different types of auditory distractors. In addition, we evaluated the effects of contralateral noise on auditory nerve responses as a measure of the individual strength of the olivocochlear reflex. We demonstrate that KO mice have a reduced olivocochlear reflex strength and perform poorly in a visual selective attention paradigm. These results confirm that an intact medial olivocochlear transmission aids in ignoring auditory distraction during selective attention to visual stimuli. The auditory efferent system is a neural network that originates in the auditory cortex and projects to the cochlear receptor through the olivocochlear system. It has been proposed to function as a top-down filter of peripheral auditory responses during attention to cross-modal stimuli. However, to date, there is no conclusive evidence of the involvement of olivocochlear

  10. Tactile Defensiveness and Impaired Adaptation of Neuronal Activity in the Fmr1 Knock-Out Mouse Model of Autism.

    PubMed

    He, Cynthia X; Cantu, Daniel A; Mantri, Shilpa S; Zeiger, William A; Goel, Anubhuti; Portera-Cailliau, Carlos

    2017-07-05

    Sensory hypersensitivity is a common symptom in autism spectrum disorders (ASDs), including fragile X syndrome (FXS), and frequently leads to tactile defensiveness. In mouse models of ASDs, there is mounting evidence of neuronal and circuit hyperexcitability in several brain regions, which could contribute to sensory hypersensitivity. However, it is not yet known whether or how sensory stimulation might trigger abnormal sensory processing at the circuit level or abnormal behavioral responses in ASD mouse models, especially during an early developmental time when experience-dependent plasticity shapes such circuits. Using a novel assay, we discovered exaggerated motor responses to whisker stimulation in young Fmr1 knock-out (KO) mice (postnatal days 14-16), a model of FXS. Adult Fmr1 KO mice actively avoided a stimulus that was innocuous to wild-type controls, a sign of tactile defensiveness. Using in vivo two-photon calcium imaging of layer 2/3 barrel cortex neurons expressing GCaMP6s, we found no differences between wild-type and Fmr1 KO mice in overall whisker-evoked activity, though 45% fewer neurons in young Fmr1 KO mice responded in a time-locked manner. Notably, we identified a pronounced deficit in neuronal adaptation to repetitive whisker stimulation in both young and adult Fmr1 KO mice. Thus, impaired adaptation in cortical sensory circuits is a potential cause of tactile defensiveness in autism.SIGNIFICANCE STATEMENT We use a novel paradigm of repetitive whisker stimulation and in vivo calcium imaging to assess tactile defensiveness and barrel cortex activity in young and adult Fmr1 knock-out mice, the mouse model of fragile X syndrome (FXS). We describe evidence of tactile defensiveness, as well as a lack of L2/3 neuronal adaptation in barrel cortex, during whisker stimulation. We propose that a defect in sensory adaptation within local neuronal networks, beginning at a young age and continuing into adulthood, likely contributes to sensory overreactivity

  11. Pantothenate kinase-associated neurodegeneration: altered mitochondria membrane potential and defective respiration in Pank2 knock-out mouse model.

    PubMed

    Brunetti, Dario; Dusi, Sabrina; Morbin, Michela; Uggetti, Andrea; Moda, Fabio; D'Amato, Ilaria; Giordano, Carla; d'Amati, Giulia; Cozzi, Anna; Levi, Sonia; Hayflick, Susan; Tiranti, Valeria

    2012-12-15

    Neurodegeneration with brain iron accumulation (NBIA) comprises a group of neurodegenerative disorders characterized by high brain content of iron and presence of axonal spheroids. Mutations in the PANK2 gene, which encodes pantothenate kinase 2, underlie an autosomal recessive inborn error of coenzyme A metabolism, called pantothenate kinase-associated neurodegeneration (PKAN). PKAN is characterized by dystonia, dysarthria, rigidity and pigmentary retinal degeneration. The pathogenesis of this disorder is poorly understood and, although PANK2 is a mitochondrial protein, perturbations in mitochondrial bioenergetics have not been reported. A knock-out (KO) mouse model of PKAN exhibits retinal degeneration and azoospermia, but lacks any neurological phenotype. The absence of a clinical phenotype has partially been explained by the different cellular localization of the human and murine PANK2 proteins. Here we demonstrate that the mouse Pank2 protein localizes to mitochondria, similar to its human orthologue. Moreover, we show that Pank2-defective neurons derived from KO mice have an altered mitochondrial membrane potential, a defect further corroborated by the observations of swollen mitochondria at the ultra-structural level and by the presence of defective respiration.

  12. Pantothenate kinase-associated neurodegeneration: altered mitochondria membrane potential and defective respiration in Pank2 knock-out mouse model

    PubMed Central

    Brunetti, Dario; Dusi, Sabrina; Morbin, Michela; Uggetti, Andrea; Moda, Fabio; D'Amato, Ilaria; Giordano, Carla; d'Amati, Giulia; Cozzi, Anna; Levi, Sonia; Hayflick, Susan; Tiranti, Valeria

    2012-01-01

    Neurodegeneration with brain iron accumulation (NBIA) comprises a group of neurodegenerative disorders characterized by high brain content of iron and presence of axonal spheroids. Mutations in the PANK2 gene, which encodes pantothenate kinase 2, underlie an autosomal recessive inborn error of coenzyme A metabolism, called pantothenate kinase-associated neurodegeneration (PKAN). PKAN is characterized by dystonia, dysarthria, rigidity and pigmentary retinal degeneration. The pathogenesis of this disorder is poorly understood and, although PANK2 is a mitochondrial protein, perturbations in mitochondrial bioenergetics have not been reported. A knock-out (KO) mouse model of PKAN exhibits retinal degeneration and azoospermia, but lacks any neurological phenotype. The absence of a clinical phenotype has partially been explained by the different cellular localization of the human and murine PANK2 proteins. Here we demonstrate that the mouse Pank2 protein localizes to mitochondria, similar to its human orthologue. Moreover, we show that Pank2-defective neurons derived from KO mice have an altered mitochondrial membrane potential, a defect further corroborated by the observations of swollen mitochondria at the ultra-structural level and by the presence of defective respiration. PMID:22983956

  13. Enhancement in colonization of bovine spermatogonial stem cells following addition of knock-out serum replacement to culture medium

    PubMed Central

    Youssefi, Reza; Tajik, Parviz; Movahedin, Mansoureh; Akbarinejad, Vahid

    2016-01-01

    Enrichment of cell suspension with germ cells prior to injection into recipient seminiferous tubules is of importance in spermatogonial stem cells (SSCs) transplantation. Knock-out serum replacement (KSR) has been reported to enhance the proliferation of murine SSCs and human embryonic stem cells. The aim of the present study was to investigate the effect of KSR versus fetal bovine serum (FBS) and their interaction on colonization of bovine SSCs in vitro. When FBS (10%) was replaced with KSR (10%), a significant increase in the colonization of SSCs and the expression of Thy1, as marker for enrichment of SSCs, was observed. It was revealed that the lesser proliferative effect of FBS as well as the greater proliferative impact of KSR on SSCs colonization were not irreversible as cells having been cultured with FBS (10%) for three days with low colonization showed high rate of colonization in response to KSR (10%) and cells having been cultured with KSR (10%) with high colonization experienced low rate of colonization in response to FBS (10%). Further, it was shown that FBS did not contain factors inhibiting SSCs colonization and it simply lacked factors essential for SSCs proliferation because the combination of FBS (5%) and KSR (5%) resulted in even greater rate of colonization than did KSR (10%). In conclusion, the present study showed that addition of KSR to culture medium would significantly increase SSCs proliferation. PMID:28144417

  14. Ammonia excretion in Caenorhabditis elegans: Physiological and molecular characterization of the rhr-2 knock-out mutant.

    PubMed

    Adlimoghaddam, Aida; O'Donnell, Michael J; Kormish, Jay; Banh, Sheena; Treberg, Jason R; Merz, David; Weihrauch, Dirk

    2016-05-01

    Previous studies have shown the free living soil nematode Caenorhabditis elegans (N2 strain) to be ammonotelic. Ammonia excretion was suggested to take place partially via the hypodermis, involving the Na(+)/K(+)-ATPase (NKA), V-ATPase (VAT), carbonic anhydrase, NHX-3 and a functional microtubule network and at least one Rh-like ammonia transporter RHR-1. In the current study, we show that a second Rh-protein, RHR-2, is highly expressed in the hypodermis, here also in the apical membrane of that tissue. To further characterize the role of RHR-2 in ammonia excretion, a knock-out mutant rhr-2 (ok403), further referred to as ∆rhr-2, was employed. Compared to wild-type worms (N2), this mutant showed a lower rate of ammonia excretion and a lower hypodermal H(+) excretion rate. At the same time rhr-1, nka, vat, and nhx-3 showed higher mRNA expression levels when compared to N2. Also, in contrast to N2 worms, ∆rhr-2 did not show enhanced ammonia excretion rates when exposed to a low pH environment, suggesting that RHR-2 represents the apical NH3 pathway that allows ammonia trapping via the hypodermis in N2 worms. A hypothetical model for the mechanism of hypodermal ammonia excretion is proposed on the basis of data in this and previous investigations. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Enhancement in colonization of bovine spermatogonial stem cells following addition of knock-out serum replacement to culture medium.

    PubMed

    Youssefi, Reza; Tajik, Parviz; Movahedin, Mansoureh; Akbarinejad, Vahid

    2016-01-01

    Enrichment of cell suspension with germ cells prior to injection into recipient seminiferous tubules is of importance in spermatogonial stem cells (SSCs) transplantation. Knock-out serum replacement (KSR) has been reported to enhance the proliferation of murine SSCs and human embryonic stem cells. The aim of the present study was to investigate the effect of KSR versus fetal bovine serum (FBS) and their interaction on colonization of bovine SSCs in vitro. When FBS (10%) was replaced with KSR (10%), a significant increase in the colonization of SSCs and the expression of Thy1, as marker for enrichment of SSCs, was observed. It was revealed that the lesser proliferative effect of FBS as well as the greater proliferative impact of KSR on SSCs colonization were not irreversible as cells having been cultured with FBS (10%) for three days with low colonization showed high rate of colonization in response to KSR (10%) and cells having been cultured with KSR (10%) with high colonization experienced low rate of colonization in response to FBS (10%). Further, it was shown that FBS did not contain factors inhibiting SSCs colonization and it simply lacked factors essential for SSCs proliferation because the combination of FBS (5%) and KSR (5%) resulted in even greater rate of colonization than did KSR (10%). In conclusion, the present study showed that addition of KSR to culture medium would significantly increase SSCs proliferation.

  16. [Role of elastin in the development of vascular function. Knock-out study of the elastin gene in mice].

    PubMed

    Faury, G

    2001-01-01

    The elastic fibres endow extensible tissues with resiliency, such as in blood vessels, heart, skin and lung. Elastic fibres are made of microfibrils, and mainly elastin (90%) which provides the fibre with elasticity. Beside the biomechanical role of elastin, a close correlation between elastin and elastic fibre network disorganisation and vascular smooth muscle cell (VSMC) growth disregulation has been known for several years through the description and study of several human or animal polyfeatured or obstructive vascular diseases, such as supravalvular aortic stenosis (SVAS) and Williams syndrome (WS), both related to heterozygous mutations or deletion in the elastin gene. The study of mice knock-out for the elastin gene (homozygous or heterozygous) leads to think that elastin should now be seen as an important elastic component providing extensible tissues with resiliency, as well as a major developmental regulator of VSMC life cycle and smooth muscle tissue organisation. Further developments in the area of preventive therapy of SVAS, WS or other inherited muscular disorders are likely to arise from these results.

  17. Prolonged Starvation Causes Up-Regulation of AQP1 in Adipose Tissue Capillaries of AQP7 Knock-Out Mice

    PubMed Central

    Skowronski, Mariusz T.; Skowronska, Agnieszka; Rojek, Aleksandra; Oklinski, Michal K.; Nielsen, Søren

    2016-01-01

    Aquaporins (AQPs) are membrane proteins involved in the regulation of cellular transport and the balance of water and glycerol and cell volume in the white adipose tissue (WAT). In our previous study, we found the co-expression of the AQP1 water channel and AQP7 in the mouse WAT. In our present study, we aimed to find out whether prolonged starvation influences the AQP1 expression of AQP7 knock-out mice (AQP7 KO) in the WAT. To resolve this hypothesis, immunoperoxidase, immunoblot and immunogold microscopy were used. AQP1 expression was found with the use of immunohistochemistry and was confirmed by immunogold microscopy in the vessels of mouse WAT of all studied groups. Semi-quantitative immunoblot and quantitative immunogold microscopy showed a significant increase (by 2.5- to 3-fold) in the abundance of AQP1 protein expression in WAT in the 72 h starved AQP7 KO mice as compared to AQP7+/+ (p < 0.05) and AQP7−/− (p < 0.01) controls, respectively. In conclusion, the AQP1 water channel located in the vessels of WAT is up-regulated in response to prolonged starvation in the WAT of AQP7 KO mice. The present data suggest that an interaction of different AQP isoforms is required for maintaining proper water homeostasis within the mice WAT. PMID:27455244

  18. 1,3-propanediol production with Citrobacter werkmanii DSM17579: effect of a dhaD knock-out

    PubMed Central

    2014-01-01

    Background 1,3-propanediol (PDO) is a substantially industrial metabolite used in the polymer industry. Although several natural PDO production hosts exist, e.g. Klebsiella sp., Citrobacter sp. and Clostridium sp., the PDO yield on glycerol is insufficient for an economically viable bio-process. Enhancing this yield via strain improvement can be achieved by disconnecting the production and growth pathways. In the case of PDO formation, this approach results in a microorganism metabolizing glycerol strictly for PDO production, while catabolizing a co-substrate for growth and maintenance. We applied this strategy to improve the PDO production with Citrobacter werkmanii DSM17579. Results Genetic tools were developed and used to create Citrobacter werkmanii DSM17579 ∆dhaD in which dhaD, encoding for glycerol dehydrogenase, was deleted. Since this strain was unable to grow on glycerol anaerobically, both pathways were disconnected. The knock-out strain was perturbed with 13 different co-substrates for growth and maintenance. Glucose was the most promising, although a competition between NADH-consuming enzymes and 1,3-propanediol dehydrogenase emerged. Conclusion Due to the deletion of dhaD in Citrobacter werkmanii DSM17579, the PDO production and growth pathway were split. As a consequence, the PDO yield on glycerol was improved 1,5 times, strengthening the idea that Citrobacter werkmanii DSM17579 could become an industrially interesting host for PDO production. PMID:24885849

  19. Reconstructing gene regulatory networks from knock-out data using Gaussian Noise Model and Pearson Correlation Coefficient.

    PubMed

    Mohamed Salleh, Faridah Hani; Arif, Shereena Mohd; Zainudin, Suhaila; Firdaus-Raih, Mohd

    2015-12-01

    A gene regulatory network (GRN) is a large and complex network consisting of interacting elements that, over time, affect each other's state. The dynamics of complex gene regulatory processes are difficult to understand using intuitive approaches alone. To overcome this problem, we propose an algorithm for inferring the regulatory interactions from knock-out data using a Gaussian model combines with Pearson Correlation Coefficient (PCC). There are several problems relating to GRN construction that have been outlined in this paper. We demonstrated the ability of our proposed method to (1) predict the presence of regulatory interactions between genes, (2) their directionality and (3) their states (activation or suppression). The algorithm was applied to network sizes of 10 and 50 genes from DREAM3 datasets and network sizes of 10 from DREAM4 datasets. The predicted networks were evaluated based on AUROC and AUPR. We discovered that high false positive values were generated by our GRN prediction methods because the indirect regulations have been wrongly predicted as true relationships. We achieved satisfactory results as the majority of sub-networks achieved AUROC values above 0.5. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. The Phospholipase D2 Knock Out Mouse Has Ectopic Purkinje Cells and Suffers from Early Adult-Onset Anosmia

    PubMed Central

    Zhang, Qifeng; Smethurst, Elizabeth; Segonds-Pichon, Anne; Schrewe, Heinrich; Wakelam, Michael J. O.

    2016-01-01

    Phospholipase D2 (PLD2) is an enzyme that produces phosphatidic acid (PA), a lipid messenger molecule involved in a number of cellular events including, through its membrane curvature properties, endocytosis. The PLD2 knock out (PLD2KO) mouse has been previously reported to be protected from insult in a model of Alzheimer's disease. We have further analysed a PLD2KO mouse using mass spectrophotometry of its lipids and found significant differences in PA species throughout its brain. We have examined the expression pattern of PLD2 which allowed us to define which region of the brain to analyse for defect, notably PLD2 was not detected in glial-rich regions. The expression pattern lead us to specifically examine the mitral cells of olfactory bulbs, the Cornus Amonis (CA) regions of the hippocampus and the Purkinje cells of the cerebellum. We find that the change to longer PA species correlates with subtle architectural defect in the cerebellum, exemplified by ectopic Purkinje cells and an adult-onset deficit of olfaction. These observations draw parallels to defects in the reelin heterozygote as well as the effect of high fat diet on olfaction. PMID:27658289

  1. Analysis of knock-out mice to determine the role of HPC-1/syntaxin 1A in expressing synaptic plasticity.

    PubMed

    Fujiwara, Tomonori; Mishima, Tatsuya; Kofuji, Takefumi; Chiba, Tomoki; Tanaka, Keiji; Yamamoto, Akitsugu; Akagawa, Kimio

    2006-05-24

    The protein HPC-1/syntaxin 1A is abundantly expressed in neurons and localized in the neuronal plasma membrane. It forms a complex with SNAP-25 (25 kDa synaptosomal-associated protein) and VAMP-2 (vesicle-associated membrane protein)/synaptobrevin called SNARE (a soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptor) complex, which is considered essential for synaptic vesicle exocytosis; thus, HPC-1/syntaxin 1A is considered crucial for synaptic transmission. To examine the physiological function of HPC-1/syntaxin 1A in vivo, we produced knock-out (KO) mice by targeted gene disruption. Although HPC-1/syntaxin 1A expression was completely depleted without any effect on the expression of other SNARE proteins, the KO mice were viable. They grew normally, were fertile, and displayed no difference in appearance compared with control littermate. In cultured hippocampal neurons derived from the KO mice, the basic synaptic transmission in vitro was normal. However, the mutant mice had impaired long-term potentiation in the hippocampal slice. Also, although KO mice exhibited normal spatial memory in the hidden platform test, consolidation of conditioned fear memory was impaired. Interestingly, the KO mice had impaired conditioned fear memory extinction. These observations suggest that HPC-1/syntaxin 1A may be closely related to synaptic plasticity.

  2. Adenoviral gene therapy of the Tay-Sachs disease in hexosaminidase A-deficient knock-out mice.

    PubMed

    Guidotti, J E; Mignon, A; Haase, G; Caillaud, C; McDonell, N; Kahn, A; Poenaru, L

    1999-05-01

    The severe neurodegenerative disorder, Tays-Sachs disease, is caused by a beta-hexosaminidase alpha-subunit deficiency which prevents the formation of lysosomal heterodimeric alpha-beta enzyme, hexosaminidase A (HexA). No treatment is available for this fatal disease; however, gene therapy could represent a therapeutic approach. We previously have constructed and characterized, in vitro, adenoviral and retroviral vectors coding for alpha- and beta-subunits of the human beta-hexosaminidases. Here, we have determined the in vivo strategy which leads to the highest HexA activity in the maximum number of tissues in hexA -deficient knock-out mice. We demonstrated that intravenous co-administration of adenoviral vectors coding for both alpha- and beta-subunits, resulting in preferential liver transduction, was essential to obtain the most successful results. Only the supply of both subunits allowed for HexA overexpression leading to massive secretion of the enzyme in serum, and full or partial enzymatic activity restoration in all peripheral tissues tested. The enzymatic correction was likely to be due to direct cellular transduction by adenoviral vectors and/or uptake of secreted HexA by different organs. These results confirmed that the liver was the preferential target organ to deliver a large amount of secreted proteins. In addition, the need to overexpress both subunits of heterodimeric proteins in order to obtain a high level of secretion in animals defective in only one subunit is emphasized. The endogenous non-defective subunit is otherwise limiting.

  3. Behavioral Phenotype of Fmr1 Knock-Out Mice during Active Phase in an Altered Light/Dark Cycle.

    PubMed

    Saré, R Michelle; Levine, Merlin; Smith, Carolyn Beebe

    2016-01-01

    Fragile X syndrome (FXS) is the most commonly inherited form of intellectual disability and is a disorder that is also highly associated with autism. FXS occurs as a result of an expanded CGG repeat sequence leading to transcriptional silencing. In an animal model of FXS in which Fmr1 is knocked out (Fmr1 KO), many physical, physiological, and behavioral characteristics of the human disease are recapitulated. Prior characterization of the mouse model was conducted during the day, the inactive phase of the circadian cycle. Circadian rhythms are an important contributor to behavior and may play a role in the study of disease phenotype. Moreover, changes in the parameters of circadian rhythm are known to occur in FXS animal models. We conducted an investigation of key behavioral phenotypes in Fmr1 KO mice during their active phase. We report that phase did not alter the Fmr1 KO phenotype in open field activity, anxiety, and learning and memory. There was a slight effect of phase on social behavior as measured by time in chamber, but not by time spent sniffing. Our data strengthen the existing data characterizing the phenotype of Fmr1 KO mice, indicating that it is independent of circadian phase.

  4. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system.

    PubMed

    Guo, Rihong; Wan, Yongjie; Xu, Dan; Cui, Libin; Deng, Mingtian; Zhang, Guomin; Jia, Ruoxin; Zhou, Wenjun; Wang, Zhen; Deng, Kaiping; Huang, Mingrui; Wang, Feng; Zhang, Yanli

    2016-07-15

    Myostatin (Mstn) is a conserved negative regulator of skeletal muscle mass in mammals. However, whether precise disruption of Mstn in livestock can be achieved and safely used to improve meat productivity has not been proven. We applied CRISPR/Cas9 system to generate Mstn knock-out (KO) rabbits and goats and then analyzed the changes in their phenotypes to answer this question. We efficiently generated 24 Mstn KO rabbits out of 32 newborn infants after embryo injection with two sgRNAs targeting rabbit Mstn, and found that the Mstn KO rabbits exhibited increased birthweight and a significantly increase in the weight ratios of the quadriceps and biceps muscles to the whole body. Mstn KO also caused high probability of enlarged tongue phenomenon and severe health problems such as stillbirth and early stage death. Using the same method, one out of four goats was generated with edition at Mstn locus. The early stage growth rate of this goat outperformed the control goats. In conclusion, we efficiently generated Mstn KO rabbits and goats using CRISPR/Cas9 technology. However, Mstn KO causes severe health problems and may also have the same effects on other species. This safety issue must be studied further before applied to animal reproduction processes.

  5. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system

    PubMed Central

    Guo, Rihong; Wan, Yongjie; Xu, Dan; Cui, Libin; Deng, Mingtian; Zhang, Guomin; Jia, Ruoxin; Zhou, Wenjun; Wang, Zhen; Deng, Kaiping; Huang, Mingrui; Wang, Feng; Zhang, Yanli

    2016-01-01

    Myostatin (Mstn) is a conserved negative regulator of skeletal muscle mass in mammals. However, whether precise disruption of Mstn in livestock can be achieved and safely used to improve meat productivity has not been proven. We applied CRISPR/Cas9 system to generate Mstn knock-out (KO) rabbits and goats and then analyzed the changes in their phenotypes to answer this question. We efficiently generated 24 Mstn KO rabbits out of 32 newborn infants after embryo injection with two sgRNAs targeting rabbit Mstn, and found that the Mstn KO rabbits exhibited increased birthweight and a significantly increase in the weight ratios of the quadriceps and biceps muscles to the whole body. Mstn KO also caused high probability of enlarged tongue phenomenon and severe health problems such as stillbirth and early stage death. Using the same method, one out of four goats was generated with edition at Mstn locus. The early stage growth rate of this goat outperformed the control goats. In conclusion, we efficiently generated Mstn KO rabbits and goats using CRISPR/Cas9 technology. However, Mstn KO causes severe health problems and may also have the same effects on other species. This safety issue must be studied further before applied to animal reproduction processes. PMID:27417210

  6. Impaired glucose tolerance and predisposition to the fasted state in liver glycogen synthase knock-out mice.

    PubMed

    Irimia, Jose M; Meyer, Catalina M; Peper, Caron L; Zhai, Lanmin; Bock, Cheryl B; Previs, Stephen F; McGuinness, Owen P; DePaoli-Roach, Anna; Roach, Peter J

    2010-04-23

    Conversion to glycogen is a major fate of ingested glucose in the body. A rate-limiting enzyme in the synthesis of glycogen is glycogen synthase encoded by two genes, GYS1, expressed in muscle and other tissues, and GYS2, primarily expressed in liver (liver glycogen synthase). Defects in GYS2 cause the inherited monogenic disease glycogen storage disease 0. We have generated mice with a liver-specific disruption of the Gys2 gene (liver glycogen synthase knock-out (LGSKO) mice), using Lox-P/Cre technology. Conditional mice carrying floxed Gys2 were crossed with mice expressing Cre recombinase under the albumin promoter. The resulting LGSKO mice are viable, develop liver glycogen synthase deficiency, and have a 95% reduction in fed liver glycogen content. They have mild hypoglycemia but dispose glucose less well in a glucose tolerance test. Fed, LGSKO mice also have a reduced capacity for exhaustive exercise compared with mice carrying floxed alleles, but the difference disappears after an overnight fast. Upon fasting, LGSKO mice reach within 4 h decreased blood glucose levels attained by control floxed mice only after 24 h of food deprivation. The LGSKO mice maintain this low blood glucose for at least 24 h. Basal gluconeogenesis is increased in LGSKO mice, and insulin suppression of endogenous glucose production is impaired as assessed by euglycemic-hyperinsulinemic clamp. This observation correlates with an increase in the liver gluconeogenic enzyme phosphoenolpyruvate carboxykinase expression and activity. This mouse model mimics the pathophysiology of glycogen storage disease 0 patients and highlights the importance of liver glycogen stores in whole body glucose homeostasis.

  7. CHO cells knocked out for TSC2 display an improved productivity of antibodies under fed batch conditions.

    PubMed

    McVey, Duncan; Aronov, Michael; Rizzi, Giovanni; Cowan, Alexis; Scott, Charo; Megill, John; Russell, Reb; Tirosh, Boaz

    2016-09-01

    The kinase mTOR operates in two cellular complexes, mTORC1 and mTORC2. mTORC1 adjusts metabolic activity according to external growth conditions and nutrients availability. When conditions are prosperous, mTOR facilitates protein and lipid biosyntheses and inhibits autophagy, while under metabolic constraints, however, its attenuation induces a catabolic program, energy preservation and autophagy. CHO is a key cell line for manufacturing of biologics owing to its remarkable ability to grow to high densities and maintain protein production and secretion for extended times. While high mTOR activity has been associated with high productivity in CHO cells, its inhibition by rapamycin has also been documented to augment productivity via promotion of viability. Here using CRISPR/Cas9 editing we engineered CHO cells to enforce high mTORC1 activity by knocking-out TSC2, a major mTOR inhibitory protein, or PTEN, a phosphatase that attenuates the PI3K/AKT/mTOR pathway. Only TSC2-deleted cells exhibited a constitutive activation of mTORC1 under fed batch conditions. Cells grew larger in size, synthesized more proteins and displayed an over twofold elevation in their specific productivity. While peak viable cell density was compromised, overall titers increased to an extent dependent upon the parental clone. Our data underscore manipulation of TSC as a strategy to improve performance of CHO cell in bioreactors. Biotechnol. Bioeng. 2016;113: 1942-1952. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Orexin/hypocretin and histamine: distinct roles in the control of wakefulness demonstrated using knock-out mouse models.

    PubMed

    Anaclet, Christelle; Parmentier, Régis; Ouk, Koliane; Guidon, Gérard; Buda, Colette; Sastre, Jean-Pierre; Akaoka, Hidéo; Sergeeva, Olga A; Yanagisawa, Masashi; Ohtsu, Hiroshi; Franco, Patricia; Haas, Helmut L; Lin, Jian-Sheng

    2009-11-18

    To determine the respective role played by orexin/hypocretin and histamine (HA) neurons in maintaining wakefulness (W), we characterized the behavioral and sleep-wake phenotypes of orexin (Ox) knock-out (-/-) mice and compared them with those of histidine-decarboxylase (HDC, HA-synthesizing enzyme)-/- mice. While both mouse strains displayed sleep fragmentation and increased paradoxical sleep (PS), they presented a number of marked differences: (1) the PS increase in HDC(-/-) mice was seen during lightness, whereas that in Ox(-/-) mice occurred during darkness; (2) contrary to HDC(-/-), Ox(-/-) mice had no W deficiency around lights-off, nor an abnormal EEG and responded to a new environment with increased W; (3) only Ox(-/-), but not HDC(-/-) mice, displayed narcolepsy and deficient W when faced with motor challenge. Thus, when placed on a wheel, wild-type (WT), but not littermate Ox(-/-) mice, voluntarily spent their time in turning it and as a result, remained highly awake; this was accompanied by dense c-fos expression in many areas of their brains, including Ox neurons in the dorsolateral hypothalamus. The W and motor deficiency of Ox(-/-) mice was due to the absence of Ox because intraventricular dosing of orexin-A restored their W amount and motor performance whereas SB-334867 (Ox1-receptor antagonist, i.p.) impaired W and locomotion of WT mice during the test. These data indicate that Ox, but not HA, promotes W through enhanced locomotion and suggest that HA and Ox neurons exert a distinct, but complementary and synergistic control of W: the neuropeptide being more involved in its behavioral aspects, whereas the amine is mainly responsible for its qualitative cognitive aspects and cortical EEG activation.

  9. Three-dimensional reconstruction of efferent ducts in wild-type and Lgr4 knock-out mice.

    PubMed

    Lambot, Marie-Alexandra H; Mendive, Fernando; Laurent, Patrick; Van Schoore, Gregory; Noël, Jean-Christophe; Vanderhaeghen, Pierre; Vassart, Gilbert

    2009-04-01

    We have recently shown that Lgr4 knock-out (LGR4KO) male mice are infertile due to a developmental defect of the reproductive tract. Spermatozoa do not reach the epididymis and accumulate at the rete testis and efferent ducts (ED). We have proposed that in LGR4KO, ED might fail to connect resulting in blind-ended tubes that preclude the normal transit of sperm cells. To explore this possibility, we reconstructed the three-dimensional (3D) structure of the organ from serial microphotographs. The resulting model allowed to individualize and follow each ED from the testis up to the epididymis, and to display the spatial distribution of their content. The transit of spermatozoa is indeed blocked in LGR4KO mice but, contrary to the expectation, the ducts connect normally to each other, forming a single tube that flows into the epididymis, as in the wild-type animals. In the KO however, transit of the sperm is abruptly blocked at the same level syncytial-like aggregates appear in the luminal space. The model also allowed calculating, for the first time, morphometric parameters of the mouse ED, such as total volume, surface, radius, and length. These data unambiguously showed that ED in the mutant mouse are dramatically shortened and less convoluted than in the wild-type animal, providing an explanation to the phenotype observed in LGR4KO. Combined with in situ immunodetection or RNA in situ hybridization, 3D reconstruction of serial histological sections will provide an efficient mean to study expression profiles in organs which do not lend themselves to whole-mount studies.

  10. T cell responses in mammalian diaphanous-related formin mDia1 knock-out mice.

    PubMed

    Eisenmann, Kathryn M; West, Richard A; Hildebrand, Dagmar; Kitchen, Susan M; Peng, Jun; Sigler, Robert; Zhang, Jinyi; Siminovitch, Katherine A; Alberts, Arthur S

    2007-08-24

    Activated T cells rapidly assemble filamentous (F-) actin networks in response to ligation of the T cell receptor or upon interaction with adhesive stimuli in order to facilitate cell migration and the formation of the immune synapse. Branched filament assembly is crucial for this process and is dependent upon activation of the Arp2/3 complex by the actin nucleation-promoting factor Wiskott-Aldrich Syndrome protein (WASp). Genetic disruption of the WAS gene has been linked to hematopoietic malignancies and various cytopenias. Although the contributions of WASp and Arp2/3 to T cell responses are fairly well characterized, the role of the mammalian Diaphanous (mDia)-related formins, which both nucleate and processively elongate non-branched F-actin, has not been demonstrated. Here, we report the effects on T cell development and function following the knock out of the murine Drf1 gene encoding the canonical formin p140mDia1. Drf1(-/-) mice develop lymphopenia characterized by diminished T cell populations in lymphoid tissues. Consistent with a role for p140mDia1 in the regulation of the actin cytoskeleton, isolated Drf1(-/-) splenic T cells adhered poorly to extracellular matrix proteins and migration in response to chemotactic stimuli was completely abrogated. Both integrin and chemokine receptor expression was unaffected by Drf1(-/-) targeting. In response to proliferative stimuli, both thymic and splenic Drf1(-/-) T cells failed to proliferate; ERK1/2 activation was also diminished in activated Drf1(-/-) T cells. These data suggest a central role for p140mDia1 in vivo in dynamic cytoskeletal remodeling events driving normal T cell responses.

  11. Life-long norepinephrine transporter (NET) knock-out leads to the increase in the NET mRNA in brain regions rich in norepinephrine terminals.

    PubMed

    Solich, Joanna; Kolasa, Magdalena; Kusmider, Maciej; Pabian, Paulina; Faron-Gorecka, Agata; Zurawek, Dariusz; Szafran-Pilch, Kinga; Kedracka-Krok, Sylwia; Jankowska, Urszula; Swiderska, Bianka; Dziedzicka-Wasylewska, Marta

    2015-08-01

    These studies aimed to identify the genes differentially expressed in the frontal cortex of mice bearing a life-long norepinephrine transporter knock-out (NET-KO) and wild-type animals (WT). Differences in gene expression in the mouse frontal cortex were studied using a whole-genome microarray approach. Using an alternative approach, i.e. RT-PCR (reverse transcription polymerase chain reaction) with primers complementary to various exons of the NET gene, as well as TaqMan arrays, the level of mRNA encoding the NET in other brain regions of the NET-KO mice was also examined. The analyses revealed a group of 92 transcripts (27 genes) that differentiated the NET-KO mice from the WT mice. Surprisingly, the studies have shown that the mRNA encoding NET accumulated in the brain regions rich in norepinephrine nerve endings in the NET-KO mice. Because there is no other source of NET mRNA besides the noradrenergic terminals in the brain regions studied, these results might speak in favor of the presence of mRNA in axon terminals. RNA-Binding Protein Immunoprecipitation approach indicated that mRNA encoding NET was detected in the Ago2 protein/mRNA complex. In addition, the amount of Ago2 protein in the frontal cortex was significantly higher in NET-KO mice as compared with that of the WT animals. These results are important for further characterization of the NET-KO mice, which - besides other merits - might serve as a good model to study the fate of truncated mRNA in neurons.

  12. Gene expression and mRNA editing of serotonin receptor 2C in brains of HPRT gene knock-out mice, an animal model of Lesch-Nyhan disease

    PubMed Central

    Bertelli, Matteo; Alushi, Brunilda; Veicsteinas, Arsenio; Jinnah, H.A.; Micheli, Vanna

    2016-01-01

    Lesch-Nyhan disease (LND), a genetic disorder associated with motor and psychiatric disturbance and self-injurious behaviour (SIB) is caused by a complete deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT). The connection between enzyme deficiency and neurological involvement is still unclear. Evidence exists for a role of basal ganglia dysfunction with decreased dopamine and excess serotonin striatal content. In this study, we investigate the role of serotonin receptor 2C (HTR2C) in the brains of HPRT gene knock-out mice, a model of LND. HTR2C expression is analyzed by real-time polymerase chain reaction (PCR) using SYBR-green detection methods. The percentage of edited HTR2C mRNA was determined by direct sequencing of amplification products of the region containing the editing sites. We found a 55% increase in the expression of HTR2C gene but no significant difference in mRNA editing levels between knock-out and control mice. The above alteration found in HPRT-deficient mice is similar to those found in other animal models used to study aggressive and self-injurious behaviour. PMID:19473847

  13. 2-Methyl-6-(phenylethynyl) pyridine (MPEP) reverses maze learning and PSD-95 deficits in Fmr1 knock-out mice

    PubMed Central

    Gandhi, Réno M.; Kogan, Cary S.; Messier, Claude

    2014-01-01

    Fragile X Syndrome (FXS) is caused by the lack of expression of the fragile X mental retardation protein (FMRP), which results in intellectual disability and other debilitating symptoms including impairment of visual-spatial functioning. FXS is the only single-gene disorder that is highly co-morbid with autism spectrum disorder and can therefore provide insight into its pathophysiology. Lack of FMRP results in altered group I metabotropic glutamate receptor (mGluR) signaling, which is a target for putative treatments. The Hebb-Williams (H-W) mazes are a set of increasingly complex spatial navigation problems that depend on intact hippocampal and thus mGluR-5 functioning. In the present investigation, we examined whether an antagonist of mGluR-5 would reverse previously described behavioral deficits in fragile X mental retardation 1 knock-out (Fmr1 KO) mice. Mice were trained on a subset of the H-W mazes and then treated with either 20 mg/kg of an mGluR-5 antagonist, 2-Methyl-6-(phenylethynyl) pyridine (MPEP; n = 11) or an equivalent dose of saline (n = 11) prior to running test mazes. Latency and errors were dependent variables recorded during the test phase. Immediately after completing each test, marble-burying behavior was assessed, which confirmed that the drug treatment was pharmacologically active during maze learning. Although latency was not statistically different between the groups, MPEP treated Fmr1 KO mice made significantly fewer errors on mazes deemed more difficult suggesting a reversal of the behavioral deficit. MPEP treated mice were also less perseverative and impulsive when navigating mazes. Furthermore, MPEP treatment reversed post-synaptic density-95 (PSD-95) protein deficits in Fmr1 KO treated mice, whereas levels of a control protein (β-tubulin) remained unchanged. These data further validate MPEP as a potentially beneficial treatment for FXS. Our findings also suggest that adapted H-W mazes may be a useful tool to document alterations in

  14. The fbpA/sapM Double Knock Out Strain of Mycobacterium tuberculosis Is Highly Attenuated and Immunogenic in Macrophages

    PubMed Central

    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J.; Khan, Arshad; Armitige, Lisa Y.; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian

    2012-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine. PMID:22574140

  15. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes.

    PubMed

    Crispo, M; Mulet, A P; Tesson, L; Barrera, N; Cuadro, F; dos Santos-Neto, P C; Nguyen, T H; Crénéguy, A; Brusselle, L; Anegón, I; Menchaca, A

    2015-01-01

    While CRISPR/Cas9 technology has proven to be a valuable system to generate gene-targeted modified animals in several species, this tool has been scarcely reported in farm animals. Myostatin is encoded by MSTN gene involved in the inhibition of muscle differentiation and growth. We determined the efficiency of the CRISPR/Cas9 system to edit MSTN in sheep and generate knock-out (KO) animals with the aim to promote muscle development and body growth. We generated CRISPR/Cas9 mRNAs specific for ovine MSTN and microinjected them into the cytoplasm of ovine zygotes. When embryo development of CRISPR/Cas9 microinjected zygotes (n = 216) was compared with buffer injected embryos (n = 183) and non microinjected embryos (n = 173), cleavage rate was lower for both microinjected groups (P<0.05) and neither was affected by CRISPR/Cas9 content in the injected medium. Embryo development to blastocyst was not affected by microinjection and was similar among the experimental groups. From 20 embryos analyzed by Sanger sequencing, ten were mutant (heterozygous or mosaic; 50% efficiency). To obtain live MSTN KO lambs, 53 blastocysts produced after zygote CRISPR/Cas9 microinjection were transferred to 29 recipient females resulting in 65.5% (19/29) of pregnant ewes and 41.5% (22/53) of newborns. From 22 born lambs analyzed by T7EI and Sanger sequencing, ten showed indel mutations at MSTN gene. Eight showed mutations in both alleles and five of them were homozygous for indels generating out-of frame mutations that resulted in premature stop codons. Western blot analysis of homozygous KO founders confirmed the absence of myostatin, showing heavier body weight than wild type counterparts. In conclusion, our results demonstrate that CRISPR/Cas9 system was a very efficient tool to generate gene KO sheep. This technology is quick and easy to perform and less expensive than previous techniques, and can be applied to obtain genetically modified animal models of interest for biomedicine and

  16. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes

    PubMed Central

    Crispo, M.; Mulet, A. P.; Tesson, L.; Barrera, N.; Cuadro, F.; dos Santos-Neto, P. C.; Nguyen, T. H.; Crénéguy, A.; Brusselle, L.; Anegón, I.; Menchaca, A.

    2015-01-01

    While CRISPR/Cas9 technology has proven to be a valuable system to generate gene-targeted modified animals in several species, this tool has been scarcely reported in farm animals. Myostatin is encoded by MSTN gene involved in the inhibition of muscle differentiation and growth. We determined the efficiency of the CRISPR/Cas9 system to edit MSTN in sheep and generate knock-out (KO) animals with the aim to promote muscle development and body growth. We generated CRISPR/Cas9 mRNAs specific for ovine MSTN and microinjected them into the cytoplasm of ovine zygotes. When embryo development of CRISPR/Cas9 microinjected zygotes (n = 216) was compared with buffer injected embryos (n = 183) and non microinjected embryos (n = 173), cleavage rate was lower for both microinjected groups (P<0.05) and neither was affected by CRISPR/Cas9 content in the injected medium. Embryo development to blastocyst was not affected by microinjection and was similar among the experimental groups. From 20 embryos analyzed by Sanger sequencing, ten were mutant (heterozygous or mosaic; 50% efficiency). To obtain live MSTN KO lambs, 53 blastocysts produced after zygote CRISPR/Cas9 microinjection were transferred to 29 recipient females resulting in 65.5% (19/29) of pregnant ewes and 41.5% (22/53) of newborns. From 22 born lambs analyzed by T7EI and Sanger sequencing, ten showed indel mutations at MSTN gene. Eight showed mutations in both alleles and five of them were homozygous for indels generating out-of frame mutations that resulted in premature stop codons. Western blot analysis of homozygous KO founders confirmed the absence of myostatin, showing heavier body weight than wild type counterparts. In conclusion, our results demonstrate that CRISPR/Cas9 system was a very efficient tool to generate gene KO sheep. This technology is quick and easy to perform and less expensive than previous techniques, and can be applied to obtain genetically modified animal models of interest for biomedicine and

  17. Hawthorn (Crataegus pinnatifida Bunge) leave flavonoids attenuate atherosclerosis development in apoE knock-out mice.

    PubMed

    Dong, Pengzhi; Pan, Lanlan; Zhang, Xiting; Zhang, Wenwen; Wang, Xue; Jiang, Meixiu; Chen, Yuanli; Duan, Yajun; Wu, Honghua; Xu, Yantong; Zhang, Peng; Zhu, Yan

    2017-02-23

    Hawthorn (Crataegus pinnatifida Bunge) leave have been used to treat cardiovascular diseases in China and Europe. Hawthorn leave flavonoids (HLF) are the main part of extraction. Whether hawthorn leave flavonoids could attenuate the development of atherosclerosis and the possible mechanism remain unknown. High-fat diet (HFD) mixed with HLF at concentrations of 5mg/kg and 20mg/kg were administered to apolipoprotein E (apoE) knock out mice. 16 weeks later, mouse serum was collected to determine the lipid profile while the mouse aorta dissected was prepared to measure the lesion area. Hepatic mRNA of genes involved in lipid metabolism were determined. Peritoneal macrophages were collected to study the impact of HLF on cholesterol efflux, formation of foam cell and the expression of ATP binding cassette transporter A1 (ABCA1). Besides, in vivo reverse cholesterol transport (RCT) was conducted. HLF attenuated the development of atherosclerosis that the mean atherosclerotic lesion area in en face aortas was reduced by 23.1% (P<0.05). In mice fed with 20mg/kg HLF, Total cholesterol (TC) level was decreased by 18.6% and very low density lipoprotein cholesterol plus low density lipoprotein cholesterol (VLDLc+LDLc) level were decreased by 23.1% whereas high density lipoprotein cholesterol (HDLc) and triglyceride (TG) levels were similar compared to that of the control group. Peroxisome proliferator activated receptor alpha (PPARα) mRNA was increased by 31.2% (P<0.05) and 60.9% (P<0.05) in mice fed with 5mg/kg and 20mg/kg HLF respectively. Sterol regulatory element binding protein-1c (SREBP-1c) was decreased by 59.3% in the group of 20mg/kg. Carnitine palmitoyl transferase 1 (CPT-1) mRNA level of 20mg/kg group was induced 66.7% (P<0.05). Superoxide dismutase 1 and 2 (SOD1 and SOD2) mRNA were induced 25.4% (P<0.05) and 71.4% (P<0.05) while induced by 36.3% (P<0.05) and 73.2% (P<0.05) in group of 20mg/kg. Glutathione peroxidase 3 (Gpx3) mRNA in the group of 20mg/kg was induced

  18. A Novel Cysteine Sulfinic Acid Decarboxylase Knock-Out Mouse: Taurine Distribution in Various Tissues With and Without Taurine Supplementation.

    PubMed

    Park, Eunkyue; Park, Seung Yong; Cho, In Soo; Kim, Bo Sook; Schuller-Levis, Georgia

    2017-01-01

    Taurine, a sulfur containing amino acid, has various physiological functions including development of the eye and brain, immune function, reproduction, osmo-regulatory function as well as anti-oxidant and anti-inflammatory activities. In order to understand the physiological role, we developed taurine deficient mice deleting a rate-liming enzyme, cysteine sulfinic acid decarboxylase (CSAD) for biosynthesis of taurine. Taurine was measured in various tissues including the liver, brain, lung, spleen, thymus, pancreas, heart, muscle and kidney as well as plasma from CSAD knock-out mice (CSAD KO) with and without treatment of taurine in the drinking water at the age of 2 months (2 M). Taurine was determined using HPLC as a phenylisothiocyanate derivative of taurine at 254 nm. Taurine concentrations in the liver and kidney from homozygotes of CSAD KO (HO), in which CSAD level is high, were 90% and 70% lower than WT, respectively. Taurine concentrations in the brain, spleen and lung, where CSAD level is low, were 21%, 20% and 28% lower than WT, respectively. At 2 M, 1% taurine treatment of HO restored taurine concentrations in all tissues compared to that of WT. To select an appropriate taurine treatment, HO were treated with various concentrations (0.05, 0.2, 1%) of taurine for 4 months (4 M). Restoration of taurine in all tissues except the liver, kidney and lung requires 0.05% taurine to be restored to that of WT. The liver and kidney restore taurine back to WT with 0.2% taurine. To examine which enzymes influence taurine concentrations in various tissues from WT and HO at 2 M, expression of five taurine-related enzymes, two antioxidant enzymes as well as lactoferrin (Lft) and prolactin receptor (Prlr) was determined using RT(2) qPCR. The expression of taurine transporter in the liver, brain, muscle and kidney from HO was increased except in the lung. Our data showed expression of glutamate decarboxylase-like 1(Gadl-1) was increased in the brain and muscle in HO

  19. Vaccination with recombinant adenoviruses expressing Ebola virus glycoprotein elicits protection in the interferon alpha/beta receptor knock-out mouse.

    PubMed

    O'Brien, Lyn M; Stokes, Margaret G; Lonsdale, Stephen G; Maslowski, David R; Smither, Sophie J; Lever, Mark S; Laws, Thomas R; Perkins, Stuart D

    2014-03-01

    The resistance of adult immunocompetent mice to infection with ebolaviruses has led to the development of alternative small animal models that utilise immunodeficient mice, for example the interferon α/β receptor knock-out mouse (IFNR(-/-)). IFNR(-/-) mice have been shown to be susceptible to infection with ebolaviruses by multiple routes but it is not known if this murine model is suitable for testing therapeutics that rely on the generation of an immune response for efficacy. We have tested recombinant adenovirus vectors for their ability to protect IFNR(-/-) mice from challenge with Ebola virus and have analysed the humoral response generated after immunisation. The recombinant vaccines elicited good levels of protection in the knock-out mouse and the antibody response in IFNR(-/-) mice was similar to that observed in vaccinated wild-type mice. These results indicate that the IFNR(-/-) mouse is a relevant small animal model for studying ebolavirus-specific therapeutics.

  20. Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues.

    PubMed

    Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou

    2015-09-01

    Cross-talk between tissues plays key roles in development of organisms; however, there are few researches on cross-talk between tissues in insects. Our previous studies showed that the pupal body weight was elevated after knocking out the fibroin heavy chain gene (BmFib-H), whereas the gene specifically expressed in silk glands of silkworm. Hence, the mutant is a good material for studying the cross-talk between tissues. It is considered that the fat body of silkworm during larval stage is used to store nutrients for pupal development. Herein, comparative proteomic of fat body on the 5th day of fifth instar was performed between BmFib-H gene knock-out Bombyx mori line (FGKO) and its wide-type Dazao. These results revealed that a single gene knock-out in silk gland triggered large-scale metabolic pathways changes in fat body. The levels of proteins involved in glycolysis/gluconeogenesis, pentose phosphate pathway, and glycine-serine biosynthetic pathway were down-regulated in the FGKO fat body. In contrast, the abundances of many proteins participating in protein synthesis, including ribosomal proteins, eukaryotic translation initiation factor, and elongation factor, were up-regulated. Moreover, the concentrations of glycogen and proteins in the FGKO fat body were greatly increased. These findings provided a novel insight into the cross-talk between silk gland and fat body in silkworm, and the presence of cross-talk between silk gland and fat body could regulate the redistribution of nutrients in the FGKO fat body leading to the increase of the pupal weight.

  1. [Effect of CD40 knock out on cytotoxic effector function in CD8(+) T cell of mice with cigarette smoke-induced emphysema].

    PubMed

    Wang, Q; Deng, T T; Kuang, L J; Qiu, S L; Liang, Y; Zhong, X N; He, Z Y; Zhang, J Q; Bai, J; Li, M H

    2016-05-31

    To explore the effect of CD40 knock out on the cytotoxic function of CD8(+) T cell of mice with cigarette smoke-induced emphysema. A total of 40 male C57 mice were divided into four groups according to the random number table, including CD40(+ /+) control group, CD40(+ /+) smoke-exposure group, CD40(-/-)control group, CD40(-/-)smoke-exposure group. The smoke-exposure groups were exposed to cigarette smoke for 24 weeks to establish emphysema model. Morphological changes were evaluated by linear intercepts. The percentages of CD8, perforin, granzyme B positive cells were evaluated by immunohistochemistry. The mRNA expressions of perforin, granzyme B, interleukin (IL) -27 were measured by fluorescent real time quantitative polymerase chain reaction (RT-PCR). The IL-27 cytokine level was tested by enzyme-linked immunosorbent assay (ELISA). The mean linear intercepts in CD40(+ /+) smoke-exposure group was significantly higher than CD40(+ /+) control group, CD40(-/-)control group, and CD40(-/-)smoke-exposure group [(37.2±3.6) vs (24.0±3.4), (22.5±2.4), (29.9±1.7) μm] (all P<0.05). CD40(-/-)smoke-exposure group was higher than CD40(+ /+) control group, CD40(-/-)control group (all P<0.05). The percentages of CD8 positive, perforin positive and granzyme B positive cells in CD40(+ /+) smoke-exposure group [(16.3±2.3)%, (11.4±2.1)%, (10.7±1.9)%] were significantly higher than CD40(+ /+) control group [(8.3±1.6)%, (5.1±1.2)%, (4.6±1.0)%], CD40(-/-)control group [ (6.4±1.5)%, (4.3±1.0)%, (4.2±1.0)%] and CD40(-/-)smoke-exposure group [(8.6±1.7)%, (5.6±1.3)%, (5.5±1.3)%] (all P<0.05). RT-PCR results showed that the mRNA expressions of perforin, granzyme B and IL-27 in CD40(+ /+) smoke-exposure group [(20.3±7.3), (18.3±12.3), (2.2±0.7)] were significantly higher than CD40(+ /+) control group [(9.4±4.8), (10.6±3.8), (1.3±0.6)], CD40(-/-)control group [ (8.1±3.1), (7.7±3.5), (1.1±0.5)] and CD40(-/-)smoke-exposure group [(12.9±6.2), (10.4±4.6), (1.5±0

  2. Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    PubMed Central

    GHASEMI NEJAD ALMANI, Pooya; SHARIFI, Iraj; KAZEMI, Bahram; BABAEI, Zahra; BANDEHPOUR, Mojgan; SALARI, Samira; SAEDI DEZAKI, Ebrahim

    2016-01-01

    Background: Leishmaniasis represents a major public health concern in tropical and sub-tropical countries. At present, there is no efficacious vaccine against the disease and new control methods are needed. One way to access this important goal is to knock out genes of specific macromolecules to evaluate the effect of deletion on the growth, multiplication, pathogenesis and immunity of the parasite. The aim of this study was to design and clone molecular constructs to knock out N-acetylglucosamine phosphatidylinositol de-N-acetylase (GPI12) gene in Leishmania major. Methods: For designing and making molecular constructs, we used pLEXSY-neo2 and pLEXSY-hyg2 vectors. The molecular constructs were cloned in E. coli strain Top10. The molecular constructs were transfected by electroporation into L. major in two stages. Results: The molecular constructs were confirmed by Colony PCR and sequencing. The recombinant strains were isolated by selective antibiotics, after which they were confirmed by PCR, Southern and Western blots. Conclusion: Recombinant parasites were created and examined for subsequent study. With the use of molecular constructs, it was possible to remove and study gene GPI12 and to achieve a live recombinant Leishmania parasite that maintained the original form of the antigenic parasites. This achievement can be used as an experimental model for vaccine development studies. Further investigations are essential to check this model in a suitable host. PMID:28127356

  3. Reduced levels of dopamine and altered metabolism in brains of HPRT knock-out rats: a new rodent model of Lesch-Nyhan Disease.

    PubMed

    Meek, Stephen; Thomson, Alison J; Sutherland, Linda; Sharp, Matthew G F; Thomson, Julie; Bishop, Valerie; Meddle, Simone L; Gloaguen, Yoann; Weidt, Stefan; Singh-Dolt, Karamjit; Buehr, Mia; Brown, Helen K; Gill, Andrew C; Burdon, Tom

    2016-05-17

    Lesch-Nyhan disease (LND) is a severe neurological disorder caused by loss-of-function mutations in the gene encoding hypoxanthine phosphoribosyltransferase (HPRT), an enzyme required for efficient recycling of purine nucleotides. Although this biochemical defect reconfigures purine metabolism and leads to elevated levels of the breakdown product urea, it remains unclear exactly how loss of HPRT activity disrupts brain function. As the rat is the preferred rodent experimental model for studying neurobiology and diseases of the brain, we used genetically-modified embryonic stem cells to generate an HPRT knock-out rat. Male HPRT-deficient rats were viable, fertile and displayed normal caged behaviour. However, metabolomic analysis revealed changes in brain biochemistry consistent with disruption of purine recycling and nucleotide metabolism. Broader changes in brain biochemistry were also indicated by increased levels of the core metabolite citrate and reduced levels of lipids and fatty acids. Targeted MS/MS analysis identified reduced levels of dopamine in the brains of HPRT-deficient animals, consistent with deficits noted previously in human LND patients and HPRT knock-out mice. The HPRT-deficient rat therefore provides a new experimental platform for future investigation of how HPRT activity and disruption of purine metabolism affects neural function and behaviour.

  4. Reduced levels of dopamine and altered metabolism in brains of HPRT knock-out rats: a new rodent model of Lesch-Nyhan Disease

    PubMed Central

    Meek, Stephen; Thomson, Alison J.; Sutherland, Linda; Sharp, Matthew G. F.; Thomson, Julie; Bishop, Valerie; Meddle, Simone L.; Gloaguen, Yoann; Weidt, Stefan; Singh-Dolt, Karamjit; Buehr, Mia; Brown, Helen K.; Gill, Andrew C.; Burdon, Tom

    2016-01-01

    Lesch-Nyhan disease (LND) is a severe neurological disorder caused by loss-of-function mutations in the gene encoding hypoxanthine phosphoribosyltransferase (HPRT), an enzyme required for efficient recycling of purine nucleotides. Although this biochemical defect reconfigures purine metabolism and leads to elevated levels of the breakdown product urea, it remains unclear exactly how loss of HPRT activity disrupts brain function. As the rat is the preferred rodent experimental model for studying neurobiology and diseases of the brain, we used genetically-modified embryonic stem cells to generate an HPRT knock-out rat. Male HPRT-deficient rats were viable, fertile and displayed normal caged behaviour. However, metabolomic analysis revealed changes in brain biochemistry consistent with disruption of purine recycling and nucleotide metabolism. Broader changes in brain biochemistry were also indicated by increased levels of the core metabolite citrate and reduced levels of lipids and fatty acids. Targeted MS/MS analysis identified reduced levels of dopamine in the brains of HPRT-deficient animals, consistent with deficits noted previously in human LND patients and HPRT knock-out mice. The HPRT-deficient rat therefore provides a new experimental platform for future investigation of how HPRT activity and disruption of purine metabolism affects neural function and behaviour. PMID:27185277

  5. Exacerbation of spontaneous autoimmune nephritis following regulatory T cell depletion in B cell lymphoma 2-interacting mediator knock-out mice.

    PubMed

    Wang, Y M; Zhang, G Y; Wang, Y; Hu, M; Zhou, J J; Sawyer, A; Cao, Q; Wang, Y; Zheng, G; Lee, V W S; Harris, D C H; Alexander, S I

    2017-02-02

    Regulatory T cells (Tregs ) have been recognized as central mediators for maintaining peripheral tolerance and limiting autoimmune diseases. The loss of Tregs or their function has been associated with exacerbation of autoimmune disease. However, the temporary loss of Tregs in the chronic spontaneous disease model has not been investigated. In this study, we evaluated the role of Tregs in a novel chronic spontaneous glomerulonephritis model of B cell lymphoma 2-interacting mediator (Bim) knock-out mice by transient depleting Tregs . Bim is a pro-apoptotic member of the B cell lymphoma 2 (Bcl-2) family. Bim knock-out (Bim(-/-) ) mice fail to delete autoreactive T cells in thymus, leading to chronic spontaneous autoimmune kidney disease. We found that Treg depletion in Bim(-/-) mice exacerbated the kidney injury with increased proteinuria, impaired kidney function, weight loss and greater histological injury compared with wild-type mice. There was a significant increase in interstitial infiltrate of inflammatory cells, antibody deposition and tubular damage. Furthermore, the serum levels of cytokines interleukin (IL)-2, IL-4, IL-6, IL-10, IL-17α, interferon (IFN)-γ and tumour necrosis factor (TNF)-α were increased significantly after Treg depletion in Bim(-/-) mice. This study demonstrates that transient depletion of Tregs leads to enhanced self-reactive T effector cell function followed by exacerbation of kidney disease in the chronic spontaneous kidney disease model of Bim-deficient mice.

  6. Effects of SIRT1 gene knock-out via activation of SREBP2 protein-mediated PI3K/AKT signaling on osteoarthritis in mice.

