Science.gov

Sample records for knock-out reactions

  1. Proton Knock-Out in Hall A

    SciTech Connect

    Kees de Jager

    2002-06-01

    Proton knock-out is studied in a broad program in Hall A at Jefferson Lab. The first experiment performed in Hall A studied the {sup 16}O(e,e'p) reaction. Since then proton knock-out experiments have studied a variety of aspects of that reaction, from single-nucleon properties to its mechanism, such as final-state interactions and two-body currents, in nuclei from {sup 2}H to {sup 16}O. In this review the results of this program will be summarized and an outlook given of future accomplishments.

  2. Bex1 knock out mice show altered skeletal muscle regeneration

    SciTech Connect

    Koo, Jae Hyung Smiley, Mark A.; Lovering, Richard M.; Margolis, Frank L.

    2007-11-16

    Bex1 and Calmodulin (CaM) are upregulated during skeletal muscle regeneration. We confirm this finding and demonstrate the novel finding that they interact in a calcium-dependent manner. To study the role of Bex1 and its interaction with CaM in skeletal muscle regeneration, we generated Bex1 knock out (Bex1-KO) mice. These mice appeared to develop normally and are fertile, but displayed a functional deficit in exercise performance compared to wild type (WT) mice. After intramuscular injection of cardiotoxin, which causes extensive and reproducible myotrauma followed by recovery, regenerating muscles of Bex1-KO mice exhibited elevated and prolonged cell proliferation, as well as delayed cell differentiation, compared to WT mice. Thus, our results provide the first evidence that Bex1-KO mice show altered muscle regeneration, and allow us to propose that the interaction of Bex1 with Ca{sup 2+}/CaM may be involved in skeletal muscle regeneration.

  3. Accelerated retinal aging in PACAP knock-out mice.

    PubMed

    Kovács-Valasek, Andrea; Szabadfi, Krisztina; Dénes, Viktória; Szalontai, Bálint; Tamás, Andrea; Kiss, Péter; Szabó, Aliz; Setalo, Gyorgy; Reglődi, Dóra; Gábriel, Robert

    2017-02-13

    Pituitary adenylate cyclase activating polypeptide (PACAP) is a neurotrophic and neuroprotective peptide. PACAP and its receptors are widely distributed in the retina. A number of reports provided evidence that PACAP is neuroprotective in retinal degenerations. The current study compared retina cell type-specific differences in young (3-4months) and aged adults (14-16months), of wild-type (WT) mice and knock-out (KO) mice lacking endogenous PACAP production during the course of aging. Histological, immunocytochemical and Western blot examinations were performed. The staining for standard neurochemical markers (tyrosine hydroxylase for dopaminergic cells, calbindin 28 kDa for horizontal cells, protein kinase Cα for rod bipolar cells) of young adult PACAP KO retinas showed no substantial alterations compared to young adult WT retinas, except for the specific PACAP receptor (PAC1-R) staining. We could not detect PAC1-R immunoreactivity in bipolar and horizontal cells in young adult PACAP KO animals. Some other age-related changes were observed only in the PACAP KO mice only. These alterations included horizontal and rod bipolar cell dendritic sprouting into the photoreceptor layer and decreased ganglion cell number. Also, Müller glial cells showed elevated GFAP expression compared to the aging WT retinas. Furthermore, Western blot analyses revealed significant differences between the phosphorylation state of ERK1/2 and JNK in KO mice, indicating alterations in the MAPK signaling pathway. These results support the conclusion that endogenous PACAP contributes to protection against aging of the nervous system.

  4. IL-4 Knock Out Mice Display Anxiety-Like Behavior.

    PubMed

    Moon, Morgan L; Joesting, Jennifer J; Blevins, Neil A; Lawson, Marcus A; Gainey, Stephen J; Towers, Albert E; McNeil, Leslie K; Freund, Gregory G

    2015-07-01

    Inflammation is a recognized antecedent and coincident factor when examining the biology of anxiety. Little is known, however, about how reductions in endogenous anti-inflammatory mediators impact anxiety. Therefore, mood- cognition- and anxiety-associated/like behaviors were examined in IL-4 knock out (KO) mice and wild-type (WT) mice. In comparison to WT mice, IL-4 KO mice demonstrated decreased burrowing and increased social exploration. No differences were seen in forced swim or saccharine preference testing. IL-4 KO mice had similar performance to WT mice in the Morris water maze and during object location and novel object recognition. In the elevated zero-maze, IL-4 KO mice, in comparison to WT mice, demonstrated anxiety-like behavior. Anxiety-like behavior in IL-4 KO mice was not observed, however, during open-field testing. Taken together, these data indicate that IL-4 KO mice display state, but not trait, anxiety suggesting that reductions in endogenous anti-inflammatory bioactives can engender subtypes of anxiety.

  5. IL-4 Knock out Mice Display Anxiety-like Behavior

    PubMed Central

    Moon, Morgan L.; Joesting, Jennifer J.; Blevins, Neil A.; Lawson, Marcus A.; Gainey, Stephen J.; Towers, Albert E.; McNeil, Leslie K.; Freund, Gregory G.

    2015-01-01

    Inflammation is a recognized antecedent and coincident factor when examining the biology of anxiety. Little is known, however, about how reductions in endogenous anti-inflammatory mediators impact anxiety. Therefore, mood- cognition- and anxiety-associated/like behaviors were examined in IL-4 knock out (KO) mice and wild-type (WT) mice. In comparison to WT mice, IL-4 KO mice demonstrated decreased burrowing and increased social exploration. No differences were seen in forced swim or saccharine preference testing. IL-4 KO mice had similar performance to WT mice in the Morris water maze and during object location and novel object recognition. In the elevated zero-maze, IL-4 KO mice, in comparison to WT mice, demonstrated anxiety-like behavior. Anxiety-like behavior in IL-4 KO mice was not observed, however, during open-field testing. Taken together, these data indicate that IL-4 KO mice display state, but not trait, anxiety suggesting that reductions in endogenous anti-inflammatory bioactives can engender subtypes of anxiety. PMID:25772794

  6. Characterization of TG2 and TG1-TG2 double knock-out mouse epidermis.

    PubMed

    Pitolli, Consuelo; Pietroni, Valentina; Marekov, Lyuben; Terrinoni, Alessandro; Yamanishi, Kiyofumi; Mazzanti, Cinzia; Melino, Gerry; Candi, Eleonora

    2017-03-01

    Transglutaminases (TGs) are a family of enzymes that catalyse the formation of isopeptide bonds between the γ-carboxamide groups of glutamine residues and the ε-amino groups of lysine residues leading to cross-linking reactions among proteins. Four members, TG1, TG2, TG3, and TG5, of the nine mammalian enzymes are expressed in the skin. TG1, TG3 and TG5 crosslinking properties are fundamental for cornified envelope assembly. In contrast, the role of TG2 in keratinization has never been studied at biochemical level in vivo. In this study, taking advantage of the TG2 knock-out (KO) and TG1 heterozygous mice, we generated and characterized the epidermis of TG1-TG2 double knock-out (DKO) mice. We performed morphological analysis of the epidermis and evaluation of the expression of differentiation markers. In addition, we performed analysis of the amino acid composition from isolated corneocytes. We found a significant change in amino acid composition in TG1KO cornified cell envelopes (CEs) while TG2KO amino acid composition was similar to wild-type CEs. Our results confirm a key role of TG1 in skin differentiation and CE assembly and demonstrate that TG2 is not essential for CE assembly and skin formation.

  7. Proton knock-out from tensor polarized deuterium

    SciTech Connect

    E. Passchier; M. Ferro-Luzzi; Z.-L. Zhou; T. Botto; M. Bouwhuis; J. F. J. van den Brand; D. Dimitroyannis; M. Doets; Kees de Jager; J. Konijn; D. J. J. de Lange; G. J. Nooren; N. Papadakis; I. Passchier; P. Salle; J. J. M. Steijger; N. Vodinas; H. de Vries; C. Zegers; Ricardo Alarcon; Seonho Choi; Joseph Comfort; D. M. Nikolenko; S. G. Popov; Igor Rachek; J. Lang; H. Arenhoevel; Rolf Ent; W. Leidemann; M. Bucholz; H. J. Bulten; Mike Miller; J. S. Neal; O. Unal

    1994-09-01

    A status report is given on experiment 91-12, which is the first internal target experiment performed at the internal target facility of NIKHEF. The aim of this experiment is to measure the asymmetry in the (e,e'p) reaction from a tensor polarized deuterium target with unpolarized electrons. An update on the experimental setup and results of an extensive set of test measurements are presented.

  8. Knock-Outs, Stick-Outs, Cut-Outs: Clipping Paths Separate Objects from Background.

    ERIC Educational Resources Information Center

    Wilson, Bradley

    1998-01-01

    Outlines a six-step process that allows computer operators, using Photoshop software, to create "knock-outs" to precisely define the path that will serve to separate the object from the background. (SR)

  9. Photodynamic therapy and knocking out of single tumor cells by multiphoton excitation processes

    NASA Astrophysics Data System (ADS)

    Riemann, Iris; Fischer, Peter; Koenig, Karsten

    2004-09-01

    Near infrared (NIR) ultrashort laser pulses of 780 nm have been used to induce intracellular photodynamic reactions by nonlinear excitation of porphyrin photosensitizers. Intracellular accumulation and photobleaching of the fluorescent photosensitizers protoporphyrin IX and Photofrin (PF) have been studied by non-resonant two-photon fluorescence excitation of PF and aminolevulinic acid (ALA)-labeled Chinese hamster ovary (CHO) cells. To testify the efficacy of both substrates to induce irreversible destructive effects, the cloning efficiency (CE) of cells exposed to femtosecond pulses of a multiphoton laser scanning microscope (40x/1.3) was determined. In the case of Photofrin accumulation, CEs of 50% and 0% were obtained after 17 laserscans (2 mW?, 16 s/ frame) and 50 scans, respectively. All cells exposed to 50 scans died within 48h after laser exposure. 100 scans were required to induce lethal effects in ALA labeled cells. Sensitizer-free control cells could be scanned 250 times (1.1 h) and more without impact on the reproduction behavior, morphology, and vitality. In addition to the slow phototoxic effect by photooxidation processes, another destructive but immediate effect based on optical breakdown was induced when employing high intense NIR femtosecond laser beams. This was used to optically knock out single tumor cells in living mice (solid Ehrlich-Carcinoma) in a depth of 10 to 100 μm.

  10. Orthogonal gene knock out and activation with a catalytically active Cas9 nuclease

    PubMed Central

    Dahlman, James E.; Abudayyeh, Omar O.; Joung, Julia; Gootenberg, Jonathan S.; Zhang, Feng; Konermann, Silvana

    2015-01-01

    We have developed a CRISPR-based method that uses catalytically active Cas9 and distinct sgRNA constructs to knock out and activate different genes in the same cell. These sgRNAs, with 14 15 bp target sequences and MS2 binding loops, can activate gene expression using an active Cas9 nuclease, without inducing DSBs. We use these ‘dead RNAs’ to perform orthogonal gene knockout and transcriptional activation in human cells. PMID:26436575

  11. Oxygen Knock-Out and Other Studies in -Irradiated Polycrystalline Bi-2212 Superconductor

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, S. K.; Ghosh, A. K.; Barat, P.; Sen, Pintu; Basu, A. N.; Ghosh, B.

    1997-08-01

    Bulk polycrystalline samples of Bi2Sr2CaCu2O8+x (Bi-2212) have been irradiated with 40 MeV -particles. Tc increases up to a certain dose. The increase in Tc is correlated with the knock-out of oxygen, which has been verified by the determination of the oxygen contents of the irradiated samples by iodometry. A model of the knock-out of oxygen is proposed on the basis of Monte-Carlo TRIM calculations. Resistivity versus temperature of the irradiated samples shows fairly metallic behaviour up to a certain dose. Excess conductivity analysis shows a cross-over from 2D to 3D behaviour in conductivity for the unirradiated sample. However, for irradiated samples, the critical fluctuation regime sets in. The interlayer coupling strengths decrease with the increase in the irradiation dose. The sample with the highest dose shows a nonmetallic behaviour in resistivity. A detailed analysis shows a conductivity behaviour in the nonmetallic region characteristic of three-dimensional variable range hopping of charge carriers.

  12. Monitoring concussion in a knocked-out boxer by CSF biomarker analysis.

    PubMed

    Neselius, Sanna; Brisby, Helena; Granholm, Fredrik; Zetterberg, Henrik; Blennow, Kaj

    2015-09-01

    Concussion is common in many sports, and the incidence is increasing. The medical consequences after a sport-related concussion have received increased attention in recent years since it is known that concussions cause axonal and glial damage, which disturbs the cerebral physiology and makes the brain more vulnerable for additional concussions. This study reports on a knocked-out amateur boxer in whom cerebrospinal fluid (CSF) neurofilament light (NFL) protein, reflecting axonal damage, was used to identify and monitor brain damage. CSF NFL was markedly increased during 36 weeks, suggesting that neuronal injury persists longer than expected after a concussion. CSF biomarker analysis may be valuable in the medical counselling of concussed athletes and in return-to-play considerations.

  13. Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila.

    PubMed

    Xue, Zhaoyu; Ren, Mengda; Wu, Menghua; Dai, Junbiao; Rong, Yikang S; Gao, Guanjun

    2014-03-21

    Bacterial Cas9 nuclease induces site-specific DNA breaks using small gRNA as guides. Cas9 has been successfully introduced into Drosophila for genome editing. Here, we improve the versatility of this method by developing a transgenic system that expresses Cas9 in the Drosophila germline. Using this system, we induced inheritable knock-out mutations by injecting only the gRNA into embryos, achieved highly efficient mutagenesis by expressing gRNA from the promoter of a novel non-coding RNA gene, and recovered homologous recombination-based knock-in of a fluorescent marker at a rate of 4.5% by co-injecting gRNA with a circular DNA donor.

  14. Mildly Increased Mechanical Nociceptive Sensitivity in REV-ERBα Knock-out Mice

    PubMed Central

    Lee, Jaehyun; Ko, Hyoung-Gon; Kim, Kyungjin

    2016-01-01

    Nociception is one of the most complex senses that is affected not only by external stimulation but also internal conditions. Previous studies have suggested that circadian rhythm is important in modulating nociception. REV-ERBα knock-out (KO) mice have disrupted circadian rhythm and altered mood-related phenotypes. In this study, we examined the role of REV-ERBα in inflammatory nociception. We found that the nociceptive sensitivity of KO mice was partially enhanced in mechanical nociception. However, this partial alteration was independent of the circadian rhythm. Taken together, deletion of REV-ERBα induced a mild change in mechanical nociceptive sensitivity but this alteration was not dependent on the circadian rhythm. PMID:28035185

  15. Transgenic gene knock-outs: functional genomics and therapeutic target selection.

    PubMed

    Harris, S; Foord, S M

    2000-11-01

    The completion of the first draft of the human genome presents both a tremendous opportunity and enormous challenge to the pharmaceutical industry since the whole community, with few exceptions, will soon have access to the same pool of candidate gene sequences from which to select future therapeutic targets. The commercial imperative to select and pursue therapeutically relevant genes from within the overall content of the genome will be particularly intense for those gene families that currently represent the chemically tractable or 'drugable' gene targets. As a consequence the emphasis within exploratory research has shifted towards the evaluation and adoption of technology platforms that can add additional value to the gene selection process, either through functional studies or direct/indirect measures of disease alignment e.g., genetics, differential gene expression, proteomics, tissue distribution, comparative species data etc. The selection of biological targets for the development of potential new medicines relies, in part, on the quality of the in vivo biological data that correlates a particular molecular target with the underlying pathophysiology of a disease. Within the pharmaceutical industry, studies employing transgenic animals and, in particular, animals with specific gene deletions are playing an increasingly important role in the therapeutic target gene selection, drug candidate selection and product development phases of the overall drug discovery process. The potential of phenotypic information from gene knock-outs to contribute to a high-throughput target selection/validation strategy has hitherto been limited by the resources required to rapidly generate and characterise a large number of knock-out transgenics in a timely fashion. The offerings of several companies that provide an opportunity to overcome these hurdles, albeit at a cost, are assessed with respect to the strategic business needs of the pharmaceutical industry.

  16. Uptake and catabolism of modified LDL in scavenger-receptor class A type I/II knock-out mice.

    PubMed Central

    Van Berkel, T J; Van Velzen, A; Kruijt, J K; Suzuki, H; Kodama, T

    1998-01-01

    The liver is the major organ responsible for the uptake of modified low-density lipoprotein (LDL) from the blood circulation, with endothelial and Kupffer cells as major cellular uptake sites. Scavenger-receptors, which include various classes, are held responsible for this uptake. Mice deficient in scavenger-receptor class A types I and II were created and the fate of acetylated LDL (Ac-LDL) in vivo and its interaction with liver endothelial, Kupffer and peritoneal macrophages was characterized. Surprisingly, the decay in vivo (t12 < 2 min), tissue distribution and liver uptake (at 5 min it was 77.4 +/- 4.6% of the injected dose) of Ac-LDL in the knock-out mice were not significantly different from control mice (t12 < 2 min and liver uptake 79.1 +/- 4.6% of the injected dose). A separation of mice liver cells into parenchymal, endothelial and Kupffer cells 10 min after injection of Ac-LDL indicated that in both control and knock-out mice the liver endothelial cells were responsible for more than 70% of the liver uptake. Both in control and knock-out mice, preinjection of polyinosinic acid (poly I, 200 microg) completely blocked the liver uptake, indicating that both in control and knock-out mice the scavenger-receptors are sensitive to poly I. Preinjection of suboptimal poly I concentrations (20 and 50 microg) provided evidence that the serum decay and liver uptake of Ac-LDL is more readily inhibited in the knock-out mice as compared with the control mice, indicating less efficient removal of Ac-LDL in vivo in the knock-out mice under these conditions. Studies in vitro with isolated liver endothelial and Kupffer cells from knock-out mice indicate that the cell association of Ac-LDL during 2 h at 37 degrees C is 50 and 53% of the control, respectively, whereas the degradation reaches values of 58 and 63%. For peritoneal macrophages from knock-out mice the cell association of Ac-LDL was identical to the control mice whereas the Ac-LDL degradation in cells from the

  17. Arterial Remodeling in B-Type Natriuretic Peptide Knock-Out Females

    PubMed Central

    Holditch, Sara J.; Schreiber, Claire A.; Burnett, John C.; Ikeda, Yasuhiro

    2016-01-01

    Sexual dimorphisms are recognized in cardiovascular conditions such as hypertension, stroke, thrombosis and vasculitis. B-type natriuretic peptide (BNP) is a guanylyl cyclase A (GC-A) agonist. The anti-hypertensive, vasodilatory, anti-fibrotic, and anti-hypertrophic properties of BNP are well established in male animal models. Although circulating BNP levels are higher in women, when compared to age-matched men, the cardiovascular protective propensity of BNP in females is poorly understood. We assessed the cardiovascular consequences of BNP deletion in genetically null (Nppb−/−) female rat lines. Throughout the study, blood pressure (BP) remained uninfluenced by genotype, and cardiorenal consequences of BNP knock out remained minor. Unexpectedly, approximately 60% of Nppb−/− females developed mesenteric polyarteritis-nodosa (PAN)-like vasculitis in their life span, some as early as 4 months of age. Mesenteric lesions involved intense arterial remodeling, progressive inflammation, occluded lumens, and less frequently intestinal necrosis and multiple visceral arterial aneurysms. Cumulative pathologies resulted in a significant decline in survival of the Nppb−/− female. This study highlights BNP’s vasoprotective propensity, bringing to light a possible sex specific difference in the cardiovascular protection provided by BNP. Defects in the BNP/GC-A/cGMP pathway may play a role in arteriopathies in women, while GC-A agonists may provide effective therapy for arteritis. PMID:27162120

  18. Norepinephrine transporter knock-out alters expression of the genes connected with antidepressant drugs action.

    PubMed

    Solich, Joanna; Kolasa, Magdalena; Kusmider, Maciej; Faron-Gorecka, Agata; Pabian, Paulina; Zurawek, Dariusz; Szafran-Pilch, Kinga; Dziedzicka-Wasylewska, Marta

    2015-01-12

    Norepinephrine transporter knock-out mice (NET-KO) exhibit depression-resistant phenotypes. They manifest significantly shorter immobility times in both the forced swim test and the tail suspension test. Moreover, biochemical studies have revealed the up-regulation of other monoamine transporters (dopamine and serotonin) in the brains of NET-KO mice, similar to the phenomenon observed after the chronic pharmacological blockade of norepinephrine transporter by desipramine in wild-type (WT) animals. NET-KO mice are also resistant to stress, as we demonstrated previously by measuring plasma corticosterone concentration. In the present study, we used a microdissection technique to separate target brain regions and the TaqMan Low Density Array approach to test the expression of a group of genes in the NET-KO mice compared with WT animals. A group of genes with altered expression were identified in four brain structures (frontal and cingulate cortices, dentate gyrus of hippocampus and basal-lateral amygdala) of NET-KO mice compared with WT mice. These genes are known to be altered by antidepressant drugs administration. The most interesting gene is Crh-bp, which modulates the activity of corticotrophin--releasing hormone (CRH) and several CRH-family members. Generally, genetic disturbances within noradrenergic neurons result in biological changes, such as in signal transduction and intercellular communication, and may be linked to changes in noradrenaline levels in the brains of NET-KO mice.

  19. Schmallenberg virus infection of adult type I interferon receptor knock-out mice.

    PubMed

    Wernike, Kerstin; Breithaupt, Angele; Keller, Markus; Hoffmann, Bernd; Beer, Martin; Eschbaumer, Michael

    2012-01-01

    Schmallenberg virus (SBV), a novel orthobunyavirus, was discovered in Europe in late 2011. It causes mild and transient disease in adult ruminants, but fetal infection can lead to abortion or severe malformations. There is considerable demand for SBV research, but in vivo studies in large animals are complicated by their long gestation periods and the cost of high containment housing. The goal of this study was to investigate whether type I interferon receptor knock-out (IFNAR(-/-)) mice are a suitable small animal model for SBV. Twenty IFNAR(-/-) mice were inoculated with SBV, four were kept as controls. After inoculation, all were observed and weighed daily; two mice per day were sacrificed and blood, brain, lungs, liver, spleen, and intestine were harvested. All but one inoculated mouse lost weight, and two mice died spontaneously at the end of the first week, while another two had to be euthanized. Real-time RT-PCR detected large amounts of SBV RNA in all dead or sick mice; the controls were healthy and PCR-negative. IFNAR(-/-) mice are susceptible to SBV infection and can develop fatal disease, making them a handy and versatile tool for SBV vaccine research.

  20. Characterization of skeletal muscle in the synemin knock-out mouse

    NASA Astrophysics Data System (ADS)

    García-Pelagio, Karla P.; Muriel, Joaquin; Lovering, Richard M.; Lund, Linda; Bond, Meredith; Bloch, Robert J.

    2014-11-01

    Diseases linked to intermediate filament (IF) proteins are associated with defects in the organization of the contractile apparatus of skeletal and cardiac muscle and its links to costameres, which connect the sarcomeres to the cell membrane. Synemin is a large IF protein that associates with dystrobrevin, vinculin, and talin at costameres of the cell membrane of striated muscle, as well as with α-actinin and desmin at the Z disks. Synemin can be expressed in either 210 kDa α- or 180 kDa β- alternatively spliced forms. We generated mice null for synemin by homologous recombination to study synemin's function in skeletal muscle. Skeletal muscle in the knock out (syn KO) mouse does not make synemin mRNA or protein. Preliminary characterization of the syn KO mouse suggests that it has a mild skeletal muscle phenotype. The organization of costameres appears to be normal. Treadmill running uphill test results was not significantly affected when compared to controls at any age. More notably, the biomechanical properties of the cell membrane are different in the syn KO, though they are less affected than by the absence of desmin or dystrophin. These results suggest that the viscoelastic properties of the cell membrane-costamere-myofibril complex are significantly influenced by synemin.

  1. Effects of cinnarizine, a calcium antagonist that produces human parkinsonism, in parkin knock out mice.

    PubMed

    Serrano, A; Menéndez, J; Casarejos, M J; Solano, R M; Gallego, E; Sánchez, M; Mena, M A; García de Yebenes, J

    2005-08-01

    Cinnarizine, a calcium antagonist that produces parkinsonism in humans, induces behavioural changes such as alopecia, buco-lingual dyskinesia and reduction of motor activity in female parkin knock out (PK-KO) mice but not in wild-type (WT) controls. PK-KO mice have high striatal dopamine levels and increased dopamine metabolism in spite of low reduced tyrosine hydroxylase protein. Cinnarizine, which blocks dopamine receptors and increases dopamine release, further increased dopamine metabolism. PK-KO mice increased GSH levels as a compensatory mechanism against enhanced free radical production related to acceleration of dopamine turnover. Neuronal markers, such as beta-tubulin slightly increased in PK-KO and furthermore with cinnarizine. Astroglial markers were decreased in PK-KO mice, and this effect was potentiated by cinnarizine, suggesting abnormal glia in these animals. Microglia was hyperactivated in PK-KO midbrain, suggesting inflammation in these animals. Proapoptotic proteins were increased by cinnarizine and, to a lesser extent, in PK-KO mice. Our data indicate that mutation of parkin is a risk factor for drug-induced parkinsonism.

  2. Impaired sensorimotor gating in Fmr1 knock out and Fragile X premutation model mice.

    PubMed

    Renoux, A J; Sala-Hamrick, K J; Carducci, N M; Frazer, M; Halsey, K E; Sutton, M A; Dolan, D F; Murphy, G G; Todd, P K

    2014-07-01

    Fragile X syndrome (FXS) is a common inherited cause of intellectual disability that results from a CGG repeat expansion in the FMR1 gene. Large repeat expansions trigger both transcriptional and translational suppression of Fragile X protein (FMRP) production. Fragile X-associated Tremor/Ataxia Syndrome (FXTAS) is an allelic neurodegenerative disease caused by smaller "pre-mutation" CGG repeat expansions that enhance FMR1 transcription but lead to translational inefficiency and reduced FMRP expression in animal models. Sensorimotor gating as measured by pre-pulse inhibition (PPI) is altered in both FXS patients and Fmr1 knock out (KO) mice. Similarly, FXTAS patients have demonstrated PPI deficits. Recent work suggests there may be overlapping synaptic defects between Fmr1 KO and CGG knock-in premutation mouse models (CGG KI). We therefore sought to interrogate PPI in CGG KI mice. Using a quiet PPI protocol more akin to human testing conditions, we find that Fmr1 KO animals have significantly impaired PPI. Using this same protocol, we find CGG KI mice demonstrate an age-dependent impairment in PPI compared to wild type (WT) controls. This study describes a novel phenotype in CGG KI mice that can be used in future therapeutic development targeting premutation associated symptoms.

  3. Multiple Cranial Organ Defects after Conditionally Knocking Out Fgf10 in the Neural Crest

    PubMed Central

    Teshima, Tathyane H. N.; Lourenco, Silvia V.; Tucker, Abigail S.

    2016-01-01

    Fgf10 is necessary for the development of a number of organs that fail to develop or are reduced in size in the null mutant. Here we have knocked out Fgf10 specifically in the neural crest driven by Wnt1cre. The Wnt1creFgf10fl/fl mouse phenocopies many of the null mutant defects, including cleft palate, loss of salivary glands, and ocular glands, highlighting the neural crest origin of the Fgf10 expressing mesenchyme surrounding these organs. In contrast tissues such as the limbs and lungs, where Fgf10 is expressed by the surrounding mesoderm, were unaffected, as was the pituitary gland where Fgf10 is expressed by the neuroepithelium. The circumvallate papilla of the tongue formed but was hypoplastic in the conditional and Fgf10 null embryos, suggesting that other sources of FGF can compensate in development of this structure. The tracheal cartilage rings showed normal patterning in the conditional knockout, indicating that the source of Fgf10 for this tissue is mesodermal, which was confirmed using Wnt1cre-dtTom to lineage trace the boundary of the neural crest in this region. The thyroid, thymus, and parathyroid glands surrounding the trachea were present but hypoplastic in the conditional mutant, indicating that a neighboring source of mesodermal Fgf10 might be able to partially compensate for loss of neural crest derived Fgf10. PMID:27826253

  4. Phospholipase D δ knock-out mutants are tolerant to severe drought stress

    PubMed Central

    Distéfano, Ayelen M; Valiñas, Matías A; Scuffi, Denise; Lamattina, Lorenzo; ten Have, Arjen; García-Mata, Carlos; Laxalt, Ana M

    2015-01-01

    Phospholipase D (PLD) is involved in different plant processes, ranging from responses to abiotic and biotic stress to plant development. Phospholipase Dδ (PLDδ) is activated in dehydration and salt stress, producing the lipid second messenger phosphatidic acid. In this work we show that pldδ Arabidopsis mutants were more tolerant to severe drought than wild-type plants. PLDδ has been shown to be required for ABA regulation of stomatal closure of isolated epidermal peels. However, there was no significant difference in stomatal conductance at the whole plant level between wild-type and pldδ mutants. Since PLD hydrolyses structural phospholipids, then we looked at membrane integrity. Ion leakage measurements showed that during dehydration of leaf discs pldδ mutant has less membrane degradation compared to the wild-type. We further analyzed the mutants and showed that pldδ have higher mRNA levels of RAB18 and RD29A compared to wild-type plants under normal growth conditions. Transient expression of AtPLDδ in Nicotiana benthamiana plants induced a wilting phenotype. These findings suggest that, in wt plants PLDδ disrupt membranes in severe drought stress and, in the absence of the protein (PLDδ knock-out) might drought-prime the plants, making them more tolerant to severe drought stress. The results are discussed in relation to PLDδ role in guard cell signaling and drought tolerance. PMID:26340512

  5. Phospholipase D δ knock-out mutants are tolerant to severe drought stress.

    PubMed

    Distéfano, Ayelen M; Valiñas, Matías A; Scuffi, Denise; Lamattina, Lorenzo; Ten Have, Arjen; García-Mata, Carlos; Laxalt, Ana M

    2015-01-01

    Phospholipase D (PLD) is involved in different plant processes, ranging from responses to abiotic and biotic stress to plant development. Phospholipase Dδ (PLDδ) is activated in dehydration and salt stress, producing the lipid second messenger phosphatidic acid. In this work we show that pldδ Arabidopsis mutants were more tolerant to severe drought than wild-type plants. PLDδ has been shown to be required for ABA regulation of stomatal closure of isolated epidermal peels. However, there was no significant difference in stomatal conductance at the whole plant level between wild-type and pldδ mutants. Since PLD hydrolyses structural phospholipids, then we looked at membrane integrity. Ion leakage measurements showed that during dehydration of leaf discs pldδ mutant has less membrane degradation compared to the wild-type. We further analyzed the mutants and showed that pldδ have higher mRNA levels of RAB18 and RD29A compared to wild-type plants under normal growth conditions. Transient expression of AtPLDδ in Nicotiana benthamiana plants induced a wilting phenotype. These findings suggest that, in wt plants PLDδ disrupt membranes in severe drought stress and, in the absence of the protein (PLDδ knock-out) might drought-prime the plants, making them more tolerant to severe drought stress. The results are discussed in relation to PLDδ role in guard cell signaling and drought tolerance.

  6. Granulin Knock Out Zebrafish Lack Frontotemporal Lobar Degeneration and Neuronal Ceroid Lipofuscinosis Pathology

    PubMed Central

    Solchenberger, Barbara; Russell, Claire; Kremmer, Elisabeth; Haass, Christian; Schmid, Bettina

    2015-01-01

    Loss of function mutations in granulin (GRN) are linked to two distinct neurological disorders, frontotemporal lobar degeneration (FTLD) and neuronal ceroid lipofuscinosis (NCL). It is so far unknown how a complete loss of GRN in NCL and partial loss of GRN in FTLD can result in such distinct diseases. In zebrafish, there are two GRN homologues, Granulin A (Grna) and Granulin B (Grnb). We have generated stable Grna and Grnb loss of function zebrafish mutants by zinc finger nuclease mediated genome editing. Surprisingly, the grna and grnb single and double mutants display neither spinal motor neuron axonopathies nor a reduced number of myogenic progenitor cells as previously reported for Grna and Grnb knock down embryos. Additionally, grna−/−;grnb−/− double mutants have no obvious FTLD- and NCL-related biochemical and neuropathological phenotypes. Taken together, the Grna and Grnb single and double knock out zebrafish lack any obvious morphological, pathological and biochemical phenotypes. Loss of zebrafish Grna and Grnb might therefore either be fully compensated or only become symptomatic upon additional challenge. PMID:25785851

  7. Glutaminyl cyclase knock-out mice exhibit slight hypothyroidism but no hypogonadism: implications for enzyme function and drug development.

    PubMed

    Schilling, Stephan; Kohlmann, Stephanie; Bäuscher, Christoph; Sedlmeier, Reinhard; Koch, Birgit; Eichentopf, Rico; Becker, Andreas; Cynis, Holger; Hoffmann, Torsten; Berg, Sabine; Freyse, Ernst-Joachim; von Hörsten, Stephan; Rossner, Steffen; Graubner, Sigrid; Demuth, Hans-Ulrich

    2011-04-22

    Glutaminyl cyclases (QCs) catalyze the formation of pyroglutamate (pGlu) residues at the N terminus of peptides and proteins. Hypothalamic pGlu hormones, such as thyrotropin-releasing hormone and gonadotropin-releasing hormone are essential for regulation of metabolism and fertility in the hypothalamic pituitary thyroid and gonadal axes, respectively. Here, we analyzed the consequences of constitutive genetic QC ablation on endocrine functions and on the behavior of adult mice. Adult homozygous QC knock-out mice are fertile and behave indistinguishably from wild type mice in tests of motor function, cognition, general activity, and ingestion behavior. The QC knock-out results in a dramatic drop of enzyme activity in the brain, especially in hypothalamus and in plasma. Other peripheral organs like liver and spleen still contain QC activity, which is most likely caused by its homolog isoQC. The serum gonadotropin-releasing hormone, TSH, and testosterone concentrations were not changed by QC depletion. The serum thyroxine was decreased by 24% in homozygous QC knock-out animals, suggesting a mild hypothyroidism. QC knock-out mice were indistinguishable from wild type with regard to blood glucose and glucose tolerance, thus differing from reports of thyrotropin-releasing hormone knock-out mice significantly. The results suggest a significant formation of the hypothalamic pGlu hormones by alternative mechanisms, like spontaneous cyclization or conversion by isoQC. The different effects of QC depletion on the hypothalamic pituitary thyroid and gonadal axes might indicate slightly different modes of substrate conversion of both enzymes. The absence of significant abnormalities in QC knock-out mice suggests the presence of a therapeutic window for suppression of QC activity in current drug development.

  8. The Expression of TALEN before Fertilization Provides a Rapid Knock-Out Phenotype in Xenopus laevis Founder Embryos.

    PubMed

    Miyamoto, Kei; Suzuki, Ken-Ichi T; Suzuki, Miyuki; Sakane, Yuto; Sakuma, Tetsushi; Herberg, Sarah; Simeone, Angela; Simpson, David; Jullien, Jerome; Yamamoto, Takashi; Gurdon, J B

    2015-01-01

    Recent advances in genome editing using programmable nucleases have revolutionized gene targeting in various organisms. Successful gene knock-out has been shown in Xenopus, a widely used model organism, although a system enabling less mosaic knock-out in founder embryos (F0) needs to be explored in order to judge phenotypes in the F0 generation. Here, we injected modified highly active transcription activator-like effector nuclease (TALEN) mRNA to oocytes at the germinal vesicle (GV) stage, followed by in vitro maturation and intracytoplasmic sperm injection, to achieve a full knock-out in F0 embryos. Unlike conventional injection methods to fertilized embryos, the injection of TALEN mRNA into GV oocytes allows expression of nucleases before fertilization, enabling them to work from an earlier stage. Using this procedure, most of developed embryos showed full knock-out phenotypes of the pigmentation gene tyrosinase and/or embryonic lethal gene pax6 in the founder generation. In addition, our method permitted a large 1 kb deletion. Thus, we describe nearly complete gene knock-out phenotypes in Xenopus laevis F0 embryos. The presented method will help to accelerate the production of knock-out frogs since we can bypass an extra generation of about 1 year in Xenopus laevis. Meantime, our method provides a unique opportunity to rapidly test the developmental effects of disrupting those genes that do not permit growth to an adult able to reproduce. In addition, the protocol shown here is considerably less invasive than the previously used host transfer since our protocol does not require surgery. The experimental scheme presented is potentially applicable to other organisms such as mammals and fish to resolve common issues of mosaicism in founders.

  9. TRP vanilloid 2 knock-out mice are susceptible to perinatal lethality but display normal thermal and mechanical nociception.

    PubMed

    Park, Una; Vastani, Nisha; Guan, Yun; Raja, Srinivasa N; Koltzenburg, Martin; Caterina, Michael J

    2011-08-10

    TRP vanilloid 2 (TRPV2) is a nonselective cation channel expressed prominently in medium- to large-diameter sensory neurons that can be activated by extreme heat (>52°C). These features suggest that TRPV2 might be a transducer of noxious heat in vivo. TRPV2 can also be activated by hypoosmolarity or cell stretch, suggesting potential roles in mechanotransduction. To address the physiological functions of TRPV2 in somatosensation, we generated TRPV2 knock-out mice and examined their behavioral and electrophysiological responses to heat and mechanical stimuli. TRPV2 knock-out mice showed reduced embryonic weight and perinatal viability. As adults, surviving knock-out mice also exhibited a slightly reduced body weight. TRPV2 knock-out mice showed normal behavioral responses to noxious heat over a broad range of temperatures and normal responses to punctate mechanical stimuli, both in the basal state and under hyperalgesic conditions such as peripheral inflammation and L5 spinal nerve ligation. Moreover, behavioral assays of TRPV1/TRPV2 double knock-out mice or of TRPV2 knock-out mice treated with resiniferatoxin to desensitize TRPV1-expressing afferents revealed no thermosensory consequences of TRPV2 absence. In line with behavioral findings, electrophysiological recordings from skin afferents showed that C-fiber responses to heat and C- and Aδ-fiber responses to noxious mechanical stimuli were unimpaired in the absence of TRPV2. The prevalence of thermosensitive Aδ-fibers was too low to permit comparison between genotypes. Thus, TRPV2 is important for perinatal viability but is not essential for heat or mechanical nociception or hypersensitivity in the adult mouse.

  10. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies.

    PubMed

    Lin, F; Fukuoka, Y; Spicer, A; Ohta, R; Okada, N; Harris, C L; Emancipator, S N; Medof, M E

    2001-10-01

    Decay-accelerating factor (DAF) is a membrane regulator of C3 activation that protects self cells from autologous complement attack. In humans, DAF is uniformly expressed as a glycosylphosphatidylinositol (GPI)-anchored molecule. In mice, both GPI-anchored and transmembrane-anchored DAF proteins are produced, each of which can be derived from two different genes (Daf1 and Daf2). In this report, we describe a Daf1 gene knock-out mouse arising as the first product of a strategy for targeting one or both Daf genes. As part of the work, we characterize recently described monoclonal antibodies against murine DAF protein using deletion mutants synthesized in yeast, and then employ the monoclonal antibodies in conjunction with wild-type and the Daf1 knock-out mice to determine the tissue distribution of the mouse Daf1 and Daf2 gene products. To enhance the immunohistochemical detection of murine DAF protein, we utilized the sensitive tyramide fluorescence method. In wild-type mice, we found strong DAF labelling of glomeruli, airway and gut epithelium, the spleen, vascular endothelium throughout all tissues, and seminiferous tubules of the testis. In Daf1 knock-out mice, DAF labelling was ablated in most tissues, but strong labelling of the testis and splenic dendritic cells remained. In both sites, reverse transcription-polymerase chain reaction analyses identified both GPI and transmembrane forms of Daf2 gene-derived protein. The results have relevance for studies of in vivo murine DAF function and of murine DAF structure.

  11. Motivational effects of ethanol in DARPP-32 knock-out mice.

    PubMed

    Risinger, F O; Freeman, P A; Greengard, P; Fienberg, A A

    2001-01-01

    DARPP-32 (dopamine and adenosine 3',5'-monophosphate-regulated phosphoprotein, 32 kDa) is an important component of dopaminergic function in brain areas thought to be important for drug and alcohol addiction. The present experiments characterized the acquisition of ethanol-induced conditioned taste aversion, ethanol-induced conditioned place preference, and ethanol self-administration in DARPP-32 knock-out (KO) mice compared to wild-type (WT) controls. For taste conditioning, KO and WT mice received access to 0.2 m NaCl solution followed immediately by intraperitoneal injection of 0-4 gm/kg ethanol. Ethanol produced dose-dependent conditioned taste aversion that was the same in both genotypes. For place conditioning, KO and WT mice received eight pairings of a tactile stimulus with ethanol (2 gm/kg, i.p.), and a different stimulus with saline. Ethanol produced increases in locomotor activity during conditioning, with KO mice showing higher activity levels after ethanol compared to WT mice. WT mice, but not KO mice, acquired conditioned preference for the ethanol-paired stimulus. In the self-administration procedure, KO and WT mice were trained to lever press for access to 10% v/v ethanol. Subsequently, the mice had 23 hr/d access to food, ethanol, and water. Response patterns were determined using 0-30% v/v ethanol concentrations. WT mice displayed concentration-dependent responding for ethanol. Responding on the ethanol lever by KO mice did not change as a function of ethanol concentration. Saccharin (0.2% w/v) was subsequently added to the ethanol mixture, and responding was examined at 0, 5, 10, and 20% ethanol concentrations. Ethanol responding increased in both genotypes, although WT mice showed higher rates at all concentrations.

  12. Systemic and Cerebral Iron Homeostasis in Ferritin Knock-Out Mice

    PubMed Central

    Li, Wei; Garringer, Holly J.; Goodwin, Charles B.; Richine, Briana; Acton, Anthony; VanDuyn, Natalia; Muhoberac, Barry B.; Irimia-Dominguez, Jose; Chan, Rebecca J.; Peacock, Munro; Nass, Richard; Ghetti, Bernardino; Vidal, Ruben

    2015-01-01

    Ferritin, a 24-mer heteropolymer of heavy (H) and light (L) subunits, is the main cellular iron storage protein and plays a pivotal role in iron homeostasis by modulating free iron levels thus reducing radical-mediated damage. The H subunit has ferroxidase activity (converting Fe(II) to Fe(III)), while the L subunit promotes iron nucleation and increases ferritin stability. Previous studies on the H gene (Fth) in mice have shown that complete inactivation of Fth is lethal during embryonic development, without ability to compensate by the L subunit. In humans, homozygous loss of the L gene (FTL) is associated with generalized seizure and atypical restless leg syndrome, while mutations in FTL cause a form of neurodegeneration with brain iron accumulation. Here we generated mice with genetic ablation of the Fth and Ftl genes. As previously reported, homozygous loss of the Fth allele on a wild-type Ftl background was embryonic lethal, whereas knock-out of the Ftl allele (Ftl-/-) led to a significant decrease in the percentage of Ftl-/- newborn mice. Analysis of Ftl-/- mice revealed systemic and brain iron dyshomeostasis, without any noticeable signs of neurodegeneration. Our findings indicate that expression of the H subunit can rescue the loss of the L subunit and that H ferritin homopolymers have the capacity to sequester iron in vivo. We also observed that a single allele expressing the H subunit is not sufficient for survival when both alleles encoding the L subunit are absent, suggesting the need of some degree of complementation between the subunits as well as a dosage effect. PMID:25629408

  13. Knock-out of nexilin in mice leads to dilated cardiomyopathy and endomyocardial fibroelastosis.

    PubMed

    Aherrahrou, Zouhair; Schlossarek, Saskia; Stoelting, Stephanie; Klinger, Matthias; Geertz, Birgit; Weinberger, Florian; Kessler, Thorsten; Aherrahrou, Redouane; Moreth, Kristin; Bekeredjian, Raffi; Hrabě de Angelis, Martin; Just, Steffen; Rottbauer, Wolfgang; Eschenhagen, Thomas; Schunkert, Heribert; Carrier, Lucie; Erdmann, Jeanette

    2016-01-01

    Cardiomyopathy is one of the most common causes of chronic heart failure worldwide. Mutations in the gene encoding nexilin (NEXN) occur in patients with both hypertrophic and dilated cardiomyopathy (DCM); however, little is known about the pathophysiological mechanisms and relevance of NEXN to these disorders. Here, we evaluated the functional role of NEXN using a constitutive Nexn knock-out (KO) mouse model. Heterozygous (Het) mice were inter-crossed to produce wild-type (WT), Het, and homozygous KO mice. At birth, 32, 46, and 22 % of the mice were WT, Het, and KO, respectively, which is close to the expected Mendelian ratio. After postnatal day 6, the survival of the Nexn KO mice decreased dramatically and all of the animals died by day 8. Phenotypic characterizations of the WT and KO mice were performed at postnatal days 1, 2, 4, and 6. At birth, the relative heart weights of the WT and KO mice were similar; however, at day 4, the relative heart weight of the KO group was 2.3-fold higher than of the WT group. In addition, the KO mice developed rapidly progressive cardiomyopathy with left ventricular dilation and wall thinning and decreased cardiac function. At day 6, the KO mice developed a fulminant DCM phenotype characterized by dilated ventricular chambers and systolic dysfunction. At this stage, collagen deposits and some elastin deposits were observed within the left ventricle cavity, which resembles the features of endomyocardial fibroelastosis (EFE). Overall, these results further emphasize the role of NEXN in DCM and suggest a novel role in EFE.

  14. Fumarylacetoacetate Hydrolase Knock-out Rabbit Model for Hereditary Tyrosinemia Type 1*

    PubMed Central

    Li, Li; Zhang, Quanjun; Yang, Huaqiang; Zou, Qingjian; Lai, Chengdan; Jiang, Fei; Zhao, Ping; Luo, Zhiwei; Yang, Jiayin; Chen, Qian; Wang, Yan; Newsome, Philip N.; Frampton, Jon; Maxwell, Patrick H.; Li, Wenjuan; Chen, Shuhan; Wang, Dongye; Siu, Tak-Shing; Tam, Sidney; Tse, Hung-Fat; Qin, Baoming; Bao, Xichen; Esteban, Miguel A.; Lai, Liangxue

    2017-01-01

    Hereditary tyrosinemia type 1 (HT1) is a severe human autosomal recessive disorder caused by the deficiency of fumarylacetoacetate hydroxylase (FAH), an enzyme catalyzing the last step in the tyrosine degradation pathway. Lack of FAH causes accumulation of toxic metabolites (fumarylacetoacetate and succinylacetone) in blood and tissues, ultimately resulting in severe liver and kidney damage with onset that ranges from infancy to adolescence. This tissue damage is lethal but can be controlled by administration of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), which inhibits tyrosine catabolism upstream of the generation of fumarylacetoacetate and succinylacetone. Notably, in animals lacking FAH, transient withdrawal of NTBC can be used to induce liver damage and a concomitant regenerative response that stimulates the growth of healthy hepatocytes. Among other things, this model has raised tremendous interest for the in vivo expansion of human primary hepatocytes inside these animals and for exploring experimental gene therapy and cell-based therapies. Here, we report the generation of FAH knock-out rabbits via pronuclear stage embryo microinjection of transcription activator-like effector nucleases. FAH−/− rabbits exhibit phenotypic features of HT1 including liver and kidney abnormalities but additionally develop frequent ocular manifestations likely caused by local accumulation of tyrosine upon NTBC administration. We also show that allogeneic transplantation of wild-type rabbit primary hepatocytes into FAH−/− rabbits enables highly efficient liver repopulation and prevents liver insufficiency and death. Because of significant advantages over rodents and their ease of breeding, maintenance, and manipulation compared with larger animals including pigs, FAH−/− rabbits are an attractive alternative for modeling the consequences of HT1. PMID:28053091

  15. Progressive deafness and altered cochlear innervation in knock-out mice lacking prosaposin.

    PubMed

    Akil, Omar; Chang, Jolie; Hiel, Hakim; Kong, Jee-Hyun; Yi, Eunyoung; Glowatzki, Elisabeth; Lustig, Lawrence R

    2006-12-13

    After a yeast two-hybrid screen identified prosaposin as a potential interacting protein with the nicotinic acetylcholine receptor (nAChR) subunit alpha10, studies were performed to characterize prosaposin in the normal rodent inner ear. Prosaposin demonstrates diffuse organ of Corti expression at birth, with gradual localization to the inner hair cells (IHCs) and its supporting cells, inner pillar cells, and synaptic region of the outer hair cells (OHCs) and Deiters' cells (DCs) by postnatal day 21 (P21). Microdissected OHC and DC quantitative reverse transcriptase-PCR and immunohistology localizes prosaposin mRNA to DCs and OHCs, and protein predominantly to the apex of the DCs. Subsequent studies in a prosaposin knock-out (KO) (-/-) mouse showed intact but slightly reduced hearing through P19, but deafness by P25 and reduced distortion product otoacoustic emissions from P15 onward. Beginning at P12, the prosaposin KO mice showed histologic organ of Corti changes including cellular hypertrophy in the region of the IHC and greater epithelial ridge, a loss of OHCs from cochlear apex, and vacuolization of OHCs. Immunofluorescence revealed exuberant overgrowth of auditory afferent neurites in the region of the IHCs and proliferation of auditory efferent neurites in the region of the tunnel of Corti. IHC recordings from these KO mice showed normal I-V curves and responses to applied acetylcholine. Together, these results suggest that prosaposin helps maintain normal innervation patterns to the organ of Corti. Furthermore, prosaposin's overlapping developmental expression pattern and binding capacity toward the nAChR alpha10 suggest that alpha10 may also play a role in this function.