    PubMed

    Yu, Fei; Zeng, Hui; Lei, Ming; Xiao, De-Ming; Li, Wei; Yuan, Hao; Lin, Jian-Jing

    2016-10-01

    This study investigated the effects of SIRT1 gene knock-out on osteoarthritis in mice, and the possible roles of SREBP2 protein and the PI3K/AKT signaling pathway in the effects. Mice were randomly divided into a normal group and a SIRT1 gene knock-out group (6 mice in each group). In these groups, one side of the knee anterior cruciate ligament was traversed, and the ipsilateral medial meniscus was cut to establish an osteoarthritis model of knee joint. The countralateral synovial bursa was cut out, serving as controls. The knee joint specimens were then divided into four groups: SIRT1(+/+) control group (group A, n=6); SIRT1(+/+) osteoarthritis group (group B, n=6); SIRT1(-/-) control group (group C, n=6); SIRT1(-/-) osteoarthritis group (group D, n=6). HE staining, Masson staining, Safranin O-Fast Green staining and Van Gieson staining were used to observe the morphological changes in the articular cartilage of the knee. Immunohistochemical staining was employed to detect the expression of SIRT1, SREBP2, VEGF, AKT, HMGCR and type II collagen proteins. SA-β-gal staining was utilized to evaluate chondrocyte aging. The results showed clear knee joint cartilage destruction and degeneration in the SIRT1(-/-) osteoarthritis group. The tidal line was twisted and displaced anteriorly. Type II collagen was destroyed and distributed unevenly. Compared with the SIRT1(+/+) osteoarthritis group and SIRT1(-/-) control group, SIRT1 protein expression was not obviously changed in the SIRT1(-/-) osteoarthritis group (P>0.05), while the expression levels of the SREBP2, VEGF and HMGCR proteins were significantly increased (P<0.05) and the levels of AKT and type II collagen proteins were significantly decreased (P<0.05). SIRT1 gene knock-out may aggravate cartilage degeneration in osteoarthritis by activating the SREBP2 protein-mediated PI3K/AKT signalling pathway, suggesting that SIRT1 gene may play a protective role against osteoarthritis.

  7. Attenuated Inflammatory Response in Triggering Receptor Expressed on Myeloid Cells 2 (TREM2) Knock-Out Mice following Stroke

    PubMed Central

    Brehm, Martin; Guenther, Madlen; Linnartz-Gerlach, Bettina; Neumann, Harald; Witte, Otto W.; Frahm, Christiane

    2013-01-01

    Background Triggering receptor expressed on myeloid cells-2 (TREM2) is a microglial surface receptor involved in phagocytosis. Clearance of apoptotic debris after stroke represents an important mechanism to re-attain tissue homeostasis and thereby ensure functional recovery. The role of TREM2 following stroke is currently unclear. Methods and Results As an experimental stroke model, the middle cerebral artery of mice was occluded for 30 minutes with a range of reperfusion times (duration of reperfusion: 6 h/12 h/24 h/2 d/7 d/28 d). Quantitative PCR (qPCR) revealed a greatly increased transcription of TREM2 after stroke. We subsequently analyzed the expression of pro-inflammatory cytokines, chemokines and their receptors in TREM2-knockout (TREM2-KO) mice via qPCR. Microglial activation (CD68, Iba1) and CD3-positive T-cell invasion were analyzed via qPCR and immunohistochemistry. Functional consequences of TREM2 knockout were assessed by infarct volumetry. The acute inflammatory response (12 h reperfusion) was very similar between TREM2-KO mice and their littermate controls. However, in the sub-acute phase (7 d reperfusion) following stroke, TREM2-KO mice showed a decreased transcription of pro-inflammatory cytokines TNFα, IL-1α and IL-1β, associated with a reduced microglial activity (CD68, Iba1). Furthermore, TREM2-KO mice showed a reduced transcription of chemokines CCL2 (MCP1), CCL3 (MIP1α) and the chemokine receptor CX3CR1, followed by a diminished invasion of CD3-positive T-cells. No effect on the lesion size was observed. Conclusions Although we initially expected an exaggerated pro-inflammatory response following ablation of TREM2, our data support a contradictory scenario that the sub-acute inflammatory reaction after stroke is attenuated in TREM2-KO mice. We therefore conclude that TREM2 appears to sustain a distinct inflammatory response after stroke. PMID:23301011

  8. Knock out of the PHOSPHATE 2 Gene TaPHO2-A1 Improves Phosphorus Uptake and Grain Yield under Low Phosphorus Conditions in Common Wheat

    PubMed Central

    Ouyang, Xiang; Hong, Xia; Zhao, Xueqiang; Zhang, Wei; He, Xue; Ma, Wenying; Teng, Wan; Tong, Yiping

    2016-01-01

    MiR399 and its target PHOSPHATE2 (PHO2) play pivotal roles in phosphate signaling in plants. Loss of function mutation in PHO2 leads to excessive Pi accumulation in shoots and growth retardation in diploid plants like Arabidopsis thaliana and rice (Oryza sativa). Here we isolated three PHO2 homologous genes TaPHO2-A1, -B1 and -D1 from hexaploid wheat (Triticum aestivum). These TaPHO2 genes all contained miR399-binding sites and were able to be degraded by tae-miR399. TaPHO2-D1 was expressed much more abundantly than TaPHO2-A1 and -B1. The ion beam-induced deletion mutants were used to analyze the effects of TaPHO2s on phosphorus uptake and plant growth. The tapho2-a1, tapho2-b1 and tapho2-d1 mutants all had significant higher leaf Pi concentrations than did the wild type, with tapho2-d1 having the strongest effect, and tapho2-b1 the weakest. Two consecutive field experiments showed that knocking out TaPHO2-D1 reduced plant height and grain yield under both low and high phosphorus conditions. However, knocking out TaPHO2-A1 significantly increased phosphorus uptake and grain yield under low phosphorus conditions, with no adverse effect on grain yield under high phosphorus conditions. Our results indicated that TaPHO2s involved in phosphorus uptake and translocation, and molecular engineering TaPHO2 shows potential in improving wheat yield with less phosphorus fertilizer. PMID:27416927

  9. Towards in vivo mutation analysis: knock-out of specific chlorophylls bound to the light-harvesting complexes of Arabidopsis thaliana - the case of CP24 (Lhcb6).

    PubMed

    Passarini, Francesca; Xu, Pengqi; Caffarri, Stefano; Hille, Jacques; Croce, Roberta

    2014-09-01

    In the last ten years, a large series of studies have targeted antenna complexes of plants (Lhc) with the aim of understanding the mechanisms of light harvesting and photoprotection. Combining spectroscopy, modeling and mutation analyses, the role of individual pigments in these processes has been highlighted in vitro. In plants, however, these proteins are associated with multiple complexes of the photosystems and function within this framework. In this work, we have envisaged a way to bridge the gap between in vitro and in vivo studies by knocking out in vivo pigments that have been proposed to play an important role in excitation energy transfer between the complexes or in photoprotection. We have complemented a CP24 knock-out mutant of Arabidopsis thaliana with the CP24 (Lhcb6) gene carrying a His-tag and with a mutated version lacking the ligand for chlorophyll 612, a specific pigment that in vitro experiments have indicated as the lowest energy site of the complex. Both complexes efficiently integrated into the thylakoid membrane and assembled into the PSII supercomplexes, indicating that the His-tag does not impair the organization in vivo. The presence of the His-tag allowed the purification of CP24-WT and of CP24-612 mutant in their native states. It is shown that CP24-WT coordinates 10 chlorophylls and 2 carotenoid molecules and has properties identical to those of the reconstituted complex, demonstrating that the complex self-assembled in vitro assumes the same folding as in the plant. The absence of the ligand for chlorophyll 612 leads to the loss of one Chl a and of lutein, again as in vitro, indicating the feasibility of the method. This article is part of a special issue entitled: photosynthesis research for sustainability: keys to produce clean energy.

  10. Peripheral Benzodiazepine Receptor/Translocator Protein Global Knock-out Mice Are Viable with No Effects on Steroid Hormone Biosynthesis*♦

    PubMed Central

    Tu, Lan N.; Morohaku, Kanako; Manna, Pulak R.; Pelton, Susanne H.; Butler, W. Ronald; Stocco, Douglas M.; Selvaraj, Vimal

    2014-01-01

    Translocator protein (TSPO), previously known as the peripheral benzodiazepine receptor, is a mitochondrial outer membrane protein implicated as essential for cholesterol import to the inner mitochondrial membrane, the rate-limiting step in steroid hormone biosynthesis. Previous research on TSPO was based entirely on in vitro experiments, and its critical role was reinforced by an early report that claimed TSPO knock-out mice were embryonic lethal. In a previous publication, we examined Leydig cell-specific TSPO conditional knock-out mice that suggested TSPO was not required for testosterone production in vivo. This raised controversy and several questions regarding TSPO function. To examine the definitive role of TSPO in steroidogenesis and embryo development, we generated global TSPO null (Tspo−/−) mice. Contrary to the early report, Tspo−/− mice survived with no apparent phenotypic abnormalities and were fertile. Examination of adrenal and gonadal steroidogenesis showed no defects in Tspo−/− mice. Adrenal transcriptome comparison of gene expression profiles showed that genes involved in steroid hormone biosynthesis (Star, Cyp11a1, and Hsd3b1) were unchanged in Tspo−/− mice. Adrenocortical ultrastructure illustrated no morphological alterations in Tspo−/− mice. In an attempt to correlate our in vivo findings to previously used in vitro models, we also determined that siRNA knockdown or the absence of TSPO in different mouse and human steroidogenic cell lines had no effect on steroidogenesis. These findings directly refute the dogma that TSPO is indispensable for steroid hormone biosynthesis and viability. By amending the current model, this study advances our understanding of steroidogenesis with broad implications in biology and medicine. PMID:24936060

  11. Synergistic Roles for G-protein γ3 and γ7 Subtypes in Seizure Susceptibility as Revealed in Double Knock-out Mice*

    PubMed Central

    Schwindinger, William F.; Mirshahi, Uyenlinh L.; Baylor, Kelly A.; Sheridan, Kathleen M.; Stauffer, Anna M.; Usefof, Stephanie; Stecker, Mark M.; Mirshahi, Tooraj; Robishaw, Janet D.

    2012-01-01

    The functions of different G-protein αβγ subunit combinations are traditionally ascribed to their various α components. However, the discovery of similarly diverse γ subtypes raises the possibility that they may also contribute to specificity. To test this possibility, we used a gene targeting approach to determine whether the closely related γ3 and γ7 subunits can perform functionally interchangeable roles in mice. In contrast to single knock-out mice that show normal survival, Gng3−/−Gng7−/− double knock-out mice display a progressive seizure disorder that dramatically reduces their median life span to only 75 days. Biochemical analyses reveal that the severe phenotype is not due to redundant roles for the two γ subunits in the same signaling pathway but rather is attributed to their unique actions in different signaling pathways. The results suggest that the γ3 subunit is a component of a Gi/o protein that is required for γ-aminobutyric acid, type B, receptor-regulated neuronal excitability, whereas the γ7 subunit is a component of a Golf protein that is responsible for A2A adenosine or D1 dopamine receptor-induced neuro-protective response. The development of this mouse model offers a novel experimental framework for exploring how signaling pathways integrate to produce normal brain function and how their combined dysfunction leads to spontaneous seizures and premature death. The results underscore the critical role of the γ subunit in this process. PMID:22207761

  12. Broken or knocked out tooth

    MedlinePlus

    Cohenca N. Management of traumatic dental injuries. In: Torabinejad M, Walton, RE, Fouad AF, eds. Endodontics: Principles and Practice . 5th ed. St. Louis, MO: Elsevier Saunders; 2015:chap 11. Tinanoff N. Dental trauma. In: Kliegman ...

  13. Generation of two auxotrophic genes knock-out Edwardsiella tarda and assessment of its potential as a combined vaccine in olive flounder (Paralichthys olivaceus).

    PubMed

    Choi, Seung Hyuk; Kim, Ki Hong

    2011-07-01

    Two auxotrophic genes that play essential roles in bacterial cell wall biosynthesis--alanine racemase (alr) gene and aspartate semialdehyde dehydrogenase (asd) gene--knock-out Edwardsiella tarda (Δalr Δasd E. tarda) was generated by the allelic exchange method to develop a combined vaccine system. Green fluorescent protein (GFP) was used as a model foreign protein, and was expressed by transformation of the mutant E. tarda with antibiotic resistant gene-free plasmids harboring cassettes for GFP and asd expression (pG02-ASD-EtPR-GFP). In vitro growth of the mutant E. tarda was similar to wild-type E. tarda when D-alanine and diaminopimelic acid (DAP) were supplemented to growth medium. However, without d-alanine and/or DAP supplementation, the mutant showed very limited growth. The Δalr Δasd E. tarda transformed with pG02-ASD-EtPR-GFP showed a similar growth pattern of wild-type E. tarda when D-alanine was supplemented in the medium, and the expression of GFP could be observed even with naked eyes. The virulence of the auxotrophic mutant E. tarda was decreased, which was demonstrated by approximately 10⁶ fold increase of LD₅₀ dose compared to wild-type E. tarda. To assess vaccine potential of the present combined vaccine system, olive flounder (Paralichthys olivaceus) were immunized with the GFP expressing mutant E. tarda, and analyzed protection efficacy against E. tarda challenge and antibody titers against E. tarda and GFP. Groups of fish immunized with 10⁷ CFU of the Δalr Δasd E. tarda harboring pG02-ASD-EtPR-GFP showed no mortality, which was irrespective to boost immunization. The cumulative mortality rates of fish immunized with 10⁶ or 10⁵ CFU of the mutant bacteria were lowered by a boost immunization. Fish immunized with the mutant E. tarda at doses of 10⁶-10⁷ CFU/fish showed significantly higher serum agglutination activities against formalin-killed E. tarda than PBS-injected control fish. Furthermore, fish immunized with 10⁶-10

  14. Antidepressant activity: contribution of brain microdialysis in knock-out mice to the understanding of BDNF/5-HT transporter/5-HT autoreceptor interactions

    PubMed Central

    Gardier, Alain M.

    2013-01-01

    Why antidepressants vary in terms of efficacy is currently unclear. Despite the leadership of selective serotonin reuptake inhibitors (SSRIs) in the treatment of depression, the precise neurobiological mechanisms involved in their therapeutic action are poorly understood. A better knowledge of molecular interactions between monoaminergic system, pre- and post-synaptic partners, brain neuronal circuits and regions involved may help to overcome limitations of current treatments and identify new therapeutic targets. Intracerebral in vivo microdialysis (ICM) already provided important information about the brain mechanism of action of antidepressants first in anesthetized rats in the early 1990s, and since then in conscious wild-type or knock-out mice. The principle of ICM is based on the balance between release of neurotransmitters (e.g., monoamines) and reuptake by selective transporters [e.g., serotonin transporter for serotonin 5-hydroxytryptamine (5-HT)]. Complementary to electrophysiology, this technique reflects pre-synaptic monoamines release and intrasynaptic events corresponding to ≈80% of whole brain tissue content. The inhibitory role of serotonergic autoreceptors infers that they limit somatodendritic and nerve terminal 5-HT release. It has been proposed that activation of 5-HT1A and 5-HT1B receptor sub-types limits the antidepressant-like activity of SSRIs. This hypothesis is based partially on results obtained in ICM experiments performed in naïve, non-stressed rodents. The present review will first remind the principle and methodology of ICM performed in mice. The crucial need of developing animal models that display anxiety and depression-like behaviors, neurochemical and brain morphological phenotypes reminiscent of these mood disorders in humans, will be underlined. Recently developed genetic mouse models have been generated to independently manipulate 5-HT1A auto and heteroreceptors and ICM helped to clarify the role of the pre-synaptic component

  15. The phenotypes of ATG9, ATG16 and ATG9/16 knock-out mutants imply autophagy-dependent and -independent functions

    PubMed Central

    Xiong, Qiuhong; Ünal, Can; Matthias, Jan; Steinert, Michael; Eichinger, Ludwig

    2015-01-01

    Macroautophagy is a highly conserved intracellular bulk degradation system of all eukaryotic cells. It is governed by a large number of autophagy proteins (ATGs) and is crucial for many cellular processes. Here, we describe the phenotypes of Dictyostelium discoideum ATG16− and ATG9−/16− cells and compare them to the previously reported ATG9− mutant. ATG16 deficiency caused an increase in the expression of several core autophagy genes, among them atg9 and the two atg8 paralogues. The single and double ATG9 and ATG16 knock-out mutants had complex phenotypes and displayed severe and comparable defects in pinocytosis and phagocytosis. Uptake of Legionella pneumophila was reduced. In addition, ATG9− and ATG16− cells had dramatic defects in autophagy, development and proteasomal activity which were much more severe in the ATG9−/16− double mutant. Mutant cells showed an increase in poly-ubiquitinated proteins and contained large ubiquitin-positive protein aggregates which partially co-localized with ATG16-GFP in ATG9−/16− cells. The more severe autophagic, developmental and proteasomal phenotypes of ATG9−/16− cells imply that ATG9 and ATG16 probably function in parallel in autophagy and have in addition autophagy-independent functions in further cellular processes. PMID:25878144

  16. The effect of neuronal conditional knock-out of peroxisome proliferator-activated receptors in the MPTP mouse model of Parkinson's disease.

    PubMed

    Mounsey, R B; Martin, H L; Nelson, M C; Evans, R M; Teismann, P

    2015-08-06

    Activation of peroxisome proliferator-activated receptors (PPARs), namely PPARγ and PPARδ, has been shown to provide neuroprotection in a number of neurodegenerative disorders, such as Alzheimer's and Parkinson's disease (PD). The observed neuroprotective effects in experimental models of PD have been linked to anti-oxidant and anti-inflammatory actions. This study aimed to analyze the full influence of these receptors in neuroprotection by generating a nerve cell-specific conditional knock-out of these receptors and subjecting these genetically modified mice to the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) neurotoxin to model dopaminergic degeneration. Mice null for both receptors show the lowest levels of tyrosine hydroxylase (TH)-positive cell bodies following MPTP administration. Presence of one or both these receptors show a trend toward protection against this degeneration, as higher dopaminergic cell immunoreactivity and striatal monoamine levels are evident. These data supplement recent studies that have elected to use agonists of the receptors to regulate immune responses. The results place further importance on the activation of PPARs and the neuroprotective roles these have in inflammatory processes linked to neurodegenerative processes. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Comparative N-linked glycan analysis of wild-type and α1,3-galactosyltransferase gene knock-out pig fibroblasts using mass spectrometry approaches.

    PubMed

    Park, Hae-Min; Kim, Yoon-Woo; Kim, Kyoung-Jin; Kim, Young June; Yang, Yung-Hun; Jin, Jang Mi; Kim, Young Hwan; Kim, Byung-Gee; Shim, Hosup; Kim, Yun-Gon

    2015-01-31

    Carbohydrate antigens expressed on pig cells are considered to be major barriers in pig-to-human xenotransplantation. Even after α1,3-galactosyltransferase gene knock-out (GalT-KO) pigs are generated, potential non-Gal antigens are still existed. However, to the best of our knowledge there is no extensive study analyzing N-glycans expressed on the GalT-KO pig tissues or cells. Here, we identified and quantified totally 47 N-glycans from wild-type (WT) and GalT-KO pig fibroblasts using mass spectrometry. First, our results confirmed the absence of galactose-alpha-1,3-galactose (α-Gal) residue in the GalT-KO pig cells. Interestingly, we showed that the level of overall fucosylated N-glycans from GalT-KO pig fibroblasts is much higher than from WT pig fibroblasts. Moreover, the relative quantity of the N-glycolylneuraminic acid (NeuGc) antigen is slightly higher in the GalT-KO pigs. Thus, this study will contribute to a better understanding of cellular glycan alterations on GalT-KO pigs for successful xenotransplantation.

  18. A role for glucocorticoid-signaling in depression-like behavior of gastrin-releasing peptide receptor knock-out mice.

    PubMed

    Monje, Francisco J; Kim, Eun-Jung; Cabatic, Maureen; Lubec, Gert; Herkner, Kurt R; Pollak, Daniela D

    2011-08-01

    Abstract Background. The gastrin-releasing peptide receptor (GRPR) is highly expressed in the limbic system, where it importantly regulates emotional functions and in the suprachiasmatic nucleus, where it is central for the photic resetting of the circadian clock. Mice lacking GRPR presented with deficient light-induced phase shift in activity as well altered emotional learning and amygdala function. The effect of GRPR deletion on depression-like behavior and its molecular signature in the amygdala, however, has not yet been evaluated. Methods. GRPR knock-out mice (GRPR-KO) were tested in the forced-swim test and the sucrose preference test for depression-like behavior. Gene expression in the basolateral nucleus of the amygdala was evaluated by micorarray analysis subsequent to laser-capture microdissection-assisted extraction of mRNA. The expression of selected genes was confirmed by RT-PCR. Results. GRPR-KO mice were found to present with increased depression-like behavior. Microarray analysis revealed down-regulation of several glucocorticoid-responsive genes in the basolateral amygdala. Acute administration of dexamethasone reversed the behavioral phenotype and alterations in gene expression. Discussion. We propose that deletion of GRPR leads to the induction of depression-like behavior which is paralleled by dysregulation of amygdala gene expression, potentially resulting from deficient light-induced corticosterone release in GRPR-KO.

  19. Reduced Expression of P2Y2 Receptor and Acetylcholinesterase at Neuromuscular Junction of P2Y1 Receptor Knock-out Mice.

    PubMed

    Xu, Miranda L; Bi, Cathy W C; Cheng, Lily K W; Mak, Shinghung; Yao, Ping; Luk, Wilson K W; Lau, Kitty K M; Cheng, Anthony W M; Tsim, Karl W K

    2015-11-01

    ATP is co-stored and co-released with acetylcholine (ACh) at the pre-synaptic vesicles in vertebrate neuromuscular junction (nmj). Several lines of studies demonstrated that binding of ATP to its corresponding P2Y1 and P2Y2 receptors in the muscle regulated post-synaptic gene expressions. To further support the notion that P2Y receptors are playing indispensable role in formation of post-synaptic specifications at the nmj, the knock-out mice of P2Y1 receptor (P2Y1R (-/-)) were employed here for analyses. In P2Y1R (-/-) mice, the expression of P2Y2 receptor in muscle was reduced by over 50 %, as compared to P2Y1R (+/+) mice. In parallel, the expression of acetylcholinesterase (AChE) in muscle was markedly decreased. In the analysis of the expression of anchoring subunits of AChE in P2Y1R (-/-) mice, the proline-rich membrane anchor (PRiMA) subunit was reduced by 60 %; while the collagen tail (ColQ) subunit was reduced by 50 %. AChE molecular forms in the muscle were not changed, except the amount of enzyme was reduced. Immuno-staining of P2Y1R (-/-) mice nmj, both AChE and AChR were still co-localized at the nmj, and the staining was diminished. Taken together our data demonstrated that P2Y1 receptor regulated the nmj gene expression.

  20. Analysis of the synergistic effect of glycyrrhizin and other constituents in licorice extract on lipopolysaccharide-induced nitric oxide production using knock-out extract.

    PubMed

    Uto, Takuhiro; Morinaga, Osamu; Tanaka, Hiroyuki; Shoyama, Yukihiro

    2012-01-06

    The pharmacological evidence for synergism between natural compounds is not fully elucidated. In this study, we investigated the synergistic function of one target compound in medicinal plant extract by using knock-out (KO) extract, which is one target compound-eliminated extract from whole crude extract. Licorice is the most important ingredient used in the traditional Chinese medicine (TCM) and the Japanese Kampo medicine, and one of the major active components of licorice is glycyrrhizin (GC). To identify the potential role of GC, we prepared GC-removed extract (GC-KO extract) from licorice extract (LE) using immunoaffinity column conjugated with anti-GC monoclonal antibody (MAb), which could eliminate 99.5% of GC from LE. LE inhibited nitric oxide (NO) production and inducible NO synthase (iNOS) expression in lipopolysaccharide (LPS)-stimulated RAW264 murine macrophage cells. However, treatment of GC alone could not show the suppression of NO production and iNOS expression. Interestingly, the inhibitory effect of GC-KO extract was significantly attenuated compared with LE. Furthermore, the combined treatment with GC-KO extract and GC could improve the attenuated inhibition. Taken together, our results indicate that GC may exert synergistic suppression of iNOS expression when coexisting with the other constituents contained in LE, and KO extract is a useful approach for determination of real pharmacological functions of natural compound in the phytochemical mixture.

  1. Type II Cochlear Ganglion Neurons Do Not Drive the Olivocochlear Reflex: Re-Examination of the Cochlear Phenotype in Peripherin Knock-Out Mice

    PubMed Central

    2016-01-01

    Abstract The cochlear nerve includes a small population of unmyelinated sensory fibers connecting outer hair cells to the brain. The functional role of these type II afferent neurons is controversial, because neurophysiological data are sparse. A recent study (Froud et al., 2015) reported that targeted deletion of peripherin, a type of neurofilament, eliminated type II afferents and inactivated efferent feedback to the outer hair cells, thereby suggesting that type II afferents were the sensory drive to this sound-evoked, negative-feedback reflex, the olivocochlear pathway. Here, we re-evaluated the cochlear phenotype in mice from the peripherin knock-out line and show that (1) type II afferent terminals are present in normal number and (2) olivocochlear suppression of cochlear responses is absent even when this efferent pathway is directly activated by shocks. We conclude that type II neurons are not the sensory drive for the efferent reflex and that peripherin deletion likely causes dysfunction of synaptic transmission between olivocochlear terminals and their peripheral targets. PMID:27570826

  2. The effect of neuronal conditional knock-out of peroxisome proliferator-activated receptors in the MPTP mouse model of Parkinson’s disease

    PubMed Central

    Mounsey, R.B.; Martin, H.L.; Nelson, M.C.; Evans, R.M.; Teismann, P.

    2015-01-01

    Activation of peroxisome proliferator-activated receptors (PPARs), namely PPARγ and PPARδ, has been shown to provide neuroprotection in a number of neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease (PD). The observed neuroprotective effects in experimental models of PD have been linked to anti-oxidant and anti-inflammatory actions. This study aimed to analyze the full influence of these receptors in neuroprotection by generating a nerve cell-specific conditional knock-out of these receptors and subjecting these genetically modified mice to the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) neurotoxin to model dopaminergic degeneration. Mice null for both receptors show the lowest levels of tyrosine hydroxylase (TH)-positive cell bodies following MPTP administration. Presence of one or both these receptors show a trend toward protection against this degeneration, as higher dopaminergic cell immunoreactivity and striatal monoamine levels are evident. These data supplement recent studies that have elected to use agonists of the receptors to regulate immune responses. The results place further importance on the activation of PPARs and the neuroprotective roles these have in inflammatory processes linked to neurodegenerative processes. PMID:26028469

  3. Impairment of catecholamine systems during induction of long-term potentiation at hippocampal CA1 synapses in HPC-1/syntaxin 1A knock-out mice.

    PubMed

    Mishima, Tatsuya; Fujiwara, Tomonori; Kofuji, Takefumi; Akagawa, Kimio

    2012-01-04

    The membrane protein HPC-1/syntaxin 1A is believed to play a key role in synaptic vesicle exocytosis, and it was recently suggested to be required for synaptic plasticity. Despite evidence for the function of HPC-1/syntaxin 1A in synaptic plasticity, the underlying cellular mechanism is unclear. We found that although fast synaptic transmission and long-term depression were unaffected, HPC-1/syntaxin 1A knock-out (STX1A(-/-)) mice showed impaired long-term potentiation (LTP) in response to theta-burst stimulation in CA1 hippocampal slices. The impairment in LTP was rescued by the application of forskolin, an adenylyl cyclase activator, or more robust stimulation, suggesting that cAMP/protein kinase A signaling was suppressed in these mice. In addition, catecholamine release from the hippocampus was significantly reduced in STX1A(-/-) mice. Because HPC-1/syntaxin 1A regulates exocytosis of dense-core synaptic vesicles, which contain neuromodulatory transmitters such as noradrenaline, dopamine and 5-HT, we examined the effect of neuromodulatory transmitters on LTP induction. Noradrenaline and dopamine enhanced LTP induction in STX1A(-/-) mice, whereas catecholamine depletion reduced LTP induction in wild-type mice. Theses results suggest that HPC-1/syntaxin 1A regulates catecholaminergic systems via exocytosis of dense-core synaptic vesicles, and that deletion of HPC-1/syntaxin 1A causes impairment of LTP induction.

  4. Progression of Alport Kidney Disease in Col4a3 Knock Out Mice Is Independent of Sex or Macrophage Depletion by Clodronate Treatment.

    PubMed

    Kim, Munkyung; Piaia, Alessandro; Shenoy, Neeta; Kagan, David; Gapp, Berangere; Kueng, Benjamin; Weber, Delphine; Dietrich, William; Ksiazek, Iwona

    2015-01-01

    Alport syndrome is a genetic disease of collagen IV (α3, 4, 5) resulting in renal failure. This study was designed to investigate sex-phenotype correlations and evaluate the contribution of macrophage infiltration to disease progression using Col4a3 knock out (Col4a3KO) mice, an established genetic model of autosomal recessive Alport syndrome. No sex differences in the evolution of body mass loss, renal pathology, biomarkers of tubular damage KIM-1 and NGAL, or deterioration of kidney function were observed during the life span of Col4a3KO mice. These findings confirm that, similar to human autosomal recessive Alport syndrome, female and male Col4a3KO mice develop renal failure at the same age and with similar severity. The specific contribution of macrophage infiltration to Alport disease, one of the prominent features of the disease in human and Col4a3KO mice, remains unknown. This study shows that depletion of kidney macrophages in Col4a3KO male mice by administration of clodronate liposomes, prior to clinical onset of disease and throughout the study period, does not protect the mice from renal failure and interstitial fibrosis, nor delay disease progression. These results suggest that therapy targeting macrophage recruitment to kidney is unlikely to be effective as treatment of Alport syndrome.

  5. [Biological characteristics of an Hog1 MAPK homologous gene FoHog1 knock-out mutant of Fusarium oxysporum f. sp. cubense].

    PubMed

    Mao, Chao; Chen, Pingya; Dai, Qingdong; Yang, Laying; Huang, Junsheng

    2014-11-04

    This study was aimed to obtain a mitogen-activated protein kinase (MAPK) gene namely FoHog1 from Fusarium oxysporum f. sp. cubense and to verify its function. We amplified FoHog1 gene by PCR and RT-PCR methods and analyzed it through bioinformatics method. PEG-mediated protoplast transformation was used to create the deletion mutants of FoHog1 gene. We analyzed different biological characteristics between knock-out strain and wild-type strain. FoHog1 gene encoding a putative protein of 357 amino acids and its genetic relationship with different Fusarium' s protein. Compared with the wild-type strain, FoHog1 deletion mutants have loose hyphae colony, less spores production, lower dry weight of hyphae and more sensitive to temperature, pH and osmotic stress. FoHog1 deletion mutants also have reduced colonization ability compared with the wild-type strain. FoHog1 gene participated in mycelial growth, sporulation, catabolism of sodium acetate and ammonium chloride, osmotic stress response and pathogenic process with Fusarium oxysporum f. sp. cubense Race 4.

  6. [Knocking-out extra domain A alternative splice fragment of fibronectin using a clustered regularly interspaced short palindromic repeats/associated proteins 9 system].

    PubMed

    Yang, Yue; Wang, Haicheng; Xu, Shuyu; Peng, Jing; Jiang, Jiuhui; Li, Cuiying

    2015-08-01

    To investigate the effect of the fibronectin extra domain A on the aggressiveness of salivary adenoid cystic carcinoma (SACC) cells, via the clustered regularly interspaced short palindromic repeats (CRISPR)/ associated proteins (Cas) system. One sgRNA was designed to target the upstream of the genome sequences of extra domain A(EDA) exon and the downstream. Then the sgRNA was linked into plasmid PX-330 and transfected into SACC-83 cells. PCR and DNA sequence were used to testify the knockout cells, and the monoclones of EDA absent SACC cells were selected (A+C-2, A+C-6, B+C-10). CCK-8 cell proliferation and invasion was then tested in control group and the experimental group. The sgRNA was successfully linked into PX-330 plasmid. Part of adenoid cystic carcinoma cells' SACC-83 genomic EDA exon was knocked out, and the knockdown efficiency was above 70%, but the total amount of fibronectin did not change significantly. Three monoclones of EDA absent SACC- 83 cells were successfully selected with diminished migration and proliferation. The CRISPR/Cas9 system was a simplified system with relatively high knockout efficiency and EDA knockout could inhibiting SACC cell's mobility and invasiveness.

  7. Altered learning, memory, and social behavior in type 1 taste receptor subunit 3 knock-out mice are associated with neuronal dysfunction.

    PubMed

    Martin, Bronwen; Wang, Rui; Cong, Wei-Na; Daimon, Caitlin M; Wu, Wells W; Ni, Bin; Becker, Kevin G; Lehrmann, Elin; Wood, William H; Zhang, Yongqing; Etienne, Harmonie; van Gastel, Jaana; Azmi, Abdelkrim; Janssens, Jonathan; Maudsley, Stuart

    2017-07-07

    The type 1 taste receptor member 3 (T1R3) is a G protein-coupled receptor involved in sweet-taste perception. Besides the tongue, the T1R3 receptor is highly expressed in brain areas implicated in cognition, including the hippocampus and cortex. As cognitive decline is often preceded by significant metabolic or endocrinological dysfunctions regulated by the sweet-taste perception system, we hypothesized that a disruption of the sweet-taste perception in the brain could have a key role in the development of cognitive dysfunction. To assess the importance of the sweet-taste receptors in the brain, we conducted transcriptomic and proteomic analyses of cortical and hippocampal tissues isolated from T1R3 knock-out (T1R3KO) mice. The effect of an impaired sweet-taste perception system on cognition functions were examined by analyzing synaptic integrity and performing animal behavior on T1R3KO mice. Although T1R3KO mice did not present a metabolically disrupted phenotype, bioinformatic interpretation of the high-dimensionality data indicated a strong neurodegenerative signature associated with significant alterations in pathways involved in neuritogenesis, dendritic growth, and synaptogenesis. Furthermore, a significantly reduced dendritic spine density was observed in T1R3KO mice together with alterations in learning and memory functions as well as sociability deficits. Taken together our data suggest that the sweet-taste receptor system plays an important neurotrophic role in the extralingual central nervous tissue that underpins synaptic function, memory acquisition, and social behavior. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Automated pipeline to analyze non-contact infrared images of the paraventricular nucleus specific leptin receptor knock-out mouse model

    NASA Astrophysics Data System (ADS)

    Diaz Martinez, Myriam; Ghamari-Langroudi, Masoud; Gifford, Aliya; Cone, Roger; Welch, E. B.

    2015-03-01

    Evidence of leptin resistance is indicated by elevated leptin levels together with other hallmarks of obesity such as a defect in energy homeostasis.1 As obesity is an increasing epidemic in the US, the investigation of mechanisms by which leptin resistance has a pathophysiological impact on energy is an intensive field of research.2 However, the manner in which leptin resistance contributes to the dysregulation of energy, specifically thermoregulation,3 is not known. The aim of this study was to investigate whether the leptin receptor expressed in paraventricular nucleus (PVN) neurons plays a role in thermoregulation at different temperatures. Non-contact infrared (NCIR) thermometry was employed to measure surface body temperature (SBT) of nonanesthetized mice with a specific deletion of the leptin receptor in the PVN after exposure to room (25 °C) and cold (4 °C) temperature. Dorsal side infrared images of wild type (LepRwtwt/sim1-Cre), heterozygous (LepRfloxwt/sim1-Cre) and knock-out (LepRfloxflox/sim1-Cre) mice were collected. Images were input to an automated post-processing pipeline developed in MATLAB to calculate average and maximum SBTs. Linear regression was used to evaluate the relationship between sex, cold exposure and leptin genotype with SBT measurements. Findings indicate that average SBT has a negative relationship to the LepRfloxflox/sim1-Cre genotype, the female sex and cold exposure. However, max SBT is affected by the LepRfloxflox/sim1-Cre genotype and the female sex. In conclusion this data suggests that leptin within the PVN may have a neuroendocrine role in thermoregulation and that NCIR thermometry combined with an automated imaging-processing pipeline is a promising approach to determine SBT in non-anesthetized mice.

  9. Conversion of the Modulatory Actions of Dopamine on Spinal Reflexes from Depression to Facilitation in D3 Receptor Knock-Out Mice

    PubMed Central

    Clemens, Stefan; Hochman, Shawn

    2009-01-01

    Descending monoaminergic systems modulate spinal cord function, yet spinal dopaminergic actions are poorly understood. Using the in vitro lumbar cord, we studied the effects of dopamine and D2-like receptor ligands on spinal reflexes in wild-type (WT) and D3-receptor knock-out mice (D3KO). Low dopamine levels (1µm) decreased the monosynaptic “stretch” reflex (MSR) amplitude in WT animals and increased it in D3KO animals. Higher dopamine concentrations (10 –100µm) decreased MSR amplitudes in both groups, but always more strongly in WT. Like low dopamine, the D3 receptor agonists pergolide and PD 128907 reduced MSR amplitude in WT but not D3KO mice. Conversely, D3 receptor antagonists (GR 103691 and nafadotride) increased the MSR in WT but not in D3KO mice. In comparison,D2-preferring agonists bromocriptine and quinpirole depressed the MSR in both groups. Low dopamine (1–5 µm) also depressed longer-latency (presumably polysynaptic) reflexes in WT but facilitated responses in D3KO mice. Additionally, in some experiments (e.g., during 10 µm dopamine or pergolide in WT), polysynaptic reflexes were facilitated in parallel to MSR depression, demonstrating differential modulatory control of these reflex circuits. Thus, low dopamine activates D3 receptors to limit reflex excitability. Moreover, in D3 ligand-insensitive mice, excitatory actions are unmasked, functionally converting the modulatory action of dopamine from depression to facilitation. Restless legs syndrome (RLS) is a CNS disorder involving abnormal limb sensations. Because RLS symptoms peak at night when dopamine levels are lowest, are relieved by D3 agonists, and likely involve increased reflex excitability, the D3KO mouse putatively explains how impaired D3 activity could contribute to this sleep disorder. PMID:15601940

  10. Increased cellular free cholesterol in macrophage-specific Abca1 knock-out mice enhances pro-inflammatory response of macrophages.

    PubMed

    Zhu, Xuewei; Lee, Ji-Young; Timmins, Jenelle M; Brown, J Mark; Boudyguina, Elena; Mulya, Anny; Gebre, Abraham K; Willingham, Mark C; Hiltbold, Elizabeth M; Mishra, Nilamadhab; Maeda, Nobuyo; Parks, John S

    2008-08-22

    Macrophage-specific Abca1 knock-out (Abca1(-)(M)(/-)(M)) mice were generated to determine the role of macrophage ABCA1 expression in plasma lipoprotein concentrations and the innate immune response of macrophages. Plasma lipid and lipoprotein concentrations in chow-fed Abca1(-)(M)(/-)(M) and wild-type (WT) mice were indistinguishable. Compared with WT macrophages, Abca1(-)(M)(/-)(M) macrophages had a >95% reduction in ABCA1 protein, failed to efflux lipid to apoA-I, and had a significant increase in free cholesterol (FC) and membrane lipid rafts without induction of endoplasmic reticulum stress. Lipopolysaccharide (LPS)-treated Abca1(-)(M)(/-)(M) macrophages exhibited enhanced expression of pro-inflammatory cytokines and increased activation of the NF-kappaB and MAPK pathways, which could be diminished by silencing MyD88 or by chemical inhibition of NF-kappaB or MAPK. In vivo LPS injection also resulted in a higher pro-inflammatory response in Abca1(-)(M)(/-)(M) mice compared with WT mice. Furthermore, cholesterol depletion of macrophages with methyl-beta-cyclodextrin normalized FC content between the two genotypes and their response to LPS; cholesterol repletion of macrophages resulted in increased cellular FC accumulation and enhanced cellular response to LPS. Our results suggest that macrophage ABCA1 expression may protect against atherosclerosis by facilitating the net removal of excess lipid from macrophages and dampening pro-inflammatory MyD88-dependent signaling pathways by reduction of cell membrane FC and lipid raft content.

  11. Conversion of the modulatory actions of dopamine on spinal reflexes from depression to facilitation in D3 receptor knock-out mice.

    PubMed

    Clemens, Stefan; Hochman, Shawn

    2004-12-15

    Descending monoaminergic systems modulate spinal cord function, yet spinal dopaminergic actions are poorly understood. Using the in vitro lumbar cord, we studied the effects of dopamine and D2-like receptor ligands on spinal reflexes in wild-type (WT) and D3-receptor knock-out mice (D3KO). Low dopamine levels (1 microM) decreased the monosynaptic "stretch" reflex (MSR) amplitude in WT animals and increased it in D3KO animals. Higher dopamine concentrations (10-100 microM) decreased MSR amplitudes in both groups, but always more strongly in WT. Like low dopamine, the D3 receptor agonists pergolide and PD 128907 reduced MSR amplitude in WT but not D3KO mice. Conversely, D3 receptor antagonists (GR 103691 and nafadotride) increased the MSR in WT but not in D3KO mice. In comparison, D2-preferring agonists bromocriptine and quinpirole depressed the MSR in both groups. Low dopamine (1-5 microM) also depressed longer-latency (presumably polysynaptic) reflexes in WT but facilitated responses in D3KO mice. Additionally, in some experiments (e.g., during 10 microM dopamine or pergolide in WT), polysynaptic reflexes were facilitated in parallel to MSR depression, demonstrating differential modulatory control of these reflex circuits. Thus, low dopamine activates D3 receptors to limit reflex excitability. Moreover, in D3 ligand-insensitive mice, excitatory actions are unmasked, functionally converting the modulatory action of dopamine from depression to facilitation. Restless legs syndrome (RLS) is a CNS disorder involving abnormal limb sensations. Because RLS symptoms peak at night when dopamine levels are lowest, are relieved by D3 agonists, and likely involve increased reflex excitability, the D3KO mouse putatively explains how impaired D3 activity could contribute to this sleep disorder.

  12. Production of superoxide from photosystem II-light harvesting complex II supercomplex in STN8 kinase knock-out rice mutants under photoinhibitory illumination.

    PubMed

    Poudyal, Roshan Sharma; Nath, Krishna; Zulfugarov, Ismayil S; Lee, Choon-Hwan

    2016-09-01

    When phosphorylation of Photosystem (PS) II core proteins is blocked in STN8 knock-out mutants of rice (Oryza sativa) under photoinhibitory illumination, the mobilization of PSII supercomplex is prevented. We have previously proposed that more superoxide (O2(-)) is produced from PSII in the mutant (Nath et al., 2013, Plant J. 76, 675-686). Here, we clarify the type and site for the generation of reactive oxygen species (ROS). Using both histochemical and fluorescence probes, we observed that, compared with wild-type (WT) leaves, levels of ROS, including O2(-) and hydrogen peroxide (H2O2), were increased when leaves from mutant plants were illuminated with excess light. However, singlet oxygen production was not enhanced under such conditions. When superoxide dismutase was inhibited, O2(-) production was increased, indicating that it is the initial event prior to H2O2 production. In thylakoids isolated from WT leaves, kinase was active in the presence of ATP, and spectrophotometric analysis of nitrobluetetrazolium absorbance for O2(-) confirmed that PSII-driven superoxide production was greater in the mutant thylakoids than in the WT. This contrast in levels of PSII-driven superoxide production between the mutants and the WT plants was confirmed by conducting protein oxidation assays of PSII particles from osstn8 leaves under strong illumination. Those assays also demonstrated that PSII-LHCII supercomplex proteins were oxidized more in the mutant, thereby implying that PSII particles incur greater damage even though D1 degradation during PSII-supercomplex mobilization is partially blocked in the mutant. These results suggest that O2(-) is the major form of ROS produced in the mutant, and that the damaged PSII in the supercomplex is the primary source of O2(-).

  13. Use of zinc-finger nucleases to knock out the WAS gene in K562 cells: a human cellular model for Wiskott-Aldrich syndrome

    PubMed Central

    Toscano, Miguel G.; Anderson, Per; Muñoz, Pilar; Lucena, Gema; Cobo, Marién; Benabdellah, Karim; Gregory, Philip D.; Holmes, Michael C.; Martin, Francisco

    2013-01-01

    SUMMARY Mutations in the WAS gene cause Wiskott-Aldrich syndrome (WAS), which is characterized by eczema, immunodeficiency and microthrombocytopenia. Although the role of WASP in lymphocytes and myeloid cells is well characterized, its role on megakaryocyte (MK) development is poorly understood. In order to develop a human cellular model that mimics the megakaryocytic-derived defects observed in WAS patients we used K562 cells, a well-known model for study of megakaryocytic development. We knocked out the WAS gene in K562 cells using a zinc-finger nuclease (ZFN) pair targeting the WAS intron 1 and a homologous donor DNA that disrupted WASP expression. Knockout of WASP on K562 cells (K562WASKO cells) resulted in several megakaryocytic-related defects such as morphological alterations, lower expression of CD41ɑ, lower increments in F-actin polymerization upon stimulation, reduced CD43 expression and increased phosphatidylserine exposure. All these defects have been previously described either in WAS-knockout mice or in WAS patients, validating K562WASKO as a cell model for WAS. However, K562WASPKO cells showed also increased basal F-actin and adhesion, increased expression of CD61 and reduced expression of TGFβ and Factor VIII, defects that have never been described before for WAS-deficient cells. Interestingly, these phenotypic alterations correlate with different roles for WASP in megakaryocytic differentiation. All phenotypic alterations observed in K562WASKO cells were alleviated upon expression of WAS following lentiviral transduction, confirming the role of WASP in these phenotypes. In summary, in this work we have validated a human cellular model, K562WASPKO, that mimics the megakaryocytic-related defects found in WAS-knockout mice and have found evidences for a role of WASP as regulator of megakaryocytic differentiation. We propose the use of K562WASPKO cells as a tool to study the molecular mechanisms involved in the megakaryocytic-related defects observed

  14. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone

    PubMed Central

    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R.; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L.; Ferris, Craig F.

    2016-01-01

    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain

  15. Use of zinc-finger nucleases to knock out the WAS gene in K562 cells: a human cellular model for Wiskott-Aldrich syndrome.

    PubMed

    Toscano, Miguel G; Anderson, Per; Muñoz, Pilar; Lucena, Gema; Cobo, Marién; Benabdellah, Karim; Gregory, Philip D; Holmes, Michael C; Martin, Francisco

    2013-03-01

    Mutations in the WAS gene cause Wiskott-Aldrich syndrome (WAS), which is characterized by eczema, immunodeficiency and microthrombocytopenia. Although the role of WASP in lymphocytes and myeloid cells is well characterized, its role on megakaryocyte (MK) development is poorly understood. In order to develop a human cellular model that mimics the megakaryocytic-derived defects observed in WAS patients we used K562 cells, a well-known model for study of megakaryocytic development. We knocked out the WAS gene in K562 cells using a zinc-finger nuclease (ZFN) pair targeting the WAS intron 1 and a homologous donor DNA that disrupted WASP expression. Knockout of WASP on K562 cells (K562WASKO cells) resulted in several megakaryocytic-related defects such as morphological alterations, lower expression of CD41, lower increments in F-actin polymerization upon stimulation, reduced CD43 expression and increased phosphatidylserine exposure. All these defects have been previously described either in WAS-knockout mice or in WAS patients, validating K562WASKO as a cell model for WAS. However, K562WASPKO cells showed also increased basal F-actin and adhesion, increased expression of CD61 and reduced expression of TGFβ and Factor VIII, defects that have never been described before for WAS-deficient cells. Interestingly, these phenotypic alterations correlate with different roles for WASP in megakaryocytic differentiation. All phenotypic alterations observed in K562WASKO cells were alleviated upon expression of WAS following lentiviral transduction, confirming the role of WASP in these phenotypes. In summary, in this work we have validated a human cellular model, K562WASPKO, that mimics the megakaryocytic-related defects found in WAS-knockout mice and have found evidences for a role of WASP as regulator of megakaryocytic differentiation. We propose the use of K562WASPKO cells as a tool to study the molecular mechanisms involved in the megakaryocytic-related defects observed in WAS

  16. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci

    PubMed Central

    2013-01-01

    Background Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. Results A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous ‘arms’ target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. Conclusions The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal

  17. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone.

    PubMed

    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L; Ferris, Craig F

    2016-01-01

    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain

  18. Zinc finger nuclease knock-out of NADPH:cytochrome P450 oxidoreductase (POR) in human tumor cell lines demonstrates that hypoxia-activated prodrugs differ in POR dependence.

    PubMed

    Su, Jiechuang; Gu, Yongchuan; Pruijn, Frederik B; Smaill, Jeff B; Patterson, Adam V; Guise, Christopher P; Wilson, William R

    2013-12-27

    Hypoxia, a ubiquitous feature of tumors, can be exploited by hypoxia-activated prodrugs (HAP) that are substrates for one-electron reduction in the absence of oxygen. NADPH:cytochrome P450 oxidoreductase (POR) is considered one of the major enzymes responsible, based on studies using purified enzyme or forced overexpression in cell lines. To examine the role of POR in HAP activation at endogenous levels of expression, POR knock-outs were generated in HCT116 and SiHa cells by targeted mutation of exon 8 using zinc finger nucleases. Absolute quantitation by proteotypic peptide mass spectrometry of DNA sequence-confirmed multiallelic mutants demonstrated expression of proteins with residual one-electron reductase activity in some clones and identified two (Hko2 from HCT116 and S2ko1 from SiHa) that were functionally null by multiple criteria. Sensitivities of the clones to 11 HAP (six nitroaromatics, three benzotriazine N-oxides, and two quinones) were compared with wild-type and POR-overexpressing cells. All except the quinones were potentiated by POR overexpression. Knocking out POR had a marked effect on antiproliferative activity of the 5-nitroquinoline SN24349 in both genetic backgrounds after anoxic exposure but little or no effect on activity of most other HAP, including the clinical stage 2-nitroimidazole mustard TH-302, dinitrobenzamide mustard PR-104A, and benzotriazine N-oxide SN30000. Clonogenic cell killing and reductive metabolism of PR-104A and SN30000 under anoxia also showed little change in the POR knock-outs. Thus, although POR expression is a potential biomarker of sensitivity to some HAP, identification of other one-electron reductases responsible for HAP activation is needed for their rational clinical development.

  19. Zinc Finger Nuclease Knock-out of NADPH:Cytochrome P450 Oxidoreductase (POR) in Human Tumor Cell Lines Demonstrates That Hypoxia-activated Prodrugs Differ in POR Dependence*

    PubMed Central

    Su, Jiechuang; Gu, Yongchuan; Pruijn, Frederik B.; Smaill, Jeff B.; Patterson, Adam V.; Guise, Christopher P.; Wilson, William R.

    2013-01-01

    Hypoxia, a ubiquitous feature of tumors, can be exploited by hypoxia-activated prodrugs (HAP) that are substrates for one-electron reduction in the absence of oxygen. NADPH:cytochrome P450 oxidoreductase (POR) is considered one of the major enzymes responsible, based on studies using purified enzyme or forced overexpression in cell lines. To examine the role of POR in HAP activation at endogenous levels of expression, POR knock-outs were generated in HCT116 and SiHa cells by targeted mutation of exon 8 using zinc finger nucleases. Absolute quantitation by proteotypic peptide mass spectrometry of DNA sequence-confirmed multiallelic mutants demonstrated expression of proteins with residual one-electron reductase activity in some clones and identified two (Hko2 from HCT116 and S2ko1 from SiHa) that were functionally null by multiple criteria. Sensitivities of the clones to 11 HAP (six nitroaromatics, three benzotriazine N-oxides, and two quinones) were compared with wild-type and POR-overexpressing cells. All except the quinones were potentiated by POR overexpression. Knocking out POR had a marked effect on antiproliferative activity of the 5-nitroquinoline SN24349 in both genetic backgrounds after anoxic exposure but little or no effect on activity of most other HAP, including the clinical stage 2-nitroimidazole mustard TH-302, dinitrobenzamide mustard PR-104A, and benzotriazine N-oxide SN30000. Clonogenic cell killing and reductive metabolism of PR-104A and SN30000 under anoxia also showed little change in the POR knock-outs. Thus, although POR expression is a potential biomarker of sensitivity to some HAP, identification of other one-electron reductases responsible for HAP activation is needed for their rational clinical development. PMID:24196959

  20. Mouse Pet-1 knock-out induced 5-HT disruption results in a lack of cognitive deficits and an anxiety phenotype complicated by hypoactivity and defensiveness

    PubMed Central

    Schaefer, Tori L.; Vorhees, Charles V.; Williams, Michael T.

    2009-01-01

    Serotonin (5-HT) is involved in many developmental processes and influences behaviors including anxiety, aggression, and cognition. Disruption of the serotonergic system has been implicated in human disorders including autism, depression, schizophrenia, and ADHD. Although pharmacological, neurotoxin, and dietary manipulation of 5-HT and tryptophan hydroxylase has added to our understanding of the serotonergic system, the results are complicated by multiple factors. A newly identified ETS domain transcription factor, Pet-1, has direct control of major aspects of 5-HT neuronal development. Pet-1 is the only known factor that is restricted in the brain to 5-HT neurons during development and adulthood and exerts dominant control over 5-HT neuronal phenotype. Disruption of Pet-1 produces an ∼80% loss of 5-HT neurons and content and results in increased aggression in male Pet-1-/- mice (Hendricks et al., 2003). We hypothesized that Pet-1-/- mice would also exhibit changes in anxiety and cognition. Pet-1-/- mice were hypoactive which may have affected the observed lack of anxious behavior in the elevated zero maze and light-dark test. Pet-1-/- mice, however, were more defensive during marble burying and showed acoustic startle hyper-reactivity. No deficits in spatial, egocentric, or novel object recognition learning were found in Pet-1-/- mice. These findings were unexpected given that 5-HT depleting drugs given to adult or developing animals result in learning deficits (Mazer et al., 1997;Morford et al., 2002;Vorhees et al., 2007). Lack of differences may be the result of compensatory mechanisms in reaction to a constitutive knockout of Pet-1 or 5-HT may not be as important in learning and memory as previously suspected. PMID:19786075

  1. Circadian rhythms in heart rate, motility, and body temperature of wild-type C57 and eNOS knock-out mice under light-dark, free-run, and after time zone transition.

    PubMed

    Arraj, M; Lemmer, B

    2006-01-01

    The nitric oxide (NO) system is involved in the regulation of the cardiovascular system in controlling central and peripheral vascular tone and cardiac functions. It was the aim of this study to investigate in wild-type C57BL/6 and endothelial nitric oxide synthase (eNOS) knock-out mice (eNOS-/-) the contribution of NO on the circadian rhythms in heart rate (HR), motility (motor activity [MA]), and body temperature (BT) under various environmental conditions. Experiments were performed in 12:12 h of a light:dark cycle (LD), under free-run in total darkness (DD), and after a phase delay shift of the LD cycle by -6 h (i.e., under simulation of a westward time zone transition). All parameters were monitored by radiotelemetry in freely moving mice. In LD, no significant differences in the rhythms of HR and MA were observed between the two strains of mice. BT, however, was significantly lower during the light phase in eNOS-/- mice, resulting in a significantly greater amplitude. The period of the free-running rhythm in DD was slightly shorter for all variables, though not significant. In general, rhythmicity was greater in eNOS-/- than in C57 mice both in LD and DD. After a delay shift of the LD cycle, HR and BT were resynchronized to the new LD schedule within 5-6 days, and resynchronization of MA occurred within 2-3 days. The results in telemetrically instrumented mice show that complete knock-out of the endothelial NO system--though expressed in the suprachiasmatic nuclei and in peripheral tissues--did not affect the circadian organization of heart rate and motility. The circadian regulation of the body temperature was slightly affected in eNOS-/- mice.

  2. Working Memory Impairment in Calcineurin Knock-out Mice Is Associated with Alterations in Synaptic Vesicle Cycling and Disruption of High-Frequency Synaptic and Network Activity in Prefrontal Cortex

    PubMed Central

    Cottrell, Jeffrey R.; Levenson, Jonathan M.; Kim, Sung Hyun; Gibson, Helen E.; Richardson, Kristen A.; Sivula, Michael; Li, Bing; Ashford, Crystle J.; Heindl, Karen A.; Babcock, Ryan J.; Rose, David M.; Hempel, Chris M.; Wiig, Kjesten A.; Laeng, Pascal; Levin, Margaret E.; Ryan, Timothy A.

    2013-01-01

    Working memory is an essential component of higher cognitive function, and its impairment is a core symptom of multiple CNS disorders, including schizophrenia. Neuronal mechanisms supporting working memory under normal conditions have been described and include persistent, high-frequency activity of prefrontal cortical neurons. However, little is known about the molecular and cellular basis of working memory dysfunction in the context of neuropsychiatric disorders. To elucidate synaptic and neuronal mechanisms of working memory dysfunction, we have performed a comprehensive analysis of a mouse model of schizophrenia, the forebrain-specific calcineurin knock-out mouse. Biochemical analyses of cortical tissue from these mice revealed a pronounced hyperphosphorylation of synaptic vesicle cycling proteins known to be necessary for high-frequency synaptic transmission. Examination of the synaptic vesicle cycle in calcineurin-deficient neurons demonstrated an impairment of vesicle release enhancement during periods of intense stimulation. Moreover, brain slice and in vivo electrophysiological analyses showed that loss of calcineurin leads to a gene dose-dependent disruption of high-frequency synaptic transmission and network activity in the PFC, correlating with selective working memory impairment. Finally, we showed that levels of dynamin I, a key presynaptic protein and calcineurin substrate, are significantly reduced in prefrontal cortical samples from schizophrenia patients, extending the disease relevance of our findings. Our data provide support for a model in which impaired synaptic vesicle cycling represents a critical node for disease pathologies underlying the cognitive deficits in schizophrenia. PMID:23825400

  3. Sensitivity of heterozygous α1,6-fucosyltransferase knock-out mice to cigarette smoke-induced emphysema: implication of aberrant transforming growth factor-β signaling and matrix metalloproteinase gene expression.

    PubMed

    Gao, Congxiao; Maeno, Toshitaka; Ota, Fumi; Ueno, Manabu; Korekane, Hiroaki; Takamatsu, Shinji; Shirato, Ken; Matsumoto, Akio; Kobayashi, Satoshi; Yoshida, Keiichi; Kitazume, Shinobu; Ohtsubo, Kazuaki; Betsuyaku, Tomoko; Taniguchi, Naoyuki

    2012-05-11

    We previously demonstrated that a deficiency in core fucosylation caused by the genetic disruption of α1,6-fucosyltransferase (Fut8) leads to lethal abnormalities and the development of emphysematous lesions in the lung by attenuation of TGF-β1 receptor signaling. Herein, we investigated the physiological relevance of core fucosylation in the pathogenesis of emphysema using viable heterozygous knock-out mice (Fut8(+/-)) that were exposed to cigarette smoke (CS). The Fut8(+/-) mice exhibited a marked decrease in FUT8 activity, and matrix metalloproteinase (MMP)-9 activities were elevated in the lung at an early stage of exposure. Emphysema developed after a 3-month CS exposure, accompanied by the recruitment of large numbers of macrophages to the lung. CS exposure substantially and persistently elevated the expression level of Smad7, resulting in a significant reduction of Smad2 phosphorylation (which controls MMP-9 expression) in Fut8(+/-) mice and Fut8-deficient embryonic fibroblast cells. These in vivo and in vitro studies show that impaired core fucosylation enhances the susceptibility to CS and constitutes at least part of the disease process of emphysema, in which TGF-β-Smad signaling is impaired and the MMP-mediated destruction of lung parenchyma is up-regulated.

  4. IWTS metal-water reaction rate evaluation (Fauske and Associates report 99-26)

    SciTech Connect

    DUNCAN, D.R.

    1999-07-29

    The report presents a thermal stability analysis of partially metallic particulate in two IWTS components, the knock out pot and settlers. Particulate in the knock out pot is thermally stable for combinations of average particle size and metal mass fraction which appear realistic. Particulate in the settlers is thermally stable when a realistic account of particle reactions over time, metal fraction, and size distribution is considered.

  5. Intradermal Immunization of Leishmania donovani Centrin Knock-Out Parasites in Combination with Salivary Protein LJM19 from Sand Fly Vector Induces a Durable Protective Immune Response in Hamsters

    PubMed Central

    Fiuza, Jacqueline Araújo; Dey, Ranadhir; Davenport, Dwann; Abdeladhim, Maha; Meneses, Claudio; Oliveira, Fabiano; Kamhawi, Shaden; Valenzuela, Jesus G.; Gannavaram, Sreenivas; Nakhasi, Hira L.

    2016-01-01

    Background Visceral leishmaniasis (VL) is a neglected tropical disease and is fatal if untreated. There is no vaccine available against leishmaniasis. The majority of patients with cutaneous leishmaniasis (CL) or VL develop a long-term protective immunity after cure from infection, which indicates that development of an effective vaccine against leishmaniasis is possible. Such protection may also be achieved by immunization with live attenuated parasites that do not cause disease. We have previously reported a protective response in mice, hamsters and dogs with Leishmania donovani centrin gene knock-out parasites (LdCen-/-), a live attenuated parasite with a cell division specific centrin1 gene deletion. In this study we have explored the effects of salivary protein LJM19 as an adjuvant and intradermal (ID) route of immunization on the efficacy of LdCen-/- parasites as a vaccine against virulent L. donovani. Methodology/Principal Findings To explore the potential of a combination of LdCen-/- parasites and salivary protein LJM19 as vaccine antigens, LdCen-/- ID immunization followed by ID challenge with virulent L. donovani were performed in hamsters in a 9-month follow up study. We determined parasite burden (serial dilution), antibody production (ELISA) and cytokine expression (qPCR) in these animals. Compared to controls, animals immunized with LdCen-/- + LJM19 induced a strong antibody response, a reduction in spleen and liver parasite burden and a higher expression of pro-inflammatory cytokines after immunization and one month post-challenge. Additionally, a low parasite load in lymph nodes, spleen and liver, and a non-inflamed spleen was observed in immunized animals 9 months after the challenge infection. Conclusions Our results demonstrate that an ID vaccination using LdCen-/-parasites in combination with sand fly salivary protein LJM19 has the capability to confer long lasting protection against visceral leishmaniasis that is comparable to intravenous or

  6. Single and Compound Knock-outs of MicroRNA (miRNA)-155 and Its Angiogenic Gene Target CCN1 in Mice Alter Vascular and Neovascular Growth in the Retina via Resident Microglia*

    PubMed Central

    Yan, Lulu; Lee, Sangmi; Lazzaro, Douglas R.; Aranda, Jacob; Grant, Maria B.; Chaqour, Brahim

    2015-01-01

    The response of the retina to ischemic insult typically leads to aberrant retinal neovascularization, a major cause of blindness. The epigenetic regulation of angiogenic gene expression by miRNAs provides new prospects for their therapeutic utility in retinal neovascularization. Here, we focus on miR-155, a microRNA functionally important in inflammation, which is of paramount importance in the pathogenesis of retinal neovascularization. Whereas constitutive miR-155-deficiency in mice results in mild vascular defects, forced expression of miR-155 causes endothelial hyperplasia and increases microglia count and activation. The mouse model of oxygen-induced retinopathy, which recapitulates ischemia-induced aberrant neovessel growth, is characterized by increased expression of miR-155 and localized areas of microglia activation. Interestingly, miR-155 deficiency in mice reduces microglial activation, curtails abnormal vessel growth, and allows for rapid normalization of the retinal vasculature following ischemic insult. miR-155 binds to the 3′-UTR and represses the expression of the CCN1 gene, which encodes an extracellular matrix-associated integrin-binding protein that both promotes physiological angiogenesis and harnesses growth factor-induced abnormal angiogenic responses. Single CCN1 deficiency or double CCN1 and miR-155 knock-out in mice causes retinal vascular malformations typical of faulty maturation, mimicking the vascular alterations of miR-155 gain of function. During development, the miR-155/CCN1 regulatory axis balances the proangiogenic and proinflammatory activities of microglia to allow for their function as guideposts for sprout fusion and anastomosis. Under ischemic conditions, dysregulated miR-155 and CCN1 expression increases the inflammatory load and microglial activation, prompting aberrant angiogenic responses. Thus, miR-155 functions in tandem with CCN1 to modulate inflammation-induced vascular homeostasis and repair. PMID:26242736

  7. Effects of Ascorbic Acid on Carcinogenicity and Acute Toxicity of Nickel Subsulfide, and on Tumor Transplants Growth in Gulonolactone Oxidase Knock-Out Mice and Wild-type C57BL Mice

    PubMed Central

    Kasprzak, Kazimierz S.; Diwan, Bhalchandra A.; Kaczmarek, Monika Z.; Logsdon, Daniel L.; Fivash, Mathew J.; Salnikow, Konstantin

    2011-01-01

    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono--lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni3S2), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni3S2 carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni3S2. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni3S2 in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni3S2 carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni3S2 and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies. PMID:21878346

  8. Effects of ascorbic acid on carcinogenicity and acute toxicity of nickel subsulfide, and on tumor transplants growth in gulonolactone oxidase knock-out mice and wild-type C57BL mice.

    PubMed

    Kasprzak, Kazimierz S; Diwan, Bhalchandra A; Kaczmarek, Monika Z; Logsdon, Daniel L; Fivash, Mathew J; Salnikow, Konstantin

    2011-11-15

    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono--lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni₃S₂), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni₃S₂ carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni₃S₂. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni₃S₂ in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni₃S₂ carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni₃S₂ and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies.

  9. Single and Compound Knock-outs of MicroRNA (miRNA)-155 and Its Angiogenic Gene Target CCN1 in Mice Alter Vascular and Neovascular Growth in the Retina via Resident Microglia.

    PubMed

    Yan, Lulu; Lee, Sangmi; Lazzaro, Douglas R; Aranda, Jacob; Grant, Maria B; Chaqour, Brahim

    2015-09-18

    The response of the retina to ischemic insult typically leads to aberrant retinal neovascularization, a major cause of blindness. The epigenetic regulation of angiogenic gene expression by miRNAs provides new prospects for their therapeutic utility in retinal neovascularization. Here, we focus on miR-155, a microRNA functionally important in inflammation, which is of paramount importance in the pathogenesis of retinal neovascularization. Whereas constitutive miR-155-deficiency in mice results in mild vascular defects, forced expression of miR-155 causes endothelial hyperplasia and increases microglia count and activation. The mouse model of oxygen-induced retinopathy, which recapitulates ischemia-induced aberrant neovessel growth, is characterized by increased expression of miR-155 and localized areas of microglia activation. Interestingly, miR-155 deficiency in mice reduces microglial activation, curtails abnormal vessel growth, and allows for rapid normalization of the retinal vasculature following ischemic insult. miR-155 binds to the 3'-UTR and represses the expression of the CCN1 gene, which encodes an extracellular matrix-associated integrin-binding protein that both promotes physiological angiogenesis and harnesses growth factor-induced abnormal angiogenic responses. Single CCN1 deficiency or double CCN1 and miR-155 knock-out in mice causes retinal vascular malformations typical of faulty maturation, mimicking the vascular alterations of miR-155 gain of function. During development, the miR-155/CCN1 regulatory axis balances the proangiogenic and proinflammatory activities of microglia to allow for their function as guideposts for sprout fusion and anastomosis. Under ischemic conditions, dysregulated miR-155 and CCN1 expression increases the inflammatory load and microglial activation, prompting aberrant angiogenic responses. Thus, miR-155 functions in tandem with CCN1 to modulate inflammation-induced vascular homeostasis and repair.

  10. Activation of NADPH-recycling systems in leaves and roots of Arabidopsis thaliana under arsenic-induced stress conditions is accelerated by knock-out of Nudix hydrolase 19 (AtNUDX19) gene.

    PubMed

    Corpas, Francisco J; Aguayo-Trinidad, Simeón; Ogawa, Takahisa; Yoshimura, Kazuya; Shigeoka, Shigeru

    2016-03-15

    NADPH is an important cofactor in cell growth, proliferation and detoxification. Arabidopsis thaliana Nudix hydrolase 19 (AtNUDX19) belongs to a family of proteins defined by the conserved amino-acid sequence GX5-EX7REUXEEXGU which has the capacity to hydrolyze NADPH as a physiological substrate in vivo. Given the importance of NADPH in the cellular redox homeostasis of plants, the present study compares the responses of the main NADPH-recycling systems including NADP-isocitrate dehydrogenase (ICDH), glucose-6-phosphate dehydrogenase (G6PDH), 6-phosphogluconate dehydrogenase (6PGDH) and NADP-malic enzyme (ME) in the leaves and roots of Arabidopsis wild-type (Wt) and knock-out (KO) AtNUDX19 mutant (Atnudx19) plants under physiological and arsenic-induced stress conditions. Two major features were observed in the behavior of the main NADPH-recycling systems: (i) under optimal conditions in both organs, the levels of these activities were higher in nudx19 mutants than in Wt plants; and, (ii) under 500μM AsV conditions, these activities increase, especially in nudx19 mutant plants. Moreover, G6PDH activity in roots was the most affected enzyme in both Wt and nudx19 mutant plants, with a 4.6-fold and 5.0-fold increase, respectively. In summary, the data reveals a connection between the absence of chloroplastic AtNUDX19 and the rise in all NADP-dehydrogenase activities under physiological and arsenic-induced stress conditions, particularly in roots. This suggests that AtNUDX19 could be a key factor in modulating the NADPH pool in plants and consequently in redox homeostasis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  11. Intradermal Immunization of Leishmania donovani Centrin Knock-Out Parasites in Combination with Salivary Protein LJM19 from Sand Fly Vector Induces a Durable Protective Immune Response in Hamsters.

    PubMed

    Fiuza, Jacqueline Araújo; Dey, Ranadhir; Davenport, Dwann; Abdeladhim, Maha; Meneses, Claudio; Oliveira, Fabiano; Kamhawi, Shaden; Valenzuela, Jesus G; Gannavaram, Sreenivas; Nakhasi, Hira L

    2016-01-01

    Visceral leishmaniasis (VL) is a neglected tropical disease and is fatal if untreated. There is no vaccine available against leishmaniasis. The majority of patients with cutaneous leishmaniasis (CL) or VL develop a long-term protective immunity after cure from infection, which indicates that development of an effective vaccine against leishmaniasis is possible. Such protection may also be achieved by immunization with live attenuated parasites that do not cause disease. We have previously reported a protective response in mice, hamsters and dogs with Leishmania donovani centrin gene knock-out parasites (LdCen-/-), a live attenuated parasite with a cell division specific centrin1 gene deletion. In this study we have explored the effects of salivary protein LJM19 as an adjuvant and intradermal (ID) route of immunization on the efficacy of LdCen-/- parasites as a vaccine against virulent L. donovani. To explore the potential of a combination of LdCen-/- parasites and salivary protein LJM19 as vaccine antigens, LdCen-/- ID immunization followed by ID challenge with virulent L. donovani were performed in hamsters in a 9-month follow up study. We determined parasite burden (serial dilution), antibody production (ELISA) and cytokine expression (qPCR) in these animals. Compared to controls, animals immunized with LdCen-/- + LJM19 induced a strong antibody response, a reduction in spleen and liver parasite burden and a higher expression of pro-inflammatory cytokines after immunization and one month post-challenge. Additionally, a low parasite load in lymph nodes, spleen and liver, and a non-inflamed spleen was observed in immunized animals 9 months after the challenge infection. Our results demonstrate that an ID vaccination using LdCen-/-parasites in combination with sand fly salivary protein LJM19 has the capability to confer long lasting protection against visceral leishmaniasis that is comparable to intravenous or intracardial immunization.

  12. Depletion of CD4+CD25+ regulatory T cells exacerbates sodium iodide-induced experimental autoimmune thyroiditis in human leucocyte antigen DR3 (DRB1*0301) transgenic class II-knock-out non-obese diabetic mice.

    PubMed

    Flynn, J C; Meroueh, C; Snower, D P; David, C S; Kong, Y M

    2007-03-01

    Both genetic and environmental factors contribute to autoimmune disease development. Previously, we evaluated genetic factors in a humanized mouse model of Hashimoto's thyroiditis (HT) by immunizing human leucocyte antigen DR3 (HLA-DR3) and HLA-DQ8 transgenic class II-knock-out non-obese diabetic (NOD) mice. DR3+ mice were susceptible to experimental autoimmune thyroiditis (EAT) induction by both mouse thyroglobulin (mTg) and human (h) Tg, while DQ8+ mice were weakly susceptible only to hTg. As one environmental factor associated with HT and tested in non-transgenic models is increased sodium iodide (NaI) intake, we examined the susceptibility of DR3+ and/or DQ8+ mice to NaI-induced disease. Mice were treated for 8 weeks with NaI in the drinking water. At 0 x 05% NaI, 23% of DR3+, 0% of DQ8+ and 20% of DR3+DQ8+ mice had thyroid destruction. No spleen cell proliferation to mTg was observed. Most mice had undetectable anti-mTg antibodies, but those with low antibody levels usually had thyroiditis. At 0.3% NaI, a higher percentage of DR3+ and DR3+DQ8+ mice developed destructive thyroiditis, but it was not statistically significant. However, when DR3+ mice had been depleted of CD4+CD25+ regulatory T cells prior to NaI treatment, destructive thyroiditis (68%) and serum anti-mTg antibodies were exacerbated further. The presence of DQ8 molecules does not alter the susceptibility of DR3+DQ8+ mice to NaI-induced thyroiditis, similar to earlier findings with mTg-induced EAT. Susceptibility of DR3+ mice to NaI-induced EAT, in both the presence and absence of regulatory T cells, demonstrates the usefulness of HLA class II transgenic mice in evaluating the roles of environmental factors and immune dysregulation in autoimmune thyroid disease.

  13. Effects of ascorbic acid on carcinogenicity and acute toxicity of nickel subsulfide, and on tumor transplants growth in gulonolactone oxidase knock-out mice and wild-type C57BL mice

    SciTech Connect

    Kasprzak, Kazimierz S.; Diwan, Bhalchandra A.; Kaczmarek, Monika Z.; Logsdon, Daniel L.; Fivash, Mathew J.; Salnikow, Konstantin

    2011-11-15

    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono- < gamma > -lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni{sub 3}S{sub 2}), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni{sub 3}S{sub 2} carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni{sub 3}S{sub 2}. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni{sub 3}S{sub 2} in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni{sub 3}S{sub 2} carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni{sub 3}S{sub 2} and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies. -- Highlights: Black-Right-Pointing-Pointer Ascorbate depletion enhances carcinogenicity and acute toxicity of nickel. Black-Right-Pointing-Pointer Gulo-/- mice unable to synthesize ascorbate were used in this study. Black

  14. Meperidine, remifentanil and tramadol but not sufentanil interact with alpha(2)-adrenoceptors in alpha(2A)-, alpha(2B)- and alpha(2C)-adrenoceptor knock out mice brain.

    PubMed

    Höcker, Jan; Weber, Bernd; Tonner, Peter H; Scholz, Jens; Brand, Philipp-Alexander; Ohnesorge, Henning; Bein, Berthold

    2008-03-17

    alpha(2)-adrenoceptor agonists like clonidine or dexmedetomidine increase the sedative and analgesic actions of opioids. Furthermore opioids like meperidine show potent anti-shivering effects like alpha(2)-adrenoceptor agonists. The underlying molecular mechanisms of these effects are still poorly defined. The authors therefore studied the ability of four different opioids (meperidine, remifentanil, sufentanil and tramadol) to interact with different alpha(2)-adrenoceptor subtypes in mice lacking individual alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptors (alpha(2)-adrenoceptor knock out (alpha(2)-AR KO) mice)). The interaction of opioids with alpha(2)-adrenoceptors was investigated by quantitative receptor autoradiography in brain slices of alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptor deficient mice. Displacement of the radiolabelled alpha(2)-adrenoceptor agonist [(125)I]-paraiodoclonidine ([(125)I]-PIC) from alpha(2)-adrenoceptors in different brain regions by increasing opioid concentrations was measured, and binding affinity of the analysed opioids to alpha(2)-adrenoceptor subtypes in different brain regions was quantified. Meperidine, remifentanil and tramadol but not sufentanil provoked dose dependent displacement of specifically bound [(125)I]-PIC from all alpha(2)-adrenoceptor subtypes in cortex, cerebellum, medulla oblongata, thalamus, hippocampus and pons. Required concentrations of meperidine and remifentanil for [(125)I]-PIC displacement from alpha(2B)- and alpha(2C)-adrenoceptors were lower than from alpha(2A)-adrenoceptors, indicating higher binding affinity for alpha(2B)- and alpha(2C)-adrenoceptors. In contrast, [(125)I]-PIC displacement by tramadol indicated higher binding affinity to alpha(2A)-adrenoceptors than to alpha(2B)- and alpha(2C)-adrenoceptors. Our results indicate that meperidine, remifentanil and tramadol interact with alpha(2)-adrenoceptors in mouse brain showing different affinity for alpha(2A)-, alpha(2B)- and alpha(2C

  15. Comparative Analysis of the Effects of Hydroxysafflor Yellow A and Anhydrosafflor Yellow B in Safflower Series of Herb Pairs Using Prep-HPLC and a Selective Knock-Out Approach.

    PubMed

    Qu, Cheng; Wang, Lin-Yan; Jin, Wen-Tao; Tang, Yu-Ping; Jin, Yi; Shi, Xu-Qin; Shang, Li-Li; Shang, Er-Xin; Duan, Jin-Ao

    2016-11-06

    The flower of Carthamus tinctorius L. (Carthami Flos, safflower), important in traditional Chinese medicine (TCM), is known for treating blood stasis, coronary heart disease, hypertension, and cerebrovascular disease in clinical and experimental studies. It is widely accepted that hydroxysafflor yellow A (HSYA) and anhydrosafflor yellow B (ASYB) are the major bioactive components of many formulae comprised of safflower. In this study, selective knock-out of target components such as HSYA and ASYB by using preparative high performance liquid chromatography (prep-HPLC) followed by antiplatelet and anticoagulation activities evaluation was used to investigate the roles of bioactive ingredients in safflower series of herb pairs. The results showed that both HSYA and ASYB not only played a direct role in activating blood circulation, but also indirectly made a contribution to the total bioactivity of safflower series of herb pairs. The degree of contribution of HSYA in the safflower and its series herb pairs was as follows: Carthami Flos-Ginseng Radix et Rhizoma Rubra (CF-GR) > Carthami Flos-Sappan Lignum (CF-SL) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Astragali Radix (CF-AR) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Glycyrrhizae Radix et Rhizoma (CF-GL) > Carthami Flos-Salviae Miltiorrhizae Radix et Rhizoma (CF-SM) > Carthami Flos (CF), and the contribution degree of ASYB in the safflower and its series herb pairs: CF-GL > CF-PS > CF-AS > CF-SL > CF-SM > CF-AR > CF-GR > CF. So, this study provided a significant and effective approach to elucidate the contribution of different herbal components to the bioactivity of the herb pair, and clarification of the variation of herb-pair compatibilities. In addition, this study provides guidance for investigating the relationship between herbal compounds and the bioactivities of herb pairs. It also provides a scientific basis for reasonable clinical applications and new drug

  16. Neer Award 2016: reduced muscle degeneration and decreased fatty infiltration after rotator cuff tear in a poly(ADP-ribose) polymerase 1 (PARP-1) knock-out mouse model.

    PubMed

    Kuenzler, Michael B; Nuss, Katja; Karol, Agnieszka; Schär, Michael O; Hottiger, Michael; Raniga, Sumit; Kenkel, David; von Rechenberg, Brigitte; Zumstein, Matthias A

    2017-05-01

    Disturbed muscular architecture, atrophy, and fatty infiltration remain irreversible in chronic rotator cuff tears even after repair. Poly (adenosine 5'-diphosphate-ribose) polymerase 1 (PARP-1) is a key regulator of inflammation, apoptosis, muscle atrophy, muscle regeneration, and adipocyte development. We hypothesized that the absence of PARP-1 would lead to a reduction in damage to the muscle subsequent to combined tenotomy and neurectomy in a PARP-1 knockout (KO) mouse model. PARP-1 KO and wild-type C57BL/6 (WT group) mice were analyzed at 1, 6, and 12 weeks (total n = 84). In all mice, the supraspinatus and infraspinatus muscles of the left shoulder were detached and denervated. Macroscopic analysis, magnetic resonance imaging, gene expression analysis, immunohistochemistry, and histology were used to assess the differences in PARP-1 KO and WT mice. The muscles in the PARP-1 KO group had significantly less retraction, atrophy, and fatty infiltration after 12 weeks than in the WT group. Gene expression of inflammatory, apoptotic, adipogenic, and muscular atrophy genes was significantly decreased in PARP-1 KO mice in the first 6 weeks. Absence of PARP-1 leads to a reduction in muscular architectural damage, early inflammation, apoptosis, atrophy, and fatty infiltration after combined tenotomy and neurectomy of the rotator cuff muscle. Although the macroscopic reaction to injury is similar in the first 6 weeks, the ability of the muscles to regenerate was much greater in the PARP-1 KO group, leading to a near-normalization of the muscle after 12 weeks. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  17. Help NCI at Frederick “Knock Out Hunger” | Poster

    Cancer.gov

    NCI at Frederick is once again participating in the Feds Feed Families initiative, an annual food drive that addresses severe shortages of non-perishable items in food banks across D.C., Maryland, and Virginia during the summer months, when giving is at its lowest.

  18. Moon formation: Punch combo or knock-out blow?

    NASA Astrophysics Data System (ADS)

    Collins, Gareth S.

    2017-01-01

    The twin isotopic signatures of the Moon and Earth are difficult to explain by a single giant impact. Impact simulations suggest that making the Moon by a combination of multiple, smaller moonlet-forming impacts may work better.

  19. Knock-Out Models Reveal New Aquaporin Functions

    PubMed Central

    Verkman, Alan S.

    2013-01-01

    Knockout mice have been informative in the discovery of unexpected biological functions of aquaporins. Knockout mice have confirmed the predicted roles of aquaporins in transepithelial fluid transport, as in the urinary concentrating mechanism and glandular fluid secretion. A less obvious, though predictable role of aquaporins is in tissue swelling under stress, as in the brain in stroke, tumor and infection. Phenotype analysis of aquaporin knockout mice has revealed several unexpected cellular roles of aquaporins whose mechanisms are being elucidated. Aquaporins facilitate cell migration, as seen in aquaporin-dependent tumor angiogenesis and tumor metastasis, by a mechanism that may involve facilitated water transport in lamellipodia of migrating cells. The ‘aquaglyceroporins’, aquaporins that transport both glycerol and water, regulate glycerol content in epidermis, fat and other tissues, and lead to a multiplicity of interesting consequences of gene disruption including dry skin, resistance to skin carcinogenesis, impaired cell proliferation and altered fat metabolism. An even more surprising role of a mammalian aquaporin is in neural signal transduction in the central nervous system. The many roles of aquaporins might be exploited for clinical benefit by modulation of aquaporin expression/function – as diuretics, and in the treatment of brain swelling, glaucoma, epilepsy, obesity and cancer. PMID:19096787

  20. Knocking out knotweed: research pins down a rogue invasive

    Treesearch

    Natasha Vizcarra; Shannon Claeson

    2015-01-01

    Bohemian knotweed spreads aggressively along rivers. This invasive weed chokes waterways, displaces native plants, erodes riverbanks, and keeps tree seedlings from growing. Communities in the Pacific Northwest spend millions of dollars to eradicate it on the assumption that it harms fish habitats.But knotweed is difficult to kill. It takes...

  1. Mice expressing the human CYP7A1 gene in the mouse CYP7A1 knock-out background lack induction of CYP7A1 expression by cholesterol feeding and have increased hypercholesterolemia when fed a high fat diet.

    PubMed

    Chen, Jean Y; Levy-Wilson, Beatriz; Goodart, Sheryl; Cooper, Allen D

    2002-11-08

    Cholesterol 7alpha-hydroxylase (CYP7A1) catalyzes the rate-limiting step in the pathway responsible for the formation of the majority of bile acids. Transcription of the gene is regulated by the size of the bile acid pool and dietary and hormonal factors. The farnesoid X receptor and the liver X receptor (LXR) are responsible for regulation by bile acids and cholesterol, respectively. To study the effects of dietary cholesterol and fat upon expression of the human CYP7A1 gene, mice were generated by crossing transgenic mice carrying the human CYP7A1 gene with mice that were homozygous knock-outs (CYP7A1(-/-)). The mice (mCYP7A1(-/-)/hCYP7A1) expressed the human gene at much higher levels than did the transgenics bred in the wild-type background. A diet containing 1% cholic acid reduced the expression of the human gene in mCYP7A1(-/-)/hCYP7A1 mice to undetectable levels. Cholestyramine (5%) increased the level of expression of the human gene and the mouse gene. Thus, farnesoid X receptor-mediated regulation was preserved. A diet containing 2% cholesterol increased expression of the mouse gene in wild-type mice, but it did not affect expression of the human gene in mCYP7A1(-/-)/hCYP7A1 mice. None of the diets altered the serum cholesterol or triglyceride levels in these mice; 1% cholic acid caused a redistribution of cholesterol from the high density lipoprotein to the low density lipoprotein density in the humanized mice but not in wild-type mice. A diet containing 30% saturated fat and 2% cholesterol caused a decrease in CYP7A1 levels in mCYP7A1(-/-)/hCYP7A1 mice. The serum cholesterol levels rose in all mice fed this diet. The increase was greater in the mCYP7A1(-/-)/hCYP7A1 mice. Together, these data suggest that the lack of an LXR element in the region from -56 to -49 of the human CYP7A1 promoter may account for some of the differences in response to diets between humans and rodents.

  2. Isotopic effects in the ( π±, 2N) reactions on 16O and 18O

    NASA Astrophysics Data System (ADS)

    Altman, A.; Ashery, D.; Piasetzky, E.; Lichtenstadt, J.; Yavin, A. I.; Bertl, W.; Felawka, L.; Walter, H. K.; Powers, R. J.; Winter, R. G.; v. d. Pluym, J.

    1984-09-01

    The ( π+, 2p), ( π+, pn) and ( π-, pn) reactions on 16O and 18O were studied at 165 MeV. The cross section for the ( π+, 2p) reaction on 18O is larger than that for 16O be only 5% ± 3%, while the total π+ absorption cross section is larger by 17% ± 5%. This supports the assumption that two-nucleon absorption occurs mainly on nucleons in the same shell. It is further concluded that Δ++n → pp is not only absorption mechanism that couples strongly to the nucleon knock out reactions.

  3. How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    NASA Technical Reports Server (NTRS)

    Ladbury, Ray

    2014-01-01

    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  4. Autistic-Like Traits and Cerebellar Dysfunction in Purkinje Cell PTEN Knock-Out Mice.

    PubMed

    Cupolillo, Dario; Hoxha, Eriola; Faralli, Alessio; De Luca, Annarita; Rossi, Ferdinando; Tempia, Filippo; Carulli, Daniela

    2016-05-01

    Autism spectrum disorders (ASDs) are neurodevelopmental disorders characterized by impaired social interaction, isolated areas of interest, and insistence on sameness. Mutations in Phosphatase and tensin homolog missing on chromosome 10 (PTEN) have been reported in individuals with ASDs. Recent evidence highlights a crucial role of the cerebellum in the etiopathogenesis of ASDs. In the present study we analyzed the specific contribution of cerebellar Purkinje cell (PC) PTEN loss to these disorders. Using the Cre-loxP recombination system, we generated conditional knockout mice in which PTEN inactivation was induced specifically in PCs. We investigated PC morphology and physiology as well as sociability, repetitive behavior, motor learning, and cognitive inflexibility of adult PC PTEN-mutant mice. Loss of PTEN in PCs results in autistic-like traits, including impaired sociability, repetitive behavior and deficits in motor learning. Mutant PCs appear hypertrophic and show structural abnormalities in dendrites and axons, decreased excitability, disrupted parallel fiber and climbing fiber synapses and late-onset cell death. Our results unveil new roles of PTEN in PC function and provide the first evidence of a link between the loss of PTEN in PCs and the genesis of ASD-like traits.

  5. Aryl hydrocarbon receptor knock-out exacerbates choroidal neovascularization via multiple pathogenic pathways

    PubMed Central

    Choudhary, Mayur; Kazmin, Dmitri; Hu, Peng; Thomas, Russell S; McDonnell, Donald P; Malek, Goldis

    2015-01-01

    The aryl hydrocarbon receptor (AhR) is a heterodimeric transcriptional regulator with pleiotropic functions in xenobiotic metabolism and detoxification, vascular development and cancer. Herein, we report a previously undescribed role for the AhR signalling pathway in the pathogenesis of the wet, neovascular subtype of age-related macular degeneration (AMD), the leading cause of vision loss in the elderly in the Western world. Comparative analysis of gene expression profiles of aged AhR−/− and wild-type (wt) mice, using high-throughput RNA sequencing, revealed differential modulation of genes belonging to several AMD-related pathogenic pathways, including inflammation, angiogenesis and extracellular matrix regulation. To investigate AhR regulation of these pathways in wet AMD, we experimentally induced choroidal neovascular lesions in AhR−/− mice and found that they measured significantly larger in area and volume compared to age-matched wt mice. Furthermore, these lesions displayed a higher number of ionized calcium-binding adaptor molecule 1-positive (Iba1+) microglial cells and a greater amount of collagen type IV deposition, events also seen in human wet AMD pathology specimens. Consistent with our in vivo observations, AhR knock-down was sufficient to increase choroidal endothelial cell migration and tube formation in vitro. Moreover, AhR knock-down caused an increase in collagen type IV production and secretion in both retinal pigment epithelial (RPE) and choroidal endothelial cell cultures, increased expression of angiogenic and inflammatory molecules, including vascular endothelial growth factor A (VEGFA) and chemokine (C–C motif) ligand 2 (CCL2) in RPE cells, and increased expression of secreted phosphoprotein 1 (SPP1) and transforming growth factor-β1 (TGFβ1) in choroidal endothelial cells. Collectively, our findings identify AhR as a regulator of multiple pathogenic pathways in experimentally induced choroidal neovascularization, findings that are consistent with a possible role of AhR in wet AMD. The data discussed in this paper have been deposited in NCBI's Gene Expression Omnibus; GEO Submission No. GSE56983, NCBI Tracking System No. 17021116. PMID:25186463

  6. [Progress in preparation of small monoclonal antibodies of knock out technique].

    PubMed

    Liu, Jing; Mao, Xin-min; Li, Lin-lin; Li, Xin-xia; Wang, Ye; Lan, Yi

    2015-10-01

    With the application of monoclonal antibody technology more and more widely, its production technology is becoming more and more perfect. Small molecule monoclonal antibody technology is becoming a hot research topic for people. The application of traditional Chinese medicine small molecule monoclonal antibody technology has been more and more widely, the technology for effective Chinese medicine component knockout provide strong technical support. The preparation of monoclonal antibodies and small molecule knockout technology are reviewed in this paper. The preparation of several steps, such as: in the process of preparation of antigen, hapten carrier coupling, coupling ratio determination and identification of artificial antigen and establishment of animal immunization and hybridoma cell lines of monoclonal antibody, the large-scale preparation; small molecule monoclonal antibody on Immune in affinity chromatography column method is discussed in detail. The author believes that this technology will make the traditional Chinese medicine research on a higher level, and improve the level of internationalization of Chinese medicine research.

  7. Age-Dependent Deficits in Fear Learning in Heterozygous BDNF Knock-Out Mice

    ERIC Educational Resources Information Center

    Endres, Thomas; Lessmann, Volkmar

    2012-01-01

    Beyond its trophic function, the neurotrophin BDNF (brain-derived neurotrophic factor) is well known to crucially mediate synaptic plasticity and memory formation. Whereas recent studies suggested that acute BDNF/TrkB signaling regulates amygdala-dependent fear learning, no impairments of cued fear learning were reported in heterozygous BDNF…

  8. Accelerated Human Mutant Tau Aggregation by Knocking Out Murine Tau in a Transgenic Mouse Model

    PubMed Central

    Ando, Kunie; Leroy, Karelle; Héraud, Céline; Yilmaz, Zehra; Authelet, Michèle; Suain, Valèrie; De Decker, Robert; Brion, Jean-Pierre

    2011-01-01

    Many models of human tauopathies have been generated in mice by expression of a human mutant tau with maintained expression of mouse endogenous tau. Because murine tau might interfere with the toxic effects of human mutant tau, we generated a model in which a pathogenic human tau protein is expressed in the absence of wild-type tau protein, with the aim of facilitating the study of the pathogenic role of the mutant tau and to reproduce more faithfully a human tauopathy. The Tg30 line is a tau transgenic mouse model overexpressing human 1N4R double-mutant tau (P301S and G272V) that develops Alzheimer's disease-like neurofibrillary tangles in an age-dependent manner. By crossing Tg30 mice with mice invalidated for their endogenous tau gene, we obtained Tg30xtau−/− mice that express only exogenous human double-mutant 1N4R tau. Although Tg30xtau−/− mice express less tau protein compared with Tg30, they exhibit signs of decreased survival, increased proportion of sarkosyl-insoluble tau in the brain and in the spinal cord, increased number of Gallyas-positive neurofibrillary tangles in the hippocampus, increased number of inclusions in the spinal cord, and a more severe motor phenotype. Deletion of murine tau accelerated tau aggregation during aging of this mutant tau transgenic model, suggesting that murine tau could interfere with the development of tau pathology in transgenic models of human tauopathies. PMID:21281813

  9. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer.

    PubMed

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-09-22

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth.

  10. Knocking out ubiquitin proteasome system function in vivo and in vitro with genetically encodable tandem ubiquitin.

    PubMed

    Saeki, Y; Isono, E; Shimada, M; Kawahara, H; Yokosawa, H; Toh-E, A

    2005-01-01

    At present, the 26S proteasome-specific inhibitor is not available. We constructed polyubiquitin derivatives that contained a tandem repeat of ubiquitins and were insensitive to ubiquitin hydrolases. When these artificial polyubiquitins (tUbs, tandem ubiquitins) were overproduced in the wild-type yeast strain, growth was strongly inhibited, probably because of inhibition of the 26S proteasome. We also found that several substrates of the ubiquitin-proteasome pathway were stabilized by expressing tUbs in vivo. tUbs containing four units or more of the ubiquitin monomer were found to form a complex with the 26S proteasome. We showed that tUb bound to the 26S proteasome inhibited the in vitro degradation of polyubiquitinylated Sic1 by the 26S proteasome. When tUB6 (six-mer) messenger RNA was injected into Xenopus embryos, cell division was inhibited, suggesting that tUb can be used as a versatile inhibitor of the 26S proteasome.

  11. Subregion-Specific p300 Conditional Knock-Out Mice Exhibit Long-Term Memory Impairments

    ERIC Educational Resources Information Center

    Oliveira, Ana M. M.; Estevez, Marcel A.; Hawk, Joshua D.; Grimes, Shannon; Brindle, Paul K.; Abel, Ted

    2011-01-01

    Histone acetylation plays a critical role during long-term memory formation. Several studies have demonstrated that the histone acetyltransferase (HAT) CBP is required during long-term memory formation, but the involvement of other HAT proteins has not been extensively investigated. The HATs CBP and p300 have at least 400 described interacting…

  12. Knock-out mouse models of proprotein convertases: unique functions or redundancy?

    PubMed

    Creemers, John W M; Khatib, Abdel-Majid

    2008-05-01

    The members of the proprotein convertase family play a central role in the processing and/or activation of various protein precursors involved in many physiological processes and various pathologies. The proteolysis of these precursors that occur at basic residues within the general motif (K/R)-(X)-(K/R) is mediated by the proprotein convertases PC1/3, PC2, Furin, PACE4, PC4, PC5 and PC7, whereas the proteolysis of precursors within hydrophobic residues performed by the convertase S1P/SKI-1 and the convertase NARC-1/PCSK9 seems to prefer cleavages at the motif LVFAQSIP. Here we provide a comprehensive overview of their remarkable complex roles as revealed by disruption of their genes individually using generalized or conditional approaches.

  13. Knock out of the NADPH oxidase Nox4 has no impact on life span in mice.

    PubMed

    Rezende, Flavia; Schürmann, Christoph; Schütz, Susanne; Harenkamp, Sabine; Herrmann, Eva; Seimetz, Michael; Weißmann, Norbert; Schröder, Katrin

    2017-04-01

    The free radical theory of aging suggests reactive oxygen species as a main reason for accumulation of damage events eventually leading to aging. Nox4, a member of the family of NADPH oxidases constitutively produces ROS and therefore has the potential to be a main driver of aging. Herein we analyzed the life span of Nox4 deficient mice and found no difference when compared to their wildtype littermates. Accordingly neither Tert expression nor telomere length was different in cells isolated from those animals. In fact, Nox4 mRNA expression in lungs of wildtype mice dropped with age. We conclude that Nox4 has no influence on lifespan of healthy mice.

  14. Knock-out of Arabidopsis AtNHX4 gene enhances tolerance to salt stress

    SciTech Connect

    Li, Hong-Tao; Liu, Hua; Gao, Xiao-Shu; Zhang, Hongxia

    2009-05-08

    AtNHX4 belongs to the monovalent cation:proton antiporter-1 (CPA1) family in Arabidopsis. Several members of this family have been shown to be critical for plant responses to abiotic stress, but little is known on the biological functions of AtNHX4. Here, we provide the evidence that AtNHX4 plays important roles in Arabidopsis responses to salt stress. Expression of AtNHX4 was responsive to salt stress and abscisic acid. Experiments with CFP-AtNHX4 fusion protein indicated that AtNHX4 is vacuolar localized. The nhx4 mutant showed enhanced tolerance to salt stress, and lower Na{sup +} content under high NaCl stress compared with wild-type plants. Furthermore, heterologous expression of AtNHX4 in Escherichia coli BL21 rendered the transformants hypersensitive to NaCl. Deletion of the hydrophilic C-terminus of AtNHX4 dramatically increased the hypersensitivity of transformants, indicating that AtNHX4 may function in Na{sup +} homeostasis in plant cell, and its C-terminus plays a role in regulating the AtNHX4 activity.

  15. Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice.

    PubMed

    Zhang, Qiangge; Gao, Xian; Li, Chenchen; Feliciano, Catia; Wang, Dongqing; Zhou, Dingxi; Mei, Yuan; Monteiro, Patricia; Anand, Michelle; Itohara, Shigeyoshi; Dong, Xiaowei; Fu, Zhanyan; Feng, Guoping

    2016-02-17

    Intellectual disability is a common neurodevelopmental disorder characterized by impaired intellectual and adaptive functioning. Both environmental insults and genetic defects contribute to the etiology of intellectual disability. Copy number variations of SORBS2 have been linked to intellectual disability. However, the neurobiological function of SORBS2 in the brain is unknown. The SORBS2 gene encodes ArgBP2 (Arg/c-Abl kinase binding protein 2) protein in non-neuronal tissues and is alternatively spliced in the brain to encode nArgBP2 protein. We found nArgBP2 colocalized with F-actin at dendritic spines and growth cones in cultured hippocampal neurons. In the mouse brain, nArgBP2 was highly expressed in the cortex, amygdala, and hippocampus, and enriched in the outer one-third of the molecular layer in dentate gyrus. Genetic deletion of Sorbs2 in mice led to reduced dendritic complexity and decreased frequency of AMPAR-miniature spontaneous EPSCs in dentate gyrus granule cells. Behavioral characterization revealed that Sorbs2 deletion led to a reduced acoustic startle response, and defective long-term object recognition memory and contextual fear memory. Together, our findings demonstrate, for the first time, an important role for nArgBP2 in neuronal dendritic development and excitatory synaptic transmission, which may thus inform exploration of neurobiological basis of SORBS2 deficiency in intellectual disability. Copy number variations of the SORBS2 gene are linked to intellectual disability, but the neurobiological mechanisms are unknown. We found that nArgBP2, the only neuronal isoform encoded by SORBS2, colocalizes with F-actin at neuronal dendritic growth cones and spines. nArgBP2 is highly expressed in the cortex, amygdala, and dentate gyrus in the mouse brain. Genetic deletion of Sorbs2 in mice leads to impaired dendritic complexity and reduced excitatory synaptic transmission in dentate gyrus granule cells, accompanied by behavioral deficits in acoustic startle response and long-term memory. This is the first study of Sorbs2 function in the brain, and our findings may facilitate the study of neurobiological mechanisms underlying SORBS2 deficiency in the development of intellectual disability. Copyright © 2016 the authors 0270-6474/16/362248-14$15.00/0.

  16. [Study on material base of Carthamus tinctorius with antioxidant effect based on selective knock-out].

    PubMed

    Wang, Lin-Yan; Tang, Yu-Ping; Liu, Xin; Ge, Ya-Hui; Li, Shu-Jiao; Shang, Er-Xin; Duan, Jin-Ao

    2014-04-01

    To establish a method for studying efficacious materials of traditional Chinese medicines from an overall perspective. Carthamus tinctorius was taken the example. Its major components were depleted by preparing liquid chromatography. Afterwards, the samples with major components depleted were evaluated for their antioxidant effect, so as to compare and analyze the major efficacious materials of C. tinctorius with antioxidant activity and the contributions. Seven major components were depleted from C. tinctorius samples, and six of them were identified with MS data and control comparison. After all of the samples including depleted materials are compared and evaluated for their antioxidant effect, the findings showed that hydroxysafflor yellow A, anhydrosafflor yellow B and 6-hydroxykaempferol-3, 6-di-O-glucoside-7-O-glucuronide were the major efficacious materials. This study explored a novel and effective method for studying efficacious materials of traditional Chinese medicines. Through this method, we could explain the direct and indirect contributions of different components to the efficacy of traditional Chinese medicines, and make the efficacious material expression of traditional Chinese medicines clearer.

  17. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer

    PubMed Central

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-01-01

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth. PMID:27654750

  18. Knock-out and Transgenic Strategies to Improve Neural Transplantation Therapy for Parkinson’s Disease

    DTIC Science & Technology

    2000-07-01

    Parkinson’s disease (PD) are 1) poor survival of grafted fetal neurons and 2) insufficient axonal outgrowth and functional recovery. We carried out experiments aimed at by short-term inhibition by pre-treatment of fetal cells with pharmacological inhibitors of caspases. In our second objective of enhancing axonal growth leading to optimal functional recovery by neuronal transplants, we employed transgenic bcl-2 overexpressing donor cells and similar molecules influencing the growth of axons in the fetal and adult CNS. Use of such molecules could significantly improve

  19. Were you knocked out?--Yes, but I wasn't admitted.

    PubMed Central

    Gorman, D F

    1985-01-01

    A prospective study was undertaken of the effects of applying a more selective admission policy to a group of 6685 accident and emergency attenders with head injuries. The efficacy of such a policy was assessed by comparison with 5768 head injury attenders subject to an orthodox admission policy and collected retrospectively. Epidemiological characteristics of both study groups, of patients not admitted but who would previously have been admitted, and of patients admitted because of head injury alone during the prospective study are detailed. The more selective policy was no worse than current practice in terms of immediate morbidity and mortality. Survival of patients with post-traumatic intracranial haematomas was more likely in the prospective group, as was the diagnosis and treatment of such lesions while the patients were alive. Patients admitted because of head injury alone were reduced to one-third of their expected number and all admissions, from among those attenders with head injury in the prospective study, were reduced by half. Adopting such a policy nationally could save 11,000,000 pounds annually. PMID:4052208

  20. Taurine depletion caused by knocking out the taurine transporter gene leads to cardiomyopathy with cardiac atrophy.

    PubMed

    Ito, Takashi; Kimura, Yasushi; Uozumi, Yoriko; Takai, Mika; Muraoka, Satoko; Matsuda, Takahisa; Ueki, Kei; Yoshiyama, Minoru; Ikawa, Masahito; Okabe, Masaru; Schaffer, Stephen W; Fujio, Yasushi; Azuma, Junichi

    2008-05-01

    The sulfur-containing beta-amino acid, taurine, is the most abundant free amino acid in cardiac and skeletal muscle. Although its physiological function has not been established, it is thought to play an important role in ion movement, calcium handling, osmoregulation and cytoprotection. To begin examining the physiological function of taurine, we generated taurine transporter- (TauT-) knockout mice (TauTKO), which exhibited a deficiency in myocardial and skeletal muscle taurine content compared with their wild-type littermates. The TauTKO heart underwent ventricular remodeling, characterized by reductions in ventricular wall thickness and cardiac atrophy accompanied with the smaller cardiomyocytes. Associated with the structural changes in the heart was a reduction in cardiac output and increased expression of heart cardiac failure (fetal) marker genes, such as ANP, BNP and beta-MHC. Moreover, ultrastructural damage to the myofilaments and mitochondria was observed. Further, the skeletal muscle of the TauTKO mice also exhibited decreased cell volume, structural defects and a reduction of exercise endurance capacity. Importantly, the expression of Hsp70, ATA2 and S100A4, which are upregulated by osmotic stress, was elevated in both heart and skeletal muscle of the TauTKO mice. Taurine depletion causes cardiomyocyte atrophy, mitochondrial and myofiber damage and cardiac dysfunction, effects likely related to the actions of taurine. Our data suggest that multiple actions of taurine, including osmoregulation, regulation of mitochondrial protein expression and inhibition of apoptosis, collectively ensure proper maintenance of cardiac and skeletal muscular structure and function.

  1. Smad3 knock-out mice as a useful model to study intestinal fibrogenesis

    PubMed Central

    Zanninelli, Giuliana; Vetuschi, Antonella; Sferra, Roberta; D’Angelo, Angela; Fratticci, Amato; Continenza, Maria Adelaide; Chiaramonte, Maria; Gaudio, Eugenio; Caprilli, Renzo; Latella, Giovanni

    2006-01-01

    AIM: To evaluate the possible differences in morphology and immunohistochemical expression of CD3, transforming growth factor β1(TGF-β1), Smad7, α-smooth muscle actin (α-Sma), and collagen types I-VII of small and large intestine in Smad3 null and wild-type mice. METHODS: Ten null and ten wild-type adult mice were sacrificed at 4 mo of age and the organs (esophagus, small and large bowel, ureters) were collected for histology(hematoxylin and eosin, Masson thrichrome, silver staining), morphometry and immunohistochemistry analysis. TGF-β1 levels of intestinal tissue homogenates were assessed by ELISA. RESULTS: No macroscopic intestinal lesions were detected both in null and wild-type mice. Histological and morphometric evaluation revealed a significant reduction in muscle layer thickness of small and large intestine in null mice as compared to wild-type mice. Immunohistochemistry evaluation showed a significant increase of CD3+T cell, TGF-β1 and Smad7 staining in the small and large intestine mucosa of Smad3 null mice as compared to wild-type mice. α-Sma and collagen I-VII staining of small and large intestine did not differ between the two groups of mice. TGF-β1 levels of colonic tissue homogenates were significantly higher in null mice than in wild-type mice. In preliminary experiments a significant reduction of TNBS-induced intestinal fibrosis was observed in null mice as compared to wild-type mice. CONCLUSION: Smad3 null mice are a useful model to investigate the in vivo role of the TGF-β/Smad signalling pathway in intestinal inflammation and fibrosis. PMID:16534873

  2. Knocking out P2X receptors reduces transmitter secretion in taste buds

    PubMed Central

    Huang, Yijen A.; Stone, Leslie M.; Pereira, Elizabeth; Yang, Ruibiao; Kinnamon, John C.; Dvoryanchikov, Gennady; Chaudhari, Nirupa; Finger, Thomas E.; Kinnamon, Sue C.; Roper, Stephen D.

    2011-01-01

    In response to gustatory stimulation, taste bud cells release a transmitter, ATP, that activates P2X2 and P2X3 receptors on gustatory afferent fibers. Taste behavior and gustatory neural responses are largely abolished in mice lacking P2X2 and P2X3 receptors (P2X2 and P2X3 double knockout, or “DKO” mice). The assumption has been that eliminating P2X2 and P2X3 receptors only removes postsynaptic targets but that transmitter secretion in mice is normal. Using functional imaging, ATP biosensor cells, and a cell-free assay for ATP, we tested this assumption. Surprisingly, although gustatory stimulation mobilizes Ca2+ in taste Receptor (Type II) cells from DKO mice, as from wild type (WT) mice, taste cells from DKO mice fail to release ATP when stimulated with tastants. ATP release could be elicited by depolarizing DKO Receptor cells with KCl, suggesting that ATP-release machinery remains functional in DKO taste buds. To explore the difference in ATP release across genotypes, we employed reverse transcriptase (RT)-PCR, immunostaining, and histochemistry for key proteins underlying ATP secretion and degradation: Pannexin1, TRPM5, and NTPDase2 (ecto-ATPase) are indistinguishable between WT and DKO mice. The ultrastructure of contacts between taste cells and nerve fibers is also normal in the DKO mice. Finally, quantitative RT-PCR show that P2X4 and P2X7, potential modulators of ATP secretion, are similarly expressed in taste buds in WT and DKO taste buds. Importantly, we find that P2X2 is expressed in WT taste buds and appears to function as an autocrine, positive feedback signal to amplify taste-evoked ATP secretion. PMID:21940456

  3. Age-Dependent Deficits in Fear Learning in Heterozygous BDNF Knock-Out Mice

    ERIC Educational Resources Information Center

    Endres, Thomas; Lessmann, Volkmar

    2012-01-01

    Beyond its trophic function, the neurotrophin BDNF (brain-derived neurotrophic factor) is well known to crucially mediate synaptic plasticity and memory formation. Whereas recent studies suggested that acute BDNF/TrkB signaling regulates amygdala-dependent fear learning, no impairments of cued fear learning were reported in heterozygous BDNF…

  4. Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice

    PubMed Central

    Zhang, Qiangge; Gao, Xian; Li, Chenchen; Feliciano, Catia; Wang, Dongqing; Zhou, Dingxi; Mei, Yuan; Monteiro, Patricia; Anand, Michelle; Itohara, Shigeyoshi; Dong, Xiaowei; Fu, Zhanyan

    2016-01-01

    Intellectual disability is a common neurodevelopmental disorder characterized by impaired intellectual and adaptive functioning. Both environmental insults and genetic defects contribute to the etiology of intellectual disability. Copy number variations of SORBS2 have been linked to intellectual disability. However, the neurobiological function of SORBS2 in the brain is unknown. The SORBS2 gene encodes ArgBP2 (Arg/c-Abl kinase binding protein 2) protein in non-neuronal tissues and is alternatively spliced in the brain to encode nArgBP2 protein. We found nArgBP2 colocalized with F-actin at dendritic spines and growth cones in cultured hippocampal neurons. In the mouse brain, nArgBP2 was highly expressed in the cortex, amygdala, and hippocampus, and enriched in the outer one-third of the molecular layer in dentate gyrus. Genetic deletion of Sorbs2 in mice led to reduced dendritic complexity and decreased frequency of AMPAR-miniature spontaneous EPSCs in dentate gyrus granule cells. Behavioral characterization revealed that Sorbs2 deletion led to a reduced acoustic startle response, and defective long-term object recognition memory and contextual fear memory. Together, our findings demonstrate, for the first time, an important role for nArgBP2 in neuronal dendritic development and excitatory synaptic transmission, which may thus inform exploration of neurobiological basis of SORBS2 deficiency in intellectual disability. SIGNIFICANCE STATEMENT Copy number variations of the SORBS2 gene are linked to intellectual disability, but the neurobiological mechanisms are unknown. We found that nArgBP2, the only neuronal isoform encoded by SORBS2, colocalizes with F-actin at neuronal dendritic growth cones and spines. nArgBP2 is highly expressed in the cortex, amygdala, and dentate gyrus in the mouse brain. Genetic deletion of Sorbs2 in mice leads to impaired dendritic complexity and reduced excitatory synaptic transmission in dentate gyrus granule cells, accompanied by behavioral deficits in acoustic startle response and long-term memory. This is the first study of Sorbs2 function in the brain, and our findings may facilitate the study of neurobiological mechanisms underlying SORBS2 deficiency in the development of intellectual disability. PMID:26888934

  5. Behavioral and cognitive data in mice with different tryptophan-metabolizing enzymes knocked out.

    PubMed

    Too, Lay Khoon; Li, Kong M; Suarna, Cacang; Maghzal, Ghassan J; Stocker, Roland; McGregor, Iain S; Hunt, Nicholas H

    2016-12-01

    This article demonstrates behavioral changes in mice in response to free adaptation and drinking session adaptation modules implemented in their social home environment, the IntelliCage. These data complement the study "Deletion of TDO2, IDO-1 and IDO-2 differentially affects mouse behavior and cognitive function" (Too LK, Li KM, Suarna C, Maghzal GJ, Stocker R, McGregor IS, et al., 2016) [1]. Prior to programmed drinking sessions, all mice were exposed to a home cage adaptation module during which there was no time limit on water access - the free adaptation module. The exploratory behaviors are here expressed as percentages of visits with nosepokes and of visits with licks. The measurements by percentage of exploratory activity showed minimal genotype effects. The number of nosepokes or licks per corner visit also was compared between WT and gene knockout (GKO) IDO1 mice, WT and GKO IDO2 mice and WT and GKO TDO2 mice and demonstrated unremarkable behavioral changes during the free adaptation module. Analysis of drinking session adaptation behavior showed no genotype effect between WT and GKO of IDO1, IDO2 or TDO2 background. Notwithstanding the absence of genotype differences, each IDO1, IDO2 or TDO2 animal group displayed a specific pattern of adaptation to the drinking session modules. Furthermore, IDO1 GKO mice showed a more rapid recovery of lick frequency to the baseline level compared to the WT equivalents in a simple patrolling task during the first complete testing cycle (R1). TDO2 GKO mice on the other hand did not differ from their WT equivalents in terms of lick frequency over the three test days of complex patrolling and discrimination reversal tasks. Lastly, IDO2 GKO mice reduced their visits to the permanently non-rewarding reference corners by the same degree as did the WT mice.

  6. Relevant Feature Set Estimation with a Knock-out Strategy and Random Forests

    PubMed Central

    Ganz, Melanie; Greve, Douglas N.; Fischl, Bruce; Konukoglu, Ender

    2015-01-01

    Group analysis of neuroimaging data is a vital tool for identifying anatomical and functional variations related to diseases as well as normal biological processes. The analyses are often performed on a large number of highly correlated measurements using a relatively smaller number of samples. Despite the correlation structure, the most widely used approach is to analyze the data using univariate methods followed by post-hoc corrections that try to account for the data’s multivariate nature. Although widely used, this approach may fail to recover from the adverse effects of the initial analysis when local effects are not strong. Multivariate pattern analysis (MVPA) is a powerful alternative to the univariate approach for identifying relevant variations. Jointly analyzing all the measures, MVPA techniques can detect global effects even when individual local effects are too weak to detect with univariate analysis. Current approaches are successful in identifying variations that yield highly predictive and compact models. However, they suffer from lessened sensitivity and instabilities in identification of relevant variations. Furthermore, current methods’ user-defined parameters are often unintuitive and difficult to determine. In this article, we propose a novel MVPA method for group analysis of high-dimensional data that overcomes the drawbacks of the current techniques. Our approach explicitly aims to identify all relevant variations using a “knock-out” strategy and the Random Forest algorithm. In evaluations with synthetic datasets the proposed method achieved substantially higher sensitivity and accuracy than the state-of-the-art MVPA methods, and outperformed the univariate approach when the effect size is low. In experiments with real datasets the proposed method identified regions beyond the univariate approach, while other MVPA methods failed to replicate the univariate results. More importantly, in a reproducibility study with the well-known ADNI dataset the proposed method yielded higher stability and power than the univariate approach. PMID:26272728

  7. C6 knock-out Mice Are Protected from Thrombophilia Mediated by Antiphospholipid Antibodies

    PubMed Central

    Laura, Carrera-Marín Ana; Zurina, Romay-Penabad; Elizabeth, Papalardo; Elba, Reyes-Maldonado; Ethel, Garcia-Latorre; Gracie, Vargas; Tuya, Shilagard; Silvia, Pierangeli

    2013-01-01

    Background Complement activation plays a role in pathogenesis of the Antiphospholipid Syndrome (APS), but the involvement of the C5b-9 membrane attack complex (MAC) is unknown. Here we studied the effects of human polyclonal antiphospholipid (aPL) antibodies on thrombosis and tissue factor (TF) up-regulation in C6 deficient (C6-/-) mice. Methods C6-/- or the wild-type (C3H/HeJ) C6+/+ mice were injected twice with IgG-APS (n=2) or IgM-APS (n=1) isolated from APS patients or with the corresponding control Igs (IgG-NHS or IgM-NHS). Then, the size of induced thrombi in the femoral vein were determined 72 hours after the first injection. Tissue factor was determined in homogenates of carotid arteries and in peritoneal macrophages. Results Thrombus sizes were significantly larger in C6+/+ treated with IgG-APS1 or with IgG-APS2 or with IgM-APS when compared with C6+/+ mice treated with IgG-NHS or with IgM-NHS, respectively. The sizes of thrombi were significantly smaller in the C6-/- mice injected with IgG-APS1, IgG-APS2 or IgM-APS (p<0.001), compared to their C6+/+ counterparts showing an important abrogation of thrombus formation in mice lacking C6. The TF expression and activity in the C6-/- mice treated with IgG-APS were diminished when compared to C6+/+ treated with the same immunoglobulins. All mice injected with IgG-APS and IgM-APS had medium-high titers of aCL and aβ2GPI antibodies. Conclusions These data indicate that the C6 component of the complement system mediates aPL-thrombogenic effects, underscoring an important pathogenic mechanism and indicating the possibility of inhibiting complement to ameliorate APS-related manifestations. PMID:22933620

  8. Generation and Behavioral Characterization of β-catenin Forebrain-Specific Conditional Knock-Out Mice

    PubMed Central

    Gould, Todd D.; O'Donnell, Kelley C.; Picchini, Alyssa M.; Dow, Eliot R.; Chen, Guang; Manji, Husseini K.