  16. The Brain Proteome of the Ubiquitin Ligase Peli1 Knock-Out Mouse during Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Lereim, Ragnhild Reehorst; Oveland, Eystein; Xiao, Yichuan; Torkildsen, Øivind; Wergeland, Stig; Myhr, Kjell-Morten; Sun, Shao-Cong; Berven, Frode S

    2016-01-01

    The ubiquitin ligase Peli1 has previously been suggested as a potential treatment target in multiple sclerosis. In the multiple sclerosis disease model, experimental autoimmune encephalomyelitis, Peli1 knock-out led to less activated microglia and less inflammation in the central nervous system. Despite being important in microglia, Peli1 expression has also been detected in glial and neuronal cells. In the present study the overall brain proteomes of Peli1 knock-out mice and wild-type mice were compared prior to experimental autoimmune encephalomyelitis induction, at onset of the disease and at disease peak. Brain samples from the frontal hemisphere, peripheral from the extensive inflammatory foci, were analyzed using TMT-labeling of sample pools, and the discovered proteins were verified in individual mice using label-free proteomics. The greatest proteomic differences between Peli1 knock-out and wild-type mice were observed at the disease peak. In Peli1 knock-out a higher degree of antigen presentation, increased activity of adaptive and innate immune cells and alterations to proteins involved in iron metabolism were observed during experimental autoimmune encephalomyelitis. These results unravel global effects to the brain proteome when abrogating Peli1 expression, underlining the importance of Peli1 as a regulator of the immune response also peripheral to inflammatory foci during experimental autoimmune encephalomyelitis. The proteomics data is available in PRIDE with accession PXD003710. PMID:27746629

  17. Evaluation of cimi-shield knock-out bed bug eliminator against house fly (Musca domestica) adults.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cimi-Shield Knock-Out (CSKO) Bed Bug Eliminator is a green treatment labeled for use against bed bugs, carpet beetles, ants, roaches, fleas, ticks, silverfish, millipedes and centipedes. The active ingredient is soybean oil. If CSKO is formulated according to label instructions and sprayed directly ...

  18. Evaluation of cimi-shield knock-out bed bug eliminator against house fly (Musca domestica) adults

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cimi-Shield Knock-Out (CSKO) Bed Bug Eliminator is a green treatment labeled for use against bed bugs, carpet beetles, ants, roaches, fleas, ticks, silverfish, millipedes and centipedes. The active ingredient is soybean oil. If CSKO is formulated according to label instructions and sprayed directly ...

  19. Selective Photoreceptor Gene Knock-out Reveals a Regulatory Role for the Growth Behavior of Pseudomonas syringae.

    PubMed

    Shah, Rashmi; Pathak, Gopal; Drepper, Thomas; Gärtner, Wolfgang

    2016-07-01

    The plant pathogen Pseudomonas syringae (Ps) is a well-established model organism for bacterial infection of plants. The genome sequences of two pathovars, pv. syringae and pv. tomato, revealed one gene encoding a blue and two genes encoding red/far red light-sensing photoreceptors. Continuing former molecular characterization of the photoreceptor proteins, we here report selective photoreceptor gene disruption for pv. tomato aiming at identification of potentially regulatory functions of these photoreceptors. Transformation of Ps cells with linear DNA constructs yielded interposon mutations of the corresponding genes. Cell growth studies of the generated photoreceptor knock-out mutants revealed their role in light-dependent regulation of cell growth and motility. Disruption of the blue-light (BL) receptor gene caused a growth deregulation, in line with an observed increased virulence of this mutant (Moriconi et al., Plant J., 2013, 76, 322). Bacterial phytochrome-1 (BphP1) deletion mutant caused unaltered cell growth, but a stronger swarming capacity. Inactivation of its ortholog, BphP2, however, caused reduced growth and remarkably altered dendritic swarming behavior. Combined knock-out of both bacteriophytochromes reproduced the swarming pattern observed for the BphP2 mutant alone. A triple knock-out mutant showed a growth rate between that of the BL (deregulation) and the phytochrome-2 mutant (growth reduction).

  20. Phenotypic and Molecular Alterations in the Mammary Tissue of R-Spondin1 Knock-Out Mice during Pregnancy

    PubMed Central

    Chadi, Sead; Polyte, Jacqueline; Lefevre, Lucas; Castille, Johan; Ehanno, Aude; Laubier, Johann; Jaffrézic, Florence; Le Provost, Fabienne

    2016-01-01

    R-spondin1 (Rspo1) is a member of a secreted protein family which has pleiotropic functions in development and stem cell growth. Rspo1 knock-out mice are sex-reversed, but some remain sub-fertile, so they fail to nurse their pups. A lack of Rspo1 expression in the mammary gland results in an absence of duct side-branching development and defective alveolar formation. The aim of this study was to characterize the phenotypic and molecular alterations of mammary gland due to Rspo1 knock-out. Using the transcriptional profiling of mammary tissues, we identified misregulated genes in the mammary gland of Rspo1 knock-out mice during pregnancy. A stronger expression of mesenchymal markers was observed, without modifications to the structure of mammary epithelial tissue. Mammary epithelial cell immunohistochemical analysis revealed a persistence of virgin markers, which signify a delay in cell differentiation. Moreover, serial transplantation experiments showed that Rspo1 is associated with a regenerative potential of mammary epithelial cell control. Our finding also highlights the negatively regulated expression of Rspo1’s partners, Lgr4 and RNF43, in the mammary gland during pregnancy. Moreover, we offer evidence that Tgf-β signalling is modified in the absence of Rspo1. Taken together, our results show an abrupt halt or delay to mammary development during pregnancy due to the loss of a further differentiated function. PMID:27611670

  1. 'Knock, and it shall be opened': knocking out and knocking in to reveal mechanisms of disease and novel therapies.

    PubMed

    Hacking, Douglas F

    2008-12-01

    Recent significant advances in molecular biology have generated genetically modified bacteria, yeast, nematodes, fruit flies, and fish. However, it is the genetic modification of mammalian model organisms, particularly the mouse, that has the greatest potential to shed light on human development, physiology and pathology in ways that have significant implications for neonatal and paediatric clinical practice. Here, we review some of the techniques for knocking out (inactivating), mutating and knocking in (inserting) selected genes that are important to neonatology and show how this research will lead both to a better understanding of disease and to novel therapies for infants and children.

  2. Loss of Bace2 in zebrafish affects melanocyte migration and is distinct from Bace1 knock out phenotypes.

    PubMed

    van Bebber, Frauke; Hruscha, Alexander; Willem, Michael; Schmid, Bettina; Haass, Christian

    2013-11-01

    Alzheimer's disease is the most frequent dementia. Pathologically, Alzheimer's disease is characterized by the accumulation of senile plaques composed of amyloid β-peptide (Aβ). Two proteases, β- and γ-secretase proteolytically generate Aβ from its precursor, the ß-amyloid precursor protein (APP). Inhibition of β-secretase, also referred to as beta-site APP cleaving enzyme (BACE1) or γ-secretase is therefore of prime interest for the development of amyloid-lowering drugs. To assess the in vivo function of zebrafish Bace1 (zBace1), we generated zBace1 knock out fish by zinc finger nuclease-mediated genome editing. bace1 mutants (bace1-/-) are hypomyelinated in the PNS while the CNS is not affected. Moreover, the number of mechanosensory neuromasts is elevated in bace1-/-. Mutations in zebrafish Bace2 (zBace2) revealed a distinct melanocyte migration phenotype, which is not observed in bace1-/-. Double homozygous bace1-/-; bace2-/- fish do not enhance the single mutant phenotypes indicating non-redundant distinct physiological functions. Single homozygous bace1 mutants as well as double homozygous bace1 and bace2 mutants are viable and fertile suggesting that Bace1 is a promising drug target without major side effects. The identification of a specific bace2 -/- associated phenotype further allows improving selective Bace1 inhibitors and to distinguish between Bace 1 and Bace 2 inhibition in vivo. Inhibition of BACE1 protease activity has therapeutic importance for Alzheimer's disease. Analysis of BACE1 and BACE2 knock-out zebrafish revealed that they exhibit distinct phenotypes. bace1 mutants display hypomyelination in the PNS and supernumerary neuromasts while in bace2 mutants the shape and migration of melanocytes is affected. These phenotypes are not further enhanced in the viable double mutants. Our data suggest that blocking BACE1 activity is a safe therapeutic approach.

  3. Generation of α-1,3-galactosyltransferase knocked-out transgenic cloned pigs with knocked-in five human genes.

    PubMed

    Kwon, Dae-Jin; Kim, Dong-Hwan; Hwang, In-Sul; Kim, Dong-Ern; Kim, Hyung-Joo; Kim, Jang-Seong; Lee, Kichoon; Im, Gi-Sun; Lee, Jeong-Woong; Hwang, Seongsoo

    2017-02-01

    Recent progress in genetic manipulation of pigs designated for xenotransplantation ha6s shown considerable promise on xenograft survival in primates. However, genetic modification of multiple genes in donor pigs by knock-out and knock-in technologies, aiming to enhance immunological tolerance against transplanted organs in the recipients, has not been evaluated for health issues of donor pigs. We produced transgenic Massachusetts General Hospital piglets by knocking-out the α-1,3-galactosyltransferase (GT) gene and by simultaneously knocking-in an expression cassette containing five different human genes including, DAF, CD39, TFPI, C1 inhibitor (C1-INH), and TNFAIP3 (A20) [GT(-(DAF/CD39/TFPI/C1-INH/TNFAIP3)/+)] that are connected by 2A peptide cleavage sequences to release individual proteins from a single translational product. All five individual protein products were successfully produced as determined by western blotting of umbilical cords from the newborn transgenic pigs. Although gross observation and histological examination revealed no significant pathological abnormality in transgenic piglets, hematological examination found that the transgenic piglets had abnormally low numbers of platelets and WBCs, including neutrophils, eosinophils, basophils, and lymphocytes. However, transgenic piglets had similar numbers of RBC and values of parameters related to RBC compared to the control littermate piglets. These data suggest that transgenic expression of those human genes in pigs impaired hematopoiesis except for erythropoiesis. In conclusion, our data suggest that transgenic expression of up to five different genes can be efficiently achieved and provide the basis for determining optimal dosages of transgene expression and combinations of the transgenes to warrant production of transgenic donor pigs without health issues.

  4. Production of heterozygous alpha 1,3-galactosyltransferase (GGTA1) knock-out transgenic miniature pigs expressing human CD39.

    PubMed

    Choi, Kimyung; Shim, Joohyun; Ko, Nayoung; Eom, Heejong; Kim, Jiho; Lee, Jeong-Woong; Jin, Dong-Il; Kim, Hyunil

    2017-04-01

    Production of transgenic pigs for use as xenotransplant donors is a solution to the severe shortage of human organs for transplantation. The first barrier to successful xenotransplantation is hyperacute rejection, a rapid, massive humoral immune response directed against the pig carbohydrate GGTA1 epitope. Platelet activation, adherence, and clumping, all major features of thrombotic microangiopathy, are inevitable results of immune-mediated transplant rejection. Human CD39 rapidly hydrolyzes ATP and ADP to AMP; AMP is hydrolyzed by ecto-5'-nucleotidase (CD73) to adenosine, an anti-thrombotic and cardiovascular protective mediator. In this study, we developed a vector-based strategy for ablation of GGTA1 function and concurrent expression of human CD39 (hCD39). An hCD39 expression cassette was constructed to target exon 4 of GGTA1. We established heterozygous GGTA1 knock-out cell lines expressing hCD39 from pig ear fibroblasts for somatic cell nuclear transfer (SCNT). We also described production of heterozygous GGTA1 knock-out piglets expressing hCD39 and analyzed expression and function of the transgene. Human CD39 was expressed in heart, kidney and aorta. Human CD39 knock-in heterozygous ear fibroblast from transgenic cloned pigs, but not in non-transgenic pig's cells. Expression of GGTA1 gene was lower in the knock-in heterozygous ear fibroblast from transgenic pigs compared to the non-transgenic pig's cell. The peripheral blood mononuclear cells (PBMC) from the transgenic pigs were more resistant to lysis by pooled complement-preserved normal human serum than that from wild type (WT) pig. Accordingly, GGTA1 mutated piglets expressing hCD39 will provide a new organ source for xenotransplantation research.

  5. Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

    SciTech Connect

    Malur, Anagha; Huizar, Isham; Wells, Greg; Barna, Barbara P.; Malur, Achut G.; Thomassen, Mary Jane

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Lentivirus-ABCG1 reduces lipid accumulation in lungs of GM-CSF knock-out mice. Black-Right-Pointing-Pointer Up-regulation of ABCG1 improves lung function. Black-Right-Pointing-Pointer Upregulation of ABCG1 improves surfactant metabolism. -- Abstract: We have shown decreased expression of the nuclear transcription factor, peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) and the PPAR{gamma}-regulated ATP-binding cassette transporter G1 (ABCG1) in alveolar macrophages from patients with pulmonary alveolar proteinosis (PAP). PAP patients also exhibit neutralizing antibodies to granulocyte-macrophage colony stimulating factor (GM-CSF), an upregulator of PPAR{gamma}. In association with functional GM-CSF deficiency, PAP lung is characterized by surfactant-filled alveolar spaces and lipid-filled alveolar macrophages. Similar pathology characterizes GM-CSF knock-out (KO) mice. We reported previously that intratracheal instillation of a lentivirus (lenti)-PPAR{gamma} plasmid into GM-CSF KO animals elevated ABCG1 and reduced alveolar macrophage lipid accumulation. Here, we hypothesized that instillation of lenti-ABCG1 might be sufficient to decrease lipid accumulation and improve pulmonary function in GM-CSF KO mice. Animals received intratracheal instillation of lenti-ABCG1 or control lenti-enhanced Green Fluorescent Protein (eGFP) plasmids and alveolar macrophages were harvested 10 days later. Alveolar macrophage transduction efficiency was 79% as shown by lenti-eGFP fluorescence. Quantitative PCR analyses indicated a threefold (p = 0.0005) increase in ABCG1 expression with no change of PPAR{gamma} or ABCA1 in alveolar macrophages of lenti-ABCG1 treated mice. ABCG1 was unchanged in control lenti-eGFP and PBS-instilled groups. Oil Red O staining detected reduced intracellular neutral lipid in alveolar macrophages from lenti-ABCG1 treated mice. Extracellular cholesterol and phospholipids were also decreased as shown by

  6. 1,3-propanediol production with Citrobacter werkmanii DSM17579: effect of a dhaD knock-out

    PubMed Central

    2014-01-01

    Background 1,3-propanediol (PDO) is a substantially industrial metabolite used in the polymer industry. Although several natural PDO production hosts exist, e.g. Klebsiella sp., Citrobacter sp. and Clostridium sp., the PDO yield on glycerol is insufficient for an economically viable bio-process. Enhancing this yield via strain improvement can be achieved by disconnecting the production and growth pathways. In the case of PDO formation, this approach results in a microorganism metabolizing glycerol strictly for PDO production, while catabolizing a co-substrate for growth and maintenance. We applied this strategy to improve the PDO production with Citrobacter werkmanii DSM17579. Results Genetic tools were developed and used to create Citrobacter werkmanii DSM17579 ∆dhaD in which dhaD, encoding for glycerol dehydrogenase, was deleted. Since this strain was unable to grow on glycerol anaerobically, both pathways were disconnected. The knock-out strain was perturbed with 13 different co-substrates for growth and maintenance. Glucose was the most promising, although a competition between NADH-consuming enzymes and 1,3-propanediol dehydrogenase emerged. Conclusion Due to the deletion of dhaD in Citrobacter werkmanii DSM17579, the PDO production and growth pathway were split. As a consequence, the PDO yield on glycerol was improved 1,5 times, strengthening the idea that Citrobacter werkmanii DSM17579 could become an industrially interesting host for PDO production. PMID:24885849

  7. The Phospholipase D2 Knock Out Mouse Has Ectopic Purkinje Cells and Suffers from Early Adult-Onset Anosmia

    PubMed Central

    Zhang, Qifeng; Smethurst, Elizabeth; Segonds-Pichon, Anne; Schrewe, Heinrich; Wakelam, Michael J. O.

    2016-01-01

    Phospholipase D2 (PLD2) is an enzyme that produces phosphatidic acid (PA), a lipid messenger molecule involved in a number of cellular events including, through its membrane curvature properties, endocytosis. The PLD2 knock out (PLD2KO) mouse has been previously reported to be protected from insult in a model of Alzheimer's disease. We have further analysed a PLD2KO mouse using mass spectrophotometry of its lipids and found significant differences in PA species throughout its brain. We have examined the expression pattern of PLD2 which allowed us to define which region of the brain to analyse for defect, notably PLD2 was not detected in glial-rich regions. The expression pattern lead us to specifically examine the mitral cells of olfactory bulbs, the Cornus Amonis (CA) regions of the hippocampus and the Purkinje cells of the cerebellum. We find that the change to longer PA species correlates with subtle architectural defect in the cerebellum, exemplified by ectopic Purkinje cells and an adult-onset deficit of olfaction. These observations draw parallels to defects in the reelin heterozygote as well as the effect of high fat diet on olfaction. PMID:27658289

  8. Knock-out of HCN1 subunit flattens dorsal-ventral frequency gradient of medial entorhinal neurons in adult mice.

    PubMed

    Giocomo, Lisa M; Hasselmo, Michael E

    2009-06-10

    Layer II stellate cells at different locations along the dorsal to ventral axis of medial entorhinal cortex show differences in the frequency of intrinsic membrane potential oscillations and resonance (Giocomo et al., 2007). The frequency differences scale with differences in the size and spacing of grid-cell firing fields recorded in layer II of the medial entorhinal cortex in behaving animals. To determine the mechanism for this difference in intrinsic frequency, we analyzed oscillatory properties in adult control mice and adult mice with a global deletion of the HCN1 channel. Data from whole-cell patch recordings show that the oscillation frequency gradient along the dorsal-ventral axis previously shown in juvenile rats also appears in control adult mice, indicating that the dorsal-ventral gradient generalizes across age and species. Knock-out of the HCN1 channel flattens the dorsal-ventral gradient of the membrane potential oscillation frequency, the resonant frequency, the time constant of the "sag" potential and the amplitude of the sag potential. This supports a role of the HCN1 subunit in the mechanism of the frequency gradient in these neurons. These findings have important implications for models of grid cells and generate predictions for future in vivo work on entorhinal grid cells.

  9. Enhancement in colonization of bovine spermatogonial stem cells following addition of knock-out serum replacement to culture medium

    PubMed Central

    Youssefi, Reza; Tajik, Parviz; Movahedin, Mansoureh; Akbarinejad, Vahid

    2016-01-01

    Enrichment of cell suspension with germ cells prior to injection into recipient seminiferous tubules is of importance in spermatogonial stem cells (SSCs) transplantation. Knock-out serum replacement (KSR) has been reported to enhance the proliferation of murine SSCs and human embryonic stem cells. The aim of the present study was to investigate the effect of KSR versus fetal bovine serum (FBS) and their interaction on colonization of bovine SSCs in vitro. When FBS (10%) was replaced with KSR (10%), a significant increase in the colonization of SSCs and the expression of Thy1, as marker for enrichment of SSCs, was observed. It was revealed that the lesser proliferative effect of FBS as well as the greater proliferative impact of KSR on SSCs colonization were not irreversible as cells having been cultured with FBS (10%) for three days with low colonization showed high rate of colonization in response to KSR (10%) and cells having been cultured with KSR (10%) with high colonization experienced low rate of colonization in response to FBS (10%). Further, it was shown that FBS did not contain factors inhibiting SSCs colonization and it simply lacked factors essential for SSCs proliferation because the combination of FBS (5%) and KSR (5%) resulted in even greater rate of colonization than did KSR (10%). In conclusion, the present study showed that addition of KSR to culture medium would significantly increase SSCs proliferation. PMID:28144417

  10. Adenoviral gene therapy of the Tay-Sachs disease in hexosaminidase A-deficient knock-out mice.

    PubMed

    Guidotti, J E; Mignon, A; Haase, G; Caillaud, C; McDonell, N; Kahn, A; Poenaru, L

    1999-05-01

    The severe neurodegenerative disorder, Tays-Sachs disease, is caused by a beta-hexosaminidase alpha-subunit deficiency which prevents the formation of lysosomal heterodimeric alpha-beta enzyme, hexosaminidase A (HexA). No treatment is available for this fatal disease; however, gene therapy could represent a therapeutic approach. We previously have constructed and characterized, in vitro, adenoviral and retroviral vectors coding for alpha- and beta-subunits of the human beta-hexosaminidases. Here, we have determined the in vivo strategy which leads to the highest HexA activity in the maximum number of tissues in hexA -deficient knock-out mice. We demonstrated that intravenous co-administration of adenoviral vectors coding for both alpha- and beta-subunits, resulting in preferential liver transduction, was essential to obtain the most successful results. Only the supply of both subunits allowed for HexA overexpression leading to massive secretion of the enzyme in serum, and full or partial enzymatic activity restoration in all peripheral tissues tested. The enzymatic correction was likely to be due to direct cellular transduction by adenoviral vectors and/or uptake of secreted HexA by different organs. These results confirmed that the liver was the preferential target organ to deliver a large amount of secreted proteins. In addition, the need to overexpress both subunits of heterodimeric proteins in order to obtain a high level of secretion in animals defective in only one subunit is emphasized. The endogenous non-defective subunit is otherwise limiting.

  11. Prolonged Starvation Causes Up-Regulation of AQP1 in Adipose Tissue Capillaries of AQP7 Knock-Out Mice

    PubMed Central

    Skowronski, Mariusz T.; Skowronska, Agnieszka; Rojek, Aleksandra; Oklinski, Michal K.; Nielsen, Søren

    2016-01-01

    Aquaporins (AQPs) are membrane proteins involved in the regulation of cellular transport and the balance of water and glycerol and cell volume in the white adipose tissue (WAT). In our previous study, we found the co-expression of the AQP1 water channel and AQP7 in the mouse WAT. In our present study, we aimed to find out whether prolonged starvation influences the AQP1 expression of AQP7 knock-out mice (AQP7 KO) in the WAT. To resolve this hypothesis, immunoperoxidase, immunoblot and immunogold microscopy were used. AQP1 expression was found with the use of immunohistochemistry and was confirmed by immunogold microscopy in the vessels of mouse WAT of all studied groups. Semi-quantitative immunoblot and quantitative immunogold microscopy showed a significant increase (by 2.5- to 3-fold) in the abundance of AQP1 protein expression in WAT in the 72 h starved AQP7 KO mice as compared to AQP7+/+ (p < 0.05) and AQP7−/− (p < 0.01) controls, respectively. In conclusion, the AQP1 water channel located in the vessels of WAT is up-regulated in response to prolonged starvation in the WAT of AQP7 KO mice. The present data suggest that an interaction of different AQP isoforms is required for maintaining proper water homeostasis within the mice WAT. PMID:27455244

  12. Reconstructing gene regulatory networks from knock-out data using Gaussian Noise Model and Pearson Correlation Coefficient.

    PubMed

    Mohamed Salleh, Faridah Hani; Arif, Shereena Mohd; Zainudin, Suhaila; Firdaus-Raih, Mohd

    2015-12-01

    A gene regulatory network (GRN) is a large and complex network consisting of interacting elements that, over time, affect each other's state. The dynamics of complex gene regulatory processes are difficult to understand using intuitive approaches alone. To overcome this problem, we propose an algorithm for inferring the regulatory interactions from knock-out data using a Gaussian model combines with Pearson Correlation Coefficient (PCC). There are several problems relating to GRN construction that have been outlined in this paper. We demonstrated the ability of our proposed method to (1) predict the presence of regulatory interactions between genes, (2) their directionality and (3) their states (activation or suppression). The algorithm was applied to network sizes of 10 and 50 genes from DREAM3 datasets and network sizes of 10 from DREAM4 datasets. The predicted networks were evaluated based on AUROC and AUPR. We discovered that high false positive values were generated by our GRN prediction methods because the indirect regulations have been wrongly predicted as true relationships. We achieved satisfactory results as the majority of sub-networks achieved AUROC values above 0.5.

  13. Ammonia excretion in Caenorhabditis elegans: Physiological and molecular characterization of the rhr-2 knock-out mutant.

    PubMed

    Adlimoghaddam, Aida; O'Donnell, Michael J; Kormish, Jay; Banh, Sheena; Treberg, Jason R; Merz, David; Weihrauch, Dirk

    2016-05-01

    Previous studies have shown the free living soil nematode Caenorhabditis elegans (N2 strain) to be ammonotelic. Ammonia excretion was suggested to take place partially via the hypodermis, involving the Na(+)/K(+)-ATPase (NKA), V-ATPase (VAT), carbonic anhydrase, NHX-3 and a functional microtubule network and at least one Rh-like ammonia transporter RHR-1. In the current study, we show that a second Rh-protein, RHR-2, is highly expressed in the hypodermis, here also in the apical membrane of that tissue. To further characterize the role of RHR-2 in ammonia excretion, a knock-out mutant rhr-2 (ok403), further referred to as ∆rhr-2, was employed. Compared to wild-type worms (N2), this mutant showed a lower rate of ammonia excretion and a lower hypodermal H(+) excretion rate. At the same time rhr-1, nka, vat, and nhx-3 showed higher mRNA expression levels when compared to N2. Also, in contrast to N2 worms, ∆rhr-2 did not show enhanced ammonia excretion rates when exposed to a low pH environment, suggesting that RHR-2 represents the apical NH3 pathway that allows ammonia trapping via the hypodermis in N2 worms. A hypothetical model for the mechanism of hypodermal ammonia excretion is proposed on the basis of data in this and previous investigations.

  14. Pantothenate kinase-associated neurodegeneration: altered mitochondria membrane potential and defective respiration in Pank2 knock-out mouse model.

    PubMed

    Brunetti, Dario; Dusi, Sabrina; Morbin, Michela; Uggetti, Andrea; Moda, Fabio; D'Amato, Ilaria; Giordano, Carla; d'Amati, Giulia; Cozzi, Anna; Levi, Sonia; Hayflick, Susan; Tiranti, Valeria

    2012-12-15

    Neurodegeneration with brain iron accumulation (NBIA) comprises a group of neurodegenerative disorders characterized by high brain content of iron and presence of axonal spheroids. Mutations in the PANK2 gene, which encodes pantothenate kinase 2, underlie an autosomal recessive inborn error of coenzyme A metabolism, called pantothenate kinase-associated neurodegeneration (PKAN). PKAN is characterized by dystonia, dysarthria, rigidity and pigmentary retinal degeneration. The pathogenesis of this disorder is poorly understood and, although PANK2 is a mitochondrial protein, perturbations in mitochondrial bioenergetics have not been reported. A knock-out (KO) mouse model of PKAN exhibits retinal degeneration and azoospermia, but lacks any neurological phenotype. The absence of a clinical phenotype has partially been explained by the different cellular localization of the human and murine PANK2 proteins. Here we demonstrate that the mouse Pank2 protein localizes to mitochondria, similar to its human orthologue. Moreover, we show that Pank2-defective neurons derived from KO mice have an altered mitochondrial membrane potential, a defect further corroborated by the observations of swollen mitochondria at the ultra-structural level and by the presence of defective respiration.

  15. Behavioral Phenotype of Fmr1 Knock-Out Mice during Active Phase in an Altered Light/Dark Cycle.

    PubMed

    Saré, R Michelle; Levine, Merlin; Smith, Carolyn Beebe

    2016-01-01

    Fragile X syndrome (FXS) is the most commonly inherited form of intellectual disability and is a disorder that is also highly associated with autism. FXS occurs as a result of an expanded CGG repeat sequence leading to transcriptional silencing. In an animal model of FXS in which Fmr1 is knocked out (Fmr1 KO), many physical, physiological, and behavioral characteristics of the human disease are recapitulated. Prior characterization of the mouse model was conducted during the day, the inactive phase of the circadian cycle. Circadian rhythms are an important contributor to behavior and may play a role in the study of disease phenotype. Moreover, changes in the parameters of circadian rhythm are known to occur in FXS animal models. We conducted an investigation of key behavioral phenotypes in Fmr1 KO mice during their active phase. We report that phase did not alter the Fmr1 KO phenotype in open field activity, anxiety, and learning and memory. There was a slight effect of phase on social behavior as measured by time in chamber, but not by time spent sniffing. Our data strengthen the existing data characterizing the phenotype of Fmr1 KO mice, indicating that it is independent of circadian phase.

  16. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system.

    PubMed

    Guo, Rihong; Wan, Yongjie; Xu, Dan; Cui, Libin; Deng, Mingtian; Zhang, Guomin; Jia, Ruoxin; Zhou, Wenjun; Wang, Zhen; Deng, Kaiping; Huang, Mingrui; Wang, Feng; Zhang, Yanli

    2016-07-15

    Myostatin (Mstn) is a conserved negative regulator of skeletal muscle mass in mammals. However, whether precise disruption of Mstn in livestock can be achieved and safely used to improve meat productivity has not been proven. We applied CRISPR/Cas9 system to generate Mstn knock-out (KO) rabbits and goats and then analyzed the changes in their phenotypes to answer this question. We efficiently generated 24 Mstn KO rabbits out of 32 newborn infants after embryo injection with two sgRNAs targeting rabbit Mstn, and found that the Mstn KO rabbits exhibited increased birthweight and a significantly increase in the weight ratios of the quadriceps and biceps muscles to the whole body. Mstn KO also caused high probability of enlarged tongue phenomenon and severe health problems such as stillbirth and early stage death. Using the same method, one out of four goats was generated with edition at Mstn locus. The early stage growth rate of this goat outperformed the control goats. In conclusion, we efficiently generated Mstn KO rabbits and goats using CRISPR/Cas9 technology. However, Mstn KO causes severe health problems and may also have the same effects on other species. This safety issue must be studied further before applied to animal reproduction processes.

  17. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system

    PubMed Central

    Guo, Rihong; Wan, Yongjie; Xu, Dan; Cui, Libin; Deng, Mingtian; Zhang, Guomin; Jia, Ruoxin; Zhou, Wenjun; Wang, Zhen; Deng, Kaiping; Huang, Mingrui; Wang, Feng; Zhang, Yanli

    2016-01-01

    Myostatin (Mstn) is a conserved negative regulator of skeletal muscle mass in mammals. However, whether precise disruption of Mstn in livestock can be achieved and safely used to improve meat productivity has not been proven. We applied CRISPR/Cas9 system to generate Mstn knock-out (KO) rabbits and goats and then analyzed the changes in their phenotypes to answer this question. We efficiently generated 24 Mstn KO rabbits out of 32 newborn infants after embryo injection with two sgRNAs targeting rabbit Mstn, and found that the Mstn KO rabbits exhibited increased birthweight and a significantly increase in the weight ratios of the quadriceps and biceps muscles to the whole body. Mstn KO also caused high probability of enlarged tongue phenomenon and severe health problems such as stillbirth and early stage death. Using the same method, one out of four goats was generated with edition at Mstn locus. The early stage growth rate of this goat outperformed the control goats. In conclusion, we efficiently generated Mstn KO rabbits and goats using CRISPR/Cas9 technology. However, Mstn KO causes severe health problems and may also have the same effects on other species. This safety issue must be studied further before applied to animal reproduction processes. PMID:27417210

  18. Orexin/hypocretin and histamine: distinct roles in the control of wakefulness demonstrated using knock-out mouse models.

    PubMed

    Anaclet, Christelle; Parmentier, Régis; Ouk, Koliane; Guidon, Gérard; Buda, Colette; Sastre, Jean-Pierre; Akaoka, Hidéo; Sergeeva, Olga A; Yanagisawa, Masashi; Ohtsu, Hiroshi; Franco, Patricia; Haas, Helmut L; Lin, Jian-Sheng

    2009-11-18

    To determine the respective role played by orexin/hypocretin and histamine (HA) neurons in maintaining wakefulness (W), we characterized the behavioral and sleep-wake phenotypes of orexin (Ox) knock-out (-/-) mice and compared them with those of histidine-decarboxylase (HDC, HA-synthesizing enzyme)-/- mice. While both mouse strains displayed sleep fragmentation and increased paradoxical sleep (PS), they presented a number of marked differences: (1) the PS increase in HDC(-/-) mice was seen during lightness, whereas that in Ox(-/-) mice occurred during darkness; (2) contrary to HDC(-/-), Ox(-/-) mice had no W deficiency around lights-off, nor an abnormal EEG and responded to a new environment with increased W; (3) only Ox(-/-), but not HDC(-/-) mice, displayed narcolepsy and deficient W when faced with motor challenge. Thus, when placed on a wheel, wild-type (WT), but not littermate Ox(-/-) mice, voluntarily spent their time in turning it and as a result, remained highly awake; this was accompanied by dense c-fos expression in many areas of their brains, including Ox neurons in the dorsolateral hypothalamus. The W and motor deficiency of Ox(-/-) mice was due to the absence of Ox because intraventricular dosing of orexin-A restored their W amount and motor performance whereas SB-334867 (Ox1-receptor antagonist, i.p.) impaired W and locomotion of WT mice during the test. These data indicate that Ox, but not HA, promotes W through enhanced locomotion and suggest that HA and Ox neurons exert a distinct, but complementary and synergistic control of W: the neuropeptide being more involved in its behavioral aspects, whereas the amine is mainly responsible for its qualitative cognitive aspects and cortical EEG activation.

  19. Impaired glucose tolerance and predisposition to the fasted state in liver glycogen synthase knock-out mice.

    PubMed

    Irimia, Jose M; Meyer, Catalina M; Peper, Caron L; Zhai, Lanmin; Bock, Cheryl B; Previs, Stephen F; McGuinness, Owen P; DePaoli-Roach, Anna; Roach, Peter J

    2010-04-23

    Conversion to glycogen is a major fate of ingested glucose in the body. A rate-limiting enzyme in the synthesis of glycogen is glycogen synthase encoded by two genes, GYS1, expressed in muscle and other tissues, and GYS2, primarily expressed in liver (liver glycogen synthase). Defects in GYS2 cause the inherited monogenic disease glycogen storage disease 0. We have generated mice with a liver-specific disruption of the Gys2 gene (liver glycogen synthase knock-out (LGSKO) mice), using Lox-P/Cre technology. Conditional mice carrying floxed Gys2 were crossed with mice expressing Cre recombinase under the albumin promoter. The resulting LGSKO mice are viable, develop liver glycogen synthase deficiency, and have a 95% reduction in fed liver glycogen content. They have mild hypoglycemia but dispose glucose less well in a glucose tolerance test. Fed, LGSKO mice also have a reduced capacity for exhaustive exercise compared with mice carrying floxed alleles, but the difference disappears after an overnight fast. Upon fasting, LGSKO mice reach within 4 h decreased blood glucose levels attained by control floxed mice only after 24 h of food deprivation. The LGSKO mice maintain this low blood glucose for at least 24 h. Basal gluconeogenesis is increased in LGSKO mice, and insulin suppression of endogenous glucose production is impaired as assessed by euglycemic-hyperinsulinemic clamp. This observation correlates with an increase in the liver gluconeogenic enzyme phosphoenolpyruvate carboxykinase expression and activity. This mouse model mimics the pathophysiology of glycogen storage disease 0 patients and highlights the importance of liver glycogen stores in whole body glucose homeostasis.

  20. Life-long norepinephrine transporter (NET) knock-out leads to the increase in the NET mRNA in brain regions rich in norepinephrine terminals.

    PubMed

    Solich, Joanna; Kolasa, Magdalena; Kusmider, Maciej; Pabian, Paulina; Faron-Gorecka, Agata; Zurawek, Dariusz; Szafran-Pilch, Kinga; Kedracka-Krok, Sylwia; Jankowska, Urszula; Swiderska, Bianka; Dziedzicka-Wasylewska, Marta

    2015-08-01

    These studies aimed to identify the genes differentially expressed in the frontal cortex of mice bearing a life-long norepinephrine transporter knock-out (NET-KO) and wild-type animals (WT). Differences in gene expression in the mouse frontal cortex were studied using a whole-genome microarray approach. Using an alternative approach, i.e. RT-PCR (reverse transcription polymerase chain reaction) with primers complementary to various exons of the NET gene, as well as TaqMan arrays, the level of mRNA encoding the NET in other brain regions of the NET-KO mice was also examined. The analyses revealed a group of 92 transcripts (27 genes) that differentiated the NET-KO mice from the WT mice. Surprisingly, the studies have shown that the mRNA encoding NET accumulated in the brain regions rich in norepinephrine nerve endings in the NET-KO mice. Because there is no other source of NET mRNA besides the noradrenergic terminals in the brain regions studied, these results might speak in favor of the presence of mRNA in axon terminals. RNA-Binding Protein Immunoprecipitation approach indicated that mRNA encoding NET was detected in the Ago2 protein/mRNA complex. In addition, the amount of Ago2 protein in the frontal cortex was significantly higher in NET-KO mice as compared with that of the WT animals. These results are important for further characterization of the NET-KO mice, which - besides other merits - might serve as a good model to study the fate of truncated mRNA in neurons.

  1. The fbpA/sapM Double Knock Out Strain of Mycobacterium tuberculosis Is Highly Attenuated and Immunogenic in Macrophages

    PubMed Central

    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J.; Khan, Arshad; Armitige, Lisa Y.; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian

    2012-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine. PMID:22574140

  2. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes.

    PubMed

    Crispo, M; Mulet, A P; Tesson, L; Barrera, N; Cuadro, F; dos Santos-Neto, P C; Nguyen, T H; Crénéguy, A; Brusselle, L; Anegón, I; Menchaca, A

    2015-01-01

    While CRISPR/Cas9 technology has proven to be a valuable system to generate gene-targeted modified animals in several species, this tool has been scarcely reported in farm animals. Myostatin is encoded by MSTN gene involved in the inhibition of muscle differentiation and growth. We determined the efficiency of the CRISPR/Cas9 system to edit MSTN in sheep and generate knock-out (KO) animals with the aim to promote muscle development and body growth. We generated CRISPR/Cas9 mRNAs specific for ovine MSTN and microinjected them into the cytoplasm of ovine zygotes. When embryo development of CRISPR/Cas9 microinjected zygotes (n = 216) was compared with buffer injected embryos (n = 183) and non microinjected embryos (n = 173), cleavage rate was lower for both microinjected groups (P<0.05) and neither was affected by CRISPR/Cas9 content in the injected medium. Embryo development to blastocyst was not affected by microinjection and was similar among the experimental groups. From 20 embryos analyzed by Sanger sequencing, ten were mutant (heterozygous or mosaic; 50% efficiency). To obtain live MSTN KO lambs, 53 blastocysts produced after zygote CRISPR/Cas9 microinjection were transferred to 29 recipient females resulting in 65.5% (19/29) of pregnant ewes and 41.5% (22/53) of newborns. From 22 born lambs analyzed by T7EI and Sanger sequencing, ten showed indel mutations at MSTN gene. Eight showed mutations in both alleles and five of them were homozygous for indels generating out-of frame mutations that resulted in premature stop codons. Western blot analysis of homozygous KO founders confirmed the absence of myostatin, showing heavier body weight than wild type counterparts. In conclusion, our results demonstrate that CRISPR/Cas9 system was a very efficient tool to generate gene KO sheep. This technology is quick and easy to perform and less expensive than previous techniques, and can be applied to obtain genetically modified animal models of interest for biomedicine and

  3. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes

    PubMed Central

    Crispo, M.; Mulet, A. P.; Tesson, L.; Barrera, N.; Cuadro, F.; dos Santos-Neto, P. C.; Nguyen, T. H.; Crénéguy, A.; Brusselle, L.; Anegón, I.; Menchaca, A.

    2015-01-01

    While CRISPR/Cas9 technology has proven to be a valuable system to generate gene-targeted modified animals in several species, this tool has been scarcely reported in farm animals. Myostatin is encoded by MSTN gene involved in the inhibition of muscle differentiation and growth. We determined the efficiency of the CRISPR/Cas9 system to edit MSTN in sheep and generate knock-out (KO) animals with the aim to promote muscle development and body growth. We generated CRISPR/Cas9 mRNAs specific for ovine MSTN and microinjected them into the cytoplasm of ovine zygotes. When embryo development of CRISPR/Cas9 microinjected zygotes (n = 216) was compared with buffer injected embryos (n = 183) and non microinjected embryos (n = 173), cleavage rate was lower for both microinjected groups (P<0.05) and neither was affected by CRISPR/Cas9 content in the injected medium. Embryo development to blastocyst was not affected by microinjection and was similar among the experimental groups. From 20 embryos analyzed by Sanger sequencing, ten were mutant (heterozygous or mosaic; 50% efficiency). To obtain live MSTN KO lambs, 53 blastocysts produced after zygote CRISPR/Cas9 microinjection were transferred to 29 recipient females resulting in 65.5% (19/29) of pregnant ewes and 41.5% (22/53) of newborns. From 22 born lambs analyzed by T7EI and Sanger sequencing, ten showed indel mutations at MSTN gene. Eight showed mutations in both alleles and five of them were homozygous for indels generating out-of frame mutations that resulted in premature stop codons. Western blot analysis of homozygous KO founders confirmed the absence of myostatin, showing heavier body weight than wild type counterparts. In conclusion, our results demonstrate that CRISPR/Cas9 system was a very efficient tool to generate gene KO sheep. This technology is quick and easy to perform and less expensive than previous techniques, and can be applied to obtain genetically modified animal models of interest for biomedicine and

  4. 2-Methyl-6-(phenylethynyl) pyridine (MPEP) reverses maze learning and PSD-95 deficits in Fmr1 knock-out mice

    PubMed Central

    Gandhi, Réno M.; Kogan, Cary S.; Messier, Claude

    2014-01-01

    Fragile X Syndrome (FXS) is caused by the lack of expression of the fragile X mental retardation protein (FMRP), which results in intellectual disability and other debilitating symptoms including impairment of visual-spatial functioning. FXS is the only single-gene disorder that is highly co-morbid with autism spectrum disorder and can therefore provide insight into its pathophysiology. Lack of FMRP results in altered group I metabotropic glutamate receptor (mGluR) signaling, which is a target for putative treatments. The Hebb-Williams (H-W) mazes are a set of increasingly complex spatial navigation problems that depend on intact hippocampal and thus mGluR-5 functioning. In the present investigation, we examined whether an antagonist of mGluR-5 would reverse previously described behavioral deficits in fragile X mental retardation 1 knock-out (Fmr1 KO) mice. Mice were trained on a subset of the H-W mazes and then treated with either 20 mg/kg of an mGluR-5 antagonist, 2-Methyl-6-(phenylethynyl) pyridine (MPEP; n = 11) or an equivalent dose of saline (n = 11) prior to running test mazes. Latency and errors were dependent variables recorded during the test phase. Immediately after completing each test, marble-burying behavior was assessed, which confirmed that the drug treatment was pharmacologically active during maze learning. Although latency was not statistically different between the groups, MPEP treated Fmr1 KO mice made significantly fewer errors on mazes deemed more difficult suggesting a reversal of the behavioral deficit. MPEP treated mice were also less perseverative and impulsive when navigating mazes. Furthermore, MPEP treatment reversed post-synaptic density-95 (PSD-95) protein deficits in Fmr1 KO treated mice, whereas levels of a control protein (β-tubulin) remained unchanged. These data further validate MPEP as a potentially beneficial treatment for FXS. Our findings also suggest that adapted H-W mazes may be a useful tool to document alterations in

  5. The fbpA/sapM double knock out strain of Mycobacterium tuberculosis is highly attenuated and immunogenic in macrophages.

    PubMed

    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J; Khan, Arshad; Armitige, Lisa Y; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian

    2012-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine.

  6. Vaccination with recombinant adenoviruses expressing Ebola virus glycoprotein elicits protection in the interferon alpha/beta receptor knock-out mouse.

    PubMed

    O'Brien, Lyn M; Stokes, Margaret G; Lonsdale, Stephen G; Maslowski, David R; Smither, Sophie J; Lever, Mark S; Laws, Thomas R; Perkins, Stuart D

    2014-03-01

    The resistance of adult immunocompetent mice to infection with ebolaviruses has led to the development of alternative small animal models that utilise immunodeficient mice, for example the interferon α/β receptor knock-out mouse (IFNR(-/-)). IFNR(-/-) mice have been shown to be susceptible to infection with ebolaviruses by multiple routes but it is not known if this murine model is suitable for testing therapeutics that rely on the generation of an immune response for efficacy. We have tested recombinant adenovirus vectors for their ability to protect IFNR(-/-) mice from challenge with Ebola virus and have analysed the humoral response generated after immunisation. The recombinant vaccines elicited good levels of protection in the knock-out mouse and the antibody response in IFNR(-/-) mice was similar to that observed in vaccinated wild-type mice. These results indicate that the IFNR(-/-) mouse is a relevant small animal model for studying ebolavirus-specific therapeutics.

  7. Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues.

    PubMed

    Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou

    2015-09-01

    Cross-talk between tissues plays key roles in development of organisms; however, there are few researches on cross-talk between tissues in insects. Our previous studies showed that the pupal body weight was elevated after knocking out the fibroin heavy chain gene (BmFib-H), whereas the gene specifically expressed in silk glands of silkworm. Hence, the mutant is a good material for studying the cross-talk between tissues. It is considered that the fat body of silkworm during larval stage is used to store nutrients for pupal development. Herein, comparative proteomic of fat body on the 5th day of fifth instar was performed between BmFib-H gene knock-out Bombyx mori line (FGKO) and its wide-type Dazao. These results revealed that a single gene knock-out in silk gland triggered large-scale metabolic pathways changes in fat body. The levels of proteins involved in glycolysis/gluconeogenesis, pentose phosphate pathway, and glycine-serine biosynthetic pathway were down-regulated in the FGKO fat body. In contrast, the abundances of many proteins participating in protein synthesis, including ribosomal proteins, eukaryotic translation initiation factor, and elongation factor, were up-regulated. Moreover, the concentrations of glycogen and proteins in the FGKO fat body were greatly increased. These findings provided a novel insight into the cross-talk between silk gland and fat body in silkworm, and the presence of cross-talk between silk gland and fat body could regulate the redistribution of nutrients in the FGKO fat body leading to the increase of the pupal weight.