    2009-01-01

    The canonical Wnt pathway and β-catenin have been implicated in the pathophysiology of mood disorders. We generated forebrain-specific CRE-mediated conditional β-catenin knockout mice to begin exploring the behavioral implications of decreased Wnt pathway signaling in the central nervous system. In situ hybridization revealed a progressive knockout of β-catenin that began between 2 and 4 weeks of age, and by 12 weeks resulted in considerably decreased β-catenin expression in regions of the forebrain, including the frontal cortex, hippocampus, and striatum. A significant decrease in protein levels of β-catenin in these brain regions was observed by western blot. Behavioral characterization of these mice in several tests (including the forced swim test, tail suspension test (TST), learned helplessness, response and sensitization to stimulants, and light/dark box among other tests) revealed relatively circumscribed alterations. In the TST, knockout mice spent significantly less time struggling (a depression-like phenotype). However, knockout mice did not differ from their wild-type littermates in the other behavioral tests of mood-related or anxiety-related behaviors. These results suggest that a considerable β-catenin reserve exists, and that a 50-70% β-catenin reduction in circumscribed brain regions is only capable of inducing subtle behavioral changes. Alternatively, regulating β-catenin may modulate drug effects rather than being a model of mood disorder pathophysiology per se. PMID:18299155

  9. Investigation of olfactory function in a Panx1 knock out mouse model

    PubMed Central

    Kurtenbach, Stefan; Whyte-Fagundes, Paige; Gelis, Lian; Kurtenbach, Sarah; Brazil, Émerson; Zoidl, Christiane; Hatt, Hanns; Shestopalov, Valery I.; Zoidl, Georg

    2014-01-01

    Pannexin 1 (Panx1), the most extensively investigated member of a channel-forming protein family, is able to form pores conducting molecules up to 1.5 kDa, like ATP, upon activation. In the olfactory epithelium (OE), ATP modulates olfactory responsiveness and plays a role in proliferation and differentiation of olfactory sensory neurons (OSNs). This process continuously takes place in the OE, as neurons are replaced throughout the whole lifespan. The recent discovery of Panx1 expression in the OE raises the question whether Panx1 mediates ATP release responsible for modulating chemosensory function. In this study, we analyzed pannexin expression in the OE and a possible role of Panx1 in olfactory function using a Panx1−/− mouse line with a global ablation of Panx1. This mouse model has been previously used to investigate Panx1 functions in the retina and adult hippocampus. Here, qPCR, in-situ hybridization, and immunohistochemistry (IHC) demonstrated that Panx1 is expressed in axon bundles deriving from sensory neurons of the OE. The localization, distribution, and expression of major olfactory signal transduction proteins were not significantly altered in Panx1−/− mice. Further, functional analysis of Panx1−/− animals does not reveal any major impairment in odor perception, indicated by electroolfactogram (EOG) measurements and behavioral testing. However, ATP release evoked by potassium gluconate application was reduced in Panx1−/− mice. This result is consistent with previous reports on ATP release in isolated erythrocytes and spinal or lumbar cord preparations from Panx1−/− mice, suggesting that Panx1 is one of several alternative pathways to release ATP in the olfactory system. PMID:25309319

  10. Aryl hydrocarbon receptor knock-out exacerbates choroidal neovascularization via multiple pathogenic pathways.

    PubMed

    Choudhary, Mayur; Kazmin, Dmitri; Hu, Peng; Thomas, Russell S; McDonnell, Donald P; Malek, Goldis

    2015-01-01

    The aryl hydrocarbon receptor (AhR) is a heterodimeric transcriptional regulator with pleiotropic functions in xenobiotic metabolism and detoxification, vascular development and cancer. Herein, we report a previously undescribed role for the AhR signalling pathway in the pathogenesis of the wet, neovascular subtype of age-related macular degeneration (AMD), the leading cause of vision loss in the elderly in the Western world. Comparative analysis of gene expression profiles of aged AhR(-/-) and wild-type (wt) mice, using high-throughput RNA sequencing, revealed differential modulation of genes belonging to several AMD-related pathogenic pathways, including inflammation, angiogenesis and extracellular matrix regulation. To investigate AhR regulation of these pathways in wet AMD, we experimentally induced choroidal neovascular lesions in AhR(-/-) mice and found that they measured significantly larger in area and volume compared to age-matched wt mice. Furthermore, these lesions displayed a higher number of ionized calcium-binding adaptor molecule 1-positive (Iba1(+) ) microglial cells and a greater amount of collagen type IV deposition, events also seen in human wet AMD pathology specimens. Consistent with our in vivo observations, AhR knock-down was sufficient to increase choroidal endothelial cell migration and tube formation in vitro. Moreover, AhR knock-down caused an increase in collagen type IV production and secretion in both retinal pigment epithelial (RPE) and choroidal endothelial cell cultures, increased expression of angiogenic and inflammatory molecules, including vascular endothelial growth factor A (VEGFA) and chemokine (C-C motif) ligand 2 (CCL2) in RPE cells, and increased expression of secreted phosphoprotein 1 (SPP1) and transforming growth factor-β1 (TGFβ1) in choroidal endothelial cells. Collectively, our findings identify AhR as a regulator of multiple pathogenic pathways in experimentally induced choroidal neovascularization, findings that are consistent with a possible role of AhR in wet AMD. The data discussed in this paper have been deposited in NCBI's Gene Expression Omnibus; GEO Submission No. GSE56983, NCBI Tracking System No. 17021116. © 2014 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

  11. Subregion-Specific p300 Conditional Knock-Out Mice Exhibit Long-Term Memory Impairments

    ERIC Educational Resources Information Center

    Oliveira, Ana M. M.; Estevez, Marcel A.; Hawk, Joshua D.; Grimes, Shannon; Brindle, Paul K.; Abel, Ted

    2011-01-01

    Histone acetylation plays a critical role during long-term memory formation. Several studies have demonstrated that the histone acetyltransferase (HAT) CBP is required during long-term memory formation, but the involvement of other HAT proteins has not been extensively investigated. The HATs CBP and p300 have at least 400 described interacting…

  12. Direct reaction experimental studies with beams of radioactive tin ions

    SciTech Connect

    Jones, K. L. Ayres, A.; Bey, A.; Burcher, S.; Cartegni, L.; Cerizza, G.; Ahn, S.; Allmond, J. M.; Beene, J. R.; Galindo-Uribarri, A.; Liang, J. F.; Nesaraja, C. D.; Pain, S. D.; Radford, D. C.; Schmitt, K. T.; Smith, M. S.; Stracener, D. W.; Varner, R. L.; Bardayan, D. W.; Baugher, T.; and others

    2015-10-15

    The tin chain of isotopes provides a unique region in which to investigate the evolution of single-particle structure, spreading from N = 50 at {sup 100}Sn, through 10 stable isotopes and the N = 82 shell closure at {sup 132}Sn out into the r-process path. Direct reactions performed on radioactive ion beams are sensitive spectroscopic tools for studying exotic nuclei. Here we present one experiment knocking out neutrons from tin isotopes that are already neutron deficient and two reactions that add a neutron to neutron-rich {sup 130}Sn. Both techniques rely on selective particle identification and the measurement of γ rays in coincidence with charged ions. We present the goals of the two experiments and the particle identification for the channels of interest. The final results will be presented in future publications.

  13. Direct Reaction Experimental Studies with Beams of Radioactive Tin Ions

    SciTech Connect

    Jones, K. L.; Ahn, S.H.; Allmond, James M; Ayres, A.; Bardayan, Daniel W; Baugher, T.; Bazin, D.; Beene, James R; Berryman, J. S.; Bey, A.; Bingham, C. R.; Cartegni, L.; Chae, K. Y.; Gade, A.; Galindo-Uribarri, Alfredo {nmn}; Garcia-Ruiz, R.F.; Grzywacz, Robert Kazimierz; Howard, Meredith E; Kozub, R. L.; Liang, J Felix; Manning, Brett M; Matos, M.; McDaniel, S.; Miller, D.; Nesaraja, Caroline D; O'Malley, Patrick; Padgett, S; Padilla-Rodal, Elizabeth; Pain, Steven D; Pittman, S. T.; Radford, David C; Ratkiewicz, Andrew J; Schmitt, Kyle; Smith, Michael Scott; Stracener, Daniel W; Stroberg, S.; Tostevin, Jeffrey A; Varner Jr, Robert L; Weisshaar, D.; Wimmer, K.

    2015-01-01

    The tin chain of isotopes provides a unique region in which to investigate the evolution of single-particle structure, spreading from N = 50 at Sn-100, through 10 stable isotopes and the N = 82 shell closure at Sn-132 out into the r-process path. Direct reactions performed on radioactive ion beams are sensitive spectroscopic tools for studying exotic nuclei. Here we present one experiment knocking out neutrons from tin isotopes that are already neutron deficient and two reactions that add a neutron to neutron-rich Sn-130. Both techniques rely on selective particle identification and the measurement of gamma rays in coincidence with charged ions. We present the goals of the two experiments and the particle identification for the channels of interest. The final results will be presented in future publications.

  14. Knockout reactions on p-shell nuclei for tests of structure and reaction models

    NASA Astrophysics Data System (ADS)

    Kuchera, A. N.; Bazin, D.; Babo, M.; Baumann, T.; Bowry, M.; Bradt, J.; Brown, J.; Deyoung, P. A.; Elman, B.; Finck, J. E.; Gade, A.; Grinyer, G. F.; Jones, M. D.; Lunderberg, E.; Redpath, T.; Rogers, W. F.; Stiefel, K.; Thoennessen, M.; Weisshaar, D.; Whitmore, K.

    2015-10-01

    A series of knockout reactions on p-shell nuclei were studied to extract exclusive cross sections and to investigate the neutron knockout mechanism. The measured cross sections provide stringent tests of shell model and ab initio calculations while measurements of neutron+residual coincidences test the accuracy and validity of reaction models used to predict cross sections. Six different beams ranging from A = 7 to 12 were produced at the NSCL totaling measurements of nine different reaction settings. The reaction settings were determined by the magnetic field of the Sweeper magnet which bends the residues into charged particle detectors. The reaction target was surrounded by the high efficiency CsI array, CAESAR, to tag gamma rays for cross section measurements of low-lying excited states. Additionally, knocked out neutrons were detected with MoNA-LISA in coincidence with the charged residuals. Preliminary results will be discussed. This work is partially supported by the National Science Foundation under Grant No. PHY11-02511 and the Department of Energy National Nuclear Security Administration under Award No. DE-NA0000979.

  15. Direct Reactions with MoNA-LISA

    NASA Astrophysics Data System (ADS)

    Kuchera, Anthony

    2016-03-01

    Nuclear reactions can be used to probe the structure of nuclei. Direct reactions, which take place on short time scales, are well-suited for experiments with beams of short-lived nuclei. One such reaction is nucleon knockout where a proton or neutron is removed from the incoming beam from the interaction with a target. Single nucleon knockout reactions have been used to study the single-particle nature of nuclear wave functions. A recent experiment at the National Superconducting Cyclotron Laboratory was performed to measure cross sections from single nucleon knockout reactions for several p-shell nuclei. Detection of the residual nucleus in coincidence with any gamma rays emitted from the target allowed cross sections to ground and excited states to be measured. Together with input from reaction theory, ab initio structure theories can be tested. Simultaneously the accuracy of knockout reaction models can be validated by detecting the knocked out neutron with the Modular Neutron Array and Large multi-Institutional Scintillator Array (MoNA-LISA). Preliminary results from this experiment will be shown. Knockout reactions can also be used to populate nuclei which are neutron unbound, thus emit neutrons nearly instantaneously. The structure of these nuclei, therefore, cannot be probed with gamma ray spectroscopy. However, with large neutron detectors like MoNA-LISA the properties of these short-lived nuclei are able to be measured. Recent results using MoNA-LISA to study the structure of neutron-rich nuclei will be presented. The author would like to acknowledge support from the NNSA and NSF.

  16. NewsMars: Express journey to Mars ASE 2003: Knocked out by meteorites Events: Sun-Earth Day ASE 2003: Fun Physics - popular as ever Appointments: Sykes to bring science to the people UK Science Education: The future's bright, the future's science ASE 2003: A grand finale for Catherine Teaching Resources: UK goes to the planets Cambridge Physics Update: Basement physics Conferences: Earth Science Teachers' Association Conference 2003 New Website: JESEI sets sail GIREP: Teacher education seminar Malaysia: Rewards for curriculum change Cambridge Physics Update: My boomerang will come back! Teaching Resources: Widening particiption through ideas and evidence with the University of Surrey Wales: First Ffiseg Events: Nuna: Solar car on tour Physics on Stage: Physics on Stage 3 embraces life Symposium: In what sense a nuclear 'debate'? Gifted and Talented: Able pupils experiencing challenging science Australia: ISS flies high Down Under

    NASA Astrophysics Data System (ADS)

    2003-03-01

    Mars: Express journey to Mars ASE 2003: Knocked out by meteorites Events: Sun-Earth Day ASE 2003: Fun Physics - popular as ever Appointments: Sykes to bring science to the people UK Science Education: The future's bright, the future's science ASE 2003: A grand finale for Catherine Teaching Resources: UK goes to the planets Cambridge Physics Update: Basement physics Conferences: Earth Science Teachers' Association Conference 2003 New Website: JESEI sets sail GIREP: Teacher education seminar Malaysia: Rewards for curriculum change Cambridge Physics Update: My boomerang will come back! Teaching Resources: Widening particiption through ideas and evidence with the University of Surrey Wales: First Ffiseg Events: Nuna: Solar car on tour Physics on Stage: Physics on Stage 3 embraces life Symposium: In what sense a nuclear 'debate'? Gifted and Talented: Able pupils experiencing challenging science Australia: ISS flies high Down Under

  17. Sun-Earth Connections: How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    NASA Technical Reports Server (NTRS)

    Ladbury, Raymond L.

    2014-01-01

    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  18. [Generation of tnnt2a knock-out zebrafish via CRISPR/Cas9 and phenotypic analysis].

    PubMed

    Liu, Lian; Zhang, Ran-Ran; Yang, Qian; Wang, Xu; Gui, Yong-Hao

    2017-06-25

    Cardiac troponin T (cTnT) serves as a structural protein of myocardial fiber, and participates in heart excitation-contraction coupling process. Here, we generated tnnt2a (cTnT-coding gene) deletion mutant zebrafish via CRISPR/Cas9 technique, and performed phenotypic analysis of the identified tnnt2a mutants. We observed that there was no significant difference between heterozygous mutant and wild type zebrafish, and the homozygous mutants displayed significant malformations in heart, including cardiac arrest, atrium and ventricle enlargement, pericardium effusion, and the individuals usually died before 7 day post fertilization (dpf). We further analyzed the expression alternations of heart sarcomere genes (tnnt2a, actc1a, tpm4a, myl7, vmhc) at transcriptional level in tnnt2a(-/-)(Δ2) zebrafish by performing real time RT-PCR, and found that the RNA expression level of tnnt2a in tnnt2a(-/-) zebrafish decreased constantly at each time point of developmental stages, and actc1a, tpm4a, myl7 and vmhc all showed higher expressions at early developmental stages and lower expressions at late developmental stages, in comparison with those of wild type zebrafish. Lastly, electron microscopy on cardiac tissues suggested that there were significant changes of the thick or thin filament structures in tnnt2a(-/-)(Δ2) zebrafish, which was further confirmed by F-actin and Tpm4 immunofluorescence staining. The tnnt2a(-/-) zebrafish generated by CRISPR/Cas9 bears the most common symptoms of patients with dilated cardiomyopathy, and therefore can be used as a tool to study TNNT2-deficiency related cardiomyopathy.

  19. COMPARATIVE HEPATIC EFFECTS OF PERFLUOROOCTANOIC ACID AND WY 14,643 IN PPARÁ KNOCKED OUT AND WILD-TYPE MICE

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a fluorinated organic chemical widely used in consumer and industrial products. Its persistence in the environment and presence in humans and wildlife have raised considerable concerns. PFOA induces liver tumors in rodents, which is thought to be ...

  20. A Novel Knock-Out Animal Model to Analyze Transcriptional Signaling by p53 Tumor Suppressor Protein in Breast Cancer

    DTIC Science & Technology

    2002-05-01

    p2lpcna genes was obtained from Celera mouse database. DNA sequences identified from the database and the sequence of the 40 bp overgo probe for screening...aagaccagagggagcctgaagactgtgatggggtagtttccatagtgacccgggtccttcttgtgtttcagccacagcgac c Complete overgo sequence for P21 5_UTR2 AGCCTGAAGACTGTGATGGGGTAGTTTCCATAGTGACCCG >pcna_5_UTR (highly specific...UNPUBLISHED Complete overgo sequence for PCNA 5_UTR CGCGGAAACTTCCTAAGGATGGAAACTGCAGCCTAAACTC Initial screen of the BAC library was performed by

  1. CRISPR-Cas9 directed knock-out of a constitutively expressed gene using lance array nanoinjection.

    PubMed

    Sessions, John W; Skousen, Craig S; Price, Kevin D; Hanks, Brad W; Hope, Sandra; Alder, Jonathan K; Jensen, Brian D

    2016-01-01

    CRISPR-Cas9 genome editing and labeling has emerged as an important tool in biologic research, particularly in regards to potential transgenic and gene therapy applications. Delivery of CRISPR-Cas9 plasmids to target cells is typically done by non-viral methods (chemical, physical, and/or electrical), which are limited by low transfection efficiencies or with viral vectors, which are limited by safety and restricted volume size. In this work, a non-viral transfection technology, named lance array nanoinjection (LAN), utilizes a microfabricated silicon chip to physically and electrically deliver genetic material to large numbers of target cells. To demonstrate its utility, we used the CRISPR-Cas9 system to edit the genome of isogenic cells. Two variables related to the LAN process were tested which include the magnitude of current used during plasmid attraction to the silicon lance array (1.5, 4.5, or 6.0 mA) and the number of times cells were injected (one or three times). Results indicate that most successful genome editing occurred after injecting three times at a current control setting of 4.5 mA, reaching a median level of 93.77 % modification. Furthermore, we found that genome editing using LAN follows a non-linear injection-dose response, meaning samples injected three times had modification rates as high as nearly 12 times analogously treated single injected samples. These findings demonstrate the LAN's ability to deliver genetic material to cells and indicate that successful alteration of the genome is influenced by a serial injection method as well as the electrical current settings.

  2. Enhanced Histaminergic Neurotransmission and Sleep-Wake Alterations, a Study in Histamine H3-Receptor Knock-Out Mice

    PubMed Central

    Gondard, Elise; Anaclet, Christelle; Akaoka, Hidéo; Guo, Rui-Xian; Zhang, Mei; Buda, Colette; Franco, Patricia; Kotani, Hidehito; Lin, Jian-Sheng

    2013-01-01

    Long-term abolition of a brain arousal system impairs wakefulness (W), but little is known about the consequences of long-term enhancement. The brain histaminergic arousal system is under the negative control of H3-autoreceptors whose deletion results in permanent enhancement of histamine (HA) turnover. In order to determine the consequences of enhancement of the histaminergic system, we compared the cortical EEG and sleep-wake states of H3-receptor knockout (H3R−/−) and wild-type mouse littermates. We found that H3R−/−mice had rich phenotypes. On the one hand, they showed clear signs of enhanced HA neurotransmission and vigilance, i.e., a higher EEG θ power during spontaneous W and a greater extent of W or sleep restriction during behavioral tasks, including environmental change, locomotion, and motivation tests. On the other hand, during the baseline dark period, they displayed deficient W and signs of sleep deterioration, such as pronounced sleep fragmentation and reduced cortical slow activity during slow wave sleep (SWS), most likely due to a desensitization of postsynaptic histaminergic receptors as a result of constant HA release. Ciproxifan (H3-receptor inverse agonist) enhanced W in wild-type mice, but not in H3R−/−mice, indicating a functional deletion of H3-receptors, whereas triprolidine (postsynaptic H1-receptor antagonist) or α-fluoromethylhistidine (HA-synthesis inhibitor) caused a greater SWS increase in H3R−/− than in wild-type mice, consistent with enhanced HA neurotransmission. These sleep-wake characteristics and the obesity phenotypes previously reported in this animal model suggest that chronic enhancement of histaminergic neurotransmission eventually compromises the arousal system, leading to sleep-wake, behavioral, and metabolic disorders similar to those caused by voluntary sleep restriction in humans. PMID:23303066

  3. Orexin/Hypocretin and Histamine: Distinct Roles in the Control of Wakefulness Demonstrated Using Knock-Out Mouse Models

    PubMed Central

    Anaclet, Christelle; Parmentier, Régis; Ouk, Koliane; Guidon, Gérard; Buda, Colette; Sastre, Jean-Pierre; Akaoka, Hidéo; Sergeeva, Olga A.; Yanagisawa, Masashi; Ohtsu, Hiroshi; Franco, Patricia; Haas, Helmut L.; Lin, Jian Sheng

    2009-01-01

    To determine the respective role played by orexin/hypocretin and histamine (HA) neurons in maintaining wakefulness (W), we characterized the behavioral and sleep-wake phenotypes of orexin(Ox) knockout(−/−) mice and compared them with those of histidine-decarboxylase(HDC, HA-synthesizing enzyme)−/−mice. While both mouse strains displayed sleep fragmentation and increased paradoxical sleep(PS), they presented a number of marked differences: 1) The PS-increase in HDC−/−mice was seen during lightness, whereas that in Ox−/−mice occurred during darkness; 2) Contrary to HDC−/−, Ox−/−mice had no W deficiency around lights-off, nor an abnormal EEG and responded to a new environment with increased W; 3) Only Ox−/−, but not HDC−/−mice, displayed narcolepsy and deficient W when faced with motor challenge. Thus, when placed on a wheel, WT, but not littermate Ox−/−mice, voluntarily spent their time in turning it and as a result, remained highly awake; this was accompanied by dense c-fos expression in many areas of their brains, including Ox-neurons in the dorsolateral hypothalamus. The W and motor deficiency of Ox−/−mice was due to the absence of Ox because intraventricular dosing of Ox-A restored their W amount and motor performance whereas SB-334867 (Ox1-receptor antagonist, i.p.) impaired W and locomotion of WT mice during the test. These data indicate that Ox, but not HA, promotes W through enhanced locomotion and suggest that HA and Ox neurons exert a distinct, but complementary and synergistic control of W: the neuropeptide being more involved in its behavioral aspects, whereas the amine is mainly responsible for its qualitative cognitive aspects and cortical-EEG activation. PMID:19923277

  4. Effects of eggplant (Solanum melongena) on the atherogenesis and oxidative stress in LDL receptor knock out mice (LDLR(-/-)).

    PubMed

    Botelho, Françoise V; Enéas, Luciana R; Cesar, Giovana C; Bizzotto, Carolina S; Tavares, Erico; Oliveira, Fabrícia A; Gloria, M Beatriz A; Silvestre, Marialice P C; Arantes, Rosa M E; Alvarez-Leite, Jacqueline I

    2004-08-01

    Eggplant (Solanum melongena) has been used as hypocholesterolemic agent in many countries. However, few controlled studies were addressed to this subject and atherogenesis. We have evaluated the effect of eggplant on cholesterol metabolism and atherogenesis in LDLR(-/-) mice. Animals were fed on chow (n=17) or atherogenic (n=21) diet during 12 weeks receiving water (control) or eggplant extract. Liver, serum and fecal lipids, together with serum lipoproteins were measured. Oxidative stress was evaluated through conjugate diene formation and ox-LDL antibodies by enzyme immunoassay. Atherosclerotic lesions were measured in different sites of aorta. Total cholesterol and atherogenic lipoproteins did not decrease after eggplant intake. Animals receiving eggplant and chow diet showed increased anti-ox-LDL antibodies and a decreased lag phase of conjugated diene formation, indicating a higher oxidative stress than controls. No differences were seen in lesion area of aortic valve. Eggplant extract had high histamine and other amine levels that could enhance LDL oxidation and its endocytosis. Eggplant did not decrease plasma cholesterol nor prevent the development of atherosclerosis in LDLR(-/-) mice. Surprisingly, eggplant increased oxidative stress, representing a risk factor for atherosclerosis. These results did not support the use of eggplant extract as hypocholesterolemic agent.

  5. Knocking out consumer concerns and regulator's rules: efficient use of CRISPR/Cas ribonucleoprotein complexes for genome editing in cereals.

    PubMed

    Wolter, Felix; Puchta, Holger

    2017-02-28

    Selection-free genome editing using Cas9 ribonucleoprotein embryo bombardment has been achieved for maize and wheat. This is a breakthrough that should make new breeding technologies more acceptable for worldwide use.

  6. Small Conductance Ca2+-Activated K+ Channel Knock-Out Mice Reveal the Identity of Calcium-Dependent Afterhyperpolarization Currents

    PubMed Central

    Bond, Chris T.; Herson, Paco S.; Strassmaier, Timothy; Hammond, Rebecca; Stackman, Robert; Maylie, James; Adelman, John P.

    2010-01-01

    Action potentials in many central neurons are followed by a prolonged afterhyperpolarization (AHP) that influences firing frequency and affects neuronal integration. In hippocampal CA1 pyramidal neurons, the current ascribed to the AHP (IAHP) has three kinetic components. The IfastAHP is predominantly attributable to voltage-dependent K+ channels, whereas Ca2+-dependent and voltage-independent K+ channels contribute to the ImediumAHP (ImAHP) and IslowAHP (IsAHP). Apamin, which selectively suppresses a component of the mAHP, increases neuronal excitability and facilitates the induction of synaptic plasticity at Schaffer collateral synapses and hippocampal-dependent learning. The Ca2+-dependent components of the AHP have been attributed to the activity of small conductance Ca2+-activated K+(SK) channels. Examination of transgenic mice, each lacking one of the three SK channel genes expressed in the CNS, reveals that mice without the SK2 subunit completely lack the apamin-sensitive component of the ImAHP in CA1 neurons, whereas the IsAHP is not different in any of the SK transgenic mice. In each of the transgenic lines, the expression levels of the remaining SK genes are not changed. The results demonstrate that only SK2 channels are necessary for the ImAHP, and none of the SK channels underlie the IsAHP. PMID:15190101

  7. Impaired Angiogenesis during Fracture Healing in GPCR Kinase 2 Interacting Protein-1 (GIT1) Knock Out Mice

    PubMed Central

    Menon, Prashanthi; Pang, Jinjiang; Ho, Hsin-Chiu; Shi, Shanshan; Xie, Chao; Smolock, Elaine; Yan, Chen; Zuscik, Michael J.; Berk, Bradford C.

    2014-01-01

    G protein coupled receptor kinase 2 (GRK2) interacting protein-1 (GIT1), is a scaffold protein that plays an important role in angiogenesis and osteoclast activity. We have previously demonstrated that GIT1 knockout (GIT1 KO) mice have impaired angiogenesis and dysregulated osteoclast podosome formation leading to a reduction in the bone resorbing ability of these cells. Since both angiogenesis and osteoclast-mediated bone remodeling are involved in the fracture healing process, we hypothesized that GIT1 participates in the normal progression of repair following bone injury. In the present study, comparison of fracture healing in wild type (WT) and GIT1 KO mice revealed altered healing in mice with loss of GIT1 function. Alcian blue staining of fracture callus indicated a persistence of cartilagenous matrix in day 21 callus samples from GIT1 KO mice which was temporally correlated with increased type 2 collagen immunostaining. GIT1 KO mice also showed a decrease in chondrocyte proliferation and apoptosis at days 7 and 14, as determined by PCNA and TUNEL staining. Vascular microcomputed tomography analysis of callus samples at days 7, 14 and 21 revealed decreased blood vessel volume, number, and connection density in GIT1 KO mice compared to WT controls. Correlating with this, VEGF-A, phospho-VEGFR2 and PECAM1 (CD31) were decreased in GIT1 KO mice, indicating reduced angiogenesis with loss of GIT1. Finally, calluses from GIT1 KO mice displayed a reduced number of tartrate resistant acid phosphatase-positive osteoclasts at days 14 and 21. Collectively, these results indicate that GIT1 is an important signaling participant in fracture healing, with gene ablation leading to reduced callus vascularity and reduced osteoclast number in the healing callus. PMID:24586541

  8. P2Y2 receptor knock-out mice display normal NaCl absorption in medullary thick ascending limb.

    PubMed

    Marques, Rita D; Praetorius, Helle A; Leipziger, Jens

    2013-01-01

    Local purinergic signals modulate renal tubular transport. Acute activation of renal epithelial P2 receptors causes inhibition of epithelial transport and thus, should favor increased water and salt excretion by the kidney. So far only a few studies have addressed the effects of extracellular nucleotides on ion transport in the thick ascending limb (TAL). In the medullary thick ascending limb (mTAL), basolateral P2X receptors markedly (~25%) inhibit NaCl absorption. Although this segment does express both apical and basolateral P2Y2 receptors, acute activation of the basolateral P2Y2 receptors had no apparent effect on transepithelial ion transport. Here we studied, if the absence of the P2Y2 receptor causes chronic alterations in mTAL NaCl absorption by comparing basal and AVP-stimulated transepithelial transport rates. We used perfused mouse mTALs to electrically measure NaCl absorption in juvenile (<35 days) and adult (>35 days) male mice. Using microelectrodes, we determined the transepithelial voltage (Vte) and the transepithelial resistance (Rte) and thus, transepithelial NaCl absorption (equivalent short circuit current, I'sc). We find that mTALs from adult wild type (WT) mice have significantly lower NaCl absorption rates when compared to mTALs from juvenile WT mice. This could be attributed to significantly higher Rtevalues in mTALs from adult WT mice. This pattern was not observed in mTALs from P2Y2 receptor knockout (KO) mice. In addition, adult P2Y2 receptor KO mTALs have significantly lower Vtevalues compared to the juvenile. No difference in absolute I'sc was observed when comparing mTALs from WT and KO mice. AVP stimulated the mTALs to similar increases of NaCl absorption irrespective of the absence of the P2Y2 receptor. No difference was observed in the medullary expression level of NKCC2 in between the genotypes. These data indicate that the lack of P2Y2 receptors does not cause substantial differences in resting and AVP-stimulated NaCl absorption in mouse mTAL.

  9. P2Y2 receptor knock-out mice display normal NaCl absorption in medullary thick ascending limb

    PubMed Central

    Marques, Rita D.; Praetorius, Helle A.; Leipziger, Jens

    2013-01-01

    Local purinergic signals modulate renal tubular transport. Acute activation of renal epithelial P2 receptors causes inhibition of epithelial transport and thus, should favor increased water and salt excretion by the kidney. So far only a few studies have addressed the effects of extracellular nucleotides on ion transport in the thick ascending limb (TAL). In the medullary thick ascending limb (mTAL), basolateral P2X receptors markedly (~25%) inhibit NaCl absorption. Although this segment does express both apical and basolateral P2Y2 receptors, acute activation of the basolateral P2Y2 receptors had no apparent effect on transepithelial ion transport. Here we studied, if the absence of the P2Y2 receptor causes chronic alterations in mTAL NaCl absorption by comparing basal and AVP-stimulated transepithelial transport rates. We used perfused mouse mTALs to electrically measure NaCl absorption in juvenile (<35 days) and adult (>35 days) male mice. Using microelectrodes, we determined the transepithelial voltage (Vte) and the transepithelial resistance (Rte) and thus, transepithelial NaCl absorption (equivalent short circuit current, I'sc). We find that mTALs from adult wild type (WT) mice have significantly lower NaCl absorption rates when compared to mTALs from juvenile WT mice. This could be attributed to significantly higher Rtevalues in mTALs from adult WT mice. This pattern was not observed in mTALs from P2Y2 receptor knockout (KO) mice. In addition, adult P2Y2 receptor KO mTALs have significantly lower Vtevalues compared to the juvenile. No difference in absolute I'sc was observed when comparing mTALs from WT and KO mice. AVP stimulated the mTALs to similar increases of NaCl absorption irrespective of the absence of the P2Y2 receptor. No difference was observed in the medullary expression level of NKCC2 in between the genotypes. These data indicate that the lack of P2Y2 receptors does not cause substantial differences in resting and AVP-stimulated NaCl absorption in mouse mTAL. PMID:24130530

  10. COMPARATIVE HEPATIC EFFECTS OF PERFLUOROOCTANOIC ACID AND WY 14,643 IN PPARÁ KNOCKED OUT AND WILD-TYPE MICE

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a fluorinated organic chemical widely used in consumer and industrial products. Its persistence in the environment and presence in humans and wildlife have raised considerable concerns. PFOA induces liver tumors in rodents, which is thought to be ...

  11. Enhanced histaminergic neurotransmission and sleep-wake alterations, a study in histamine H3-receptor knock-out mice.

    PubMed

    Gondard, Elise; Anaclet, Christelle; Akaoka, Hidéo; Guo, Rui-Xian; Zhang, Mei; Buda, Colette; Franco, Patricia; Kotani, Hidehito; Lin, Jian-Sheng

    2013-05-01

    Long-term abolition of a brain arousal system impairs wakefulness (W), but little is known about the consequences of long-term enhancement. The brain histaminergic arousal system is under the negative control of H3-autoreceptors whose deletion results in permanent enhancement of histamine (HA) turnover. In order to determine the consequences of enhancement of the histaminergic system, we compared the cortical EEG and sleep-wake states of H3-receptor knockout (H3R-/-) and wild-type mouse littermates. We found that H3R-/-mice had rich phenotypes. On the one hand, they showed clear signs of enhanced HA neurotransmission and vigilance, i.e., a higher EEG θ power during spontaneous W and a greater extent of W or sleep restriction during behavioral tasks, including environmental change, locomotion, and motivation tests. On the other hand, during the baseline dark period, they displayed deficient W and signs of sleep deterioration, such as pronounced sleep fragmentation and reduced cortical slow activity during slow wave sleep (SWS), most likely due to a desensitization of postsynaptic histaminergic receptors as a result of constant HA release. Ciproxifan (H3-receptor inverse agonist) enhanced W in wild-type mice, but not in H3R-/-mice, indicating a functional deletion of H3-receptors, whereas triprolidine (postsynaptic H1-receptor antagonist) or α-fluoromethylhistidine (HA-synthesis inhibitor) caused a greater SWS increase in H3R-/- than in wild-type mice, consistent with enhanced HA neurotransmission. These sleep-wake characteristics and the obesity phenotypes previously reported in this animal model suggest that chronic enhancement of histaminergic neurotransmission eventually compromises the arousal system, leading to sleep-wake, behavioral, and metabolic disorders similar to those caused by voluntary sleep restriction in humans.

  12. The GAD65 knock out mouse - a model for GABAergic processes in fear- and stress-induced psychopathology.

    PubMed

    Müller, Iris; Çalışkan, Gürsel; Stork, Oliver

    2015-01-01

    The γ-amino butyric acid (GABA) synthetic enzyme glutamic acid decarboxylase (GAD)65 is critically involved in the activity-dependent regulation of GABAergic inhibition in the central nervous system. It is also required for the maturation of the GABAergic system during adolescence, a phase that is critical for the development of several neuropsychiatric diseases. Mice bearing a null mutation of the GAD65 gene develop hyperexcitability of the amygdala and hippocampus, and a phenotype of increased anxiety and pathological fear memory reminiscent of posttraumatic stress disorder. Although genetic association of GAD65 in human has not yet been reported, these findings are in line with observations of reduced GABAergic function in these brain regions of anxiety disorder patients. The particular value of GAD65(-/-) mice thus lies in modeling the effects of reduced GABAergic function in the mature nervous system. The expression of GAD65 and a second GAD isozyme, GAD67, are differentially regulated in response to stress in limbic brain areas suggesting that by controlling GABAergic inhibition these enzymes determine the vulnerability for the development of pathological anxiety and other stress-induced phenotypes. In fact, we could recently show that GAD65 haplodeficiency, which results in delayed postnatal increase of GABA levels, provides resilience to juvenile-stress-induced anxiety to GAD65(+/-) mice thus foiling the increased fear and anxiety in homozygous GAD65(-/-) mice.

  13. Development of Accelerated Coronary Atherosclerosis Model Using Low Density Lipoprotein Receptor Knock-Out Swine with Balloon Injury

    PubMed Central

    Ogita, Manabu; Miyauchi, Katsumi; Onishi, Akira; Tsuboi, Shuta; Wada, Hideki; Konishi, Hirokazu; Naito, Ryo; Dohi, Tomotaka; Kasai, Takatoshi; Kojima, Yuko; Schwartz, Robert S.; Daida, Hiroyuki

    2016-01-01

    Background Several animal models have facilitated the evaluation and pathological understanding of atherosclerosis, but a definitive animal model of coronary atherosclerosis is not available. We therefore developed low density lipoprotein receptor knockout (LDLR-KO) pigs with hypercholesterolemia, a model which rapidly developed coronary atherosclerosis following balloon injury. Methods and Results We deleted LDLR exon regions from cultured porcine fetal fibroblasts and cloned LDLR knockout (LDLR-KO) embryos microinjecting fetal fibroblast nuclei into enucleated oocytes. Twelve LDLR-KO pigs were fed a 2.0% cholesterol and 20% fat diet. Baseline serum LDL cholesterol level was 510.0±86.1 mg/dL. Balloon injury was created in 46 coronary segments and necropsy were obtained 2, 4, 8 and 12 weeks later. Coronary artery sections were reviewed to evaluate lesion progression. We found lipid accumulation with foam cells and inflammatory cells beginning four weeks after balloon injury. The mean ratio of macrophages to plaque area was significantly higher in the four- weeks and eight-week animals compared with those at 2-weeks (8.79% ± 5.98% and 17.00% ± 10.38% vs. 1.14% ± 1.88%, P < 0.0001). At 12 weeks the ratio decreased toward the level at 2 week level (4.00% ± 4.56%, P = 0.66 vs. baseline). Advanced coronary atherosclerotic lesions contained lipid pools at eight-weeks with fibrous components beginning at 12 weeks. Conclusions We developed a model of rapid coronary atherosclerosis using LDLR KO pigs with balloon injury. This model may be useful for preclinical evaluation of medication or devices, and may also help investigate mechanisms of plaque progression. PMID:27631974

  14. A network-based approach for predicting Hsp27 knock-out targets in mouse skeletal muscles

    PubMed Central

    Kammoun, Malek; Picard, Brigitte; Henry-Berger, Joëlle; Cassar-Malek, Isabelle

    2013-01-01

    Thanks to genomics, we have previously identified markers of beef tenderness, and computed a bioinformatic analysis that enabled us to build an interactome in which we found Hsp27 at a crucial node. Here, we have used a network-based approach for understanding the contribution of Hsp27 to tenderness through the prediction of its interactors related to tenderness. We have revealed the direct interactors of Hsp27. The predicted partners of Hsp27 included proteins involved in different functions, e.g. members of Hsp families (Hsp20, Cryab, Hsp70a1a, and Hsp90aa1), regulators of apoptosis (Fas, Chuk, and caspase-3), translation factors (Eif4E, and Eif4G1), cytoskeletal proteins (Desmin) and antioxidants (Sod1). The abundances of 15 proteins were quantified by Western blotting in two muscles of HspB1-null mice and their controls. We observed changes in the amount of most of the Hsp27 predicted targets in mice devoid of Hsp27 mainly in the most oxidative muscle. Our study demonstrates the functional links between Hsp27 and its predicted targets. It suggests that Hsp status, apoptotic processes and protection against oxidative stress are crucial for post-mortem muscle metabolism, subsequent proteolysis, and therefore for beef tenderness. PMID:24688716

  15. Knock-out of the plastid ribosomal protein L11 in Arabidopsis: effects on mRNA translation and photosynthesis.

    PubMed

    Pesaresi, P; Varotto, C; Meurer, J; Jahns, P; Salamini, F; Leister, D

    2001-08-01

    The prpl11-1 mutant of Arabidopsis thaliana was identified among a collection of T-DNA tagged lines on the basis of a decrease in the effective quantum yield of photosystem II. The mutation responsible was localized to Prpl11, a single-copy nuclear gene that encodes PRPL11, a component of the large subunit of the plastid ribosome. The amino acid sequence of Arabidopsis PRPL11 is very similar to those of L11 proteins from spinach and prokaryotes. In the prpl11-1 mutant, photosensitivity and chlorophyll fluorescence parameters are significantly altered owing to changes in the levels of thylakoid protein complexes and stromal proteins. The abundance of most plastome transcripts examined, such as those of genes coding for the photosystem II core complex and RbcL, is not decreased. Plastid ribosomal RNA accumulates in wild-type amounts, and the assembly of plastid polysomes on the transcripts of the rbcL, psbA and psbE genes remains mainly unchanged in mutant plants, indicating that lack of PRPL11 affects neither the abundance of plastid ribosomes nor their assembly into polysomes. However, in vivo translation assays demonstrate that the rate of translation of the large subunit of Rubisco (RbcL) is significantly reduced in prpl11-1 plastids. Our data suggest a major role for PRPL11 in plastid ribosome activity per se, consistent with its location near the GTPase-binding centre of the chloroplast 50S ribosomal subunit. Additional effects of the mutation, including the pale green colour of the leaves and a drastic reduction in growth rate under greenhouse conditions, are compatible with reduced levels of protein synthesis in plastids.

  16. Enamel defects and ameloblast-specific expression in Enam knock-out/lacz knock-in mice.

    PubMed

    Hu, Jan C-C; Hu, Yuanyuan; Smith, Charles E; McKee, Marc D; Wright, J Timothy; Yamakoshi, Yasuo; Papagerakis, Petros; Hunter, Graeme K; Feng, Jerry Q; Yamakoshi, Fumiko; Simmer, James P

    2008-04-18

    Enamelin is critical for proper dental enamel formation, and defects in the human enamelin gene cause autosomal dominant amelogenesis imperfecta. We used gene targeting to generate a knock-in mouse carrying a null allele of enamelin (Enam) that has a lacZ reporter gene replacing the Enam translation initiation site and gene sequences through exon 7. Correct targeting of the transgene was confirmed by Southern blotting and PCR analyses. No enamelin protein could be detected by Western blotting in the Enam-null mice. Histochemical 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal) staining demonstrated ameloblast-specific expression of enamelin. The enamel of the Enam(+/-) mice was nearly normal in the maxillary incisors, but the mandibular incisors were discolored and tended to wear rapidly where they contacted the maxillary incisors. The Enam(-/-) mice showed no true enamel. Radiography, microcomputed tomography, and light and scanning electron microscopy were used to document changes in the enamel of Enam(-/-) mice but did not discern any perturbations of bone, dentin, or any other tissue besides the enamel layer. Although a thick layer of enamel proteins covered normal-appearing dentin of unerupted teeth, von Kossa staining revealed almost a complete absence of mineral formation in this protein layer. However, a thin, highly irregular, mineralized crust covered the dentin on erupted teeth, apparently arising from the formation and fusion of small mineralization foci (calcospherites) in the deeper part of the accumulated enamel protein layer. These results demonstrate ameloblast-specific expression of enamelin and reveal that enamelin is essential for proper enamel matrix organization and mineralization.

  17. Pharmacological enhancement of mGlu5 receptors rescues behavioral deficits in SHANK3 knock-out mice

    PubMed Central

    Vicidomini, Cinzia; Ponzoni, Luisa; Lim, Dmitry; Schmeisser, Michael; Reim, Dominik; Morello, Noemi; Orelanna, Daniel; Tozzi, Alessandro; Durante, Valentina; Scalmani, Paolo; Mantegazza, Massimo; Genazzani, Armando A.; Giustetto, Maurizio; Sala, Mariaelvina; Calabresi, Paolo; Boeckers, Tobias M.; Sala, Carlo; Verpelli, Chiara

    2016-01-01

    SHANK3 (also called PROSAP2) genetic haploinsufficiency is thought to be the major cause of neuropsychiatric symptoms in Phelan-McDermid syndrome (PMS). PMS is a rare genetic disorder that causes a severe form of intellectual disability (ID), expressive language delays and other autistic features. Furthermore, a significant number of SHANK3 mutations have been identified in patients with Autism Spectrum disorders ASD, and SHANK3 truncating mutations are associated with moderate to profound ID. The Shank3 protein is a scaffold protein that is located in the postsynaptic density (PSD) of excitatory synapses and is crucial for synapse development and plasticity. In this study, we investigated the molecular mechanisms associated with the ASD-like behaviors observed in Shank3Δ11-/- mice in which exon 11 has been deleted. Our results indicate that Shank3 is essential to mediating mGlu5 receptor signaling by recruiting Homer1b/c to the PSD, specifically in the striatum and cortex. Moreover, augmenting mGlu5 receptor activity by administering 3-Cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB) ameliorated the functional and behavioral defects that were observed in Shank3Δ11-/- mice, suggesting that pharmaceutical treatments that increase mGlu5 activity may represent a new approach for treating patients that are affected by PMS and SHANK3 mutations. PMID:27021819

  18. Genetic-Background Modulation of Core and Variable Autistic-Like Symptoms in Fmr1 Knock-Out Mice

    PubMed Central

    Pietropaolo, Susanna; Guilleminot, Aurélie; Martin, Benoît; D'Amato, Francesca R.; Crusio, Wim E.

    2011-01-01

    Background No animal models of autism spectrum disorders (ASD) with good construct validity are currently available; using genetic models of pathologies characterized by ASD-like deficits, but with known causes, may be therefore a promising strategy. The Fmr1-KO mouse is an example of this approach, modeling Fragile X syndrome, a well-known genetic disorder presenting ASD symptoms. The Fmr1-KO is available on different genetic backgrounds (FVB versus C57BL/6), which may explain some of the conflicting results that have been obtained with these mutants up till now. Methods Fmr1 KO and their wild-type littermates on both the FVB and C57BL/6 genetic backgrounds were examined on a battery of tests modeling the clinical symptoms of ASD, including the triad of core symptoms (alterations in social interaction and communication, presence of repetitive behaviors), as well as the secondary symptoms (disturbances in sensori-motor reactivity and in circadian patterns of activity, epileptic events). Results Fmr1-KO mice displayed autistic-like core symptoms of altered social interaction and occurrence of repetitive behaviors with additional hyperactivity. The genetic background modulated the effects of the Fmr1 deletion and it appears that the C57BL/6 background may be more suitable for further research on core autistic-like symptoms. Conclusions The Fmr1-mouse line does not recapitulate all of the main core and secondary ASD symptoms, but still can be useful to elucidate the neurobiological mechanisms underlying specific ASD-like endophenotypes. PMID:21364941

  19. Genetic-background modulation of core and variable autistic-like symptoms in Fmr1 knock-out mice.

    PubMed

    Pietropaolo, Susanna; Guilleminot, Aurélie; Martin, Benoît; D'Amato, Francesca R; Crusio, Wim E

    2011-02-22

    No animal models of autism spectrum disorders (ASD) with good construct validity are currently available; using genetic models of pathologies characterized by ASD-like deficits, but with known causes, may be therefore a promising strategy. The Fmr1-KO mouse is an example of this approach, modeling Fragile X syndrome, a well-known genetic disorder presenting ASD symptoms. The Fmr1-KO is available on different genetic backgrounds (FVB versus C57BL/6), which may explain some of the conflicting results that have been obtained with these mutants up till now. Fmr1 KO and their wild-type littermates on both the FVB and C57BL/6 genetic backgrounds were examined on a battery of tests modeling the clinical symptoms of ASD, including the triad of core symptoms (alterations in social interaction and communication, presence of repetitive behaviors), as well as the secondary symptoms (disturbances in sensori-motor reactivity and in circadian patterns of activity, epileptic events). Fmr1-KO mice displayed autistic-like core symptoms of altered social interaction and occurrence of repetitive behaviors with additional hyperactivity. The genetic background modulated the effects of the Fmr1 deletion and it appears that the C57BL/6 background may be more suitable for further research on core autistic-like symptoms. The Fmr1-mouse line does not recapitulate all of the main core and secondary ASD symptoms, but still can be useful to elucidate the neurobiological mechanisms underlying specific ASD-like endophenotypes.

  20. Increased analgesic tolerance to acute morphine in fosB knock-out mice: a gender study.

    PubMed

    Solecki, Wojciech; Krowka, Tomasz; Kubik, Jakub; Kaczmarek, Leszek; Przewlocki, Ryszard

    2008-10-01

    The proteins of Fos family are a potential candidate to link molecular mechanisms of morphine action with behavioural effects such as morphine-induced reward, dependence and tolerance. We used both male and female mice lacking fosB gene to study its contribution to morphine effects. Morphine analgesia (tail-flick test) and hypothermia were studied using morphine at cumulative doses in morphine-naive and morphine-tolerant (tolerance induced by 24 h prior 100 mg/kg morphine administration) mice. FosB -/- mice, as compared to fosB +/+ mice, developed enhanced tolerance to morphine-induced analgesia. No effects of genotype or gender on tolerance to morphine-induced hypothermia were observed. These results suggest that fosB may be involved in the development of tolerance to morphine analgesia but not hypothermia. The gender study implicates that lack of FosB proteins in female fosB -/- mice enhanced morphine analgesic potency. In conclusion, we show that fosB gene is important to analgesia but not hypothermia phenotype indicating its role in morphine effects.

  1. Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects.

    PubMed

    Henriques, Rossana; Jásik, Ján; Klein, Markus; Martinoia, Enrico; Feller, Urs; Schell, Jeff; Pais, Maria S; Koncz, Csaba

    2002-11-01

    IRT1 and IRT2 are members of the Arabidopsis ZIP metal transporter family that are specifically induced by iron deprivation in roots and act as heterologous suppressors of yeast mutations inhibiting iron and zinc uptake. Although IRT1 and IRT2 are thought to perform redundant functions as root-specific metal transporters, insertional inactivation of the IRT1 gene alone results in typical symptoms of iron deficiency causing severe leaf chlorosis and lethality in soil. The irt1 mutation is characterized by specific developmental defects, including a drastic reduction of chloroplast thylakoid stacking into grana and lack of palisade parenchyma differentiation in leaves, reduced number of vascular bundles in stems, and irregular patterns of enlarged endodermal and cortex cells in roots. Pulse labeling with 59Fe through the root system shows that the irt1 mutation reduces iron accumulation in the shoots. Short-term labeling with 65Zn reveals no alteration in spatial distribution of zinc, but indicates a lower level of zinc accumulation. In comparison to wild-type, the irt1 mutant responds to iron and zinc deprivation by altered expression of certain zinc and iron transporter genes, which results in the activation of ZIP1 in shoots, reduction of ZIP2 transcript levels in roots, and enhanced expression of IRT2 in roots. These data support the conclusion that IRT1 is an essential metal transporter required for proper development and regulation of iron and zinc homeostasis in Arabidopsis.

  2. Dietary cladode powder from wild type and domesticated Opuntia species reduces atherogenesis in apoE knock-out mice.

    PubMed

    Garoby-Salom, Sandra; Guéraud, Françoise; Camaré, Caroline; de la Rosa, Ana-Paulina Barba; Rossignol, Michel; Santos Díaz, María del Socorro; Salvayre, Robert; Negre-Salvayre, Anne

    2016-03-01

    Dietary intake of Opuntia species may prevent the development of cardiovascular diseases. The present study was designed to characterize the biological antioxidant and anti-inflammatory properties of Opuntia species and to investigate whether Opuntia cladodes prevent the development of atherosclerosis in vivo, in apoE(-)KO mice. The effects of the two Opuntia species, the wild Opuntia streptacantha and the domesticated Opuntia ficus-indica, were tested on the generation of intra- and extracellular reactive oxygen species (ROS) production and kinetics of the LDL oxidation by murine CRL2181 endothelial cells and on the subsequent inflammatory signaling leading to the adhesion of monocytes on the activated endothelium and the formation of foam cells. Opuntia species blocked the extracellular ROS (superoxide anion) generation and LDL oxidation by CRL2181, as well as the intracellular ROS rise and signaling evoked by the oxidized LDL, including the nuclear translocation of the transcription factor NFκB, the expression of ICAM-1 and VCAM-1 adhesion molecules, and the adhesion of monocytes to CRL2181. In vivo, Opuntia significantly reduced the formation of atherosclerotic lesions and the accumulation of 4-hydroxynonenal adducts in the vascular wall of apoE-KO mice, indicating that Opuntia cladodes prevent lipid oxidation in the vascular wall. In conclusion, wild and domesticated Opuntia species exhibit antioxidant, anti-inflammatory, and antiatherogenic properties which emphasize their nutritional benefit for preventing cardiovascular diseases.

  3. Knocking out the dopamine reuptake transporter (DAT) does not change the baseline brain arachidonic acid signal in the mouse

    PubMed Central

    Ramadan, Epolia; Chang, Lisa; Chen, Mei; Ma, Kaizong; Hall, F. Scott; Uhl, George R.; Rapoport, Stanley I.; Basselin, Mireille

    2012-01-01

    Background Dopamine transporter (DAT) homozygous knockout (DAT−/−) mice have a 10-fold higher extracellular DA concentration in the caudate-putamen and nucleus accumbens than do wildtype (DAT+/+) mice, but show reduced presynaptic DA synthesis and fewer postsynaptic D2 receptors. One aspect of neurotransmission involves DA binding to postsynaptic D2-like receptors coupled to cytosolic phospholipase A2 (cPLA2), releasing second messenger arachidonic acid (AA) from synaptic membrane phospholipid. We hypothesized that tonic overactivation of D2-like receptors in DAT−/− mice due to elevated DA would not increase brain AA signaling, because of compensatory downregulation of postsynaptic signaling mechanisms. Methods [1-14C]AA was infused intravenously for 3 min in unanesthetized DAT+/+, heterozygous (DAT+/−) and DAT−/− mice. AA incorporation coefficients k* and rates Jin, markers of AA metabolism and signaling, were imaged in 83 brain regions using quantitative autoradiography brain cPLA2-IV activity also was measured. Results Neither k* nor Jin for AA in any brain region, or in brain cPLA2-IV activity, differed significantly between DAT−/−, DAT+/− and DAT+/+ mice. Conclusions These results differ from reported increases in k* and Jin for AA, and brain cPLA2 expression, in serotonin reuptake transporter (5-HTT) knockout mice, and suggest that postsynaptic dopaminergic neurotransmission mechanisms involving AA are downregulated despite elevated DA in DAT−/− mice. PMID:22376027

  4. Neutron detectors for fusion reaction-rate measurements

    SciTech Connect

    Lerche, R.A.; Phillion, D.W.; Landen, O.L.; Murphy, T.J.; Jaanimagi, P.A.

    1994-02-10

    Fusion reactions in an inertial-confinement fusion (ICF) target filled with deuterium or a deuterium/tritium fuel release nearly monoenergetic neutrons. Because most the neutrons leave the compressed target without collision, they preserve reaction-rate information as they travel radially outward from their point of origin. Three fast, neutron detector techniques, each capable of measuring the fusion reaction-rate of ICF targets, have been demonstrated. The most advanced detector is based on the fast rise-time of a commercial plastic scintillator material (BC-422) which acts as a neutron-to-light converter. Signals, which are recorded with a fast optical streak camera, have a resolution of 25 ps. Good signals can be recorded for targets producing only 5 x 10{sup 7} DT neutrons. Two other detectors use knock-on collisions between neutrons and protons in a thin polyethylene (CH{sub 2}) converter. In one, the converter is placed in front of the photocathode of an x-ray streak camera. Recoil protons pass through the photocathode and knock out electrons which are accelerated and deflected to produce a signal. Resolutions < 25 ps are possible. In the other, the converter is placed in front of a microchannel plate (MCP) with a gated microstrip. Recoil protons eject electrons from the gold layer forming the microstrip. If a gate pulse is present, the signal is amplified. Present gate times are about 80 ps.

  5. Sensitivity of chemical reaction networks: a structural approach. 1. Examples and the carbon metabolic network.

    PubMed

    Mochizuki, Atsushi; Fiedler, Bernold

    2015-02-21

    In biological cells, chemical reaction pathways lead to complex network systems like metabolic networks. One experimental approach to the dynamics of such systems examines their "sensitivity": each enzyme mediating a reaction in the system is increased/decreased or knocked out separately, and the responses in the concentrations of chemicals or their fluxes are observed. In this study, we present a mathematical method, named structural sensitivity analysis, to determine the sensitivity of reaction systems from information on the network alone. We investigate how the sensitivity responses of chemicals in a reaction network depend on the structure of the network, and on the position of the perturbed reaction in the network. We establish and prove some general rules which relate the sensitivity response to the structure of the underlying network. We describe a hierarchical pattern in the flux response which is governed by branchings in the network. We apply our method to several hypothetical and real life chemical reaction networks, including the metabolic network of the Escherichia coli TCA cycle. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Investigation of the reaction mechanism for the four-particle photodisintegration of a carbon nucleus

    NASA Astrophysics Data System (ADS)

    Afanas'ev, S. N.; Gorbenko, E. S.; Khodyachikh, A. F.

    2007-05-01

    The four-particle photodisintegration of a carbon nucleus in the reactions 12C(γ, p)3H2α and 12C(γ, n)3H2α is investigated by a method that employs a diffusion chamber in a magnetic field. It is shown that these reactions proceed according a sequential-type scheme: excited states of 11B and 11C nuclei decay to weakly excited states of 8Be, 7Li, and 7Be nuclei. It is concluded that nucleons are knocked out from the s shell. In the excitation curve for the 2α system in the reaction 12C(γ, p)3H2α, a resonance is found between the maxima corresponding to the ground and the first excited state of the 8Be nucleus, and this resonance is identified as a ghost anomaly. The branching fractions of the decay modes are determined. The angular distributions of nucleons in the reaction c.m. frame are measured. The energy dependence of the asymmetry coefficient for the angular distributions is obtained. A fast increase in this coefficient is observed in the energy range 38 40 MeV. It is concluded that the asymmetry coefficient depends on the excitation energy of the final nucleus in the region of intermediate photon energies.

  7. B- and T-lymphocyte attenuator targeting protects against the acute phase of graft versus host reaction by inhibiting donor anti-host cytotoxicity.

    PubMed

    del Rio, Maria-Luisa; Kurtz, Josef; Perez-Martinez, Claudia; Ghosh, Arnab; Perez-Simon, José Antonio; Rodriguez-Barbosa, Jose-Ignacio

    2011-11-27

    B- and T-lymphocyte attenuator (BTLA) functions as a coinhibitory/costimulatory molecule that belongs to the immunoglobulin superfamily and exhibits a pattern of expression restricted to the hematopoietic compartment. Engagement of BTLA by its ligand, herpes virus entry mediator (HVEM), delivers negative signals to T cells, whereas engagement of HVEM receptor on T cells by surface BTLA expressed on other immune cells costimulates T activation. Previous work has reported that parental donor BTLA knock-out or HVEM knock-out T cells adoptively transferred into nonirradiated F1 recipient mice survived poorly, and the rejection of host hematopoietic cells was attenuated compared with F1 recipients receiving wild-type T cells. Parent into nonirradiated immunocompetent F1 murine model of acute graft versus host reaction, which is induced with the adoptive transfer of splenocytes from donor B6 mice (H-2(b)) into F1 recipients (BALB/c×B6, H-2(d/b)), was used as an experimental approach to test the therapeutic effect of targeting BTLA during the course of an allogeneic immune response. We herein provide evidence that administration of an anti-BTLA monoclonal antibody leads to significant reduction of donor anti-host allogeneic immune response against bone marrow and thymus during the acute phase of graft versus host reaction in a parent into nonirradiated F1 murine model of alloreactivity. Anti-BTLA protection against donor anti-host hematopoietic cell rejection correlated with impaired anti-host cytotoxic T-lymphocyte activity than reduction in T-cell number infiltrating host tissues. These findings place BTLA receptor as a potential immunoregulatory target for the modulation of cytotoxic T-lymphocyte-mediated alloresponses.

  8. Flux balance impact degree: a new definition of impact degree to properly treat reversible reactions in metabolic networks

    PubMed Central

    Zhao, Yang; Tamura, Takeyuki; Akutsu, Tatsuya; Vert, Jean-Philippe

    2013-01-01

    Motivation: Metabolic pathways are complex systems of chemical reactions taking place in every living cell to degrade substrates and synthesize molecules needed for life. Modeling the robustness of these networks with respect to the dysfunction of one or several reactions is important to understand the basic principles of biological network organization, and to identify new drug targets. While several approaches have been proposed for that purpose, they are computationally too intensive to analyze large networks, and do not properly handle reversible reactions. Results: We propose a new model—the flux balance impact degree—to model the robustness of large metabolic networks with respect to gene knock-out. We formulate the computation of the impact of one or several reaction blocking as linear programs, and propose efficient strategies to solve them. We show that the proposed method better predicts the phenotypic impact of single gene deletions on Escherichia coli than existing methods. Availability: https://sunflower.kuicr.kyoto-u.ac.jp/∼tyoyo/fbid/index.html Contact: takutsu@kuicr.kyoto-u.ac.jp or Jean-Philippe.Vert@mines.org Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23828783

  9. Drug Reactions

    MedlinePlus

    ... or diabetes. But medicines can also cause unwanted reactions. One problem is interactions, which may occur between ... more serious. Drug allergies are another type of reaction. They can be mild or life-threatening. Skin ...