  8. Designing and Cloning Molecular Constructs to Knock Out N-Acetylglucosamine Phosphatidylinositol De-N-Acetylase (GPI12) Gene in Leishmania major (MRHO/IR/75/ER)

    PubMed Central

    GHASEMI NEJAD ALMANI, Pooya; SHARIFI, Iraj; KAZEMI, Bahram; BABAEI, Zahra; BANDEHPOUR, Mojgan; SALARI, Samira; SAEDI DEZAKI, Ebrahim

    2016-01-01

    Background: Leishmaniasis represents a major public health concern in tropical and sub-tropical countries. At present, there is no efficacious vaccine against the disease and new control methods are needed. One way to access this important goal is to knock out genes of specific macromolecules to evaluate the effect of deletion on the growth, multiplication, pathogenesis and immunity of the parasite. The aim of this study was to design and clone molecular constructs to knock out N-acetylglucosamine phosphatidylinositol de-N-acetylase (GPI12) gene in Leishmania major. Methods: For designing and making molecular constructs, we used pLEXSY-neo2 and pLEXSY-hyg2 vectors. The molecular constructs were cloned in E. coli strain Top10. The molecular constructs were transfected by electroporation into L. major in two stages. Results: The molecular constructs were confirmed by Colony PCR and sequencing. The recombinant strains were isolated by selective antibiotics, after which they were confirmed by PCR, Southern and Western blots. Conclusion: Recombinant parasites were created and examined for subsequent study. With the use of molecular constructs, it was possible to remove and study gene GPI12 and to achieve a live recombinant Leishmania parasite that maintained the original form of the antigenic parasites. This achievement can be used as an experimental model for vaccine development studies. Further investigations are essential to check this model in a suitable host. PMID:28127356

  9. Reduced levels of dopamine and altered metabolism in brains of HPRT knock-out rats: a new rodent model of Lesch-Nyhan Disease

    PubMed Central

    Meek, Stephen; Thomson, Alison J.; Sutherland, Linda; Sharp, Matthew G. F.; Thomson, Julie; Bishop, Valerie; Meddle, Simone L.; Gloaguen, Yoann; Weidt, Stefan; Singh-Dolt, Karamjit; Buehr, Mia; Brown, Helen K.; Gill, Andrew C.; Burdon, Tom

    2016-01-01

    Lesch-Nyhan disease (LND) is a severe neurological disorder caused by loss-of-function mutations in the gene encoding hypoxanthine phosphoribosyltransferase (HPRT), an enzyme required for efficient recycling of purine nucleotides. Although this biochemical defect reconfigures purine metabolism and leads to elevated levels of the breakdown product urea, it remains unclear exactly how loss of HPRT activity disrupts brain function. As the rat is the preferred rodent experimental model for studying neurobiology and diseases of the brain, we used genetically-modified embryonic stem cells to generate an HPRT knock-out rat. Male HPRT-deficient rats were viable, fertile and displayed normal caged behaviour. However, metabolomic analysis revealed changes in brain biochemistry consistent with disruption of purine recycling and nucleotide metabolism. Broader changes in brain biochemistry were also indicated by increased levels of the core metabolite citrate and reduced levels of lipids and fatty acids. Targeted MS/MS analysis identified reduced levels of dopamine in the brains of HPRT-deficient animals, consistent with deficits noted previously in human LND patients and HPRT knock-out mice. The HPRT-deficient rat therefore provides a new experimental platform for future investigation of how HPRT activity and disruption of purine metabolism affects neural function and behaviour. PMID:27185277

  10. Exacerbation of spontaneous autoimmune nephritis following regulatory T cell depletion in B cell lymphoma 2-interacting mediator knock-out mice.

    PubMed

    Wang, Y M; Zhang, G Y; Wang, Y; Hu, M; Zhou, J J; Sawyer, A; Cao, Q; Wang, Y; Zheng, G; Lee, V W S; Harris, D C H; Alexander, S I

    2017-02-02

    Regulatory T cells (Tregs ) have been recognized as central mediators for maintaining peripheral tolerance and limiting autoimmune diseases. The loss of Tregs or their function has been associated with exacerbation of autoimmune disease. However, the temporary loss of Tregs in the chronic spontaneous disease model has not been investigated. In this study, we evaluated the role of Tregs in a novel chronic spontaneous glomerulonephritis model of B cell lymphoma 2-interacting mediator (Bim) knock-out mice by transient depleting Tregs . Bim is a pro-apoptotic member of the B cell lymphoma 2 (Bcl-2) family. Bim knock-out (Bim(-/-) ) mice fail to delete autoreactive T cells in thymus, leading to chronic spontaneous autoimmune kidney disease. We found that Treg depletion in Bim(-/-) mice exacerbated the kidney injury with increased proteinuria, impaired kidney function, weight loss and greater histological injury compared with wild-type mice. There was a significant increase in interstitial infiltrate of inflammatory cells, antibody deposition and tubular damage. Furthermore, the serum levels of cytokines interleukin (IL)-2, IL-4, IL-6, IL-10, IL-17α, interferon (IFN)-γ and tumour necrosis factor (TNF)-α were increased significantly after Treg depletion in Bim(-/-) mice. This study demonstrates that transient depletion of Tregs leads to enhanced self-reactive T effector cell function followed by exacerbation of kidney disease in the chronic spontaneous kidney disease model of Bim-deficient mice.

  11. Effects of SIRT1 gene knock-out via activation of SREBP2 protein-mediated PI3K/AKT signaling on osteoarthritis in mice.

    PubMed

    Yu, Fei; Zeng, Hui; Lei, Ming; Xiao, De-Ming; Li, Wei; Yuan, Hao; Lin, Jian-Jing

    2016-10-01

    This study investigated the effects of SIRT1 gene knock-out on osteoarthritis in mice, and the possible roles of SREBP2 protein and the PI3K/AKT signaling pathway in the effects. Mice were randomly divided into a normal group and a SIRT1 gene knock-out group (6 mice in each group). In these groups, one side of the knee anterior cruciate ligament was traversed, and the ipsilateral medial meniscus was cut to establish an osteoarthritis model of knee joint. The countralateral synovial bursa was cut out, serving as controls. The knee joint specimens were then divided into four groups: SIRT1(+/+) control group (group A, n=6); SIRT1(+/+) osteoarthritis group (group B, n=6); SIRT1(-/-) control group (group C, n=6); SIRT1(-/-) osteoarthritis group (group D, n=6). HE staining, Masson staining, Safranin O-Fast Green staining and Van Gieson staining were used to observe the morphological changes in the articular cartilage of the knee. Immunohistochemical staining was employed to detect the expression of SIRT1, SREBP2, VEGF, AKT, HMGCR and type II collagen proteins. SA-β-gal staining was utilized to evaluate chondrocyte aging. The results showed clear knee joint cartilage destruction and degeneration in the SIRT1(-/-) osteoarthritis group. The tidal line was twisted and displaced anteriorly. Type II collagen was destroyed and distributed unevenly. Compared with the SIRT1(+/+) osteoarthritis group and SIRT1(-/-) control group, SIRT1 protein expression was not obviously changed in the SIRT1(-/-) osteoarthritis group (P>0.05), while the expression levels of the SREBP2, VEGF and HMGCR proteins were significantly increased (P<0.05) and the levels of AKT and type II collagen proteins were significantly decreased (P<0.05). SIRT1 gene knock-out may aggravate cartilage degeneration in osteoarthritis by activating the SREBP2 protein-mediated PI3K/AKT signalling pathway, suggesting that SIRT1 gene may play a protective role against osteoarthritis.

  12. Attenuated Inflammatory Response in Triggering Receptor Expressed on Myeloid Cells 2 (TREM2) Knock-Out Mice following Stroke

    PubMed Central

    Brehm, Martin; Guenther, Madlen; Linnartz-Gerlach, Bettina; Neumann, Harald; Witte, Otto W.; Frahm, Christiane

    2013-01-01

    Background Triggering receptor expressed on myeloid cells-2 (TREM2) is a microglial surface receptor involved in phagocytosis. Clearance of apoptotic debris after stroke represents an important mechanism to re-attain tissue homeostasis and thereby ensure functional recovery. The role of TREM2 following stroke is currently unclear. Methods and Results As an experimental stroke model, the middle cerebral artery of mice was occluded for 30 minutes with a range of reperfusion times (duration of reperfusion: 6 h/12 h/24 h/2 d/7 d/28 d). Quantitative PCR (qPCR) revealed a greatly increased transcription of TREM2 after stroke. We subsequently analyzed the expression of pro-inflammatory cytokines, chemokines and their receptors in TREM2-knockout (TREM2-KO) mice via qPCR. Microglial activation (CD68, Iba1) and CD3-positive T-cell invasion were analyzed via qPCR and immunohistochemistry. Functional consequences of TREM2 knockout were assessed by infarct volumetry. The acute inflammatory response (12 h reperfusion) was very similar between TREM2-KO mice and their littermate controls. However, in the sub-acute phase (7 d reperfusion) following stroke, TREM2-KO mice showed a decreased transcription of pro-inflammatory cytokines TNFα, IL-1α and IL-1β, associated with a reduced microglial activity (CD68, Iba1). Furthermore, TREM2-KO mice showed a reduced transcription of chemokines CCL2 (MCP1), CCL3 (MIP1α) and the chemokine receptor CX3CR1, followed by a diminished invasion of CD3-positive T-cells. No effect on the lesion size was observed. Conclusions Although we initially expected an exaggerated pro-inflammatory response following ablation of TREM2, our data support a contradictory scenario that the sub-acute inflammatory reaction after stroke is attenuated in TREM2-KO mice. We therefore conclude that TREM2 appears to sustain a distinct inflammatory response after stroke. PMID:23301011

  13. Peripheral Benzodiazepine Receptor/Translocator Protein Global Knock-out Mice Are Viable with No Effects on Steroid Hormone Biosynthesis*♦

    PubMed Central

    Tu, Lan N.; Morohaku, Kanako; Manna, Pulak R.; Pelton, Susanne H.; Butler, W. Ronald; Stocco, Douglas M.; Selvaraj, Vimal

    2014-01-01

    Translocator protein (TSPO), previously known as the peripheral benzodiazepine receptor, is a mitochondrial outer membrane protein implicated as essential for cholesterol import to the inner mitochondrial membrane, the rate-limiting step in steroid hormone biosynthesis. Previous research on TSPO was based entirely on in vitro experiments, and its critical role was reinforced by an early report that claimed TSPO knock-out mice were embryonic lethal. In a previous publication, we examined Leydig cell-specific TSPO conditional knock-out mice that suggested TSPO was not required for testosterone production in vivo. This raised controversy and several questions regarding TSPO function. To examine the definitive role of TSPO in steroidogenesis and embryo development, we generated global TSPO null (Tspo−/−) mice. Contrary to the early report, Tspo−/− mice survived with no apparent phenotypic abnormalities and were fertile. Examination of adrenal and gonadal steroidogenesis showed no defects in Tspo−/− mice. Adrenal transcriptome comparison of gene expression profiles showed that genes involved in steroid hormone biosynthesis (Star, Cyp11a1, and Hsd3b1) were unchanged in Tspo−/− mice. Adrenocortical ultrastructure illustrated no morphological alterations in Tspo−/− mice. In an attempt to correlate our in vivo findings to previously used in vitro models, we also determined that siRNA knockdown or the absence of TSPO in different mouse and human steroidogenic cell lines had no effect on steroidogenesis. These findings directly refute the dogma that TSPO is indispensable for steroid hormone biosynthesis and viability. By amending the current model, this study advances our understanding of steroidogenesis with broad implications in biology and medicine. PMID:24936060

  14. Towards in vivo mutation analysis: knock-out of specific chlorophylls bound to the light-harvesting complexes of Arabidopsis thaliana - the case of CP24 (Lhcb6).

    PubMed

    Passarini, Francesca; Xu, Pengqi; Caffarri, Stefano; Hille, Jacques; Croce, Roberta

    2014-09-01

    In the last ten years, a large series of studies have targeted antenna complexes of plants (Lhc) with the aim of understanding the mechanisms of light harvesting and photoprotection. Combining spectroscopy, modeling and mutation analyses, the role of individual pigments in these processes has been highlighted in vitro. In plants, however, these proteins are associated with multiple complexes of the photosystems and function within this framework. In this work, we have envisaged a way to bridge the gap between in vitro and in vivo studies by knocking out in vivo pigments that have been proposed to play an important role in excitation energy transfer between the complexes or in photoprotection. We have complemented a CP24 knock-out mutant of Arabidopsis thaliana with the CP24 (Lhcb6) gene carrying a His-tag and with a mutated version lacking the ligand for chlorophyll 612, a specific pigment that in vitro experiments have indicated as the lowest energy site of the complex. Both complexes efficiently integrated into the thylakoid membrane and assembled into the PSII supercomplexes, indicating that the His-tag does not impair the organization in vivo. The presence of the His-tag allowed the purification of CP24-WT and of CP24-612 mutant in their native states. It is shown that CP24-WT coordinates 10 chlorophylls and 2 carotenoid molecules and has properties identical to those of the reconstituted complex, demonstrating that the complex self-assembled in vitro assumes the same folding as in the plant. The absence of the ligand for chlorophyll 612 leads to the loss of one Chl a and of lutein, again as in vitro, indicating the feasibility of the method. This article is part of a special issue entitled: photosynthesis research for sustainability: keys to produce clean energy.

  15. Knock out of the PHOSPHATE 2 Gene TaPHO2-A1 Improves Phosphorus Uptake and Grain Yield under Low Phosphorus Conditions in Common Wheat

    PubMed Central

    Ouyang, Xiang; Hong, Xia; Zhao, Xueqiang; Zhang, Wei; He, Xue; Ma, Wenying; Teng, Wan; Tong, Yiping

    2016-01-01

    MiR399 and its target PHOSPHATE2 (PHO2) play pivotal roles in phosphate signaling in plants. Loss of function mutation in PHO2 leads to excessive Pi accumulation in shoots and growth retardation in diploid plants like Arabidopsis thaliana and rice (Oryza sativa). Here we isolated three PHO2 homologous genes TaPHO2-A1, -B1 and -D1 from hexaploid wheat (Triticum aestivum). These TaPHO2 genes all contained miR399-binding sites and were able to be degraded by tae-miR399. TaPHO2-D1 was expressed much more abundantly than TaPHO2-A1 and -B1. The ion beam-induced deletion mutants were used to analyze the effects of TaPHO2s on phosphorus uptake and plant growth. The tapho2-a1, tapho2-b1 and tapho2-d1 mutants all had significant higher leaf Pi concentrations than did the wild type, with tapho2-d1 having the strongest effect, and tapho2-b1 the weakest. Two consecutive field experiments showed that knocking out TaPHO2-D1 reduced plant height and grain yield under both low and high phosphorus conditions. However, knocking out TaPHO2-A1 significantly increased phosphorus uptake and grain yield under low phosphorus conditions, with no adverse effect on grain yield under high phosphorus conditions. Our results indicated that TaPHO2s involved in phosphorus uptake and translocation, and molecular engineering TaPHO2 shows potential in improving wheat yield with less phosphorus fertilizer. PMID:27416927

  16. Synergistic Roles for G-protein γ3 and γ7 Subtypes in Seizure Susceptibility as Revealed in Double Knock-out Mice*

    PubMed Central

    Schwindinger, William F.; Mirshahi, Uyenlinh L.; Baylor, Kelly A.; Sheridan, Kathleen M.; Stauffer, Anna M.; Usefof, Stephanie; Stecker, Mark M.; Mirshahi, Tooraj; Robishaw, Janet D.

    2012-01-01

    The functions of different G-protein αβγ subunit combinations are traditionally ascribed to their various α components. However, the discovery of similarly diverse γ subtypes raises the possibility that they may also contribute to specificity. To test this possibility, we used a gene targeting approach to determine whether the closely related γ3 and γ7 subunits can perform functionally interchangeable roles in mice. In contrast to single knock-out mice that show normal survival, Gng3−/−Gng7−/− double knock-out mice display a progressive seizure disorder that dramatically reduces their median life span to only 75 days. Biochemical analyses reveal that the severe phenotype is not due to redundant roles for the two γ subunits in the same signaling pathway but rather is attributed to their unique actions in different signaling pathways. The results suggest that the γ3 subunit is a component of a Gi/o protein that is required for γ-aminobutyric acid, type B, receptor-regulated neuronal excitability, whereas the γ7 subunit is a component of a Golf protein that is responsible for A2A adenosine or D1 dopamine receptor-induced neuro-protective response. The development of this mouse model offers a novel experimental framework for exploring how signaling pathways integrate to produce normal brain function and how their combined dysfunction leads to spontaneous seizures and premature death. The results underscore the critical role of the γ subunit in this process. PMID:22207761

  17. Broken or knocked out tooth

    MedlinePlus

    ... Geme JW, Schor NF, eds. Nelson Textbook of Pediatrics . 20th ed. Philadelphia, PA: Elsevier; 2016:chap 314. Read More Root canal Review Date 2/22/2016 Updated by: Michael Kapner, DDS, general and aesthetic dentistry, Norwalk Medical Center, Norwalk, CT. Review provided by ...

  18. Antidepressant activity: contribution of brain microdialysis in knock-out mice to the understanding of BDNF/5-HT transporter/5-HT autoreceptor interactions

    PubMed Central

    Gardier, Alain M.

    2013-01-01

    Why antidepressants vary in terms of efficacy is currently unclear. Despite the leadership of selective serotonin reuptake inhibitors (SSRIs) in the treatment of depression, the precise neurobiological mechanisms involved in their therapeutic action are poorly understood. A better knowledge of molecular interactions between monoaminergic system, pre- and post-synaptic partners, brain neuronal circuits and regions involved may help to overcome limitations of current treatments and identify new therapeutic targets. Intracerebral in vivo microdialysis (ICM) already provided important information about the brain mechanism of action of antidepressants first in anesthetized rats in the early 1990s, and since then in conscious wild-type or knock-out mice. The principle of ICM is based on the balance between release of neurotransmitters (e.g., monoamines) and reuptake by selective transporters [e.g., serotonin transporter for serotonin 5-hydroxytryptamine (5-HT)]. Complementary to electrophysiology, this technique reflects pre-synaptic monoamines release and intrasynaptic events corresponding to ≈80% of whole brain tissue content. The inhibitory role of serotonergic autoreceptors infers that they limit somatodendritic and nerve terminal 5-HT release. It has been proposed that activation of 5-HT1A and 5-HT1B receptor sub-types limits the antidepressant-like activity of SSRIs. This hypothesis is based partially on results obtained in ICM experiments performed in naïve, non-stressed rodents. The present review will first remind the principle and methodology of ICM performed in mice. The crucial need of developing animal models that display anxiety and depression-like behaviors, neurochemical and brain morphological phenotypes reminiscent of these mood disorders in humans, will be underlined. Recently developed genetic mouse models have been generated to independently manipulate 5-HT1A auto and heteroreceptors and ICM helped to clarify the role of the pre-synaptic component

  19. The phenotypes of ATG9, ATG16 and ATG9/16 knock-out mutants imply autophagy-dependent and -independent functions

    PubMed Central

    Xiong, Qiuhong; Ünal, Can; Matthias, Jan; Steinert, Michael; Eichinger, Ludwig

    2015-01-01

    Macroautophagy is a highly conserved intracellular bulk degradation system of all eukaryotic cells. It is governed by a large number of autophagy proteins (ATGs) and is crucial for many cellular processes. Here, we describe the phenotypes of Dictyostelium discoideum ATG16− and ATG9−/16− cells and compare them to the previously reported ATG9− mutant. ATG16 deficiency caused an increase in the expression of several core autophagy genes, among them atg9 and the two atg8 paralogues. The single and double ATG9 and ATG16 knock-out mutants had complex phenotypes and displayed severe and comparable defects in pinocytosis and phagocytosis. Uptake of Legionella pneumophila was reduced. In addition, ATG9− and ATG16− cells had dramatic defects in autophagy, development and proteasomal activity which were much more severe in the ATG9−/16− double mutant. Mutant cells showed an increase in poly-ubiquitinated proteins and contained large ubiquitin-positive protein aggregates which partially co-localized with ATG16-GFP in ATG9−/16− cells. The more severe autophagic, developmental and proteasomal phenotypes of ATG9−/16− cells imply that ATG9 and ATG16 probably function in parallel in autophagy and have in addition autophagy-independent functions in further cellular processes. PMID:25878144

  20. Type II Cochlear Ganglion Neurons Do Not Drive the Olivocochlear Reflex: Re-Examination of the Cochlear Phenotype in Peripherin Knock-Out Mice

    PubMed Central

    2016-01-01

    Abstract The cochlear nerve includes a small population of unmyelinated sensory fibers connecting outer hair cells to the brain. The functional role of these type II afferent neurons is controversial, because neurophysiological data are sparse. A recent study (Froud et al., 2015) reported that targeted deletion of peripherin, a type of neurofilament, eliminated type II afferents and inactivated efferent feedback to the outer hair cells, thereby suggesting that type II afferents were the sensory drive to this sound-evoked, negative-feedback reflex, the olivocochlear pathway. Here, we re-evaluated the cochlear phenotype in mice from the peripherin knock-out line and show that (1) type II afferent terminals are present in normal number and (2) olivocochlear suppression of cochlear responses is absent even when this efferent pathway is directly activated by shocks. We conclude that type II neurons are not the sensory drive for the efferent reflex and that peripherin deletion likely causes dysfunction of synaptic transmission between olivocochlear terminals and their peripheral targets. PMID:27570826

  1. Establishment of Immortalized BMP2/4 Double Knock-Out Osteoblastic Cells Is Essential for Study of Osteoblast Growth, Differentiation, and Osteogenesis.

    PubMed

    Wu, Li-An; Wang, Feng; Donly, Kevin J; Baker, Andrew; Wan, Chunyan; Luo, Daoshu; MacDougall, Mary; Chen, Shuo

    2016-06-01

    Bone morphogenetic proteins 2 and 4 (BMP2/4) are essential for osteoblast differentiation and osteogenesis. Generation of a BMP2/4 dual knock-out ((ko/ko)) osteoblastic cell line is a valuable asset for studying effects of BMP2/4 on skeletal development. In this study, our goal was to create immortalized mouse deleted BMP2/4 osteoblasts by infecting adenoviruses with Cre recombinase and green fluorescent protein genes into immortalized murine floxed BMP2/4 osteoblasts. Transduced BMP2/4(ko/ko) cells were verified by green immunofluorescence and PCR. BMP2/4(ko/ko) osteoblasts exhibited small size, slow cell proliferation rate and cell growth was arrested in G1 and G2 phases. Expression of bone-relate genes was reduced in the BMP2/4(ko/ko) cells, resulting in delay of cell differentiation and mineralization. Importantly, extracellular matrix remodeling was impaired in the BMP2/4(ko/ko) osteoblasts as reflected by decreased Mmp-2 and Mmp-9 expressions. Cell differentiation and mineralization were rescued by exogenous BMP2 and/or BMP4. Therefore, we for the first time described establishment of an immortalized deleted BMP2/4 osteoblast line useful for study of mechanisms in regulating osteoblast lineages.

  2. The effect of neuronal conditional knock-out of peroxisome proliferator-activated receptors in the MPTP mouse model of Parkinson’s disease

    PubMed Central

    Mounsey, R.B.; Martin, H.L.; Nelson, M.C.; Evans, R.M.; Teismann, P.

    2015-01-01

    Activation of peroxisome proliferator-activated receptors (PPARs), namely PPARγ and PPARδ, has been shown to provide neuroprotection in a number of neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease (PD). The observed neuroprotective effects in experimental models of PD have been linked to anti-oxidant and anti-inflammatory actions. This study aimed to analyze the full influence of these receptors in neuroprotection by generating a nerve cell-specific conditional knock-out of these receptors and subjecting these genetically modified mice to the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) neurotoxin to model dopaminergic degeneration. Mice null for both receptors show the lowest levels of tyrosine hydroxylase (TH)-positive cell bodies following MPTP administration. Presence of one or both these receptors show a trend toward protection against this degeneration, as higher dopaminergic cell immunoreactivity and striatal monoamine levels are evident. These data supplement recent studies that have elected to use agonists of the receptors to regulate immune responses. The results place further importance on the activation of PPARs and the neuroprotective roles these have in inflammatory processes linked to neurodegenerative processes. PMID:26028469

  3. A role for glucocorticoid-signaling in depression-like behavior of gastrin-releasing peptide receptor knock-out mice.

    PubMed

    Monje, Francisco J; Kim, Eun-Jung; Cabatic, Maureen; Lubec, Gert; Herkner, Kurt R; Pollak, Daniela D

    2011-08-01

    Abstract Background. The gastrin-releasing peptide receptor (GRPR) is highly expressed in the limbic system, where it importantly regulates emotional functions and in the suprachiasmatic nucleus, where it is central for the photic resetting of the circadian clock. Mice lacking GRPR presented with deficient light-induced phase shift in activity as well altered emotional learning and amygdala function. The effect of GRPR deletion on depression-like behavior and its molecular signature in the amygdala, however, has not yet been evaluated. Methods. GRPR knock-out mice (GRPR-KO) were tested in the forced-swim test and the sucrose preference test for depression-like behavior. Gene expression in the basolateral nucleus of the amygdala was evaluated by micorarray analysis subsequent to laser-capture microdissection-assisted extraction of mRNA. The expression of selected genes was confirmed by RT-PCR. Results. GRPR-KO mice were found to present with increased depression-like behavior. Microarray analysis revealed down-regulation of several glucocorticoid-responsive genes in the basolateral amygdala. Acute administration of dexamethasone reversed the behavioral phenotype and alterations in gene expression. Discussion. We propose that deletion of GRPR leads to the induction of depression-like behavior which is paralleled by dysregulation of amygdala gene expression, potentially resulting from deficient light-induced corticosterone release in GRPR-KO.

  4. Comparative N-linked glycan analysis of wild-type and α1,3-galactosyltransferase gene knock-out pig fibroblasts using mass spectrometry approaches.

    PubMed

    Park, Hae-Min; Kim, Yoon-Woo; Kim, Kyoung-Jin; Kim, Young June; Yang, Yung-Hun; Jin, Jang Mi; Kim, Young Hwan; Kim, Byung-Gee; Shim, Hosup; Kim, Yun-Gon

    2015-01-31

    Carbohydrate antigens expressed on pig cells are considered to be major barriers in pig-to-human xenotransplantation. Even after α1,3-galactosyltransferase gene knock-out (GalT-KO) pigs are generated, potential non-Gal antigens are still existed. However, to the best of our knowledge there is no extensive study analyzing N-glycans expressed on the GalT-KO pig tissues or cells. Here, we identified and quantified totally 47 N-glycans from wild-type (WT) and GalT-KO pig fibroblasts using mass spectrometry. First, our results confirmed the absence of galactose-alpha-1,3-galactose (α-Gal) residue in the GalT-KO pig cells. Interestingly, we showed that the level of overall fucosylated N-glycans from GalT-KO pig fibroblasts is much higher than from WT pig fibroblasts. Moreover, the relative quantity of the N-glycolylneuraminic acid (NeuGc) antigen is slightly higher in the GalT-KO pigs. Thus, this study will contribute to a better understanding of cellular glycan alterations on GalT-KO pigs for successful xenotransplantation.

  5. Increased cellular free cholesterol in macrophage-specific Abca1 knock-out mice enhances pro-inflammatory response of macrophages.

    PubMed

    Zhu, Xuewei; Lee, Ji-Young; Timmins, Jenelle M; Brown, J Mark; Boudyguina, Elena; Mulya, Anny; Gebre, Abraham K; Willingham, Mark C; Hiltbold, Elizabeth M; Mishra, Nilamadhab; Maeda, Nobuyo; Parks, John S

    2008-08-22

    Macrophage-specific Abca1 knock-out (Abca1(-)(M)(/-)(M)) mice were generated to determine the role of macrophage ABCA1 expression in plasma lipoprotein concentrations and the innate immune response of macrophages. Plasma lipid and lipoprotein concentrations in chow-fed Abca1(-)(M)(/-)(M) and wild-type (WT) mice were indistinguishable. Compared with WT macrophages, Abca1(-)(M)(/-)(M) macrophages had a >95% reduction in ABCA1 protein, failed to efflux lipid to apoA-I, and had a significant increase in free cholesterol (FC) and membrane lipid rafts without induction of endoplasmic reticulum stress. Lipopolysaccharide (LPS)-treated Abca1(-)(M)(/-)(M) macrophages exhibited enhanced expression of pro-inflammatory cytokines and increased activation of the NF-kappaB and MAPK pathways, which could be diminished by silencing MyD88 or by chemical inhibition of NF-kappaB or MAPK. In vivo LPS injection also resulted in a higher pro-inflammatory response in Abca1(-)(M)(/-)(M) mice compared with WT mice. Furthermore, cholesterol depletion of macrophages with methyl-beta-cyclodextrin normalized FC content between the two genotypes and their response to LPS; cholesterol repletion of macrophages resulted in increased cellular FC accumulation and enhanced cellular response to LPS. Our results suggest that macrophage ABCA1 expression may protect against atherosclerosis by facilitating the net removal of excess lipid from macrophages and dampening pro-inflammatory MyD88-dependent signaling pathways by reduction of cell membrane FC and lipid raft content.

  6. Production of superoxide from photosystem II-light harvesting complex II supercomplex in STN8 kinase knock-out rice mutants under photoinhibitory illumination.

    PubMed

    Poudyal, Roshan Sharma; Nath, Krishna; Zulfugarov, Ismayil S; Lee, Choon-Hwan

    2016-09-01

    When phosphorylation of Photosystem (PS) II core proteins is blocked in STN8 knock-out mutants of rice (Oryza sativa) under photoinhibitory illumination, the mobilization of PSII supercomplex is prevented. We have previously proposed that more superoxide (O2(-)) is produced from PSII in the mutant (Nath et al., 2013, Plant J. 76, 675-686). Here, we clarify the type and site for the generation of reactive oxygen species (ROS). Using both histochemical and fluorescence probes, we observed that, compared with wild-type (WT) leaves, levels of ROS, including O2(-) and hydrogen peroxide (H2O2), were increased when leaves from mutant plants were illuminated with excess light. However, singlet oxygen production was not enhanced under such conditions. When superoxide dismutase was inhibited, O2(-) production was increased, indicating that it is the initial event prior to H2O2 production. In thylakoids isolated from WT leaves, kinase was active in the presence of ATP, and spectrophotometric analysis of nitrobluetetrazolium absorbance for O2(-) confirmed that PSII-driven superoxide production was greater in the mutant thylakoids than in the WT. This contrast in levels of PSII-driven superoxide production between the mutants and the WT plants was confirmed by conducting protein oxidation assays of PSII particles from osstn8 leaves under strong illumination. Those assays also demonstrated that PSII-LHCII supercomplex proteins were oxidized more in the mutant, thereby implying that PSII particles incur greater damage even though D1 degradation during PSII-supercomplex mobilization is partially blocked in the mutant. These results suggest that O2(-) is the major form of ROS produced in the mutant, and that the damaged PSII in the supercomplex is the primary source of O2(-).

  7. Automated pipeline to analyze non-contact infrared images of the paraventricular nucleus specific leptin receptor knock-out mouse model

    NASA Astrophysics Data System (ADS)

    Diaz Martinez, Myriam; Ghamari-Langroudi, Masoud; Gifford, Aliya; Cone, Roger; Welch, E. B.

    2015-03-01

    Evidence of leptin resistance is indicated by elevated leptin levels together with other hallmarks of obesity such as a defect in energy homeostasis.1 As obesity is an increasing epidemic in the US, the investigation of mechanisms by which leptin resistance has a pathophysiological impact on energy is an intensive field of research.2 However, the manner in which leptin resistance contributes to the dysregulation of energy, specifically thermoregulation,3 is not known. The aim of this study was to investigate whether the leptin receptor expressed in paraventricular nucleus (PVN) neurons plays a role in thermoregulation at different temperatures. Non-contact infrared (NCIR) thermometry was employed to measure surface body temperature (SBT) of nonanesthetized mice with a specific deletion of the leptin receptor in the PVN after exposure to room (25 °C) and cold (4 °C) temperature. Dorsal side infrared images of wild type (LepRwtwt/sim1-Cre), heterozygous (LepRfloxwt/sim1-Cre) and knock-out (LepRfloxflox/sim1-Cre) mice were collected. Images were input to an automated post-processing pipeline developed in MATLAB to calculate average and maximum SBTs. Linear regression was used to evaluate the relationship between sex, cold exposure and leptin genotype with SBT measurements. Findings indicate that average SBT has a negative relationship to the LepRfloxflox/sim1-Cre genotype, the female sex and cold exposure. However, max SBT is affected by the LepRfloxflox/sim1-Cre genotype and the female sex. In conclusion this data suggests that leptin within the PVN may have a neuroendocrine role in thermoregulation and that NCIR thermometry combined with an automated imaging-processing pipeline is a promising approach to determine SBT in non-anesthetized mice.

  8. Conversion of the modulatory actions of dopamine on spinal reflexes from depression to facilitation in D3 receptor knock-out mice.

    PubMed

    Clemens, Stefan; Hochman, Shawn

    2004-12-15

    Descending monoaminergic systems modulate spinal cord function, yet spinal dopaminergic actions are poorly understood. Using the in vitro lumbar cord, we studied the effects of dopamine and D2-like receptor ligands on spinal reflexes in wild-type (WT) and D3-receptor knock-out mice (D3KO). Low dopamine levels (1 microM) decreased the monosynaptic "stretch" reflex (MSR) amplitude in WT animals and increased it in D3KO animals. Higher dopamine concentrations (10-100 microM) decreased MSR amplitudes in both groups, but always more strongly in WT. Like low dopamine, the D3 receptor agonists pergolide and PD 128907 reduced MSR amplitude in WT but not D3KO mice. Conversely, D3 receptor antagonists (GR 103691 and nafadotride) increased the MSR in WT but not in D3KO mice. In comparison, D2-preferring agonists bromocriptine and quinpirole depressed the MSR in both groups. Low dopamine (1-5 microM) also depressed longer-latency (presumably polysynaptic) reflexes in WT but facilitated responses in D3KO mice. Additionally, in some experiments (e.g., during 10 microM dopamine or pergolide in WT), polysynaptic reflexes were facilitated in parallel to MSR depression, demonstrating differential modulatory control of these reflex circuits. Thus, low dopamine activates D3 receptors to limit reflex excitability. Moreover, in D3 ligand-insensitive mice, excitatory actions are unmasked, functionally converting the modulatory action of dopamine from depression to facilitation. Restless legs syndrome (RLS) is a CNS disorder involving abnormal limb sensations. Because RLS symptoms peak at night when dopamine levels are lowest, are relieved by D3 agonists, and likely involve increased reflex excitability, the D3KO mouse putatively explains how impaired D3 activity could contribute to this sleep disorder.

  9. Use of zinc-finger nucleases to knock out the WAS gene in K562 cells: a human cellular model for Wiskott-Aldrich syndrome.

    PubMed

    Toscano, Miguel G; Anderson, Per; Muñoz, Pilar; Lucena, Gema; Cobo, Marién; Benabdellah, Karim; Gregory, Philip D; Holmes, Michael C; Martin, Francisco

    2013-03-01

    Mutations in the WAS gene cause Wiskott-Aldrich syndrome (WAS), which is characterized by eczema, immunodeficiency and microthrombocytopenia. Although the role of WASP in lymphocytes and myeloid cells is well characterized, its role on megakaryocyte (MK) development is poorly understood. In order to develop a human cellular model that mimics the megakaryocytic-derived defects observed in WAS patients we used K562 cells, a well-known model for study of megakaryocytic development. We knocked out the WAS gene in K562 cells using a zinc-finger nuclease (ZFN) pair targeting the WAS intron 1 and a homologous donor DNA that disrupted WASP expression. Knockout of WASP on K562 cells (K562WASKO cells) resulted in several megakaryocytic-related defects such as morphological alterations, lower expression of CD41, lower increments in F-actin polymerization upon stimulation, reduced CD43 expression and increased phosphatidylserine exposure. All these defects have been previously described either in WAS-knockout mice or in WAS patients, validating K562WASKO as a cell model for WAS. However, K562WASPKO cells showed also increased basal F-actin and adhesion, increased expression of CD61 and reduced expression of TGFβ and Factor VIII, defects that have never been described before for WAS-deficient cells. Interestingly, these phenotypic alterations correlate with different roles for WASP in megakaryocytic differentiation. All phenotypic alterations observed in K562WASKO cells were alleviated upon expression of WAS following lentiviral transduction, confirming the role of WASP in these phenotypes. In summary, in this work we have validated a human cellular model, K562WASPKO, that mimics the megakaryocytic-related defects found in WAS-knockout mice and have found evidences for a role of WASP as regulator of megakaryocytic differentiation. We propose the use of K562WASPKO cells as a tool to study the molecular mechanisms involved in the megakaryocytic-related defects observed in WAS

  10. Use of zinc-finger nucleases to knock out the WAS gene in K562 cells: a human cellular model for Wiskott-Aldrich syndrome

    PubMed Central

    Toscano, Miguel G.; Anderson, Per; Muñoz, Pilar; Lucena, Gema; Cobo, Marién; Benabdellah, Karim; Gregory, Philip D.; Holmes, Michael C.; Martin, Francisco

    2013-01-01

    SUMMARY Mutations in the WAS gene cause Wiskott-Aldrich syndrome (WAS), which is characterized by eczema, immunodeficiency and microthrombocytopenia. Although the role of WASP in lymphocytes and myeloid cells is well characterized, its role on megakaryocyte (MK) development is poorly understood. In order to develop a human cellular model that mimics the megakaryocytic-derived defects observed in WAS patients we used K562 cells, a well-known model for study of megakaryocytic development. We knocked out the WAS gene in K562 cells using a zinc-finger nuclease (ZFN) pair targeting the WAS intron 1 and a homologous donor DNA that disrupted WASP expression. Knockout of WASP on K562 cells (K562WASKO cells) resulted in several megakaryocytic-related defects such as morphological alterations, lower expression of CD41ɑ, lower increments in F-actin polymerization upon stimulation, reduced CD43 expression and increased phosphatidylserine exposure. All these defects have been previously described either in WAS-knockout mice or in WAS patients, validating K562WASKO as a cell model for WAS. However, K562WASPKO cells showed also increased basal F-actin and adhesion, increased expression of CD61 and reduced expression of TGFβ and Factor VIII, defects that have never been described before for WAS-deficient cells. Interestingly, these phenotypic alterations correlate with different roles for WASP in megakaryocytic differentiation. All phenotypic alterations observed in K562WASKO cells were alleviated upon expression of WAS following lentiviral transduction, confirming the role of WASP in these phenotypes. In summary, in this work we have validated a human cellular model, K562WASPKO, that mimics the megakaryocytic-related defects found in WAS-knockout mice and have found evidences for a role of WASP as regulator of megakaryocytic differentiation. We propose the use of K562WASPKO cells as a tool to study the molecular mechanisms involved in the megakaryocytic-related defects observed

  11. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone.

    PubMed

    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L; Ferris, Craig F

    2016-01-01

    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain

  12. BOLD Imaging in Awake Wild-Type and Mu-Opioid Receptor Knock-Out Mice Reveals On-Target Activation Maps in Response to Oxycodone

    PubMed Central

    Moore, Kelsey; Madularu, Dan; Iriah, Sade; Yee, Jason R.; Kulkarni, Praveen; Darcq, Emmanuel; Kieffer, Brigitte L.; Ferris, Craig F.

    2016-01-01

    Blood oxygen level dependent (BOLD) imaging in awake mice was used to identify differences in brain activity between wild-type, and Mu (μ) opioid receptor knock-outs (MuKO) in response to oxycodone (OXY). Using a segmented, annotated MRI mouse atlas and computational analysis, patterns of integrated positive and negative BOLD activity were identified across 122 brain areas. The pattern of positive BOLD showed enhanced activation across the brain in WT mice within 15 min of intraperitoneal administration of 2.5 mg of OXY. BOLD activation was detected in 72 regions out of 122, and was most prominent in areas of high μ opioid receptor density (thalamus, ventral tegmental area, substantia nigra, caudate putamen, basal amygdala, and hypothalamus), and focus on pain circuits indicated strong activation in major pain processing centers (central amygdala, solitary tract, parabrachial area, insular cortex, gigantocellularis area, ventral thalamus primary sensory cortex, and prelimbic cortex). Importantly, the OXY-induced positive BOLD was eliminated in MuKO mice in most regions, with few exceptions (some cerebellar nuclei, CA3 of the hippocampus, medial amygdala, and preoptic areas). This result indicates that most effects of OXY on positive BOLD are mediated by the μ opioid receptor (on-target effects). OXY also caused an increase in negative BOLD in WT mice in few regions (16 out of 122) and, unlike the positive BOLD response the negative BOLD was only partially eliminated in the MuKO mice (cerebellum), and in some case intensified (hippocampus). Negative BOLD analysis therefore shows activation and deactivation events in the absence of the μ receptor for some areas where receptor expression is normally extremely low or absent (off-target effects). Together, our approach permits establishing opioid-induced BOLD activation maps in awake mice. In addition, comparison of WT and MuKO mutant mice reveals both on-target and off-target activation events, and set an OXY brain

  13. Mouse Pet-1 knock-out induced 5-HT disruption results in a lack of cognitive deficits and an anxiety phenotype complicated by hypoactivity and defensiveness

    PubMed Central

    Schaefer, Tori L.; Vorhees, Charles V.; Williams, Michael T.

    2009-01-01

    Serotonin (5-HT) is involved in many developmental processes and influences behaviors including anxiety, aggression, and cognition. Disruption of the serotonergic system has been implicated in human disorders including autism, depression, schizophrenia, and ADHD. Although pharmacological, neurotoxin, and dietary manipulation of 5-HT and tryptophan hydroxylase has added to our understanding of the serotonergic system, the results are complicated by multiple factors. A newly identified ETS domain transcription factor, Pet-1, has direct control of major aspects of 5-HT neuronal development. Pet-1 is the only known factor that is restricted in the brain to 5-HT neurons during development and adulthood and exerts dominant control over 5-HT neuronal phenotype. Disruption of Pet-1 produces an ∼80% loss of 5-HT neurons and content and results in increased aggression in male Pet-1-/- mice (Hendricks et al., 2003). We hypothesized that Pet-1-/- mice would also exhibit changes in anxiety and cognition. Pet-1-/- mice were hypoactive which may have affected the observed lack of anxious behavior in the elevated zero maze and light-dark test. Pet-1-/- mice, however, were more defensive during marble burying and showed acoustic startle hyper-reactivity. No deficits in spatial, egocentric, or novel object recognition learning were found in Pet-1-/- mice. These findings were unexpected given that 5-HT depleting drugs given to adult or developing animals result in learning deficits (Mazer et al., 1997;Morford et al., 2002;Vorhees et al., 2007). Lack of differences may be the result of compensatory mechanisms in reaction to a constitutive knockout of Pet-1 or 5-HT may not be as important in learning and memory as previously suspected. PMID:19786075

  14. Circadian rhythms in heart rate, motility, and body temperature of wild-type C57 and eNOS knock-out mice under light-dark, free-run, and after time zone transition.

    PubMed

    Arraj, M; Lemmer, B

    2006-01-01

    The nitric oxide (NO) system is involved in the regulation of the cardiovascular system in controlling central and peripheral vascular tone and cardiac functions. It was the aim of this study to investigate in wild-type C57BL/6 and endothelial nitric oxide synthase (eNOS) knock-out mice (eNOS-/-) the contribution of NO on the circadian rhythms in heart rate (HR), motility (motor activity [MA]), and body temperature (BT) under various environmental conditions. Experiments were performed in 12:12 h of a light:dark cycle (LD), under free-run in total darkness (DD), and after a phase delay shift of the LD cycle by -6 h (i.e., under simulation of a westward time zone transition). All parameters were monitored by radiotelemetry in freely moving mice. In LD, no significant differences in the rhythms of HR and MA were observed between the two strains of mice. BT, however, was significantly lower during the light phase in eNOS-/- mice, resulting in a significantly greater amplitude. The period of the free-running rhythm in DD was slightly shorter for all variables, though not significant. In general, rhythmicity was greater in eNOS-/- than in C57 mice both in LD and DD. After a delay shift of the LD cycle, HR and BT were resynchronized to the new LD schedule within 5-6 days, and resynchronization of MA occurred within 2-3 days. The results in telemetrically instrumented mice show that complete knock-out of the endothelial NO system--though expressed in the suprachiasmatic nuclei and in peripheral tissues--did not affect the circadian organization of heart rate and motility. The circadian regulation of the body temperature was slightly affected in eNOS-/- mice.

  15. Sensitivity of heterozygous α1,6-fucosyltransferase knock-out mice to cigarette smoke-induced emphysema: implication of aberrant transforming growth factor-β signaling and matrix metalloproteinase gene expression.

    PubMed

    Gao, Congxiao; Maeno, Toshitaka; Ota, Fumi; Ueno, Manabu; Korekane, Hiroaki; Takamatsu, Shinji; Shirato, Ken; Matsumoto, Akio; Kobayashi, Satoshi; Yoshida, Keiichi; Kitazume, Shinobu; Ohtsubo, Kazuaki; Betsuyaku, Tomoko; Taniguchi, Naoyuki

    2012-05-11

    We previously demonstrated that a deficiency in core fucosylation caused by the genetic disruption of α1,6-fucosyltransferase (Fut8) leads to lethal abnormalities and the development of emphysematous lesions in the lung by attenuation of TGF-β1 receptor signaling. Herein, we investigated the physiological relevance of core fucosylation in the pathogenesis of emphysema using viable heterozygous knock-out mice (Fut8(+/-)) that were exposed to cigarette smoke (CS). The Fut8(+/-) mice exhibited a marked decrease in FUT8 activity, and matrix metalloproteinase (MMP)-9 activities were elevated in the lung at an early stage of exposure. Emphysema developed after a 3-month CS exposure, accompanied by the recruitment of large numbers of macrophages to the lung. CS exposure substantially and persistently elevated the expression level of Smad7, resulting in a significant reduction of Smad2 phosphorylation (which controls MMP-9 expression) in Fut8(+/-) mice and Fut8-deficient embryonic fibroblast cells. These in vivo and in vitro studies show that impaired core fucosylation enhances the susceptibility to CS and constitutes at least part of the disease process of emphysema, in which TGF-β-Smad signaling is impaired and the MMP-mediated destruction of lung parenchyma is up-regulated.

  16. Working Memory Impairment in Calcineurin Knock-out Mice Is Associated with Alterations in Synaptic Vesicle Cycling and Disruption of High-Frequency Synaptic and Network Activity in Prefrontal Cortex

    PubMed Central

    Cottrell, Jeffrey R.; Levenson, Jonathan M.; Kim, Sung Hyun; Gibson, Helen E.; Richardson, Kristen A.; Sivula, Michael; Li, Bing; Ashford, Crystle J.; Heindl, Karen A.; Babcock, Ryan J.; Rose, David M.; Hempel, Chris M.; Wiig, Kjesten A.; Laeng, Pascal; Levin, Margaret E.; Ryan, Timothy A.

    2013-01-01

    Working memory is an essential component of higher cognitive function, and its impairment is a core symptom of multiple CNS disorders, including schizophrenia. Neuronal mechanisms supporting working memory under normal conditions have been described and include persistent, high-frequency activity of prefrontal cortical neurons. However, little is known about the molecular and cellular basis of working memory dysfunction in the context of neuropsychiatric disorders. To elucidate synaptic and neuronal mechanisms of working memory dysfunction, we have performed a comprehensive analysis of a mouse model of schizophrenia, the forebrain-specific calcineurin knock-out mouse. Biochemical analyses of cortical tissue from these mice revealed a pronounced hyperphosphorylation of synaptic vesicle cycling proteins known to be necessary for high-frequency synaptic transmission. Examination of the synaptic vesicle cycle in calcineurin-deficient neurons demonstrated an impairment of vesicle release enhancement during periods of intense stimulation. Moreover, brain slice and in vivo electrophysiological analyses showed that loss of calcineurin leads to a gene dose-dependent disruption of high-frequency synaptic transmission and network activity in the PFC, correlating with selective working memory impairment. Finally, we showed that levels of dynamin I, a key presynaptic protein and calcineurin substrate, are significantly reduced in prefrontal cortical samples from schizophrenia patients, extending the disease relevance of our findings. Our data provide support for a model in which impaired synaptic vesicle cycling represents a critical node for disease pathologies underlying the cognitive deficits in schizophrenia. PMID:23825400

  17. IWTS metal-water reaction rate evaluation (Fauske and Associates report 99-26)

    SciTech Connect

    DUNCAN, D.R.

    1999-07-29

    The report presents a thermal stability analysis of partially metallic particulate in two IWTS components, the knock out pot and settlers. Particulate in the knock out pot is thermally stable for combinations of average particle size and metal mass fraction which appear realistic. Particulate in the settlers is thermally stable when a realistic account of particle reactions over time, metal fraction, and size distribution is considered.

  18. Single and Compound Knock-outs of MicroRNA (miRNA)-155 and Its Angiogenic Gene Target CCN1 in Mice Alter Vascular and Neovascular Growth in the Retina via Resident Microglia.

    PubMed

    Yan, Lulu; Lee, Sangmi; Lazzaro, Douglas R; Aranda, Jacob; Grant, Maria B; Chaqour, Brahim

    2015-09-18

    The response of the retina to ischemic insult typically leads to aberrant retinal neovascularization, a major cause of blindness. The epigenetic regulation of angiogenic gene expression by miRNAs provides new prospects for their therapeutic utility in retinal neovascularization. Here, we focus on miR-155, a microRNA functionally important in inflammation, which is of paramount importance in the pathogenesis of retinal neovascularization. Whereas constitutive miR-155-deficiency in mice results in mild vascular defects, forced expression of miR-155 causes endothelial hyperplasia and increases microglia count and activation. The mouse model of oxygen-induced retinopathy, which recapitulates ischemia-induced aberrant neovessel growth, is characterized by increased expression of miR-155 and localized areas of microglia activation. Interestingly, miR-155 deficiency in mice reduces microglial activation, curtails abnormal vessel growth, and allows for rapid normalization of the retinal vasculature following ischemic insult. miR-155 binds to the 3'-UTR and represses the expression of the CCN1 gene, which encodes an extracellular matrix-associated integrin-binding protein that both promotes physiological angiogenesis and harnesses growth factor-induced abnormal angiogenic responses. Single CCN1 deficiency or double CCN1 and miR-155 knock-out in mice causes retinal vascular malformations typical of faulty maturation, mimicking the vascular alterations of miR-155 gain of function. During development, the miR-155/CCN1 regulatory axis balances the proangiogenic and proinflammatory activities of microglia to allow for their function as guideposts for sprout fusion and anastomosis. Under ischemic conditions, dysregulated miR-155 and CCN1 expression increases the inflammatory load and microglial activation, prompting aberrant angiogenic responses. Thus, miR-155 functions in tandem with CCN1 to modulate inflammation-induced vascular homeostasis and repair.

  19. Effects of ascorbic acid on carcinogenicity and acute toxicity of nickel subsulfide, and on tumor transplants growth in gulonolactone oxidase knock-out mice and wild-type C57BL mice.

    PubMed

    Kasprzak, Kazimierz S; Diwan, Bhalchandra A; Kaczmarek, Monika Z; Logsdon, Daniel L; Fivash, Mathew J; Salnikow, Konstantin

    2011-11-15

    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono--lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni₃S₂), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni₃S₂ carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni₃S₂. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni₃S₂ in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni₃S₂ carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni₃S₂ and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies.

  20. Intradermal Immunization of Leishmania donovani Centrin Knock-Out Parasites in Combination with Salivary Protein LJM19 from Sand Fly Vector Induces a Durable Protective Immune Response in Hamsters

    PubMed Central

    Fiuza, Jacqueline Araújo; Dey, Ranadhir; Davenport, Dwann; Abdeladhim, Maha; Meneses, Claudio; Oliveira, Fabiano; Kamhawi, Shaden; Valenzuela, Jesus G.; Gannavaram, Sreenivas; Nakhasi, Hira L.

    2016-01-01

    Background Visceral leishmaniasis (VL) is a neglected tropical disease and is fatal if untreated. There is no vaccine available against leishmaniasis. The majority of patients with cutaneous leishmaniasis (CL) or VL develop a long-term protective immunity after cure from infection, which indicates that development of an effective vaccine against leishmaniasis is possible. Such protection may also be achieved by immunization with live attenuated parasites that do not cause disease. We have previously reported a protective response in mice, hamsters and dogs with Leishmania donovani centrin gene knock-out parasites (LdCen-/-), a live attenuated parasite with a cell division specific centrin1 gene deletion. In this study we have explored the effects of salivary protein LJM19 as an adjuvant and intradermal (ID) route of immunization on the efficacy of LdCen-/- parasites as a vaccine against virulent L. donovani. Methodology/Principal Findings To explore the potential of a combination of LdCen-/- parasites and salivary protein LJM19 as vaccine antigens, LdCen-/- ID immunization followed by ID challenge with virulent L. donovani were performed in hamsters in a 9-month follow up study. We determined parasite burden (serial dilution), antibody production (ELISA) and cytokine expression (qPCR) in these animals. Compared to controls, animals immunized with LdCen-/- + LJM19 induced a strong antibody response, a reduction in spleen and liver parasite burden and a higher expression of pro-inflammatory cytokines after immunization and one month post-challenge. Additionally, a low parasite load in lymph nodes, spleen and liver, and a non-inflamed spleen was observed in immunized animals 9 months after the challenge infection. Conclusions Our results demonstrate that an ID vaccination using LdCen-/-parasites in combination with sand fly salivary protein LJM19 has the capability to confer long lasting protection against visceral leishmaniasis that is comparable to intravenous or

  1. Molecular Cloning, Genomic Organization, Developmental Regulation, and a Knock-out Mutant of a Novel Leu-rich Repeats-containing G Protein-coupled Receptor (DLGR-2) from Drosophila melanogaster

    PubMed Central

    Eriksen, Kathrine Krageskov; Hauser, Frank; Schiøtt, Morten; Pedersen, Karen-Marie; Søndergaard, Leif; Grimmelikhuijzen, Cornelis J.P.

    2000-01-01

    After screening the Berkeley Drosophila Genome Project database with sequences from a recently characterized Leu-rich repeats-containing G protein-coupled receptor (LGR) from Drosophila (DLGR-1), we identified a second gene for a different LGR (DLGR-2) and cloned its cDNA. DLGR-2 is 1360 amino acid residues long and shows a striking structural homology with members of the glycoprotein hormone [thyroid-stimulating hormone (TSH); follicle-stimulating hormone (FSH); luteinizing hormone/choriogonadotropin (LH/CG)] receptor family from mammals and with two additional, recently identified mammalian orphan LGRs (LGR-4 and LGR-5). This homology includes the seven transmembrane region (e.g., 49% amino acid identity with the human TSH receptor) and the very large extracellular amino terminus. This amino terminus contains 18 Leu-rich repeats—in contrast with the 3 mammalian glycoprotein hormone receptors and DLGR-1 that contain 9 Leu-rich repeats, but resembling the mammalian LGR-4 and LGR-5 that each have 17 Leu-rich repeats in their amino termini. The DLGR-2 gene is >18.6 kb pairs long and contains 15 exons and 14 introns. Four intron positions coincide with the intron positions of the three mammalian glycoprotein hormone receptors and have the same intron phasing, showing that DLGR-2 is evolutionarily related to these mammalian receptors. The DLGR-2 gene is located at position 34E-F on the left arm of the second chromosome and is expressed in embryos and pupae but not in larvae and adult flies. Homozygous knock-out mutants, where the DLGR-2 gene is interrupted by a P element insertion, die around the time of hatching. This finding, together with the expression data, strongly suggests that DLGR-2 is exclusively involved in development. [The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL database with accession no. AF142343.] PMID:10899142

  2. Effects of ascorbic acid on carcinogenicity and acute toxicity of nickel subsulfide, and on tumor transplants growth in gulonolactone oxidase knock-out mice and wild-type C57BL mice

    SciTech Connect

    Kasprzak, Kazimierz S.; Diwan, Bhalchandra A.; Kaczmarek, Monika Z.; Logsdon, Daniel L.; Fivash, Mathew J.; Salnikow, Konstantin

    2011-11-15

    The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono- < gamma > -lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni{sub 3}S{sub 2}), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strains of mice differed significantly with regard to (1) Ni{sub 3}S{sub 2} carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni{sub 3}S{sub 2}. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni{sub 3}S{sub 2} in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni{sub 3}S{sub 2} carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni{sub 3}S{sub 2} and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies. -- Highlights: Black-Right-Pointing-Pointer Ascorbate depletion enhances carcinogenicity and acute toxicity of nickel. Black-Right-Pointing-Pointer Gulo-/- mice unable to synthesize ascorbate were used in this study. Black

  3. Meperidine, remifentanil and tramadol but not sufentanil interact with alpha(2)-adrenoceptors in alpha(2A)-, alpha(2B)- and alpha(2C)-adrenoceptor knock out mice brain.

    PubMed

    Höcker, Jan; Weber, Bernd; Tonner, Peter H; Scholz, Jens; Brand, Philipp-Alexander; Ohnesorge, Henning; Bein, Berthold

    2008-03-17

    alpha(2)-adrenoceptor agonists like clonidine or dexmedetomidine increase the sedative and analgesic actions of opioids. Furthermore opioids like meperidine show potent anti-shivering effects like alpha(2)-adrenoceptor agonists. The underlying molecular mechanisms of these effects are still poorly defined. The authors therefore studied the ability of four different opioids (meperidine, remifentanil, sufentanil and tramadol) to interact with different alpha(2)-adrenoceptor subtypes in mice lacking individual alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptors (alpha(2)-adrenoceptor knock out (alpha(2)-AR KO) mice)). The interaction of opioids with alpha(2)-adrenoceptors was investigated by quantitative receptor autoradiography in brain slices of alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptor deficient mice. Displacement of the radiolabelled alpha(2)-adrenoceptor agonist [(125)I]-paraiodoclonidine ([(125)I]-PIC) from alpha(2)-adrenoceptors in different brain regions by increasing opioid concentrations was measured, and binding affinity of the analysed opioids to alpha(2)-adrenoceptor subtypes in different brain regions was quantified. Meperidine, remifentanil and tramadol but not sufentanil provoked dose dependent displacement of specifically bound [(125)I]-PIC from all alpha(2)-adrenoceptor subtypes in cortex, cerebellum, medulla oblongata, thalamus, hippocampus and pons. Required concentrations of meperidine and remifentanil for [(125)I]-PIC displacement from alpha(2B)- and alpha(2C)-adrenoceptors were lower than from alpha(2A)-adrenoceptors, indicating higher binding affinity for alpha(2B)- and alpha(2C)-adrenoceptors. In contrast, [(125)I]-PIC displacement by tramadol indicated higher binding affinity to alpha(2A)-adrenoceptors than to alpha(2B)- and alpha(2C)-adrenoceptors. Our results indicate that meperidine, remifentanil and tramadol interact with alpha(2)-adrenoceptors in mouse brain showing different affinity for alpha(2A)-, alpha(2B)- and alpha(2C

  4. Comparative Analysis of the Effects of Hydroxysafflor Yellow A and Anhydrosafflor Yellow B in Safflower Series of Herb Pairs Using Prep-HPLC and a Selective Knock-Out Approach.

    PubMed

    Qu, Cheng; Wang, Lin-Yan; Jin, Wen-Tao; Tang, Yu-Ping; Jin, Yi; Shi, Xu-Qin; Shang, Li-Li; Shang, Er-Xin; Duan, Jin-Ao

    2016-11-06

    The flower of Carthamus tinctorius L. (Carthami Flos, safflower), important in traditional Chinese medicine (TCM), is known for treating blood stasis, coronary heart disease, hypertension, and cerebrovascular disease in clinical and experimental studies. It is widely accepted that hydroxysafflor yellow A (HSYA) and anhydrosafflor yellow B (ASYB) are the major bioactive components of many formulae comprised of safflower. In this study, selective knock-out of target components such as HSYA and ASYB by using preparative high performance liquid chromatography (prep-HPLC) followed by antiplatelet and anticoagulation activities evaluation was used to investigate the roles of bioactive ingredients in safflower series of herb pairs. The results showed that both HSYA and ASYB not only played a direct role in activating blood circulation, but also indirectly made a contribution to the total bioactivity of safflower series of herb pairs. The degree of contribution of HSYA in the safflower and its series herb pairs was as follows: Carthami Flos-Ginseng Radix et Rhizoma Rubra (CF-GR) > Carthami Flos-Sappan Lignum (CF-SL) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Astragali Radix (CF-AR) > Carthami Flos-Angelicae Sinensis Radix (CF-AS) > Carthami Flos-Glycyrrhizae Radix et Rhizoma (CF-GL) > Carthami Flos-Salviae Miltiorrhizae Radix et Rhizoma (CF-SM) > Carthami Flos (CF), and the contribution degree of ASYB in the safflower and its series herb pairs: CF-GL > CF-PS > CF-AS > CF-SL > CF-SM > CF-AR > CF-GR > CF. So, this study provided a significant and effective approach to elucidate the contribution of different herbal components to the bioactivity of the herb pair, and clarification of the variation of herb-pair compatibilities. In addition, this study provides guidance for investigating the relationship between herbal compounds and the bioactivities of herb pairs. It also provides a scientific basis for reasonable clinical applications and new drug

  5. Knock-Out Models Reveal New Aquaporin Functions

    PubMed Central

    Verkman, Alan S.

    2013-01-01

    Knockout mice have been informative in the discovery of unexpected biological functions of aquaporins. Knockout mice have confirmed the predicted roles of aquaporins in transepithelial fluid transport, as in the urinary concentrating mechanism and glandular fluid secretion. A less obvious, though predictable role of aquaporins is in tissue swelling under stress, as in the brain in stroke, tumor and infection. Phenotype analysis of aquaporin knockout mice has revealed several unexpected cellular roles of aquaporins whose mechanisms are being elucidated. Aquaporins facilitate cell migration, as seen in aquaporin-dependent tumor angiogenesis and tumor metastasis, by a mechanism that may involve facilitated water transport in lamellipodia of migrating cells. The ‘aquaglyceroporins’, aquaporins that transport both glycerol and water, regulate glycerol content in epidermis, fat and other tissues, and lead to a multiplicity of interesting consequences of gene disruption including dry skin, resistance to skin carcinogenesis, impaired cell proliferation and altered fat metabolism. An even more surprising role of a mammalian aquaporin is in neural signal transduction in the central nervous system. The many roles of aquaporins might be exploited for clinical benefit by modulation of aquaporin expression/function – as diuretics, and in the treatment of brain swelling, glaucoma, epilepsy, obesity and cancer. PMID:19096787

  6. Moon formation: Punch combo or knock-out blow?

    NASA Astrophysics Data System (ADS)

    Collins, Gareth S.

    2017-01-01

    The twin isotopic signatures of the Moon and Earth are difficult to explain by a single giant impact. Impact simulations suggest that making the Moon by a combination of multiple, smaller moonlet-forming impacts may work better.

  7. Mice expressing the human CYP7A1 gene in the mouse CYP7A1 knock-out background lack induction of CYP7A1 expression by cholesterol feeding and have increased hypercholesterolemia when fed a high fat diet.

    PubMed

    Chen, Jean Y; Levy-Wilson, Beatriz; Goodart, Sheryl; Cooper, Allen D

    2002-11-08

    Cholesterol 7alpha-hydroxylase (CYP7A1) catalyzes the rate-limiting step in the pathway responsible for the formation of the majority of bile acids. Transcription of the gene is regulated by the size of the bile acid pool and dietary and hormonal factors. The farnesoid X receptor and the liver X receptor (LXR) are responsible for regulation by bile acids and cholesterol, respectively. To study the effects of dietary cholesterol and fat upon expression of the human CYP7A1 gene, mice were generated by crossing transgenic mice carrying the human CYP7A1 gene with mice that were homozygous knock-outs (CYP7A1(-/-)). The mice (mCYP7A1(-/-)/hCYP7A1) expressed the human gene at much higher levels than did the transgenics bred in the wild-type background. A diet containing 1% cholic acid reduced the expression of the human gene in mCYP7A1(-/-)/hCYP7A1 mice to undetectable levels. Cholestyramine (5%) increased the level of expression of the human gene and the mouse gene. Thus, farnesoid X receptor-mediated regulation was preserved. A diet containing 2% cholesterol increased expression of the mouse gene in wild-type mice, but it did not affect expression of the human gene in mCYP7A1(-/-)/hCYP7A1 mice. None of the diets altered the serum cholesterol or triglyceride levels in these mice; 1% cholic acid caused a redistribution of cholesterol from the high density lipoprotein to the low density lipoprotein density in the humanized mice but not in wild-type mice. A diet containing 30% saturated fat and 2% cholesterol caused a decrease in CYP7A1 levels in mCYP7A1(-/-)/hCYP7A1 mice. The serum cholesterol levels rose in all mice fed this diet. The increase was greater in the mCYP7A1(-/-)/hCYP7A1 mice. Together, these data suggest that the lack of an LXR element in the region from -56 to -49 of the human CYP7A1 promoter may account for some of the differences in response to diets between humans and rodents.

  8. Isotopic effects in the ( π±, 2N) reactions on 16O and 18O

    NASA Astrophysics Data System (ADS)

    Altman, A.; Ashery, D.; Piasetzky, E.; Lichtenstadt, J.; Yavin, A. I.; Bertl, W.; Felawka, L.; Walter, H. K.; Powers, R. J.; Winter, R. G.; v. d. Pluym, J.

    1984-09-01

    The ( π+, 2p), ( π+, pn) and ( π-, pn) reactions on 16O and 18O were studied at 165 MeV. The cross section for the ( π+, 2p) reaction on 18O is larger than that for 16O be only 5% ± 3%, while the total π+ absorption cross section is larger by 17% ± 5%. This supports the assumption that two-nucleon absorption occurs mainly on nucleons in the same shell. It is further concluded that Δ++n → pp is not only absorption mechanism that couples strongly to the nucleon knock out reactions.

  9. Subregion-Specific p300 Conditional Knock-Out Mice Exhibit Long-Term Memory Impairments

    ERIC Educational Resources Information Center

    Oliveira, Ana M. M.; Estevez, Marcel A.; Hawk, Joshua D.; Grimes, Shannon; Brindle, Paul K.; Abel, Ted

    2011-01-01

    Histone acetylation plays a critical role during long-term memory formation. Several studies have demonstrated that the histone acetyltransferase (HAT) CBP is required during long-term memory formation, but the involvement of other HAT proteins has not been extensively investigated. The HATs CBP and p300 have at least 400 described interacting…

  10. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer

    PubMed Central

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-01-01

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth. PMID:27654750

  11. Age-Dependent Deficits in Fear Learning in Heterozygous BDNF Knock-Out Mice

    ERIC Educational Resources Information Center

    Endres, Thomas; Lessmann, Volkmar

    2012-01-01

    Beyond its trophic function, the neurotrophin BDNF (brain-derived neurotrophic factor) is well known to crucially mediate synaptic plasticity and memory formation. Whereas recent studies suggested that acute BDNF/TrkB signaling regulates amygdala-dependent fear learning, no impairments of cued fear learning were reported in heterozygous BDNF…

  12. Taurine depletion caused by knocking out the taurine transporter gene leads to cardiomyopathy with cardiac atrophy.

    PubMed

    Ito, Takashi; Kimura, Yasushi; Uozumi, Yoriko; Takai, Mika; Muraoka, Satoko; Matsuda, Takahisa; Ueki, Kei; Yoshiyama, Minoru; Ikawa, Masahito; Okabe, Masaru; Schaffer, Stephen W; Fujio, Yasushi; Azuma, Junichi

    2008-05-01

    The sulfur-containing beta-amino acid, taurine, is the most abundant free amino acid in cardiac and skeletal muscle. Although its physiological function has not been established, it is thought to play an important role in ion movement, calcium handling, osmoregulation and cytoprotection. To begin examining the physiological function of taurine, we generated taurine transporter- (TauT-) knockout mice (TauTKO), which exhibited a deficiency in myocardial and skeletal muscle taurine content compared with their wild-type littermates. The TauTKO heart underwent ventricular remodeling, characterized by reductions in ventricular wall thickness and cardiac atrophy accompanied with the smaller cardiomyocytes. Associated with the structural changes in the heart was a reduction in cardiac output and increased expression of heart cardiac failure (fetal) marker genes, such as ANP, BNP and beta-MHC. Moreover, ultrastructural damage to the myofilaments and mitochondria was observed. Further, the skeletal muscle of the TauTKO mice also exhibited decreased cell volume, structural defects and a reduction of exercise endurance capacity. Importantly, the expression of Hsp70, ATA2 and S100A4, which are upregulated by osmotic stress, was elevated in both heart and skeletal muscle of the TauTKO mice. Taurine depletion causes cardiomyocyte atrophy, mitochondrial and myofiber damage and cardiac dysfunction, effects likely related to the actions of taurine. Our data suggest that multiple actions of taurine, including osmoregulation, regulation of mitochondrial protein expression and inhibition of apoptosis, collectively ensure proper maintenance of cardiac and skeletal muscular structure and function.

  13. Smad3 knock-out mice as a useful model to study intestinal fibrogenesis

    PubMed Central

    Zanninelli, Giuliana; Vetuschi, Antonella; Sferra, Roberta; D’Angelo, Angela; Fratticci, Amato; Continenza, Maria Adelaide; Chiaramonte, Maria; Gaudio, Eugenio; Caprilli, Renzo; Latella, Giovanni

    2006-01-01

    AIM: To evaluate the possible differences in morphology and immunohistochemical expression of CD3, transforming growth factor β1(TGF-β1), Smad7, α-smooth muscle actin (α-Sma), and collagen types I-VII of small and large intestine in Smad3 null and wild-type mice. METHODS: Ten null and ten wild-type adult mice were sacrificed at 4 mo of age and the organs (esophagus, small and large bowel, ureters) were collected for histology(hematoxylin and eosin, Masson thrichrome, silver staining), morphometry and immunohistochemistry analysis. TGF-β1 levels of intestinal tissue homogenates were assessed by ELISA. RESULTS: No macroscopic intestinal lesions were detected both in null and wild-type mice. Histological and morphometric evaluation revealed a significant reduction in muscle layer thickness of small and large intestine in null mice as compared to wild-type mice. Immunohistochemistry evaluation showed a significant increase of CD3+T cell, TGF-β1 and Smad7 staining in the small and large intestine mucosa of Smad3 null mice as compared to wild-type mice. α-Sma and collagen I-VII staining of small and large intestine did not differ between the two groups of mice. TGF-β1 levels of colonic tissue homogenates were significantly higher in null mice than in wild-type mice. In preliminary experiments a significant reduction of TNBS-induced intestinal fibrosis was observed in null mice as compared to wild-type mice. CONCLUSION: Smad3 null mice are a useful model to investigate the in vivo role of the TGF-β/Smad signalling pathway in intestinal inflammation and fibrosis. PMID:16534873

  14. Knock-out mouse models of proprotein convertases: unique functions or redundancy?

    PubMed

    Creemers, John W M; Khatib, Abdel-Majid

    2008-05-01

    The members of the proprotein convertase family play a central role in the processing and/or activation of various protein precursors involved in many physiological processes and various pathologies. The proteolysis of these precursors that occur at basic residues within the general motif (K/R)-(X)-(K/R) is mediated by the proprotein convertases PC1/3, PC2, Furin, PACE4, PC4, PC5 and PC7, whereas the proteolysis of precursors within hydrophobic residues performed by the convertase S1P/SKI-1 and the convertase NARC-1/PCSK9 seems to prefer cleavages at the motif LVFAQSIP. Here we provide a comprehensive overview of their remarkable complex roles as revealed by disruption of their genes individually using generalized or conditional approaches.

  15. Knock out of the NADPH oxidase Nox4 has no impact on life span in mice.

    PubMed

    Rezende, Flavia; Schürmann, Christoph; Schütz, Susanne; Harenkamp, Sabine; Herrmann, Eva; Seimetz, Michael; Weißmann, Norbert; Schröder, Katrin

    2017-04-01

    The free radical theory of aging suggests reactive oxygen species as a main reason for accumulation of damage events eventually leading to aging. Nox4, a member of the family of NADPH oxidases constitutively produces ROS and therefore has the potential to be a main driver of aging. Herein we analyzed the life span of Nox4 deficient mice and found no difference when compared to their wildtype littermates. Accordingly neither Tert expression nor telomere length was different in cells isolated from those animals. In fact, Nox4 mRNA expression in lungs of wildtype mice dropped with age. We conclude that Nox4 has no influence on lifespan of healthy mice.

  16. Knock-out and Transgenic Strategies to Improve Neural Transplantation Therapy for Parkinson’s Disease

    DTIC Science & Technology

    2000-07-01

    Parkinson’s disease (PD) are 1) poor survival of grafted fetal neurons and 2) insufficient axonal outgrowth and functional recovery. We carried out experiments aimed at by short-term inhibition by pre-treatment of fetal cells with pharmacological inhibitors of caspases. In our second objective of enhancing axonal growth leading to optimal functional recovery by neuronal transplants, we employed transgenic bcl-2 overexpressing donor cells and similar molecules influencing the growth of axons in the fetal and adult CNS. Use of such molecules could significantly improve

  17. Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice

    PubMed Central

    Zhang, Qiangge; Gao, Xian; Li, Chenchen; Feliciano, Catia; Wang, Dongqing; Zhou, Dingxi; Mei, Yuan; Monteiro, Patricia; Anand, Michelle; Itohara, Shigeyoshi; Dong, Xiaowei; Fu, Zhanyan

    2016-01-01

    Intellectual disability is a common neurodevelopmental disorder characterized by impaired intellectual and adaptive functioning. Both environmental insults and genetic defects contribute to the etiology of intellectual disability. Copy number variations of SORBS2 have been linked to intellectual disability. However, the neurobiological function of SORBS2 in the brain is unknown. The SORBS2 gene encodes ArgBP2 (Arg/c-Abl kinase binding protein 2) protein in non-neuronal tissues and is alternatively spliced in the brain to encode nArgBP2 protein. We found nArgBP2 colocalized with F-actin at dendritic spines and growth cones in cultured hippocampal neurons. In the mouse brain, nArgBP2 was highly expressed in the cortex, amygdala, and hippocampus, and enriched in the outer one-third of the molecular layer in dentate gyrus. Genetic deletion of Sorbs2 in mice led to reduced dendritic complexity and decreased frequency of AMPAR-miniature spontaneous EPSCs in dentate gyrus granule cells. Behavioral characterization revealed that Sorbs2 deletion led to a reduced acoustic startle response, and defective long-term object recognition memory and contextual fear memory. Together, our findings demonstrate, for the first time, an important role for nArgBP2 in neuronal dendritic development and excitatory synaptic transmission, which may thus inform exploration of neurobiological basis of SORBS2 deficiency in intellectual disability. SIGNIFICANCE STATEMENT Copy number variations of the SORBS2 gene are linked to intellectual disability, but the neurobiological mechanisms are unknown. We found that nArgBP2, the only neuronal isoform encoded by SORBS2, colocalizes with F-actin at neuronal dendritic growth cones and spines. nArgBP2 is highly expressed in the cortex, amygdala, and dentate gyrus in the mouse brain. Genetic deletion of Sorbs2 in mice leads to impaired dendritic complexity and reduced excitatory synaptic transmission in dentate gyrus granule cells, accompanied by behavioral deficits in acoustic startle response and long-term memory. This is the first study of Sorbs2 function in the brain, and our findings may facilitate the study of neurobiological mechanisms underlying SORBS2 deficiency in the development of intellectual disability. PMID:26888934

  18. Accelerated Human Mutant Tau Aggregation by Knocking Out Murine Tau in a Transgenic Mouse Model

    PubMed Central

    Ando, Kunie; Leroy, Karelle; Héraud, Céline; Yilmaz, Zehra; Authelet, Michèle; Suain, Valèrie; De Decker, Robert; Brion, Jean-Pierre

    2011-01-01

    Many models of human tauopathies have been generated in mice by expression of a human mutant tau with maintained expression of mouse endogenous tau. Because murine tau might interfere with the toxic effects of human mutant tau, we generated a model in which a pathogenic human tau protein is expressed in the absence of wild-type tau protein, with the aim of facilitating the study of the pathogenic role of the mutant tau and to reproduce more faithfully a human tauopathy. The Tg30 line is a tau transgenic mouse model overexpressing human 1N4R double-mutant tau (P301S and G272V) that develops Alzheimer's disease-like neurofibrillary tangles in an age-dependent manner. By crossing Tg30 mice with mice invalidated for their endogenous tau gene, we obtained Tg30xtau−/− mice that express only exogenous human double-mutant 1N4R tau. Although Tg30xtau−/− mice express less tau protein compared with Tg30, they exhibit signs of decreased survival, increased proportion of sarkosyl-insoluble tau in the brain and in the spinal cord, increased number of Gallyas-positive neurofibrillary tangles in the hippocampus, increased number of inclusions in the spinal cord, and a more severe motor phenotype. Deletion of murine tau accelerated tau aggregation during aging of this mutant tau transgenic model, suggesting that murine tau could interfere with the development of tau pathology in transgenic models of human tauopathies. PMID:21281813

  19. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer.

    PubMed

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-09-22

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth.

  20. Knock-out of Arabidopsis AtNHX4 gene enhances tolerance to salt stress

    SciTech Connect

    Li, Hong-Tao; Liu, Hua; Gao, Xiao-Shu; Zhang, Hongxia

    2009-05-08

    AtNHX4 belongs to the monovalent cation:proton antiporter-1 (CPA1) family in Arabidopsis. Several members of this family have been shown to be critical for plant responses to abiotic stress, but little is known on the biological functions of AtNHX4. Here, we provide the evidence that AtNHX4 plays important roles in Arabidopsis responses to salt stress. Expression of AtNHX4 was responsive to salt stress and abscisic acid. Experiments with CFP-AtNHX4 fusion protein indicated that AtNHX4 is vacuolar localized. The nhx4 mutant showed enhanced tolerance to salt stress, and lower Na{sup +} content under high NaCl stress compared with wild-type plants. Furthermore, heterologous expression of AtNHX4 in Escherichia coli BL21 rendered the transformants hypersensitive to NaCl. Deletion of the hydrophilic C-terminus of AtNHX4 dramatically increased the hypersensitivity of transformants, indicating that AtNHX4 may function in Na{sup +} homeostasis in plant cell, and its C-terminus plays a role in regulating the AtNHX4 activity.

  1. How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    NASA Technical Reports Server (NTRS)

    Ladbury, Ray

    2014-01-01

    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  2. Autistic-Like Traits and Cerebellar Dysfunction in Purkinje Cell PTEN Knock-Out Mice.

    PubMed

    Cupolillo, Dario; Hoxha, Eriola; Faralli, Alessio; De Luca, Annarita; Rossi, Ferdinando; Tempia, Filippo; Carulli, Daniela

    2016-05-01

    Autism spectrum disorders (ASDs) are neurodevelopmental disorders characterized by impaired social interaction, isolated areas of interest, and insistence on sameness. Mutations in Phosphatase and tensin homolog missing on chromosome 10 (PTEN) have been reported in individuals with ASDs. Recent evidence highlights a crucial role of the cerebellum in the etiopathogenesis of ASDs. In the present study we analyzed the specific contribution of cerebellar Purkinje cell (PC) PTEN loss to these disorders. Using the Cre-loxP recombination system, we generated conditional knockout mice in which PTEN inactivation was induced specifically in PCs. We investigated PC morphology and physiology as well as sociability, repetitive behavior, motor learning, and cognitive inflexibility of adult PC PTEN-mutant mice. Loss of PTEN in PCs results in autistic-like traits, including impaired sociability, repetitive behavior and deficits in motor learning. Mutant PCs appear hypertrophic and show structural abnormalities in dendrites and axons, decreased excitability, disrupted parallel fiber and climbing fiber synapses and late-onset cell death. Our results unveil new roles of PTEN in PC function and provide the first evidence of a link between the loss of PTEN in PCs and the genesis of ASD-like traits.

  3. [Progress in preparation of small monoclonal antibodies of knock out technique].

    PubMed

    Liu, Jing; Mao, Xin-min; Li, Lin-lin; Li, Xin-xia; Wang, Ye; Lan, Yi

    2015-10-01

    With the application of monoclonal antibody technology more and more widely, its production technology is becoming more and more perfect. Small molecule monoclonal antibody technology is becoming a hot research topic for people. The application of traditional Chinese medicine small molecule monoclonal antibody technology has been more and more widely, the technology for effective Chinese medicine component knockout provide strong technical support. The preparation of monoclonal antibodies and small molecule knockout technology are reviewed in this paper. The preparation of several steps, such as: in the process of preparation of antigen, hapten carrier coupling, coupling ratio determination and identification of artificial antigen and establishment of animal immunization and hybridoma cell lines of monoclonal antibody, the large-scale preparation; small molecule monoclonal antibody on Immune in affinity chromatography column method is discussed in detail. The author believes that this technology will make the traditional Chinese medicine research on a higher level, and improve the level of internationalization of Chinese medicine research.

  4. Aryl hydrocarbon receptor knock-out exacerbates choroidal neovascularization via multiple pathogenic pathways

    PubMed Central

    Choudhary, Mayur; Kazmin, Dmitri; Hu, Peng; Thomas, Russell S; McDonnell, Donald P; Malek, Goldis

    2015-01-01

    The aryl hydrocarbon receptor (AhR) is a heterodimeric transcriptional regulator with pleiotropic functions in xenobiotic metabolism and detoxification, vascular development and cancer. Herein, we report a previously undescribed role for the AhR signalling pathway in the pathogenesis of the wet, neovascular subtype of age-related macular degeneration (AMD), the leading cause of vision loss in the elderly in the Western world. Comparative analysis of gene expression profiles of aged AhR−/− and wild-type (wt) mice, using high-throughput RNA sequencing, revealed differential modulation of genes belonging to several AMD-related pathogenic pathways, including inflammation, angiogenesis and extracellular matrix regulation. To investigate AhR regulation of these pathways in wet AMD, we experimentally induced choroidal neovascular lesions in AhR−/− mice and found that they measured significantly larger in area and volume compared to age-matched wt mice. Furthermore, these lesions displayed a higher number of ionized calcium-binding adaptor molecule 1-positive (Iba1+) microglial cells and a greater amount of collagen type IV deposition, events also seen in human wet AMD pathology specimens. Consistent with our in vivo observations, AhR knock-down was sufficient to increase choroidal endothelial cell migration and tube formation in vitro. Moreover, AhR knock-down caused an increase in collagen type IV production and secretion in both retinal pigment epithelial (RPE) and choroidal endothelial cell cultures, increased expression of angiogenic and inflammatory molecules, including vascular endothelial growth factor A (VEGFA) and chemokine (C–C motif) ligand 2 (CCL2) in RPE cells, and increased expression of secreted phosphoprotein 1 (SPP1) and transforming growth factor-β1 (TGFβ1) in choroidal endothelial cells. Collectively, our findings identify AhR as a regulator of multiple pathogenic pathways in experimentally induced choroidal neovascularization, findings that are consistent with a possible role of AhR in wet AMD. The data discussed in this paper have been deposited in NCBI's Gene Expression Omnibus; GEO Submission No. GSE56983, NCBI Tracking System No. 17021116. PMID:25186463

  5. Investigation of olfactory function in a Panx1 knock out mouse model

    PubMed Central

    Kurtenbach, Stefan; Whyte-Fagundes, Paige; Gelis, Lian; Kurtenbach, Sarah; Brazil, Émerson; Zoidl, Christiane; Hatt, Hanns; Shestopalov, Valery I.; Zoidl, Georg

    2014-01-01

    Pannexin 1 (Panx1), the most extensively investigated member of a channel-forming protein family, is able to form pores conducting molecules up to 1.5 kDa, like ATP, upon activation. In the olfactory epithelium (OE), ATP modulates olfactory responsiveness and plays a role in proliferation and differentiation of olfactory sensory neurons (OSNs). This process continuously takes place in the OE, as neurons are replaced throughout the whole lifespan. The recent discovery of Panx1 expression in the OE raises the question whether Panx1 mediates ATP release responsible for modulating chemosensory function. In this study, we analyzed pannexin expression in the OE and a possible role of Panx1 in olfactory function using a Panx1−/− mouse line with a global ablation of Panx1. This mouse model has been previously used to investigate Panx1 functions in the retina and adult hippocampus. Here, qPCR, in-situ hybridization, and immunohistochemistry (IHC) demonstrated that Panx1 is expressed in axon bundles deriving from sensory neurons of the OE. The localization, distribution, and expression of major olfactory signal transduction proteins were not significantly altered in Panx1−/− mice. Further, functional analysis of Panx1−/− animals does not reveal any major impairment in odor perception, indicated by electroolfactogram (EOG) measurements and behavioral testing. However, ATP release evoked by potassium gluconate application was reduced in Panx1−/− mice. This result is consistent with previous reports on ATP release in isolated erythrocytes and spinal or lumbar cord preparations from Panx1−/− mice, suggesting that Panx1 is one of several alternative pathways to release ATP in the olfactory system. PMID:25309319

  6. Generation and Behavioral Characterization of β-catenin Forebrain-Specific Conditional Knock-Out Mice

    PubMed Central

    Gould, Todd D.; O'Donnell, Kelley C.; Picchini, Alyssa M.; Dow, Eliot R.; Chen, Guang; Manji, Husseini K.

    2009-01-01

    The canonical Wnt pathway and β-catenin have been implicated in the pathophysiology of mood disorders. We generated forebrain-specific CRE-mediated conditional β-catenin knockout mice to begin exploring the behavioral implications of decreased Wnt pathway signaling in the central nervous system. In situ hybridization revealed a progressive knockout of β-catenin that began between 2 and 4 weeks of age, and by 12 weeks resulted in considerably decreased β-catenin expression in regions of the forebrain, including the frontal cortex, hippocampus, and striatum. A significant decrease in protein levels of β-catenin in these brain regions was observed by western blot. Behavioral characterization of these mice in several tests (including the forced swim test, tail suspension test (TST), learned helplessness, response and sensitization to stimulants, and light/dark box among other tests) revealed relatively circumscribed alterations. In the TST, knockout mice spent significantly less time struggling (a depression-like phenotype). However, knockout mice did not differ from their wild-type littermates in the other behavioral tests of mood-related or anxiety-related behaviors. These results suggest that a considerable β-catenin reserve exists, and that a 50-70% β-catenin reduction in circumscribed brain regions is only capable of inducing subtle behavioral changes. Alternatively, regulating β-catenin may modulate drug effects rather than being a model of mood disorder pathophysiology per se. PMID:18299155

  7. C6 knock-out Mice Are Protected from Thrombophilia Mediated by Antiphospholipid Antibodies

    PubMed Central

    Laura, Carrera-Marín Ana; Zurina, Romay-Penabad; Elizabeth, Papalardo; Elba, Reyes-Maldonado; Ethel, Garcia-Latorre; Gracie, Vargas; Tuya, Shilagard; Silvia, Pierangeli

    2013-01-01

    Background Complement activation plays a role in pathogenesis of the Antiphospholipid Syndrome (APS), but the involvement of the C5b-9 membrane attack complex (MAC) is unknown. Here we studied the effects of human polyclonal antiphospholipid (aPL) antibodies on thrombosis and tissue factor (TF) up-regulation in C6 deficient (C6-/-) mice. Methods C6-/- or the wild-type (C3H/HeJ) C6+/+ mice were injected twice with IgG-APS (n=2) or IgM-APS (n=1) isolated from APS patients or with the corresponding control Igs (IgG-NHS or IgM-NHS). Then, the size of induced thrombi in the femoral vein were determined 72 hours after the first injection. Tissue factor was determined in homogenates of carotid arteries and in peritoneal macrophages. Results Thrombus sizes were significantly larger in C6+/+ treated with IgG-APS1 or with IgG-APS2 or with IgM-APS when compared with C6+/+ mice treated with IgG-NHS or with IgM-NHS, respectively. The sizes of thrombi were significantly smaller in the C6-/- mice injected with IgG-APS1, IgG-APS2 or IgM-APS (p<0.001), compared to their C6+/+ counterparts showing an important abrogation of thrombus formation in mice lacking C6. The TF expression and activity in the C6-/- mice treated with IgG-APS were diminished when compared to C6+/+ treated with the same immunoglobulins. All mice injected with IgG-APS and IgM-APS had medium-high titers of aCL and aβ2GPI antibodies. Conclusions These data indicate that the C6 component of the complement system mediates aPL-thrombogenic effects, underscoring an important pathogenic mechanism and indicating the possibility of inhibiting complement to ameliorate APS-related manifestations. PMID:22933620

  8. Direct reaction experimental studies with beams of radioactive tin ions

    SciTech Connect

    Jones, K. L. Ayres, A.; Bey, A.; Burcher, S.; Cartegni, L.; Cerizza, G.; Ahn, S.; Allmond, J. M.; Beene, J. R.; Galindo-Uribarri, A.; Liang, J. F.; Nesaraja, C. D.; Pain, S. D.; Radford, D. C.; Schmitt, K. T.; Smith, M. S.; Stracener, D. W.; Varner, R. L.; Bardayan, D. W.; Baugher, T.; and others

    2015-10-15

    The tin chain of isotopes provides a unique region in which to investigate the evolution of single-particle structure, spreading from N = 50 at {sup 100}Sn, through 10 stable isotopes and the N = 82 shell closure at {sup 132}Sn out into the r-process path. Direct reactions performed on radioactive ion beams are sensitive spectroscopic tools for studying exotic nuclei. Here we present one experiment knocking out neutrons from tin isotopes that are already neutron deficient and two reactions that add a neutron to neutron-rich {sup 130}Sn. Both techniques rely on selective particle identification and the measurement of γ rays in coincidence with charged ions. We present the goals of the two experiments and the particle identification for the channels of interest. The final results will be presented in future publications.

  9. Direct Reaction Experimental Studies with Beams of Radioactive Tin Ions

    SciTech Connect

    Jones, K. L.; Ahn, S.H.; Allmond, James M; Ayres, A.; Bardayan, Daniel W; Baugher, T.; Bazin, D.; Beene, James R; Berryman, J. S.; Bey, A.; Bingham, C. R.; Cartegni, L.; Chae, K. Y.; Gade, A.; Galindo-Uribarri, Alfredo {nmn}; Garcia-Ruiz, R.F.; Grzywacz, Robert Kazimierz; Howard, Meredith E; Kozub, R. L.; Liang, J Felix; Manning, Brett M; Matos, M.; McDaniel, S.; Miller, D.; Nesaraja, Caroline D; O'Malley, Patrick; Padgett, S; Padilla-Rodal, Elizabeth; Pain, Steven D; Pittman, S. T.; Radford, David C; Ratkiewicz, Andrew J; Schmitt, Kyle; Smith, Michael Scott; Stracener, Daniel W; Stroberg, S.; Tostevin, Jeffrey A; Varner Jr, Robert L; Weisshaar, D.; Wimmer, K.

    2015-01-01

    The tin chain of isotopes provides a unique region in which to investigate the evolution of single-particle structure, spreading from N = 50 at Sn-100, through 10 stable isotopes and the N = 82 shell closure at Sn-132 out into the r-process path. Direct reactions performed on radioactive ion beams are sensitive spectroscopic tools for studying exotic nuclei. Here we present one experiment knocking out neutrons from tin isotopes that are already neutron deficient and two reactions that add a neutron to neutron-rich Sn-130. Both techniques rely on selective particle identification and the measurement of gamma rays in coincidence with charged ions. We present the goals of the two experiments and the particle identification for the channels of interest. The final results will be presented in future publications.

  10. Knockout reactions on p-shell nuclei for tests of structure and reaction models

    NASA Astrophysics Data System (ADS)

    Kuchera, A. N.; Bazin, D.; Babo, M.; Baumann, T.; Bowry, M.; Bradt, J.; Brown, J.; Deyoung, P. A.; Elman, B.; Finck, J. E.; Gade, A.; Grinyer, G. F.; Jones, M. D.; Lunderberg, E.; Redpath, T.; Rogers, W. F.; Stiefel, K.; Thoennessen, M.; Weisshaar, D.; Whitmore, K.

    2015-10-01

    A series of knockout reactions on p-shell nuclei were studied to extract exclusive cross sections and to investigate the neutron knockout mechanism. The measured cross sections provide stringent tests of shell model and ab initio calculations while measurements of neutron+residual coincidences test the accuracy and validity of reaction models used to predict cross sections. Six different beams ranging from A = 7 to 12 were produced at the NSCL totaling measurements of nine different reaction settings. The reaction settings were determined by the magnetic field of the Sweeper magnet which bends the residues into charged particle detectors. The reaction target was surrounded by the high efficiency CsI array, CAESAR, to tag gamma rays for cross section measurements of low-lying excited states. Additionally, knocked out neutrons were detected with MoNA-LISA in coincidence with the charged residuals. Preliminary results will be discussed. This work is partially supported by the National Science Foundation under Grant No. PHY11-02511 and the Department of Energy National Nuclear Security Administration under Award No. DE-NA0000979.

  11. NewsMars: Express journey to Mars ASE 2003: Knocked out by meteorites Events: Sun-Earth Day ASE 2003: Fun Physics - popular as ever Appointments: Sykes to bring science to the people UK Science Education: The future's bright, the future's science ASE 2003: A grand finale for Catherine Teaching Resources: UK goes to the planets Cambridge Physics Update: Basement physics Conferences: Earth Science Teachers' Association Conference 2003 New Website: JESEI sets sail GIREP: Teacher education seminar Malaysia: Rewards for curriculum change Cambridge Physics Update: My boomerang will come back! Teaching Resources: Widening particiption through ideas and evidence with the University of Surrey Wales: First Ffiseg Events: Nuna: Solar car on tour Physics on Stage: Physics on Stage 3 embraces life Symposium: In what sense a nuclear 'debate'? Gifted and Talented: Able pupils experiencing challenging science Australia: ISS flies high Down Under

    NASA Astrophysics Data System (ADS)

    2003-03-01

    Mars: Express journey to Mars ASE 2003: Knocked out by meteorites Events: Sun-Earth Day ASE 2003: Fun Physics - popular as ever Appointments: Sykes to bring science to the people UK Science Education: The future's bright, the future's science ASE 2003: A grand finale for Catherine Teaching Resources: UK goes to the planets Cambridge Physics Update: Basement physics Conferences: Earth Science Teachers' Association Conference 2003 New Website: JESEI sets sail GIREP: Teacher education seminar Malaysia: Rewards for curriculum change Cambridge Physics Update: My boomerang will come back! Teaching Resources: Widening particiption through ideas and evidence with the University of Surrey Wales: First Ffiseg Events: Nuna: Solar car on tour Physics on Stage: Physics on Stage 3 embraces life Symposium: In what sense a nuclear 'debate'? Gifted and Talented: Able pupils experiencing challenging science Australia: ISS flies high Down Under

  12. Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects.

    PubMed

    Henriques, Rossana; Jásik, Ján; Klein, Markus; Martinoia, Enrico; Feller, Urs; Schell, Jeff; Pais, Maria S; Koncz, Csaba

    2002-11-01

    IRT1 and IRT2 are members of the Arabidopsis ZIP metal transporter family that are specifically induced by iron deprivation in roots and act as heterologous suppressors of yeast mutations inhibiting iron and zinc uptake. Although IRT1 and IRT2 are thought to perform redundant functions as root-specific metal transporters, insertional inactivation of the IRT1 gene alone results in typical symptoms of iron deficiency causing severe leaf chlorosis and lethality in soil. The irt1 mutation is characterized by specific developmental defects, including a drastic reduction of chloroplast thylakoid stacking into grana and lack of palisade parenchyma differentiation in leaves, reduced number of vascular bundles in stems, and irregular patterns of enlarged endodermal and cortex cells in roots. Pulse labeling with 59Fe through the root system shows that the irt1 mutation reduces iron accumulation in the shoots. Short-term labeling with 65Zn reveals no alteration in spatial distribution of zinc, but indicates a lower level of zinc accumulation. In comparison to wild-type, the irt1 mutant responds to iron and zinc deprivation by altered expression of certain zinc and iron transporter genes, which results in the activation of ZIP1 in shoots, reduction of ZIP2 transcript levels in roots, and enhanced expression of IRT2 in roots. These data support the conclusion that IRT1 is an essential metal transporter required for proper development and regulation of iron and zinc homeostasis in Arabidopsis.

  13. Impaired Angiogenesis during Fracture Healing in GPCR Kinase 2 Interacting Protein-1 (GIT1) Knock Out Mice

    PubMed Central

    Menon, Prashanthi; Pang, Jinjiang; Ho, Hsin-Chiu; Shi, Shanshan; Xie, Chao; Smolock, Elaine; Yan, Chen; Zuscik, Michael J.; Berk, Bradford C.