  10. Effects of NV gene knock-out recombinant viral hemorrhagic septicemia virus (VHSV) on Mx gene expression in Epithelioma papulosum cyprini (EPC) cells and olive flounder (Paralichthys olivaceus).

    PubMed

    Kim, Min Sun; Kim, Ki Hong

    2012-03-01

    To determine whether the NV gene of viral hemorrhagic septicemia virus (VHSV) is related to the type I interferon response of hosts, expression of Mx gene in Epithelioma papulosum cyprini (EPC) cells and in olive flounder (Paralichthys olivaceus) in response to infection with either wild-type VHSV or recombinant VHSVs (rVHSV-ΔNV-EGFP and rVHSV-wild) was investigated. A reporter vector was constructed for measuring Mx gene expression using olive flounder Mx promoter, in which the reporter Metridia luciferase was designed to be excreted to culture medium to facilitate measurement. The highest increase of luciferase activity was detected from supernatant of cells infected with rVHSV-ΔNV-EGFP. In contrast cells infected with wild-type VHSV showed a slight increase of the luciferase activity. Interestingly, cells infected with rVHSV-wild that has artificially changed nucleotides just before and after the NV gene ORF, also showed highly increased luciferase activity, but the increased amplitude was lower than that by rVHSV-ΔNV-EGFP. These results strongly suggest that the NV protein of VHSV plays an important role in suppressing interferon response in host cells, which provides a condition for the viruses to efficiently proliferate in host cells. In an in vivo experiment, the Mx gene expression in olive flounder challenged with the rVHSV-ΔNV-EGFP was clearly higher than fish challenged with rVHSV-wild or wild-type VHSV, suggesting that lacking of the NV gene in the genome of rVHSV-ΔNV-EGFP brought to strong interferon response that subsequently inhibit viral replication in fish.

  11. Knocking Out ACR2 Does Not Affect Arsenic Redox Status in Arabidopsis thaliana: Implications for As Detoxification and Accumulation in Plants

    PubMed Central

    Liu, Wenju; Schat, Henk; Bliek, Mathijs; Chen, Yi; McGrath, Steve P.; George, Graham; Salt, David E.; Zhao, Fang-Jie

    2012-01-01

    Many plant species are able to reduce arsenate to arsenite efficiently, which is an important step allowing detoxification of As through either efflux of arsenite or complexation with thiol compounds. It has been suggested that this reduction is catalyzed by ACR2, a plant homologue of the yeast arsenate reductase ScACR2. Silencing of AtACR2 was reported to result in As hyperaccumulation in the shoots of Arabidopsis thaliana. However, no information of the in vivo As speciation has been reported. Here, we investigated the effect of AtACR2 knockout or overexpression on As speciation, arsenite efflux from roots and As accumulation in shoots. T-DNA insertion lines, overexpression lines and wild-type (WT) plants were exposed to different concentrations of arsenate for different periods, and As speciation in plants and arsenite efflux were determined using HPLC-ICP-MS. There were no significant differences in As speciation between different lines, with arsenite accounting for >90% of the total extractable As in both roots and shoots. Arsenite efflux to the external medium represented on average 77% of the arsenate taken up during 6 h exposure, but there were no significant differences between WT and mutants or overexpression lines. Accumulation of As in the shoots was also unaffected by AtACR2 knockout or overexpression. Additionally, after exposure to arsenate, the yeast (Saccharomyces cerevisiae) strain with ScACR2 deleted showed similar As speciation as the WT with arsenite-thiol complexes being the predominant species. Our results suggest the existence of multiple pathways of arsenate reduction in plants and yeast. PMID:22879969

  12. Knock out of S1P3 receptor signaling attenuates inflammation and fibrosis in bleomycin-induced lung injury mice model.

    PubMed

    Murakami, Ken; Kohno, Masataka; Kadoya, Masatoshi; Nagahara, Hidetake; Fujii, Wataru; Seno, Takahiro; Yamamoto, Aihiro; Oda, Ryo; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Morita, Satoshi; Nakada, Hiroshi; Hla, Timothy; Kawahito, Yutaka

    2014-01-01

    Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite involved in many critical cellular processes, including proliferation, migration, and angiogenesis, through interaction with a family of five G protein-coupled receptors (S1P1-5). Some reports have implicated S1P as an important inflammatory mediator of the pathogenesis of airway inflammation, but the role of S1P3 in the pathogenesis of lung diseases is not completely understood. We used S1P3-deficient (knockout (KO)) mice to clarify the role of S1P3 receptor signaling in the pathogenesis of pulmonary inflammation and fibrosis using a bleomycin-induced model of lung injury. On the seventh day after bleomycin administration, S1P3 KO mice exhibited significantly less body weight loss and pulmonary inflammation than wild-type (WT) mice. On the 28th day, there was less pulmonary fibrosis in S1P3 KO mice than in WT mice. S1P3 KO mice demonstrated a 56% reduction in total cell count in bronchoalveolar lavage fluid (BALF) collected on the seventh day compared with WT mice; however, the differential white blood cell profiles were similar. BALF analysis on the seventh day showed that connective tissue growth factor (CTGF) levels were significantly decreased in S1P3 KO mice compared with WT mice, although no differences were observed in monocyte chemotactic protein-1 (MCP-1) or transforming growth factor β1 (TGF-β1) levels. Finally, S1P levels in BALF collected on the 7th day after treatment were not significantly different between WT and S1P3 KO mice. Our results indicate that S1P3 receptor signaling plays an important role in pulmonary inflammation and fibrosis and that this signaling occurs via CTGF expression. This suggests that this pathway might be a therapeutic target for pulmonary fibrosis.

  13. Metallothionein (MT) 1/2 expression in MT 1/2 and MT 3 knock-out mice and Long-Evans Cinnamon (LEC) rats.

    PubMed

    Nakazato, Kyoumi; Nakajima, Katsuyuki; Nakano, Takamitsu; Kodaira, Tsukasa; Nakayama, Kenji; Satoh, Masahiko; Nagamine, Takeaki

    2012-02-01

    Metallothionein (MT) is known to be involved in various physiological roles and diseases. However, a standard method for MT measurement has not been established until recently. Therefore, we have developed an easy and specific enzyme-linked immunosorbent assays (ELISA) to determine MT-1 and MT-2. In order to evaluate the method we developed, MT-1/2 in liver, kidney and brain was determined in wild type (WT), MT-1/2 knockout (KO) and MT-3 KO mice, with and without Cd treatment. MT 1/2 in urine was determined in genetically disordered LEC rats (an animal model of Wilson disease). MT-1/2 concentrations in the liver, kidney and brain in MT-1/2 KO mice were significantly lower compared to those of WT and MT-3 KO mice. MT-1/2 concentrations in the livers of WT mice significantly increased with Cd administration, but not in MT-1/2 KO mice. Similar results were observed by immunohistochemical staining. To confirm the molecular weight (MW) of MT detected in organs by the ELISA, analysis with a Sephadex G-75 was performed. Two peaks of MT-1/2 (MW small and large) were detected in WT and MT-3 KO mice. The small MT peak was mostly depleted in MT 1/2-KO mice, while a large MT peak remained. A significant increase in MT-1/2 concentration was detected in the urine of LEC rats with age and especially at the hepatitis stage. In conclusion, MT-1/2 ELISA and immunohistochemical staining was highly correlated with MT-1/2 determination in experimental animal specimens and could be a robust analytical tool for physiological and toxicological studies.

  14. Differential proteome-metabolome profiling of YCA1-knock-out and wild type cells reveals novel metabolic pathways and cellular processes dependent on the yeast metacaspase.

    PubMed

    Ždralević, Maša; Longo, Valentina; Guaragnella, Nicoletta; Giannattasio, Sergio; Timperio, Anna Maria; Zolla, Lello

    2015-06-01

    The yeast Saccharomyces cerevisiae expresses one member of the metacaspase Cys protease family, encoded by the YCA1 gene. Combination of proteomics and metabolomics data showed that YCA1 deletion down-regulated glycolysis, the TCA cycle and alcoholic fermentation as compared with WT cells. Δyca1 cells also showed a down-regulation of the pentose phosphate pathway and accumulation of pyruvate, correlated with higher levels of certain amino acids found in these cells. Accordingly, there is a decrease in protein biosynthesis, and up-regulation of specific stress response proteins like Ahp1p, which possibly provides these cells with a better protection against stress. Moreover, in agreement with the down-regulation of protein biosynthesis machinery in Δyca1 cells, we have found that regulation of transcription, co-translational protein folding and protein targeting to different subcellular locations were also down-regulated. Metabolomics analysis of the nucleotide content showed a significant reduction in Δyca1 cells in comparison with the WT, except for GTP content which remained unchanged. Thus, our combined proteome-metabolome approach added a new dimension to the non-apoptotic function of yeast metacaspase, which can specifically affect cell metabolism through as yet unknown mechanisms and possibly stress-response pathways, like HOG and cell wall integrity pathways. Certainly, YCA1 deletion may induce compensatory changes in stress response proteins offering a better protection against apoptosis to Δyca1 cells rather than a loss in pro-apoptotic YCA1-associated activity.

  15. (R)-3-hydroxyacyl-ACP:CoA transacylase of Pseudomonas chlororaphis: gene cloning, characterization and knock-out on PHA and rhamnolipid syntheses

    USDA-ARS?s Scientific Manuscript database

    Pseudomonas chlororaphis is a useful microorganism capable of producing polyhydroxyalkanoate (PHA) biopolymer and rhamnolipid (RL) biosurfactants by using carbon- and nitrogen-sources derived from renewable feedstocks as substrates of fermentation. We are interested in increasing the yield of RL pr...

  16. Attrition of Hepatic Damage Inflicted by Angiotensin II with α-Tocopherol and β-Carotene in Experimental Apolipoprotein E Knock-out Mice.

    PubMed

    Gopal, Kaliappan; Gowtham, Munusamy; Sachin, Singh; Ravishankar Ram, Mani; Shankar, Esaki M; Kamarul, Tunku

    2015-12-16

    Angiotensin II is one of the key regulatory peptides implicated in the pathogenesis of liver disease. The mechanisms underlying the salubrious role of α-tocopherol and β-carotene on liver pathology have not been comprehensively assessed. Here, we investigated the mechanisms underlying the role of Angiotensin II on hepatic damage and if α-tocopherol and β-carotene supplementation attenuates hepatic damage. Hepatic damage was induced in Apoe(-/-)mice by infusion of Angiotensin II followed by oral administration with α-tocopherol and β-carotene-enriched diet for 60 days. Investigations showed fibrosis, kupffer cell hyperplasia, hepatocyte degeneration and hepatic cell apoptosis; sinusoidal dilatation along with haemorrhages; evidence of fluid accumulation; increased ROS level and increased AST and ALT activities. In addition, tPA and uPA were down-regulated due to 42-fold up-regulation of PAI-1. MMP-2, MMP-9, MMP-12, and M-CSF were down-regulated in Angiotensin II-treated animals. Notably, α-tocopherol and β-carotene treatment controlled ROS, fibrosis, hepatocyte degeneration, kupffer cell hyperplasia, hepatocyte apoptosis, sinusoidal dilatation and fluid accumulation in the liver sinusoids, and liver enzyme levels. In addition, PAI-1, tPA and uPA expressions were markedly controlled by β-carotene treatment. Thus, Angiotensin II markedly influenced hepatic damage possibly by restraining fibrinolytic system. We concluded that α-tocopherol and β-carotene treatment has salubrious role in repairing hepatic pathology.

  17. Relationships among parvalbumin-immunoreactive neuron density, phase-locked gamma oscillations, and autistic/schizophrenic symptoms in PDGFR-β knock-out and control mice.

    PubMed

    Nakamura, Tomoya; Matsumoto, Jumpei; Takamura, Yusaku; Ishii, Yoko; Sasahara, Masakiyo; Ono, Taketoshi; Nishijo, Hisao

    2015-01-01

    Cognitive deficits and negative symptoms are important therapeutic targets for schizophrenia and autism disorders. Although reduction of phase-locked gamma oscillation has been suggested to be a result of reduced parvalbumin-immunoreactive (putatively, GABAergic) neurons, no direct correlations between these have been established in these disorders. In the present study, we investigated such relationships during pharmacological treatment with a newly synthesized drug, T-817MA, which displays neuroprotective and neurotrophic effects. In this study, we used platelet-derived growth factor receptor-β gene knockout (PDGFR-β KO) mice as an animal model of schizophrenia and autism. These mutant mice display a reduction in social behaviors; deficits in prepulse inhibition (PPI); reduced levels of parvalbumin-immunoreactive neurons in the medical prefrontal cortex, hippocampus, amygdala, and superior colliculus; and a deficit in of auditory phase-locked gamma oscillations. We found that oral administration of T-817MA ameliorated all these symptoms in the PDGFR-β KO mice. Furthermore, phase-locked gamma oscillations were significantly correlated with the density of parvalbumin-immunoreactive neurons, which was, in turn, correlated with PPI and behavioral parameters. These findings suggest that recovery of parvalbumin-immunoreactive neurons by pharmacological intervention relieved the reduction of phase-locked gamma oscillations and, consequently, ameliorated PPI and social behavioral deficits. Thus, our findings suggest that phase-locked gamma oscillations could be a useful physiological biomarker for abnormality of parvalbumin-immunoreactive neurons that may induce cognitive deficits and negative symptoms of schizophrenia and autism, as well as of effective pharmacological interventions in both humans and experimental animals.

  18. Comparative hepatic effects of perfluorooctanoic acid and WY 14,643 in PPARa-knocked out and wild-type mice.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is an environmentally persistent chemical commonly found in humans and wildlife. Induction of liver tumors by PFOA in rodents is thought to be mediated by PPARα activation, although hepatic hypertrophy persists in PPARα-null mice. This study evalua...

  19. Prion Protein (PrP) Knock-Out Mice Show Altered Iron Metabolism: A Functional Role for PrP in Iron Uptake and Transport

    PubMed Central

    Singh, Ajay; Kong, Qingzhong; Luo, Xiu; Petersen, Robert B.; Meyerson, Howard; Singh, Neena

    2009-01-01

    Despite overwhelming evidence implicating the prion protein (PrP) in prion disease pathogenesis, the normal function of this cell surface glycoprotein remains unclear. In previous reports we demonstrated that PrP mediates cellular iron uptake and transport, and aggregation of PrP to the disease causing PrP-scrapie (PrPSc) form results in imbalance of iron homeostasis in prion disease affected human and animal brains. Here, we show that selective deletion of PrP in transgenic mice (PrPKO) alters systemic iron homeostasis as reflected in hematological parameters and levels of total iron and iron regulatory proteins in the plasma, liver, spleen, and brain of PrPKO mice relative to matched wild type controls. Introduction of radiolabeled iron (59FeCl3) to Wt and PrPKO mice by gastric gavage reveals inefficient transport of 59Fe from the duodenum to the blood stream, an early abortive spike of erythropoiesis in the long bones and spleen, and eventual decreased 59Fe content in red blood cells and all major organs of PrPKO mice relative to Wt controls. The iron deficient phenotype of PrPKO mice is reversed by expressing Wt PrP in the PrPKO background, demonstrating a functional role for PrP in iron uptake and transport. Since iron is required for essential metabolic processes and is also potentially toxic if mismanaged, these results suggest that loss of normal function of PrP due to aggregation to the PrPSc form induces imbalance of brain iron homeostasis, resulting in disease associated neurotoxicity. PMID:19568430

  20. Analyzing structure–function relationships of artificial and cancer-associated PARP1 variants by reconstituting TALEN-generated HeLa PARP1 knock-out cells

    PubMed Central

    Rank, Lisa; Veith, Sebastian; Gwosch, Eva C.; Demgenski, Janine; Ganz, Magdalena; Jongmans, Marjolijn C.; Vogel, Christopher; Fischbach, Arthur; Buerger, Stefanie; Fischer, Jan M.F.; Zubel, Tabea; Stier, Anna; Renner, Christina; Schmalz, Michael; Beneke, Sascha; Groettrup, Marcus; Kuiper, Roland P.; Bürkle, Alexander; Ferrando-May, Elisa; Mangerich, Aswin

    2016-01-01

    Genotoxic stress activates PARP1, resulting in the post-translational modification of proteins with poly(ADP-ribose) (PAR). We genetically deleted PARP1 in one of the most widely used human cell systems, i.e. HeLa cells, via TALEN-mediated gene targeting. After comprehensive characterization of these cells during genotoxic stress, we analyzed structure–function relationships of PARP1 by reconstituting PARP1 KO cells with a series of PARP1 variants. Firstly, we verified that the PARP1\\E988K mutant exhibits mono-ADP-ribosylation activity and we demonstrate that the PARP1\\L713F mutant is constitutively active in cells. Secondly, both mutants exhibit distinct recruitment kinetics to sites of laser-induced DNA damage, which can potentially be attributed to non-covalent PARP1–PAR interaction via several PAR binding motifs. Thirdly, both mutants had distinct functional consequences in cellular patho-physiology, i.e. PARP1\\L713F expression triggered apoptosis, whereas PARP1\\E988K reconstitution caused a DNA-damage-induced G2 arrest. Importantly, both effects could be rescued by PARP inhibitor treatment, indicating distinct cellular consequences of constitutive PARylation and mono(ADP-ribosyl)ation. Finally, we demonstrate that the cancer-associated PARP1 SNP variant (V762A) as well as a newly identified inherited PARP1 mutation (F304L\\V762A) present in a patient with pediatric colorectal carcinoma exhibit altered biochemical and cellular properties, thereby potentially supporting human carcinogenesis. Together, we establish a novel cellular model for PARylation research, by revealing strong structure–function relationships of natural and artificial PARP1 variants. PMID:27694308

  1. Susceptibility of T cell receptor-α chain knock-out mice to ultraviolet B light and fluorouracil: a novel model for drug-induced cutaneous lupus erythematosus

    PubMed Central

    YOSHIMASU, T; NISHIDE, T; SEO, N; HIROI, A; OHTANI, T; UEDE, K; FURUKAWA, F

    2004-01-01

    The anticancer agent 5-fluorouracil (FU) frequently induces cutaneous lupus erythematosus (LE) lesions on sun exposed sites. Based on this observation, we have tried to establish a cutaneous LE model of C57BL/6 J (B6) mice, B6 T cell receptor (TCR)-α–/– mice and B6 TCR-δ–/– mice treated with FU and/or ultraviolet B light (UVBL) in order to clarify the role of T cells and the cytokine profile of cutaneous lupus lesions. Cutaneous LE-like skin lesions could be induced in TCR-α–/– mice with low FU (0·2 mg) plus UVBL, and in B6 mice treated with a high dose of FU (2·0 mg) plus UVBL. In contrast, low FU plus UVBL induced such skin lesions in TCR-δ–/– mice at a very low incidence. Specifically, the skin lesions of TCR-α–/– mice with low FU plus UVBL appeared more rapidly and were more severe than lesions in B6 mice. The former had the common characteristic features of human chronic cutaneous LE such as typical histology, positive IgG at the dermoepidermal junction, low antinuclear antibody and low mortality. Furthermore, a Th1 response was induced in the development of drug-induced cutaneous LE. FU and UVBL-induced cutaneous LE-like eruption is an excellent model for better understanding the pathomechanisms of skin lesion development in LE. PMID:15086387

  2. CRISPR/Cas9-based Pten knock-out and Sleeping Beauty Transposon-mediated Nras knock-in induces hepatocellular carcinoma and hepatic lipid accumulation in mice.

    PubMed

    Gao, Mingming; Liu, Dexi

    2017-07-03

    Both Pten and Nras are downstream mediators of receptor tyrosine kinase activation that plays important roles in controlling cell survival and proliferation. Here, we investigated whether and how Pten loss cross-talks with Nras activation in driving liver cancer development in mice. Somatic disruption of hepatic Pten and overexpression of Nras were achieved in out-bred immunocompetent CD-1 mice through a hydrodynamic delivery of plasmids carrying Sleeping Beauty transposon-based integration of Nras and the CRISPR/Cas9-mediated Pten knockout system. Concurrent Pten knockout and Nras knock-in induced hepatocellular carcinoma, while individual gene manipulation failed. Tumor development was associated with liver fibrosis, hyperlipidemia, hepatic deposition of lipid droplets and glycogen, and hepatomegaly. At the molecular level, lipid droplet formation was primarily contributed by upregulated expression of genes responsible for lipogenesis and fatty acid sequestration, such as Srebpf1, Acc, Pparg and its downstream targets. Our findings demonstrated that Pten disruption was synergized by Nras overexpression in driving hepatocyte malignant transformation, which correlated with extensive formation of lipid droplets.

  3. Conditional Knock-Out of Vesicular GABA Transporter Gene from Starburst Amacrine Cells Reveals the Contributions of Multiple Synaptic Mechanisms Underlying Direction Selectivity in the Retina

    PubMed Central

    Pei, Zhe; Chen, Qiang; Koren, David; Giammarinaro, Benno; Acaron Ledesma, Hector

    2015-01-01

    Direction selectivity of direction-selective ganglion cells (DSGCs) in the retina results from patterned excitatory and inhibitory inputs onto DSGCs during motion stimuli. The inhibitory inputs onto DSGCs are directionally tuned to the antipreferred (null) direction and therefore potently suppress spiking during motion in the null direction. However, whether direction-selective inhibition is indispensable for direction selectivity is unclear. Here, we selectively eliminated the directional tuning of inhibitory inputs onto DSGCs by disrupting GABA release from the presynaptic interneuron starburst amacrine cell in the mouse retina. We found that, even without directionally tuned inhibition, direction selectivity can still be implemented in a subset of On-Off DSGCs by direction-selective excitation and a temporal offset between excitation and isotropic inhibition. Our results therefore demonstrate the concerted action of multiple synaptic mechanisms for robust direction selectivity in the retina. SIGNIFICANCE STATEMENT The direction-selective circuit in the retina has been a classic model to study neural computations by the brain. An important but unresolved question is how direction selectivity is implemented by directionally tuned excitatory and inhibitory mechanisms. Here we specifically removed the direction tuning of inhibition from the circuit. We found that direction tuning of inhibition is important but not indispensable for direction selectivity of DSGCs' spiking activity, and that the residual direction selectivity is implemented by direction-selective excitation and temporal offset between excitation and inhibition. Our results highlight the concerted actions of synaptic excitation and inhibition required for robust direction selectivity in the retina and provide critical insights into how patterned excitation and inhibition collectively implement sensory processing. PMID:26400950

  4. Enkephalin levels and the number of neuropeptide Y-containing interneurons in the hippocampus are decreased in female cannabinoid-receptor 1 knock-out mice.

    PubMed

    Rogers, Sophie A; Kempen, Tracey A Van; Pickel, Virginia M; Milner, Teresa A

    2016-05-04

    Drug addiction requires learning and memory processes that are facilitated by activation of cannabinoid-1 (CB1) and opioid receptors in the hippocampus. This involves activity-dependent synaptic plasticity that is partially regulated by endogenous opioid (enkephalin and dynorphin) and non-opioid peptides, specifically cholecystokinin, parvalbumin and neuropeptide Y, the neuropeptides present in inhibitory interneurons that co-express CB1 or selective opioid receptors. We tested the hypothesis that CB1 receptor expression is a determinant of the availability of one or more of these peptide modulators in the hippocampus. This was achieved by quantitatively analyzing the immunoperoxidase labeling for each of these neuropeptide in the dorsal hippocampus of female wild-type (CB1+/+) and cannabinoid receptor 1 knockout (CB1-/-) C57/BL6 mice. The levels of Leu(5)-enkephalin-immunoreactivity were significantly reduced in the hilus of the dentate gyrus and in stratum lucidum of CA3 in CB1-/- mice. Moreover, the numbers of neuropeptide Y-immunoreactive interneurons in the dentate hilus were significantly lower in the CB1-/- compared to wild-type mice. However, CB1+/+ and CB1-/- mice did not significantly differ in expression levels of either dynorphin or cholecystokinin, and showed no differences in numbers of parvalbumin-containing interneurons. These findings suggest that the cannabinoid and opioid systems have a nuanced, regulatory relationship that could affect the balance of excitation and inhibition in the hippocampus and thus processes such as learning that rely on this balance.

  5. Metabolic consequences of knocking out UGT85B1, the gene encoding the glucosyltransferase required for synthesis of dhurrin in Sorghum bicolor (L. Moench).

    PubMed

    Blomstedt, Cecilia K; O'Donnell, Natalie H; Bjarnholt, Nanna; Neale, Alan D; Hamill, John D; Møller, Birger Lindberg; Gleadow, Roslyn M

    2016-02-01

    Many important food crops produce cyanogenic glucosides as natural defense compounds to protect against herbivory or pathogen attack. It has also been suggested that these nitrogen-based secondary metabolites act as storage reserves of nitrogen. In sorghum, three key genes, CYP79A1, CYP71E1 and UGT85B1, encode two Cytochrome P450s and a glycosyltransferase, respectively, the enzymes essential for synthesis of the cyanogenic glucoside dhurrin. Here, we report the use of targeted induced local lesions in genomes (TILLING) to identify a line with a mutation resulting in a premature stop codon in the N-terminal region of UGT85B1. Plants homozygous for this mutation do not produce dhurrin and are designated tcd2 (totally cyanide deficient 2) mutants. They have reduced vigor, being dwarfed, with poor root development and low fertility. Analysis using liquid chromatography-mass spectrometry (LC-MS) shows that tcd2 mutants accumulate numerous dhurrin pathway-derived metabolites, some of which are similar to those observed in transgenic Arabidopsis expressing the CYP79A1 and CYP71E1 genes. Our results demonstrate that UGT85B1 is essential for formation of dhurrin in sorghum with no co-expressed endogenous UDP-glucosyltransferases able to replace it. The tcd2 mutant suffers from self-intoxication because sorghum does not have a feedback mechanism to inhibit the initial steps of dhurrin biosynthesis when the glucosyltransferase activity required to complete the synthesis of dhurrin is lacking. The LC-MS analyses also revealed the presence of metabolites in the tcd2 mutant which have been suggested to be derived from dhurrin via endogenous pathways for nitrogen recovery, thus indicating which enzymes may be involved in such pathways.

  6. Ferulic Acid Orchestrates Anti-Oxidative Properties of Danggui Buxue Tang, an Ancient Herbal Decoction: Elucidation by Chemical Knock-Out Approach

    PubMed Central

    Gong, Amy G. W.; Huang, Vincent Y.; Wang, Huai Y.; Lin, Huang Q.; Dong, Tina T. X.; Tsim, Karl W. K.

    2016-01-01

    Ferulic acid, a phenolic acid derived mainly from a Chinese herb Angelica Sinensis Radix (ASR), was reported to reduce the formation of free radicals. Danggui Buxue Tang (DBT), a herbal decoction composing of Astragali Radix (AR) and ASR, has been utilized for more than 800 years in China having known anti-oxidative property. Ferulic acid is a major active ingredient in DBT; however, the role of ferulic acid within the herbal mixture has not been resolved. In order to elucidate the function of ferulic acid within this herbal decoction, a ferulic acid-depleted herbal decoction was created and named as DBTΔfa. The anti-oxidative properties of chemically modified DBT decoction were systemically compared in cultured H9C2 rat cardiomyoblast cell line. The application of DBT and DBTΔfa into the cultures showed functions in (i) decreasing the reactive oxygen species (ROS) formation, detected by laser confocal; (ii) increasing of the activation of Akt; (iii) increasing the transcriptional activity of anti-oxidant response element (ARE); and (iv) increasing the expressions of anti-oxidant enzymes, i.e. NQO1 and GCLM. In all scenario, the aforementioned anti-oxidative properties of DBTΔfa in H9C2 cells were significantly reduced, as compared to authentic DBT. Thus, ferulic acid could be an indispensable chemical in DBT to orchestrate multi-components of DBT as to achieve maximal anti-oxidative functions. PMID:27824860

  7. The knock-out of ARP3a gene affects F-actin cytoskeleton organization altering cellular tip growth, morphology and development in moss Physcomitrella patens.

    PubMed

    Finka, Andrija; Saidi, Younousse; Goloubinoff, Pierre; Neuhaus, Jean-Marc; Zrÿd, Jean-Pierre; Schaefer, Didier G

    2008-10-01

    The seven subunit Arp2/3 complex is a highly conserved nucleation factor of actin microfilaments. We have isolated the genomic sequence encoding a putative Arp3a protein of the moss Physcomitrella patens. The disruption of this ARP3A gene by allele replacement has generated loss-of-function mutants displaying a complex developmental phenotype. The loss-of function of ARP3A gene results in shortened, almost cubic chloronemal cells displaying affected tip growth and lacking differentiation to caulonemal cells. In moss arp3a mutants, buds differentiate directly from chloronemata to form stunted leafy shoots having differentiated leaves similar to wild type. Yet, rhizoids never differentiate from stem epidermal cells. To characterize the F-actin organization in the arp3a-mutated cells, we disrupted ARP3A gene in the previously described HGT1 strain expressing conditionally the GFP-talin marker. In vivo observation of the F-actin cytoskeleton during P. patens development demonstrated that loss-of-function of Arp3a is associated with the disappearance of specific F-actin cortical structures associated with the establishment of localized cellular growth domains. Finally, we show that constitutive expression of the P. patens Arp3a and its Arabidopsis thaliana orthologs efficiently complement the mutated phenotype indicating a high degree of evolutionary conservation of the Arp3 function in land plants.

  8. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice

    PubMed Central

    Busby, Ellen R.; Sherwood, Nancy M.

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15–28 may account for the altered metabolism in the prepubertal female pups. PMID:28346489

  9. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice.

    PubMed

    Busby, Ellen R; Sherwood, Nancy M

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15-28 may account for the altered metabolism in the prepubertal female pups.

  10. Conditional knock-out reveals a requirement for O-linked N-Acetylglucosaminase (O-GlcNAcase) in metabolic homeostasis.

    PubMed

    Keembiyehetty, Chithra; Love, Dona C; Harwood, Katryn R; Gavrilova, Oksana; Comly, Marcella E; Hanover, John A

    2015-03-13

    O-GlcNAc cycling is maintained by the reciprocal activities of the O-GlcNAc transferase and the O-GlcNAcase (OGA) enzymes. O-GlcNAc transferase is responsible for O-GlcNAc addition to serine and threonine (Ser/Thr) residues and OGA for its removal. Although the Oga gene (MGEA5) is a documented human diabetes susceptibility locus, its role in maintaining insulin-glucose homeostasis is unclear. Here, we report a conditional disruption of the Oga gene in the mouse. The resulting homozygous Oga null (KO) animals lack OGA enzymatic activity and exhibit elevated levels of the O-GlcNAc modification. The Oga KO animals showed nearly complete perinatal lethality associated with low circulating glucose and low liver glycogen stores. Defective insulin-responsive GSK3β phosphorylation was observed in both heterozygous (HET) and KO Oga animals. Although Oga HET animals were viable, they exhibited alterations in both transcription and metabolism. Transcriptome analysis using mouse embryonic fibroblasts revealed deregulation in the transcripts of both HET and KO animals specifically in genes associated with metabolism and growth. Additionally, metabolic profiling showed increased fat accumulation in HET and KO animals compared with WT, which was increased by a high fat diet. Reduced insulin sensitivity, glucose tolerance, and hyperleptinemia were also observed in HET and KO female mice. Notably, the respiratory exchange ratio of the HET animals was higher than that observed in WT animals, indicating the preferential utilization of glucose as an energy source. These results suggest that the loss of mouse OGA leads to defects in metabolic homeostasis culminating in obesity and insulin resistance.

  11. Comparative hepatic effects of perfluorooctanoic acid and WY 14,643 in PPARa-knocked out and wild-type mice.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is an environmentally persistent chemical commonly found in humans and wildlife. Induction of liver tumors by PFOA in rodents is thought to be mediated by PPARα activation, although hepatic hypertrophy persists in PPARα-null mice. This study evalua...

  12. Developmental Toxicity of Perfluorononanoic Acid in the Wild-Type and PPAR-alpha Knock-out Mouse After Gestational Exposure

    EPA Science Inventory

    Perfluorononanoic acid (PFNA) is a perfluoroalkyl acid detected in the environment and in tissues of humans and wildlife, and its concentration in human serum has increased in the past few years. PFNA negatively affects development and survival of CD1 mice and activates peroxisom...

  13. Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice

    PubMed Central

    Matheu, Victor; Treschow, Alexandra; Teige, Ingrid; Navikas, Vaidrius; Issazadeh-Navikas, Shohreh

    2005-01-01

    Background CpG oligodeoxynucleotides (CpG-ODN) are capable of inducing high amounts of type I IFNs with many immunomodulatory properties. Furthermore, type-I IFNs have been proposed to play a key role in mediating effects of CpG-ODN. The precise role of IFN-β in the immunomodulatory effects of CpG-ODN is not known. Objective Here, we aimed to elucidate the role of IFN-β in the anti-allergic effect of CpG motifs. Methods We assessed the immune response in OVA-primed/OVA-challenged IFN-β knockout (-/-) mice compared to wild type (WT) control, after intranasal and systemic treatment with synthetic CpG motifs. Results Vaccination with CpG-ODN reduced the number of cells in airways of OVA-sensitized WT but not IFN-β-/- mice. Although airway eosinophilia was reduced in both treated groups, they were significantly higher in IFN-β-/- mice. Other inflammatory cells, such as lymphocytes and macrophages were enhanced in airways by CpG treatment in IFN-β-/- mice. The ratio of IFN-γ/IL-4 cytokines in airways was significantly skewed to a Th1 response in WT compared to IFN-β-/- group. In contrast, IL-4 and IgE were reduced with no differences between groups. Ag-specific T-cell proliferation, Th1-cytokines such as IFN-γ, IL-2 and also IL-12 were significantly lower in IFN-β-/- mice. Surprisingly, we discovered that intranasal treatment of mice with CpG-ODN results in mild synovitis particularly in IFN-β-/- mice. Conclusion Our results indicate that induction of Th1 response by therapy with CpG-ODN is only slightly and partially dependent on IFN-β, while IFN-β is not an absolute requirement for suppression of airway eosinophilia and IgE. Furthermore, our finding of mild synovitis is a warning for possible negative effects of CpG-ODN vaccination. PMID:15748290

  14. Deficits in axonal transport in hippocampal-based circuitry and the visual pathway in APP knock-out animals witnessed by manganese enhanced MRI

    PubMed Central

    Gallagher, Joseph J.; Zhang, Xiaowei; Ziomek, Greg; Jacobs, Russell E.; Bearer, Elaine L.

    2012-01-01

    Mounting evidence implicates axonal transport defects, typified by the presence of axonal varicosities with aberrant accumulations of cargo, as an early event in Alzheimer’s disease (AD) pathogenesis. Work identifying amyloid precursor protein (APP) as a vesicular motor receptor for anterograde axonal transport further implicates axonal transport in AD. Manganese-enhanced MRI (MEMRI) detects axonal transport dynamics in preclinical studies. Here we pursue an understanding of the role of APP in axonal transport in the central nervous system by applying MEMRI to hippocampal circuitry and to the visual pathway in living mice homozygous for either wild type or a deletion in the APP gene (n = 12 for each genotype). Following intra-ocular or stereotaxic hippocampal injection, we performed time-lapse MRI to detect Mn2+ transport. Three dimensional whole brain datasets were compared on a voxel-wise basis using within-group pair-wise analysis. Quantification of transport to structures connected to injection sites via axonal fiber tracts was also performed. Histology confirmed consistent placement of hippocampal injections and no observable difference in glial-response to the injections. APP −/− mice had significantly reduced transport from the hippocampus to the septal nuclei and amygdala after 7 hours and reduced transport to the contralateral hippocampus after 25 hours; axonal transport deficits in the APP −/− animals were also identified in the visual pathway. These data support a system-wide role for APP in axonal transport within the central nervous system and demonstrate the power of MEMRI for assessing neuronal circuitry involved in memory and learning. PMID:22500926

  15. Developmental Toxicity of Perfluorononanoic Acid in the Wild-Type and PPAR-alpha Knock-out Mouse After Gestational Exposure

    EPA Science Inventory

    Perfluorononanoic acid (PFNA) is a perfluoroalkyl acid detected in the environment and in tissues of humans and wildlife, and its concentration in human serum has increased in the past few years. PFNA negatively affects development and survival of CD1 mice and activates peroxisom...

  16. An efficient method to enrich for knock-out and knock-in cellular clones using the CRISPR/Cas9 system.

    PubMed

    Niccheri, Francesca; Pecori, Riccardo; Conticello, Silvestro G

    2017-09-01

    Clustered Regularly Interspaced Short Palindromic Repeats-associated protein 9 nuclease (CRISPR/Cas9) and Transcription Activator-Like Effector Nucleases (TALENs) are versatile tools for genome editing. Here we report a method to increase the frequency of Cas9-targeted cellular clones. Our method is based on a chimeric construct with a Blasticidin S Resistance gene (bsr) placed out-of-frame by a surrogate target sequence. End joining of the CRISPR/Cas9-induced double-strand break on the surrogate target can place the bsr in frame, thus providing temporary resistance to Blasticidin S: this is used to enrich for cells where Cas9 is active. By this approach, in a real experimental setting, we disrupted the Aicda gene in ~70% of clones from CH12F3 lymphoma cells (>40% biallelically). With the same approach we knocked in a single nucleotide to reconstruct the frame of Aicda in these null cells, restoring the function in ~37% of the clones (less than 10% by the standard approach). Targeting of single nucleotide changes in other genes yielded analogous results. These results support our enrichment method as an efficient tool in genome editing.

  17. Deficits in axonal transport in hippocampal-based circuitry and the visual pathway in APP knock-out animals witnessed by manganese enhanced MRI.

    PubMed

    Gallagher, Joseph J; Zhang, Xiaowei; Ziomek, Gregory J; Jacobs, Russell E; Bearer, Elaine L

    2012-04-15

    Mounting evidence implicates axonal transport defects, typified by the presence of axonal varicosities with aberrant accumulations of cargo, as an early event in Alzheimer's disease (AD) pathogenesis. Work identifying amyloid precursor protein (APP) as a vesicular motor receptor for anterograde axonal transport further implicates axonal transport in AD. Manganese-enhanced MRI (MEMRI) detects axonal transport dynamics in preclinical studies. Here we pursue an understanding of the role of APP in axonal transport in the central nervous system by applying MEMRI to hippocampal circuitry and to the visual pathway in living mice homozygous for either wild type or a deletion in the APP gene (n=12 for each genotype). Following intra-ocular or stereotaxic hippocampal injection, we performed time-lapse MRI to detect Mn(2+) transport. Three dimensional whole brain datasets were compared on a voxel-wise basis using within-group pair-wise analysis. Quantification of transport to structures connected to injection sites via axonal fiber tracts was also performed. Histology confirmed consistent placement of hippocampal injections and no observable difference in glial-response to the injections. APP-/- mice had significantly reduced transport from the hippocampus to the septal nuclei and amygdala after 7h and reduced transport to the contralateral hippocampus after 25 h; axonal transport deficits in the APP-/- animals were also identified in the visual pathway. These data support a system-wide role for APP in axonal transport within the central nervous system and demonstrate the power of MEMRI for assessing neuronal circuitry involved in memory and learning.

  18. Involvement of mitogen-activated protein kinases (MAPKs) during testicular ischemia-reperfusion injury in nuclear factor-kappaB knock-out mice.

    PubMed

    Minutoli, Letteria; Antonuccio, Pietro; Polito, Francesca; Bitto, Alessandra; Fiumara, Tiziana; Squadrito, Francesco; Nicotina, Piero Antonio; Arena, Salvatore; Marini, Herbert; Romeo, Carmelo; Altavilla, Domenica

    2007-07-12

    Nuclear factor kappa-B (NF-kappaB), extracellular regulated kinase (ERK 1/2) and c-jun-N terminal kinase (JNK) play an important role in testicular ischemia. We investigated the patterns of ERK1/2, JNK and p38 activation in NF-kappaB knockout (KO) mice subjected to testicular torsion. KO and normal littermate wild-type (WT) animals underwent at 1 h testicular ischemia followed by 24 h reperfusion (TI/R). Sham testicular ischemia-reperfusion mice served as controls. ERK 1/2, JNK and p38 expression by western blot analysis, tumor necrosis factor-alpha (TNF-alpha) expression (RT-PCR and western blot analysis) and a complete histological examination were carried out. TI/R caused a greater increase in phosphorylated form of ERK 1/2 in KO mice than in WT animals in either the ischemic testis and the contralateral one. By contrary, active form of JNK and p38 were completely abrogated in both testes of KO mice, while WT animals showed a significant activation of those kinases in both testes. TNF-alpha expression was markedly reduced in KO mice when compared to WT mice either at the mRNA and the protein level. Finally TI/R-induced histological damage was markedly reduced in KO mice. Our data indicate that NF-kappaB plays a pivotal role in the development of testicular ischemia-reperfusion injury and suggest that, in the absence of the transcriptional factor, the up-stream signal JNK and p38 may be abrogated while ERK 1/2 activity is enhanced.

  19. Characterization of fast-twitch and slow-twitch skeletal muscles of calsequestrin 2 (CASQ2)-knock out mice: unexpected adaptive changes of fast-twitch muscles only.

    PubMed

    Valle, Giorgia; Vergani, Barbara; Sacchetto, Roberta; Reggiani, Carlo; De Rosa, Edith; Maccatrozzo, Lisa; Nori, Alessandra; Villa, Antonello; Volpe, Pompeo

    2016-12-01

    This study investigates the functional role of calsequestrin 2 (CASQ2) in both fast-twitch and slow-twitch skeletal muscles by using CASQ2-/- mice; CASQ2 is expressed throughout life in slow-twitch muscles, but only in the developmental and neonatal stages in fast-twitch muscles. CASQ2-/- causes increase in calsequestrin 1 (CASQ1) expression, but without functional changes in both muscle types. CASQ2-/- mice have ultrastructural changes in fast-twitch muscles only, i.e., formation of pentads and stacks in the sarcoplasmic reticulum.

  20. Low 17beta-estradiol levels in CNR1 knock-out mice affect spermatid chromatin remodeling by interfering with chromatin reorganization.

    PubMed

    Cacciola, Giovanna; Chioccarelli, Teresa; Altucci, Lucia; Ledent, Catherine; Mason, J Ian; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda

    2013-06-01

    The type 1-cannabinoid receptor, CNR1, regulates differentiation of spermatids. Indeed, we have recently reported that the genetic inactivation of Cnr1 in mice influenced chromatin remodeling of spermatids, by reducing histone displacement and then sperm chromatin quality indices (chromatin condensation and DNA integrity). Herein, we have studied, at both central and testicular levels, the molecular signals potentially involved in histone displacement. In particular, investigation of the neuroendocrine axis involved in estrogen production demonstrated down-regulation of the axis supporting FSH/estrogen secretion in Cnr1-knockout male mice. Conversely, Cnr1-knockout male mice treated with 17beta-estradiol showed a weak increase of pituitary Fsh-beta subunit mRNA levels and a rescue of sperm chromatin quality indices demonstrating that estrogens, possibly in combination with FSH secretion, play an important role in regulating chromatin remodeling of spermatids.

  1. Knocking Out Cytosolic Cysteine Synthesis Compromises the Antioxidant Capacity of the Cytosol to Maintain Discrete Concentrations of Hydrogen Peroxide in Arabidopsis1[W

    PubMed Central

    López-Martín, M. Carmen; Becana, Manuel; Romero, Luis C.; Gotor, Cecilia

    2008-01-01

    Plant cells contain different O-acetylserine(thiol)lyase (OASTL) enzymes involved in cysteine (Cys) biosynthesis and located in different subcellular compartments. These enzymes are made up of a complex variety of isoforms resulting in different subcellular Cys pools. To unravel the contribution of cytosolic Cys to plant metabolism, we characterized the knockout oas-a1.1 and osa-a1.2 mutants, deficient in the most abundant cytosolic OASTL isoform in Arabidopsis (Arabidopsis thaliana). Total intracellular Cys and glutathione concentrations were reduced, and the glutathione redox state was shifted in favor of its oxidized form. Interestingly, the capability of the mutants to chelate heavy metals did not differ from that of the wild type, but the mutants have an enhanced sensitivity to cadmium. With the aim of establishing the metabolic network most influenced by the cytosolic Cys pool, we used the ATH1 GeneChip for evaluation of differentially expressed genes in the oas-a1.1 mutant grown under nonstress conditions. The transcriptomic footprints of mutant plants had predicted functions associated with various physiological responses that are dependent on reactive oxygen species and suggested that the mutant was oxidatively stressed. Evidences that the mutation caused a perturbation in H2O2 homeostasis are that, in the knockout, H2O2 production was localized in shoots and roots; spontaneous cell death lesions occurred in the leaves; and lignification and guaiacol peroxidase activity were significantly increased. All these findings indicate that a deficiency of OAS-A1 in the cytosol promotes a perturbation in H2O2 homeostasis and that Cys is an important determinant of the antioxidative capacity of the cytosol in Arabidopsis. PMID:18441224

  2. Conditional Knock-out Reveals a Requirement for O-Linked N-Acetylglucosaminase (O-GlcNAcase) in Metabolic Homeostasis*

    PubMed Central

    Keembiyehetty, Chithra; Love, Dona C.; Harwood, Katryn R.; Gavrilova, Oksana; Comly, Marcella E.; Hanover, John A.

    2015-01-01

    O-GlcNAc cycling is maintained by the reciprocal activities of the O-GlcNAc transferase and the O-GlcNAcase (OGA) enzymes. O-GlcNAc transferase is responsible for O-GlcNAc addition to serine and threonine (Ser/Thr) residues and OGA for its removal. Although the Oga gene (MGEA5) is a documented human diabetes susceptibility locus, its role in maintaining insulin-glucose homeostasis is unclear. Here, we report a conditional disruption of the Oga gene in the mouse. The resulting homozygous Oga null (KO) animals lack OGA enzymatic activity and exhibit elevated levels of the O-GlcNAc modification. The Oga KO animals showed nearly complete perinatal lethality associated with low circulating glucose and low liver glycogen stores. Defective insulin-responsive GSK3β phosphorylation was observed in both heterozygous (HET) and KO Oga animals. Although Oga HET animals were viable, they exhibited alterations in both transcription and metabolism. Transcriptome analysis using mouse embryonic fibroblasts revealed deregulation in the transcripts of both HET and KO animals specifically in genes associated with metabolism and growth. Additionally, metabolic profiling showed increased fat accumulation in HET and KO animals compared with WT, which was increased by a high fat diet. Reduced insulin sensitivity, glucose tolerance, and hyperleptinemia were also observed in HET and KO female mice. Notably, the respiratory exchange ratio of the HET animals was higher than that observed in WT animals, indicating the preferential utilization of glucose as an energy source. These results suggest that the loss of mouse OGA leads to defects in metabolic homeostasis culminating in obesity and insulin resistance. PMID:25596529

  3. Relationships among Parvalbumin-Immunoreactive Neuron Density, Phase-Locked Gamma Oscillations, and Autistic/Schizophrenic Symptoms in PDGFR-β Knock-Out and Control Mice

    PubMed Central

    Nakamura, Tomoya; Matsumoto, Jumpei; Takamura, Yusaku; Ishii, Yoko; Sasahara, Masakiyo; Ono, Taketoshi; Nishijo, Hisao

    2015-01-01

    Cognitive deficits and negative symptoms are important therapeutic targets for schizophrenia and autism disorders. Although reduction of phase-locked gamma oscillation has been suggested to be a result of reduced parvalbumin-immunoreactive (putatively, GABAergic) neurons, no direct correlations between these have been established in these disorders. In the present study, we investigated such relationships during pharmacological treatment with a newly synthesized drug, T-817MA, which displays neuroprotective and neurotrophic effects. In this study, we used platelet-derived growth factor receptor-β gene knockout (PDGFR-β KO) mice as an animal model of schizophrenia and autism. These mutant mice display a reduction in social behaviors; deficits in prepulse inhibition (PPI); reduced levels of parvalbumin-immunoreactive neurons in the medical prefrontal cortex, hippocampus, amygdala, and superior colliculus; and a deficit in of auditory phase-locked gamma oscillations. We found that oral administration of T-817MA ameliorated all these symptoms in the PDGFR-β KO mice. Furthermore, phase-locked gamma oscillations were significantly correlated with the density of parvalbumin-immunoreactive neurons, which was, in turn, correlated with PPI and behavioral parameters. These findings suggest that recovery of parvalbumin-immunoreactive neurons by pharmacological intervention relieved the reduction of phase-locked gamma oscillations and, consequently, ameliorated PPI and social behavioral deficits. Thus, our findings suggest that phase-locked gamma oscillations could be a useful physiological biomarker for abnormality of parvalbumin-immunoreactive neurons that may induce cognitive deficits and negative symptoms of schizophrenia and autism, as well as of effective pharmacological interventions in both humans and experimental animals. PMID:25803852

  4. Establishment of Immortalized Mouse Bmp2 Knock-Out Dental Papilla Mesenchymal Cells Necessary for Study of Odontoblastic Differentiation and Odontogenesis.

    PubMed

    Wu, Lian; Wang, Feng; Donly, Kevin J; Wan, Chunyan; Luo, Daoshu; Harris, Stephen E; MacDougall, Mary; Chen, Shuo

    2015-11-01

    Bmp2 is essential for dentin formation. Bmp2 cKO mice exhibited similar phenotype to dentinogenesis imperfecta, showing dental pulp exposure, hypomineralized dentin, and delayed odontoblast differentiation. As it is relatively difficult to obtain lot of primary Bmp2 cKO dental papilla mesenchymal cells and to maintain a long-term culture of these primary cells, availability of immortalized deleted Bmp2 dental papilla mesenchymal cells is critical for studying the underlying mechanism of Bmp2 signal in odontogenesis. In this study, our goal was to generate an immortalized deleted Bmp2 dental papilla mesenchymal (iBmp2(ko/ko)dp) cell line by introducing Cre recombinase and green fluorescent protein (GFP) into the immortalized mouse floxed Bmp2 dental papilla mesenchymal (iBmp2(fx/fx)dp) cells. iBmp2(ko/ko)dp cells were confirmed by GFP and PCR. The deleted Bmp2 cells exhibited slow cell proliferation rate and cell growth was arrested in G2 phase. Expression of tooth-related marker genes and cell differentiation were decreased in the deleted cells. Importantly, extracellular matrix remodeling was impaired in the iBmp2(ko/ko)dp cells as reflected by the decreased Mmp-9 expression. In addition, with exogenous Bmp2 induction, these cell differentiation and mineralization were rescued as well as extracellular matrix remodeling was enhanced. Therefore, we for the first time described establishment of iBmp(ko/ko) cells that are useful for study of mechanisms in regulating dental papilla mesenchymal cell lineages. © 2015 Wiley Periodicals, Inc.

  5. Establishment of Immortalized Mouse Bmp2 Knock-Out Dental Papilla Mesenchymal Cells Necessary for Study of Odontoblastic Differentiation and Odontogenesis

    PubMed Central

    Wu, Lian; Wang, Feng; Donly, Kevin J.; Wan, Chunyan; Luo, Daoshu; Harris, Stephen E.; Macdougall, Mary; Chen, Shuo

    2016-01-01

    Bmp2 is essential for dentin formation. Bmp2 cKO mice exhibited similar phenotype to dentinogenesis imperfecta, showing dental pulp exposure, hypomineralized dentin, and delayed odontoblast differentiation. As it is relatively difficult to obtain lot of primary Bmp2 cKO dental papilla mesenchymal cells and to maintain a long-term culture of these primary cells, availability of immortalized deleted Bmp2 dental papilla mesenchymal cells is critical for studying the underlying mechanism of Bmp2 signal in odontogenesis. In this study, our goal was to generate an immortalized deleted Bmp2 dental papilla mesenchymal (iBmp2ko/ko dp) cell line by introducing Cre fluorescent protein (GFP) into the immortalized mouse floxed Bmp2 dental papilla mesenchymal (iBmp2fx/fx dp) cells. iBmp2ko/ko dp cells were confirmed by GFP and PCR. The deleted Bmp2 cells exhibited slow cell proliferation rate and cell growth was arrested in G2 phase. Expression of tooth-related marker genes and cell differentiation were decreased in the deleted cells. Importantly, extracellular matrix remodeling was impaired in the iBmp2ko/ko dp cells as reflected by the decreased Mmp-9 expression. In addition, with exogenous Bmp2 induction, these cell differentiation and mineralization were rescued as well as extracellular matrix remodeling was enhanced. Therefore, we for the first time described establishment of iBmpko/ko cells that are useful for study of mechanisms in regulating dental papilla mesenchymal cell lineages. PMID:26037045

  6. Unexpected Lack of Hypersensitivity in LRRK2 Knock-out Mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)

    PubMed Central

    Andres-Mateos, Eva; Mejias, Rebeca; Sasaki, Masayuki; Li, Xiaojie; Lin, Brian M; Biskup, Saskia; Zhang, Li; Banerjee, Rebecca; Thomas, Bobby; Yang, Lichuan; Liu, Guosheng; Beal, M Flint; Huso, David L; Dawson, Ted M; Dawson, Valina L

    2010-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common known cause of Parkinson's disease (PD). Whether loss of LRRK2 function accounts for neurodegeneration of dopamine neurons in PD is not known, nor is it known whether LRRK2 kinase activity modulates the susceptibility of dopamine (DA) neurons to the selective dopaminergic toxin, 1-methyl-4-phenyl-1,2,3,6 tetrahydropyridine (MPTP). To better understand the role of LRRK2 in DA neuronal survival and its role in the susceptibility of DA neurons to MPTP, we generated LRRK2 knockout (KO) mice lacking the kinase domain of LRRK2. Here we show that LRRK2 KO mice are viable and have no major abnormalities and live to adulthood. The dopaminergic system is normal in LRRK2 KO mice as assessed via HPLC for DA and its metabolites and via stereologic assessment of DA neuron number in young and aged mice. Importantly, there is no significant difference in the susceptibility of LRRK2 KO and wild type (WT) mice to MPTP. These results suggest that LRRK2 plays little if any role in the development and survival of DA neurons under physiologic conditions. Thus, PD due to LRRK2 mutations are likely not due to a loss of function. Moreover, LRRK2 is not required for the susceptibility of DA neurons to MPTP. PMID:20016100

  7. The alpha-fetoprotein knock-out mouse model suggests that parental behavior is sexually differentiated under the influence of prenatal estradiol.

    PubMed

    Keller, Matthieu; Pawluski, Jodi L; Brock, Olivier; Douhard, Quentin; Bakker, Julie

    2010-04-01

    In rodent species, sexual differentiation of the brain for many reproductive processes depends largely on estradiol. This was recently confirmed again by using the alpha-fetoprotein knockout (AFP-KO) mouse model, which lacks the protective actions of alpha-fetoprotein against maternal estradiol and as a result represents a good model to determine the contribution of prenatal estradiol to the sexual differentiation of the brain and behavior. Female AFP-KO mice were defeminized and masculinized with regard to their neuroendocrine responses as well as sexual behavior. Since parental behavior is also strongly sexually differentiated in mice, we used the AFP-KO mouse model here to ask whether parental responses are differentiated prenatally under the influence of estradiol. It was found that AFP-KO females showed longer latencies to retrieve pups to the nest and also exhibited lower levels of crouching over the pups in the nest in comparison to WT females. In fact, they resembled males (WT and AFP-KO). Other measures of maternal behavior, for example the incidence of infanticide, tended to be higher in AFP-KO females than in WT females but this increase failed to reach statistical significance. The deficits observed in parental behavior of AFP-KO females could not be explained by any changes in olfactory function, novelty recognition or anxiety. Thus our results suggest that prenatal estradiol defeminizes the parental brain in mice.

  8. Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis

    PubMed Central

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K.; Joshi, Amritanshu B.; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D.; KuKuruga, Mark A.; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L.

    2016-01-01

    Background Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Methodology Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells between aged and young mice; the adaptive response specifically in terms of T cell and B cell activation in aged animals was reduced compared to young mice which correlated with less protection in old mice compared to young mice. Conclusions Taken together, LdCen-/- immunization induced a significant but diminished host protective response in aged mice after challenge with virulent L. donovani parasites compared to young mice. PMID:27580076

  9. Studies on exotic nuclei by proton-induced direct reaction at GSI and FAIR

    SciTech Connect

    Kiselev, O. A.

    2007-02-26

    The proton-induced direct reactions like elastic, quasi-elastic scattering and knock-out at intermediate energies and inverse kinematics are the most powerful classical methods for obtaining spectroscopic information on the structure of unstable exotic nuclei. Few elastic scattering experiments performed at GSI with the gaseous and liquid hydrogen targets provided the most precise data on a nuclear matter distribution and a halo-core structure of the neutron-rich He and Li isotopes. The measured differential cross sections have been also used for probing density distributions as predicted by various microscopic theories. The comparison of the data with the latest calculations will be shown. The description of the recent experiment with proton-rich 8B and neutron-rich Be isotopes is presented.The experimental conditions at the future facility FAIR will provide unique opportunities for nuclear structure studies on nuclei far off stability, and will allow to reach new regions in the chart of nuclides of high interest for nuclear structure and astrophysics. In particular, predicted luminosity will allow for the investigation of direct reactions with stored and cooled radioactive beams at internal H, He, etc. targets of the storage ring NESR. This technique enables high resolution measurements down to very low momentum transfer and provides a gain in luminosity from accumulation and recirculation of the radioactive beams. In order to explore the experimental conditions for measurements planned at EXL/FAIR setup, a first attempt exploring experimentally the feasibility of its concept has been recently made. A detector setup was installed at the ESR storage ring at GSI, Darmstadt. A 136Xe beam was interacting to an internal hydrogen gas-jet target. The detector setup had all the basic ingredients as foreseen by EXL collaboration. A set of scattering reactions has been studied and the overall performance of the setup demonstrated the feasibility of the EXL experimental

  10. [Plasma antioxidant activity--a test for impaired biological functions of endoecology, exotrophy, and inflammation reactions].

    PubMed

    Titov, V N; Krylin, V V; Dmitriev, V A; Iashin, Ia I

    2010-07-01

    The authors discuss the diagnostic value of a test for total serum antioxidant activity determined by an electrochemistry method on a liquid chromatograph (without a column), by using an amperometric detector, as well as the composition of the endogenously synthesized hydrophilic and hydrophobic acceptors of reactive oxygen species (ROS). Uric acid is a major hydrophilic acceptor of ROS; monoenic oleic fatty acid acts as its major lipophilic acceptor. The constant determined by the authors for of 03 oleic acid oxidation during automatic titration in the organic medium is an order of magnitude higher than that for alpha-tocopherol, beta-carotene and linoleic fatty acid; its concentration is also an order of magnitude higher. In oxidative stress, the adrenal steroid hormone dehydroepiandrosterone initiates oleic acid synthesis via expression of palmitoyl elongase and steatoryl desaturase. In early steps of phylogenesis in primates, spontaneous mutation resulted in ascorbic acid synthesis gene knockout; phylogenetically, further other mutation knocked out the gene encoding the synthesis of uricase and the conversion of uric acid to alantoin. In primates, uric acid became not only a catabolite of purine bases in vivo, but also the major endogenous hydrophilic acceptor of ROS. This philogenetic order makes it clear why the epithelium in the proximal nephron tubule entirely reabsorbs uric acid (a catabolite?) from primary urine and then secretes it again to urine depending on the impairment of biological functions of endoecology (the intercellular medium being contaminated with biological rubbish), the activation of a biological inflammatory reaction, the cellular production of ROS, and the reduction in serum total antioxidant activity. With each biological reaction, there was an increase in the blood content of uric acid as a hydrophilic acceptor of ROS, by actively lowering its secretion into urine. Uric acid is a diagnostic test of inflammation, or rather compensatory

  11. In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways*♦

    PubMed Central

    Dey, Swati; North, Justin A.; Sriram, Jaya; Evans, Bradley S.; Tabita, F. Robert

    2015-01-01

    All organisms possess fundamental metabolic pathways to ensure that needed carbon and sulfur compounds are provided to the cell in the proper chemical form and oxidation state. For most organisms capable of using CO2 as sole source of carbon, ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) catalyzes primary carbon dioxide assimilation. In addition, sulfur salvage pathways are necessary to ensure that key sulfur-containing compounds are both available and, where necessary, detoxified in the cell. Using knock-out mutations and metabolomics in the bacterium Rhodospirillum rubrum, we show here that Rubisco concurrently catalyzes key and essential reactions for seemingly unrelated but physiologically essential central carbon and sulfur salvage metabolic pathways of the cell. In this study, complementation and mutagenesis studies indicated that representatives of all known extant functional Rubisco forms found in nature are capable of simultaneously catalyzing reactions required for both CO2-dependent growth as well as growth using 5-methylthioadenosine as sole sulfur source under anaerobic photosynthetic conditions. Moreover, specific inactivation of the CO2 fixation reaction did not affect the ability of Rubisco to support anaerobic 5-methylthioadenosine metabolism, suggesting that the active site of Rubisco has evolved to ensure that this enzyme maintains both key functions. Thus, despite the coevolution of both functions, the active site of this protein may be differentially modified to affect only one of its key functions. PMID:26511314

  12. In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways.

    PubMed

    Dey, Swati; North, Justin A; Sriram, Jaya; Evans, Bradley S; Tabita, F Robert

    2015-12-25

    All organisms possess fundamental metabolic pathways to ensure that needed carbon and sulfur compounds are provided to the cell in the proper chemical form and oxidation state. For most organisms capable of using CO2 as sole source of carbon, ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) catalyzes primary carbon dioxide assimilation. In addition, sulfur salvage pathways are necessary to ensure that key sulfur-containing compounds are both available and, where necessary, detoxified in the cell. Using knock-out mutations and metabolomics in the bacterium Rhodospirillum rubrum, we show here that Rubisco concurrently catalyzes key and essential reactions for seemingly unrelated but physiologically essential central carbon and sulfur salvage metabolic pathways of the cell. In this study, complementation and mutagenesis studies indicated that representatives of all known extant functional Rubisco forms found in nature are capable of simultaneously catalyzing reactions required for both CO2-dependent growth as well as growth using 5-methylthioadenosine as sole sulfur source under anaerobic photosynthetic conditions. Moreover, specific inactivation of the CO2 fixation reaction did not affect the ability of Rubisco to support anaerobic 5-methylthioadenosine metabolism, suggesting that the active site of Rubisco has evolved to ensure that this enzyme maintains both key functions. Thus, despite the coevolution of both functions, the active site of this protein may be differentially modified to affect only one of its key functions.

  13. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the He4(e ,e'pN) Triple-Coincidence Reaction

    NASA Astrophysics Data System (ADS)

    Korover, I.; Muangma, N.; Hen, O.; Shneor, R.; Sulkosky, V.; Kelleher, A.; Gilad, S.; Higinbotham, D. W.; Piasetzky, E.; Watson, J. W.; Wood, S. A.; Aguilera, P.; Ahmed, Z.; Albataineh, H.; Allada, K.; Anderson, B.; Anez, D.; Aniol, K.; Annand, J.; Armstrong, W.; Arrington, J.; Averett, T.; Badman, T.; Baghdasaryan, H.; Bai, X.; Beck, A.; Beck, S.; Bellini, V.; Benmokhtar, F.; Bertozzi, W.; Bittner, J.; Boeglin, W.; Camsonne, A.; Chen, C.; Chen, J.-P.; Chirapatpimol, K.; Cisbani, E.; Dalton, M. M.; Daniel, A.; Day, D.; de Jager, C. W.; De Leo, R.; Deconinck, W.; Defurne, M.; Flay, D.; Fomin, N.; Friend, M.; Frullani, S.; Fuchey, E.; Garibaldi, F.; Gaskell, D.; Gilman, R.; Glamazdin, O.; Gu, C.; Gueye, P.; Hamilton, D.; Hanretty, C.; Hansen, J.-O.; Hashemi Shabestari, M.; Holmstrom, T.; Huang, M.; Iqbal, S.; Jin, G.; Kalantarians, N.; Kang, H.; Khandaker, M.; LeRose, J.; Leckey, J.; Lindgren, R.; Long, E.; Mammei, J.; Margaziotis, D. J.; Markowitz, P.; Marti Jimenez-Arguello, A.; Meekins, D.; Meziani, Z.; Michaels, R.; Mihovilovic, M.; Monaghan, P.; Munoz Camacho, C.; Norum, B.; Nuruzzaman, Pan, K.; Phillips, S.; Pomerantz, I.; Posik, M.; Punjabi, V.; Qian, X.; Qiang, Y.; Qiu, X.; Rakhman, A.; Reimer, P. E.; Riordan, S.; Ron, G.; Rondon-Aramayo, O.; Saha, A.; Schulte, E.; Selvy, L.; Shahinyan, A.; Sirca, S.; Sjoegren, J.; Slifer, K.; Solvignon, P.; Sparveris, N.; Subedi, R.; Tireman, W.; Wang, D.; Weinstein, L. B.; Wojtsekhowski, B.; Yan, W.; Yaron, I.; Ye, Z.; Zhan, X.; Zhang, J.; Zhang, Y.; Zhao, B.; Zhao, Z.; Zheng, X.; Zhu, P.; Zielinski, R.; Jefferson Lab Hall A Collaboration

    2014-07-01

    We studied simultaneously the He4(e ,e'p), He4(e ,e'pp), and He4(e ,e'pn) reactions at Q2=2(GeV/c)2 and xB>1, for an (e ,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A =2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum, in a region where the nucleon-nucleon (NN) force is expected to change from predominantly tensor to repulsive. The abundance of neutron-proton pairs is reduced as the nucleon momentum increases beyond ˜500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum. Our data are compared with calculations of two-nucleon momentum distributions in He4 and discussed in the context of probing the elusive repulsive component of the NN force.

  14. Probing the repulsive core of the nucleon-nucleon interaction via the (4)He(e,e'pN) triple-coincidence reaction.

    PubMed

    Korover, I; Muangma, N; Hen, O; Shneor, R; Sulkosky, V; Kelleher, A; Gilad, S; Higinbotham, D W; Piasetzky, E; Watson, J W; Wood, S A; Aguilera, P; Ahmed, Z; Albataineh, H; Allada, K; Anderson, B; Anez, D; Aniol, K; Annand, J; Armstrong, W; Arrington, J; Averett, T; Badman, T; Baghdasaryan, H; Bai, X; Beck, A; Beck, S; Bellini, V; Benmokhtar, F; Bertozzi, W; Bittner, J; Boeglin, W; Camsonne, A; Chen, C; Chen, J-P; Chirapatpimol, K; Cisbani, E; Dalton, M M; Daniel, A; Day, D; de Jager, C W; De Leo, R; Deconinck, W; Defurne, M; Flay, D; Fomin, N; Friend, M; Frullani, S; Fuchey, E; Garibaldi, F; Gaskell, D; Gilman, R; Glamazdin, O; Gu, C; Gueye, P; Hamilton, D; Hanretty, C; Hansen, J-O; Hashemi Shabestari, M; Holmstrom, T; Huang, M; Iqbal, S; Jin, G; Kalantarians, N; Kang, H; Khandaker, M; LeRose, J; Leckey, J; Lindgren, R; Long, E; Mammei, J; Margaziotis, D J; Markowitz, P; Marti Jimenez-Arguello, A; Meekins, D; Meziani, Z; Michaels, R; Mihovilovic, M; Monaghan, P; Munoz Camacho, C; Norum, B; Nuruzzaman; Pan, K; Phillips, S; Pomerantz, I; Posik, M; Punjabi, V; Qian, X; Qiang, Y; Qiu, X; Rakhman, A; Reimer, P E; Riordan, S; Ron, G; Rondon-Aramayo, O; Saha, A; Schulte, E; Selvy, L; Shahinyan, A; Sirca, S; Sjoegren, J; Slifer, K; Solvignon, P; Sparveris, N; Subedi, R; Tireman, W; Wang, D; Weinstein, L B; Wojtsekhowski, B; Yan, W; Yaron, I; Ye, Z; Zhan, X; Zhang, J; Zhang, Y; Zhao, B; Zhao, Z; Zheng, X; Zhu, P; Zielinski, R

    2014-07-11

    We studied simultaneously the (4)He(e,e'p), (4)He(e,e'pp), and (4)He(e,e'pn) reactions at Q(2)=2(GeV/c)(2) and x(B)>1, for an (e,e'p) missing-momentum range of 400 to 830  MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum, in a region where the nucleon-nucleon (NN) force is expected to change from predominantly tensor to repulsive. The abundance of neutron-proton pairs is reduced as the nucleon momentum increases beyond ∼500  MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum. Our data are compared with calculations of two-nucleon momentum distributions in (4)He and discussed in the context of probing the elusive repulsive component of the NN force.

  15. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the 4He(e,e`pN) Triple-Coincidence Reaction

    DOE PAGES

    Korover, Igor; Muangma, Navaphon; Hen, Or; ...

    2014-07-01

    We studied simultaneously the 4He(e,e'p), 4He(e,e'pp), and 4He(e,e'pn) reactions at Q2=2 [GeV/c]2 and xB >1, for a (e,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum in a region where the nucleon-nucleon force is expected to change from predominantly tensor to repulsive. Neutron-proton pairs dominate the high-momentum tail ofmore » the nucleon momentum distributions, but their abundance is reduced as the nucleon momentum increases beyond ~500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum in the range we studied. Our data are compared with ab-initio calculations of two-nucleon momentum distributions in 4He.« less

  16. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the 4He(e,e`pN) Triple-Coincidence Reaction

    SciTech Connect

    Korover, Igor; Muangma, Navaphon; Hen, Or; Shneor, Ran; Sulkosky, Vincent; Kelleher, Aidan; Gilad, Shalev; Higinbotham, Douglas; Piasetzky, Eliazer; Wood, Stephen; Rakhman, Abdurahim; Aguilera, Paula; Ahmed, Zafar; Albataineh, Hisham; Allada, Kalyan; Anderson, Bryon; Anez, David; Aniol, Konrad; Annand, John; Armstrong, Whitney; Arrington, John; Averett, Todd; Badman, Toby; Baghdasaryan, Hovhannes; Bai, Xinzhan; Beck, Arie; Beck, Sharon; Bellini, Vincenzo; Benmokhtar, Fatiha; Bertozzi, William; Bittner, James; Boeglin, Werner; Camsonne, Alexandre; Chen, Chunhua; Chen, Jian -Ping; Chirapatpimol, Khem; Cisbani, Evaristo; Dalton, Mark; Daniel, Aji; Day, Donal; De, Cornelis; de Jager, C. W.; De, Raffaele; Leo, R. De; Deconinck, Wouter; Defurne, Maxime; Flay, David; Fomin, Nadia; Friend, Megan; Frullani, Salvatore; Fuchey, Eric; Garibaldi, Franco; Gaskell, David; Gilman, Ronald; Glamazdin, Oleksandr; Gu, Chao; Gueye, Paul; Hamilton, David; Hanretty, Charles; Hansen, Jens-Ole; Shabestari, Mitra Hashemi; Holmstrom, Timothy; Huang, Min; Iqbal, Sophia; Jin, Ge; Kalantarians, Narbe; Kang, Hoyoung; Khandaker, Mahbubul; LeRose, John; Leckey, John; Lindgren, Richard; Long, Elena; Mammei, Juliette; Margaziotis, Demetrius; Markowitz, Pete; Meekins, David; Meziani, Zein -Eddine; Michaels, Robert; Mihovilovic, Miha; Monaghan, Peter; Munoz, Carlos; Camacho, C. Munoz; Norum, Blaine; Nuruzzaman, nfn; Pan, Kai; Phillips, Sarah; Pomerantz, Ishay; Posik, Matthew; Punjabi, Vina; Qian, Xin; Qiang, Yi; Qiu, Xiyu; Reimer, Paul; Riordan, Seamus; Ron, Guy; Rondon-Aramayo, Oscar; Saha, Arunava; Schulte, Elaine; Selvy, Lawrence; Shahinyan, Albert; Sirca, Simon; Sjoegren, Johan; Slifer, Karl; Solvignon-Slifer, Patricia; Sparveris, Nikolaos; Subedi, Ramesh; Tireman, William; Wang, Diancheng; Weinstein, Lawrence; Wojtsekhowski, Bogdan; Yan, Wenbiao; Yaron, Israel; Ye, Zhihong; Zhan, X.; Zhang, J.; Zhang, Yawei; Zhao, Bo; Zhao, Zhiwen; Zheng, Xiaochao; Zhu, Pengjia; Zielinski, Ryan; Watson, John

    2014-07-01

    We studied simultaneously the 4He(e,e'p), 4He(e,e'pp), and 4He(e,e'pn) reactions at Q2=2 [GeV/c]2 and xB >1, for a (e,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum in a region where the nucleon-nucleon force is expected to change from predominantly tensor to repulsive. Neutron-proton pairs dominate the high-momentum tail of the nucleon momentum distributions, but their abundance is reduced as the nucleon momentum increases beyond ~500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum in the range we studied. Our data are compared with ab-initio calculations of two-nucleon momentum distributions in 4He.

  17. Study of Quasielastic 1p-shell proton Knockout in the 16O (e,e'p) reaction at Q2=0.8 (GeV/c)2

    SciTech Connect

    Gao, Juncai

    1999-06-01

    Coincidence cross sections and the structure functions RL+TT, RT and RLT have been obtained for the quasielastic 16O( e, e'p) reaction with the proton knocked out from the 1p1/2 and 1p3/2 states in perpendicular kinematics. The nominal energy transfer ω was 439 MeV the nominal Q2 was 0.8 ( GeV/ c)2 and the kinetic energy of knocked- out proton was 427 MeV. The data was taken in Hall A Je erson Laboratory using two high resolution spectrometers to detect electrons and protons respectively. Nominal beam energies 845 MeV , 1645 MeV and 2445 MeV were employed. For each beam energy, the momentum and angle of electron arm were fixed, while the angle between the proton momentum and the momentum transfer {vector q} was varied to map out the missing momentum. RLT was separated out to ~350 MeV /c in missing momentum. RL+TT and RT were separated out to ~280 MeV/ c in missing momentum. RL and RT were separated at a missing momentum of 52.5 MeV/ c for the data taken with hadron arm along $\\vec{q}$. The measured cross sections and response functions agree with both relativistic and non relativistic DWIA calculations employing spectroscopic factors between 60-75% for 1 p1/2 and 1 p3/2 states. The left- right asymmetry does not support the non -relativistic DWIA calculation using the Weyl gauge. Also the left- right asymmetry measurement favors the relativistic calculation. This thesis describes the details of the experimental setup , the calibration of the spectrometers, the techniques used in the data analysis to derive the fi nal cross sec tions as well as the response functions and the comparison of the results with the theoretical calculations.

  18. (d ,n ) proton-transfer reactions on 9Be, 11B, 13C, N,1514, and 19F and spectroscopic factors at Ed=16 MeV

    NASA Astrophysics Data System (ADS)

    Febbraro, M.; Becchetti, F. D.; Torres-Isea, R. O.; Riggins, J.; Lawrence, C. C.; Kolata, J. J.; Howard, A. M.

    2017-08-01

    The (d ,n ) reaction has been studied with targets of 9Be, 11B, 13C, N,1514, and 19F at Ed=16 MeV using a deuterated liquid-scintillator array. Advanced spectral unfolding techniques with accurately measured scintillator response functions were employed to extract neutron energy spectra without the need for long-path neutron time-of-flight. An analysis of the proton-transfer data at forward angles to the ground states of the final nuclei, using finite-range distorted-wave Born approximation analysis with common bound-state, global, and local optical-model parameter sets, yields a set of self-consistent spectroscopic factors. These are compared with the results of several previous time-of-flight measurements, most done many years ago for individual nuclei at lower energy and often analyzed using zero-range transfer codes. In contrast to some of the earlier published data, our data generally compare well with simple shell-model predictions, with little evidence for uniform quenching (reduction from shell-model values) that has previously been reported from analysis of nucleon knock-out reactions. Data for low-lying excited states in 14N from 13C(d ,n ) also is analyzed and spectroscopic information relevant to nuclear astrophysics obtained. A preliminary study of the radioactive ion beam induced reaction 7Be(d ,n ) , E (7Be)=30 MeV was carried out and indicates further improvements are needed for such measurements, which require detection of neutrons with En<2 MeV .

  19. Catalysis of Photochemical Reactions.

    ERIC Educational Resources Information Center

    Albini, A.

    1986-01-01

    Offers a classification system of catalytic effects in photochemical reactions, contrasting characteristic properties of photochemical and thermal reactions. Discusses catalysis and sensitization, examples of catalyzed reactions of excepted states, complexing ground state substrates, and catalysis of primary photoproducts. (JM)

  20. Anaphylaxis-Like Reactions

    MedlinePlus

    ... Home Conditions Anaphylaxis Anaphylaxis-Like Reactions Anaphylaxis-Like Reactions Make an Appointment Refer a Patient Ask a ... exposed to a foreign substance, some people suffer reactions identical to anaphylaxis, but no allergy (IgE antibody) ...

  1. Catalysis of Photochemical Reactions.

    ERIC Educational Resources Information Center

    Albini, A.

    1986-01-01

    Offers a classification system of catalytic effects in photochemical reactions, contrasting characteristic properties of photochemical and thermal reactions. Discusses catalysis and sensitization, examples of catalyzed reactions of excepted states, complexing ground state substrates, and catalysis of primary photoproducts. (JM)

  2. Anaphylaxis-Like Reactions

    MedlinePlus

    ... Home Conditions Anaphylaxis Anaphylaxis-Like Reactions Anaphylaxis-Like Reactions Make an Appointment Refer a Patient Ask a ... exposed to a foreign substance, some people suffer reactions identical to anaphylaxis, but no allergy (IgE antibody) ...

  3. The Glyoxal Clock Reaction

    ERIC Educational Resources Information Center

    Ealy, Julie B.; Negron, Alexandra Rodriguez; Stephens, Jessica; Stauffer, Rebecca; Furrow, Stanley D.

    2007-01-01

    Research on the glyoxal clock reaction has led to adaptation of the clock reaction to a general chemistry experiment. This particular reaction is just one of many that used formaldehyde in the past. The kinetics of the glyoxal clock makes the reaction suitable as a general chemistry lab using a Calculator Based Laboratory (CBL) or a LabPro. The…

  4. The Glyoxal Clock Reaction

    ERIC Educational Resources Information Center

    Ealy, Julie B.; Negron, Alexandra Rodriguez; Stephens, Jessica; Stauffer, Rebecca; Furrow, Stanley D.

    2007-01-01

    Research on the glyoxal clock reaction has led to adaptation of the clock reaction to a general chemistry experiment. This particular reaction is just one of many that used formaldehyde in the past. The kinetics of the glyoxal clock makes the reaction suitable as a general chemistry lab using a Calculator Based Laboratory (CBL) or a LabPro. The…

  5. Skin reactions to sunscreens.

    PubMed

    Nixon, R L; Frowen, K E; Lewis, A E

    1997-06-01

    Sunscreen reactions are said not to be uncommon. A population referred to a patch testing clinic was evaluated for reactions to sunscreen by questionnaire initially and then, if relevant, by patch testing to sunscreen products and their components. Irritant reactions were more common than allergic contact dermatitis. Allergic reactions to sunscreens were less common than to non-sunscreen chemicals present in sunscreen products.

  6. [Reactions to food].

    PubMed

    Halvorsen, R; Eggesb M; Botten, G

    1995-12-10

    Adverse reactions to food occur in about 1-2% of the population, but are reported more frequently by patients. Most reactions to food are not caused by allergy. IgE-mediated food reactions are well known and of major clinical significance owing to their potentially dangerous, even life-threatening character. Adverse reactions to food can also be caused by immunological mechanisms other than IgE-mediated reactions such as, enzyme deficiencies, active pharmacological substances in food and psychological mechanisms. Double-blind provocation is the only way to diagnose a positive reaction to a food item with some certainty. Regretably no objective measures for food reactions exist.

  7. Microscale Thermite Reactions.

    ERIC Educational Resources Information Center

    Arnaiz, Francisco J.; Aguado, Rafael; Arnaiz, Susana

    1998-01-01

    Describes the adaptation of thermite (aluminum with metal oxides) reactions from whole-class demonstrations to student-run micro-reactions. Lists detailed directions and possible variations of the experiment. (WRM)

  8. Allergic reactions (image)

    MedlinePlus

    Allergic reaction is a sensitivity to a specific substance, called an allergen, that is contacted through the skin, inhaled into the lungs, swallowed or injected. The body's reaction to an allergen can be mild, such as ...

  9. Allergic reactions (image)

    MedlinePlus

    Allergic reaction can be provoked by skin contact with poison plants, chemicals and animal scratches, as well as by ... dust, nuts and shellfish, may also cause allergic reaction. Medications such as penicillin and other antibiotics are ...

  10. Microfluidic chemical reaction circuits

    SciTech Connect

    Lee, Chung-cheng; Sui, Guodong; Elizarov, Arkadij; Kolb, Hartmuth C; Huang, Jiang; Heath, James R; Phelps, Michael E; Quake, Stephen R; Tseng, Hsian-rong; Wyatt, Paul; Daridon, Antoine

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  11. Microscale Thermite Reactions.

    ERIC Educational Resources Information Center

    Arnaiz, Francisco J.; Aguado, Rafael; Arnaiz, Susana

    1998-01-01

    Describes the adaptation of thermite (aluminum with metal oxides) reactions from whole-class demonstrations to student-run micro-reactions. Lists detailed directions and possible variations of the experiment. (WRM)

  12. Modeling Mechanochemical Reaction Mechanisms.

    PubMed

    Adams, Heather; Miller, Brendan P; Furlong, Octavio J; Fantauzzi, Marzia; Navarra, Gabriele; Rossi, Antonella; Xu, Yufu; Kotvis, Peter V; Tysoe, Wilfred T

    2017-08-09

    The mechanochemical reaction between copper and dimethyl disulfide is studied under well-controlled conditions in ultrahigh vacuum (UHV). Reaction is initiated by fast S-S bond scission to form adsorbed methyl thiolate species, and the reaction kinetics are reproduced by two subsequent elementary mechanochemical reaction steps, namely a mechanochemical decomposition of methyl thiolate to deposit sulfur on the surface and evolve small, gas-phase hydrocarbons, and sliding-induced oxidation of the copper by sulfur that regenerates vacant reaction sites. The steady-state reaction kinetics are monitored in situ from the variation in the friction force as the reaction proceeds and modeled using the elementary-step reaction rate constants found for monolayer adsorbates. The analysis yields excellent agreement between the experiment and the kinetic model, as well as correctly predicting the total amount of subsurface sulfur in the film measured using Auger spectroscopy and the sulfur depth distribution measured by angle-resolved X-ray photoelectron spectroscopy.

  13. Hypersensitivity reaction to azathioprine.

    PubMed

    Fields, C L; Robinson, J W; Roy, T M; Ossorio, M A; Byrd, R P

    1998-05-01

    Adverse drug reactions can vary from a simple rash to anaphylactic shock. While certain medications including the penicillins are well known to cause such reactions, other drugs are not as commonly recognized. Azathioprine hypersensitivity reactions tend to be benign and self-limiting with cessation of drug ingestion. We report a patient who had a hypersensitivity reaction to azathioprine, which manifested as distributive shock that mimicked sepsis. We also reviewed the English language literature for risk factors for a hypersensitivity reaction to azathioprine and its possible mechanism.

  14. [Adverse reactions to vaccines].

    PubMed

    Eseverri, J L; Ranea, S; Marin, A

    2003-01-01

    Adverse reactions to vaccines are highly varied, ranging from mild local reactions to fatal outcomes. In the last few years many adverse reactions have been attributed to vaccines, often without justification. In agreement with the World Health Organization, these reactions can be classified as follows, depending on the cause: vaccination-induced reactions (due to an effect of the vaccine itself or to an idiosyncrasy); reactions due to errors in storage, manipulation and/or administration; and coincidental reactions (no causal relationship with the vaccine). Hypersensitivity reactions fall into six categories, depending on the causative agent: reactions due to some component of the infectious agent or one of its products; reactions due to adjuvants: aluminium hydroxide; reactions due to stabilizers: gelatin; reactions due to preservatives: thiomersal; reactions due to antibiotics: neomycin; and reactions due to a biological culture medium: chicken embryo cells. Allergic children should not be excluded from the normal vaccine calendar. Immunologically, allergic individuals are more susceptible to infection and to microbial and viral diseases, which often play an aggravating role. Rubella, whooping cough, and influenza usually exacerbate respiratory allergies. Non-vaccination carries a marked risk of contracting serious diseases such as poliomyelitis, tetanus, and diphtheria, etc. In a not too distant future, the techniques of genetic recombination and monoclonal antibody production will allow the creation of vaccines from organisms that cannot be cultivated in the laboratory or that produce small quantities of antigen. These techniques will also lead to identification of the antigens with the greatest immunogenic power and, consequently, to extremely pure vaccines. The adverse reactions to vaccines referred to our service account for between 0.59 % and 1.27 % of first visits in the last three years. We recorded a total of 48 adverse reactions to vaccines. Of

  15. Upregulation of the Angiotensin-Converting Enzyme 2/Angiotensin-(1-7)/Mas Receptor Axis in the Heart and the Kidney of Growth Hormone Receptor knock-out Mice

    PubMed Central

    GIANI, Jorge F.; MIQUET, Johanna G.; MUÑOZ, Marina C.; BURGHI, Valeria; TOBLLI, Jorge E.; MASTERNAK, Michal M.; KOPCHIC, John J.; BARTKE, Andrzej; TURYN, Daniel; DOMINICI, Fernando P.

    2012-01-01

    Objective Growth hormone (GH) resistance leads to enhanced insulin sensitivity, decreased systolic blood pressure and increased lifespan. The aim of this study was to determine if there is a shift in the balance of the renin-angiotensin system (RAS) towards the ACE2/Ang-(1-7)/Mas receptor axis in the heart and the kidney of a model of GH resistance and retarded aging, the GH receptor knockout (GHR−/−) mouse. Design RAS components were evaluated in the heart and the kidney of GHR−/− and control mice by immunohistochemistry and western blotting (n=12 for both groups). Results The immunostaining of Ang-(1-7) was increased in both the heart and the kidney of GHR−/− mice. These changes were concomitant with an increased immunostaining of the Mas receptor and ACE2 in both tissues. The immunostaining of AT1 receptor was reduced in heart and kidney of GHR−/− mice while that of AT2 receptor was increased in the heart and unaltered in the kidney. Ang II, ACE and angiotensinogen levels remained unaltered in the heart and the kidney of GH resistant mice. These results were confirmed by Western Blotting and correlated with a significant increase in the abundance of the endothelial nitric oxide synthase in both tissues. Conclusions The shift within the RAS towards an exacerbation of the ACE2/Ang-(1-7)/Mas receptor axis observed in GHR−/− mice could be related to a protective role in cardiac and renal function; and thus, possibly contribute to the decreased incidence of cardiovascular diseases displayed by this animal model of longevity. PMID:22947377

  16. Deep phosphorus fertiliser placement and reduced irrigation methods for rice (Oryza sativa L.) combine to knock-out competition from its nemesis, barnyard grass (Echinochloa crus-galli (L.) P.Beauv)

    USDA-ARS?s Scientific Manuscript database

    Productivity of rice is increasingly being constrained by limitations in the quantity, quality, and cost of water and nutrients, and competition from weeds. This is a ‘commentary’ on the recent work of Weerarathne et al. (2015). They reported new discoveries from greenhouse experiments that showed...

  17. Targeting of GFP-Cre to the Mouse Cyp11a1 Locus Both Drives Cre Recombinase Expression in Steroidogenic Cells and Permits Generation of Cyp11a1 Knock Out Mice

    PubMed Central

    O'Hara, Laura; York, Jean Philippe; Zhang, Pumin; Smith, Lee B.

    2014-01-01

    To permit conditional gene targeting of floxed alleles in steroidogenic cell-types we have generated a transgenic mouse line that expresses Cre Recombinase under the regulation of the endogenous Cytochrome P450 side chain cleavage enzyme (Cyp11a1) promoter. Mice Carrying the Cyp11a1-GC (GFP-Cre) allele express Cre Recombinase in fetal adrenal and testis, and adrenal cortex, testicular Leydig cells (and a small proportion of Sertoli cells), theca cells of the ovary, and the hindbrain in postnatal life. Circulating testosterone concentration is unchanged in Cyp11+/GC males, suggesting steroidogenesis is unaffected by loss of one allele of Cyp11a1, mice are grossly normal, and Cre Recombinase functions to recombine floxed alleles of both a YFP reporter gene and the Androgen Receptor (AR) in steroidogenic cells of the testis, ovary, adrenal and hindbrain. Additionally, when bred to homozygosity (Cyp11a1GC/GC), knock-in of GFP-Cre to the endogenous Cyp11a1 locus results in a novel mouse model lacking endogenous Cyp11a1 (P450-SCC) function. This unique dual-purpose model has utility both for those wishing to conditionally target genes within steroidogenic cell types and for studies requiring mice lacking endogenous steroid hormone production. PMID:24404170

  18. Knock-out of metacaspase and/or cytochrome c results in the activation of a ROS-independent acetic acid-induced programmed cell death pathway in yeast.

    PubMed

    Guaragnella, Nicoletta; Passarella, Salvatore; Marra, Ersilia; Giannattasio, Sergio

    2010-08-20

    To gain further insight into yeast acetic acid-induced programmed cell death (AA-PCD) we analyzed the effects of the antioxidant N-acetyl-L-cysteine (NAC) on cell viability, hydrogen peroxide (H(2)O(2)) production, DNA fragmentation, cytochrome c (cyt c) release and caspase-like activation in wild type (wt) and metacaspase and/or cyt c-lacking cells. We found that NAC prevents AA-PCD in wt cells, by scavenging H(2)O(2) and by inhibiting both cyt c release and caspase-like activation. This shows the occurrence of a reactive oxygen species (ROS)-dependent AA-PCD. Contrarily no NAC dependent change in AA-PCD of mutant cells was detectable, showing that a ROS-independent AA-PCD can also occur.

  19. Global ischemia-induced increases in the gap junctional proteins connexin 32 (Cx32) and Cx36 in hippocampus and enhanced vulnerability of Cx32 knock-out mice.

    PubMed

    Oguro, K; Jover, T; Tanaka, H; Lin, Y; Kojima, T; Oguro, N; Grooms, S Y; Bennett, M V; Zukin, R S

    2001-10-01

    Gap junctions are conductive channels that connect the interiors of coupled cells. In the hippocampus, GABA-containing hippocampal interneurons are interconnected by gap junctions, which mediate electrical coupling and synchronous firing and thereby promote inhibitory transmission. The present study was undertaken to examine the hypothesis that the gap junctional proteins connexin 32 (Cx32; expressed by oligodendrocytes, interneurons, or both), Cx36 (expressed by interneurons), and Cx43 (expressed by astrocytes) play a role in defining cell-specific patterns of neuronal death in hippocampus after global ischemia in mice. Global ischemia did not significantly alter Cx32 and Cx36 mRNA expression and slightly increased Cx43 mRNA expression in the vulnerable CA1, as assessed by Northern blot analysis and in situ hybridization. Global ischemia induced a selective increase in Cx32 and Cx36 but not Cx43 protein abundance in CA1 before onset of neuronal death, as assessed by Western blot analysis. The increase in Cx32 and Cx36 expression was intense and specific to parvalbumin-positive inhibitory interneurons of CA1, as assessed by double immunofluorescence. Protein abundance was unchanged in CA3 and dentate gyrus. The finding of increase in connexin protein without increase in mRNA suggests regulation of Cx32 and Cx36 expression at the translational or post-translational level. Cx32(Y/-) null mice exhibited enhanced vulnerability to brief ischemic insults, consistent with a role for Cx32 gap junctions in neuronal survival. These findings suggest that Cx32 and Cx36 gap junctions may contribute to the survival and resistance of GABAergic interneurons, thereby defining cell-specific patterns of global ischemia-induced neuronal death.

  20. Determination of loperamide in mdr1a/1b knock-out mouse brain tissue using matrix-assisted laser desorption/ionization mass spectrometry and comparison with quantitative electrospray-triple quadrupole mass spectrometry analysis.

    PubMed

    Shin, Young G; Dong, Teresa; Chou, Bilin; Menghrajani, Kapil

    2011-11-01

    Recently matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) imaging has been used to analyze small molecule pharmaceutical compounds directly on tissue sections to determine spatial distribution within target tissue and organs. The data presented to date usually indicate relative amounts of drug within the tissue. The determination of absolute amounts is still done using tissue homogenization followed by traditional liquid chromatography-tandem mass spectrometry (LC-MS/MS). In this study, the quantitative determination of loperamide, an antidiarrheal agent and a P-glycoprotein substrate, in mdr1a/1b (-/-) mouse brain tissue sections using MALDI MS on a quadrupole time-of-flight mass spectrometry is described. 5 mg/mL α-cyano-4-hydroxycinnamic acid in 50% acetonitrile with 0.1% trifluoroacetic acid and 0.5 μM reserpine was used as the MALDI matrix. The calibration curve constructed by the peak intensities of standard samples from MALDI MS was linear from 0.025 to 0.5 μM with r² = 0.9989. The accuracy of calibration curve standards was 78.3-105.9% and the percent deviation was less than 25%. Comparison between direct MALDI tissue analysis and conventional tissue analysis using homogenization followed by electrospray LC-MS/MS was also explored.

  1. Dynamics of Sun5 Localization during Spermatogenesis in Wild Type and Dpy19l2 Knock-Out Mice Indicates That Sun5 Is Not Involved in Acrosome Attachment to the Nuclear Envelope

    PubMed Central

    Yassine, Sandra; Escoffier, Jessica; Nahed, Roland Abi; Pierre, Virginie; Karaouzene, Thomas; Ray, Pierre F.; Arnoult, Christophe

    2015-01-01

    The acrosome is an organelle that is central to sperm physiology and a defective acrosome biogenesis leads to globozoospermia, a severe male infertility. The identification of the actors involved in acrosome biogenesis is therefore particularly important to decipher the molecular pathogeny of globozoospermia. We recently showed that a defect in the DPY19L2 gene is present in more than 70% of globozoospermic men and demonstrated that Dpy19l2, located in the inner nuclear membrane, is the first protein involved in the attachment of the acrosome to the nuclear envelope (NE). SUN proteins serve to link the nuclear envelope to the cytoskeleton and are therefore good candidates to participate in acrosome-nucleus attachment, potentially by interacting with DPY19L2. In order to characterize new actors of acrosomal attachment, we focused on Sun5 (also called Spag4l), which is highly expressed in male germ cells, and investigated its localization during spermatogenesis. Using immunohistochemistry and Western blot experiments in mice, we showed that Sun5 transits through different cellular compartments during meiosis. In pachytene spermatocytes, it is located in a membranous compartment different to the reticulum. In round spermatids, it progresses to the Golgi and the NE before to be located to the tail/head junction in epididymal sperm. Interestingly, we demonstrate that Sun5 is not, as initially reported, facing the acrosome but is in fact excluded from this zone. Moreover, we show that in Dpy19l2 KO spermatids, upon the detachment of the acrosome, Sun5 relocalizes to the totality of the NE suggesting that the acrosome attachment excludes Sun5 from the NE facing the acrosome. Finally, Western-blot experiments demonstrate that Sun5 is glycosylated. Overall, our work, associated with other publications, strongly suggests that the attachment of the acrosome to the nucleus does not likely depend on the formation of SUN complexes. PMID:25775128

  2. Accumulation of Oxidized LDL in the Tendon Tissues of C57BL/6 or Apolipoprotein E Knock-Out Mice That Consume a High Fat Diet: Potential Impact on Tendon Health

    PubMed Central

    Grewal, Navdeep; Thornton, Gail M.; Behzad, Hayedeh; Sharma, Aishwariya; Lu, Alex; Zhang, Peng; Reid, W. Darlene; Granville, David J.; Scott, Alex

    2014-01-01

    Objective Clinical studies have suggested an association between dyslipidemia and tendon injuries or chronic tendon pain; the mechanisms underlying this association are not yet known. The objectives of this study were (1) to evaluate the impact of a high fat diet on the function of load-bearing tendons and on the distribution in tendons of oxidized low density lipoprotein (oxLDL), and (2) to examine the effect of oxLDL on tendon fibroblast proliferation and gene expression. Methods Gene expression (Mmp2, Tgfb1, Col1a1, Col3a1), fat content (Oil Red O staining), oxLDL levels (immunohistochemistry) and tendon biomechanical properties were examined in mice (C57Bl/6 or ApoE -/-) receiving a standard or a high fat diet. Human tendon fibroblast proliferation and gene expression (COL1A1, COL3A1, MMP2) were examined following oxLDL exposure. Results In both types of mice (C57Bl/6 or ApoE -/-), consumption of a high fat diet led to a marked increase in oxLDL deposition in the load-bearing extracellular matrix of the tendon. The consumption of a high fat diet also reduced the failure stress and load of the patellar tendon in both mouse types, and increased Mmp2 expression. ApoE -/- mice exhibited more pronounced reductions in tendon function than wild-type mice, and decreased expression of Col1a1 compared to wild type mice. Human tendon fibroblasts responded to oxLDL by increasing their proliferation and their mRNA levels of MMP2, while decreasing their mRNA levels for COL1A1 and COL3A1. Conclusion The consumption of a high fat diet resulted in deleterious changes in tendon function, and these changes may be explained in part by the effects of oxLDL, which induced a proliferative, matrix-degrading phenotype in human tenocytes. PMID:25502628

  3. The delta 6 desaturase knock out mouse reveals that immunomodulatory effects of essential n-6 and n-3 polyunsaturated fatty acids are both independent of and dependent upon conversion.

    PubMed

    Monk, Jennifer M; Liddle, Danyelle M; Cohen, Daniel J A; Tsang, Denis H; Hillyer, Lyn M; Abdelmagid, Salma A; Nakamura, Manabu T; Power, Krista A; Ma, David W L; Robinson, Lindsay E

    2016-06-01

    Typically fatty acids (FA) exert differential immunomodulatory effects with n-3 [α-linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)] and n-6 [linoleic acid (LA) and arachidonic acid (AA)] exerting anti- and pro-inflammatory effects, respectively. This over-simplified interpretation is confounded by a failure to account for conversion of the parent FA (LA and ALA) to longer-chain bioactive products (AA and EPA/DHA, respectively), thereby precluding discernment of the immunomodulatory potential of specific FA. Therefore, we utilized the Δ6-desaturase model, wherein knockout mice (D6KO) lack the Fads2 gene encoding for the rate-limiting enzyme that initiates FA metabolism, thereby providing a model to determine specific FA immunomodulatory effects. Wild-type (WT) and D6KO mice were fed one of four isocaloric diets differing in FA source (9weeks): corn oil (LA-enriched), arachidonic acid single cell oil (AA-enriched), flaxseed oil (ALA-enriched) or menhaden fish oil (EPA/DHA-enriched). Splenic mononuclear cell cytokine production in response to lipopolysaccharide (LPS), T-cell receptor (TCR) and anti-CD40 stimulation was determined. Following LPS stimulation, AA was more bioactive compared to LA, by increasing inflammatory cytokine production of IL-6 (1.2-fold) and TNFα (1.3-fold). Further, LPS-stimulated IFNγ production in LA-fed D6KO mice was reduced 5-fold compared to LA-fed WT mice, indicating that conversion of LA to AA was necessary for cytokine production. Conversely, ALA exerted an independent immunomodulatory effect from EPA/DHA and all n-3 FA increased LPS-stimulated IL-10 production versus LA and AA. These data definitively identify specific immunomodulatory effects of individual FA and challenge the simplified view of the immunomodulatory effects of n-3 and n-6 FA.

  4. Generation of a Novel T Cell Specific Interleukin-1 Receptor Type 1 Conditional Knock Out Mouse Reveals Intrinsic Defects in Survival, Expansion and Cytokine Production of CD4 T Cells.

    PubMed

    Mufazalov, Ilgiz A; Regen, Tommy; Schelmbauer, Carsten; Kuschmann, Janina; Muratova, Alisa M; Nikolaev, Alexei; Müller, Werner; Pinteaux, Emmanuel; Waisman, Ari

    2016-01-01

    Interleukin-1 (IL-1) plays a crucial role in numerous inflammatory diseases via action on its only known signaling IL-1 receptor type 1 (IL-1R1). To investigate the role of IL-1 signaling in selected cell types, we generated a new mouse strain in which exon 5 of the Il1r1 gene is flanked by loxP sites. Crossing of these mice with CD4-Cre transgenic mice resulted in IL-1R1 loss of function specifically in T cells. These mice, termed IL-1R1ΔT, displayed normal development under steady state conditions. Importantly, isolated CD4 positive T cells retained their capacity to differentiate toward Th1 or Th17 cell lineages in vitro, and strongly proliferated in cultures supplemented with either anti-CD3/CD28 or Concanavalin A, but, as predicted, were completely unresponsive to IL-1β administration. Furthermore, IL-1R1ΔT mice were protected from gut inflammation in the anti-CD3 treatment model, due to dramatically reduced frequencies and absolute numbers of IL-17A and interferon (IFN)-γ producing cells. Taken together, our data shows the necessity of intact IL-1 signaling for survival and expansion of CD4 T cells that were developed in an otherwise IL-1 sufficient environment.

  5. Altered expression of β-galactosidase-1-like protein 3 (Glb1l3) in the retinal pigment epithelium (RPE)-specific 65-kDa protein knock-out mouse model of Leber’s congenital amaurosis

    PubMed Central

    Schorderet, Daniel F.; Cottet, Sandra

    2011-01-01

    Purpose In this study, we investigated the expression of the gene encoding β-galactosidase (Glb)-1-like protein 3 (Glb1l3), a member of the glycosyl hydrolase 35 family, during retinal degeneration in the retinal pigment epithelium (RPE)-specific 65-kDa protein knockout (Rpe65−/−) mouse model of Leber congenital amaurosis (LCA). Additionally, we assessed the expression of the other members of this protein family, including β-galactosidase-1 (Glb1), β-galactosidase-1-like (Glb1l), and β-galactosidase-1-like protein 2 (Glb1l2). Methods The structural features of Glb1l3 were assessed using bioinformatic tools. mRNA expression of Glb-related genes was investigated by oligonucleotide microarray, real-time PCR, and reverse transcription (RT) -PCR. The localized expression of Glb1l3 was assessed by combined in situ hybridization and immunohistochemistry. Results Glb1l3 was the only Glb-related member strongly downregulated in Rpe65−/− retinas before the onset and during progression of the disease. Glb1l3 mRNA was only expressed in the retinal layers and the RPE/choroid. The other Glb-related genes were ubiquitously expressed in different ocular tissues, including the cornea and lens. In the healthy retina, expression of Glb1l3 was strongly induced during postnatal retinal development; age-related increased expression persisted during adulthood and aging. Conclusions These data highlight early-onset downregulation of Glb1l3 in Rpe65-related disease. They further indicate that impaired expression of Glb1l3 is mostly due to the absence of the chromophore 11-cis retinal, suggesting that Rpe65 deficiency may have many metabolic consequences in the underlying neuroretina. PMID:21633714

  6. (. pi. sup +- ,. pi. sup +- prime N) reactions on sup 12 C and sup 208 Pb near the giant resonance region

    SciTech Connect

    Yoo, Sung Hoon.

    1990-05-01

    Angular distributions for the {sup 12}C({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime} p) and {sup 208}Pb({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime} p or n) reactions near the giant resonance region have been measured at T{sub {pi}} = 180 MeV, and found different between {pi}{sup +} and {pi}{sup {minus}} data. This observation is interpreted as evidence for different excitation mechanisms dominating the {pi}{sup {minus}}-nucleus and {pi}{sup +}-nucleus interactions in the giant resonance region of these targets. A comparison with the single-nucleon knock-out distorted-wave impulse approximation calculations shows, even though these calculations underestimate ({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime} N) data for both targets, the dominance of direct process for ({pi}{sup +}, {pi}{sup {plus}}{prime} p) or ({pi}{sup {minus}}, {pi}{sup {minus}}{prime} n) in contrast to ({pi}{sup {minus}}, {pi}{sup {minus}}{prime} p) or ({pi}{sup +}, {pi}{sup +}{prime} n). In the ({pi}{sup +}, {pi}{sup +}{prime} p) reaction proton-proton hole states are excited directly and appear to have a large probability for direct decay with escape width, whereas in ({pi}{sup {minus}}, {pi}{sup {minus}}{prime} p) the preferentially excited neutron-neutron hole doorway states couple to resonance states and decay with spreading width. This interpretation led us to suggest that the ratio of cross-sections for inelastic scattering to the giant resonance region should be written in terms of an incoherent sum of cross-sections to neutron and proton doorway states. In a heavy nucleus such as {sup 208}Pb, neutron and proton doorway states. In a heavy nucleus such as {sup 208}Pb, neutron and proton doorway states contribute incoherently because the different decay processes do not populate the same final states of the residual nucleus.

  7. Noncanonical reactions of flavoenzymes.

    PubMed

    Sobrado, Pablo

    2012-11-05

    Enzymes containing flavin cofactors are predominantly involved in redox reactions in numerous cellular processes where the protein environment modulates the chemical reactivity of the flavin to either transfer one or two electrons. Some flavoenzymes catalyze reactions with no net redox change. In these reactions, the protein environment modulates the reactivity of the flavin to perform novel chemistries. Recent mechanistic and structural data supporting novel flavin functionalities in reactions catalyzed by chorismate synthase, type II isopentenyl diphosphate isomerase, UDP-galactopyranose mutase, and alkyl-dihydroxyacetonephosphate synthase are presented in this review. In these enzymes, the flavin plays either a direct role in acid/base reactions or as a nucleophile or electrophile. In addition, the flavin cofactor is proposed to function as a "molecular scaffold" in the formation of UDP-galactofuranose and alkyl-dihydroxyacetonephosphate by forming a covalent adduct with reaction intermediates.

  8. Reaction spreading on graphs.

    PubMed

    Burioni, Raffaella; Chibbaro, Sergio; Vergni, Davide; Vulpiani, Angelo

    2012-11-01

    We study reaction-diffusion processes on graphs through an extension of the standard reaction-diffusion equation starting from first principles. We focus on reaction spreading, i.e., on the time evolution of the reaction product M(t). At variance with pure diffusive processes, characterized by the spectral dimension d{s}, the important quantity for reaction spreading is found to be the connectivity dimension d{l}. Numerical data, in agreement with analytical estimates based on the features of n independent random walkers on the graph, show that M(t)∼t{d{l}}. In the case of Erdös-Renyi random graphs, the reaction product is characterized by an exponential growth M(t)e{αt} with α proportional to ln(k), where (k) is the average degree of the graph.

  9. Nuclear reaction studies

    SciTech Connect

    Alexander, J.M.; Lacey, R.A.

    1994-11-01

    Research focused on the statistical and dynamical properties of ``hot`` nuclei formed in symmetric heavy-ion reactions. Theses included ``flow`` measurements and the mechanism for multifragment disassembly. Model calculations are being performed for the reactions C+C, Ne+Al, Ar+Sc, Kr+Nb, and Xe+La. It is planned to study {sup 40}Ar reactions from 27 to 115 MeV/nucleon. 2 figs., 41 refs.

  10. Photoneutron Reactions in Nucleosynthesis

    NASA Astrophysics Data System (ADS)

    Utsunomiya, Hiroaki

    Photoneutron reactions are discussed in the context of nucleosynthesis with emphasis on a unified understanding of (γ, n) and (n, γ) reactions for heavy nuclei through the γ-ray strength function and a revisit to explosive nucleosynthesis of 9Be through the reciprocity theorem. The role of photonuclear reactions in nucleosynthesis is supplemented by the photonuclear data project (IAEA-CRP F42032) and will be strengthened in the Extreme Light Infrastructure-Nuclear Physics (ELI-NP) in the future.

  11. Immune reaction to propanidid.

    PubMed

    Christmas, D

    1984-05-01

    An adverse reaction to the intravenous anaesthetic agent propanidid is described in which the main features were hypotension, facial erythema, and abdominal pain. Changes in serum complement levels and differential white cell counts indicate that this was an immune reaction mediated by the classical complement pathway. The immune reaction apparently involved antibodies other than those of the IgE (reagin) class, and circumstantial evidence suggests that it was specific to propanidid rather than to the entire formulation or to Cremophor EL.

  12. Sleeve reaction chamber system

    SciTech Connect

    Northrup, M Allen; Beeman, Barton V; Benett, William J; Hadley, Dean R; Landre, Phoebe; Lehew, Stacy L; Krulevitch, Peter A

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  13. Clock Reaction: Outreach Attraction

    ERIC Educational Resources Information Center

    Carpenter, Yuen-ying; Phillips, Heather A.; Jakubinek, Michael B.

    2010-01-01

    Chemistry students are often introduced to the concept of reaction rates through demonstrations or laboratory activities involving the well-known iodine clock reaction. For example, a laboratory experiment involving thiosulfate as an iodine scavenger is part of the first-year general chemistry laboratory curriculum at Dalhousie University. With…

  14. Clock Reaction: Outreach Attraction

    ERIC Educational Resources Information Center

    Carpenter, Yuen-ying; Phillips, Heather A.; Jakubinek, Michael B.

    2010-01-01

    Chemistry students are often introduced to the concept of reaction rates through demonstrations or laboratory activities involving the well-known iodine clock reaction. For example, a laboratory experiment involving thiosulfate as an iodine scavenger is part of the first-year general chemistry laboratory curriculum at Dalhousie University. With…

  15. Hydrogen evolution reaction catalyst

    DOEpatents

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  16. REUSABLE REACTION VESSEL

    DOEpatents

    Soine, T.S.

    1963-02-26

    This patent shows a reusable reaction vessel for such high temperature reactions as the reduction of actinide metal chlorides by calcium metal. The vessel consists of an outer metal shell, an inner container of refractory material such as sintered magnesia, and between these, a bed of loose refractory material impregnated with thermally conductive inorganic salts. (AEC)

  17. Chemical burn or reaction

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/000059.htm Chemical burn or reaction To use the sharing features on this page, please enable JavaScript. Chemicals that touch skin can lead to a reaction on the skin, throughout the body, or both. ...

  18. Oscillating Chemical Reactions

    ERIC Educational Resources Information Center

    Hawkins, M. D.; And Others

    1975-01-01

    Describes several oscillating chemical reactions which can be used in undergraduate chemistry laboratories. In one such reaction, ferroin oscillates from red (reducing solution) to blue (oxidizing solution) for about an hour at a frequency which can readily be shown to depend on such factors as the temperature, type of solvent, and concentration…

  19. Degradations and Rearrangement Reactions

    NASA Astrophysics Data System (ADS)

    Zhang, Jianbo

    This section deals with recent reports concerning degradation and rearrangement reactions of free sugars as well as some glycosides. The transformations are classified in chemical and enzymatic ways. In addition, the Maillard reaction will be discussed as an example of degradation and rearrangement transformation and its application in current research in the fields of chemistry and biology.

  20. Photoinduced Multicomponent Reactions.

    PubMed

    Garbarino, Silvia; Ravelli, Davide; Protti, Stefano; Basso, Andrea

    2016-12-12

    The combination of multicomponent approaches with light-driven processes opens up new scenarios in the area of synthetic organic chemistry, where the need for sustainable, atom- and energy-efficient reactions is increasingly urgent. Photoinduced multicomponent reactions are still in their infancy, but significant developments in this area are expected in the near future.

  1. Applications of Reaction Rate

    ERIC Educational Resources Information Center

    Cunningham, Kevin

    2007-01-01

    This article presents an assignment in which students are to research and report on a chemical reaction whose increased or decreased rate is of practical importance. Specifically, students are asked to represent the reaction they have chosen with an acceptable chemical equation, identify a factor that influences its rate and explain how and why it…

  2. Chemical Reaction Problem Solving.

    ERIC Educational Resources Information Center

    Veal, William

    1999-01-01

    Discusses the role of chemical-equation problem solving in helping students predict reaction products. Methods for helping students learn this process must be taught to students and future teachers by using pedagogical skills within the content of chemistry. Emphasizes that solving chemical reactions should involve creative cognition where…

  3. Reactions to Attitudinal Deviancy.

    ERIC Educational Resources Information Center

    Levine, John M.; Allen, Vernon L.

    This paper presents a critical review of empirical and theoretical treatments of group reaction to attitudinal deviancy. Inspired by Festinger's (1950) ideas on resolution of attitudinal discrepancies in groups, Schachter (1951) conducted an experiment that has greatly influenced subsequent research and theory concerning reaction to attitudinal…

  4. Oscillating Reactions: Two Analogies

    ERIC Educational Resources Information Center

    Petruševski, Vladimir M.; Stojanovska, Marina I.; Šoptrajanov, Bojan T.

    2007-01-01

    Oscillating chemical reactions are truly spectacular phenomena, and demonstrations are always appreciated by the class. However, explaining such reactions to high school or first-year university students is problematic, because it may seem that no acceptable explanation is possible unless the students have profound knowledge of both physical…

  5. Precompound Reactions: Basic Concepts

    SciTech Connect

    Weidenmueller, H. A.

    2008-04-17

    Because of the non-zero nuclear equilibration time, the compound-nucleus scattering model fails when the incident energy exceeds 10 or 20 MeV, and precompound reactions become important. Basic ideas used in the quantum-statistical approaches to these reactions are described.

  6. Allergic reactions to vaccines.

    PubMed

    Wood, Robert A

    2013-09-01

    Anaphylactic reactions to vaccines are rare but do occur, and have been reported for nearly every vaccine. And while the reaction rate per each dose of vaccine is low, this is a common clinical question due in large part to the enormous numbers of vaccines administered. Reactions are most often due to vaccine constituents rather than the microbial components of the vaccine, but in many instances, the specific ingredient triggering the reaction cannot be definitively identified. Evaluation of patients with suspected vaccine reactions should begin by determining whether the symptoms and timing of the reaction were consistent with a true allergic reaction, followed by an assessment to determine whether the patient needs further doses of the vaccine in question, or similar vaccines, in the future. Skin and serologic testing to vaccines and vaccine constituents can then be performed to further assess the potential cause of the reaction and to develop a plan for future immunizations. Specific guidelines for the administration of influenza vaccines to egg allergic patients have been revised to allow virtually all patients to receive this vaccine in a straightforward manner. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Reactions and their management.

    PubMed

    Ganapati, R; Pai, V V

    2004-12-01

    The uneventful response to chemotherapy in leprosy is marked by clinically disturbing episodes encountered in 20-30% of patients and these phenomena are called "reactions". Generally they are classified as reversal reaction (type-1) and erythema nodosum leprosum (type-2). The cutaneous menifestations are: (1) Type-2 reactions in LL, BL types constituting erythema nodosum leprosum, erythema multiforme, erythema necroticans, subcutaneous nodules, lepromatous exacerbation. (2) Type-1 reactions in borderline and tuberculoid leprosy. The other manifestations include: Acute neuritis, lymphadenitis, arthritis, oedema of the hands and feet, ocular lesions, etc. Sequelae of reactions are: Paralytic deformities, non-paralytic deformities, extensive scarring and renal damage. A simple guideline to identify the risk-prone cases has been narrated. Prednisolone in standard dosage schedule as recommended by WHO is now being widely used in control programmes.

  8. Algorithm for reaction classification.

    PubMed

    Kraut, Hans; Eiblmaier, Josef; Grethe, Guenter; Löw, Peter; Matuszczyk, Heinz; Saller, Heinz

    2013-11-25

    Reaction classification has important applications, and many approaches to classification have been applied. Our own algorithm tests all maximum common substructures (MCS) between all reactant and product molecules in order to find an atom mapping containing the minimum chemical distance (MCD). Recent publications have concluded that new MCS algorithms need to be compared with existing methods in a reproducible environment, preferably on a generalized test set, yet the number of test sets available is small, and they are not truly representative of the range of reactions that occur in real reaction databases. We have designed a challenging test set of reactions and are making it publicly available and usable with InfoChem's software or other classification algorithms. We supply a representative set of example reactions, grouped into different levels of difficulty, from a large number of reaction databases that chemists actually encounter in practice, in order to demonstrate the basic requirements for a mapping algorithm to detect the reaction centers in a consistent way. We invite the scientific community to contribute to the future extension and improvement of this data set, to achieve the goal of a common standard.

  9. Enhancing chemical reactions

    DOEpatents

    Morrey, John R.

    1978-01-01

    Methods of enhancing selected chemical reactions. The population of a selected high vibrational energy state of a reactant molecule is increased substantially above its population at thermal equilibrium by directing onto the molecule a beam of radiant energy from a laser having a combination of frequency and intensity selected to pump the selected energy state, and the reaction is carried out with the temperature, pressure, and concentrations of reactants maintained at a combination of values selected to optimize the reaction in preference to thermal degradation by transforming the absorbed energy into translational motion. The reaction temperature is selected to optimize the reaction. Typically a laser and a frequency doubler emit radiant energy at frequencies of .nu. and 2.nu. into an optical dye within an optical cavity capable of being tuned to a wanted frequency .delta. or a parametric oscillator comprising a non-centrosymmetric crystal having two indices of refraction, to emit radiant energy at the frequencies of .nu., 2.nu., and .delta. (and, with a parametric oscillator, also at 2.nu.-.delta.). Each unwanted frequency is filtered out, and each desired frequency is focused to the desired radiation flux within a reaction chamber and is reflected repeatedly through the chamber while reactants are fed into the chamber and reaction products are removed therefrom.

  10. Modeling of surface reactions

    SciTech Connect

    Ray, T.R.

    1993-01-01

    Mathematical models are used to elucidate properties of the monomer-monomer and monomer-dimer type chemical reactions on a two-dimensional surface. The authors use mean-field and lattice gas models, detailing similarities and differences due to correlations in the lattice gas model. The monomer-monomer, or AB surface reaction model, with no diffusion, is investigated for various reaction rates k. Study of the exact rate equations reveals that poisoning always occurs if the adsorption rates of the reactants are unequal. If the adsorption rates of the reactants are equal, simulations show slow poisoning, associated with clustering of reactants. This behavior is also shown for the two-dimensional voter model. The authors analyze precisely the slow poisoning kinetics by an analytic treatment for the AB reaction with infinitesimal reaction rate, and by direct comparison with the voter model. They extend the results to incorporate the effects of place-exchange diffusion, and they compare the AB reaction with infinitesimal reaction rate and no diffusion to the voter model with diffusion at rate 1/2. They also consider the relationship of the voter model to the monomer-dimer model, and investigate the latter model for small reaction rates. The monomer-dimer, or AB[sub 2] surface reaction model is also investigated. Specifically, they consider the ZGB-model for CO-oxidation, and in generalizations of this model which include adspecies diffusion. A theory of nucleation to describe properties of non-equilibrium first-order transitions, specifically the evolution between [open quote]reactive[close quote] steady states and trivial adsorbing states, is derived. The behavior of the [open quote]epidemic[close quote] survival probability, P[sub s], for a non-poisoned patch surrounded by a poisoned background is determined below the poisoning transition.