    2014-01-01

    G protein coupled receptor kinase 2 (GRK2) interacting protein-1 (GIT1), is a scaffold protein that plays an important role in angiogenesis and osteoclast activity. We have previously demonstrated that GIT1 knockout (GIT1 KO) mice have impaired angiogenesis and dysregulated osteoclast podosome formation leading to a reduction in the bone resorbing ability of these cells. Since both angiogenesis and osteoclast-mediated bone remodeling are involved in the fracture healing process, we hypothesized that GIT1 participates in the normal progression of repair following bone injury. In the present study, comparison of fracture healing in wild type (WT) and GIT1 KO mice revealed altered healing in mice with loss of GIT1 function. Alcian blue staining of fracture callus indicated a persistence of cartilagenous matrix in day 21 callus samples from GIT1 KO mice which was temporally correlated with increased type 2 collagen immunostaining. GIT1 KO mice also showed a decrease in chondrocyte proliferation and apoptosis at days 7 and 14, as determined by PCNA and TUNEL staining. Vascular microcomputed tomography analysis of callus samples at days 7, 14 and 21 revealed decreased blood vessel volume, number, and connection density in GIT1 KO mice compared to WT controls. Correlating with this, VEGF-A, phospho-VEGFR2 and PECAM1 (CD31) were decreased in GIT1 KO mice, indicating reduced angiogenesis with loss of GIT1. Finally, calluses from GIT1 KO mice displayed a reduced number of tartrate resistant acid phosphatase-positive osteoclasts at days 14 and 21. Collectively, these results indicate that GIT1 is an important signaling participant in fracture healing, with gene ablation leading to reduced callus vascularity and reduced osteoclast number in the healing callus. PMID:24586541

  14. Pharmacological enhancement of mGlu5 receptors rescues behavioral deficits in SHANK3 knock-out mice

    PubMed Central

    Vicidomini, Cinzia; Ponzoni, Luisa; Lim, Dmitry; Schmeisser, Michael; Reim, Dominik; Morello, Noemi; Orelanna, Daniel; Tozzi, Alessandro; Durante, Valentina; Scalmani, Paolo; Mantegazza, Massimo; Genazzani, Armando A.; Giustetto, Maurizio; Sala, Mariaelvina; Calabresi, Paolo; Boeckers, Tobias M.; Sala, Carlo; Verpelli, Chiara

    2016-01-01

    SHANK3 (also called PROSAP2) genetic haploinsufficiency is thought to be the major cause of neuropsychiatric symptoms in Phelan-McDermid syndrome (PMS). PMS is a rare genetic disorder that causes a severe form of intellectual disability (ID), expressive language delays and other autistic features. Furthermore, a significant number of SHANK3 mutations have been identified in patients with Autism Spectrum disorders ASD, and SHANK3 truncating mutations are associated with moderate to profound ID. The Shank3 protein is a scaffold protein that is located in the postsynaptic density (PSD) of excitatory synapses and is crucial for synapse development and plasticity. In this study, we investigated the molecular mechanisms associated with the ASD-like behaviors observed in Shank3Δ11-/- mice in which exon 11 has been deleted. Our results indicate that Shank3 is essential to mediating mGlu5 receptor signaling by recruiting Homer1b/c to the PSD, specifically in the striatum and cortex. Moreover, augmenting mGlu5 receptor activity by administering 3-Cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl)benzamide (CDPPB) ameliorated the functional and behavioral defects that were observed in Shank3Δ11-/- mice, suggesting that pharmaceutical treatments that increase mGlu5 activity may represent a new approach for treating patients that are affected by PMS and SHANK3 mutations. PMID:27021819

  15. Increased analgesic tolerance to acute morphine in fosB knock-out mice: a gender study.

    PubMed

    Solecki, Wojciech; Krowka, Tomasz; Kubik, Jakub; Kaczmarek, Leszek; Przewlocki, Ryszard

    2008-10-01

    The proteins of Fos family are a potential candidate to link molecular mechanisms of morphine action with behavioural effects such as morphine-induced reward, dependence and tolerance. We used both male and female mice lacking fosB gene to study its contribution to morphine effects. Morphine analgesia (tail-flick test) and hypothermia were studied using morphine at cumulative doses in morphine-naive and morphine-tolerant (tolerance induced by 24 h prior 100 mg/kg morphine administration) mice. FosB -/- mice, as compared to fosB +/+ mice, developed enhanced tolerance to morphine-induced analgesia. No effects of genotype or gender on tolerance to morphine-induced hypothermia were observed. These results suggest that fosB may be involved in the development of tolerance to morphine analgesia but not hypothermia. The gender study implicates that lack of FosB proteins in female fosB -/- mice enhanced morphine analgesic potency. In conclusion, we show that fosB gene is important to analgesia but not hypothermia phenotype indicating its role in morphine effects.

  16. Knock-out of the plastid ribosomal protein L11 in Arabidopsis: effects on mRNA translation and photosynthesis.

    PubMed

    Pesaresi, P; Varotto, C; Meurer, J; Jahns, P; Salamini, F; Leister, D

    2001-08-01

    The prpl11-1 mutant of Arabidopsis thaliana was identified among a collection of T-DNA tagged lines on the basis of a decrease in the effective quantum yield of photosystem II. The mutation responsible was localized to Prpl11, a single-copy nuclear gene that encodes PRPL11, a component of the large subunit of the plastid ribosome. The amino acid sequence of Arabidopsis PRPL11 is very similar to those of L11 proteins from spinach and prokaryotes. In the prpl11-1 mutant, photosensitivity and chlorophyll fluorescence parameters are significantly altered owing to changes in the levels of thylakoid protein complexes and stromal proteins. The abundance of most plastome transcripts examined, such as those of genes coding for the photosystem II core complex and RbcL, is not decreased. Plastid ribosomal RNA accumulates in wild-type amounts, and the assembly of plastid polysomes on the transcripts of the rbcL, psbA and psbE genes remains mainly unchanged in mutant plants, indicating that lack of PRPL11 affects neither the abundance of plastid ribosomes nor their assembly into polysomes. However, in vivo translation assays demonstrate that the rate of translation of the large subunit of Rubisco (RbcL) is significantly reduced in prpl11-1 plastids. Our data suggest a major role for PRPL11 in plastid ribosome activity per se, consistent with its location near the GTPase-binding centre of the chloroplast 50S ribosomal subunit. Additional effects of the mutation, including the pale green colour of the leaves and a drastic reduction in growth rate under greenhouse conditions, are compatible with reduced levels of protein synthesis in plastids.

  17. Enamel defects and ameloblast-specific expression in Enam knock-out/lacz knock-in mice.

    PubMed

    Hu, Jan C-C; Hu, Yuanyuan; Smith, Charles E; McKee, Marc D; Wright, J Timothy; Yamakoshi, Yasuo; Papagerakis, Petros; Hunter, Graeme K; Feng, Jerry Q; Yamakoshi, Fumiko; Simmer, James P

    2008-04-18

    Enamelin is critical for proper dental enamel formation, and defects in the human enamelin gene cause autosomal dominant amelogenesis imperfecta. We used gene targeting to generate a knock-in mouse carrying a null allele of enamelin (Enam) that has a lacZ reporter gene replacing the Enam translation initiation site and gene sequences through exon 7. Correct targeting of the transgene was confirmed by Southern blotting and PCR analyses. No enamelin protein could be detected by Western blotting in the Enam-null mice. Histochemical 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal) staining demonstrated ameloblast-specific expression of enamelin. The enamel of the Enam(+/-) mice was nearly normal in the maxillary incisors, but the mandibular incisors were discolored and tended to wear rapidly where they contacted the maxillary incisors. The Enam(-/-) mice showed no true enamel. Radiography, microcomputed tomography, and light and scanning electron microscopy were used to document changes in the enamel of Enam(-/-) mice but did not discern any perturbations of bone, dentin, or any other tissue besides the enamel layer. Although a thick layer of enamel proteins covered normal-appearing dentin of unerupted teeth, von Kossa staining revealed almost a complete absence of mineral formation in this protein layer. However, a thin, highly irregular, mineralized crust covered the dentin on erupted teeth, apparently arising from the formation and fusion of small mineralization foci (calcospherites) in the deeper part of the accumulated enamel protein layer. These results demonstrate ameloblast-specific expression of enamelin and reveal that enamelin is essential for proper enamel matrix organization and mineralization.

  18. Small Conductance Ca2+-Activated K+ Channel Knock-Out Mice Reveal the Identity of Calcium-Dependent Afterhyperpolarization Currents

    PubMed Central

    Bond, Chris T.; Herson, Paco S.; Strassmaier, Timothy; Hammond, Rebecca; Stackman, Robert; Maylie, James; Adelman, John P.

    2010-01-01

    Action potentials in many central neurons are followed by a prolonged afterhyperpolarization (AHP) that influences firing frequency and affects neuronal integration. In hippocampal CA1 pyramidal neurons, the current ascribed to the AHP (IAHP) has three kinetic components. The IfastAHP is predominantly attributable to voltage-dependent K+ channels, whereas Ca2+-dependent and voltage-independent K+ channels contribute to the ImediumAHP (ImAHP) and IslowAHP (IsAHP). Apamin, which selectively suppresses a component of the mAHP, increases neuronal excitability and facilitates the induction of synaptic plasticity at Schaffer collateral synapses and hippocampal-dependent learning. The Ca2+-dependent components of the AHP have been attributed to the activity of small conductance Ca2+-activated K+(SK) channels. Examination of transgenic mice, each lacking one of the three SK channel genes expressed in the CNS, reveals that mice without the SK2 subunit completely lack the apamin-sensitive component of the ImAHP in CA1 neurons, whereas the IsAHP is not different in any of the SK transgenic mice. In each of the transgenic lines, the expression levels of the remaining SK genes are not changed. The results demonstrate that only SK2 channels are necessary for the ImAHP, and none of the SK channels underlie the IsAHP. PMID:15190101

  19. Knocking out consumer concerns and regulator's rules: efficient use of CRISPR/Cas ribonucleoprotein complexes for genome editing in cereals.

    PubMed

    Wolter, Felix; Puchta, Holger

    2017-02-28

    Selection-free genome editing using Cas9 ribonucleoprotein embryo bombardment has been achieved for maize and wheat. This is a breakthrough that should make new breeding technologies more acceptable for worldwide use.

  20. A network-based approach for predicting Hsp27 knock-out targets in mouse skeletal muscles

    PubMed Central

    Kammoun, Malek; Picard, Brigitte; Henry-Berger, Joëlle; Cassar-Malek, Isabelle

    2013-01-01

    Thanks to genomics, we have previously identified markers of beef tenderness, and computed a bioinformatic analysis that enabled us to build an interactome in which we found Hsp27 at a crucial node. Here, we have used a network-based approach for understanding the contribution of Hsp27 to tenderness through the prediction of its interactors related to tenderness. We have revealed the direct interactors of Hsp27. The predicted partners of Hsp27 included proteins involved in different functions, e.g. members of Hsp families (Hsp20, Cryab, Hsp70a1a, and Hsp90aa1), regulators of apoptosis (Fas, Chuk, and caspase-3), translation factors (Eif4E, and Eif4G1), cytoskeletal proteins (Desmin) and antioxidants (Sod1). The abundances of 15 proteins were quantified by Western blotting in two muscles of HspB1-null mice and their controls. We observed changes in the amount of most of the Hsp27 predicted targets in mice devoid of Hsp27 mainly in the most oxidative muscle. Our study demonstrates the functional links between Hsp27 and its predicted targets. It suggests that Hsp status, apoptotic processes and protection against oxidative stress are crucial for post-mortem muscle metabolism, subsequent proteolysis, and therefore for beef tenderness. PMID:24688716

  1. The GAD65 knock out mouse - a model for GABAergic processes in fear- and stress-induced psychopathology.

    PubMed

    Müller, Iris; Çalışkan, Gürsel; Stork, Oliver

    2015-01-01

    The γ-amino butyric acid (GABA) synthetic enzyme glutamic acid decarboxylase (GAD)65 is critically involved in the activity-dependent regulation of GABAergic inhibition in the central nervous system. It is also required for the maturation of the GABAergic system during adolescence, a phase that is critical for the development of several neuropsychiatric diseases. Mice bearing a null mutation of the GAD65 gene develop hyperexcitability of the amygdala and hippocampus, and a phenotype of increased anxiety and pathological fear memory reminiscent of posttraumatic stress disorder. Although genetic association of GAD65 in human has not yet been reported, these findings are in line with observations of reduced GABAergic function in these brain regions of anxiety disorder patients. The particular value of GAD65(-/-) mice thus lies in modeling the effects of reduced GABAergic function in the mature nervous system. The expression of GAD65 and a second GAD isozyme, GAD67, are differentially regulated in response to stress in limbic brain areas suggesting that by controlling GABAergic inhibition these enzymes determine the vulnerability for the development of pathological anxiety and other stress-induced phenotypes. In fact, we could recently show that GAD65 haplodeficiency, which results in delayed postnatal increase of GABA levels, provides resilience to juvenile-stress-induced anxiety to GAD65(+/-) mice thus foiling the increased fear and anxiety in homozygous GAD65(-/-) mice.

  2. Enhanced Histaminergic Neurotransmission and Sleep-Wake Alterations, a Study in Histamine H3-Receptor Knock-Out Mice

    PubMed Central

    Gondard, Elise; Anaclet, Christelle; Akaoka, Hidéo; Guo, Rui-Xian; Zhang, Mei; Buda, Colette; Franco, Patricia; Kotani, Hidehito; Lin, Jian-Sheng

    2013-01-01

    Long-term abolition of a brain arousal system impairs wakefulness (W), but little is known about the consequences of long-term enhancement. The brain histaminergic arousal system is under the negative control of H3-autoreceptors whose deletion results in permanent enhancement of histamine (HA) turnover. In order to determine the consequences of enhancement of the histaminergic system, we compared the cortical EEG and sleep-wake states of H3-receptor knockout (H3R−/−) and wild-type mouse littermates. We found that H3R−/−mice had rich phenotypes. On the one hand, they showed clear signs of enhanced HA neurotransmission and vigilance, i.e., a higher EEG θ power during spontaneous W and a greater extent of W or sleep restriction during behavioral tasks, including environmental change, locomotion, and motivation tests. On the other hand, during the baseline dark period, they displayed deficient W and signs of sleep deterioration, such as pronounced sleep fragmentation and reduced cortical slow activity during slow wave sleep (SWS), most likely due to a desensitization of postsynaptic histaminergic receptors as a result of constant HA release. Ciproxifan (H3-receptor inverse agonist) enhanced W in wild-type mice, but not in H3R−/−mice, indicating a functional deletion of H3-receptors, whereas triprolidine (postsynaptic H1-receptor antagonist) or α-fluoromethylhistidine (HA-synthesis inhibitor) caused a greater SWS increase in H3R−/− than in wild-type mice, consistent with enhanced HA neurotransmission. These sleep-wake characteristics and the obesity phenotypes previously reported in this animal model suggest that chronic enhancement of histaminergic neurotransmission eventually compromises the arousal system, leading to sleep-wake, behavioral, and metabolic disorders similar to those caused by voluntary sleep restriction in humans. PMID:23303066

  3. Orexin/Hypocretin and Histamine: Distinct Roles in the Control of Wakefulness Demonstrated Using Knock-Out Mouse Models

    PubMed Central

    Anaclet, Christelle; Parmentier, Régis; Ouk, Koliane; Guidon, Gérard; Buda, Colette; Sastre, Jean-Pierre; Akaoka, Hidéo; Sergeeva, Olga A.; Yanagisawa, Masashi; Ohtsu, Hiroshi; Franco, Patricia; Haas, Helmut L.; Lin, Jian Sheng

    2009-01-01

    To determine the respective role played by orexin/hypocretin and histamine (HA) neurons in maintaining wakefulness (W), we characterized the behavioral and sleep-wake phenotypes of orexin(Ox) knockout(−/−) mice and compared them with those of histidine-decarboxylase(HDC, HA-synthesizing enzyme)−/−mice. While both mouse strains displayed sleep fragmentation and increased paradoxical sleep(PS), they presented a number of marked differences: 1) The PS-increase in HDC−/−mice was seen during lightness, whereas that in Ox−/−mice occurred during darkness; 2) Contrary to HDC−/−, Ox−/−mice had no W deficiency around lights-off, nor an abnormal EEG and responded to a new environment with increased W; 3) Only Ox−/−, but not HDC−/−mice, displayed narcolepsy and deficient W when faced with motor challenge. Thus, when placed on a wheel, WT, but not littermate Ox−/−mice, voluntarily spent their time in turning it and as a result, remained highly awake; this was accompanied by dense c-fos expression in many areas of their brains, including Ox-neurons in the dorsolateral hypothalamus. The W and motor deficiency of Ox−/−mice was due to the absence of Ox because intraventricular dosing of Ox-A restored their W amount and motor performance whereas SB-334867 (Ox1-receptor antagonist, i.p.) impaired W and locomotion of WT mice during the test. These data indicate that Ox, but not HA, promotes W through enhanced locomotion and suggest that HA and Ox neurons exert a distinct, but complementary and synergistic control of W: the neuropeptide being more involved in its behavioral aspects, whereas the amine is mainly responsible for its qualitative cognitive aspects and cortical-EEG activation. PMID:19923277

  4. A Novel Knock-Out Animal Model to Analyze Transcriptional Signaling by p53 Tumor Suppressor Protein in Breast Cancer

    DTIC Science & Technology

    2002-05-01

    p2lpcna genes was obtained from Celera mouse database. DNA sequences identified from the database and the sequence of the 40 bp overgo probe for screening...aagaccagagggagcctgaagactgtgatggggtagtttccatagtgacccgggtccttcttgtgtttcagccacagcgac c Complete overgo sequence for P21 5_UTR2 AGCCTGAAGACTGTGATGGGGTAGTTTCCATAGTGACCCG >pcna_5_UTR (highly specific...UNPUBLISHED Complete overgo sequence for PCNA 5_UTR CGCGGAAACTTCCTAAGGATGGAAACTGCAGCCTAAACTC Initial screen of the BAC library was performed by

  5. Dietary cladode powder from wild type and domesticated Opuntia species reduces atherogenesis in apoE knock-out mice.

    PubMed

    Garoby-Salom, Sandra; Guéraud, Françoise; Camaré, Caroline; de la Rosa, Ana-Paulina Barba; Rossignol, Michel; Santos Díaz, María del Socorro; Salvayre, Robert; Negre-Salvayre, Anne

    2016-03-01

    Dietary intake of Opuntia species may prevent the development of cardiovascular diseases. The present study was designed to characterize the biological antioxidant and anti-inflammatory properties of Opuntia species and to investigate whether Opuntia cladodes prevent the development of atherosclerosis in vivo, in apoE(-)KO mice. The effects of the two Opuntia species, the wild Opuntia streptacantha and the domesticated Opuntia ficus-indica, were tested on the generation of intra- and extracellular reactive oxygen species (ROS) production and kinetics of the LDL oxidation by murine CRL2181 endothelial cells and on the subsequent inflammatory signaling leading to the adhesion of monocytes on the activated endothelium and the formation of foam cells. Opuntia species blocked the extracellular ROS (superoxide anion) generation and LDL oxidation by CRL2181, as well as the intracellular ROS rise and signaling evoked by the oxidized LDL, including the nuclear translocation of the transcription factor NFκB, the expression of ICAM-1 and VCAM-1 adhesion molecules, and the adhesion of monocytes to CRL2181. In vivo, Opuntia significantly reduced the formation of atherosclerotic lesions and the accumulation of 4-hydroxynonenal adducts in the vascular wall of apoE-KO mice, indicating that Opuntia cladodes prevent lipid oxidation in the vascular wall. In conclusion, wild and domesticated Opuntia species exhibit antioxidant, anti-inflammatory, and antiatherogenic properties which emphasize their nutritional benefit for preventing cardiovascular diseases.

  6. Enhanced histaminergic neurotransmission and sleep-wake alterations, a study in histamine H3-receptor knock-out mice.

    PubMed

    Gondard, Elise; Anaclet, Christelle; Akaoka, Hidéo; Guo, Rui-Xian; Zhang, Mei; Buda, Colette; Franco, Patricia; Kotani, Hidehito; Lin, Jian-Sheng

    2013-05-01

    Long-term abolition of a brain arousal system impairs wakefulness (W), but little is known about the consequences of long-term enhancement. The brain histaminergic arousal system is under the negative control of H3-autoreceptors whose deletion results in permanent enhancement of histamine (HA) turnover. In order to determine the consequences of enhancement of the histaminergic system, we compared the cortical EEG and sleep-wake states of H3-receptor knockout (H3R-/-) and wild-type mouse littermates. We found that H3R-/-mice had rich phenotypes. On the one hand, they showed clear signs of enhanced HA neurotransmission and vigilance, i.e., a higher EEG θ power during spontaneous W and a greater extent of W or sleep restriction during behavioral tasks, including environmental change, locomotion, and motivation tests. On the other hand, during the baseline dark period, they displayed deficient W and signs of sleep deterioration, such as pronounced sleep fragmentation and reduced cortical slow activity during slow wave sleep (SWS), most likely due to a desensitization of postsynaptic histaminergic receptors as a result of constant HA release. Ciproxifan (H3-receptor inverse agonist) enhanced W in wild-type mice, but not in H3R-/-mice, indicating a functional deletion of H3-receptors, whereas triprolidine (postsynaptic H1-receptor antagonist) or α-fluoromethylhistidine (HA-synthesis inhibitor) caused a greater SWS increase in H3R-/- than in wild-type mice, consistent with enhanced HA neurotransmission. These sleep-wake characteristics and the obesity phenotypes previously reported in this animal model suggest that chronic enhancement of histaminergic neurotransmission eventually compromises the arousal system, leading to sleep-wake, behavioral, and metabolic disorders similar to those caused by voluntary sleep restriction in humans.

  7. Development of Accelerated Coronary Atherosclerosis Model Using Low Density Lipoprotein Receptor Knock-Out Swine with Balloon Injury

    PubMed Central

    Ogita, Manabu; Miyauchi, Katsumi; Onishi, Akira; Tsuboi, Shuta; Wada, Hideki; Konishi, Hirokazu; Naito, Ryo; Dohi, Tomotaka; Kasai, Takatoshi; Kojima, Yuko; Schwartz, Robert S.; Daida, Hiroyuki

    2016-01-01

    Background Several animal models have facilitated the evaluation and pathological understanding of atherosclerosis, but a definitive animal model of coronary atherosclerosis is not available. We therefore developed low density lipoprotein receptor knockout (LDLR-KO) pigs with hypercholesterolemia, a model which rapidly developed coronary atherosclerosis following balloon injury. Methods and Results We deleted LDLR exon regions from cultured porcine fetal fibroblasts and cloned LDLR knockout (LDLR-KO) embryos microinjecting fetal fibroblast nuclei into enucleated oocytes. Twelve LDLR-KO pigs were fed a 2.0% cholesterol and 20% fat diet. Baseline serum LDL cholesterol level was 510.0±86.1 mg/dL. Balloon injury was created in 46 coronary segments and necropsy were obtained 2, 4, 8 and 12 weeks later. Coronary artery sections were reviewed to evaluate lesion progression. We found lipid accumulation with foam cells and inflammatory cells beginning four weeks after balloon injury. The mean ratio of macrophages to plaque area was significantly higher in the four- weeks and eight-week animals compared with those at 2-weeks (8.79% ± 5.98% and 17.00% ± 10.38% vs. 1.14% ± 1.88%, P < 0.0001). At 12 weeks the ratio decreased toward the level at 2 week level (4.00% ± 4.56%, P = 0.66 vs. baseline). Advanced coronary atherosclerotic lesions contained lipid pools at eight-weeks with fibrous components beginning at 12 weeks. Conclusions We developed a model of rapid coronary atherosclerosis using LDLR KO pigs with balloon injury. This model may be useful for preclinical evaluation of medication or devices, and may also help investigate mechanisms of plaque progression. PMID:27631974

  8. Sun-Earth Connections: How the Sun Knocks Out My Cell Phone from 150 Million Kilometers Away

    NASA Technical Reports Server (NTRS)

    Ladbury, Raymond L.

    2014-01-01

    Large solar particle events (SPE) threaten many elements of critical infrastructure. A 2013 study by Lloyds of London and Atmospheric and Environmental Research recently found that if a worst-case solar event like the 1859 Carrington Event struck our planet now, it could result on $0.6-$2.36 trillion in damages to the economy. In March 2014, researchers Y. D. Liu et al. revealed that just such an event had narrowly missed Earth in July 2012. The event was observed by the STEREO A spacecraft. In this presentation, we examine how the sun can pack such a punch from 150 million km away, the threats such solar particle events pose, their mechanisms and the efforts NASA and other space agencies are carrying out to understand and mitigate such risks.

  9. Effects of eggplant (Solanum melongena) on the atherogenesis and oxidative stress in LDL receptor knock out mice (LDLR(-/-)).

    PubMed

    Botelho, Françoise V; Enéas, Luciana R; Cesar, Giovana C; Bizzotto, Carolina S; Tavares, Erico; Oliveira, Fabrícia A; Gloria, M Beatriz A; Silvestre, Marialice P C; Arantes, Rosa M E; Alvarez-Leite, Jacqueline I

    2004-08-01

    Eggplant (Solanum melongena) has been used as hypocholesterolemic agent in many countries. However, few controlled studies were addressed to this subject and atherogenesis. We have evaluated the effect of eggplant on cholesterol metabolism and atherogenesis in LDLR(-/-) mice. Animals were fed on chow (n=17) or atherogenic (n=21) diet during 12 weeks receiving water (control) or eggplant extract. Liver, serum and fecal lipids, together with serum lipoproteins were measured. Oxidative stress was evaluated through conjugate diene formation and ox-LDL antibodies by enzyme immunoassay. Atherosclerotic lesions were measured in different sites of aorta. Total cholesterol and atherogenic lipoproteins did not decrease after eggplant intake. Animals receiving eggplant and chow diet showed increased anti-ox-LDL antibodies and a decreased lag phase of conjugated diene formation, indicating a higher oxidative stress than controls. No differences were seen in lesion area of aortic valve. Eggplant extract had high histamine and other amine levels that could enhance LDL oxidation and its endocytosis. Eggplant did not decrease plasma cholesterol nor prevent the development of atherosclerosis in LDLR(-/-) mice. Surprisingly, eggplant increased oxidative stress, representing a risk factor for atherosclerosis. These results did not support the use of eggplant extract as hypocholesterolemic agent.

  10. COMPARATIVE HEPATIC EFFECTS OF PERFLUOROOCTANOIC ACID AND WY 14,643 IN PPARÁ KNOCKED OUT AND WILD-TYPE MICE

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a fluorinated organic chemical widely used in consumer and industrial products. Its persistence in the environment and presence in humans and wildlife have raised considerable concerns. PFOA induces liver tumors in rodents, which is thought to be ...

  11. Knocking out the dopamine reuptake transporter (DAT) does not change the baseline brain arachidonic acid signal in the mouse

    PubMed Central

    Ramadan, Epolia; Chang, Lisa; Chen, Mei; Ma, Kaizong; Hall, F. Scott; Uhl, George R.; Rapoport, Stanley I.; Basselin, Mireille

    2012-01-01

    Background Dopamine transporter (DAT) homozygous knockout (DAT−/−) mice have a 10-fold higher extracellular DA concentration in the caudate-putamen and nucleus accumbens than do wildtype (DAT+/+) mice, but show reduced presynaptic DA synthesis and fewer postsynaptic D2 receptors. One aspect of neurotransmission involves DA binding to postsynaptic D2-like receptors coupled to cytosolic phospholipase A2 (cPLA2), releasing second messenger arachidonic acid (AA) from synaptic membrane phospholipid. We hypothesized that tonic overactivation of D2-like receptors in DAT−/− mice due to elevated DA would not increase brain AA signaling, because of compensatory downregulation of postsynaptic signaling mechanisms. Methods [1-14C]AA was infused intravenously for 3 min in unanesthetized DAT+/+, heterozygous (DAT+/−) and DAT−/− mice. AA incorporation coefficients k* and rates Jin, markers of AA metabolism and signaling, were imaged in 83 brain regions using quantitative autoradiography brain cPLA2-IV activity also was measured. Results Neither k* nor Jin for AA in any brain region, or in brain cPLA2-IV activity, differed significantly between DAT−/−, DAT+/− and DAT+/+ mice. Conclusions These results differ from reported increases in k* and Jin for AA, and brain cPLA2 expression, in serotonin reuptake transporter (5-HTT) knockout mice, and suggest that postsynaptic dopaminergic neurotransmission mechanisms involving AA are downregulated despite elevated DA in DAT−/− mice. PMID:22376027

  12. Sensitivity of chemical reaction networks: a structural approach. 1. Examples and the carbon metabolic network.

    PubMed

    Mochizuki, Atsushi; Fiedler, Bernold

    2015-02-21

    In biological cells, chemical reaction pathways lead to complex network systems like metabolic networks. One experimental approach to the dynamics of such systems examines their "sensitivity": each enzyme mediating a reaction in the system is increased/decreased or knocked out separately, and the responses in the concentrations of chemicals or their fluxes are observed. In this study, we present a mathematical method, named structural sensitivity analysis, to determine the sensitivity of reaction systems from information on the network alone. We investigate how the sensitivity responses of chemicals in a reaction network depend on the structure of the network, and on the position of the perturbed reaction in the network. We establish and prove some general rules which relate the sensitivity response to the structure of the underlying network. We describe a hierarchical pattern in the flux response which is governed by branchings in the network. We apply our method to several hypothetical and real life chemical reaction networks, including the metabolic network of the Escherichia coli TCA cycle.

  13. Investigation of the reaction mechanism for the four-particle photodisintegration of a carbon nucleus

    NASA Astrophysics Data System (ADS)

    Afanas'ev, S. N.; Gorbenko, E. S.; Khodyachikh, A. F.

    2007-05-01

    The four-particle photodisintegration of a carbon nucleus in the reactions 12C(γ, p)3H2α and 12C(γ, n)3H2α is investigated by a method that employs a diffusion chamber in a magnetic field. It is shown that these reactions proceed according a sequential-type scheme: excited states of 11B and 11C nuclei decay to weakly excited states of 8Be, 7Li, and 7Be nuclei. It is concluded that nucleons are knocked out from the s shell. In the excitation curve for the 2α system in the reaction 12C(γ, p)3H2α, a resonance is found between the maxima corresponding to the ground and the first excited state of the 8Be nucleus, and this resonance is identified as a ghost anomaly. The branching fractions of the decay modes are determined. The angular distributions of nucleons in the reaction c.m. frame are measured. The energy dependence of the asymmetry coefficient for the angular distributions is obtained. A fast increase in this coefficient is observed in the energy range 38 40 MeV. It is concluded that the asymmetry coefficient depends on the excitation energy of the final nucleus in the region of intermediate photon energies.

  14. Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice

    PubMed Central

    Matheu, Victor; Treschow, Alexandra; Teige, Ingrid; Navikas, Vaidrius; Issazadeh-Navikas, Shohreh

    2005-01-01

    Background CpG oligodeoxynucleotides (CpG-ODN) are capable of inducing high amounts of type I IFNs with many immunomodulatory properties. Furthermore, type-I IFNs have been proposed to play a key role in mediating effects of CpG-ODN. The precise role of IFN-β in the immunomodulatory effects of CpG-ODN is not known. Objective Here, we aimed to elucidate the role of IFN-β in the anti-allergic effect of CpG motifs. Methods We assessed the immune response in OVA-primed/OVA-challenged IFN-β knockout (-/-) mice compared to wild type (WT) control, after intranasal and systemic treatment with synthetic CpG motifs. Results Vaccination with CpG-ODN reduced the number of cells in airways of OVA-sensitized WT but not IFN-β-/- mice. Although airway eosinophilia was reduced in both treated groups, they were significantly higher in IFN-β-/- mice. Other inflammatory cells, such as lymphocytes and macrophages were enhanced in airways by CpG treatment in IFN-β-/- mice. The ratio of IFN-γ/IL-4 cytokines in airways was significantly skewed to a Th1 response in WT compared to IFN-β-/- group. In contrast, IL-4 and IgE were reduced with no differences between groups. Ag-specific T-cell proliferation, Th1-cytokines such as IFN-γ, IL-2 and also IL-12 were significantly lower in IFN-β-/- mice. Surprisingly, we discovered that intranasal treatment of mice with CpG-ODN results in mild synovitis particularly in IFN-β-/- mice. Conclusion Our results indicate that induction of Th1 response by therapy with CpG-ODN is only slightly and partially dependent on IFN-β, while IFN-β is not an absolute requirement for suppression of airway eosinophilia and IgE. Furthermore, our finding of mild synovitis is a warning for possible negative effects of CpG-ODN vaccination. PMID:15748290

  15. Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis

    PubMed Central

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K.; Joshi, Amritanshu B.; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D.; KuKuruga, Mark A.; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L.

    2016-01-01

    Background Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Methodology Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells between aged and young mice; the adaptive response specifically in terms of T cell and B cell activation in aged animals was reduced compared to young mice which correlated with less protection in old mice compared to young mice. Conclusions Taken together, LdCen-/- immunization induced a significant but diminished host protective response in aged mice after challenge with virulent L. donovani parasites compared to young mice. PMID:27580076

  16. Effects of NV gene knock-out recombinant viral hemorrhagic septicemia virus (VHSV) on Mx gene expression in Epithelioma papulosum cyprini (EPC) cells and olive flounder (Paralichthys olivaceus).

    PubMed

    Kim, Min Sun; Kim, Ki Hong

    2012-03-01

    To determine whether the NV gene of viral hemorrhagic septicemia virus (VHSV) is related to the type I interferon response of hosts, expression of Mx gene in Epithelioma papulosum cyprini (EPC) cells and in olive flounder (Paralichthys olivaceus) in response to infection with either wild-type VHSV or recombinant VHSVs (rVHSV-ΔNV-EGFP and rVHSV-wild) was investigated. A reporter vector was constructed for measuring Mx gene expression using olive flounder Mx promoter, in which the reporter Metridia luciferase was designed to be excreted to culture medium to facilitate measurement. The highest increase of luciferase activity was detected from supernatant of cells infected with rVHSV-ΔNV-EGFP. In contrast cells infected with wild-type VHSV showed a slight increase of the luciferase activity. Interestingly, cells infected with rVHSV-wild that has artificially changed nucleotides just before and after the NV gene ORF, also showed highly increased luciferase activity, but the increased amplitude was lower than that by rVHSV-ΔNV-EGFP. These results strongly suggest that the NV protein of VHSV plays an important role in suppressing interferon response in host cells, which provides a condition for the viruses to efficiently proliferate in host cells. In an in vivo experiment, the Mx gene expression in olive flounder challenged with the rVHSV-ΔNV-EGFP was clearly higher than fish challenged with rVHSV-wild or wild-type VHSV, suggesting that lacking of the NV gene in the genome of rVHSV-ΔNV-EGFP brought to strong interferon response that subsequently inhibit viral replication in fish.

  17. Enkephalin levels and the number of neuropeptide Y-containing interneurons in the hippocampus are decreased in female cannabinoid-receptor 1 knock-out mice.

    PubMed

    Rogers, Sophie A; Kempen, Tracey A Van; Pickel, Virginia M; Milner, Teresa A

    2016-05-04

    Drug addiction requires learning and memory processes that are facilitated by activation of cannabinoid-1 (CB1) and opioid receptors in the hippocampus. This involves activity-dependent synaptic plasticity that is partially regulated by endogenous opioid (enkephalin and dynorphin) and non-opioid peptides, specifically cholecystokinin, parvalbumin and neuropeptide Y, the neuropeptides present in inhibitory interneurons that co-express CB1 or selective opioid receptors. We tested the hypothesis that CB1 receptor expression is a determinant of the availability of one or more of these peptide modulators in the hippocampus. This was achieved by quantitatively analyzing the immunoperoxidase labeling for each of these neuropeptide in the dorsal hippocampus of female wild-type (CB1+/+) and cannabinoid receptor 1 knockout (CB1-/-) C57/BL6 mice. The levels of Leu(5)-enkephalin-immunoreactivity were significantly reduced in the hilus of the dentate gyrus and in stratum lucidum of CA3 in CB1-/- mice. Moreover, the numbers of neuropeptide Y-immunoreactive interneurons in the dentate hilus were significantly lower in the CB1-/- compared to wild-type mice. However, CB1+/+ and CB1-/- mice did not significantly differ in expression levels of either dynorphin or cholecystokinin, and showed no differences in numbers of parvalbumin-containing interneurons. These findings suggest that the cannabinoid and opioid systems have a nuanced, regulatory relationship that could affect the balance of excitation and inhibition in the hippocampus and thus processes such as learning that rely on this balance.

  18. Metabolic consequences of knocking out UGT85B1, the gene encoding the glucosyltransferase required for synthesis of dhurrin in Sorghum bicolor (L. Moench).

    PubMed

    Blomstedt, Cecilia K; O'Donnell, Natalie H; Bjarnholt, Nanna; Neale, Alan D; Hamill, John D; Møller, Birger Lindberg; Gleadow, Roslyn M

    2016-02-01

    Many important food crops produce cyanogenic glucosides as natural defense compounds to protect against herbivory or pathogen attack. It has also been suggested that these nitrogen-based secondary metabolites act as storage reserves of nitrogen. In sorghum, three key genes, CYP79A1, CYP71E1 and UGT85B1, encode two Cytochrome P450s and a glycosyltransferase, respectively, the enzymes essential for synthesis of the cyanogenic glucoside dhurrin. Here, we report the use of targeted induced local lesions in genomes (TILLING) to identify a line with a mutation resulting in a premature stop codon in the N-terminal region of UGT85B1. Plants homozygous for this mutation do not produce dhurrin and are designated tcd2 (totally cyanide deficient 2) mutants. They have reduced vigor, being dwarfed, with poor root development and low fertility. Analysis using liquid chromatography-mass spectrometry (LC-MS) shows that tcd2 mutants accumulate numerous dhurrin pathway-derived metabolites, some of which are similar to those observed in transgenic Arabidopsis expressing the CYP79A1 and CYP71E1 genes. Our results demonstrate that UGT85B1 is essential for formation of dhurrin in sorghum with no co-expressed endogenous UDP-glucosyltransferases able to replace it. The tcd2 mutant suffers from self-intoxication because sorghum does not have a feedback mechanism to inhibit the initial steps of dhurrin biosynthesis when the glucosyltransferase activity required to complete the synthesis of dhurrin is lacking. The LC-MS analyses also revealed the presence of metabolites in the tcd2 mutant which have been suggested to be derived from dhurrin via endogenous pathways for nitrogen recovery, thus indicating which enzymes may be involved in such pathways.

  19. Ferulic Acid Orchestrates Anti-Oxidative Properties of Danggui Buxue Tang, an Ancient Herbal Decoction: Elucidation by Chemical Knock-Out Approach

    PubMed Central

    Gong, Amy G. W.; Huang, Vincent Y.; Wang, Huai Y.; Lin, Huang Q.; Dong, Tina T. X.; Tsim, Karl W. K.

    2016-01-01

    Ferulic acid, a phenolic acid derived mainly from a Chinese herb Angelica Sinensis Radix (ASR), was reported to reduce the formation of free radicals. Danggui Buxue Tang (DBT), a herbal decoction composing of Astragali Radix (AR) and ASR, has been utilized for more than 800 years in China having known anti-oxidative property. Ferulic acid is a major active ingredient in DBT; however, the role of ferulic acid within the herbal mixture has not been resolved. In order to elucidate the function of ferulic acid within this herbal decoction, a ferulic acid-depleted herbal decoction was created and named as DBTΔfa. The anti-oxidative properties of chemically modified DBT decoction were systemically compared in cultured H9C2 rat cardiomyoblast cell line. The application of DBT and DBTΔfa into the cultures showed functions in (i) decreasing the reactive oxygen species (ROS) formation, detected by laser confocal; (ii) increasing of the activation of Akt; (iii) increasing the transcriptional activity of anti-oxidant response element (ARE); and (iv) increasing the expressions of anti-oxidant enzymes, i.e. NQO1 and GCLM. In all scenario, the aforementioned anti-oxidative properties of DBTΔfa in H9C2 cells were significantly reduced, as compared to authentic DBT. Thus, ferulic acid could be an indispensable chemical in DBT to orchestrate multi-components of DBT as to achieve maximal anti-oxidative functions. PMID:27824860

  20. Knocking Out Cytosolic Cysteine Synthesis Compromises the Antioxidant Capacity of the Cytosol to Maintain Discrete Concentrations of Hydrogen Peroxide in Arabidopsis1[W

    PubMed Central

    López-Martín, M. Carmen; Becana, Manuel; Romero, Luis C.; Gotor, Cecilia

    2008-01-01

    Plant cells contain different O-acetylserine(thiol)lyase (OASTL) enzymes involved in cysteine (Cys) biosynthesis and located in different subcellular compartments. These enzymes are made up of a complex variety of isoforms resulting in different subcellular Cys pools. To unravel the contribution of cytosolic Cys to plant metabolism, we characterized the knockout oas-a1.1 and osa-a1.2 mutants, deficient in the most abundant cytosolic OASTL isoform in Arabidopsis (Arabidopsis thaliana). Total intracellular Cys and glutathione concentrations were reduced, and the glutathione redox state was shifted in favor of its oxidized form. Interestingly, the capability of the mutants to chelate heavy metals did not differ from that of the wild type, but the mutants have an enhanced sensitivity to cadmium. With the aim of establishing the metabolic network most influenced by the cytosolic Cys pool, we used the ATH1 GeneChip for evaluation of differentially expressed genes in the oas-a1.1 mutant grown under nonstress conditions. The transcriptomic footprints of mutant plants had predicted functions associated with various physiological responses that are dependent on reactive oxygen species and suggested that the mutant was oxidatively stressed. Evidences that the mutation caused a perturbation in H2O2 homeostasis are that, in the knockout, H2O2 production was localized in shoots and roots; spontaneous cell death lesions occurred in the leaves; and lignification and guaiacol peroxidase activity were significantly increased. All these findings indicate that a deficiency of OAS-A1 in the cytosol promotes a perturbation in H2O2 homeostasis and that Cys is an important determinant of the antioxidative capacity of the cytosol in Arabidopsis. PMID:18441224

  1. Low 17beta-estradiol levels in CNR1 knock-out mice affect spermatid chromatin remodeling by interfering with chromatin reorganization.

    PubMed

    Cacciola, Giovanna; Chioccarelli, Teresa; Altucci, Lucia; Ledent, Catherine; Mason, J Ian; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda

    2013-06-01

    The type 1-cannabinoid receptor, CNR1, regulates differentiation of spermatids. Indeed, we have recently reported that the genetic inactivation of Cnr1 in mice influenced chromatin remodeling of spermatids, by reducing histone displacement and then sperm chromatin quality indices (chromatin condensation and DNA integrity). Herein, we have studied, at both central and testicular levels, the molecular signals potentially involved in histone displacement. In particular, investigation of the neuroendocrine axis involved in estrogen production demonstrated down-regulation of the axis supporting FSH/estrogen secretion in Cnr1-knockout male mice. Conversely, Cnr1-knockout male mice treated with 17beta-estradiol showed a weak increase of pituitary Fsh-beta subunit mRNA levels and a rescue of sperm chromatin quality indices demonstrating that estrogens, possibly in combination with FSH secretion, play an important role in regulating chromatin remodeling of spermatids.

  2. The knock-out of ARP3a gene affects F-actin cytoskeleton organization altering cellular tip growth, morphology and development in moss Physcomitrella patens.

    PubMed

    Finka, Andrija; Saidi, Younousse; Goloubinoff, Pierre; Neuhaus, Jean-Marc; Zrÿd, Jean-Pierre; Schaefer, Didier G

    2008-10-01

    The seven subunit Arp2/3 complex is a highly conserved nucleation factor of actin microfilaments. We have isolated the genomic sequence encoding a putative Arp3a protein of the moss Physcomitrella patens. The disruption of this ARP3A gene by allele replacement has generated loss-of-function mutants displaying a complex developmental phenotype. The loss-of function of ARP3A gene results in shortened, almost cubic chloronemal cells displaying affected tip growth and lacking differentiation to caulonemal cells. In moss arp3a mutants, buds differentiate directly from chloronemata to form stunted leafy shoots having differentiated leaves similar to wild type. Yet, rhizoids never differentiate from stem epidermal cells. To characterize the F-actin organization in the arp3a-mutated cells, we disrupted ARP3A gene in the previously described HGT1 strain expressing conditionally the GFP-talin marker. In vivo observation of the F-actin cytoskeleton during P. patens development demonstrated that loss-of-function of Arp3a is associated with the disappearance of specific F-actin cortical structures associated with the establishment of localized cellular growth domains. Finally, we show that constitutive expression of the P. patens Arp3a and its Arabidopsis thaliana orthologs efficiently complement the mutated phenotype indicating a high degree of evolutionary conservation of the Arp3 function in land plants.

  3. Deficits in axonal transport in hippocampal-based circuitry and the visual pathway in APP knock-out animals witnessed by manganese enhanced MRI.

    PubMed

    Gallagher, Joseph J; Zhang, Xiaowei; Ziomek, Gregory J; Jacobs, Russell E; Bearer, Elaine L

    2012-04-15

    Mounting evidence implicates axonal transport defects, typified by the presence of axonal varicosities with aberrant accumulations of cargo, as an early event in Alzheimer's disease (AD) pathogenesis. Work identifying amyloid precursor protein (APP) as a vesicular motor receptor for anterograde axonal transport further implicates axonal transport in AD. Manganese-enhanced MRI (MEMRI) detects axonal transport dynamics in preclinical studies. Here we pursue an understanding of the role of APP in axonal transport in the central nervous system by applying MEMRI to hippocampal circuitry and to the visual pathway in living mice homozygous for either wild type or a deletion in the APP gene (n=12 for each genotype). Following intra-ocular or stereotaxic hippocampal injection, we performed time-lapse MRI to detect Mn(2+) transport. Three dimensional whole brain datasets were compared on a voxel-wise basis using within-group pair-wise analysis. Quantification of transport to structures connected to injection sites via axonal fiber tracts was also performed. Histology confirmed consistent placement of hippocampal injections and no observable difference in glial-response to the injections. APP-/- mice had significantly reduced transport from the hippocampus to the septal nuclei and amygdala after 7h and reduced transport to the contralateral hippocampus after 25 h; axonal transport deficits in the APP-/- animals were also identified in the visual pathway. These data support a system-wide role for APP in axonal transport within the central nervous system and demonstrate the power of MEMRI for assessing neuronal circuitry involved in memory and learning.

  4. Conditional knock-out reveals a requirement for O-linked N-Acetylglucosaminase (O-GlcNAcase) in metabolic homeostasis.

    PubMed

    Keembiyehetty, Chithra; Love, Dona C; Harwood, Katryn R; Gavrilova, Oksana; Comly, Marcella E; Hanover, John A

    2015-03-13

    O-GlcNAc cycling is maintained by the reciprocal activities of the O-GlcNAc transferase and the O-GlcNAcase (OGA) enzymes. O-GlcNAc transferase is responsible for O-GlcNAc addition to serine and threonine (Ser/Thr) residues and OGA for its removal. Although the Oga gene (MGEA5) is a documented human diabetes susceptibility locus, its role in maintaining insulin-glucose homeostasis is unclear. Here, we report a conditional disruption of the Oga gene in the mouse. The resulting homozygous Oga null (KO) animals lack OGA enzymatic activity and exhibit elevated levels of the O-GlcNAc modification. The Oga KO animals showed nearly complete perinatal lethality associated with low circulating glucose and low liver glycogen stores. Defective insulin-responsive GSK3β phosphorylation was observed in both heterozygous (HET) and KO Oga animals. Although Oga HET animals were viable, they exhibited alterations in both transcription and metabolism. Transcriptome analysis using mouse embryonic fibroblasts revealed deregulation in the transcripts of both HET and KO animals specifically in genes associated with metabolism and growth. Additionally, metabolic profiling showed increased fat accumulation in HET and KO animals compared with WT, which was increased by a high fat diet. Reduced insulin sensitivity, glucose tolerance, and hyperleptinemia were also observed in HET and KO female mice. Notably, the respiratory exchange ratio of the HET animals was higher than that observed in WT animals, indicating the preferential utilization of glucose as an energy source. These results suggest that the loss of mouse OGA leads to defects in metabolic homeostasis culminating in obesity and insulin resistance.

  5. Involvement of mitogen-activated protein kinases (MAPKs) during testicular ischemia-reperfusion injury in nuclear factor-kappaB knock-out mice.