  11. Cycloaddition reactions of ICNO

    NASA Astrophysics Data System (ADS)

    Pasinszki, Tibor; Krebsz, Melinda; Hajgató, Balázs

    2009-05-01

    The mechanism and selectivity of cycloaddition reactions of iodonitrile oxide, ICNO, have been studied with theoretical methods for the first time using MR-AQCC coupled-cluster and B3LYP DFT methods. Calculations have predicted that the favoured ICNO dimerisation process is a multi-step reaction to diiodofuroxan involving dinitrosoethylene-like intermediates. The ICNO cycloaddition with nitriles and ethynyl derivatives is a synchronous process favouring the formation of 1,2,4-oxadiazole and 1,2-oxazole derivatives, respectively. The cycloaddition reactions of ICNO have been studied experimentally by generating ICNO from AgCNO and iodine. Diiodofuroxan is obtained, however, even at the presence of nitriles.

  12. NEUTRONIC REACTION SYSTEM

    DOEpatents

    Wigner, E.P.

    1963-09-01

    A nuclear reactor system is described for breeding fissionable material, including a heat-exchange tank, a high- and a low-pressure chamber therein, heat- exchange tubes connecting these chambers, a solution of U/sup 233/ in heavy water in a reaction container within the tank, a slurry of thorium dioxide in heavy water in a second container surrounding the first container, an inlet conduit including a pump connecting the low pressure chamber to the reaction container, an outlet conduit connecting the high pressure chamber to the reaction container, and means of removing gaseous fission products released in both chambers. (AEC)

  13. Response reactions: equilibrium coupling.

    PubMed

    Hoffmann, Eufrozina A; Nagypal, Istvan

    2006-06-01

    It is pointed out and illustrated in the present paper that if a homogeneous multiple equilibrium system containing k components and q species is composed of the reactants actually taken and their reactions contain only k + 1 species, then we have a unique representation with (q - k) stoichiometrically independent reactions (SIRs). We define these as coupling reactions. All the other possible combinations with k + 1 species are the coupled reactions that are in equilibrium when the (q - k) SIRs are in equilibrium. The response of the equilibrium state for perturbation is determined by the coupling and coupled equilibria. Depending on the circumstances and the actual thermodynamic data, the effect of coupled equilibria may overtake the effect of the coupling ones, leading to phenomena that are in apparent contradiction with Le Chatelier's principle.

  14. Untoward penicillin reactions

    PubMed Central

    Guthe, T.; Idsöe, O.; Willcox, R. R.

    1958-01-01

    The literature on untoward reactions following the administration of penicillin is reviewed. These reactions, including a certain number of deaths which have been reported, are of particular interest to health administrations and to WHO in view of the large-scale programmes for controlling the treponematoses which are now under way—programmes affecting millions of people in many parts of the world. The most serious problems are anaphylactic sensitivity phenomena and superinfection or cross-infection with penicillin-resistant organisms, and the reactions involved range in intensity from the mildest to the fatal; the incidence of the latter is estimated at 0.1-0.3 per million injections. The authors point out that with increasing use of penicillin, more persons are likely to become sensitized and the number of reactions can therefore be expected to rise. The best prevention against such an increase is the restriction of the unnecessary use of penicillin. PMID:13596877

  15. Translated chemical reaction networks.

    PubMed

    Johnston, Matthew D

    2014-05-01

    Many biochemical and industrial applications involve complicated networks of simultaneously occurring chemical reactions. Under the assumption of mass action kinetics, the dynamics of these chemical reaction networks are governed by systems of polynomial ordinary differential equations. The steady states of these mass action systems have been analyzed via a variety of techniques, including stoichiometric network analysis, deficiency theory, and algebraic techniques (e.g., Gröbner bases). In this paper, we present a novel method for characterizing the steady states of mass action systems. Our method explicitly links a network's capacity to permit a particular class of steady states, called toric steady states, to topological properties of a generalized network called a translated chemical reaction network. These networks share their reaction vectors with their source network but are permitted to have different complex stoichiometries and different network topologies. We apply the results to examples drawn from the biochemical literature.

  16. Iodine Clock Reaction.

    ERIC Educational Resources Information Center

    Mitchell, Richard S.

    1996-01-01

    Describes a combination of solutions that can be used in the study of kinetics using the iodine clock reaction. The combination slows down degradation of the prepared solutions and can be used successfully for several weeks. (JRH)

  17. Reactor for exothermic reactions

    DOEpatents

    Smith, L.A. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-03-02

    A liquid phase process is described for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  18. Reaction wheel assembly

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The fabrication and testing of three reaction wheels with associated drive and system monitoring electronics and brushless dc spin motors are discussed; the wheels are intended for use in a teleoperator simulator. Test results are included as graphs.

  19. Adverse reactions to sulfites

    PubMed Central

    Yang, William H.; Purchase, Emerson C.R.

    1985-01-01

    Sulfites are widely used as preservatives in the food and pharmaceutical industries. In the United States more than 250 cases of sulfite-related adverse reactions, including anaphylactic shock, asthmatic attacks, urticaria and angioedema, nausea, abdominal pain and diarrhea, seizures and death, have been reported, including 6 deaths allegedly associated with restaurant food containing sulfites. In Canada 10 sulfite-related adverse reactions have been documented, and 1 death suspected to be sulfite-related has occurred. The exact mechanism of sulfite-induced reactions is unknown. Practising physicians should be aware of the clinical manifestations of sulfite-related adverse reactions as well as which foods and pharmaceuticals contain sulfites. Cases should be reported to health officials and proper advice given to the victims to prevent further exposure to sulfites. The food industry, including beer and wine manufacturers, and the pharmaceutical industry should consider using alternative preservatives. In the interim, they should list any sulfites in their products. PMID:4052897

  20. Iodine Clock Reaction.

    ERIC Educational Resources Information Center

    Mitchell, Richard S.

    1996-01-01

    Describes a combination of solutions that can be used in the study of kinetics using the iodine clock reaction. The combination slows down degradation of the prepared solutions and can be used successfully for several weeks. (JRH)

  1. An Illuminating Reaction.

    ERIC Educational Resources Information Center

    Matthews, Catherine E.

    1996-01-01

    Describes the use of carbide lights as an excellent mechanism for introducing or reviewing many basic chemistry concepts including elements and compounds, endothermic and exothermic reactions, physical and chemical changes, and balancing chemical equations. (JRH)

  2. Skin Reactions to Cold

    PubMed Central

    Talpash, Orest

    1976-01-01

    Although skin reactions to cold are seen surprisingly infrequently in Canada, it is important to manage them correctly when they do occur. Frostbite, cold urticarias, Raynaud's disease and phenomenon, and several miscellaneous changes are discussed. PMID:21308019

  3. Chemisorption And Precipitation Reactions

    EPA Science Inventory

    The transport and bioavailability of chemical components within soils is, in part, controlled by partitioning between solids and solution. General terms used to describe these partitioning reactions include chemisorption and precipitation. Chemisorption is inclusive of the suit...

  4. An Illuminating Reaction.

    ERIC Educational Resources Information Center

    Matthews, Catherine E.

    1996-01-01

    Describes the use of carbide lights as an excellent mechanism for introducing or reviewing many basic chemistry concepts including elements and compounds, endothermic and exothermic reactions, physical and chemical changes, and balancing chemical equations. (JRH)

  5. Chemisorption And Precipitation Reactions

    EPA Science Inventory

    The transport and bioavailability of chemical components within soils is, in part, controlled by partitioning between solids and solution. General terms used to describe these partitioning reactions include chemisorption and precipitation. Chemisorption is inclusive of the suit...

  6. Reactor for exothermic reactions

    DOEpatents

    Smith, Jr., Lawrence A.; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  7. [Occurrence of drug reactions].

    PubMed

    Pastorello, E; Qualizza, R M; Luraghi, M T; Ispano, M; Villa, A M; Ortolani, C; Zanussi, C

    1986-01-01

    The aim of this prospective study was to evaluate the incidence of allergic reactions to drugs compared to other kinds of medical emergencies admitted to the main Hospital in Milan during a 6 months period. At the same time we drew a list of drugs most frequently involved in allergic reactions, and a list of the most frequent symptoms. Using special forms, the medical staff collected patients' data: age, history of atopy, identification of the drug causing the reaction, and any previous reactions. Among 11,407 cases of medical emergencies, we found 163 (1.43%) patients showing drug reactions: the mean age was 27.3; 58.90% were female; atopy was present in 16.56%. The drugs most frequently involved were: pyrazon group (22%); ASA (20.86%); penicillin and derivatives (9.20%); sulfa drugs (6.14%); group B vitamins (4.30%); tetanus toxoid (4.30%); hyposensitizing extracts (3.68%); propionic acid derivatives (2.46%); paracetamol (1.84%); indomethacin (1.23%); rifampicin (1.23%); erythromycin (1.23%); glafenine (1.23%); others (17.80%). Urticaria and/or angioedema were the most frequent symptoms (86.51%), then anaphylactic shock (9.81%) and asthma (3.68%) with regard to anaphylactic shock only 6.20% of the patients had had a previous reaction to the same drug. From these data we can see that the incidence of drug reactions is very low compared to other medical emergencies; penicillin evidenced fewer reactions than expected, while the pyrazon group and ASA confirmed the data from literature.

  8. Anaphylactoid reaction to ethanol.

    PubMed

    Kelso, J M; Keating, M U; Squillace, D L; O'Connell, E J; Yunginger, J W; Sachs, M I

    1990-05-01

    We studied a 14-year-old boy who developed a pruritic rash and facial swelling after ingestion of beer or wine. A blinded challenge with purified ethanol was positive demonstrating ethanol itself to be the offending agent. An IgE-mediated reaction to ethanol or one of its metabolites as a hapten is possible, or the reaction may involve unusual metabolism of ethanol with accumulation of acetaldehyde and/or direct mast cell degranulation.

  9. Oxygen evolution reaction catalysis

    DOEpatents

    Haber, Joel A.; Jin, Jian; Xiang, Chengxiang; Gregoire, John M.; Jones, Ryan J.; Guevarra, Dan W.; Shinde, Aniketa A.

    2016-09-06

    An Oxygen Evolution Reaction (OER) catalyst includes a metal oxide that includes oxygen, cerium, and one or more second metals. In some instances, the cerium is 10 to 80 molar % of the metals in the metal oxide and/or the catalyst includes two or more second metals. The OER catalyst can be included in or on an electrode. The electrode can be arranged in an oxygen evolution system such that the Oxygen Evolution Reaction occurs at the electrode.

  10. [Cutaneous adverse drug reactions].

    PubMed

    Lebrun-Vignes, B; Valeyrie-Allanore, L

    2015-04-01

    Cutaneous adverse drug reactions (CADR) represent a heterogeneous field including various clinical patterns without specific features suggesting drug causality. Exanthematous eruptions, urticaria and vasculitis are the most common forms of CADR. Fixed eruption is uncommon in western countries. Serious reactions (fatal outcome, sequelae) represent 2% of CADR: bullous reactions (Stevens-Johnson syndrome, toxic epidermal necrolysis), DRESS (drug reaction with eosinophilia and systemic symptoms or drug-induced hypersensitivity syndrome) and acute generalized exanthematous pustulosis (AGEP). These forms must be quickly diagnosed to guide their management. The main risk factors are immunosuppression, autoimmunity and some HLA alleles in bullous reactions and DRESS. Most systemic drugs may induce cutaneous adverse reactions, especially antibiotics, anticonvulsivants, antineoplastic drugs, non-steroidal anti-inflammatory drugs, allopurinol and contrast media. Pathogenesis includes immediate or delayed immunologic mechanism, usually not related to dose, and pharmacologic/toxic mechanism, commonly dose-dependent or time-dependent. In case of immunologic mechanism, allergologic exploration is possible to clarify drug causality, with a variable sensitivity according to the drug and to the CADR type. It includes epicutaneous patch testing, prick test and intradermal test. However, no in vivo or in vitro test can confirm the drug causality. To determine the cause of the eruption, a logical approach based on clinical characteristics, chronologic factors and elimination of differential diagnosis is required, completed with a literature search. A reporting to pharmacovigilance network is essential in case of a serious CADR whatever the suspected drug and in any case if the involved drug is a newly marketed one or unusually related to cutaneous reactions.

  11. Reaction/Momentum Wheel

    NASA Technical Reports Server (NTRS)

    1997-01-01

    CTA Space Systems, Inc. has been licensed to sell commercially a reaction/momentum wheel originally developed for NASA's scientific satellites. NASA originally identified a need for the wheel in its Small Explorer program. The Submillimeter Wave Astronomy Satellite required extremely low jitter and a reaction/momentum wheel with a torque greater than any comparably sized commercially available wheel to keep the instrument pointed at celestial objects to a high degree of precision. After development, a market assessment by Research Triangle Institute was completed, showing commercial potential for the flywheel technology. A license was granted to CTA in the fall of 1996. The company currently uses the technology in its complete spacecraft fabrication services and has built over 10 reaction/momentum wheels for commercial, scientific, and military customers.

  12. Hipersensitivity Reactions to Corticosteroids.

    PubMed

    Berbegal, L; DeLeon, F J; Silvestre, J F

    2016-03-01

    Corticosteroids are widely used drugs in the clinical practice, especially by topic application in dermatology. These substances may act as allergens and produce immediate and delayed hypersensitivity reactions. Allergic contact dermatitis is the most frequent presentation of corticosteroid allergy and it should be studied by patch testing in specific units. The corticosteroids included in the Spanish standard battery are good markers but not ideal. Therefore, if those makers are positive, it is useful to apply a specific battery of corticosteroids and the drugs provided by patients. Immediate reactions are relatively rare but potentially severe, and it is important to confirm the sensitization profile and to guide the use of alternative corticosteroids, because they are often necessary in several diseases. In this article we review the main concepts regarding these two types of hypersensitivity reactions in corticosteroid allergy, as well as their approach in the clinical practice. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.

  13. Velocity pump reaction turbine

    DOEpatents

    House, Palmer A.

    1984-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  14. Velocity pump reaction turbine

    DOEpatents

    House, Palmer A.

    1982-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  15. Velocity pump reaction turbine

    DOEpatents

    House, P.A.

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  16. Velocity pump reaction turbine

    SciTech Connect

    House, P.A.

    1984-02-07

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  17. Velocity pump reaction turbine

    SciTech Connect

    House, P.A.

    1982-06-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an interrotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal application

  18. Exocharmic Reactions up Close

    ERIC Educational Resources Information Center

    Ramette, R. W.

    2007-01-01

    The exocharmic reactions that can be observed microscopically are discussed. The students can discover the optimal concentration of an acidic lead nitrate solution, so that a crystal of potassium iodide, nudged to the edge of a drop, results in glinting golden hexagons of lead iodide.

  19. Three Reaction Papers.

    ERIC Educational Resources Information Center

    Coop, Richard H.; And Others

    1982-01-01

    In reaction papers, Richard H. Coop, an educational psychologist, discusses six themes evident in papers on gifted education; B. J. Cox argues that systems theory is a valuable addition to education of identified and potentially gifted students; and Gary D. Fenstermacher argues for specification of educational entitlements of any learner before…

  20. Reaction product imaging

    SciTech Connect

    Chandler, D.W.

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  1. Exocharmic Reactions up Close

    ERIC Educational Resources Information Center

    Ramette, R. W.

    2007-01-01

    The exocharmic reactions that can be observed microscopically are discussed. The students can discover the optimal concentration of an acidic lead nitrate solution, so that a crystal of potassium iodide, nudged to the edge of a drop, results in glinting golden hexagons of lead iodide.

  2. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  3. A Superintendent's Reaction

    ERIC Educational Resources Information Center

    Lytle, James H.

    2004-01-01

    This article presents a superintendent's reaction to Catherine Marshall and Michael Ward's article on research on social justice and training for leadership. The author states that there is a problem with Marshall and Ward's article which begins with the title, particularly with the word "training." The author contends that there is a significant…

  4. The aromatic ene reaction

    NASA Astrophysics Data System (ADS)

    Niu, Dawen; Hoye, Thomas R.

    2014-01-01

    The ene reaction is a pericyclic process in which an alkene with an allylic hydrogen atom (the ene donor) reacts with a second unsaturated species (the enophile) to form a new product with a transposed π-bond. The aromatic ene reaction, in which the alkene component is embedded in an aromatic ring, has only been reported in a few (four) instances and has proceeded in low yield (≤6%). Here, we show efficient aromatic ene reactions in which a thermally generated aryne intermediate engages a pendant m-alkylarene substituent to produce a dearomatized isotoluene, itself another versatile but rare reactive intermediate. Our experiments were guided by computational studies that revealed structural features conducive to the aromatic ene process. We proceeded to identify a cascade comprising three reactions: (1) hexadehydro-Diels-Alder (for aryne generation), (2) intramolecular aromatic ene and (3) bimolecular Alder ene. The power of this cascade is evident from the structural complexity of the final products, the considerable scope, and the overall efficiency of these multistage, reagent- and by-product-free, single-pot transformations.

  5. Chemical Reactions at Surfaces

    SciTech Connect

    Michael Henderson and Nancy Ryan Gray

    2010-04-14

    Chemical reactions at surfaces underlie some of the most important processes of today, including catalysis, energy conversion, microelectronics, human health and the environment. Understanding surface chemical reactions at a fundamental level is at the core of the field of surface science. The Gordon Research Conference on Chemical Reactions at Surfaces is one of the premiere meetings in the field. The program this year will cover a broad range of topics, including heterogeneous catalysis and surface chemistry, surfaces in environmental chemistry and energy conversion, reactions at the liquid-solid and liquid-gas interface, electronic materials growth and surface modification, biological interfaces, and electrons and photons at surfaces. An exciting program is planned, with contributions from outstanding speakers and discussion leaders from the international scientific community. The conference provides a dynamic environment with ample time for discussion and interaction. Attendees are encouraged to present posters; the poster sessions are historically well attended and stimulate additional discussions. The conference provides an excellent opportunity for junior researchers (e.g. graduate students or postdocs) to present their work and interact with established leaders in the field.

  6. Online Access: User Reaction.

    ERIC Educational Resources Information Center

    Pawley, Carolyn

    1982-01-01

    Surveys reactions of students and faculty to the online circulation system at University of Guelph Library, Ontario. Findings concerning status of users, frequency of use, effectiveness of instructions on screen, convenience of terminal locations, type of information required by user, and general comments are noted. Four references are provided.…

  7. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  8. Introducing the Wittig Reaction.

    ERIC Educational Resources Information Center

    Armstead, D. E. F.

    1979-01-01

    An experiment is described which provides a simple example of the application of the Wittig reaction to the synthesis of unsaturated compounds. The experiment was designed with British HNC chemistry students in mind, but it is also suitable as a project-type exercise for final year GCE A-level students. (Author/BB)

  9. Enantioselective Vinylogous Organocascade Reactions.

    PubMed

    Hepburn, Hamish B; Dell'Amico, Luca; Melchiorre, Paolo

    2016-08-01

    Cascade reactions are powerful tools for rapidly assembling complex molecular architectures from readily available starting materials in a single synthetic operation. Their marriage with asymmetric organocatalysis has led to the development of novel techniques, which are now recognized as reliable strategies for the one-pot enantioselective synthesis of stereochemically dense molecules. In recent years, even more complex synthetic challenges have been addressed by applying the principle of vinylogy to the realm of organocascade catalysis. The key to the success of vinylogous organocascade reactions is the unique ability of the chiral organocatalyst to transfer reactivity to a distal position without losing control on the stereo-determining events. This approach has greatly expanded the synthetic horizons of the field by providing the possibility of forging multiple stereocenters in remote positions from the catalyst's point of action with high selectivity, while simultaneously constructing multiple new bonds. This article critically describes the developments achieved in the field of enantioselective vinylogous organocascade reactions, charting the ideas, the conceptual advances, and the milestone reactions that have been essential for reaching highly practical levels of synthetic efficiency.

  10. Confronting Combat Stress Reactions

    DTIC Science & Technology

    2010-03-22

    of the scalp, skull , or brain. 4 Combat stress reaction is categorized as a range of behaviors resulting from the stress of battle which decreases...3) experiencing rage aimed at discriminate and indiscriminate targets, (4) psychic numbing or emotional shutdown, (5) alienation from themselves and

  11. Lithium Cell Reactions.

    DTIC Science & Technology

    1985-02-01

    Page 1. INVESTIGATION OF CHEMICAL, ELECTROCHEMICAL AND PARASITIC REACTIONS IN LITHIUM - THIONYL CHLORIDE CELLS ....... ................. 1 1.1 INTRODUCTION...OF LITHIUM - THIONYL CHLORIDE CELLS. ................ 56 1.4.1 Carbon Limited Overdischarge...............56 1.4.1.1 Background... LITHIUM THIONYL - CHLORIDE CELLS. .. ............ ...... 101 1.5.1 Background. ....... ............ .... 101 1.5.2 Microphotography

  12. Bad Reaction to Cosmetics?

    MedlinePlus

    ... Home For Consumers Consumer Updates Bad Reaction to Cosmetics? Tell FDA Share Tweet Linkedin Pin it More ... M.D., director of the agency’s Office of Cosmetics and Colors. “So, consumers are one of FDA’s ...

  13. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  14. QUICK REACTION STUDIES.

    DTIC Science & Technology

    The functional requirements of mission planning of space missions are documented. A discussion of the current applicable computer programs to some part of the mission planning process is included. In particular the Mission Analysis and Trajectory Simulation (MATS) system is described. The applicability of current programs to the demands of mission planning in a Quick Reaction

  15. The aromatic ene reaction

    PubMed Central

    Niu, Dawen; Hoye, Thomas R.

    2014-01-01

    The ene reaction is a pericyclic process in which an alkene having an allylic hydrogen atom (the ene donor) reacts with a second unsaturated species (the enophile) to form a new product with a transposed π-bond. The aromatic ene reaction, in which the alkene component is embedded in an aromatic ring, has only been reported in a few (four) instances and has proceeded in low yield (≤6%). Here we show efficient aromatic ene reactions in which a thermally generated aryne engages a pendant m-alkylarene substituent to produce a dearomatized isotoluene, itself another versatile but rare reactive intermediate. Our experiments were guided by computational studies that revealed structural features conducive to the aromatic ene process. We proceeded to identify a cascade comprising three reactions: (i) hexadehydro-Diels-Alder (for aryne generation), (ii) intramolecular aromatic ene, and (iii) bimolecular Alder ene. The power of this cascade is evident from the structural complexity of the final products, the considerable scope, and the overall efficiency of these multi-stage, reagent- and byproduct-free, single-pot transformations. PMID:24345944

  16. Azlactone Reaction Developments.

    PubMed

    de Castro, Pedro P; Carpanez, Arthur G; Amarante, Giovanni W

    2016-07-18

    Azlactones (also known as oxazolones) are heterocycles usually employed in the stereoselective synthesis of α,α-amino acids, heterocycles and natural products. The versatility of the azlactone scaffold arises from the numerous reactive sites, allowing its application in a diversity of transformations. This review aims to cover classical and recent applications of oxazolones, especially those involving stereoselective processes. After a short introduction on their structures and intrinsic reactivities, dynamic kinetic resolution (DKR) processes as well as reactions involving stereoselective formation of a new σ C-C bond, such as alkylation/allylation/arylation, aldol, ene, Michael and Mannich reactions will be exposed. Additionally, cycloadditions, Steglich rearrangement and sulfenylation reactions will also be discussed. Recent developments of the well-known Erlenmeyer azlactones will be described. For the most examples, the proposed mechanism, activation modes and/or key reaction intermediates will be exposed to rationalize both the final product and the observed stereochemistry. Finally, this review gives an overview of the synthetic utility of oxazolones. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Reaction Formulation: A Bibliography.

    ERIC Educational Resources Information Center

    Pedrini, D. T.; Pedrini, Bonnie C.

    Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

  18. Photoneutron reactions in astrophysics

    SciTech Connect

    Varlamov, V. V. Ishkhanov, B. S.; Orlin, V. N.; Peskov, N. N.; Stopani, K. A.

    2014-12-15

    Among key problems in nuclear astrophysics, that of obtaining deeper insight into the mechanism of synthesis of chemical elements is of paramount importance. The majority of heavy elements existing in nature are produced in stars via radiative neutron capture in so-called s- and r processes, which are, respectively, slow and fast, in relation to competing β{sup −}-decay processes. At the same time, we know 35 neutron-deficient so-called bypassed p-nuclei that lie between {sup 74}Se and {sup 196}Hg and which cannot originate from the aforementioned s- and r-processes. Their production is possible in (γ, n), (γ, p), or (γ, α) photonuclear reactions. In view of this, data on photoneutron reactions play an important role in predicting and describing processes leading to the production of p-nuclei. Interest in determining cross sections for photoneutron reactions in the threshold energy region, which is of particular importance for astrophysics, has grown substantially in recent years. The use of modern sources of quasimonoenergetic photons obtained in processes of inverse Compton laser-radiation scattering on relativistic electronsmakes it possible to reveal rather interesting special features of respective cross sections, manifestations of pygmy E1 and M1 resonances, or the production of nuclei in isomeric states, on one hand, and to revisit the problem of systematic discrepancies between data on reaction cross sections from experiments of different types, on the other hand. Data obtained on the basis of our new experimental-theoretical approach to evaluating cross sections for partial photoneutron reactions are invoked in considering these problems.

  19. Inorganic Reaction Mechanisms. Part I

    ERIC Educational Resources Information Center

    Cooke, D. O.

    1976-01-01

    Provides a collection of data on the mechanistic aspects of inorganic chemical reactions. Wherever possible includes procedures for classroom demonstration or student project work. The material covered includes gas phase reactions, reactions in solution, mechanisms of electron transfer, the reaction between iron III and iodine, and hydrolysis. (GS)

  20. Inorganic Reaction Mechanisms. Part I

    ERIC Educational Resources Information Center

    Cooke, D. O.

    1976-01-01

    Provides a collection of data on the mechanistic aspects of inorganic chemical reactions. Wherever possible includes procedures for classroom demonstration or student project work. The material covered includes gas phase reactions, reactions in solution, mechanisms of electron transfer, the reaction between iron III and iodine, and hydrolysis. (GS)

  1. What Is a Reaction Rate?

    ERIC Educational Resources Information Center

    Schmitz, Guy

    2005-01-01

    The definition of reaction rate is derived and demonstrations are made for the care to be taken while using the term. Reaction rate can be in terms of a reaction property, the extent of reaction and thus it is possible to give a definition applicable in open and closed systems.

  2. Concordant Chemical Reaction Networks

    PubMed Central

    Shinar, Guy; Feinberg, Martin

    2015-01-01

    We describe a large class of chemical reaction networks, those endowed with a subtle structural property called concordance. We show that the class of concordant networks coincides precisely with the class of networks which, when taken with any weakly monotonic kinetics, invariably give rise to kinetic systems that are injective — a quality that, among other things, precludes the possibility of switch-like transitions between distinct positive steady states. We also provide persistence characteristics of concordant networks, instability implications of discordance, and consequences of stronger variants of concordance. Some of our results are in the spirit of recent ones by Banaji and Craciun, but here we do not require that every species suffer a degradation reaction. This is especially important in studying biochemical networks, for which it is rare to have all species degrade. PMID:22659063

  3. Hypersensitivity reactions to fluoroquinolones.

    PubMed

    Scherer, Kathrin; Bircher, Andreas J

    2005-01-01

    Fluoroquinolone antibiotics cause immediate and delayed hypersensitivity reactions, and may also affect internal organs and circulating blood cells. The underlying pathomechanisms are only partly understood. The extent of cross-reactivity among different quinolones depends on the type of clinical manifestation and its underlying mechanism. Despite recent advances, reliable diagnostic tests are still lacking. Recent studies have shown quinolone-specific IgE in vitro in more than 50% of patients with immediate-type reactions and a considerable cross-reactivity with related compounds. In maculopapular drug exanthems from ciprofloxacin, specific T-cell clones were identified, and cross-reactivity to related compounds was detected in approximately 50% of the clones. From re-exposure studies in patients with exanthems, cross-reactivity appears to be lower. Cellular tests such as lymphocyte transformation tests are currently not very useful. For prick and intradermal skin tests, widely divergent nonirritant test concentrations have been recommended. Desensitization may be possible in selected patients.

  4. Magnetically suspended reaction wheels

    NASA Technical Reports Server (NTRS)

    Sabnis, A. V.; Stocking, G. L.; Dendy, J. B.

    1975-01-01

    Magnetic suspensions offer several advantages over conventional bearings, arising because of the contactless nature of the load support. In application to spacecraft reaction wheels, the advantages are low drag torque, wearfree, unlubricated, vacuum-compatible operation, and unlimited life. By the provision of redundancy in the control electronics, single-point failures are eliminated. The rational for selection of a passive radial, active axial, dc magnetic suspension is presented, and the relative merits of 3-loop and single-loop magnetic suspensions are discussed. The design of a .678 N-m-sec (.5 ft-lb-sec) reaction wheel using the single loop magnetic suspension was developed; the design compares favorably with current ball bearing wheels in terms of weight and power.

  5. Aluminum cluster reactions

    SciTech Connect

    Leuchtner, R.E.; Harms, A.C.; Castleman, A.W. Jr. )

    1991-01-15

    Aluminum clusters, both anion and cation, are produced using laser vaporization and reacted under thermal conditions with oxygen in a flow tube reactor. An etching reaction is observed and bimolecular rate constants are reported for Al{sup +}{sub {ital n}}, {ital n}=1--33, and Al{sup {minus}}{sub {ital n}}, {ital n}=5--37. For certain clusters, namely Al{sup +}{sub 7}, Al{sup {minus}}{sub 13}, and Al{sup {minus}}{sub 23}, no apparent reactivity is observed (they are found to be produced from larger species). Interestingly, these correspond to predicted jellium shell closings with 20, 40, and 70 electrons, respectively. Besides these exceptions, and a small odd/even alternation in reaction rates, the overall reactivity is relatively insensitive to cluster size, and is found to range between about 1 {times} 10{sup {minus}12} and 5 {times} 10{sup {minus}12} cm{sup 3}/s.

  6. Reactions to dietary tartrazine.

    PubMed Central

    David, T J

    1987-01-01

    Double blind challenges with tartrazine and benzoic acid were performed in hospital in 24 children whose parents gave a definite history of a purely behavioural immediate adverse reaction to one of these substances. The patients, whose ages ranged from 1.6 to 12.4 years, were on a diet that avoided these items, and in all there was a clear history that any lapse of the diet caused an obvious adverse behavioural reaction within two hours. In no patient was any change in behaviour noted either by the parents or the nursing staff after the administration of placebo or active substances. Twenty two patients returned to a normal diet without problems, but the parents of two children insisted on continuing the diet. While popular belief has it that additives may have harmful behavioural effects, objective verification is required to prevent overdiagnosis. PMID:3548601

  7. Reaction chemistry of cerium

    SciTech Connect

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  8. Electron transfer reactions

    NASA Astrophysics Data System (ADS)

    Marcus, R. A.

    1989-07-01

    During the tenure of this contract research was performed on a number of aspects of electron transfer reactions (solvent dynamics including vibrational effects, non-Debye solvent dynamics, early steps in bacterial photosynthesis) and of the use of artificial intelligence searching methods, the latter, in part, as a prelude to our current study of electron transfer reactions in structurally complicated systems such as proteins. Seven Technical Reports were issued during this period, and research on several topics was initiated: the study of the relation between charge transfer absorption and fluorescence spectra and the inverted region, a nonadiabatic/adiabatic coherent mechanism for electron transfers, and electron transfers between two immiscible-liquid phases and between a semiconductor and an electrolyte.

  9. Photochemical reaction dynamics

    SciTech Connect

    Moore, B.C.

    1993-12-01

    The purpose of the program is to develop a fundamental understanding of unimolecular and bimolecular reaction dynamics with application in combustion and energy systems. The energy dependence in ketene isomerization, ketene dissociation dynamics, and carbonyl substitution on organometallic rhodium complexes in liquid xenon have been studied. Future studies concerning unimolecular processes in ketene as well as energy transfer and kinetic studies of methylene radicals are discussed.

  10. Adverse drug reactions.

    PubMed

    O'Reilly-Foley, Georgina

    2017-04-05

    What was the nature of the CPD activity, practice-related feedback and/or event and/or experience in your practice? The CPD article defined the different types of adverse drug reactions (ADRs) and explored when they can occur. It emphasised the importance of being knowledgeable about medications, considering patient safety when patients are taking medications, being alert to the possibility of ADRs, and recognising and responding to suspected ADRs.

  11. Chemical Reactions in Clusters

    DTIC Science & Technology

    1992-11-04

    NH 3)n, n _> 4, clusters has been attributed to the (solvated) naphtholate anion.3a A single picosecond decay measurement has been reported which...vibrational energy in the cluster Sl state. The data are summarized in Table I. A model to explain these decay results can be constructed based on a proton...11 TITLE (Include Security Classification) Chemical Reactions in Clusters 12 PERSONAL AUTHOR(S) Elliot R. Bernstein 13a TYPE OF REPORT 13b TIME COVERED

  12. Chemical Reactions in DSMC

    NASA Astrophysics Data System (ADS)

    Bird, G. A.

    2011-05-01

    DSMC simulations of chemically reacting gas flows have generally employed procedures that convert the macroscopic chemical rate equations to reaction cross-sections at the microscopic level. They therefore depend on the availability of experimental data that has been fitted to equations of the Arrhenius form. This paper presents a physical model for dissociation and recombination reactions and a phenomenological model for exchange and chain reactions. These are based on the vibrational states of the colliding molecules and do not require any experimentally-based data. The simplicity of the models allows the corresponding rate equations to be written down and, while these are not required for the implementation of the models, they facilitate their validation. The model is applied to a typical hypersonic atmospheric entry problem and the results are compared with the corresponding results from the traditional method. It is also used to investigate both spontaneous and forced ignition as well as the structure of a deflagration wave in an oxygen-hydrogen mixture.

  13. Chemical Reactions in DSMC

    SciTech Connect

    Bird, G. A.

    2011-05-20

    DSMC simulations of chemically reacting gas flows have generally employed procedures that convert the macroscopic chemical rate equations to reaction cross-sections at the microscopic level. They therefore depend on the availability of experimental data that has been fitted to equations of the Arrhenius form. This paper presents a physical model for dissociation and recombination reactions and a phenomenological model for exchange and chain reactions. These are based on the vibrational states of the colliding molecules and do not require any experimentally-based data. The simplicity of the models allows the corresponding rate equations to be written down and, while these are not required for the implementation of the models, they facilitate their validation. The model is applied to a typical hypersonic atmospheric entry problem and the results are compared with the corresponding results from the traditional method. It is also used to investigate both spontaneous and forced ignition as well as the structure of a deflagration wave in an oxygen-hydrogen mixture.

  14. [Skin reactions to bradykinin].

    PubMed

    Rihoux, J P; Ramboer, I; Fadel, R

    1995-10-01

    A large series of experiments carried out in animals and humans suggest that histamine release is not involved in the leakage phenomenon induced by bradykinin (BK) challenge. These experiments comprise in vitro studies on skin and bronchial human mast cells and in vivo studies on guinea pig airways and human skin using mepyramine, chlorpheniramine and terfenadine as reference H1-anti-histamines. Nevertheless, it has been shown recently that the H1 antagonist cetirizine 10 mg p.o. markedly inhibits skin reactions induced by BK challenge (intradermal injection of 212 micrograms BK in 10 microL saline and prick test with a solution of 21.2 micrograms/microL). In a guinea pig model, this drug also inhibited the bronchospasm induced by increasing concentrations of BK given by iv route (0.25 to 2 micrograms/Kg) and aerosol (3 to 300 micrograms/Kg). This inhibition was similar to the one obtained with the specific BK antagonist HOE 140 (15 pM/Kg). New data in the literature suggest the existence of various pharmacological mediators possibly involved in the BK-induced reaction: neuromediators, nitric oxyde and PAF. They also suggest that this reaction presents itself as a well defined sequence of pharmacological events. Since we could show that there is no binding of cetirizine to a human recombinant B2 receptor in vitro, some hypotheses are raised in order to explain this unexpected inhibiting effect of cetirizine.

  15. Adverse cutaneous drug reaction.

    PubMed

    Nayak, Surajit; Acharjya, Basanti

    2008-01-01

    In everyday clinical practice, almost all physicians come across many instances of suspected adverse cutaneous drug reactions (ACDR) in different forms. Although such cutaneous reactions are common, comprehensive information regarding their incidence, severity and ultimate health effects are often not available as many cases go unreported. It is also a fact that in the present world, almost everyday a new drug enters market; therefore, a chance of a new drug reaction manifesting somewhere in some form in any corner of world is unknown or unreported. Although many a times, presentation is too trivial and benign, the early identification of the condition and identifying the culprit drug and omit it at earliest holds the keystone in management and prevention of a more severe drug rash. Therefore, not only the dermatologists, but all practicing physicians should be familiar with these conditions to diagnose them early and to be prepared to handle them adequately. However, we all know it is most challenging and practically difficult when patient is on multiple medicines because of myriad clinical symptoms, poorly understood multiple mechanisms of drug-host interaction, relative paucity of laboratory testing that is available for any definitive and confirmatory drug-specific testing. Therefore, in practice, the diagnosis of ACDR is purely based on clinical judgment. In this discussion, we will be primarily focusing on pathomechanism and approach to reach a diagnosis, which is the vital pillar to manage any case of ACDR.

  16. Polyneutron Chain Reactions

    SciTech Connect

    John C. Fisher

    2000-11-12

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of {approx}60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N{>=}12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between {sup 16}O and {sup A}Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound {sup 16}O {sup A}Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the {sup 16}O and {sup A}Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of {sup A}Nt is prevented by the buildup of Coulomb energy associated with transforming {sup A}Nt into {sup A}H in close proximity to {sup 16}O. Thus, it is possible that {sup 16}O {sup A}Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the {sup A}Nt component can

  17. Well sealing via thermite reactions

    SciTech Connect

    Lowry, William Edward; Dunn, Sandra Dalvit

    2016-11-15

    A platform is formed in a well below a target plug zone by lowering a thermite reaction charge into the well and igniting it, whereby the products of the reaction are allowed to cool and expand to form a platform or support in the well. A main thermite reaction charge is placed above the platform and ignited to form a main sealing plug for the well. In some embodiments an upper plug is formed by igniting an upper thermite reaction charge above the main thermite reaction charge. The upper plug confines the products of ignition of the main thermite reaction charge.

  18. Reaction Extrema: Extent of Reaction in General Chemistry

    ERIC Educational Resources Information Center

    Vandezande, Jonathon E.; Vander Griend, Douglas A.; DeKock, Roger L.

    2013-01-01

    Nearly 100 years ago de Donder introduced the term "extent of reaction", ?. We build on that work by defining the concept of reagent extrema for an arbitrary chemical reaction, aA + bB [reversible reaction] yY + zZ. The central equation is ?^[subscript i] = -n[subscript i,0]/?[subscript i]. The symbol ?^[subscript i] represents the…

  19. Reaction Extrema: Extent of Reaction in General Chemistry

    ERIC Educational Resources Information Center

    Vandezande, Jonathon E.; Vander Griend, Douglas A.; DeKock, Roger L.

    2013-01-01

    Nearly 100 years ago de Donder introduced the term "extent of reaction", ?. We build on that work by defining the concept of reagent extrema for an arbitrary chemical reaction, aA + bB [reversible reaction] yY + zZ. The central equation is ?^[subscript i] = -n[subscript i,0]/?[subscript i]. The symbol ?^[subscript i] represents the…

  20. Procedures for Decomposing a Redox Reaction into Half-Reaction

    ERIC Educational Resources Information Center

    Fishtik, Ilie; Berka, Ladislav H.

    2005-01-01

    A simple algorithm for a complete enumeration of the possible ways a redox reaction (RR) might be uniquely decomposed into half-reactions (HRs) using the response reactions (RERs) formalism is presented. A complete enumeration of the possible ways a RR may be decomposed into HRs is equivalent to a complete enumeration of stoichiometrically…

  1. Insect bite reactions.

    PubMed

    Singh, Sanjay; Mann, Baldeep Kaur

    2013-01-01

    Insects are a class of living creatures within the arthropods. Insect bite reactions are commonly seen in clinical practice. The present review touches upon the medically important insects and their places in the classification, the sparse literature on the epidemiology of insect bites in India, and different variables influencing the susceptibility of an individual to insect bites. Clinical features of mosquito bites, hypersensitivity to mosquito bites Epstein-Barr virus NK (HMB-EBV-NK) disease, eruptive pseudoangiomatosis, Skeeter syndrome, papular pruritic eruption of HIV/AIDS, and clinical features produced by bed bugs, Mexican chicken bugs, assassin bugs, kissing bugs, fleas, black flies, Blandford flies, louse flies, tsetse flies, midges, and thrips are discussed. Brief account is presented of the immunogenic components of mosquito and bed bug saliva. Papular urticaria is discussed including its epidemiology, the 5 stages of skin reaction, the SCRATCH principle as an aid in diagnosis, and the recent evidence supporting participation of types I, III, and IV hypersensitivity reactions in its causation is summarized. Recent developments in the treatment of pediculosis capitis including spinosad 0.9% suspension, benzyl alcohol 5% lotion, dimethicone 4% lotion, isopropyl myristate 50% rinse, and other suffocants are discussed within the context of evidence derived from randomized controlled trials and key findings of a recent systematic review. We also touch upon a non-chemical treatment of head lice and the ineffectiveness of egg-loosening products. Knockdown resistance (kdr) as the genetic mechanism making the lice nerves insensitive to permethrin is discussed along with the surprising contrary clinical evidence from Europe about efficacy of permethrin in children with head lice carrying kdr-like gene. The review also presents a brief account of insects as vectors of diseases and ends with discussion of prevention of insect bites and some serious adverse effects

  2. Copper mediated carbometalation reactions.

    PubMed

    Müller, D S; Marek, I

    2016-08-08

    Since the first discovery of carbocupration of alkynes in the 1970s a tremendous amount of research has been carried out in this field. The exceptionally high selectivities obtained attribute to the great synthetic value of carbocupration reactions. This tutorial review will present the most important features of carbocupration of alkynes and highlight the most relevant reviews. Then a comprehensive review of copper mediated carbometalation of cyclopropenes will follow. The latter method has received much attention over the last decade as it allows the highly selective construction of poly-substituted cyclopropanes which can be transformed into acyclic derivatives bearing one or multiple tertiary or quaternary carbon stereocenters.

  3. Reactions of Negative Ions

    DTIC Science & Technology

    1984-07-17

    AUTHOR(S)* Viggiano , Albert A., Paulson, John F. C 6 UPE E T R O A IOE 18ate SUBo EC TERMS enti t e "Swrme f Ionsar and Efyb l to n in Gases, FIELD...Reactions of Negative Ions Albert A. Viggiano * and John F. Paulson Air Force Geophysics Laboratory Hanscom AFB, Massachusetts 017310 *Air Force Geophysics...an important process in controlling the electron density in a variety of natural plasmas , such as the earth’s ionosphere and interstellar space, and

  4. Hydrogen forming reaction process

    SciTech Connect

    Marianowski, L.G.; Fleming, D.K.

    1989-03-07

    A hydrogen forming process is described, comprising: conducting in a hydrogen production zone a chemical reaction forming mixed gases comprising molecular hydrogen; contacting one side of a hydrogen ion porous and molecular gas nonporous metallic foil with the mixed gases in the hydrogen production zone; dissociating the molecular hydrogen to ionic hydrogen on the one side of the metallic foil; passing the ionic hydrogen through the metallic foil to its other side; and withdrawing hydrogen from the other side of the metallic foil, thereby removing hydrogen from the hydrogen production zone.

  5. Gravitational Radiation Reaction

    NASA Astrophysics Data System (ADS)

    Tanaka, T.

    We give a short personally-biased review on the recent progress in our understanding of gravitational radiation reaction acting on a point particle orbiting a black hole. The main motivation of this study is to obtain sufficiently precise gravitational waveforms from inspiraling binary compact stars with a large mass ratio. For this purpose, various new concepts and techniques have been developed to compute the orbital evolution taking into account the gravitational self-force. Combining these ideas with a few supplementary new ideas, we try to outline a path to our goal here.

  6. The polymerase chain reaction.

    PubMed

    Welch, Hazel M

    2012-01-01

    The polymerase chain reaction (PCR) has had a significant impact on all aspects of the molecular biosciences, from cancer research to forensic science. The sensitivity and specificity inherent in the technique allow minute quantities of genetic material to be detected while the unique properties of thermostable DNA polymerase ensure that abundant copies are reliably reproduced to levels that can be visualized and/or used for further applications. This chapter describes applications of PCR and PCR-RT to investigate primary cancer and metastatic disease at both the DNA and mRNA expression levels.

  7. Demonstration of the Fenton Reaction

    ERIC Educational Resources Information Center

    Luehrs, Dean C.; Roher, Alex E.

    2007-01-01

    The study demonstrates the Fenton reaction, which is carried out using the Fenton reagent that is used for groundwater and soil remediation. The Fenton reaction can be implicated in DNA damage, Alzheimer's disease, cardiovascular disease and ageing in general.

  8. Hydrazine decomposition and other reactions

    NASA Technical Reports Server (NTRS)

    Armstrong, Warren E. (Inventor); La France, Donald S. (Inventor); Voge, Hervey H. (Inventor)

    1978-01-01

    This invention relates to the catalytic decomposition of hydrazine, catalysts useful for this decomposition and other reactions, and to reactions in hydrogen atmospheres generally using carbon-containing catalysts.

  9. Positive reaction to allergen (image)

    MedlinePlus

    Allergic reaction is a sensitivity to a specific substance, called an allergen, that is contacted through the skin, inhaled into the lungs, swallowed or injected. The body's reaction to an allergen can be mild, such as ...

  10. Demonstration of the Fenton Reaction

    ERIC Educational Resources Information Center

    Luehrs, Dean C.; Roher, Alex E.

    2007-01-01

    The study demonstrates the Fenton reaction, which is carried out using the Fenton reagent that is used for groundwater and soil remediation. The Fenton reaction can be implicated in DNA damage, Alzheimer's disease, cardiovascular disease and ageing in general.

  11. [Hypersensitivity reactions to insulin].

    PubMed

    Becerril-Ángeles, Martín; Moctezuma-Trejo, Cristina; Espinosa-Larrañaga, Francisco

    2012-01-01

    Hypersensitivity reactions to insulin are infrequent, yet of clinical importance. The mechanisms of hypersensitivity involved can be of three types: I, III and IV. To describe the pathophysiology of hypersensitivity to insulin, its clinical features and diagnostic and therapeutic approach, that help identify the cases of allergy to insulin and begin a treatment, or if necessary, to refer patients to a specialists or appropriate medical attention. An electronic search of papers related to insulin hypersensitivity was performed in PubMed and the articles selected were those considered the most relevant for this review. Thirty eight papers about pathophysiology, mechanisms of injury and the different types of insulin involved in hypersensitivity reactions were included. Likewise, information for the diagnosis of insulin hypersensitivity and some options of treatment for first contact physicians or the referral of patients to specialists in endocrinology and allergy were included. Insulin hypersensitivity has a low prevalence and diverse clinical manifestations. The different types of insulin suitable allow the majority of cases of hypersensitivity to continue the treatment in a efficient and flexible manner.

  12. Drug dangers and reactions.

    PubMed

    WEILERSTEIN, R W

    1961-01-01

    The protection of the consumer against dangerous, adulterated, and misbranded drugs provided by the Federal Food, Drug, and Cosmetic Act has failed in some instances. A general program of reporting adverse drug reactions has been initiated on a pilot basis. Arrangements are being made to extend this program into larger hospitals. Better and more complete reporting of adverse drug reactions together with tightening of the Food and Drug law regarding new drugs will improve this situation. Recently the president of the National Academy of Sciences appointed a committee at the request of the Secretary of Health, Education, and Welfare to review the policies and procedures used by the Food and Drug Administration in reaching decisions and to present recommendations. This committee has completed its work and has made specific recommendations that would give the Food and Drug Administration authority to require proof of efficacy as well as safety of all new drugs, and would provide it with sufficient resources to meet the responsibilities assigned to it.

  13. DRUG DANGERS AND REACTIONS

    PubMed Central

    Weilerstein, Ralph W.

    1961-01-01

    The protection of the consumer against dangerous, adulterated, and misbranded drugs provided by the Federal Food, Drug, and Cosmetic Act has failed in some instances. A general program of reporting adverse drug reactions has been initiated on a pilot basis. Arrangements are being made to extend this program into larger hospitals. Better and more complete reporting of adverse drug reactions together with tightening of the Food and Drug law regarding new drugs will improve this situation. Recently the president of the National Academy of Sciences appointed a committee at the request of the Secretary of Health, Education, and Welfare to review the policies and procedures used by the Food and Drug Administration in reaching decisions and to present recommendations. This committee has completed its work and has made specific recommendations that would give the Food and Drug Administration authority to require proof of efficacy as well as safety of all new drugs, and would provide it with sufficient resources to meet the responsibilities assigned to it. PMID:13783849

  14. Reactions of intermetallic clusters

    SciTech Connect

    Farley, R.W.; Castleman, A.W. Jr. )

    1990-02-01

    Reaction of bismuth--alkali clusters with closed-shell HX acids provides insight into the structures, formation, and stabilities of these intermetallic species. HC1 and HI are observed to quantitatively strip Bi{sub {ital x}}Na{sub {ital y}} and Bi{sub {ital x}}K{sub {ital y}}, respectively, of their alkali component, leaving bare bismuth clusters as the only bismuth-containing species detected. Product bismuth clusters exhibit the same distribution observed when pure bismuth is evaporated in the source. Though evaporated simultaneously from the same crucible, this suggests alkali atoms condense onto existing bismuth clusters and have negligible effect on their formation and consequent distribution. The indistinguishibility of reacted and pure bismuth cluster distributions further argues against the simple replacement of alkali atoms with hydrogen in these reactions. This is considered further evidence that the alkali atoms are external to the stable bismuth Zintl anionic structures. Reactivities of Bi{sub {ital x}}Na{sub {ital y}} clusters with HC1 are estimated to lie between 3{times}10{sup {minus}13} for Bi{sub 4}Na, to greater than 4{times}10{sup {minus}11} for clusters possessing large numbers of alkali atoms. Bare bismuth clusters are observed in separate experiments to react significantly more slowly with rates of 1--9{times}10{sup {minus}14} and exhibit little variation of reactivity with size. The bismuth clusters may thus be considered a relatively inert substrate upon which the alkali overlayer reacts.

  15. [Abnormal grief reaction].

    PubMed

    Meyer, J E

    1977-01-01

    Pathological grief reactions following the death of a child are reported on the basis of five case studies. In contrast to acute grief reactions these pathological syndromes are of long standing. One parent had not truly accepted the death of the child. The denial of reality is sometimes a defence against aggression towards the deceased, because of his having left one behind. The mourning process comes to no end but remains in its initial phase. At the same time the life of the mourner stands still, as in the house and the family everything is left unchanged. Family interactions alter, particularly between the parents. For the genesis of these grief syndromes the following is of relevance: The death occurs at a time, when another child cannot replace the one who died. Mature independence had not been reached by either parent or child. Death destroyed expectations that this child would succeed in that which the parent had been unable to achieve. The parent had not seen the child after death--a gap in the continuity of experiencing which made acceptance of the irreversibility of the loss even more difficult.

  16. Metallic induction reaction engine

    NASA Astrophysics Data System (ADS)

    Hart, Douglas; Mongeau, Peter P.; Kolm, Henry H.

    1985-11-01

    Metal rings placed close to a pulsed field coil have been accelerated at 200 million gee to 5 km/s in a 2 cm length by Bandoletov in the USSR Bandoletov, 1977. We have studied the basic phenomena and ultimate limitations of the pulsed induction process both theoretically and experimentally to determine its usefulness as a reaction engine. It is possible in principle to accelerate metal rings at high efficiency, and impart sufficient energy to ensure melting and evaporation, so that the reaction mass is ultimately ejected in the form of plasma. In practice the process is limited by electrical, mechanical and thermal failure of the induction coil. Over a hundred shots were fired including several in which 12 gram rings were accelerated to over 700 m/s at efficiencies above 30 percent. This is equivalent to the performance of a high power rifle with a one inch long barrel. An unexpected result of these studies is the discovery that to achieve maximum velocity, the mutual inductance gradient between induction coil and projectile ring in the firing position must be reduced to minimize the initial acceleration. This reduces the back voltage and increases the interaction time, resulting in maximum energy transfer.

  17. Lowering energy barriers in surface reactions through concerted reaction mechanisms.

    PubMed

    Sakong, Sung; Mosch, Christian; Lozano, Ariel; Busnengo, H Fabio; Gross, Axel

    2012-10-22

    Any technologically important chemical reaction typically involves a number of different elementary reaction steps consisting of bond-breaking and bond-making processes. Usually, one assumes that such complex chemical reactions occur in a step-wise fashion where one single bond is made or broken at a time. Using first-principles calculations based on density functional theory we show that the barriers of rate-limiting steps for technologically relevant surface reactions are significantly reduced if concerted reaction mechanisms are taken into account.

  18. The Vitamin C Clock Reaction

    NASA Astrophysics Data System (ADS)

    Wright, Stephen W.

    2002-01-01

    An iodine clock reaction that gives a colorless to black result similar to that of the familiar Landolt iodate-bisulfite clock reaction is described. The vitamin C clock reaction uses chemicals that are readily available on the retail market: vitamin C, tincture of iodine, 3% hydrogen peroxide, and laundry starch. Orange juice may be used as the vitamin C source to give an orange to black reaction.

  19. Enzymatic reactions on immobilised substrates.

    PubMed

    Gray, Christopher J; Weissenborn, Martin J; Eyers, Claire E; Flitsch, Sabine L

    2013-08-07

    This review gives an overview of enzymatic reactions that have been conducted on substrates attached to solid surfaces. Such biochemical reactions have become more important with the drive to miniaturisation and automation in chemistry, biology and medicine. Technical aspects such as choice of solid surface and analytical methods are discussed and examples of enzyme reactions that have been successful on these surfaces are provided.

  20. The Vitamin C Clock Reaction.

    ERIC Educational Resources Information Center

    Wright, Stephen W.

    2002-01-01

    Describes an iodine clock reaction that produces an effect similar to the Landolt clock reaction. This reaction uses supermarket chemicals and avoids iodate, bisulfite, and mercury compounds. Ascorbic acid and tincture of iodine are the main reactants with alternate procedures provided for vitamin C tablets and orange juice. (DDR)

  1. Corona reaction method and apparatus

    SciTech Connect

    Lowther, F.E.

    1981-08-11

    Corona induced chemical reactions are conducted in a corona discharge zone in which narrow high voltage pulses are applied along with a relatively low voltage bias potential. It is found that for many corona discharge reactions, such as the conversion of oxygen to ozone, the present method increases the electrical efficiency of the reaction.

  2. Mass Transfer with Chemical Reaction.

    ERIC Educational Resources Information Center

    DeCoursey, W. J.

    1987-01-01

    Describes the organization of a graduate course dealing with mass transfer, particularly as it relates to chemical reactions. Discusses the course outline, including mathematics models of mass transfer, enhancement of mass transfer rates by homogeneous chemical reaction, and gas-liquid systems with chemical reaction. (TW)

  3. The Vitamin C Clock Reaction.

    ERIC Educational Resources Information Center

    Wright, Stephen W.

    2002-01-01

    Describes an iodine clock reaction that produces an effect similar to the Landolt clock reaction. This reaction uses supermarket chemicals and avoids iodate, bisulfite, and mercury compounds. Ascorbic acid and tincture of iodine are the main reactants with alternate procedures provided for vitamin C tablets and orange juice. (DDR)

  4. More on Chemical Reaction Balancing.

    ERIC Educational Resources Information Center

    Swinehart, D. F.

    1985-01-01

    A previous article stated that only the matrix method was powerful enough to balance a particular chemical equation. Shows how this equation can be balanced without using the matrix method. The approach taken involves writing partial mathematical reactions and redox half-reactions, and combining them to yield the final balanced reaction. (JN)

  5. Mass Transfer with Chemical Reaction.

    ERIC Educational Resources Information Center

    DeCoursey, W. J.

    1987-01-01

    Describes the organization of a graduate course dealing with mass transfer, particularly as it relates to chemical reactions. Discusses the course outline, including mathematics models of mass transfer, enhancement of mass transfer rates by homogeneous chemical reaction, and gas-liquid systems with chemical reaction. (TW)

  6. Reaction Decoder Tool (RDT): extracting features from chemical reactions

    PubMed Central

    Rahman, Syed Asad; Torrance, Gilliean; Baldacci, Lorenzo; Martínez Cuesta, Sergio; Fenninger, Franz; Gopal, Nimish; Choudhary, Saket; May, John W.; Holliday, Gemma L.; Steinbeck, Christoph; Thornton, Janet M.

    2016-01-01

    Summary: Extracting chemical features like Atom–Atom Mapping (AAM), Bond Changes (BCs) and Reaction Centres from biochemical reactions helps us understand the chemical composition of enzymatic reactions. Reaction Decoder is a robust command line tool, which performs this task with high accuracy. It supports standard chemical input/output exchange formats i.e. RXN/SMILES, computes AAM, highlights BCs and creates images of the mapped reaction. This aids in the analysis of metabolic pathways and the ability to perform comparative studies of chemical reactions based on these features. Availability and implementation: This software is implemented in Java, supported on Windows, Linux and Mac OSX, and freely available at https://github.com/asad/ReactionDecoder Contact: asad@ebi.ac.uk or s9asad@gmail.com PMID:27153692

  7. Reaction Decoder Tool (RDT): extracting features from chemical reactions.

    PubMed

    Rahman, Syed Asad; Torrance, Gilliean; Baldacci, Lorenzo; Martínez Cuesta, Sergio; Fenninger, Franz; Gopal, Nimish; Choudhary, Saket; May, John W; Holliday, Gemma L; Steinbeck, Christoph; Thornton, Janet M

    2016-07-01

    Extracting chemical features like Atom-Atom Mapping (AAM), Bond Changes (BCs) and Reaction Centres from biochemical reactions helps us understand the chemical composition of enzymatic reactions. Reaction Decoder is a robust command line tool, which performs this task with high accuracy. It supports standard chemical input/output exchange formats i.e. RXN/SMILES, computes AAM, highlights BCs and creates images of the mapped reaction. This aids in the analysis of metabolic pathways and the ability to perform comparative studies of chemical reactions based on these features. This software is implemented in Java, supported on Windows, Linux and Mac OSX, and freely available at https://github.com/asad/ReactionDecoder : asad@ebi.ac.uk or s9asad@gmail.com. © The Author 2016. Published by Oxford University Press.

  8. Polymerase chain reaction

    SciTech Connect

    Arnhelm, N. ); Levenson, C.H. )

    1990-10-01

    This paper discusses the polymerase chain reaction (PCR) an in-vitro method of amplifying DNA sequences. Beginning with DNA of any origin- bacterial, viral, plant, or animal- PCR can increase the amount of a DNA sequence hundreds of millions to billions of times. The procedure can amplify a targeted sequence even when it makes up less than one part in a million of the total initial sample. PCR is an enzymatic process that is carried out in discrete cycles of amplification, each of which can double the amount of target DNA in the sample. Thus, n cycles can produce 2{sup n} times as much target as was present to begin with. This paper discusses how PCR has had an impact on molecular biology, human genetics, infectious and genetic disease diagnosis, forensic science, and evolutionary biology.