    PubMed

    Minutoli, Letteria; Antonuccio, Pietro; Polito, Francesca; Bitto, Alessandra; Fiumara, Tiziana; Squadrito, Francesco; Nicotina, Piero Antonio; Arena, Salvatore; Marini, Herbert; Romeo, Carmelo; Altavilla, Domenica

    2007-07-12

    Nuclear factor kappa-B (NF-kappaB), extracellular regulated kinase (ERK 1/2) and c-jun-N terminal kinase (JNK) play an important role in testicular ischemia. We investigated the patterns of ERK1/2, JNK and p38 activation in NF-kappaB knockout (KO) mice subjected to testicular torsion. KO and normal littermate wild-type (WT) animals underwent at 1 h testicular ischemia followed by 24 h reperfusion (TI/R). Sham testicular ischemia-reperfusion mice served as controls. ERK 1/2, JNK and p38 expression by western blot analysis, tumor necrosis factor-alpha (TNF-alpha) expression (RT-PCR and western blot analysis) and a complete histological examination were carried out. TI/R caused a greater increase in phosphorylated form of ERK 1/2 in KO mice than in WT animals in either the ischemic testis and the contralateral one. By contrary, active form of JNK and p38 were completely abrogated in both testes of KO mice, while WT animals showed a significant activation of those kinases in both testes. TNF-alpha expression was markedly reduced in KO mice when compared to WT mice either at the mRNA and the protein level. Finally TI/R-induced histological damage was markedly reduced in KO mice. Our data indicate that NF-kappaB plays a pivotal role in the development of testicular ischemia-reperfusion injury and suggest that, in the absence of the transcriptional factor, the up-stream signal JNK and p38 may be abrogated while ERK 1/2 activity is enhanced.

  6. Analyzing structure–function relationships of artificial and cancer-associated PARP1 variants by reconstituting TALEN-generated HeLa PARP1 knock-out cells

    PubMed Central

    Rank, Lisa; Veith, Sebastian; Gwosch, Eva C.; Demgenski, Janine; Ganz, Magdalena; Jongmans, Marjolijn C.; Vogel, Christopher; Fischbach, Arthur; Buerger, Stefanie; Fischer, Jan M.F.; Zubel, Tabea; Stier, Anna; Renner, Christina; Schmalz, Michael; Beneke, Sascha; Groettrup, Marcus; Kuiper, Roland P.; Bürkle, Alexander; Ferrando-May, Elisa; Mangerich, Aswin

    2016-01-01

    Genotoxic stress activates PARP1, resulting in the post-translational modification of proteins with poly(ADP-ribose) (PAR). We genetically deleted PARP1 in one of the most widely used human cell systems, i.e. HeLa cells, via TALEN-mediated gene targeting. After comprehensive characterization of these cells during genotoxic stress, we analyzed structure–function relationships of PARP1 by reconstituting PARP1 KO cells with a series of PARP1 variants. Firstly, we verified that the PARP1\\E988K mutant exhibits mono-ADP-ribosylation activity and we demonstrate that the PARP1\\L713F mutant is constitutively active in cells. Secondly, both mutants exhibit distinct recruitment kinetics to sites of laser-induced DNA damage, which can potentially be attributed to non-covalent PARP1–PAR interaction via several PAR binding motifs. Thirdly, both mutants had distinct functional consequences in cellular patho-physiology, i.e. PARP1\\L713F expression triggered apoptosis, whereas PARP1\\E988K reconstitution caused a DNA-damage-induced G2 arrest. Importantly, both effects could be rescued by PARP inhibitor treatment, indicating distinct cellular consequences of constitutive PARylation and mono(ADP-ribosyl)ation. Finally, we demonstrate that the cancer-associated PARP1 SNP variant (V762A) as well as a newly identified inherited PARP1 mutation (F304L\\V762A) present in a patient with pediatric colorectal carcinoma exhibit altered biochemical and cellular properties, thereby potentially supporting human carcinogenesis. Together, we establish a novel cellular model for PARylation research, by revealing strong structure–function relationships of natural and artificial PARP1 variants. PMID:27694308

  7. Prion Protein (PrP) Knock-Out Mice Show Altered Iron Metabolism: A Functional Role for PrP in Iron Uptake and Transport

    PubMed Central

    Singh, Ajay; Kong, Qingzhong; Luo, Xiu; Petersen, Robert B.; Meyerson, Howard; Singh, Neena

    2009-01-01

    Despite overwhelming evidence implicating the prion protein (PrP) in prion disease pathogenesis, the normal function of this cell surface glycoprotein remains unclear. In previous reports we demonstrated that PrP mediates cellular iron uptake and transport, and aggregation of PrP to the disease causing PrP-scrapie (PrPSc) form results in imbalance of iron homeostasis in prion disease affected human and animal brains. Here, we show that selective deletion of PrP in transgenic mice (PrPKO) alters systemic iron homeostasis as reflected in hematological parameters and levels of total iron and iron regulatory proteins in the plasma, liver, spleen, and brain of PrPKO mice relative to matched wild type controls. Introduction of radiolabeled iron (59FeCl3) to Wt and PrPKO mice by gastric gavage reveals inefficient transport of 59Fe from the duodenum to the blood stream, an early abortive spike of erythropoiesis in the long bones and spleen, and eventual decreased 59Fe content in red blood cells and all major organs of PrPKO mice relative to Wt controls. The iron deficient phenotype of PrPKO mice is reversed by expressing Wt PrP in the PrPKO background, demonstrating a functional role for PrP in iron uptake and transport. Since iron is required for essential metabolic processes and is also potentially toxic if mismanaged, these results suggest that loss of normal function of PrP due to aggregation to the PrPSc form induces imbalance of brain iron homeostasis, resulting in disease associated neurotoxicity. PMID:19568430

  8. Developmental Toxicity of Perfluorononanoic Acid in the Wild-Type and PPAR-alpha Knock-out Mouse After Gestational Exposure

    EPA Science Inventory

    Perfluorononanoic acid (PFNA) is a perfluoroalkyl acid detected in the environment and in tissues of humans and wildlife, and its concentration in human serum has increased in the past few years. PFNA negatively affects development and survival of CD1 mice and activates peroxisom...

  9. Establishment of Immortalized Mouse Bmp2 Knock-Out Dental Papilla Mesenchymal Cells Necessary for Study of Odontoblastic Differentiation and Odontogenesis.

    PubMed

    Wu, Lian; Wang, Feng; Donly, Kevin J; Wan, Chunyan; Luo, Daoshu; Harris, Stephen E; MacDougall, Mary; Chen, Shuo

    2015-11-01

    Bmp2 is essential for dentin formation. Bmp2 cKO mice exhibited similar phenotype to dentinogenesis imperfecta, showing dental pulp exposure, hypomineralized dentin, and delayed odontoblast differentiation. As it is relatively difficult to obtain lot of primary Bmp2 cKO dental papilla mesenchymal cells and to maintain a long-term culture of these primary cells, availability of immortalized deleted Bmp2 dental papilla mesenchymal cells is critical for studying the underlying mechanism of Bmp2 signal in odontogenesis. In this study, our goal was to generate an immortalized deleted Bmp2 dental papilla mesenchymal (iBmp2(ko/ko)dp) cell line by introducing Cre recombinase and green fluorescent protein (GFP) into the immortalized mouse floxed Bmp2 dental papilla mesenchymal (iBmp2(fx/fx)dp) cells. iBmp2(ko/ko)dp cells were confirmed by GFP and PCR. The deleted Bmp2 cells exhibited slow cell proliferation rate and cell growth was arrested in G2 phase. Expression of tooth-related marker genes and cell differentiation were decreased in the deleted cells. Importantly, extracellular matrix remodeling was impaired in the iBmp2(ko/ko)dp cells as reflected by the decreased Mmp-9 expression. In addition, with exogenous Bmp2 induction, these cell differentiation and mineralization were rescued as well as extracellular matrix remodeling was enhanced. Therefore, we for the first time described establishment of iBmp(ko/ko) cells that are useful for study of mechanisms in regulating dental papilla mesenchymal cell lineages.

  10. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice.

    PubMed

    Busby, Ellen R; Sherwood, Nancy M

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15-28 may account for the altered metabolism in the prepubertal female pups.

  11. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice

    PubMed Central

    Busby, Ellen R.; Sherwood, Nancy M.

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15–28 may account for the altered metabolism in the prepubertal female pups. PMID:28346489

  12. Knock out of S1P3 receptor signaling attenuates inflammation and fibrosis in bleomycin-induced lung injury mice model.

    PubMed

    Murakami, Ken; Kohno, Masataka; Kadoya, Masatoshi; Nagahara, Hidetake; Fujii, Wataru; Seno, Takahiro; Yamamoto, Aihiro; Oda, Ryo; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Morita, Satoshi; Nakada, Hiroshi; Hla, Timothy; Kawahito, Yutaka

    2014-01-01

    Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite involved in many critical cellular processes, including proliferation, migration, and angiogenesis, through interaction with a family of five G protein-coupled receptors (S1P1-5). Some reports have implicated S1P as an important inflammatory mediator of the pathogenesis of airway inflammation, but the role of S1P3 in the pathogenesis of lung diseases is not completely understood. We used S1P3-deficient (knockout (KO)) mice to clarify the role of S1P3 receptor signaling in the pathogenesis of pulmonary inflammation and fibrosis using a bleomycin-induced model of lung injury. On the seventh day after bleomycin administration, S1P3 KO mice exhibited significantly less body weight loss and pulmonary inflammation than wild-type (WT) mice. On the 28th day, there was less pulmonary fibrosis in S1P3 KO mice than in WT mice. S1P3 KO mice demonstrated a 56% reduction in total cell count in bronchoalveolar lavage fluid (BALF) collected on the seventh day compared with WT mice; however, the differential white blood cell profiles were similar. BALF analysis on the seventh day showed that connective tissue growth factor (CTGF) levels were significantly decreased in S1P3 KO mice compared with WT mice, although no differences were observed in monocyte chemotactic protein-1 (MCP-1) or transforming growth factor β1 (TGF-β1) levels. Finally, S1P levels in BALF collected on the 7th day after treatment were not significantly different between WT and S1P3 KO mice. Our results indicate that S1P3 receptor signaling plays an important role in pulmonary inflammation and fibrosis and that this signaling occurs via CTGF expression. This suggests that this pathway might be a therapeutic target for pulmonary fibrosis.

  13. Attrition of Hepatic Damage Inflicted by Angiotensin II with α-Tocopherol and β-Carotene in Experimental Apolipoprotein E Knock-out Mice.

    PubMed

    Gopal, Kaliappan; Gowtham, Munusamy; Sachin, Singh; Ravishankar Ram, Mani; Shankar, Esaki M; Kamarul, Tunku

    2015-12-16

    Angiotensin II is one of the key regulatory peptides implicated in the pathogenesis of liver disease. The mechanisms underlying the salubrious role of α-tocopherol and β-carotene on liver pathology have not been comprehensively assessed. Here, we investigated the mechanisms underlying the role of Angiotensin II on hepatic damage and if α-tocopherol and β-carotene supplementation attenuates hepatic damage. Hepatic damage was induced in Apoe(-/-)mice by infusion of Angiotensin II followed by oral administration with α-tocopherol and β-carotene-enriched diet for 60 days. Investigations showed fibrosis, kupffer cell hyperplasia, hepatocyte degeneration and hepatic cell apoptosis; sinusoidal dilatation along with haemorrhages; evidence of fluid accumulation; increased ROS level and increased AST and ALT activities. In addition, tPA and uPA were down-regulated due to 42-fold up-regulation of PAI-1. MMP-2, MMP-9, MMP-12, and M-CSF were down-regulated in Angiotensin II-treated animals. Notably, α-tocopherol and β-carotene treatment controlled ROS, fibrosis, hepatocyte degeneration, kupffer cell hyperplasia, hepatocyte apoptosis, sinusoidal dilatation and fluid accumulation in the liver sinusoids, and liver enzyme levels. In addition, PAI-1, tPA and uPA expressions were markedly controlled by β-carotene treatment. Thus, Angiotensin II markedly influenced hepatic damage possibly by restraining fibrinolytic system. We concluded that α-tocopherol and β-carotene treatment has salubrious role in repairing hepatic pathology.

  14. Establishment of Immortalized Mouse Bmp2 Knock-Out Dental Papilla Mesenchymal Cells Necessary for Study of Odontoblastic Differentiation and Odontogenesis

    PubMed Central

    Wu, Lian; Wang, Feng; Donly, Kevin J.; Wan, Chunyan; Luo, Daoshu; Harris, Stephen E.; Macdougall, Mary; Chen, Shuo

    2016-01-01

    Bmp2 is essential for dentin formation. Bmp2 cKO mice exhibited similar phenotype to dentinogenesis imperfecta, showing dental pulp exposure, hypomineralized dentin, and delayed odontoblast differentiation. As it is relatively difficult to obtain lot of primary Bmp2 cKO dental papilla mesenchymal cells and to maintain a long-term culture of these primary cells, availability of immortalized deleted Bmp2 dental papilla mesenchymal cells is critical for studying the underlying mechanism of Bmp2 signal in odontogenesis. In this study, our goal was to generate an immortalized deleted Bmp2 dental papilla mesenchymal (iBmp2ko/ko dp) cell line by introducing Cre fluorescent protein (GFP) into the immortalized mouse floxed Bmp2 dental papilla mesenchymal (iBmp2fx/fx dp) cells. iBmp2ko/ko dp cells were confirmed by GFP and PCR. The deleted Bmp2 cells exhibited slow cell proliferation rate and cell growth was arrested in G2 phase. Expression of tooth-related marker genes and cell differentiation were decreased in the deleted cells. Importantly, extracellular matrix remodeling was impaired in the iBmp2ko/ko dp cells as reflected by the decreased Mmp-9 expression. In addition, with exogenous Bmp2 induction, these cell differentiation and mineralization were rescued as well as extracellular matrix remodeling was enhanced. Therefore, we for the first time described establishment of iBmpko/ko cells that are useful for study of mechanisms in regulating dental papilla mesenchymal cell lineages. PMID:26037045

  15. (R)-3-hydroxyacyl-ACP:CoA transacylase of Pseudomonas chlororaphis: gene cloning, characterization and knock-out on PHA and rhamnolipid syntheses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas chlororaphis is a useful microorganism capable of producing polyhydroxyalkanoate (PHA) biopolymer and rhamnolipid (RL) biosurfactants by using carbon- and nitrogen-sources derived from renewable feedstocks as substrates of fermentation. We are interested in increasing the yield of RL pr...

  16. Differential proteome-metabolome profiling of YCA1-knock-out and wild type cells reveals novel metabolic pathways and cellular processes dependent on the yeast metacaspase.

    PubMed

    Ždralević, Maša; Longo, Valentina; Guaragnella, Nicoletta; Giannattasio, Sergio; Timperio, Anna Maria; Zolla, Lello

    2015-06-01

    The yeast Saccharomyces cerevisiae expresses one member of the metacaspase Cys protease family, encoded by the YCA1 gene. Combination of proteomics and metabolomics data showed that YCA1 deletion down-regulated glycolysis, the TCA cycle and alcoholic fermentation as compared with WT cells. Δyca1 cells also showed a down-regulation of the pentose phosphate pathway and accumulation of pyruvate, correlated with higher levels of certain amino acids found in these cells. Accordingly, there is a decrease in protein biosynthesis, and up-regulation of specific stress response proteins like Ahp1p, which possibly provides these cells with a better protection against stress. Moreover, in agreement with the down-regulation of protein biosynthesis machinery in Δyca1 cells, we have found that regulation of transcription, co-translational protein folding and protein targeting to different subcellular locations were also down-regulated. Metabolomics analysis of the nucleotide content showed a significant reduction in Δyca1 cells in comparison with the WT, except for GTP content which remained unchanged. Thus, our combined proteome-metabolome approach added a new dimension to the non-apoptotic function of yeast metacaspase, which can specifically affect cell metabolism through as yet unknown mechanisms and possibly stress-response pathways, like HOG and cell wall integrity pathways. Certainly, YCA1 deletion may induce compensatory changes in stress response proteins offering a better protection against apoptosis to Δyca1 cells rather than a loss in pro-apoptotic YCA1-associated activity.

  17. Relationships among parvalbumin-immunoreactive neuron density, phase-locked gamma oscillations, and autistic/schizophrenic symptoms in PDGFR-β knock-out and control mice.

    PubMed

    Nakamura, Tomoya; Matsumoto, Jumpei; Takamura, Yusaku; Ishii, Yoko; Sasahara, Masakiyo; Ono, Taketoshi; Nishijo, Hisao

    2015-01-01

    Cognitive deficits and negative symptoms are important therapeutic targets for schizophrenia and autism disorders. Although reduction of phase-locked gamma oscillation has been suggested to be a result of reduced parvalbumin-immunoreactive (putatively, GABAergic) neurons, no direct correlations between these have been established in these disorders. In the present study, we investigated such relationships during pharmacological treatment with a newly synthesized drug, T-817MA, which displays neuroprotective and neurotrophic effects. In this study, we used platelet-derived growth factor receptor-β gene knockout (PDGFR-β KO) mice as an animal model of schizophrenia and autism. These mutant mice display a reduction in social behaviors; deficits in prepulse inhibition (PPI); reduced levels of parvalbumin-immunoreactive neurons in the medical prefrontal cortex, hippocampus, amygdala, and superior colliculus; and a deficit in of auditory phase-locked gamma oscillations. We found that oral administration of T-817MA ameliorated all these symptoms in the PDGFR-β KO mice. Furthermore, phase-locked gamma oscillations were significantly correlated with the density of parvalbumin-immunoreactive neurons, which was, in turn, correlated with PPI and behavioral parameters. These findings suggest that recovery of parvalbumin-immunoreactive neurons by pharmacological intervention relieved the reduction of phase-locked gamma oscillations and, consequently, ameliorated PPI and social behavioral deficits. Thus, our findings suggest that phase-locked gamma oscillations could be a useful physiological biomarker for abnormality of parvalbumin-immunoreactive neurons that may induce cognitive deficits and negative symptoms of schizophrenia and autism, as well as of effective pharmacological interventions in both humans and experimental animals.

  18. The alpha-fetoprotein knock-out mouse model suggests that parental behavior is sexually differentiated under the influence of prenatal estradiol.

    PubMed

    Keller, Matthieu; Pawluski, Jodi L; Brock, Olivier; Douhard, Quentin; Bakker, Julie

    2010-04-01

    In rodent species, sexual differentiation of the brain for many reproductive processes depends largely on estradiol. This was recently confirmed again by using the alpha-fetoprotein knockout (AFP-KO) mouse model, which lacks the protective actions of alpha-fetoprotein against maternal estradiol and as a result represents a good model to determine the contribution of prenatal estradiol to the sexual differentiation of the brain and behavior. Female AFP-KO mice were defeminized and masculinized with regard to their neuroendocrine responses as well as sexual behavior. Since parental behavior is also strongly sexually differentiated in mice, we used the AFP-KO mouse model here to ask whether parental responses are differentiated prenatally under the influence of estradiol. It was found that AFP-KO females showed longer latencies to retrieve pups to the nest and also exhibited lower levels of crouching over the pups in the nest in comparison to WT females. In fact, they resembled males (WT and AFP-KO). Other measures of maternal behavior, for example the incidence of infanticide, tended to be higher in AFP-KO females than in WT females but this increase failed to reach statistical significance. The deficits observed in parental behavior of AFP-KO females could not be explained by any changes in olfactory function, novelty recognition or anxiety. Thus our results suggest that prenatal estradiol defeminizes the parental brain in mice.

  19. Comparative hepatic effects of perfluorooctanoic acid and WY 14,643 in PPARa-knocked out and wild-type mice.

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is an environmentally persistent chemical commonly found in humans and wildlife. Induction of liver tumors by PFOA in rodents is thought to be mediated by PPARα activation, although hepatic hypertrophy persists in PPARα-null mice. This study evalua...

  20. Relationships among Parvalbumin-Immunoreactive Neuron Density, Phase-Locked Gamma Oscillations, and Autistic/Schizophrenic Symptoms in PDGFR-β Knock-Out and Control Mice

    PubMed Central

    Nakamura, Tomoya; Matsumoto, Jumpei; Takamura, Yusaku; Ishii, Yoko; Sasahara, Masakiyo; Ono, Taketoshi; Nishijo, Hisao

    2015-01-01

    Cognitive deficits and negative symptoms are important therapeutic targets for schizophrenia and autism disorders. Although reduction of phase-locked gamma oscillation has been suggested to be a result of reduced parvalbumin-immunoreactive (putatively, GABAergic) neurons, no direct correlations between these have been established in these disorders. In the present study, we investigated such relationships during pharmacological treatment with a newly synthesized drug, T-817MA, which displays neuroprotective and neurotrophic effects. In this study, we used platelet-derived growth factor receptor-β gene knockout (PDGFR-β KO) mice as an animal model of schizophrenia and autism. These mutant mice display a reduction in social behaviors; deficits in prepulse inhibition (PPI); reduced levels of parvalbumin-immunoreactive neurons in the medical prefrontal cortex, hippocampus, amygdala, and superior colliculus; and a deficit in of auditory phase-locked gamma oscillations. We found that oral administration of T-817MA ameliorated all these symptoms in the PDGFR-β KO mice. Furthermore, phase-locked gamma oscillations were significantly correlated with the density of parvalbumin-immunoreactive neurons, which was, in turn, correlated with PPI and behavioral parameters. These findings suggest that recovery of parvalbumin-immunoreactive neurons by pharmacological intervention relieved the reduction of phase-locked gamma oscillations and, consequently, ameliorated PPI and social behavioral deficits. Thus, our findings suggest that phase-locked gamma oscillations could be a useful physiological biomarker for abnormality of parvalbumin-immunoreactive neurons that may induce cognitive deficits and negative symptoms of schizophrenia and autism, as well as of effective pharmacological interventions in both humans and experimental animals. PMID:25803852

  1. Conditional Knock-out Reveals a Requirement for O-Linked N-Acetylglucosaminase (O-GlcNAcase) in Metabolic Homeostasis*

    PubMed Central

    Keembiyehetty, Chithra; Love, Dona C.; Harwood, Katryn R.; Gavrilova, Oksana; Comly, Marcella E.; Hanover, John A.

    2015-01-01

    O-GlcNAc cycling is maintained by the reciprocal activities of the O-GlcNAc transferase and the O-GlcNAcase (OGA) enzymes. O-GlcNAc transferase is responsible for O-GlcNAc addition to serine and threonine (Ser/Thr) residues and OGA for its removal. Although the Oga gene (MGEA5) is a documented human diabetes susceptibility locus, its role in maintaining insulin-glucose homeostasis is unclear. Here, we report a conditional disruption of the Oga gene in the mouse. The resulting homozygous Oga null (KO) animals lack OGA enzymatic activity and exhibit elevated levels of the O-GlcNAc modification. The Oga KO animals showed nearly complete perinatal lethality associated with low circulating glucose and low liver glycogen stores. Defective insulin-responsive GSK3β phosphorylation was observed in both heterozygous (HET) and KO Oga animals. Although Oga HET animals were viable, they exhibited alterations in both transcription and metabolism. Transcriptome analysis using mouse embryonic fibroblasts revealed deregulation in the transcripts of both HET and KO animals specifically in genes associated with metabolism and growth. Additionally, metabolic profiling showed increased fat accumulation in HET and KO animals compared with WT, which was increased by a high fat diet. Reduced insulin sensitivity, glucose tolerance, and hyperleptinemia were also observed in HET and KO female mice. Notably, the respiratory exchange ratio of the HET animals was higher than that observed in WT animals, indicating the preferential utilization of glucose as an energy source. These results suggest that the loss of mouse OGA leads to defects in metabolic homeostasis culminating in obesity and insulin resistance. PMID:25596529

  2. Unexpected Lack of Hypersensitivity in LRRK2 Knock-out Mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)

    PubMed Central

    Andres-Mateos, Eva; Mejias, Rebeca; Sasaki, Masayuki; Li, Xiaojie; Lin, Brian M; Biskup, Saskia; Zhang, Li; Banerjee, Rebecca; Thomas, Bobby; Yang, Lichuan; Liu, Guosheng; Beal, M Flint; Huso, David L; Dawson, Ted M; Dawson, Valina L

    2010-01-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common known cause of Parkinson's disease (PD). Whether loss of LRRK2 function accounts for neurodegeneration of dopamine neurons in PD is not known, nor is it known whether LRRK2 kinase activity modulates the susceptibility of dopamine (DA) neurons to the selective dopaminergic toxin, 1-methyl-4-phenyl-1,2,3,6 tetrahydropyridine (MPTP). To better understand the role of LRRK2 in DA neuronal survival and its role in the susceptibility of DA neurons to MPTP, we generated LRRK2 knockout (KO) mice lacking the kinase domain of LRRK2. Here we show that LRRK2 KO mice are viable and have no major abnormalities and live to adulthood. The dopaminergic system is normal in LRRK2 KO mice as assessed via HPLC for DA and its metabolites and via stereologic assessment of DA neuron number in young and aged mice. Importantly, there is no significant difference in the susceptibility of LRRK2 KO and wild type (WT) mice to MPTP. These results suggest that LRRK2 plays little if any role in the development and survival of DA neurons under physiologic conditions. Thus, PD due to LRRK2 mutations are likely not due to a loss of function. Moreover, LRRK2 is not required for the susceptibility of DA neurons to MPTP. PMID:20016100

  3. Drug Reactions

    MedlinePlus

    Most of the time, medicines make our lives better. They reduce aches and pains, fight infections, and control problems such as high blood pressure or diabetes. But medicines can also cause unwanted reactions. One problem is ...

  4. [Plasma antioxidant activity--a test for impaired biological functions of endoecology, exotrophy, and inflammation reactions].

    PubMed

    Titov, V N; Krylin, V V; Dmitriev, V A; Iashin, Ia I

    2010-07-01

    The authors discuss the diagnostic value of a test for total serum antioxidant activity determined by an electrochemistry method on a liquid chromatograph (without a column), by using an amperometric detector, as well as the composition of the endogenously synthesized hydrophilic and hydrophobic acceptors of reactive oxygen species (ROS). Uric acid is a major hydrophilic acceptor of ROS; monoenic oleic fatty acid acts as its major lipophilic acceptor. The constant determined by the authors for of 03 oleic acid oxidation during automatic titration in the organic medium is an order of magnitude higher than that for alpha-tocopherol, beta-carotene and linoleic fatty acid; its concentration is also an order of magnitude higher. In oxidative stress, the adrenal steroid hormone dehydroepiandrosterone initiates oleic acid synthesis via expression of palmitoyl elongase and steatoryl desaturase. In early steps of phylogenesis in primates, spontaneous mutation resulted in ascorbic acid synthesis gene knockout; phylogenetically, further other mutation knocked out the gene encoding the synthesis of uricase and the conversion of uric acid to alantoin. In primates, uric acid became not only a catabolite of purine bases in vivo, but also the major endogenous hydrophilic acceptor of ROS. This philogenetic order makes it clear why the epithelium in the proximal nephron tubule entirely reabsorbs uric acid (a catabolite?) from primary urine and then secretes it again to urine depending on the impairment of biological functions of endoecology (the intercellular medium being contaminated with biological rubbish), the activation of a biological inflammatory reaction, the cellular production of ROS, and the reduction in serum total antioxidant activity. With each biological reaction, there was an increase in the blood content of uric acid as a hydrophilic acceptor of ROS, by actively lowering its secretion into urine. Uric acid is a diagnostic test of inflammation, or rather compensatory

  5. Allergic Reactions

    MedlinePlus

    ... that is right for you. In many instances, allergy immunotherapy in the form of shots or tablets is an effective, cost-efficient long term treatment approach. While there is not yet ... Healthy Tips • Allergy symptoms are the result of a chain reaction ...

  6. In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways.

    PubMed

    Dey, Swati; North, Justin A; Sriram, Jaya; Evans, Bradley S; Tabita, F Robert

    2015-12-25

    All organisms possess fundamental metabolic pathways to ensure that needed carbon and sulfur compounds are provided to the cell in the proper chemical form and oxidation state. For most organisms capable of using CO2 as sole source of carbon, ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) catalyzes primary carbon dioxide assimilation. In addition, sulfur salvage pathways are necessary to ensure that key sulfur-containing compounds are both available and, where necessary, detoxified in the cell. Using knock-out mutations and metabolomics in the bacterium Rhodospirillum rubrum, we show here that Rubisco concurrently catalyzes key and essential reactions for seemingly unrelated but physiologically essential central carbon and sulfur salvage metabolic pathways of the cell. In this study, complementation and mutagenesis studies indicated that representatives of all known extant functional Rubisco forms found in nature are capable of simultaneously catalyzing reactions required for both CO2-dependent growth as well as growth using 5-methylthioadenosine as sole sulfur source under anaerobic photosynthetic conditions. Moreover, specific inactivation of the CO2 fixation reaction did not affect the ability of Rubisco to support anaerobic 5-methylthioadenosine metabolism, suggesting that the active site of Rubisco has evolved to ensure that this enzyme maintains both key functions. Thus, despite the coevolution of both functions, the active site of this protein may be differentially modified to affect only one of its key functions.

  7. In Vivo Studies in Rhodospirillum rubrum Indicate That Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) Catalyzes Two Obligatorily Required and Physiologically Significant Reactions for Distinct Carbon and Sulfur Metabolic Pathways*♦

    PubMed Central

    Dey, Swati; North, Justin A.; Sriram, Jaya; Evans, Bradley S.; Tabita, F. Robert

    2015-01-01

    All organisms possess fundamental metabolic pathways to ensure that needed carbon and sulfur compounds are provided to the cell in the proper chemical form and oxidation state. For most organisms capable of using CO2 as sole source of carbon, ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) catalyzes primary carbon dioxide assimilation. In addition, sulfur salvage pathways are necessary to ensure that key sulfur-containing compounds are both available and, where necessary, detoxified in the cell. Using knock-out mutations and metabolomics in the bacterium Rhodospirillum rubrum, we show here that Rubisco concurrently catalyzes key and essential reactions for seemingly unrelated but physiologically essential central carbon and sulfur salvage metabolic pathways of the cell. In this study, complementation and mutagenesis studies indicated that representatives of all known extant functional Rubisco forms found in nature are capable of simultaneously catalyzing reactions required for both CO2-dependent growth as well as growth using 5-methylthioadenosine as sole sulfur source under anaerobic photosynthetic conditions. Moreover, specific inactivation of the CO2 fixation reaction did not affect the ability of Rubisco to support anaerobic 5-methylthioadenosine metabolism, suggesting that the active site of Rubisco has evolved to ensure that this enzyme maintains both key functions. Thus, despite the coevolution of both functions, the active site of this protein may be differentially modified to affect only one of its key functions. PMID:26511314

  8. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the He4(e ,e'pN) Triple-Coincidence Reaction

    NASA Astrophysics Data System (ADS)

    Korover, I.; Muangma, N.; Hen, O.; Shneor, R.; Sulkosky, V.; Kelleher, A.; Gilad, S.; Higinbotham, D. W.; Piasetzky, E.; Watson, J. W.; Wood, S. A.; Aguilera, P.; Ahmed, Z.; Albataineh, H.; Allada, K.; Anderson, B.; Anez, D.; Aniol, K.; Annand, J.; Armstrong, W.; Arrington, J.; Averett, T.; Badman, T.; Baghdasaryan, H.; Bai, X.; Beck, A.; Beck, S.; Bellini, V.; Benmokhtar, F.; Bertozzi, W.; Bittner, J.; Boeglin, W.; Camsonne, A.; Chen, C.; Chen, J.-P.; Chirapatpimol, K.; Cisbani, E.; Dalton, M. M.; Daniel, A.; Day, D.; de Jager, C. W.; De Leo, R.; Deconinck, W.; Defurne, M.; Flay, D.; Fomin, N.; Friend, M.; Frullani, S.; Fuchey, E.; Garibaldi, F.; Gaskell, D.; Gilman, R.; Glamazdin, O.; Gu, C.; Gueye, P.; Hamilton, D.; Hanretty, C.; Hansen, J.-O.; Hashemi Shabestari, M.; Holmstrom, T.; Huang, M.; Iqbal, S.; Jin, G.; Kalantarians, N.; Kang, H.; Khandaker, M.; LeRose, J.; Leckey, J.; Lindgren, R.; Long, E.; Mammei, J.; Margaziotis, D. J.; Markowitz, P.; Marti Jimenez-Arguello, A.; Meekins, D.; Meziani, Z.; Michaels, R.; Mihovilovic, M.; Monaghan, P.; Munoz Camacho, C.; Norum, B.; Nuruzzaman, Pan, K.; Phillips, S.; Pomerantz, I.; Posik, M.; Punjabi, V.; Qian, X.; Qiang, Y.; Qiu, X.; Rakhman, A.; Reimer, P. E.; Riordan, S.; Ron, G.; Rondon-Aramayo, O.; Saha, A.; Schulte, E.; Selvy, L.; Shahinyan, A.; Sirca, S.; Sjoegren, J.; Slifer, K.; Solvignon, P.; Sparveris, N.; Subedi, R.; Tireman, W.; Wang, D.; Weinstein, L. B.; Wojtsekhowski, B.; Yan, W.; Yaron, I.; Ye, Z.; Zhan, X.; Zhang, J.; Zhang, Y.; Zhao, B.; Zhao, Z.; Zheng, X.; Zhu, P.; Zielinski, R.; Jefferson Lab Hall A Collaboration

    2014-07-01

    We studied simultaneously the He4(e ,e'p), He4(e ,e'pp), and He4(e ,e'pn) reactions at Q2=2(GeV/c)2 and xB>1, for an (e ,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A =2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum, in a region where the nucleon-nucleon (NN) force is expected to change from predominantly tensor to repulsive. The abundance of neutron-proton pairs is reduced as the nucleon momentum increases beyond ˜500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum. Our data are compared with calculations of two-nucleon momentum distributions in He4 and discussed in the context of probing the elusive repulsive component of the NN force.

  9. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the 4He(e,e`pN) Triple-Coincidence Reaction

    SciTech Connect

    Korover, Igor; Muangma, Navaphon; Hen, Or; Shneor, Ran; Sulkosky, Vincent; Kelleher, Aidan; Gilad, Shalev; Higinbotham, Douglas; Piasetzky, Eliazer; Wood, Stephen; Rakhman, Abdurahim; Aguilera, Paula; Ahmed, Zafar; Albataineh, Hisham; Allada, Kalyan; Anderson, Bryon; Anez, David; Aniol, Konrad; Annand, John; Armstrong, Whitney; Arrington, John; Averett, Todd; Badman, Toby; Baghdasaryan, Hovhannes; Bai, Xinzhan; Beck, Arie; Beck, Sharon; Bellini, Vincenzo; Benmokhtar, Fatiha; Bertozzi, William; Bittner, James; Boeglin, Werner; Camsonne, Alexandre; Chen, Chunhua; Chen, Jian -Ping; Chirapatpimol, Khem; Cisbani, Evaristo; Dalton, Mark; Daniel, Aji; Day, Donal; De, Cornelis; de Jager, C. W.; De, Raffaele; Leo, R. De; Deconinck, Wouter; Defurne, Maxime; Flay, David; Fomin, Nadia; Friend, Megan; Frullani, Salvatore; Fuchey, Eric; Garibaldi, Franco; Gaskell, David; Gilman, Ronald; Glamazdin, Oleksandr; Gu, Chao; Gueye, Paul; Hamilton, David; Hanretty, Charles; Hansen, Jens-Ole; Shabestari, Mitra Hashemi; Holmstrom, Timothy; Huang, Min; Iqbal, Sophia; Jin, Ge; Kalantarians, Narbe; Kang, Hoyoung; Khandaker, Mahbubul; LeRose, John; Leckey, John; Lindgren, Richard; Long, Elena; Mammei, Juliette; Margaziotis, Demetrius; Markowitz, Pete; Meekins, David; Meziani, Zein -Eddine; Michaels, Robert; Mihovilovic, Miha; Monaghan, Peter; Munoz, Carlos; Camacho, C. Munoz; Norum, Blaine; Nuruzzaman, nfn; Pan, Kai; Phillips, Sarah; Pomerantz, Ishay; Posik, Matthew; Punjabi, Vina; Qian, Xin; Qiang, Yi; Qiu, Xiyu; Reimer, Paul; Riordan, Seamus; Ron, Guy; Rondon-Aramayo, Oscar; Saha, Arunava; Schulte, Elaine; Selvy, Lawrence; Shahinyan, Albert; Sirca, Simon; Sjoegren, Johan; Slifer, Karl; Solvignon-Slifer, Patricia; Sparveris, Nikolaos; Subedi, Ramesh; Tireman, William; Wang, Diancheng; Weinstein, Lawrence; Wojtsekhowski, Bogdan; Yan, Wenbiao; Yaron, Israel; Ye, Zhihong; Zhan, X.; Zhang, J.; Zhang, Yawei; Zhao, Bo; Zhao, Zhiwen; Zheng, Xiaochao; Zhu, Pengjia; Zielinski, Ryan; Watson, John

    2014-07-01

    We studied simultaneously the 4He(e,e'p), 4He(e,e'pp), and 4He(e,e'pn) reactions at Q2=2 [GeV/c]2 and xB >1, for a (e,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum in a region where the nucleon-nucleon force is expected to change from predominantly tensor to repulsive. Neutron-proton pairs dominate the high-momentum tail of the nucleon momentum distributions, but their abundance is reduced as the nucleon momentum increases beyond ~500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum in the range we studied. Our data are compared with ab-initio calculations of two-nucleon momentum distributions in 4He.

  10. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the 4He(e,e`pN) Triple-Coincidence Reaction

    DOE PAGES

    Korover, Igor; Muangma, Navaphon; Hen, Or; ...

    2014-07-01

    We studied simultaneously the 4He(e,e'p), 4He(e,e'pp), and 4He(e,e'pn) reactions at Q2=2 [GeV/c]2 and xB >1, for a (e,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum in a region where the nucleon-nucleon force is expected to change from predominantly tensor to repulsive. Neutron-proton pairs dominate the high-momentum tail ofmore » the nucleon momentum distributions, but their abundance is reduced as the nucleon momentum increases beyond ~500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum in the range we studied. Our data are compared with ab-initio calculations of two-nucleon momentum distributions in 4He.« less

  11. Study of Quasielastic 1p-shell proton Knockout in the 16O (e,e'p) reaction at Q2=0.8 (GeV/c)2

    SciTech Connect

    Gao, Juncai

    1999-06-01

    Coincidence cross sections and the structure functions RL+TT, RT and RLT have been obtained for the quasielastic 16O( e, e'p) reaction with the proton knocked out from the 1p1/2 and 1p3/2 states in perpendicular kinematics. The nominal energy transfer ω was 439 MeV the nominal Q2 was 0.8 ( GeV/ c)2 and the kinetic energy of knocked- out proton was 427 MeV. The data was taken in Hall A Je erson Laboratory using two high resolution spectrometers to detect electrons and protons respectively. Nominal beam energies 845 MeV , 1645 MeV and 2445 MeV were employed. For each beam energy, the momentum and angle of electron arm were fixed, while the angle between the proton momentum and the momentum transfer {vector q} was varied to map out the missing momentum. RLT was separated out to ~350 MeV /c in missing momentum. RL+TT and RT were separated out to ~280 MeV/ c in missing momentum. RL and RT were separated at a missing momentum of 52.5 MeV/ c for the data taken with hadron arm along $\\vec{q}$. The measured cross sections and response functions agree with both relativistic and non relativistic DWIA calculations employing spectroscopic factors between 60-75% for 1 p1/2 and 1 p3/2 states. The left- right asymmetry does not support the non -relativistic DWIA calculation using the Weyl gauge. Also the left- right asymmetry measurement favors the relativistic calculation. This thesis describes the details of the experimental setup , the calibration of the spectrometers, the techniques used in the data analysis to derive the fi nal cross sec tions as well as the response functions and the comparison of the results with the theoretical calculations.

  12. Catalysis of Photochemical Reactions.

    ERIC Educational Resources Information Center

    Albini, A.

    1986-01-01

    Offers a classification system of catalytic effects in photochemical reactions, contrasting characteristic properties of photochemical and thermal reactions. Discusses catalysis and sensitization, examples of catalyzed reactions of excepted states, complexing ground state substrates, and catalysis of primary photoproducts. (JM)

  13. Anaphylaxis-Like Reactions

    MedlinePlus

    ... Home Conditions Anaphylaxis Anaphylaxis-Like Reactions Anaphylaxis-Like Reactions Make an Appointment Refer a Patient Ask a ... exposed to a foreign substance, some people suffer reactions identical to anaphylaxis, but no allergy (IgE antibody) ...

  14. Skin reactions to sunscreens.

    PubMed

    Nixon, R L; Frowen, K E; Lewis, A E

    1997-06-01

    Sunscreen reactions are said not to be uncommon. A population referred to a patch testing clinic was evaluated for reactions to sunscreen by questionnaire initially and then, if relevant, by patch testing to sunscreen products and their components. Irritant reactions were more common than allergic contact dermatitis. Allergic reactions to sunscreens were less common than to non-sunscreen chemicals present in sunscreen products.

  15. The Glyoxal Clock Reaction

    ERIC Educational Resources Information Center

    Ealy, Julie B.; Negron, Alexandra Rodriguez; Stephens, Jessica; Stauffer, Rebecca; Furrow, Stanley D.

    2007-01-01

    Research on the glyoxal clock reaction has led to adaptation of the clock reaction to a general chemistry experiment. This particular reaction is just one of many that used formaldehyde in the past. The kinetics of the glyoxal clock makes the reaction suitable as a general chemistry lab using a Calculator Based Laboratory (CBL) or a LabPro. The…

  16. Microscale Thermite Reactions.

    ERIC Educational Resources Information Center

    Arnaiz, Francisco J.; Aguado, Rafael; Arnaiz, Susana

    1998-01-01

    Describes the adaptation of thermite (aluminum with metal oxides) reactions from whole-class demonstrations to student-run micro-reactions. Lists detailed directions and possible variations of the experiment. (WRM)

  17. Microfluidic chemical reaction circuits

    SciTech Connect

    Lee, Chung-cheng; Sui, Guodong; Elizarov, Arkadij; Kolb, Hartmuth C; Huang, Jiang; Heath, James R; Phelps, Michael E; Quake, Stephen R; Tseng, Hsian-rong; Wyatt, Paul; Daridon, Antoine

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  18. Allergic reactions (image)

    MedlinePlus

    Allergic reaction is a sensitivity to a specific substance, called an allergen, that is contacted through the skin, inhaled into the lungs, swallowed or injected. The body's reaction to an allergen can be mild, such as ...

  19. Allergic reactions (image)

    MedlinePlus

    Allergic reaction can be provoked by skin contact with poison plants, chemicals and animal scratches, as well as by ... dust, nuts and shellfish, may also cause allergic reaction. Medications such as penicillin and other antibiotics are ...

  20. Global ischemia-induced increases in the gap junctional proteins connexin 32 (Cx32) and Cx36 in hippocampus and enhanced vulnerability of Cx32 knock-out mice.

    PubMed

    Oguro, K; Jover, T; Tanaka, H; Lin, Y; Kojima, T; Oguro, N; Grooms, S Y; Bennett, M V; Zukin, R S

    2001-10-01

    Gap junctions are conductive channels that connect the interiors of coupled cells. In the hippocampus, GABA-containing hippocampal interneurons are interconnected by gap junctions, which mediate electrical coupling and synchronous firing and thereby promote inhibitory transmission. The present study was undertaken to examine the hypothesis that the gap junctional proteins connexin 32 (Cx32; expressed by oligodendrocytes, interneurons, or both), Cx36 (expressed by interneurons), and Cx43 (expressed by astrocytes) play a role in defining cell-specific patterns of neuronal death in hippocampus after global ischemia in mice. Global ischemia did not significantly alter Cx32 and Cx36 mRNA expression and slightly increased Cx43 mRNA expression in the vulnerable CA1, as assessed by Northern blot analysis and in situ hybridization. Global ischemia induced a selective increase in Cx32 and Cx36 but not Cx43 protein abundance in CA1 before onset of neuronal death, as assessed by Western blot analysis. The increase in Cx32 and Cx36 expression was intense and specific to parvalbumin-positive inhibitory interneurons of CA1, as assessed by double immunofluorescence. Protein abundance was unchanged in CA3 and dentate gyrus. The finding of increase in connexin protein without increase in mRNA suggests regulation of Cx32 and Cx36 expression at the translational or post-translational level. Cx32(Y/-) null mice exhibited enhanced vulnerability to brief ischemic insults, consistent with a role for Cx32 gap junctions in neuronal survival. These findings suggest that Cx32 and Cx36 gap junctions may contribute to the survival and resistance of GABAergic interneurons, thereby defining cell-specific patterns of global ischemia-induced neuronal death.

  1. Deep phosphorus fertiliser placement and reduced irrigation methods for rice (Oryza sativa L.) combine to knock-out competition from its nemesis, barnyard grass (Echinochloa crus-galli (L.) P.Beauv)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Productivity of rice is increasingly being constrained by limitations in the quantity, quality, and cost of water and nutrients, and competition from weeds. This is a ‘commentary’ on the recent work of Weerarathne et al. (2015). They reported new discoveries from greenhouse experiments that showed...

  2. Determination of loperamide in mdr1a/1b knock-out mouse brain tissue using matrix-assisted laser desorption/ionization mass spectrometry and comparison with quantitative electrospray-triple quadrupole mass spectrometry analysis.

    PubMed

    Shin, Young G; Dong, Teresa; Chou, Bilin; Menghrajani, Kapil

    2011-11-01

    Recently matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) imaging has been used to analyze small molecule pharmaceutical compounds directly on tissue sections to determine spatial distribution within target tissue and organs. The data presented to date usually indicate relative amounts of drug within the tissue. The determination of absolute amounts is still done using tissue homogenization followed by traditional liquid chromatography-tandem mass spectrometry (LC-MS/MS). In this study, the quantitative determination of loperamide, an antidiarrheal agent and a P-glycoprotein substrate, in mdr1a/1b (-/-) mouse brain tissue sections using MALDI MS on a quadrupole time-of-flight mass spectrometry is described. 5 mg/mL α-cyano-4-hydroxycinnamic acid in 50% acetonitrile with 0.1% trifluoroacetic acid and 0.5 μM reserpine was used as the MALDI matrix. The calibration curve constructed by the peak intensities of standard samples from MALDI MS was linear from 0.025 to 0.5 μM with r² = 0.9989. The accuracy of calibration curve standards was 78.3-105.9% and the percent deviation was less than 25%. Comparison between direct MALDI tissue analysis and conventional tissue analysis using homogenization followed by electrospray LC-MS/MS was also explored.

  3. Dynamics of Sun5 Localization during Spermatogenesis in Wild Type and Dpy19l2 Knock-Out Mice Indicates That Sun5 Is Not Involved in Acrosome Attachment to the Nuclear Envelope

    PubMed Central

    Yassine, Sandra; Escoffier, Jessica; Nahed, Roland Abi; Pierre, Virginie; Karaouzene, Thomas; Ray, Pierre F.; Arnoult, Christophe

    2015-01-01

    The acrosome is an organelle that is central to sperm physiology and a defective acrosome biogenesis leads to globozoospermia, a severe male infertility. The identification of the actors involved in acrosome biogenesis is therefore particularly important to decipher the molecular pathogeny of globozoospermia. We recently showed that a defect in the DPY19L2 gene is present in more than 70% of globozoospermic men and demonstrated that Dpy19l2, located in the inner nuclear membrane, is the first protein involved in the attachment of the acrosome to the nuclear envelope (NE). SUN proteins serve to link the nuclear envelope to the cytoskeleton and are therefore good candidates to participate in acrosome-nucleus attachment, potentially by interacting with DPY19L2. In order to characterize new actors of acrosomal attachment, we focused on Sun5 (also called Spag4l), which is highly expressed in male germ cells, and investigated its localization during spermatogenesis. Using immunohistochemistry and Western blot experiments in mice, we showed that Sun5 transits through different cellular compartments during meiosis. In pachytene spermatocytes, it is located in a membranous compartment different to the reticulum. In round spermatids, it progresses to the Golgi and the NE before to be located to the tail/head junction in epididymal sperm. Interestingly, we demonstrate that Sun5 is not, as initially reported, facing the acrosome but is in fact excluded from this zone. Moreover, we show that in Dpy19l2 KO spermatids, upon the detachment of the acrosome, Sun5 relocalizes to the totality of the NE suggesting that the acrosome attachment excludes Sun5 from the NE facing the acrosome. Finally, Western-blot experiments demonstrate that Sun5 is glycosylated. Overall, our work, associated with other publications, strongly suggests that the attachment of the acrosome to the nucleus does not likely depend on the formation of SUN complexes. PMID:25775128

  4. Knock-out of metacaspase and/or cytochrome c results in the activation of a ROS-independent acetic acid-induced programmed cell death pathway in yeast.

    PubMed

    Guaragnella, Nicoletta; Passarella, Salvatore; Marra, Ersilia; Giannattasio, Sergio

    2010-08-20

    To gain further insight into yeast acetic acid-induced programmed cell death (AA-PCD) we analyzed the effects of the antioxidant N-acetyl-L-cysteine (NAC) on cell viability, hydrogen peroxide (H(2)O(2)) production, DNA fragmentation, cytochrome c (cyt c) release and caspase-like activation in wild type (wt) and metacaspase and/or cyt c-lacking cells. We found that NAC prevents AA-PCD in wt cells, by scavenging H(2)O(2) and by inhibiting both cyt c release and caspase-like activation. This shows the occurrence of a reactive oxygen species (ROS)-dependent AA-PCD. Contrarily no NAC dependent change in AA-PCD of mutant cells was detectable, showing that a ROS-independent AA-PCD can also occur.

  5. Upregulation of the Angiotensin-Converting Enzyme 2/Angiotensin-(1-7)/Mas Receptor Axis in the Heart and the Kidney of Growth Hormone Receptor knock-out Mice

    PubMed Central

    GIANI, Jorge F.; MIQUET, Johanna G.; MUÑOZ, Marina C.; BURGHI, Valeria; TOBLLI, Jorge E.; MASTERNAK, Michal M.; KOPCHIC, John J.; BARTKE, Andrzej; TURYN, Daniel; DOMINICI, Fernando P.

    2012-01-01

    Objective Growth hormone (GH) resistance leads to enhanced insulin sensitivity, decreased systolic blood pressure and increased lifespan. The aim of this study was to determine if there is a shift in the balance of the renin-angiotensin system (RAS) towards the ACE2/Ang-(1-7)/Mas receptor axis in the heart and the kidney of a model of GH resistance and retarded aging, the GH receptor knockout (GHR−/−) mouse. Design RAS components were evaluated in the heart and the kidney of GHR−/− and control mice by immunohistochemistry and western blotting (n=12 for both groups). Results The immunostaining of Ang-(1-7) was increased in both the heart and the kidney of GHR−/− mice. These changes were concomitant with an increased immunostaining of the Mas receptor and ACE2 in both tissues. The immunostaining of AT1 receptor was reduced in heart and kidney of GHR−/− mice while that of AT2 receptor was increased in the heart and unaltered in the kidney. Ang II, ACE and angiotensinogen levels remained unaltered in the heart and the kidney of GH resistant mice. These results were confirmed by Western Blotting and correlated with a significant increase in the abundance of the endothelial nitric oxide synthase in both tissues. Conclusions The shift within the RAS towards an exacerbation of the ACE2/Ang-(1-7)/Mas receptor axis observed in GHR−/− mice could be related to a protective role in cardiac and renal function; and thus, possibly contribute to the decreased incidence of cardiovascular diseases displayed by this animal model of longevity. PMID:22947377

  6. The delta 6 desaturase knock out mouse reveals that immunomodulatory effects of essential n-6 and n-3 polyunsaturated fatty acids are both independent of and dependent upon conversion.

    PubMed

    Monk, Jennifer M; Liddle, Danyelle M; Cohen, Daniel J A; Tsang, Denis H; Hillyer, Lyn M; Abdelmagid, Salma A; Nakamura, Manabu T; Power, Krista A; Ma, David W L; Robinson, Lindsay E

    2016-06-01

    Typically fatty acids (FA) exert differential immunomodulatory effects with n-3 [α-linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)] and n-6 [linoleic acid (LA) and arachidonic acid (AA)] exerting anti- and pro-inflammatory effects, respectively. This over-simplified interpretation is confounded by a failure to account for conversion of the parent FA (LA and ALA) to longer-chain bioactive products (AA and EPA/DHA, respectively), thereby precluding discernment of the immunomodulatory potential of specific FA. Therefore, we utilized the Δ6-desaturase model, wherein knockout mice (D6KO) lack the Fads2 gene encoding for the rate-limiting enzyme that initiates FA metabolism, thereby providing a model to determine specific FA immunomodulatory effects. Wild-type (WT) and D6KO mice were fed one of four isocaloric diets differing in FA source (9weeks): corn oil (LA-enriched), arachidonic acid single cell oil (AA-enriched), flaxseed oil (ALA-enriched) or menhaden fish oil (EPA/DHA-enriched). Splenic mononuclear cell cytokine production in response to lipopolysaccharide (LPS), T-cell receptor (TCR) and anti-CD40 stimulation was determined. Following LPS stimulation, AA was more bioactive compared to LA, by increasing inflammatory cytokine production of IL-6 (1.2-fold) and TNFα (1.3-fold). Further, LPS-stimulated IFNγ production in LA-fed D6KO mice was reduced 5-fold compared to LA-fed WT mice, indicating that conversion of LA to AA was necessary for cytokine production. Conversely, ALA exerted an independent immunomodulatory effect from EPA/DHA and all n-3 FA increased LPS-stimulated IL-10 production versus LA and AA. These data definitively identify specific immunomodulatory effects of individual FA and challenge the simplified view of the immunomodulatory effects of n-3 and n-6 FA.

  7. (. pi. sup +- ,. pi. sup +- prime N) reactions on sup 12 C and sup 208 Pb near the giant resonance region

    SciTech Connect

    Yoo, Sung Hoon.

    1990-05-01

    Angular distributions for the {sup 12}C({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime} p) and {sup 208}Pb({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime} p or n) reactions near the giant resonance region have been measured at T{sub {pi}} = 180 MeV, and found different between {pi}{sup +} and {pi}{sup {minus}} data. This observation is interpreted as evidence for different excitation mechanisms dominating the {pi}{sup {minus}}-nucleus and {pi}{sup +}-nucleus interactions in the giant resonance region of these targets. A comparison with the single-nucleon knock-out distorted-wave impulse approximation calculations shows, even though these calculations underestimate ({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime} N) data for both targets, the dominance of direct process for ({pi}{sup +}, {pi}{sup {plus}}{prime} p) or ({pi}{sup {minus}}, {pi}{sup {minus}}{prime} n) in contrast to ({pi}{sup {minus}}, {pi}{sup {minus}}{prime} p) or ({pi}{sup +}, {pi}{sup +}{prime} n). In the ({pi}{sup +}, {pi}{sup +}{prime} p) reaction proton-proton hole states are excited directly and appear to have a large probability for direct decay with escape width, whereas in ({pi}{sup {minus}}, {pi}{sup {minus}}{prime} p) the preferentially excited neutron-neutron hole doorway states couple to resonance states and decay with spreading width. This interpretation led us to suggest that the ratio of cross-sections for inelastic scattering to the giant resonance region should be written in terms of an incoherent sum of cross-sections to neutron and proton doorway states. In a heavy nucleus such as {sup 208}Pb, neutron and proton doorway states. In a heavy nucleus such as {sup 208}Pb, neutron and proton doorway states contribute incoherently because the different decay processes do not populate the same final states of the residual nucleus.

  8. Noncanonical reactions of flavoenzymes.

    PubMed

    Sobrado, Pablo

    2012-11-05

    Enzymes containing flavin cofactors are predominantly involved in redox reactions in numerous cellular processes where the protein environment modulates the chemical reactivity of the flavin to either transfer one or two electrons. Some flavoenzymes catalyze reactions with no net redox change. In these reactions, the protein environment modulates the reactivity of the flavin to perform novel chemistries. Recent mechanistic and structural data supporting novel flavin functionalities in reactions catalyzed by chorismate synthase, type II isopentenyl diphosphate isomerase, UDP-galactopyranose mutase, and alkyl-dihydroxyacetonephosphate synthase are presented in this review. In these enzymes, the flavin plays either a direct role in acid/base reactions or as a nucleophile or electrophile. In addition, the flavin cofactor is proposed to function as a "molecular scaffold" in the formation of UDP-galactofuranose and alkyl-dihydroxyacetonephosphate by forming a covalent adduct with reaction intermediates.

  9. Reaction spreading on graphs.

    PubMed

    Burioni, Raffaella; Chibbaro, Sergio; Vergni, Davide; Vulpiani, Angelo

    2012-11-01

    We study reaction-diffusion processes on graphs through an extension of the standard reaction-diffusion equation starting from first principles. We focus on reaction spreading, i.e., on the time evolution of the reaction product M(t). At variance with pure diffusive processes, characterized by the spectral dimension d{s}, the important quantity for reaction spreading is found to be the connectivity dimension d{l}. Numerical data, in agreement with analytical estimates based on the features of n independent random walkers on the graph, show that M(t)∼t{d{l}}. In the case of Erdös-Renyi random graphs, the reaction product is characterized by an exponential growth M(t)e{αt} with α proportional to ln(k), where (k) is the average degree of the graph.

  10. Photoneutron Reactions in Nucleosynthesis

    NASA Astrophysics Data System (ADS)

    Utsunomiya, Hiroaki

    Photoneutron reactions are discussed in the context of nucleosynthesis with emphasis on a unified understanding of (γ, n) and (n, γ) reactions for heavy nuclei through the γ-ray strength function and a revisit to explosive nucleosynthesis of 9Be through the reciprocity theorem. The role of photonuclear reactions in nucleosynthesis is supplemented by the photonuclear data project (IAEA-CRP F42032) and will be strengthened in the Extreme Light Infrastructure-Nuclear Physics (ELI-NP) in the future.

  11. Nuclear reaction studies

    SciTech Connect

    Alexander, J.M.; Lacey, R.A.

    1994-11-01

    Research focused on the statistical and dynamical properties of ``hot`` nuclei formed in symmetric heavy-ion reactions. Theses included ``flow`` measurements and the mechanism for multifragment disassembly. Model calculations are being performed for the reactions C+C, Ne+Al, Ar+Sc, Kr+Nb, and Xe+La. It is planned to study {sup 40}Ar reactions from 27 to 115 MeV/nucleon. 2 figs., 41 refs.

  12. Sleeve reaction chamber system

    DOEpatents

    Northrup, M. Allen; Beeman, Barton V.; Benett, William J.; Hadley, Dean R.; Landre, Phoebe; Lehew, Stacy L.; Krulevitch, Peter A.

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  13. Oscillating Reactions: Two Analogies

    ERIC Educational Resources Information Center

    Petruševski, Vladimir M.; Stojanovska, Marina I.; Šoptrajanov, Bojan T.

    2007-01-01

    Oscillating chemical reactions are truly spectacular phenomena, and demonstrations are always appreciated by the class. However, explaining such reactions to high school or first-year university students is problematic, because it may seem that no acceptable explanation is possible unless the students have profound knowledge of both physical…

  14. Degradations and Rearrangement Reactions

    NASA Astrophysics Data System (ADS)

    Zhang, Jianbo

    This section deals with recent reports concerning degradation and rearrangement reactions of free sugars as well as some glycosides. The transformations are classified in chemical and enzymatic ways. In addition, the Maillard reaction will be discussed as an example of degradation and rearrangement transformation and its application in current research in the fields of chemistry and biology.

  15. Photoinduced Multicomponent Reactions.

    PubMed

    Garbarino, Silvia; Ravelli, Davide; Protti, Stefano; Basso, Andrea

    2016-12-12

    The combination of multicomponent approaches with light-driven processes opens up new scenarios in the area of synthetic organic chemistry, where the need for sustainable, atom- and energy-efficient reactions is increasingly urgent. Photoinduced multicomponent reactions are still in their infancy, but significant developments in this area are expected in the near future.

  16. Lithium Cell Reactions.

    DTIC Science & Technology

    1983-12-01

    SUPPLEMENTARY NOTES It. KEY WORDS (Continue on reverse .,ide if necessary and Identify by block number) Batteries Thionyl Chloride Batteries Lithium ...Batteries Lithium Cells Primary Batteries Thionyl Chloride Cells Non Rechargeable Batteries Electrochemical Reactions 20. ABSTRACT (Continue on reverse...INVESTIGATION OF CHEMICAL, ELECTROCHEMICAL AND PARASITIC REACTIONS IN LITHIUM - THIONYL CHLORIDE CELLS .......................................... 1 1.0 IN TRO D UC

  17. Clock Reaction: Outreach Attraction

    ERIC Educational Resources Information Center

    Carpenter, Yuen-ying; Phillips, Heather A.; Jakubinek, Michael B.

    2010-01-01

    Chemistry students are often introduced to the concept of reaction rates through demonstrations or laboratory activities involving the well-known iodine clock reaction. For example, a laboratory experiment involving thiosulfate as an iodine scavenger is part of the first-year general chemistry laboratory curriculum at Dalhousie University. With…

  18. Hydrogen evolution reaction catalyst

    DOEpatents

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  19. REUSABLE REACTION VESSEL

    DOEpatents

    Soine, T.S.

    1963-02-26

    This patent shows a reusable reaction vessel for such high temperature reactions as the reduction of actinide metal chlorides by calcium metal. The vessel consists of an outer metal shell, an inner container of refractory material such as sintered magnesia, and between these, a bed of loose refractory material impregnated with thermally conductive inorganic salts. (AEC)

  20. Reactions to Attitudinal Deviancy.

    ERIC Educational Resources Information Center

    Levine, John M.; Allen, Vernon L.

    This paper presents a critical review of empirical and theoretical treatments of group reaction to attitudinal deviancy. Inspired by Festinger's (1950) ideas on resolution of attitudinal discrepancies in groups, Schachter (1951) conducted an experiment that has greatly influenced subsequent research and theory concerning reaction to attitudinal…

  1. Applications of Reaction Rate

    ERIC Educational Resources Information Center

    Cunningham, Kevin

    2007-01-01

    This article presents an assignment in which students are to research and report on a chemical reaction whose increased or decreased rate is of practical importance. Specifically, students are asked to represent the reaction they have chosen with an acceptable chemical equation, identify a factor that influences its rate and explain how and why it…

  2. Chemical Reaction Problem Solving.

    ERIC Educational Resources Information Center

    Veal, William

    1999-01-01

    Discusses the role of chemical-equation problem solving in helping students predict reaction products. Methods for helping students learn this process must be taught to students and future teachers by using pedagogical skills within the content of chemistry. Emphasizes that solving chemical reactions should involve creative cognition where…

  3. Reactions and their management.

    PubMed

    Ganapati, R; Pai, V V

    2004-12-01

    The uneventful response to chemotherapy in leprosy is marked by clinically disturbing episodes encountered in 20-30% of patients and these phenomena are called "reactions". Generally they are classified as reversal reaction (type-1) and erythema nodosum leprosum (type-2). The cutaneous menifestations are: (1) Type-2 reactions in LL, BL types constituting erythema nodosum leprosum, erythema multiforme, erythema necroticans, subcutaneous nodules, lepromatous exacerbation. (2) Type-1 reactions in borderline and tuberculoid leprosy. The other manifestations include: Acute neuritis, lymphadenitis, arthritis, oedema of the hands and feet, ocular lesions, etc. Sequelae of reactions are: Paralytic deformities, non-paralytic deformities, extensive scarring and renal damage. A simple guideline to identify the risk-prone cases has been narrated. Prednisolone in standard dosage schedule as recommended by WHO is now being widely used in control programmes.

  4. Enhancing chemical reactions

    DOEpatents

    Morrey, John R.

    1978-01-01

    Methods of enhancing selected chemical reactions. The population of a selected high vibrational energy state of a reactant molecule is increased substantially above its population at thermal equilibrium by directing onto the molecule a beam of radiant energy from a laser having a combination of frequency and intensity selected to pump the selected energy state, and the reaction is carried out with the temperature, pressure, and concentrations of reactants maintained at a combination of values selected to optimize the reaction in preference to thermal degradation by transforming the absorbed energy into translational motion. The reaction temperature is selected to optimize the reaction. Typically a laser and a frequency doubler emit radiant energy at frequencies of .nu. and 2.nu. into an optical dye within an optical cavity capable of being tuned to a wanted frequency .delta. or a parametric oscillator comprising a non-centrosymmetric crystal having two indices of refraction, to emit radiant energy at the frequencies of .nu., 2.nu., and .delta. (and, with a parametric oscillator, also at 2.nu.-.delta.). Each unwanted frequency is filtered out, and each desired frequency is focused to the desired radiation flux within a reaction chamber and is reflected repeatedly through the chamber while reactants are fed into the chamber and reaction products are removed therefrom.

  5. Algorithm for reaction classification.

    PubMed

    Kraut, Hans; Eiblmaier, Josef; Grethe, Guenter; Löw, Peter; Matuszczyk, Heinz; Saller, Heinz

    2013-11-25

    Reaction classification has important applications, and many approaches to classification have been applied. Our own algorithm tests all maximum common substructures (MCS) between all reactant and product molecules in order to find an atom mapping containing the minimum chemical distance (MCD). Recent publications have concluded that new MCS algorithms need to be compared with existing methods in a reproducible environment, preferably on a generalized test set, yet the number of test sets available is small, and they are not truly representative of the range of reactions that occur in real reaction databases. We have designed a challenging test set of reactions and are making it publicly available and usable with InfoChem's software or other classification algorithms. We supply a representative set of example reactions, grouped into different levels of difficulty, from a large number of reaction databases that chemists actually encounter in practice, in order to demonstrate the basic requirements for a mapping algorithm to detect the reaction centers in a consistent way. We invite the scientific community to contribute to the future extension and improvement of this data set, to achieve the goal of a common standard.

  6. Modeling of surface reactions

    SciTech Connect

    Ray, T.R.

    1993-01-01

    Mathematical models are used to elucidate properties of the monomer-monomer and monomer-dimer type chemical reactions on a two-dimensional surface. The authors use mean-field and lattice gas models, detailing similarities and differences due to correlations in the lattice gas model. The monomer-monomer, or AB surface reaction model, with no diffusion, is investigated for various reaction rates k. Study of the exact rate equations reveals that poisoning always occurs if the adsorption rates of the reactants are unequal. If the adsorption rates of the reactants are equal, simulations show slow poisoning, associated with clustering of reactants. This behavior is also shown for the two-dimensional voter model. The authors analyze precisely the slow poisoning kinetics by an analytic treatment for the AB reaction with infinitesimal reaction rate, and by direct comparison with the voter model. They extend the results to incorporate the effects of place-exchange diffusion, and they compare the AB reaction with infinitesimal reaction rate and no diffusion to the voter model with diffusion at rate 1/2. They also consider the relationship of the voter model to the monomer-dimer model, and investigate the latter model for small reaction rates. The monomer-dimer, or AB[sub 2] surface reaction model is also investigated. Specifically, they consider the ZGB-model for CO-oxidation, and in generalizations of this model which include adspecies diffusion. A theory of nucleation to describe properties of non-equilibrium first-order transitions, specifically the evolution between [open quote]reactive[close quote] steady states and trivial adsorbing states, is derived. The behavior of the [open quote]epidemic[close quote] survival probability, P[sub s], for a non-poisoned patch surrounded by a poisoned background is determined below the poisoning transition.

  7. Cycloaddition reactions of ICNO

    NASA Astrophysics Data System (ADS)

    Pasinszki, Tibor; Krebsz, Melinda; Hajgató, Balázs

    2009-05-01

    The mechanism and selectivity of cycloaddition reactions of iodonitrile oxide, ICNO, have been studied with theoretical methods for the first time using MR-AQCC coupled-cluster and B3LYP DFT methods. Calculations have predicted that the favoured ICNO dimerisation process is a multi-step reaction to diiodofuroxan involving dinitrosoethylene-like intermediates. The ICNO cycloaddition with nitriles and ethynyl derivatives is a synchronous process favouring the formation of 1,2,4-oxadiazole and 1,2-oxazole derivatives, respectively. The cycloaddition reactions of ICNO have been studied experimentally by generating ICNO from AgCNO and iodine. Diiodofuroxan is obtained, however, even at the presence of nitriles.

  8. NEUTRONIC REACTION SYSTEM

    DOEpatents

    Wigner, E.P.

    1963-09-01

    A nuclear reactor system is described for breeding fissionable material, including a heat-exchange tank, a high- and a low-pressure chamber therein, heat- exchange tubes connecting these chambers, a solution of U/sup 233/ in heavy water in a reaction container within the tank, a slurry of thorium dioxide in heavy water in a second container surrounding the first container, an inlet conduit including a pump connecting the low pressure chamber to the reaction container, an outlet conduit connecting the high pressure chamber to the reaction container, and means of removing gaseous fission products released in both chambers. (AEC)

  9. Bad Reaction to Cosmetics?

    MedlinePlus

    ... Devices Radiation-Emitting Products Vaccines, Blood & Biologics Animal & Veterinary Cosmetics Tobacco Products For Consumers Home For Consumers ... Reactions From Cosmetics More in Consumer Updates Animal & Veterinary Children's Health Cosmetics Dietary Supplements Drugs Food Medical ...

  10. Reactor for exothermic reactions

    DOEpatents

    Smith, Jr., Lawrence A.; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  11. Untoward penicillin reactions

    PubMed Central

    Guthe, T.; Idsöe, O.; Willcox, R. R.

    1958-01-01

    The literature on untoward reactions following the administration of penicillin is reviewed. These reactions, including a certain number of deaths which have been reported, are of particular interest to health administrations and to WHO in view of the large-scale programmes for controlling the treponematoses which are now under way—programmes affecting millions of people in many parts of the world. The most serious problems are anaphylactic sensitivity phenomena and superinfection or cross-infection with penicillin-resistant organisms, and the reactions involved range in intensity from the mildest to the fatal; the incidence of the latter is estimated at 0.1-0.3 per million injections. The authors point out that with increasing use of penicillin, more persons are likely to become sensitized and the number of reactions can therefore be expected to rise. The best prevention against such an increase is the restriction of the unnecessary use of penicillin. PMID:13596877

  12. Translated chemical reaction networks.

    PubMed

    Johnston, Matthew D

    2014-05-01

    Many biochemical and industrial applications involve complicated networks of simultaneously occurring chemical reactions. Under the assumption of mass action kinetics, the dynamics of these chemical reaction networks are governed by systems of polynomial ordinary differential equations. The steady states of these mass action systems have been analyzed via a variety of techniques, including stoichiometric network analysis, deficiency theory, and algebraic techniques (e.g., Gröbner bases). In this paper, we present a novel method for characterizing the steady states of mass action systems. Our method explicitly links a network's capacity to permit a particular class of steady states, called toric steady states, to topological properties of a generalized network called a translated chemical reaction network. These networks share their reaction vectors with their source network but are permitted to have different complex stoichiometries and different network topologies. We apply the results to examples drawn from the biochemical literature.

  13. Common Reactions After Trauma

    MedlinePlus

    ... Loss of intimacy or feeling detached Recovery from stress reactions Turn to your family and friends when ... someone is thinking about killing themselves, call the Suicide Prevention Lifeline 1-800-273-TALK (8255) http:// ...

  14. Reaction wheel assembly

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The fabrication and testing of three reaction wheels with associated drive and system monitoring electronics and brushless dc spin motors are discussed; the wheels are intended for use in a teleoperator simulator. Test results are included as graphs.

  15. Reactor for exothermic reactions

    DOEpatents

    Smith, L.A. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-03-02

    A liquid phase process is described for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  16. Oral Hypersensitivity Reactions

    MedlinePlus

    ... often flavored with agents like cinnamon, peppermint or menthol, which can trigger hypersensitivity reactions in susceptible individuals. ... potential allergens such as cinnamon, peppermint, eugenol and menthol. Even dental floss and denture cleansers may contain ...

  17. Iodine Clock Reaction.

    ERIC Educational Resources Information Center

    Mitchell, Richard S.

    1996-01-01

    Describes a combination of solutions that can be used in the study of kinetics using the iodine clock reaction. The combination slows down degradation of the prepared solutions and can be used successfully for several weeks. (JRH)

  18. Response reactions: equilibrium coupling.

    PubMed

    Hoffmann, Eufrozina A; Nagypal, Istvan

    2006-06-01

    It is pointed out and illustrated in the present paper that if a homogeneous multiple equilibrium system containing k components and q species is composed of the reactants actually taken and their reactions contain only k + 1 species, then we have a unique representation with (q - k) stoichiometrically independent reactions (SIRs). We define these as coupling reactions. All the other possible combinations with k + 1 species are the coupled reactions that are in equilibrium when the (q - k) SIRs are in equilibrium. The response of the equilibrium state for perturbation is determined by the coupling and coupled equilibria. Depending on the circumstances and the actual thermodynamic data, the effect of coupled equilibria may overtake the effect of the coupling ones, leading to phenomena that are in apparent contradiction with Le Chatelier's principle.

  19. Skin Reactions to Cold

    PubMed Central

    Talpash, Orest

    1976-01-01

    Although skin reactions to cold are seen surprisingly infrequently in Canada, it is important to manage them correctly when they do occur. Frostbite, cold urticarias, Raynaud's disease and phenomenon, and several miscellaneous changes are discussed. PMID:21308019

  20. Chemisorption And Precipitation Reactions

    EPA Science Inventory

    The transport and bioavailability of chemical components within soils is, in part, controlled by partitioning between solids and solution. General terms used to describe these partitioning reactions include chemisorption and precipitation. Chemisorption is inclusive of the suit...

  1. An Illuminating Reaction.

    ERIC Educational Resources Information Center

    Matthews, Catherine E.

    1996-01-01

    Describes the use of carbide lights as an excellent mechanism for introducing or reviewing many basic chemistry concepts including elements and compounds, endothermic and exothermic reactions, physical and chemical changes, and balancing chemical equations. (JRH)

  2. [Occurrence of drug reactions].

    PubMed

    Pastorello, E; Qualizza, R M; Luraghi, M T; Ispano, M; Villa, A M; Ortolani, C; Zanussi, C

    1986-01-01

    The aim of this prospective study was to evaluate the incidence of allergic reactions to drugs compared to other kinds of medical emergencies admitted to the main Hospital in Milan during a 6 months period. At the same time we drew a list of drugs most frequently involved in allergic reactions, and a list of the most frequent symptoms. Using special forms, the medical staff collected patients' data: age, history of atopy, identification of the drug causing the reaction, and any previous reactions. Among 11,407 cases of medical emergencies, we found 163 (1.43%) patients showing drug reactions: the mean age was 27.3; 58.90% were female; atopy was present in 16.56%. The drugs most frequently involved were: pyrazon group (22%); ASA (20.86%); penicillin and derivatives (9.20%); sulfa drugs (6.14%); group B vitamins (4.30%); tetanus toxoid (4.30%); hyposensitizing extracts (3.68%); propionic acid derivatives (2.46%); paracetamol (1.84%); indomethacin (1.23%); rifampicin (1.23%); erythromycin (1.23%); glafenine (1.23%); others (17.80%). Urticaria and/or angioedema were the most frequent symptoms (86.51%), then anaphylactic shock (9.81%) and asthma (3.68%) with regard to anaphylactic shock only 6.20% of the patients had had a previous reaction to the same drug. From these data we can see that the incidence of drug reactions is very low compared to other medical emergencies; penicillin evidenced fewer reactions than expected, while the pyrazon group and ASA confirmed the data from literature.

  3. Anaphylactoid reaction to ethanol.

    PubMed

    Kelso, J M; Keating, M U; Squillace, D L; O'Connell, E J; Yunginger, J W; Sachs, M I

    1990-05-01

    We studied a 14-year-old boy who developed a pruritic rash and facial swelling after ingestion of beer or wine. A blinded challenge with purified ethanol was positive demonstrating ethanol itself to be the offending agent. An IgE-mediated reaction to ethanol or one of its metabolites as a hapten is possible, or the reaction may involve unusual metabolism of ethanol with accumulation of acetaldehyde and/or direct mast cell degranulation.

  4. Oxygen evolution reaction catalysis

    DOEpatents

    Haber, Joel A.; Jin, Jian; Xiang, Chengxiang; Gregoire, John M.; Jones, Ryan J.; Guevarra, Dan W.; Shinde, Aniketa A.

    2016-09-06

    An Oxygen Evolution Reaction (OER) catalyst includes a metal oxide that includes oxygen, cerium, and one or more second metals. In some instances, the cerium is 10 to 80 molar % of the metals in the metal oxide and/or the catalyst includes two or more second metals. The OER catalyst can be included in or on an electrode. The electrode can be arranged in an oxygen evolution system such that the Oxygen Evolution Reaction occurs at the electrode.

  5. [Cutaneous adverse drug reactions].

    PubMed

    Lebrun-Vignes, B; Valeyrie-Allanore, L

    2015-04-01

    Cutaneous adverse drug reactions (CADR) represent a heterogeneous field including various clinical patterns without specific features suggesting drug causality. Exanthematous eruptions, urticaria and vasculitis are the most common forms of CADR. Fixed eruption is uncommon in western countries. Serious reactions (fatal outcome, sequelae) represent 2% of CADR: bullous reactions (Stevens-Johnson syndrome, toxic epidermal necrolysis), DRESS (drug reaction with eosinophilia and systemic symptoms or drug-induced hypersensitivity syndrome) and acute generalized exanthematous pustulosis (AGEP). These forms must be quickly diagnosed to guide their management. The main risk factors are immunosuppression, autoimmunity and some HLA alleles in bullous reactions and DRESS. Most systemic drugs may induce cutaneous adverse reactions, especially antibiotics, anticonvulsivants, antineoplastic drugs, non-steroidal anti-inflammatory drugs, allopurinol and contrast media. Pathogenesis includes immediate or delayed immunologic mechanism, usually not related to dose, and pharmacologic/toxic mechanism, commonly dose-dependent or time-dependent. In case of immunologic mechanism, allergologic exploration is possible to clarify drug causality, with a variable sensitivity according to the drug and to the CADR type. It includes epicutaneous patch testing, prick test and intradermal test. However, no in vivo or in vitro test can confirm the drug causality. To determine the cause of the eruption, a logical approach based on clinical characteristics, chronologic factors and elimination of differential diagnosis is required, completed with a literature search. A reporting to pharmacovigilance network is essential in case of a serious CADR whatever the suspected drug and in any case if the involved drug is a newly marketed one or unusually related to cutaneous reactions.

  6. Reaction/Momentum Wheel

    NASA Technical Reports Server (NTRS)

    1997-01-01

    CTA Space Systems, Inc. has been licensed to sell commercially a reaction/momentum wheel originally developed for NASA's scientific satellites. NASA originally identified a need for the wheel in its Small Explorer program. The Submillimeter Wave Astronomy Satellite required extremely low jitter and a reaction/momentum wheel with a torque greater than any comparably sized commercially available wheel to keep the instrument pointed at celestial objects to a high degree of precision. After development, a market assessment by Research Triangle Institute was completed, showing commercial potential for the flywheel technology. A license was granted to CTA in the fall of 1996. The company currently uses the technology in its complete spacecraft fabrication services and has built over 10 reaction/momentum wheels for commercial, scientific, and military customers.

  7. Velocity pump reaction turbine

    DOEpatents

    House, Palmer A.

    1984-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  8. Velocity pump reaction turbine

    DOEpatents

    House, Palmer A.

    1982-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  9. Velocity pump reaction turbine

    SciTech Connect

    House, P.A.

    1984-02-07

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  10. Velocity pump reaction turbine

    SciTech Connect

    House, P.A.

    1982-06-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an interrotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal application

  11. Velocity pump reaction turbine

    DOEpatents

    House, P.A.

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  12. Reaction product imaging

    SciTech Connect

    Chandler, D.W.

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  13. Introducing the Wittig Reaction.

    ERIC Educational Resources Information Center

    Armstead, D. E. F.

    1979-01-01

    An experiment is described which provides a simple example of the application of the Wittig reaction to the synthesis of unsaturated compounds. The experiment was designed with British HNC chemistry students in mind, but it is also suitable as a project-type exercise for final year GCE A-level students. (Author/BB)

  14. Enantioselective Vinylogous Organocascade Reactions.

    PubMed

    Hepburn, Hamish B; Dell'Amico, Luca; Melchiorre, Paolo

    2016-08-01

    Cascade reactions are powerful tools for rapidly assembling complex molecular architectures from readily available starting materials in a single synthetic operation. Their marriage with asymmetric organocatalysis has led to the development of novel techniques, which are now recognized as reliable strategies for the one-pot enantioselective synthesis of stereochemically dense molecules. In recent years, even more complex synthetic challenges have been addressed by applying the principle of vinylogy to the realm of organocascade catalysis. The key to the success of vinylogous organocascade reactions is the unique ability of the chiral organocatalyst to transfer reactivity to a distal position without losing control on the stereo-determining events. This approach has greatly expanded the synthetic horizons of the field by providing the possibility of forging multiple stereocenters in remote positions from the catalyst's point of action with high selectivity, while simultaneously constructing multiple new bonds. This article critically describes the developments achieved in the field of enantioselective vinylogous organocascade reactions, charting the ideas, the conceptual advances, and the milestone reactions that have been essential for reaching highly practical levels of synthetic efficiency.

  15. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  16. Chemical Reactions at Surfaces

    SciTech Connect

    Michael Henderson and Nancy Ryan Gray

    2010-04-14

    Chemical reactions at surfaces underlie some of the most important processes of today, including catalysis, energy conversion, microelectronics, human health and the environment. Understanding surface chemical reactions at a fundamental level is at the core of the field of surface science. The Gordon Research Conference on Chemical Reactions at Surfaces is one of the premiere meetings in the field. The program this year will cover a broad range of topics, including heterogeneous catalysis and surface chemistry, surfaces in environmental chemistry and energy conversion, reactions at the liquid-solid and liquid-gas interface, electronic materials growth and surface modification, biological interfaces, and electrons and photons at surfaces. An exciting program is planned, with contributions from outstanding speakers and discussion leaders from the international scientific community. The conference provides a dynamic environment with ample time for discussion and interaction. Attendees are encouraged to present posters; the poster sessions are historically well attended and stimulate additional discussions. The conference provides an excellent opportunity for junior researchers (e.g. graduate students or postdocs) to present their work and interact with established leaders in the field.

  17. Reaction Formulation: A Bibliography.

    ERIC Educational Resources Information Center

    Pedrini, D. T.; Pedrini, Bonnie C.

    Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

  18. Lithium Cell Reactions.

    DTIC Science & Technology

    1985-02-01

    Page 1. INVESTIGATION OF CHEMICAL, ELECTROCHEMICAL AND PARASITIC REACTIONS IN LITHIUM - THIONYL CHLORIDE CELLS ....... ................. 1 1.1 INTRODUCTION...OF LITHIUM - THIONYL CHLORIDE CELLS. ................ 56 1.4.1 Carbon Limited Overdischarge...............56 1.4.1.1 Background... LITHIUM THIONYL - CHLORIDE CELLS. .. ............ ...... 101 1.5.1 Background. ....... ............ .... 101 1.5.2 Microphotography

  19. Confronting Combat Stress Reactions

    DTIC Science & Technology

    2010-03-22

    of the scalp, skull , or brain. 4 Combat stress reaction is categorized as a range of behaviors resulting from the stress of battle which decreases...3) experiencing rage aimed at discriminate and indiscriminate targets, (4) psychic numbing or emotional shutdown, (5) alienation from themselves and

  20. A Superintendent's Reaction

    ERIC Educational Resources Information Center

    Lytle, James H.

    2004-01-01

    This article presents a superintendent's reaction to Catherine Marshall and Michael Ward's article on research on social justice and training for leadership. The author states that there is a problem with Marshall and Ward's article which begins with the title, particularly with the word "training." The author contends that there is a significant…

  1. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  2. Exocharmic Reactions up Close

    ERIC Educational Resources Information Center

    Ramette, R. W.

    2007-01-01

    The exocharmic reactions that can be observed microscopically are discussed. The students can discover the optimal concentration of an acidic lead nitrate solution, so that a crystal of potassium iodide, nudged to the edge of a drop, results in glinting golden hexagons of lead iodide.

  3. Three Reaction Papers.

    ERIC Educational Resources Information Center

    Coop, Richard H.; And Others

    1982-01-01

    In reaction papers, Richard H. Coop, an educational psychologist, discusses six themes evident in papers on gifted education; B. J. Cox argues that systems theory is a valuable addition to education of identified and potentially gifted students; and Gary D. Fenstermacher argues for specification of educational entitlements of any learner before…

  4. The aromatic ene reaction

    PubMed Central

    Niu, Dawen; Hoye, Thomas R.

    2014-01-01

    The ene reaction is a pericyclic process in which an alkene having an allylic hydrogen atom (the ene donor) reacts with a second unsaturated species (the enophile) to form a new product with a transposed π-bond. The aromatic ene reaction, in which the alkene component is embedded in an aromatic ring, has only been reported in a few (four) instances and has proceeded in low yield (≤6%). Here we show efficient aromatic ene reactions in which a thermally generated aryne engages a pendant m-alkylarene substituent to produce a dearomatized isotoluene, itself another versatile but rare reactive intermediate. Our experiments were guided by computational studies that revealed structural features conducive to the aromatic ene process. We proceeded to identify a cascade comprising three reactions: (i) hexadehydro-Diels-Alder (for aryne generation), (ii) intramolecular aromatic ene, and (iii) bimolecular Alder ene. The power of this cascade is evident from the structural complexity of the final products, the considerable scope, and the overall efficiency of these multi-stage, reagent- and byproduct-free, single-pot transformations. PMID:24345944

  5. Inorganic Reaction Mechanisms. Part I

    ERIC Educational Resources Information Center

    Cooke, D. O.

    1976-01-01

    Provides a collection of data on the mechanistic aspects of inorganic chemical reactions. Wherever possible includes procedures for classroom demonstration or student project work. The material covered includes gas phase reactions, reactions in solution, mechanisms of electron transfer, the reaction between iron III and iodine, and hydrolysis. (GS)

  6. What Is a Reaction Rate?

    ERIC Educational Resources Information Center

    Schmitz, Guy

    2005-01-01

    The definition of reaction rate is derived and demonstrations are made for the care to be taken while using the term. Reaction rate can be in terms of a reaction property, the extent of reaction and thus it is possible to give a definition applicable in open and closed systems.

  7. Magnetically suspended reaction wheels

    NASA Technical Reports Server (NTRS)

    Sabnis, A. V.; Stocking, G. L.; Dendy, J. B.

    1975-01-01

    Magnetic suspensions offer several advantages over conventional bearings, arising because of the contactless nature of the load support. In application to spacecraft reaction wheels, the advantages are low drag torque, wearfree, unlubricated, vacuum-compatible operation, and unlimited life. By the provision of redundancy in the control electronics, single-point failures are eliminated. The rational for selection of a passive radial, active axial, dc magnetic suspension is presented, and the relative merits of 3-loop and single-loop magnetic suspensions are discussed. The design of a .678 N-m-sec (.5 ft-lb-sec) reaction wheel using the single loop magnetic suspension was developed; the design compares favorably with current ball bearing wheels in terms of weight and power.

  8. Reaction chemistry of cerium

    SciTech Connect

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  9. Concordant Chemical Reaction Networks

    PubMed Central

    Shinar, Guy; Feinberg, Martin

    2015-01-01

    We describe a large class of chemical reaction networks, those endowed with a subtle structural property called concordance. We show that the class of concordant networks coincides precisely with the class of networks which, when taken with any weakly monotonic kinetics, invariably give rise to kinetic systems that are injective — a quality that, among other things, precludes the possibility of switch-like transitions between distinct positive steady states. We also provide persistence characteristics of concordant networks, instability implications of discordance, and consequences of stronger variants of concordance. Some of our results are in the spirit of recent ones by Banaji and Craciun, but here we do not require that every species suffer a degradation reaction. This is especially important in studying biochemical networks, for which it is rare to have all species degrade. PMID:22659063

  10. Reactions to dietary tartrazine.

    PubMed Central

    David, T J

    1987-01-01

    Double blind challenges with tartrazine and benzoic acid were performed in hospital in 24 children whose parents gave a definite history of a purely behavioural immediate adverse reaction to one of these substances. The patients, whose ages ranged from 1.6 to 12.4 years, were on a diet that avoided these items, and in all there was a clear history that any lapse of the diet caused an obvious adverse behavioural reaction within two hours. In no patient was any change in behaviour noted either by the parents or the nursing staff after the administration of placebo or active substances. Twenty two patients returned to a normal diet without problems, but the parents of two children insisted on continuing the diet. While popular belief has it that additives may have harmful behavioural effects, objective verification is required to prevent overdiagnosis. PMID:3548601

  11. Hypersensitivity reactions to fluoroquinolones.

    PubMed

    Scherer, Kathrin; Bircher, Andreas J

    2005-01-01

    Fluoroquinolone antibiotics cause immediate and delayed hypersensitivity reactions, and may also affect internal organs and circulating blood cells. The underlying pathomechanisms are only partly understood. The extent of cross-reactivity among different quinolones depends on the type of clinical manifestation and its underlying mechanism. Despite recent advances, reliable diagnostic tests are still lacking. Recent studies have shown quinolone-specific IgE in vitro in more than 50% of patients with immediate-type reactions and a considerable cross-reactivity with related compounds. In maculopapular drug exanthems from ciprofloxacin, specific T-cell clones were identified, and cross-reactivity to related compounds was detected in approximately 50% of the clones. From re-exposure studies in patients with exanthems, cross-reactivity appears to be lower. Cellular tests such as lymphocyte transformation tests are currently not very useful. For prick and intradermal skin tests, widely divergent nonirritant test concentrations have been recommended. Desensitization may be possible in selected patients.

  12. Photochemical reaction dynamics

    SciTech Connect

    Moore, B.C.

    1993-12-01

    The purpose of the program is to develop a fundamental understanding of unimolecular and bimolecular reaction dynamics with application in combustion and energy systems. The energy dependence in ketene isomerization, ketene dissociation dynamics, and carbonyl substitution on organometallic rhodium complexes in liquid xenon have been studied. Future studies concerning unimolecular processes in ketene as well as energy transfer and kinetic studies of methylene radicals are discussed.

  13. Adverse drug reactions.

    PubMed

    O'Reilly-Foley, Georgina

    2017-04-05

    What was the nature of the CPD activity, practice-related feedback and/or event and/or experience in your practice? The CPD article defined the different types of adverse drug reactions (ADRs) and explored when they can occur. It emphasised the importance of being knowledgeable about medications, considering patient safety when patients are taking medications, being alert to the possibility of ADRs, and recognising and responding to suspected ADRs.

  14. Chemical Reactions in Clusters

    DTIC Science & Technology

    1992-11-04

    NH 3)n, n _> 4, clusters has been attributed to the (solvated) naphtholate anion.3a A single picosecond decay measurement has been reported which...vibrational energy in the cluster Sl state. The data are summarized in Table I. A model to explain these decay results can be constructed based on a proton...11 TITLE (Include Security Classification) Chemical Reactions in Clusters 12 PERSONAL AUTHOR(S) Elliot R. Bernstein 13a TYPE OF REPORT 13b TIME COVERED

  15. Chemical Reactions in DSMC

    SciTech Connect

    Bird, G. A.

    2011-05-20

    DSMC simulations of chemically reacting gas flows have generally employed procedures that convert the macroscopic chemical rate equations to reaction cross-sections at the microscopic level. They therefore depend on the availability of experimental data that has been fitted to equations of the Arrhenius form. This paper presents a physical model for dissociation and recombination reactions and a phenomenological model for exchange and chain reactions. These are based on the vibrational states of the colliding molecules and do not require any experimentally-based data. The simplicity of the models allows the corresponding rate equations to be written down and, while these are not required for the implementation of the models, they facilitate their validation. The model is applied to a typical hypersonic atmospheric entry problem and the results are compared with the corresponding results from the traditional method. It is also used to investigate both spontaneous and forced ignition as well as the structure of a deflagration wave in an oxygen-hydrogen mixture.

  16. Chemical Reactions in DSMC

    NASA Astrophysics Data System (ADS)

    Bird, G. A.

    2011-05-01

    DSMC simulations of chemically reacting gas flows have generally employed procedures that convert the macroscopic chemical rate equations to reaction cross-sections at the microscopic level. They therefore depend on the availability of experimental data that has been fitted to equations of the Arrhenius form. This paper presents a physical model for dissociation and recombination reactions and a phenomenological model for exchange and chain reactions. These are based on the vibrational states of the colliding molecules and do not require any experimentally-based data. The simplicity of the models allows the corresponding rate equations to be written down and, while these are not required for the implementation of the models, they facilitate their validation. The model is applied to a typical hypersonic atmospheric entry problem and the results are compared with the corresponding results from the traditional method. It is also used to investigate both spontaneous and forced ignition as well as the structure of a deflagration wave in an oxygen-hydrogen mixture.

  17. [Skin reactions to bradykinin].

    PubMed

    Rihoux, J P; Ramboer, I; Fadel, R

    1995-10-01

    A large series of experiments carried out in animals and humans suggest that histamine release is not involved in the leakage phenomenon induced by bradykinin (BK) challenge. These experiments comprise in vitro studies on skin and bronchial human mast cells and in vivo studies on guinea pig airways and human skin using mepyramine, chlorpheniramine and terfenadine as reference H1-anti-histamines. Nevertheless, it has been shown recently that the H1 antagonist cetirizine 10 mg p.o. markedly inhibits skin reactions induced by BK challenge (intradermal injection of 212 micrograms BK in 10 microL saline and prick test with a solution of 21.2 micrograms/microL). In a guinea pig model, this drug also inhibited the bronchospasm induced by increasing concentrations of BK given by iv route (0.25 to 2 micrograms/Kg) and aerosol (3 to 300 micrograms/Kg). This inhibition was similar to the one obtained with the specific BK antagonist HOE 140 (15 pM/Kg). New data in the literature suggest the existence of various pharmacological mediators possibly involved in the BK-induced reaction: neuromediators, nitric oxyde and PAF. They also suggest that this reaction presents itself as a well defined sequence of pharmacological events. Since we could show that there is no binding of cetirizine to a human recombinant B2 receptor in vitro, some hypotheses are raised in order to explain this unexpected inhibiting effect of cetirizine.

  18. Adverse cutaneous drug reaction.

    PubMed

    Nayak, Surajit; Acharjya, Basanti

    2008-01-01

    In everyday clinical practice, almost all physicians come across many instances of suspected adverse cutaneous drug reactions (ACDR) in different forms. Although such cutaneous reactions are common, comprehensive information regarding their incidence, severity and ultimate health effects are often not available as many cases go unreported. It is also a fact that in the present world, almost everyday a new drug enters market; therefore, a chance of a new drug reaction manifesting somewhere in some form in any corner of world is unknown or unreported. Although many a times, presentation is too trivial and benign, the early identification of the condition and identifying the culprit drug and omit it at earliest holds the keystone in management and prevention of a more severe drug rash. Therefore, not only the dermatologists, but all practicing physicians should be familiar with these conditions to diagnose them early and to be prepared to handle them adequately. However, we all know it is most challenging and practically difficult when patient is on multiple medicines because of myriad clinical symptoms, poorly understood multiple mechanisms of drug-host interaction, relative paucity of laboratory testing that is available for any definitive and confirmatory drug-specific testing. Therefore, in practice, the diagnosis of ACDR is purely based on clinical judgment. In this discussion, we will be primarily focusing on pathomechanism and approach to reach a diagnosis, which is the vital pillar to manage any case of ACDR.

  19. Well sealing via thermite reactions

    SciTech Connect

    Lowry, William Edward; Dunn, Sandra Dalvit

    2016-11-15

    A platform is formed in a well below a target plug zone by lowering a thermite reaction charge into the well and igniting it, whereby the products of the reaction are allowed to cool and expand to form a platform or support in the well. A main thermite reaction charge is placed above the platform and ignited to form a main sealing plug for the well. In some embodiments an upper plug is formed by igniting an upper thermite reaction charge above the main thermite reaction charge. The upper plug confines the products of ignition of the main thermite reaction charge.