  9. [Bullous drug reactions].

    PubMed

    Hertl-Yazdi, M S; Hertl, M

    2005-01-01

    Bullous drug exanthems are clinically characteristic, usually severe cutaneous and mucosal drug hypersensitivity reactions. Commonly, they appear 5-14 days after onset of drug treatment. Therapy of choice is to avoid the culprit drug and systemic administration of glucocorticoids. A key element in the immune pathogenesis of bullous drug exanthems is presumably the activation of cytotoxic CD8(+) T lymphocytes which recognize drug metabolites as nominal antigens. These compounds form spontaneously (e.g. penicillins) or are metabolized by cytochrome P450-dependent enzymes (sulfonamides). The diagnosis of bullous drug exanthems is primarily based on skin tests and in vitro-techniques. Among the skin tests, prick as well as patch tests are important. Patch tests can be also applied at the former skin lesion in fixed drug eruption. In vitro techniques include analysis of drug-specific IgE (only available for anti-penicillin, anti-sulfamethoxazole) and cellular tests with the patients' lymphocytes (lymphocyte transformation test-LTT).

  10. Mixtures and Mineral Reactions

    NASA Astrophysics Data System (ADS)

    Rumble, D.

    The monograph Mixtures and Mineral Reactions contains a large amount of information of value to mineralogists, petrologists, and geochemists. The first four chapters are a succinct account of the thermodynamic description of crystalline solutions. In these early chapters a comparison is made between different mathematical treatments of activitycomposition models, there is a discussion of the unmixing by exsolution of a single solution into two phases, and methods of computing phase equilibria in assemblages of different minerals are given. If the reader is perplexed by the discussion of standard states (cf. Figure 1.3), not to worry. That is a normal condition for anyone forced to choose between equivalent reference frames yet knowing, somewhere down the line, that the choice will ultimately make one's computational life more or less difficult.

  11. Adverse reactions to vaccines.

    PubMed

    Martin, Bryan L; Nelson, Michael R; Hershey, Joyce N; Engler, Renata J M

    2003-06-01

    (The opinions or assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the Department of the Army or the Department of Defense.) Immunization healthcare is becoming increasingly complex as the number and types of vaccines have continued to expand. Like all prescription drugs, vaccines may be associated with adverse events. The majority of these reactions are self-limited and not associated with prolonged disability. The media, Internet and public advocacy groups have focused on potentially serious vaccine-associated adverse events with questions raised about causal linkages to increasing frequencies of diseases such as autism and asthma. Despite a lack of evidence of a causal relationship to a variety of vaccine safety concerns, including extensive reviews by the Institute of Medicine, questions regarding vaccine safety continue to threaten the success of immunization programs. Risk communication arid individual risk assessment is further challenged by the public health success of vaccine programs creating the perception that certain vaccines are no longer necessary or justified because of the rare reaction risk. There is a need for improved understanding of true vaccine contraindications and precautions as well as host factors and disease threat in order to develop a patient specific balanced risk communication intervention. When they occur, vaccine related adverse events must be treated, documented and reported through the VAERS system. The increasing complexity of vaccination health care has led the Center of Disease Control and Prevention (CDC) to identify Vaccine Safety Assessment and Evaluation as a potential new specialty.

  12. Subdiffusion-reaction processes with A→B reactions versus subdiffusion-reaction processes with A+B→B reactions.

    PubMed

    Kosztołowicz, Tadeusz; Lewandowska, Katarzyna D

    2014-09-01

    We consider the subdiffusion-reaction process with reactions of a type A+B→B (in which particles A are assumed to be mobile, whereas B are assumed to be static) in comparison to the subdiffusion-reaction process with A→B reactions which was studied by Sokolov, Schmidt, and Sagués [Phys. Rev. E 73, 031102 (2006)]. In both processes a rule that reactions can only occur between particles which continue to exist is taken into account. Although in both processes a probability of the vanishing of particle A due to a reaction is independent of both time and space variables (assuming that in the system with the A+B→B reactions, particles B are distributed homogeneously), we show that subdiffusion-reaction equations describing these processes as well as their Green's functions are qualitatively different. The reason for this difference is as follows. In the case of the former reaction, particles A and B have to meet with some probability before the reaction occurs in contradiction with the case of the latter reaction. For the subdiffusion process with the A+B→B reactions we consider three models which differ in some details concerning a description of the reactions. We base the method considered in this paper on a random walk model in a system with both discrete time and discrete space variables. Then the system with discrete variables is transformed into a system with both continuous time and continuous space variables. Such a method seems to be convenient in analyzing subdiffusion-reaction processes with partially absorbing or partially reflecting walls. The reason is that within this method we can determine Green's functions without a necessity of solving a fractional differential subdiffusion-reaction equation with boundary conditions at the walls. As an example, we use the model to find the Green's functions for a subdiffusive reaction system (with the reactions mentioned above), which is bounded by a partially absorbing wall. This example shows how the model

  13. Extent of reaction in open systems with multiple heterogeneous reactions

    USGS Publications Warehouse

    Friedly, John C.

    1991-01-01

    The familiar batch concept of extent of reaction is reexamined for systems of reactions occurring in open systems. Because species concentrations change as a result of transport processes as well as reactions in open systems, the extent of reaction has been less useful in practice in these applications. It is shown that by defining the extent of the equivalent batch reaction and a second contribution to the extent of reaction due to the transport processes, it is possible to treat the description of the dynamics of flow through porous media accompanied by many chemical reactions in a uniform, concise manner. This approach tends to isolate the reaction terms among themselves and away from the model partial differential equations, thereby enabling treatment of large problems involving both equilibrium and kinetically controlled reactions. Implications on the number of coupled partial differential equations necessary to be solved and on numerical algorithms for solving such problems are discussed. Examples provided illustrate the theory applied to solute transport in groundwater flow.

  14. Two chamber reaction furnace

    DOEpatents

    Blaugher, R.D.

    1998-05-05

    A vertical two chamber reaction furnace is described. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700 C and 800 C) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800 to 950 C to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product. 2 figs.

  15. Two chamber reaction furnace

    DOEpatents

    Blaugher, Richard D.

    1998-05-05

    A vertical two chamber reaction furnace. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700.degree. and 800.degree. C.) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800.degree. to 950.degree. C. to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product.

  16. NIF Gamma Reaction History

    NASA Astrophysics Data System (ADS)

    Herrmann, H. W.; Kim, Y.; Young, C. S.; Mack, J. M.; McEvoy, A. M.; Hoffman, N. M.; Wilson, D. C.; Langenbrunner, J. R.; Evans, S.; Batha, S. H.; Stoeffl, W.; Lee, A.; Horsfield, C. J.; Rubery, M.; Miller, E. K.; Malone, R. M.; Kaufman, M. I.

    2010-11-01

    The primary objective of the NIF Gamma Reaction History (GRH) diagnostics is to provide bang time and burn width information based upon measurement of fusion gamma-rays. This is accomplished with energy-thresholded Gas Cherenkov detectors that convert MeV gamma-rays into UV/visible photons for high-bandwidth optical detection. In addition, the GRH detectors can perform γ-ray spectroscopy to explore other nuclear processes from which additional significant implosion parameters may be inferred (e.g., plastic ablator areal density). Implementation is occurring in 2 phases: 1) four PMT-based channels mounted to the outside of the NIF target chamber at ˜6 m from TCC (GRH-6m) for the 3e13-3e16 DT neutron yield range expected during the early ignition-tuning campaigns; and 2) several channels located just inside the target bay shield wall at ˜15 m from TCC (GRH-15m) with optical paths leading through the wall into well-shielded streak cameras and PMTs for the 1e16-1e20 yield range expected during the DT ignition campaign. This suite of diagnostics will allow exploration of interesting γ-ray physics well beyond the ignition campaign. Recent data from OMEGA and NIF will be shown.

  17. Formaldehyde reactions in dark clouds.

    PubMed

    Sen, A D; Anicich, V G; Federman, S R

    1992-05-20

    The low-pressure reactions of formaldehyde (H2CO) with D+, D2+, D3+, and He+ have been studied by the ion cyclotron resonance technique. These reactions are potential loss processes for formaldehyde in cores of dark interstellar clouds. The deuterated reactants, which are easier to study experimentally, represent direct analogs for protons. Rate coefficients and branching ratios of product channels have been measured. Charge transfer is observed to be the dominant reaction of H2CO with D+, D2+, and He+ ions. Only the D3+ reaction exhibits a proton transfer channel. All reactions proceed at rate coefficients near the collision limit. Proton-deuteron exchange reactions were found to be inefficient processes in the formaldehyde system.

  18. Characterising Complex Enzyme Reaction Data

    PubMed Central

    Rahman, Syed Asad; Thornton, Janet M.

    2016-01-01

    The relationship between enzyme-catalysed reactions and the Enzyme Commission (EC) number, the widely accepted classification scheme used to characterise enzyme activity, is complex and with the rapid increase in our knowledge of the reactions catalysed by enzymes needs revisiting. We present a manual and computational analysis to investigate this complexity and found that almost one-third of all known EC numbers are linked to more than one reaction in the secondary reaction databases (e.g., KEGG). Although this complexity is often resolved by defining generic, alternative and partial reactions, we have also found individual EC numbers with more than one reaction catalysing different types of bond changes. This analysis adds a new dimension to our understanding of enzyme function and might be useful for the accurate annotation of the function of enzymes and to study the changes in enzyme function during evolution. PMID:26840640

  19. Formaldehyde reactions in dark clouds

    NASA Technical Reports Server (NTRS)

    Sen, A. D.; Anicich, V. G.; Federman, S. R.

    1992-01-01

    The low-pressure reactions of formaldehyde (H2CO) with D(+), D2(+), D3(+), and He(+) are studied by the ion-cyclotron resonance technique. These reactions are potential loss processes for formaldehyde in cores of dark interstellar clouds. The deuterated reactants represent direct analogs for protons. Rate coefficients and branching ratios of product channels have been measured. Charge transfer is observed to be the dominant reaction of H2CO with D(+), D2(+), and He(+) ions. Only the D3(+) reaction exhibits a proton-transfer channel. All reactions proceed at rate coefficients near the collision limit. Proton-deuteron exchange reactions are found to be inefficient processes in the formaldehyde system.

  20. Fractional reaction-diffusion equation

    NASA Astrophysics Data System (ADS)

    Seki, Kazuhiko; Wojcik, Mariusz; Tachiya, M.

    2003-07-01

    A fractional reaction-diffusion equation is derived from a continuous time random walk model when the transport is dispersive. The exit from the encounter distance, which is described by the algebraic waiting time distribution of jump motion, interferes with the reaction at the encounter distance. Therefore, the reaction term has a memory effect. The derived equation is applied to the geminate recombination problem. The recombination is shown to depend on the intrinsic reaction rate, in contrast with the results of Sung et al. [J. Chem. Phys. 116, 2338 (2002)], which were obtained from the fractional reaction-diffusion equation where the diffusion term has a memory effect but the reaction term does not. The reactivity dependence of the recombination probability is confirmed by numerical simulations.

  1. Stochastic Modeling Of Biochemical Reactions

    DTIC Science & Technology

    2006-11-01

    chemical reactions. Often for these reactions, the dynamics of the first M-order statistical moments of the species populations do not form a closed...results a stochastic model for gene expression is investigated. We show that in gene expression mechanisms , in which a protein inhibits its own...chemical reactions [7, 8, 4, 9, 10]. Since one is often interested in only the first and second order statistical moments for the number of molecules of

  2. Kinematically complete chemical reaction dynamics

    NASA Astrophysics Data System (ADS)

    Trippel, S.; Stei, M.; Otto, R.; Hlavenka, P.; Mikosch, J.; Eichhorn, C.; Lourderaj, U.; Zhang, J. X.; Hase, W. L.; Weidemüller, M.; Wester, R.

    2009-11-01

    Kinematically complete studies of molecular reactions offer an unprecedented level of insight into the dynamics and the different mechanisms by which chemical reactions occur. We have developed a scheme to study ion-molecule reactions by velocity map imaging at very low collision energies. Results for the elementary nucleophilic substitution (SN2) reaction Cl- + CH3I → ClCH3 + I- are presented and compared to high-level direct dynamics trajectory calculations. Furthermore, an improved design of the crossed-beam imaging spectrometer with full three-dimensional measurement capabilities is discussed and characterization measurements using photoionization of NH3 and photodissociation of CH3I are presented.

  3. Pathophysiology of hemolytic transfusion reactions.

    PubMed

    Davenport, Robertson D

    2005-07-01

    Hemolytic transfusion reactions (HTR) are systemic reactions provoked by immunologic red blood cell (RBC) incompatibility. Clinical and experimental observations of such reactions indicate that they proceed through phases of humoral immune reaction, activation of phagocytes, productions of cytokine mediators, and wide-ranging cellular responses. HTR have many features in common with the systemic inflammatory response syndrome (SIRS). Knowledge of the pathophysiologic mechanisms in HTR suggest that newer biological agents that target complement intermediates or proinflammatory cytokines may be effective agents in the treatment of severe HTRs.

  4. Racemization in Prins Cyclization Reactions

    PubMed Central

    Jasti, Ramesh

    2008-01-01

    Isotopic labeling experiments were performed in order to elucidate a new mechanism for racemization in Prins cyclization reactions. The loss in optical activity for these reactions was shown to occur by 2-oxonia-Cope rearrangements by way of a (Z)-oxocarbenium ion intermediate. Reaction conditions such as solvent, temperature, and the nucleophile employed played a critical role in whether an erosion in enantiomeric excess was observed. Additionally, certain structural features of Prins cyclization precursors were also shown to be important for preserving optical purity in these reactions. PMID:17031979

  5. [Situational reactions in suicidologic practice].

    PubMed

    Ambrumova, A G; Vrono, E M

    1985-01-01

    The paper is devoted to the description of suicidal manifestations in mentally normal adolescents among typical behavioural disorders characteristic of situational reactions of this age. Three types of suicido-dangerous situational responses of adolescents were specified with regard to their age and auto-and heteaggressiveness ratio: reaction of deprivation, explosive reaction and reaction of auto-elimination. Suicidogenic conflicts were analyzed and spheres of age-specific suicidal conflicts were defined. It is advisable that outpatient management of mentally normal adolescents with a history of a suicidal attempt be conducted in a special room of presentive suicidological service.

  6. Speeding chemical reactions by focusing.

    PubMed

    Lacasta, A M; Ramírez-Piscina, L; Sancho, J M; Lindenberg, K

    2013-04-14

    We present numerical results for a chemical reaction of colloidal particles which are transported by a laminar fluid and are focused by periodic obstacles in such a way that the two components are well mixed and consequently the chemical reaction is speeded up. The roles of the various system parameters (diffusion coefficients, reaction rate, and obstacles sizes) are studied. We show that focusing speeds up the reaction from the diffusion limited rate ∼t(-1/2) to very close to the perfect mixing rate, ∼t(-1).

  7. Speeding chemical reactions by focusing

    NASA Astrophysics Data System (ADS)

    Lacasta, A. M.; Ramírez-Piscina, L.; Sancho, J. M.; Lindenberg, K.

    2013-04-01

    We present numerical results for a chemical reaction of colloidal particles which are transported by a laminar fluid and are focused by periodic obstacles in such a way that the two components are well mixed and consequently the chemical reaction is speeded up. The roles of the various system parameters (diffusion coefficients, reaction rate, and obstacles sizes) are studied. We show that focusing speeds up the reaction from the diffusion limited rate ˜t-1/2 to very close to the perfect mixing rate, ˜t-1.

  8. Dynamic Reaction Figures: An Integrative Vehicle for Understanding Chemical Reactions

    ERIC Educational Resources Information Center

    Schultz, Emeric

    2008-01-01

    A highly flexible learning tool, referred to as a dynamic reaction figure, is described. Application of these figures can (i) yield the correct chemical equation by simply following a set of menu driven directions; (ii) present the underlying "mechanism" in chemical reactions; and (iii) help to solve quantitative problems in a number of different…

  9. Topologically invariant reaction coordinates for simulating multistate chemical reactions.

    PubMed

    Mones, Letif; Csányi, Gábor

    2012-12-27

    Evaluating free energy profiles of chemical reactions in complex environments such as solvents and enzymes requires extensive sampling, which is usually performed by potential of mean force (PMF) techniques. The reliability of the sampling depends not only on the applied PMF method but also the reaction coordinate space within the dynamics is biased. In contrast to simple geometrical collective variables that depend only on the positions of the atomic coordinates of the reactants, the E(gap) reaction coordinate (the energy difference obtained by evaluating a suitable force field using reactant and product state topologies) has the unique property that it is able to take environmental effects into account leading to better convergence, a more faithful description of the transition state ensemble and therefore more accurate free energy profiles. However, E(gap) requires predefined topologies and is therefore inapplicable for multistate reactions, in which the barrier between the chemically equivalent topologies is comparable to the reaction activation barrier, because undesired "side reactions" occur. In this article, we introduce a new energy-based collective variable by generalizing the E(gap) reaction coordinate such that it becomes invariant to equivalent topologies and show that it yields more well behaved free energy profiles than simpler geometrical reaction coordinates.

  10. Dynamic Reaction Figures: An Integrative Vehicle for Understanding Chemical Reactions

    ERIC Educational Resources Information Center

    Schultz, Emeric

    2008-01-01

    A highly flexible learning tool, referred to as a dynamic reaction figure, is described. Application of these figures can (i) yield the correct chemical equation by simply following a set of menu driven directions; (ii) present the underlying "mechanism" in chemical reactions; and (iii) help to solve quantitative problems in a number of different…

  11. Participants' Reactions to Computerized Testing.

    ERIC Educational Resources Information Center

    Moe, Kim C.; Johnson, Marilyn F.

    This study investigated participants' reactions to computerized testing and assessed the practicability of this testing method in the classroom. A sample of 315 secondary-level students took a computerized and a printed version of a standardized aptitude test battery and a survey assessing their reactions to the computerized testing. Overall…

  12. Adverse Reactions to Hallucinogenic Drugs.

    ERIC Educational Resources Information Center

    Meyer, Roger E. , Ed.

    This reports a conference of psychologists, psychiatrists, geneticists and others concerned with the biological and psychological effects of lysergic acid diethylamide and other hallucinogenic drugs. Clinical data are presented on adverse drug reactions. The difficulty of determining the causes of adverse reactions is discussed, as are different…

  13. Pharmacogenetics of hypersensitivity drug reactions.

    PubMed

    Negrini, Simone; Becquemont, Laurent

    2017-04-01

    Adverse drug reactions are a significant cause of morbidity and mortality and represent a major burden on the healthcare system. Some of those reactions are immunologically mediated (hypersensitivity reactions) and can be clinically subdivided into two categories: immediate reactions (IgE-related) and delayed reactions (T-cell-mediated). Delayed hypersensitivity reactions include both systemic syndromes and organ-specific toxicities and can be triggered by a wide range of chemically diverse drugs. Recent studies have demonstrated a strong genetic association between human leukocyte antigen alleles and susceptibility to delayed drug hypersensitivity. Most notable examples include human leukocyte antigen (HLA)-B*57:01 allele and abacavir hypersensitivity syndrome or HLA-B*15:02 and HLA-B*58:01 alleles related to severe cutaneous reactions induced by carbamazepine and allopurinol, respectively. This review aims to explore our current understanding in the field of pharmacogenomics of HLA-associated drug hypersensitivities and its translation into clinical practice for predicting adverse drug reactions. Copyright © 2017 Société française de pharmacologie et de thérapeutique. Published by Elsevier Masson SAS. All rights reserved.

  14. Statistical Factors in Complexation Reactions.

    ERIC Educational Resources Information Center

    Chung, Chung-Sun

    1985-01-01

    Four cases which illustrate statistical factors in complexation reactions (where two of the reactants are monodentate ligands) are presented. Included are tables showing statistical factors for the reactions of: (1) square-planar complexes; (2) tetrahedral complexes; and (3) octahedral complexes. (JN)

  15. "Greening up" the Suzuki Reaction

    ERIC Educational Resources Information Center

    Aktoudianakis, Evangelos; Chan, Elton; Edward, Amanda R.; Jarosz, Isabel; Lee, Vicki; Mui, Leo; Thatipamala, Sonya S.; Dicks, Andrew P.

    2008-01-01

    This article describes the rapid, green synthesis of a biaryl compound (4-phenylphenol) via a Pd(0)-catalyzed Suzuki cross-coupling reaction in water. Mild reaction conditions and operational simplicity makes this experiment especially amenable to both mid- and upper-level undergraduates. The methodology exposes students to purely aqueous…

  16. "Greening up" the Suzuki Reaction

    ERIC Educational Resources Information Center

    Aktoudianakis, Evangelos; Chan, Elton; Edward, Amanda R.; Jarosz, Isabel; Lee, Vicki; Mui, Leo; Thatipamala, Sonya S.; Dicks, Andrew P.

    2008-01-01

    This article describes the rapid, green synthesis of a biaryl compound (4-phenylphenol) via a Pd(0)-catalyzed Suzuki cross-coupling reaction in water. Mild reaction conditions and operational simplicity makes this experiment especially amenable to both mid- and upper-level undergraduates. The methodology exposes students to purely aqueous…

  17. Isosinglet approximation for nonelastic reactions

    NASA Technical Reports Server (NTRS)

    Wilson, J. W.

    1972-01-01

    Group theoretic relations are derived between different combinations of projectile and secondary particles which appear to have a broad range of application in spacecraft shielding or radiation damage studies. These relations are used to reduce the experimental effort required to obtain nuclear reaction data for transport calculations. Implications for theoretical modeling are also noted, especially for heavy-heavy reactions.

  18. Chemistry of heavy ion reactions

    SciTech Connect

    Hoffman, D.C.

    1988-10-01

    The use of heavy ions to induce nuclear reactions was reported as early as 1950. Since that time it has been one of the most active areas of nuclear research. Intense beams of ions as heavy as uranium with energies high enough to overcome the Coulomb barriers of even the heaviest elements are available. The wide variety of possible reactions gives rise to a multitude of products which have been studied by many ingenious chemical and physical techniques. Chemical techniques have been of special value for the separation and unequivocal identification of low yield species from the plethora of other nuclides present. Heavy ion reactions have been essential for the production of the trans-Md elements and a host of new isotopes. The systematics of compound nucleus reactions, transfer reactions, and deeply inelastic reactions have been elucidated using chemical techniques. A review of the variety of chemical procedures and techniques which have been developed for the study of heavy ion reactions and their products is given. Determination of the chemical properties of the trans-Md elements, which are very short-lived and can only be produced an ''atom-at-a-time'' via heavy ion reactions, is discussed. 53 refs., 19 figs.

  19. Free Radical Reactions in Food.

    ERIC Educational Resources Information Center

    Taub, Irwin A.

    1984-01-01

    Discusses reactions of free radicals that determine the chemistry of many fresh, processed, and stored foods. Focuses on reactions involving ascorbic acid, myoglobin, and palmitate radicals as representative radicals derived from a vitamin, metallo-protein, and saturated lipid. Basic concepts related to free radical structure, formation, and…

  20. Free Radical Reactions in Food.

    ERIC Educational Resources Information Center

    Taub, Irwin A.

    1984-01-01

    Discusses reactions of free radicals that determine the chemistry of many fresh, processed, and stored foods. Focuses on reactions involving ascorbic acid, myoglobin, and palmitate radicals as representative radicals derived from a vitamin, metallo-protein, and saturated lipid. Basic concepts related to free radical structure, formation, and…

  1. PHENOTHIAZINE ATARAXICS—Extrapyramidal Reactions

    PubMed Central

    Cain, Harvey D.; Malcolm, Mary

    1960-01-01

    Thirty-nine cases of extrapyramidal reactions caused by seven chemically different phenothiazine medications are presented. Historical, pharmacological, diagnostic, and therapeutic factors are considered. It is important that the physician prescribing phenothiazines be well aware of the reactions which may occur so that therapy may be discontinued at the first untoward signs. PMID:13806816

  2. Enzymatic reactions in confined environments.

    PubMed

    Küchler, Andreas; Yoshimoto, Makoto; Luginbühl, Sandra; Mavelli, Fabio; Walde, Peter

    2016-05-05

    Within each biological cell, surface- and volume-confined enzymes control a highly complex network of chemical reactions. These reactions are efficient, timely, and spatially defined. Efforts to transfer such appealing features to in vitro systems have led to several successful examples of chemical reactions catalysed by isolated and immobilized enzymes. In most cases, these enzymes are either bound or adsorbed to an insoluble support, physically trapped in a macromolecular network, or encapsulated within compartments. Advanced applications of enzymatic cascade reactions with immobilized enzymes include enzymatic fuel cells and enzymatic nanoreactors, both for in vitro and possible in vivo applications. In this Review, we discuss some of the general principles of enzymatic reactions confined on surfaces, at interfaces, and inside small volumes. We also highlight the similarities and differences between the in vivo and in vitro cases and attempt to critically evaluate some of the necessary future steps to improve our fundamental understanding of these systems.

  3. Fundamental reaction pathways during coprocessing

    SciTech Connect

    Stock, L.M.; Gatsis, J.G. . Dept. of Chemistry)

    1992-12-01

    The objective of this research was to investigate the fundamental reaction pathways in coal petroleum residuum coprocessing. Once the reaction pathways are defined, further efforts can be directed at improving those aspects of the chemistry of coprocessing that are responsible for the desired results such as high oil yields, low dihydrogen consumption, and mild reaction conditions. We decided to carry out this investigation by looking at four basic aspects of coprocessing: (1) the effect of fossil fuel materials on promoting reactions essential to coprocessing such as hydrogen atom transfer, carbon-carbon bond scission, and hydrodemethylation; (2) the effect of varied mild conditions on the coprocessing reactions; (3) determination of dihydrogen uptake and utilization under severe conditions as a function of the coal or petroleum residuum employed; and (4) the effect of varied dihydrogen pressure, temperature, and residence time on the uptake and utilization of dihydrogen and on the distribution of the coprocessed products. Accomplishments are described.

  4. Enzymatic reactions in confined environments

    NASA Astrophysics Data System (ADS)

    Küchler, Andreas; Yoshimoto, Makoto; Luginbühl, Sandra; Mavelli, Fabio; Walde, Peter

    2016-05-01

    Within each biological cell, surface- and volume-confined enzymes control a highly complex network of chemical reactions. These reactions are efficient, timely, and spatially defined. Efforts to transfer such appealing features to in vitro systems have led to several successful examples of chemical reactions catalysed by isolated and immobilized enzymes. In most cases, these enzymes are either bound or adsorbed to an insoluble support, physically trapped in a macromolecular network, or encapsulated within compartments. Advanced applications of enzymatic cascade reactions with immobilized enzymes include enzymatic fuel cells and enzymatic nanoreactors, both for in vitro and possible in vivo applications. In this Review, we discuss some of the general principles of enzymatic reactions confined on surfaces, at interfaces, and inside small volumes. We also highlight the similarities and differences between the in vivo and in vitro cases and attempt to critically evaluate some of the necessary future steps to improve our fundamental understanding of these systems.

  5. Adverse reactions to drug additives.

    PubMed

    Simon, R A

    1984-10-01

    There is a long list of additives used by the pharmaceutical industry. Most of the agents used have not been implicated in hypersensitivity reactions. Among those that have, only reactions to parabens and sulfites have been well established. Parabens have been shown to be responsible for rare immunoglobulin E-mediated reactions that occur after the use of local anesthetics. Sulfites, which are present in many drugs, including agents commonly used to treat asthma, have been shown to provoke severe asthmatic attacks in sensitive individuals. Recent studies indicate that additives do not play a significant role in "hyperactivity." The role of additives in urticaria is not well established and therefore the incidence of adverse reactions in this patient population is simply not known. In double-blind, placebo-controlled studies, reactions to tartrazine or additives other than sulfites, if they occur at all, are indeed quite rare for the asthmatic population, even for the aspirin-sensitive subpopulation.

  6. [Anaphylactic reaction following hair bleaching].

    PubMed

    Babilas, P; Landthaler, M; Szeimies, R-M

    2005-12-01

    Ammonium persulphate is a potent bleach and oxidizing agent that is commonly present in hair bleaches. Because bleaching is so commonly performed, hairdressers often develop allergic contact dermatitis to ammonium persulphate. In addition to this delayed reaction, asthma and rhinitis may develop as immediate reactions in those exposed to the fumes. Severe anaphylactic reactions are rare. We report a 24-year-old woman who acquired dermatitis following contact with bleaching substances while working as a hairdresser. After changing her profession, the dermatitis disappeared. Following the private use of a hairdressing bleach containing ammonium persulphate, she suffered a severe anaphylactic reaction with unconsciousness. The patient also developed an anaphylactic reaction three hours following patch testing with the hairdresser battery. The rub test with ammonium persulphate (2.5%) in a 1:100 solution was positive.

  7. Effective reaction rates for diffusion-limited reaction cycles

    NASA Astrophysics Data System (ADS)

    Nałecz-Jawecki, Paweł; Szymańska, Paulina; Kochańczyk, Marek; Miekisz, Jacek; Lipniacki, Tomasz

    2015-12-01

    Biological signals in cells are transmitted with the use of reaction cycles, such as the phosphorylation-dephosphorylation cycle, in which substrate is modified by antagonistic enzymes. An appreciable share of such reactions takes place in crowded environments of two-dimensional structures, such as plasma membrane or intracellular membranes, and is expected to be diffusion-controlled. In this work, starting from the microscopic bimolecular reaction rate constants and using estimates of the mean first-passage time for an enzyme-substrate encounter, we derive diffusion-dependent effective macroscopic reaction rate coefficients (EMRRC) for a generic reaction cycle. Each EMRRC was found to be half of the harmonic average of the microscopic rate constant (phosphorylation c or dephosphorylation d), and the effective (crowding-dependent) motility divided by a slowly decreasing logarithmic function of the sum of the enzyme concentrations. This implies that when c and d differ, the two EMRRCs scale differently with the motility, rendering the steady-state fraction of phosphorylated substrate molecules diffusion-dependent. Analytical predictions are verified using kinetic Monte Carlo simulations on the two-dimensional triangular lattice at the single-molecule resolution. It is demonstrated that the proposed formulas estimate the steady-state concentrations and effective reaction rates for different sets of microscopic reaction rates and concentrations of reactants, including a non-trivial example where with increasing diffusivity the fraction of phosphorylated substrate molecules changes from 10% to 90%.

  8. Reaction rates for reaction-diffusion kinetics on unstructured meshes

    NASA Astrophysics Data System (ADS)

    Hellander, Stefan; Petzold, Linda

    2017-02-01

    The reaction-diffusion master equation is a stochastic model often utilized in the study of biochemical reaction networks in living cells. It is applied when the spatial distribution of molecules is important to the dynamics of the system. A viable approach to resolve the complex geometry of cells accurately is to discretize space with an unstructured mesh. Diffusion is modeled as discrete jumps between nodes on the mesh, and the diffusion jump rates can be obtained through a discretization of the diffusion equation on the mesh. Reactions can occur when molecules occupy the same voxel. In this paper, we develop a method for computing accurate reaction rates between molecules occupying the same voxel in an unstructured mesh. For large voxels, these rates are known to be well approximated by the reaction rates derived by Collins and Kimball, but as the mesh is refined, no analytical expression for the rates exists. We reduce the problem of computing accurate reaction rates to a pure preprocessing step, depending only on the mesh and not on the model parameters, and we devise an efficient numerical scheme to estimate them to high accuracy. We show in several numerical examples that as we refine the mesh, the results obtained with the reaction-diffusion master equation approach those of a more fine-grained Smoluchowski particle-tracking model.

  9. Effective reaction rates for diffusion-limited reaction cycles.

    PubMed

    Nałęcz-Jawecki, Paweł; Szymańska, Paulina; Kochańczyk, Marek; Miękisz, Jacek; Lipniacki, Tomasz

    2015-12-07

    Biological signals in cells are transmitted with the use of reaction cycles, such as the phosphorylation-dephosphorylation cycle, in which substrate is modified by antagonistic enzymes. An appreciable share of such reactions takes place in crowded environments of two-dimensional structures, such as plasma membrane or intracellular membranes, and is expected to be diffusion-controlled. In this work, starting from the microscopic bimolecular reaction rate constants and using estimates of the mean first-passage time for an enzyme-substrate encounter, we derive diffusion-dependent effective macroscopic reaction rate coefficients (EMRRC) for a generic reaction cycle. Each EMRRC was found to be half of the harmonic average of the microscopic rate constant (phosphorylation c or dephosphorylation d), and the effective (crowding-dependent) motility divided by a slowly decreasing logarithmic function of the sum of the enzyme concentrations. This implies that when c and d differ, the two EMRRCs scale differently with the motility, rendering the steady-state fraction of phosphorylated substrate molecules diffusion-dependent. Analytical predictions are verified using kinetic Monte Carlo simulations on the two-dimensional triangular lattice at the single-molecule resolution. It is demonstrated that the proposed formulas estimate the steady-state concentrations and effective reaction rates for different sets of microscopic reaction rates and concentrations of reactants, including a non-trivial example where with increasing diffusivity the fraction of phosphorylated substrate molecules changes from 10% to 90%.

  10. Effective reaction parameters for mixing controlled reactions in heterogeneous media

    NASA Astrophysics Data System (ADS)

    Luo, Jian; Dentz, Marco; Carrera, Jesus; Kitanidis, Peter

    2008-02-01

    Sound understanding of mixing-controlled reactions in heterogeneous media is needed for the realistic modeling of contaminant transport in aquifers and is a precondition for the evaluation of natural attenuation processes, the design of nuclear waste disposal, and the engineered remediation of contaminated sites. In this work, we study the bimolecular dissolution-precipitation equilibrium reaction, adapted after De Simoni et al. (2005). Because of advective and dispersive transport of the reacting species, the system is globally in nonequilibrium because the effective reaction rate is limited by the finite rate of transport and thus is affected by the heterogeneity of the formation. We study the macroscopic formulation of such a reactive transport system in terms of mixing-controlled reaction parameters which integrate the impact of spatial heterogeneity. The apparent chemical saturation is found to be a function of the concentration variance and is generally greater than its local-scale equivalent. This explains why water samples taken from pumping wells are normally nonequilibrium with respect to minerals existing in the aquifer, even when local equilibrium is to be expected. The reaction rate is given by the product of a reaction factor, associated with the local equilibrium constant and concentration variance, and a mixing factor, which is the product of the microdispersion coefficient and the square gradient of the mean and perturbation concentration fields. The mixing factor dominates the description of the reaction rate in the upscaled macroscopic models. The reaction rate predicted by macroscopic models is controlled by two competing effects: The large heterogeneity-induced macrodispersion coefficient leads to an increase of reaction rate, while a more smoothed concentration gradient may lead to a decrease of the reaction rate. Macroscopic models may only give a good approximation at large time and away from the plume center of mass because of the balanced

  11. Leukocyte Agglomeration Reaction in Diagnosis of Allergy Reactions from Antibiotics,

    DTIC Science & Technology

    tested in a clinic on 80 patients with serious allergic anamnesis . The results of the studies indicate that the leukocyte agglomeration reaction is a highly sensitive immunological indicator of hypersensitivity to antibiotics.

  12. Interface Reactions and Synthetic Reaction of Composite Systems

    PubMed Central

    Park, Joon Sik; Kim, Jeong Min

    2010-01-01

    Interface reactions in composite systems often determine their overall properties, since product phases usually formed at interfaces during composite fabrication processing make up a large portion of the composites. Since most composite materials represent a ternary or higher order materials system, many studies have focused on analyses of diffusion phenomena and kinetics in multicomponent systems. However, the understanding of the kinetic behavior increases the complexity, since the kinetics of each component during interdiffusion reactions need to be defined for interpreting composite behaviors. From this standpoint, it is important to clarify the interface reactions for producing compatible interfaces with desired product phases. A thermodynamic evaluation such as a chemical potential of involving components can provide an understanding of the diffusion reactions, which govern diffusion pathways and product phase formation. A strategic approach for designing compatible interfaces is discussed in terms of chemical potential diagrams and interface morphology, with some material examples.

  13. Hypersensitivity reactions to food additives.

    PubMed

    Randhawa, Shahid; Bahna, Sami L

    2009-06-01

    To provide an updated concise review on food additives adverse reactions, diagnosis, and management. Despite the common use of food additives, their adverse reactions seem to be very rare in the general population (0.01-0.23%) but higher in atopic individuals (2-7%). Probably because of the difficulty in diagnosis, most of the available information is based on case reports or small series. Reported reactions are mostly mild and may affect the skin, the gastrointestinal tract, or the airways, and rarely anaphylaxis. Food additives should be suspected as the culprit in patients who report a history of reactions to a number of unrelated foods or to a certain food when commercially prepared but not when prepared at home. The major problem in dealing with reactions to additives is the identification of the offending agent(s). Apart from a careful history taking, allergy skin testing or in-vitro testing are rarely useful. Trials of elimination and reintroduction may be more helpful. If the anticipated reaction is severe, a well designed challenge testing should be carried out. Once the offending additive(s) is confirmed, treatment is avoidance. Because accidental exposure often happens, patients with a history of severe reactions should have self-injectable epinephrine and wear MedicAlert (Turlock, California, USA) identification.

  14. Surrogate Nuclear Reactions using STARS

    SciTech Connect

    Bernstein, L A; Burke, J T; Church, J A; Ahle, L; Cooper, J R; Hoffman, R D; Moody, K; Punyon, J; Schiller, A; Algin, E; Plettner, C; Ai, H; Beausang, C W; Casten, R F; Hughes, R; Ricard-McCutchan, E; Meyer, D; Ressler, J J; Caggiano, J A; Zamfir, N V; Amro, H; Heinz, A; Fallon, P; McMahan, M A; Macchiavelli, A O; Phair, L W

    2004-10-26

    The results from two surrogate reaction experiments using the STARS (Silicon Telescope Array for Reaction Studies) spectrometer are presented. The surrogate method involves measuring the particle and/or {gamma}-ray decay probabilities of excited nuclei populated via a direct reaction. These probabilities can then be used to deduce neutron-induced reaction cross sections that lead to the same compound nuclei. In the first experiment STARS coupled to the GAMMASPHERE {gamma}-ray spectrometer successfully reproduce surrogate (n,{gamma}), (n,n'{gamma}) and (n,2n{gamma}) cross sections on {sup 155,156}Gd using Gd {sup 3}He-induced reactions. In the second series of experiments an energetic deuteron beam from the ESTU tandem at the Wright Nuclear Structure Lab at Yale University was used to obtain the ratio of fission probabilities for {sup 238}U/ {sup 236}U and {sup 237}U/ {sup 239}U populated using the {sup 236,238}U(d,d'f) and {sup 236,238}U(d,pf) reactions. Results from these experiments are presented and the implications for the surrogate reaction technique are discussed.

  15. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  16. Drug hypersensitivity reactions involving skin.

    PubMed

    Hausmann, Oliver; Schnyder, Benno; Pichler, Werner J

    2010-01-01

    Immune reactions to drugs can cause a variety of diseases involving the skin, liver, kidney, lungs, and other organs. Beside immediate, IgE-mediated reactions of varying degrees (urticaria to anaphylactic shock), many drug hypersensitivity reactions appear delayed, namely hours to days after starting drug treatment, showing a variety of clinical manifestations from solely skin involvement to fulminant systemic diseases which may be fatal. Immunohistochemical and functional studies of drug-specific T cells in patients with delayed reactions confirmed a predominant role for T cells in the onset and maintenance of immune-mediated delayed drug hypersensitivity reactions (type IV reactions). In these reactions, drug-specific CD4+ and CD8+ T cells are stimulated by drugs through their T cell receptors (TCR). Drugs can stimulate T cells in two ways: they can act as haptens and bind covalently to larger protein structures (hapten-carrier model), inducing a specific immune response. In addition, they may accidentally bind in a labile, noncovalent way to a particular TCR of the whole TCR repertoire and possibly also major histocompatibility complex (MHC)-molecules - similar to their pharmacologic action. This seems to be sufficient to reactivate certain, probably in vivo preactivated T cells, if an additional interaction of the drug-stimulated TCR with MHC molecules occurs. The mechanism was named pharmacological interaction of a drug with (immune) receptor and thus termed the p-i concept. This new concept may explain the frequent skin symptoms in drug hypersensitivity to oral or parenteral drugs. Furthermore, the various clinical manifestations of T cell-mediated drug hypersensitivity may be explained by distinct T cell functions leading to different clinical phenotypes. These data allowed a subclassification of the delayed hypersensitivity reactions (type IV) into T cell reactions which, by releasing certain cytokines and chemokines, preferentially activate and recruit

  17. Standard Gibbs Energy of Metabolic Reactions: I. Hexokinase Reaction.

    PubMed

    Meurer, Florian; Bobrownik, Maria; Sadowski, Gabriele; Held, Christoph

    2016-10-11

    The standard Gibbs energy of reaction enables calculation of the driving force of a (bio)chemical reaction. Gibbs energies of reaction are required in thermodynamic approaches to determine fluxes as well as single reaction conversions of metabolic bioreactions. The hexokinase reaction (phosphorylation of glucose) is the entrance step of glycolysis, and thus its standard Gibbs energy of reaction (Δ(R)g°) is of great impact. Δ(R)g° is accessible from equilibrium measurements, and the very small concentrations of the reacting agents cause usually high error bars in data reduction steps. Even worse, works from literature do not account for the nonideal behavior of the reacting agents (activity coefficients were assumed to be unity); thus published Δ(R)g° values are not standard data. Consistent treatment of activity coefficients of reacting agents is crucial for the accurate determination of standard Gibbs energy from equilibrium measurements. In this work, equilibrium molalities of hexokinase reaction were measured with an enzyme kit. These results were combined with reacting agents' activity coefficients obtained with the thermodynamic model ePC-SAFT. Pure-component parameters for adenosine triphosphate (ATP) and adenosine diphosphate (ADP) were fitted to experimental osmotic coefficients (water + Na2ATP, water + NaADP). Δ(R)g° of the hexokinase reaction at 298.15 K and pH 7 was found to be -17.83 ± 0.52 kJ·mol(-1). This value was compared with experimental literature data; very good agreement between the different Δ(R)g° values was obtained by accounting for pH, pMg, and the activity coefficients of the reacting agents.

  18. Freeze Enhanced Halate Halide Reactions

    NASA Astrophysics Data System (ADS)

    Newberg, J. T.; Weaver, K.; Broderick, A.

    2014-12-01

    Relatively little is known about halate ion species (XO3-; X = I, Br, Cl) in atmospheric condensed phases. It was initial thought that iodate was a terminal stable species upon iodide oxidation. However, it is becoming increasingly recognized that reactions involving iodate can lead to reactive iodine, and this chemistry is accelerated under acidic conditions. The environmental concentrations and chemistry of bromate and chlorate are largely unexplored in environmental ices. We present results from a series of aqueous phase halate ion reactions with halides under acidic conditions, showing that the kinetics are strongly enhanced upon freezing. The products of these reactions are reactive halogens, which have important implications to marine boundary layer chemistry.

  19. Magnetically suspended reaction wheel assembly

    NASA Technical Reports Server (NTRS)

    Stocking, G.

    1984-01-01

    The magnetically suspended reaction wheel assembly (MSRWA) is the product of a development effort funded by the Air Force Materials Laboratory (AFML) at Wright Patterson AFB. The specific objective of the project was to establish the manufacturing processes for samarium cobalt magnets and demonstrate their use in a space application. The development was successful on both counts. The application portion of the program, which involves the magnetically suspended reaction wheel assembly, is emphasized. The requirements for the reaction wheel were based on the bias wheel requirements of the DSP satellite. The tasks included the design, fabrication, and test of the unit to the DSP program qualification requirements.

  20. Adverse reactions to tetanus toxoid.

    PubMed

    Jacobs, R L; Lowe, R S; Lanier, B Q

    1982-01-01

    A retrospective review of 740 charts of patients with a history of adverse reaction to tetanus toxoid immunization was undertaken. The most common reactions, by history, were local edema and tenderness (33%), fever (15%), and anaphylactoid response (33%). Three patients who had a vesicular eruption at the immunization site were found to have delayed hypersensitivity to mercury. Thirty percent of the patients had received tetanus toxoid within one year and 55% within five years of evaluation. Reactive responses to immediate skin tests were exceedingly rare (less than 1%). None of the challenge patients suffered an adverse reaction.

  1. [Arthropod bite reactions and pyodermias].

    PubMed

    Hengge, U R

    2008-08-01

    Tourists in the tropics often develop reactions to bites or stings of mosquitoes, fleas, mites, ants, bedbugs, beetles, larva, millipedes, spiders and scorpions. In addition, they may have fresh or salt water exposure to sponges, corals, jellyfish and sea urchins with resultant injury and inflammation. Bacterial skin infections (pyodermias) can follow bites or stings as well as mechanical trauma. The most common bacteria involved in skin infections are staphylococci and streptococci. For tourists, bacterial infections are often complicating a pruritic bite reaction and scratching. It is important to know the cause of the bite reaction and pyoderma in order to take appropriate therapeutic measures.

  2. Hypersensitivity reactions to biologic agents.

    PubMed

    Vultaggio, Alessandra; Castells, Mariana C

    2014-08-01

    Biologic agents (BAs) are important therapeutic tools; their use has rapidly expanded and they are used in oncology, immunology, and inflammatory diseases. Their use may be limited, however, by adverse drug reactions. This article reviews the current literature on clinical presentation and pathogenic mechanisms of both acute and delayed reactions. In addition, procedures for management of BA-induced reactions, including preventive and diagnostic work-up, are provided. Lastly, this article summarizes the current knowledge of desensitization to several widely used monoclonal antibodies. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Catalytic Organometallic Reactions of Ammonia

    PubMed Central

    Klinkenberg, Jessica L.

    2012-01-01

    Until recently, ammonia had rarely succumbed to catalytic transformations with homogeneous catalysts, and the development of such reactions that are selective for the formation of single products under mild conditions has encountered numerous challenges. However, recently developed catalysts have allowed several classes of reactions to create products with nitrogen-containing functional groups from ammonia. These reactions include hydroaminomethylation, reductive amination, alkylation, allylic substitution, hydroamination, and cross-coupling. This Minireview describes examples of these processes and the factors that control catalyst activity and selectivity. PMID:20857466

  4. Coarctate cyclization reactions: a primer.

    PubMed

    Young, Brian S; Herges, Rainer; Haley, Michael M

    2012-10-04

    The cleavage of five-membered heterocycles possessing an exocyclic carbene or nitrene to form conjugated ene-ene-yne systems has been documented for over 40 years; however, the reverse reaction, using a conjugated "ene-ene-yne" precursor to form a heterocycle is a relatively new approach. Over the past decade, the Haley and Herges groups have studied computationally and experimentally the cyclization of the "hetero-ene-ene-yne" motif via an unusual class of concerted reactions known as coarctate reactions. This feature article details our synthetic and mechanistic work involving triazene-arene-alkynes and structurally-related systems to generate heterocycles using coarctate chemistry.

  5. Bioluminescent Reaction by Immobilized Luciferase

    NASA Astrophysics Data System (ADS)

    Tanaka, Ryuta; Takahama, Eriko; Iinuma, Masataka; Ikeda, Takeshi; Kadoya, Yutaka; Kuroda, Akio

    We have investigated an effect of immobilization of luciferase molecules at the optical fiber end on a bioluminescent reaction. The time dependence of measured count rates of emitted photons has been analyzed by fitting with numerical solution of differential equations including the effect of the product-inhibitor and the deactivation of the luciferase. Through the analysis, we have successfully extracted kinetic constants such as, reaction rate, number of active luciferase molecules, etc. Ratio of active molecules to total luciferase molecules in immobilization was one order of magnitude lower than that in solution. The reaction rate of the bioluminescent process was also different from the one of free luciferase in solution.

  6. Chemical potential and reaction electronic flux in symmetry controlled reactions.

    PubMed

    Vogt-Geisse, Stefan; Toro-Labbé, Alejandro

    2016-07-15

    In symmetry controlled reactions, orbital degeneracies among orbitals of different symmetries can occur along a reaction coordinate. In such case Koopmans' theorem and the finite difference approximation provide a chemical potential profile with nondifferentiable points. This results in an ill-defined reaction electronic flux (REF) profile, since it is defined as the derivative of the chemical potential with respect to the reaction coordinate. To overcome this deficiency, we propose a new way for the calculation of the chemical potential based on a many orbital approach, suitable for reactions in which symmetry is preserved. This new approach gives rise to a new descriptor: symmetry adapted chemical potential (SA-CP), which is the chemical potential corresponding to a given irreducible representation of a symmetry group. A corresponding symmetry adapted reaction electronic flux (SA-REF) is also obtained. Using this approach smooth chemical potential profiles and well defined REFs are achieved. An application of SA-CP and SA-REF is presented by studying the Cs enol-keto tautomerization of thioformic acid. Two SA-REFs are obtained, JA'(ξ) and JA'' (ξ). It is found that the tautomerization proceeds via an in-plane delocalized 3-center 4-electron O-H-S hypervalent bond which is predicted to exist only in the transition state (TS) region. © 2016 Wiley Periodicals, Inc.

  7. Radiative capture reactions in astrophysics

    DOE PAGES

    Brune, Carl R.; Davids, Barry

    2015-08-07

    Here, the radiative capture reactions of greatest importance in nuclear astrophysics are identified and placed in their stellar contexts. Recent experimental efforts to estimate their thermally averaged rates are surveyed.

  8. Severe cutaneous adverse drug reactions

    PubMed Central

    Verma, Rajesh; Vasudevan, Biju; Pragasam, Vijendran

    2013-01-01

    Severe cutaneous drug reactions are one of the commonest medical challenges presenting to an emergency room in any hospital. The manifestations range from maculopapular rash to severe systemic symptoms like renal failure and cardiovascular compromise. Toxic epidermal necrolysis, erythroderma, drug rash with eosinophilia and systemic symptoms, acute generalised exanthematous pustulosis and drug induced vasculitis are the common cutaneous drug reactions which can have severe morbidity and even mortality. Careful history taking of the lag period after drug intake and associated symptoms, along with detailed examination of the skin, mucosa and various systems, help in early diagnosis of these reactions. Early stoppage of the incriminating drug, specific therapy including corticosteroids, cyclosporine and intravenous immunoglobulin depending on the case along with supportive therapy and local measures help in salvaging most patients. An overview of these important cutaneous drug reactions along with their management is being reviewed in this article. PMID:24600147

  9. Sarcoid type reaction: medical hypotheses.

    PubMed

    Tchernev, G; Chokoeva, A A; Patterson, J W; Wollina, U; Lotti, T

    2015-01-01

    Sarcoid-type reactions could not always be clearly distinct from the independent disease sarcoidosis. Particular attention should be paid to paraneoplastic type of sarcoid reaction which until recent literature was characterized as 1) sarcoidosis associated with tumor disease or 2) sarcoidosis classified and presented as paraneoplastic disease. The analogy between sarcoidosis and paraneoplastic type of sarcoid reaction are the pure epithelioid cell granulomas. The role of molecular mimicry in paraneoplastic type of reaction is probably significant but not yet fully proven and understood. Future studies on this issue should be directed to identify the genetic defects (regarding the inflammasome and those recently established at EOS and Blau Syndrome) as well as screening programs for early detection of cancers, with a view to optimization of the subsequent therapy.

  10. Method for conducting exothermic reactions

    DOEpatents

    Smith, L. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-01-05

    A liquid phase process for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  11. Solar-thermal reaction processing

    DOEpatents

    Weimer, Alan W; Dahl, Jaimee K; Lewandowski, Allan A; Bingham, Carl; Raska Buechler, Karen J; Grothe, Willy

    2014-03-18

    In an embodiment, a method of conducting a high temperature chemical reaction that produces hydrogen or synthesis gas is described. The high temperature chemical reaction is conducted in a reactor having at least two reactor shells, including an inner shell and an outer shell. Heat absorbing particles are included in a gas stream flowing in the inner shell. The reactor is heated at least in part by a source of concentrated sunlight. The inner shell is heated by the concentrated sunlight. The inner shell re-radiates from the inner wall and heats the heat absorbing particles in the gas stream flowing through the inner shell, and heat transfers from the heat absorbing particles to the first gas stream, thereby heating the reactants in the gas stream to a sufficiently high temperature so that the first gas stream undergoes the desired reaction(s), thereby producing hydrogen or synthesis gas in the gas stream.

  12. Alternative view of enzyme reactions.

    PubMed Central

    Dewar, M J; Storch, D M

    1985-01-01

    Since adsorption of the substrate in the active site of an enzyme can occur only if all solvent is squeezed out from between them, any reaction between them takes place in the absence of any intervening solvent--i.e., as it would in the gas phase. Recent work has shown that ionic reactions in the gas phase often differ greatly from analogous processes in solution. Therefore, current interpretations of enzyme reactions in terms of solution chemistry are misguided. The large rates and specificity of enzyme reactions may be due simply to elimination of the solvent. The cleavage of peptides by chymotrypsin and carboxypeptidase A can be interpreted satisfactorily in this way. PMID:3857576

  13. Transfer reactions in nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    Bardayan, D. W.

    2016-08-01

    To a high degree many aspects of the large-scale behavior of objects in the Universe are governed by the underlying nuclear physics. In fact the shell structure of nuclear physics is directly imprinted into the chemical abundances of the elements. The tranquility of the night sky is a direct result of the relatively slow rate of nuclear reactions that control and determines a star’s fate. Understanding the nuclear structure and reaction rates between nuclei is vital to understanding our Universe. Nuclear-transfer reactions make accessible a wealth of knowledge from which we can extract much of the required nuclear physics information. A review of transfer reactions for nuclear astrophysics is presented with an emphasis on the experimental challenges and opportunities for future development.

  14. Experimental Study of Serpentinization Reactions

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Brearley, A. J.; Ganguly, J.; Liermann, H.-P.; Keil, K.

    2004-01-01

    Current carbonaceous chondrite parent-body thermal models [1-3] produce scenarios that are inconsistent with constraints on aqueous alteration conditions based on meteorite mineralogical evidence, such as phase stability relationships within the meteorite matrix minerals [4] and isotope equilibration arguments [5, 6]. This discrepancy arises principally because of the thermal runaway effect produced by silicate hydration reactions (here loosely called serpentinization, as the principal products are serpentine minerals), which are so exothermic as to produce more than enough heat to melt more ice and provide a self-sustaining chain reaction. One possible way to dissipate the heat of reaction is to use a very small parent body [e.g., 2] or possibly a rubble pile model. Another possibility is to release this heat more slowly, which depends on the alteration reaction path and kinetics.

  15. Method for conducting exothermic reactions

    DOEpatents

    Smith, Jr., Lawrence; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  16. Reaction Dynamics at Liquid Interfaces

    NASA Astrophysics Data System (ADS)

    Benjamin, Ilan

    2015-04-01

    The liquid interface is a narrow, highly anisotropic region, characterized by rapidly varying density, polarity, and molecular structure. I review several aspects of interfacial solvation and show how these affect reactivity at liquid/liquid interfaces. I specifically consider ion transfer, electron transfer, and SN2 reactions, showing that solvent effects on these reactions can be understood by examining the unique structure and dynamics of the liquid interface region.

  17. Radiation reaction reconsidered (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Ruhl, Hartmut

    2017-05-01

    Starting from first principles the physics of radiation reaction for strong laser fields interacting with electrons and positrons is revisited. With the help of a Wigner formulation of QED a derivation of a system of molecular dynamical (MD) equations of motion with a new radiation reaction term and spin is given. The new equations obtained are delay equations which promise to be void of the problems encountered with the LAD theory.

  18. Vibrational excitation induces double reaction.

    PubMed

    Huang, Kai; Leung, Lydie; Lim, Tingbin; Ning, Zhanyu; Polanyi, John C

    2014-12-23

    Electron-induced reaction at metal surfaces is currently the subject of extensive study. Here, we broaden the range of experimentation to a comparison of vibrational excitation with electronic excitation, for reaction of the same molecule at the same clean metal surface. In a previous study of electron-induced reaction by scanning tunneling microscopy (STM), we examined the dynamics of the concurrent breaking of the two C-I bonds of ortho-diiodobenzene physisorbed on Cu(110). The energy of the incident electron was near the electronic excitation threshold of E0=1.0 eV required to induce this single-electron process. STM has been employed in the present work to study the reaction dynamics at the substantially lower incident electron energies of 0.3 eV, well below the electronic excitation threshold. The observed increase in reaction rate with current was found to be fourth-order, indicative of multistep reagent vibrational excitation, in contrast to the first-order rate dependence found earlier for electronic excitation. The change in mode of excitation was accompanied by altered reaction dynamics, evidenced by a different pattern of binding of the chemisorbed products to the copper surface. We have modeled these altered reaction dynamics by exciting normal modes of vibration that distort the C-I bonds of the physisorbed reagent. Using the same ab initio ground potential-energy surface as in the prior work on electronic excitation, but with only vibrational excitation of the physisorbed reagent in the asymmetric stretch mode of C-I bonds, we obtained the observed alteration in reaction dynamics.

  19. Cutaneous adverse reactions to lenalidomide.

    PubMed

    Imbesi, S; Allegra, A; Calapai, G; Musolino, C; Gangemi, S

    2015-01-01

    Lenalidomide is an immunomodulatory drug (IMiD) used principally in the treatment of multiple myeloma (MM), myelodysplastic syndromes (MS) and amyloidosis. Adverse reactions related to lenalidomide include myelosuppression (mainly neutropenia but also thrombocytopenia), gastrointestinal problems, skin eruption, atrial fibrillation and asthenia, decreased peripheral blood stem cell yield during stem cell collection, venous thromboembolism, and secondary malignances. In this review we focused our attention on the cutaneous adverse reactions to lenalidomide.

  20. Adverse reactions to food additives.

    PubMed

    Simon, R A

    1986-01-01

    There are thousands of agents that are intentionally added to the food that we consume. These include preservatives, stabilizers, conditioners, thickeners, colorings, flavorings, sweeteners, antioxidants, etc. etc. Yet only a surprisingly small number have been associated with hypersensitivity reactions. Amongst all the additives, FD&C dyes have been most frequently associated with adverse reactions. Tartrazine is the most notorious of them all; however, critical review of the medical literature and current Scripps Clinic studies would indicate that tartrazine has been confirmed to be at best only occasionally associated with flares of urticaria or asthma. There is no convincing evidence in the literature of reactivity to the other azo or nonazo dyes. This can also be said of BHA/BHT, nitrites/nitrates and sorbates. Parabens have been shown to elicit IgE mediated hypersensitivity reactions when used as pharmaceutical preservatives; however, as with the other additives noted above, ingested parabens have only occasionally been associated with adverse reactions. MSG, the cause of the 'Chinese restaurant syndrome' has only been linked to asthma in one report. Sulfiting agents used primarily as food fresheners and to control microbial growth in fermented beverages have been established as the cause of any where from mild to severe and even fatal reactions in at least 5% of the asthmatic population. Other reactions reported to follow sulfite ingestion include anaphylaxis, gastro intestinal complaints and dermatological eruptions. The prevalence of these non asthmatic reactions is unknown. The mechanism of sulfite sensitive asthma is also unknown but most likely involves hyperreactivity to inhale SO2 in the great majority of cases; however, there are reports of IgE mediated reactions and other sulfite sensitive asthmatics have been found with low levels of sulfite oxidase; necessary to oxidize endogenous sulfite to sulfate.