  20. Insect bite reactions.

    PubMed

    Singh, Sanjay; Mann, Baldeep Kaur

    2013-01-01

    Insects are a class of living creatures within the arthropods. Insect bite reactions are commonly seen in clinical practice. The present review touches upon the medically important insects and their places in the classification, the sparse literature on the epidemiology of insect bites in India, and different variables influencing the susceptibility of an individual to insect bites. Clinical features of mosquito bites, hypersensitivity to mosquito bites Epstein-Barr virus NK (HMB-EBV-NK) disease, eruptive pseudoangiomatosis, Skeeter syndrome, papular pruritic eruption of HIV/AIDS, and clinical features produced by bed bugs, Mexican chicken bugs, assassin bugs, kissing bugs, fleas, black flies, Blandford flies, louse flies, tsetse flies, midges, and thrips are discussed. Brief account is presented of the immunogenic components of mosquito and bed bug saliva. Papular urticaria is discussed including its epidemiology, the 5 stages of skin reaction, the SCRATCH principle as an aid in diagnosis, and the recent evidence supporting participation of types I, III, and IV hypersensitivity reactions in its causation is summarized. Recent developments in the treatment of pediculosis capitis including spinosad 0.9% suspension, benzyl alcohol 5% lotion, dimethicone 4% lotion, isopropyl myristate 50% rinse, and other suffocants are discussed within the context of evidence derived from randomized controlled trials and key findings of a recent systematic review. We also touch upon a non-chemical treatment of head lice and the ineffectiveness of egg-loosening products. Knockdown resistance (kdr) as the genetic mechanism making the lice nerves insensitive to permethrin is discussed along with the surprising contrary clinical evidence from Europe about efficacy of permethrin in children with head lice carrying kdr-like gene. The review also presents a brief account of insects as vectors of diseases and ends with discussion of prevention of insect bites and some serious adverse effects

  1. Reaction Extrema: Extent of Reaction in General Chemistry

    ERIC Educational Resources Information Center

    Vandezande, Jonathon E.; Vander Griend, Douglas A.; DeKock, Roger L.

    2013-01-01

    Nearly 100 years ago de Donder introduced the term "extent of reaction", ?. We build on that work by defining the concept of reagent extrema for an arbitrary chemical reaction, aA + bB [reversible reaction] yY + zZ. The central equation is ?^[subscript i] = -n[subscript i,0]/?[subscript i]. The symbol ?^[subscript i] represents the…

  2. Procedures for Decomposing a Redox Reaction into Half-Reaction

    ERIC Educational Resources Information Center

    Fishtik, Ilie; Berka, Ladislav H.

    2005-01-01

    A simple algorithm for a complete enumeration of the possible ways a redox reaction (RR) might be uniquely decomposed into half-reactions (HRs) using the response reactions (RERs) formalism is presented. A complete enumeration of the possible ways a RR may be decomposed into HRs is equivalent to a complete enumeration of stoichiometrically…

  3. Hydrogen forming reaction process

    SciTech Connect

    Marianowski, L.G.; Fleming, D.K.

    1989-03-07

    A hydrogen forming process is described, comprising: conducting in a hydrogen production zone a chemical reaction forming mixed gases comprising molecular hydrogen; contacting one side of a hydrogen ion porous and molecular gas nonporous metallic foil with the mixed gases in the hydrogen production zone; dissociating the molecular hydrogen to ionic hydrogen on the one side of the metallic foil; passing the ionic hydrogen through the metallic foil to its other side; and withdrawing hydrogen from the other side of the metallic foil, thereby removing hydrogen from the hydrogen production zone.

  4. Copper mediated carbometalation reactions.

    PubMed

    Müller, D S; Marek, I

    2016-08-08

    Since the first discovery of carbocupration of alkynes in the 1970s a tremendous amount of research has been carried out in this field. The exceptionally high selectivities obtained attribute to the great synthetic value of carbocupration reactions. This tutorial review will present the most important features of carbocupration of alkynes and highlight the most relevant reviews. Then a comprehensive review of copper mediated carbometalation of cyclopropenes will follow. The latter method has received much attention over the last decade as it allows the highly selective construction of poly-substituted cyclopropanes which can be transformed into acyclic derivatives bearing one or multiple tertiary or quaternary carbon stereocenters.

  5. The polymerase chain reaction.

    PubMed

    Welch, Hazel M

    2012-01-01

    The polymerase chain reaction (PCR) has had a significant impact on all aspects of the molecular biosciences, from cancer research to forensic science. The sensitivity and specificity inherent in the technique allow minute quantities of genetic material to be detected while the unique properties of thermostable DNA polymerase ensure that abundant copies are reliably reproduced to levels that can be visualized and/or used for further applications. This chapter describes applications of PCR and PCR-RT to investigate primary cancer and metastatic disease at both the DNA and mRNA expression levels.

  6. Medications and Drug Allergic Reactions

    MedlinePlus

    ... Library ▸ Medications and drug allergic reactions TTR Share | Medications and Drug Allergic Reactions This article has been ... by Thanai Pongdee, MD, FAAAAI Everyone reacts to medications differently. One person may develop a rash while ...

  7. Hydrazine decomposition and other reactions

    NASA Technical Reports Server (NTRS)

    Armstrong, Warren E. (Inventor); La France, Donald S. (Inventor); Voge, Hervey H. (Inventor)

    1978-01-01

    This invention relates to the catalytic decomposition of hydrazine, catalysts useful for this decomposition and other reactions, and to reactions in hydrogen atmospheres generally using carbon-containing catalysts.

  8. Positive reaction to allergen (image)

    MedlinePlus

    Allergic reaction is a sensitivity to a specific substance, called an allergen, that is contacted through the skin, inhaled into the lungs, swallowed or injected. The body's reaction to an allergen can be mild, such as ...

  9. Demonstration of the Fenton Reaction

    ERIC Educational Resources Information Center

    Luehrs, Dean C.; Roher, Alex E.

    2007-01-01

    The study demonstrates the Fenton reaction, which is carried out using the Fenton reagent that is used for groundwater and soil remediation. The Fenton reaction can be implicated in DNA damage, Alzheimer's disease, cardiovascular disease and ageing in general.

  10. [Abnormal grief reaction].

    PubMed

    Meyer, J E

    1977-01-01

    Pathological grief reactions following the death of a child are reported on the basis of five case studies. In contrast to acute grief reactions these pathological syndromes are of long standing. One parent had not truly accepted the death of the child. The denial of reality is sometimes a defence against aggression towards the deceased, because of his having left one behind. The mourning process comes to no end but remains in its initial phase. At the same time the life of the mourner stands still, as in the house and the family everything is left unchanged. Family interactions alter, particularly between the parents. For the genesis of these grief syndromes the following is of relevance: The death occurs at a time, when another child cannot replace the one who died. Mature independence had not been reached by either parent or child. Death destroyed expectations that this child would succeed in that which the parent had been unable to achieve. The parent had not seen the child after death--a gap in the continuity of experiencing which made acceptance of the irreversibility of the loss even more difficult.

  11. Drug dangers and reactions.

    PubMed

    WEILERSTEIN, R W

    1961-01-01

    The protection of the consumer against dangerous, adulterated, and misbranded drugs provided by the Federal Food, Drug, and Cosmetic Act has failed in some instances. A general program of reporting adverse drug reactions has been initiated on a pilot basis. Arrangements are being made to extend this program into larger hospitals. Better and more complete reporting of adverse drug reactions together with tightening of the Food and Drug law regarding new drugs will improve this situation. Recently the president of the National Academy of Sciences appointed a committee at the request of the Secretary of Health, Education, and Welfare to review the policies and procedures used by the Food and Drug Administration in reaching decisions and to present recommendations. This committee has completed its work and has made specific recommendations that would give the Food and Drug Administration authority to require proof of efficacy as well as safety of all new drugs, and would provide it with sufficient resources to meet the responsibilities assigned to it.

  12. DRUG DANGERS AND REACTIONS

    PubMed Central

    Weilerstein, Ralph W.

    1961-01-01

    The protection of the consumer against dangerous, adulterated, and misbranded drugs provided by the Federal Food, Drug, and Cosmetic Act has failed in some instances. A general program of reporting adverse drug reactions has been initiated on a pilot basis. Arrangements are being made to extend this program into larger hospitals. Better and more complete reporting of adverse drug reactions together with tightening of the Food and Drug law regarding new drugs will improve this situation. Recently the president of the National Academy of Sciences appointed a committee at the request of the Secretary of Health, Education, and Welfare to review the policies and procedures used by the Food and Drug Administration in reaching decisions and to present recommendations. This committee has completed its work and has made specific recommendations that would give the Food and Drug Administration authority to require proof of efficacy as well as safety of all new drugs, and would provide it with sufficient resources to meet the responsibilities assigned to it. PMID:13783849

  13. Lowering energy barriers in surface reactions through concerted reaction mechanisms.

    PubMed

    Sakong, Sung; Mosch, Christian; Lozano, Ariel; Busnengo, H Fabio; Gross, Axel

    2012-10-22

    Any technologically important chemical reaction typically involves a number of different elementary reaction steps consisting of bond-breaking and bond-making processes. Usually, one assumes that such complex chemical reactions occur in a step-wise fashion where one single bond is made or broken at a time. Using first-principles calculations based on density functional theory we show that the barriers of rate-limiting steps for technologically relevant surface reactions are significantly reduced if concerted reaction mechanisms are taken into account.

  14. The Vitamin C Clock Reaction

    NASA Astrophysics Data System (ADS)

    Wright, Stephen W.

    2002-01-01

    An iodine clock reaction that gives a colorless to black result similar to that of the familiar Landolt iodate-bisulfite clock reaction is described. The vitamin C clock reaction uses chemicals that are readily available on the retail market: vitamin C, tincture of iodine, 3% hydrogen peroxide, and laundry starch. Orange juice may be used as the vitamin C source to give an orange to black reaction.

  15. More on Chemical Reaction Balancing.

    ERIC Educational Resources Information Center

    Swinehart, D. F.

    1985-01-01

    A previous article stated that only the matrix method was powerful enough to balance a particular chemical equation. Shows how this equation can be balanced without using the matrix method. The approach taken involves writing partial mathematical reactions and redox half-reactions, and combining them to yield the final balanced reaction. (JN)

  16. Mass Transfer with Chemical Reaction.

    ERIC Educational Resources Information Center

    DeCoursey, W. J.

    1987-01-01

    Describes the organization of a graduate course dealing with mass transfer, particularly as it relates to chemical reactions. Discusses the course outline, including mathematics models of mass transfer, enhancement of mass transfer rates by homogeneous chemical reaction, and gas-liquid systems with chemical reaction. (TW)

  17. The Vitamin C Clock Reaction.

    ERIC Educational Resources Information Center

    Wright, Stephen W.

    2002-01-01

    Describes an iodine clock reaction that produces an effect similar to the Landolt clock reaction. This reaction uses supermarket chemicals and avoids iodate, bisulfite, and mercury compounds. Ascorbic acid and tincture of iodine are the main reactants with alternate procedures provided for vitamin C tablets and orange juice. (DDR)

  18. Corona reaction method and apparatus

    SciTech Connect

    Lowther, F.E.

    1981-08-11

    Corona induced chemical reactions are conducted in a corona discharge zone in which narrow high voltage pulses are applied along with a relatively low voltage bias potential. It is found that for many corona discharge reactions, such as the conversion of oxygen to ozone, the present method increases the electrical efficiency of the reaction.

  19. Enzymatic reactions on immobilised substrates.

    PubMed

    Gray, Christopher J; Weissenborn, Martin J; Eyers, Claire E; Flitsch, Sabine L

    2013-08-07

    This review gives an overview of enzymatic reactions that have been conducted on substrates attached to solid surfaces. Such biochemical reactions have become more important with the drive to miniaturisation and automation in chemistry, biology and medicine. Technical aspects such as choice of solid surface and analytical methods are discussed and examples of enzyme reactions that have been successful on these surfaces are provided.

  20. [Bullous drug reactions].

    PubMed

    Hertl-Yazdi, M S; Hertl, M

    2005-01-01

    Bullous drug exanthems are clinically characteristic, usually severe cutaneous and mucosal drug hypersensitivity reactions. Commonly, they appear 5-14 days after onset of drug treatment. Therapy of choice is to avoid the culprit drug and systemic administration of glucocorticoids. A key element in the immune pathogenesis of bullous drug exanthems is presumably the activation of cytotoxic CD8(+) T lymphocytes which recognize drug metabolites as nominal antigens. These compounds form spontaneously (e.g. penicillins) or are metabolized by cytochrome P450-dependent enzymes (sulfonamides). The diagnosis of bullous drug exanthems is primarily based on skin tests and in vitro-techniques. Among the skin tests, prick as well as patch tests are important. Patch tests can be also applied at the former skin lesion in fixed drug eruption. In vitro techniques include analysis of drug-specific IgE (only available for anti-penicillin, anti-sulfamethoxazole) and cellular tests with the patients' lymphocytes (lymphocyte transformation test-LTT).

  1. Mixtures and Mineral Reactions

    NASA Astrophysics Data System (ADS)

    Rumble, D.

    The monograph Mixtures and Mineral Reactions contains a large amount of information of value to mineralogists, petrologists, and geochemists. The first four chapters are a succinct account of the thermodynamic description of crystalline solutions. In these early chapters a comparison is made between different mathematical treatments of activitycomposition models, there is a discussion of the unmixing by exsolution of a single solution into two phases, and methods of computing phase equilibria in assemblages of different minerals are given. If the reader is perplexed by the discussion of standard states (cf. Figure 1.3), not to worry. That is a normal condition for anyone forced to choose between equivalent reference frames yet knowing, somewhere down the line, that the choice will ultimately make one's computational life more or less difficult.

  2. Adverse reactions to vaccines.

    PubMed

    Martin, Bryan L; Nelson, Michael R; Hershey, Joyce N; Engler, Renata J M

    2003-06-01

    (The opinions or assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the Department of the Army or the Department of Defense.) Immunization healthcare is becoming increasingly complex as the number and types of vaccines have continued to expand. Like all prescription drugs, vaccines may be associated with adverse events. The majority of these reactions are self-limited and not associated with prolonged disability. The media, Internet and public advocacy groups have focused on potentially serious vaccine-associated adverse events with questions raised about causal linkages to increasing frequencies of diseases such as autism and asthma. Despite a lack of evidence of a causal relationship to a variety of vaccine safety concerns, including extensive reviews by the Institute of Medicine, questions regarding vaccine safety continue to threaten the success of immunization programs. Risk communication arid individual risk assessment is further challenged by the public health success of vaccine programs creating the perception that certain vaccines are no longer necessary or justified because of the rare reaction risk. There is a need for improved understanding of true vaccine contraindications and precautions as well as host factors and disease threat in order to develop a patient specific balanced risk communication intervention. When they occur, vaccine related adverse events must be treated, documented and reported through the VAERS system. The increasing complexity of vaccination health care has led the Center of Disease Control and Prevention (CDC) to identify Vaccine Safety Assessment and Evaluation as a potential new specialty.

  3. Extent of reaction in open systems with multiple heterogeneous reactions

    USGS Publications Warehouse

    Friedly, John C.

    1991-01-01

    The familiar batch concept of extent of reaction is reexamined for systems of reactions occurring in open systems. Because species concentrations change as a result of transport processes as well as reactions in open systems, the extent of reaction has been less useful in practice in these applications. It is shown that by defining the extent of the equivalent batch reaction and a second contribution to the extent of reaction due to the transport processes, it is possible to treat the description of the dynamics of flow through porous media accompanied by many chemical reactions in a uniform, concise manner. This approach tends to isolate the reaction terms among themselves and away from the model partial differential equations, thereby enabling treatment of large problems involving both equilibrium and kinetically controlled reactions. Implications on the number of coupled partial differential equations necessary to be solved and on numerical algorithms for solving such problems are discussed. Examples provided illustrate the theory applied to solute transport in groundwater flow.

  4. Two chamber reaction furnace

    DOEpatents

    Blaugher, Richard D.

    1998-05-05

    A vertical two chamber reaction furnace. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700.degree. and 800.degree. C.) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800.degree. to 950.degree. C. to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product.

  5. Two chamber reaction furnace

    DOEpatents

    Blaugher, R.D.

    1998-05-05

    A vertical two chamber reaction furnace is described. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700 C and 800 C) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800 to 950 C to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product. 2 figs.

  6. NIF Gamma Reaction History

    NASA Astrophysics Data System (ADS)

    Herrmann, H. W.; Kim, Y.; Young, C. S.; Mack, J. M.; McEvoy, A. M.; Hoffman, N. M.; Wilson, D. C.; Langenbrunner, J. R.; Evans, S.; Batha, S. H.; Stoeffl, W.; Lee, A.; Horsfield, C. J.; Rubery, M.; Miller, E. K.; Malone, R. M.; Kaufman, M. I.

    2010-11-01

    The primary objective of the NIF Gamma Reaction History (GRH) diagnostics is to provide bang time and burn width information based upon measurement of fusion gamma-rays. This is accomplished with energy-thresholded Gas Cherenkov detectors that convert MeV gamma-rays into UV/visible photons for high-bandwidth optical detection. In addition, the GRH detectors can perform γ-ray spectroscopy to explore other nuclear processes from which additional significant implosion parameters may be inferred (e.g., plastic ablator areal density). Implementation is occurring in 2 phases: 1) four PMT-based channels mounted to the outside of the NIF target chamber at ˜6 m from TCC (GRH-6m) for the 3e13-3e16 DT neutron yield range expected during the early ignition-tuning campaigns; and 2) several channels located just inside the target bay shield wall at ˜15 m from TCC (GRH-15m) with optical paths leading through the wall into well-shielded streak cameras and PMTs for the 1e16-1e20 yield range expected during the DT ignition campaign. This suite of diagnostics will allow exploration of interesting γ-ray physics well beyond the ignition campaign. Recent data from OMEGA and NIF will be shown.

  7. Formaldehyde reactions in dark clouds.

    PubMed

    Sen, A D; Anicich, V G; Federman, S R

    1992-05-20

    The low-pressure reactions of formaldehyde (H2CO) with D+, D2+, D3+, and He+ have been studied by the ion cyclotron resonance technique. These reactions are potential loss processes for formaldehyde in cores of dark interstellar clouds. The deuterated reactants, which are easier to study experimentally, represent direct analogs for protons. Rate coefficients and branching ratios of product channels have been measured. Charge transfer is observed to be the dominant reaction of H2CO with D+, D2+, and He+ ions. Only the D3+ reaction exhibits a proton transfer channel. All reactions proceed at rate coefficients near the collision limit. Proton-deuteron exchange reactions were found to be inefficient processes in the formaldehyde system.

  8. Stochastic Modeling Of Biochemical Reactions

    DTIC Science & Technology

    2006-11-01

    chemical reactions. Often for these reactions, the dynamics of the first M-order statistical moments of the species populations do not form a closed...results a stochastic model for gene expression is investigated. We show that in gene expression mechanisms , in which a protein inhibits its own...chemical reactions [7, 8, 4, 9, 10]. Since one is often interested in only the first and second order statistical moments for the number of molecules of

  9. Kinematically complete chemical reaction dynamics

    NASA Astrophysics Data System (ADS)

    Trippel, S.; Stei, M.; Otto, R.; Hlavenka, P.; Mikosch, J.; Eichhorn, C.; Lourderaj, U.; Zhang, J. X.; Hase, W. L.; Weidemüller, M.; Wester, R.

    2009-11-01

    Kinematically complete studies of molecular reactions offer an unprecedented level of insight into the dynamics and the different mechanisms by which chemical reactions occur. We have developed a scheme to study ion-molecule reactions by velocity map imaging at very low collision energies. Results for the elementary nucleophilic substitution (SN2) reaction Cl- + CH3I → ClCH3 + I- are presented and compared to high-level direct dynamics trajectory calculations. Furthermore, an improved design of the crossed-beam imaging spectrometer with full three-dimensional measurement capabilities is discussed and characterization measurements using photoionization of NH3 and photodissociation of CH3I are presented.

  10. Pathophysiology of hemolytic transfusion reactions.

    PubMed

    Davenport, Robertson D

    2005-07-01

    Hemolytic transfusion reactions (HTR) are systemic reactions provoked by immunologic red blood cell (RBC) incompatibility. Clinical and experimental observations of such reactions indicate that they proceed through phases of humoral immune reaction, activation of phagocytes, productions of cytokine mediators, and wide-ranging cellular responses. HTR have many features in common with the systemic inflammatory response syndrome (SIRS). Knowledge of the pathophysiologic mechanisms in HTR suggest that newer biological agents that target complement intermediates or proinflammatory cytokines may be effective agents in the treatment of severe HTRs.

  11. Radiation reaction in fusion plasmas.

    PubMed

    Hazeltine, R D; Mahajan, S M

    2004-10-01

    The effects of a radiation reaction on thermal electrons in a magnetically confined plasma, with parameters typical of planned burning plasma experiments, are studied. A fully relativistic kinetic equation that includes the radiation reaction is derived. The associated rate of phase-space contraction is computed and the relative importance of the radiation reaction in phase space is estimated. A consideration of the moments of the radiation reaction force show that its effects are typically small in reactor-grade confined plasmas, but not necessarily insignificant.

  12. Racemization in Prins Cyclization Reactions

    PubMed Central

    Jasti, Ramesh

    2008-01-01

    Isotopic labeling experiments were performed in order to elucidate a new mechanism for racemization in Prins cyclization reactions. The loss in optical activity for these reactions was shown to occur by 2-oxonia-Cope rearrangements by way of a (Z)-oxocarbenium ion intermediate. Reaction conditions such as solvent, temperature, and the nucleophile employed played a critical role in whether an erosion in enantiomeric excess was observed. Additionally, certain structural features of Prins cyclization precursors were also shown to be important for preserving optical purity in these reactions. PMID:17031979

  13. Speeding chemical reactions by focusing.

    PubMed

    Lacasta, A M; Ramírez-Piscina, L; Sancho, J M; Lindenberg, K

    2013-04-14

    We present numerical results for a chemical reaction of colloidal particles which are transported by a laminar fluid and are focused by periodic obstacles in such a way that the two components are well mixed and consequently the chemical reaction is speeded up. The roles of the various system parameters (diffusion coefficients, reaction rate, and obstacles sizes) are studied. We show that focusing speeds up the reaction from the diffusion limited rate ∼t(-1/2) to very close to the perfect mixing rate, ∼t(-1).

  14. Speeding chemical reactions by focusing

    NASA Astrophysics Data System (ADS)

    Lacasta, A. M.; Ramírez-Piscina, L.; Sancho, J. M.; Lindenberg, K.

    2013-04-01

    We present numerical results for a chemical reaction of colloidal particles which are transported by a laminar fluid and are focused by periodic obstacles in such a way that the two components are well mixed and consequently the chemical reaction is speeded up. The roles of the various system parameters (diffusion coefficients, reaction rate, and obstacles sizes) are studied. We show that focusing speeds up the reaction from the diffusion limited rate ˜t-1/2 to very close to the perfect mixing rate, ˜t-1.

  15. Dynamic Reaction Figures: An Integrative Vehicle for Understanding Chemical Reactions

    ERIC Educational Resources Information Center

    Schultz, Emeric

    2008-01-01

    A highly flexible learning tool, referred to as a dynamic reaction figure, is described. Application of these figures can (i) yield the correct chemical equation by simply following a set of menu driven directions; (ii) present the underlying "mechanism" in chemical reactions; and (iii) help to solve quantitative problems in a number of different…

  16. Free Radical Reactions in Food.

    ERIC Educational Resources Information Center

    Taub, Irwin A.

    1984-01-01

    Discusses reactions of free radicals that determine the chemistry of many fresh, processed, and stored foods. Focuses on reactions involving ascorbic acid, myoglobin, and palmitate radicals as representative radicals derived from a vitamin, metallo-protein, and saturated lipid. Basic concepts related to free radical structure, formation, and…

  17. Isosinglet approximation for nonelastic reactions

    NASA Technical Reports Server (NTRS)

    Wilson, J. W.

    1972-01-01

    Group theoretic relations are derived between different combinations of projectile and secondary particles which appear to have a broad range of application in spacecraft shielding or radiation damage studies. These relations are used to reduce the experimental effort required to obtain nuclear reaction data for transport calculations. Implications for theoretical modeling are also noted, especially for heavy-heavy reactions.

  18. Adverse Reactions to Hallucinogenic Drugs.

    ERIC Educational Resources Information Center

    Meyer, Roger E. , Ed.

    This reports a conference of psychologists, psychiatrists, geneticists and others concerned with the biological and psychological effects of lysergic acid diethylamide and other hallucinogenic drugs. Clinical data are presented on adverse drug reactions. The difficulty of determining the causes of adverse reactions is discussed, as are different…

  19. Chemistry of heavy ion reactions

    SciTech Connect

    Hoffman, D.C.

    1988-10-01

    The use of heavy ions to induce nuclear reactions was reported as early as 1950. Since that time it has been one of the most active areas of nuclear research. Intense beams of ions as heavy as uranium with energies high enough to overcome the Coulomb barriers of even the heaviest elements are available. The wide variety of possible reactions gives rise to a multitude of products which have been studied by many ingenious chemical and physical techniques. Chemical techniques have been of special value for the separation and unequivocal identification of low yield species from the plethora of other nuclides present. Heavy ion reactions have been essential for the production of the trans-Md elements and a host of new isotopes. The systematics of compound nucleus reactions, transfer reactions, and deeply inelastic reactions have been elucidated using chemical techniques. A review of the variety of chemical procedures and techniques which have been developed for the study of heavy ion reactions and their products is given. Determination of the chemical properties of the trans-Md elements, which are very short-lived and can only be produced an ''atom-at-a-time'' via heavy ion reactions, is discussed. 53 refs., 19 figs.

  20. Statistical Factors in Complexation Reactions.

    ERIC Educational Resources Information Center

    Chung, Chung-Sun

    1985-01-01

    Four cases which illustrate statistical factors in complexation reactions (where two of the reactants are monodentate ligands) are presented. Included are tables showing statistical factors for the reactions of: (1) square-planar complexes; (2) tetrahedral complexes; and (3) octahedral complexes. (JN)

  1. "Greening up" the Suzuki Reaction

    ERIC Educational Resources Information Center

    Aktoudianakis, Evangelos; Chan, Elton; Edward, Amanda R.; Jarosz, Isabel; Lee, Vicki; Mui, Leo; Thatipamala, Sonya S.; Dicks, Andrew P.

    2008-01-01

    This article describes the rapid, green synthesis of a biaryl compound (4-phenylphenol) via a Pd(0)-catalyzed Suzuki cross-coupling reaction in water. Mild reaction conditions and operational simplicity makes this experiment especially amenable to both mid- and upper-level undergraduates. The methodology exposes students to purely aqueous…

  2. Enzymatic reactions in confined environments

    NASA Astrophysics Data System (ADS)

    Küchler, Andreas; Yoshimoto, Makoto; Luginbühl, Sandra; Mavelli, Fabio; Walde, Peter

    2016-05-01

    Within each biological cell, surface- and volume-confined enzymes control a highly complex network of chemical reactions. These reactions are efficient, timely, and spatially defined. Efforts to transfer such appealing features to in vitro systems have led to several successful examples of chemical reactions catalysed by isolated and immobilized enzymes. In most cases, these enzymes are either bound or adsorbed to an insoluble support, physically trapped in a macromolecular network, or encapsulated within compartments. Advanced applications of enzymatic cascade reactions with immobilized enzymes include enzymatic fuel cells and enzymatic nanoreactors, both for in vitro and possible in vivo applications. In this Review, we discuss some of the general principles of enzymatic reactions confined on surfaces, at interfaces, and inside small volumes. We also highlight the similarities and differences between the in vivo and in vitro cases and attempt to critically evaluate some of the necessary future steps to improve our fundamental understanding of these systems.

  3. Adverse reactions to drug additives.

    PubMed

    Simon, R A

    1984-10-01

    There is a long list of additives used by the pharmaceutical industry. Most of the agents used have not been implicated in hypersensitivity reactions. Among those that have, only reactions to parabens and sulfites have been well established. Parabens have been shown to be responsible for rare immunoglobulin E-mediated reactions that occur after the use of local anesthetics. Sulfites, which are present in many drugs, including agents commonly used to treat asthma, have been shown to provoke severe asthmatic attacks in sensitive individuals. Recent studies indicate that additives do not play a significant role in "hyperactivity." The role of additives in urticaria is not well established and therefore the incidence of adverse reactions in this patient population is simply not known. In double-blind, placebo-controlled studies, reactions to tartrazine or additives other than sulfites, if they occur at all, are indeed quite rare for the asthmatic population, even for the aspirin-sensitive subpopulation.

  4. Fundamental reaction pathways during coprocessing

    SciTech Connect

    Stock, L.M.; Gatsis, J.G. . Dept. of Chemistry)

    1992-12-01

    The objective of this research was to investigate the fundamental reaction pathways in coal petroleum residuum coprocessing. Once the reaction pathways are defined, further efforts can be directed at improving those aspects of the chemistry of coprocessing that are responsible for the desired results such as high oil yields, low dihydrogen consumption, and mild reaction conditions. We decided to carry out this investigation by looking at four basic aspects of coprocessing: (1) the effect of fossil fuel materials on promoting reactions essential to coprocessing such as hydrogen atom transfer, carbon-carbon bond scission, and hydrodemethylation; (2) the effect of varied mild conditions on the coprocessing reactions; (3) determination of dihydrogen uptake and utilization under severe conditions as a function of the coal or petroleum residuum employed; and (4) the effect of varied dihydrogen pressure, temperature, and residence time on the uptake and utilization of dihydrogen and on the distribution of the coprocessed products. Accomplishments are described.

  5. Enzymatic reactions in confined environments.

    PubMed

    Küchler, Andreas; Yoshimoto, Makoto; Luginbühl, Sandra; Mavelli, Fabio; Walde, Peter

    2016-05-05

    Within each biological cell, surface- and volume-confined enzymes control a highly complex network of chemical reactions. These reactions are efficient, timely, and spatially defined. Efforts to transfer such appealing features to in vitro systems have led to several successful examples of chemical reactions catalysed by isolated and immobilized enzymes. In most cases, these enzymes are either bound or adsorbed to an insoluble support, physically trapped in a macromolecular network, or encapsulated within compartments. Advanced applications of enzymatic cascade reactions with immobilized enzymes include enzymatic fuel cells and enzymatic nanoreactors, both for in vitro and possible in vivo applications. In this Review, we discuss some of the general principles of enzymatic reactions confined on surfaces, at interfaces, and inside small volumes. We also highlight the similarities and differences between the in vivo and in vitro cases and attempt to critically evaluate some of the necessary future steps to improve our fundamental understanding of these systems.

  6. Effective reaction rates for diffusion-limited reaction cycles

    NASA Astrophysics Data System (ADS)

    Nałecz-Jawecki, Paweł; Szymańska, Paulina; Kochańczyk, Marek; Miekisz, Jacek; Lipniacki, Tomasz

    2015-12-01

    Biological signals in cells are transmitted with the use of reaction cycles, such as the phosphorylation-dephosphorylation cycle, in which substrate is modified by antagonistic enzymes. An appreciable share of such reactions takes place in crowded environments of two-dimensional structures, such as plasma membrane or intracellular membranes, and is expected to be diffusion-controlled. In this work, starting from the microscopic bimolecular reaction rate constants and using estimates of the mean first-passage time for an enzyme-substrate encounter, we derive diffusion-dependent effective macroscopic reaction rate coefficients (EMRRC) for a generic reaction cycle. Each EMRRC was found to be half of the harmonic average of the microscopic rate constant (phosphorylation c or dephosphorylation d), and the effective (crowding-dependent) motility divided by a slowly decreasing logarithmic function of the sum of the enzyme concentrations. This implies that when c and d differ, the two EMRRCs scale differently with the motility, rendering the steady-state fraction of phosphorylated substrate molecules diffusion-dependent. Analytical predictions are verified using kinetic Monte Carlo simulations on the two-dimensional triangular lattice at the single-molecule resolution. It is demonstrated that the proposed formulas estimate the steady-state concentrations and effective reaction rates for different sets of microscopic reaction rates and concentrations of reactants, including a non-trivial example where with increasing diffusivity the fraction of phosphorylated substrate molecules changes from 10% to 90%.

  7. Reaction rates for reaction-diffusion kinetics on unstructured meshes

    NASA Astrophysics Data System (ADS)

    Hellander, Stefan; Petzold, Linda

    2017-02-01

    The reaction-diffusion master equation is a stochastic model often utilized in the study of biochemical reaction networks in living cells. It is applied when the spatial distribution of molecules is important to the dynamics of the system. A viable approach to resolve the complex geometry of cells accurately is to discretize space with an unstructured mesh. Diffusion is modeled as discrete jumps between nodes on the mesh, and the diffusion jump rates can be obtained through a discretization of the diffusion equation on the mesh. Reactions can occur when molecules occupy the same voxel. In this paper, we develop a method for computing accurate reaction rates between molecules occupying the same voxel in an unstructured mesh. For large voxels, these rates are known to be well approximated by the reaction rates derived by Collins and Kimball, but as the mesh is refined, no analytical expression for the rates exists. We reduce the problem of computing accurate reaction rates to a pure preprocessing step, depending only on the mesh and not on the model parameters, and we devise an efficient numerical scheme to estimate them to high accuracy. We show in several numerical examples that as we refine the mesh, the results obtained with the reaction-diffusion master equation approach those of a more fine-grained Smoluchowski particle-tracking model.

  8. Effective reaction rates for diffusion-limited reaction cycles.

    PubMed

    Nałęcz-Jawecki, Paweł; Szymańska, Paulina; Kochańczyk, Marek; Miękisz, Jacek; Lipniacki, Tomasz

    2015-12-07

    Biological signals in cells are transmitted with the use of reaction cycles, such as the phosphorylation-dephosphorylation cycle, in which substrate is modified by antagonistic enzymes. An appreciable share of such reactions takes place in crowded environments of two-dimensional structures, such as plasma membrane or intracellular membranes, and is expected to be diffusion-controlled. In this work, starting from the microscopic bimolecular reaction rate constants and using estimates of the mean first-passage time for an enzyme-substrate encounter, we derive diffusion-dependent effective macroscopic reaction rate coefficients (EMRRC) for a generic reaction cycle. Each EMRRC was found to be half of the harmonic average of the microscopic rate constant (phosphorylation c or dephosphorylation d), and the effective (crowding-dependent) motility divided by a slowly decreasing logarithmic function of the sum of the enzyme concentrations. This implies that when c and d differ, the two EMRRCs scale differently with the motility, rendering the steady-state fraction of phosphorylated substrate molecules diffusion-dependent. Analytical predictions are verified using kinetic Monte Carlo simulations on the two-dimensional triangular lattice at the single-molecule resolution. It is demonstrated that the proposed formulas estimate the steady-state concentrations and effective reaction rates for different sets of microscopic reaction rates and concentrations of reactants, including a non-trivial example where with increasing diffusivity the fraction of phosphorylated substrate molecules changes from 10% to 90%.

  9. Effective reaction parameters for mixing controlled reactions in heterogeneous media

    NASA Astrophysics Data System (ADS)

    Luo, Jian; Dentz, Marco; Carrera, Jesus; Kitanidis, Peter

    2008-02-01

    Sound understanding of mixing-controlled reactions in heterogeneous media is needed for the realistic modeling of contaminant transport in aquifers and is a precondition for the evaluation of natural attenuation processes, the design of nuclear waste disposal, and the engineered remediation of contaminated sites. In this work, we study the bimolecular dissolution-precipitation equilibrium reaction, adapted after De Simoni et al. (2005). Because of advective and dispersive transport of the reacting species, the system is globally in nonequilibrium because the effective reaction rate is limited by the finite rate of transport and thus is affected by the heterogeneity of the formation. We study the macroscopic formulation of such a reactive transport system in terms of mixing-controlled reaction parameters which integrate the impact of spatial heterogeneity. The apparent chemical saturation is found to be a function of the concentration variance and is generally greater than its local-scale equivalent. This explains why water samples taken from pumping wells are normally nonequilibrium with respect to minerals existing in the aquifer, even when local equilibrium is to be expected. The reaction rate is given by the product of a reaction factor, associated with the local equilibrium constant and concentration variance, and a mixing factor, which is the product of the microdispersion coefficient and the square gradient of the mean and perturbation concentration fields. The mixing factor dominates the description of the reaction rate in the upscaled macroscopic models. The reaction rate predicted by macroscopic models is controlled by two competing effects: The large heterogeneity-induced macrodispersion coefficient leads to an increase of reaction rate, while a more smoothed concentration gradient may lead to a decrease of the reaction rate. Macroscopic models may only give a good approximation at large time and away from the plume center of mass because of the balanced

  10. Leukocyte Agglomeration Reaction in Diagnosis of Allergy Reactions from Antibiotics,

    DTIC Science & Technology

    tested in a clinic on 80 patients with serious allergic anamnesis . The results of the studies indicate that the leukocyte agglomeration reaction is a highly sensitive immunological indicator of hypersensitivity to antibiotics.

  11. Surrogate Nuclear Reactions using STARS

    SciTech Connect

    Bernstein, L A; Burke, J T; Church, J A; Ahle, L; Cooper, J R; Hoffman, R D; Moody, K; Punyon, J; Schiller, A; Algin, E; Plettner, C; Ai, H; Beausang, C W; Casten, R F; Hughes, R; Ricard-McCutchan, E; Meyer, D; Ressler, J J; Caggiano, J A; Zamfir, N V; Amro, H; Heinz, A; Fallon, P; McMahan, M A; Macchiavelli, A O; Phair, L W

    2004-10-26

    The results from two surrogate reaction experiments using the STARS (Silicon Telescope Array for Reaction Studies) spectrometer are presented. The surrogate method involves measuring the particle and/or {gamma}-ray decay probabilities of excited nuclei populated via a direct reaction. These probabilities can then be used to deduce neutron-induced reaction cross sections that lead to the same compound nuclei. In the first experiment STARS coupled to the GAMMASPHERE {gamma}-ray spectrometer successfully reproduce surrogate (n,{gamma}), (n,n'{gamma}) and (n,2n{gamma}) cross sections on {sup 155,156}Gd using Gd {sup 3}He-induced reactions. In the second series of experiments an energetic deuteron beam from the ESTU tandem at the Wright Nuclear Structure Lab at Yale University was used to obtain the ratio of fission probabilities for {sup 238}U/ {sup 236}U and {sup 237}U/ {sup 239}U populated using the {sup 236,238}U(d,d'f) and {sup 236,238}U(d,pf) reactions. Results from these experiments are presented and the implications for the surrogate reaction technique are discussed.

  12. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  13. Drug hypersensitivity reactions involving skin.

    PubMed

    Hausmann, Oliver; Schnyder, Benno; Pichler, Werner J

    2010-01-01

    Immune reactions to drugs can cause a variety of diseases involving the skin, liver, kidney, lungs, and other organs. Beside immediate, IgE-mediated reactions of varying degrees (urticaria to anaphylactic shock), many drug hypersensitivity reactions appear delayed, namely hours to days after starting drug treatment, showing a variety of clinical manifestations from solely skin involvement to fulminant systemic diseases which may be fatal. Immunohistochemical and functional studies of drug-specific T cells in patients with delayed reactions confirmed a predominant role for T cells in the onset and maintenance of immune-mediated delayed drug hypersensitivity reactions (type IV reactions). In these reactions, drug-specific CD4+ and CD8+ T cells are stimulated by drugs through their T cell receptors (TCR). Drugs can stimulate T cells in two ways: they can act as haptens and bind covalently to larger protein structures (hapten-carrier model), inducing a specific immune response. In addition, they may accidentally bind in a labile, noncovalent way to a particular TCR of the whole TCR repertoire and possibly also major histocompatibility complex (MHC)-molecules - similar to their pharmacologic action. This seems to be sufficient to reactivate certain, probably in vivo preactivated T cells, if an additional interaction of the drug-stimulated TCR with MHC molecules occurs. The mechanism was named pharmacological interaction of a drug with (immune) receptor and thus termed the p-i concept. This new concept may explain the frequent skin symptoms in drug hypersensitivity to oral or parenteral drugs. Furthermore, the various clinical manifestations of T cell-mediated drug hypersensitivity may be explained by distinct T cell functions leading to different clinical phenotypes. These data allowed a subclassification of the delayed hypersensitivity reactions (type IV) into T cell reactions which, by releasing certain cytokines and chemokines, preferentially activate and recruit

  14. Standard Gibbs Energy of Metabolic Reactions: I. Hexokinase Reaction.

    PubMed

    Meurer, Florian; Bobrownik, Maria; Sadowski, Gabriele; Held, Christoph

    2016-10-11

    The standard Gibbs energy of reaction enables calculation of the driving force of a (bio)chemical reaction. Gibbs energies of reaction are required in thermodynamic approaches to determine fluxes as well as single reaction conversions of metabolic bioreactions. The hexokinase reaction (phosphorylation of glucose) is the entrance step of glycolysis, and thus its standard Gibbs energy of reaction (Δ(R)g°) is of great impact. Δ(R)g° is accessible from equilibrium measurements, and the very small concentrations of the reacting agents cause usually high error bars in data reduction steps. Even worse, works from literature do not account for the nonideal behavior of the reacting agents (activity coefficients were assumed to be unity); thus published Δ(R)g° values are not standard data. Consistent treatment of activity coefficients of reacting agents is crucial for the accurate determination of standard Gibbs energy from equilibrium measurements. In this work, equilibrium molalities of hexokinase reaction were measured with an enzyme kit. These results were combined with reacting agents' activity coefficients obtained with the thermodynamic model ePC-SAFT. Pure-component parameters for adenosine triphosphate (ATP) and adenosine diphosphate (ADP) were fitted to experimental osmotic coefficients (water + Na2ATP, water + NaADP). Δ(R)g° of the hexokinase reaction at 298.15 K and pH 7 was found to be -17.83 ± 0.52 kJ·mol(-1). This value was compared with experimental literature data; very good agreement between the different Δ(R)g° values was obtained by accounting for pH, pMg, and the activity coefficients of the reacting agents.

  15. Chemical potential and reaction electronic flux in symmetry controlled reactions.

    PubMed

    Vogt-Geisse, Stefan; Toro-Labbé, Alejandro

    2016-07-15

    In symmetry controlled reactions, orbital degeneracies among orbitals of different symmetries can occur along a reaction coordinate. In such case Koopmans' theorem and the finite difference approximation provide a chemical potential profile with nondifferentiable points. This results in an ill-defined reaction electronic flux (REF) profile, since it is defined as the derivative of the chemical potential with respect to the reaction coordinate. To overcome this deficiency, we propose a new way for the calculation of the chemical potential based on a many orbital approach, suitable for reactions in which symmetry is preserved. This new approach gives rise to a new descriptor: symmetry adapted chemical potential (SA-CP), which is the chemical potential corresponding to a given irreducible representation of a symmetry group. A corresponding symmetry adapted reaction electronic flux (SA-REF) is also obtained. Using this approach smooth chemical potential profiles and well defined REFs are achieved. An application of SA-CP and SA-REF is presented by studying the Cs enol-keto tautomerization of thioformic acid. Two SA-REFs are obtained, JA'(ξ) and JA'' (ξ). It is found that the tautomerization proceeds via an in-plane delocalized 3-center 4-electron O-H-S hypervalent bond which is predicted to exist only in the transition state (TS) region. © 2016 Wiley Periodicals, Inc.

  16. Coarctate cyclization reactions: a primer.

    PubMed

    Young, Brian S; Herges, Rainer; Haley, Michael M

    2012-10-04

    The cleavage of five-membered heterocycles possessing an exocyclic carbene or nitrene to form conjugated ene-ene-yne systems has been documented for over 40 years; however, the reverse reaction, using a conjugated "ene-ene-yne" precursor to form a heterocycle is a relatively new approach. Over the past decade, the Haley and Herges groups have studied computationally and experimentally the cyclization of the "hetero-ene-ene-yne" motif via an unusual class of concerted reactions known as coarctate reactions. This feature article details our synthetic and mechanistic work involving triazene-arene-alkynes and structurally-related systems to generate heterocycles using coarctate chemistry.

  17. Magnetically suspended reaction wheel assembly

    NASA Technical Reports Server (NTRS)

    Stocking, G.

    1984-01-01

    The magnetically suspended reaction wheel assembly (MSRWA) is the product of a development effort funded by the Air Force Materials Laboratory (AFML) at Wright Patterson AFB. The specific objective of the project was to establish the manufacturing processes for samarium cobalt magnets and demonstrate their use in a space application. The development was successful on both counts. The application portion of the program, which involves the magnetically suspended reaction wheel assembly, is emphasized. The requirements for the reaction wheel were based on the bias wheel requirements of the DSP satellite. The tasks included the design, fabrication, and test of the unit to the DSP program qualification requirements.

  18. Freeze Enhanced Halate Halide Reactions

    NASA Astrophysics Data System (ADS)

    Newberg, J. T.; Weaver, K.; Broderick, A.

    2014-12-01

    Relatively little is known about halate ion species (XO3-; X = I, Br, Cl) in atmospheric condensed phases. It was initial thought that iodate was a terminal stable species upon iodide oxidation. However, it is becoming increasingly recognized that reactions involving iodate can lead to reactive iodine, and this chemistry is accelerated under acidic conditions. The environmental concentrations and chemistry of bromate and chlorate are largely unexplored in environmental ices. We present results from a series of aqueous phase halate ion reactions with halides under acidic conditions, showing that the kinetics are strongly enhanced upon freezing. The products of these reactions are reactive halogens, which have important implications to marine boundary layer chemistry.

  19. Bioluminescent Reaction by Immobilized Luciferase

    NASA Astrophysics Data System (ADS)

    Tanaka, Ryuta; Takahama, Eriko; Iinuma, Masataka; Ikeda, Takeshi; Kadoya, Yutaka; Kuroda, Akio

    We have investigated an effect of immobilization of luciferase molecules at the optical fiber end on a bioluminescent reaction. The time dependence of measured count rates of emitted photons has been analyzed by fitting with numerical solution of differential equations including the effect of the product-inhibitor and the deactivation of the luciferase. Through the analysis, we have successfully extracted kinetic constants such as, reaction rate, number of active luciferase molecules, etc. Ratio of active molecules to total luciferase molecules in immobilization was one order of magnitude lower than that in solution. The reaction rate of the bioluminescent process was also different from the one of free luciferase in solution.

  20. Method for conducting exothermic reactions

    DOEpatents

    Smith, Jr., Lawrence; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  1. Method for conducting exothermic reactions

    DOEpatents

    Smith, L. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-01-05

    A liquid phase process for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  2. Radiative capture reactions in astrophysics

    DOE PAGES

    Brune, Carl R.; Davids, Barry

    2015-08-07

    Here, the radiative capture reactions of greatest importance in nuclear astrophysics are identified and placed in their stellar contexts. Recent experimental efforts to estimate their thermally averaged rates are surveyed.

  3. Sarcoid type reaction: medical hypotheses.

    PubMed

    Tchernev, G; Chokoeva, A A; Patterson, J W; Wollina, U; Lotti, T

    2015-01-01

    Sarcoid-type reactions could not always be clearly distinct from the independent disease sarcoidosis. Particular attention should be paid to paraneoplastic type of sarcoid reaction which until recent literature was characterized as 1) sarcoidosis associated with tumor disease or 2) sarcoidosis classified and presented as paraneoplastic disease. The analogy between sarcoidosis and paraneoplastic type of sarcoid reaction are the pure epithelioid cell granulomas. The role of molecular mimicry in paraneoplastic type of reaction is probably significant but not yet fully proven and understood. Future studies on this issue should be directed to identify the genetic defects (regarding the inflammasome and those recently established at EOS and Blau Syndrome) as well as screening programs for early detection of cancers, with a view to optimization of the subsequent therapy.

  4. Solar-thermal reaction processing

    DOEpatents

    Weimer, Alan W; Dahl, Jaimee K; Lewandowski, Allan A; Bingham, Carl; Raska Buechler, Karen J; Grothe, Willy

    2014-03-18

    In an embodiment, a method of conducting a high temperature chemical reaction that produces hydrogen or synthesis gas is described. The high temperature chemical reaction is conducted in a reactor having at least two reactor shells, including an inner shell and an outer shell. Heat absorbing particles are included in a gas stream flowing in the inner shell. The reactor is heated at least in part by a source of concentrated sunlight. The inner shell is heated by the concentrated sunlight. The inner shell re-radiates from the inner wall and heats the heat absorbing particles in the gas stream flowing through the inner shell, and heat transfers from the heat absorbing particles to the first gas stream, thereby heating the reactants in the gas stream to a sufficiently high temperature so that the first gas stream undergoes the desired reaction(s), thereby producing hydrogen or synthesis gas in the gas stream.

  5. Transfer reactions in nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    Bardayan, D. W.

    2016-08-01

    To a high degree many aspects of the large-scale behavior of objects in the Universe are governed by the underlying nuclear physics. In fact the shell structure of nuclear physics is directly imprinted into the chemical abundances of the elements. The tranquility of the night sky is a direct result of the relatively slow rate of nuclear reactions that control and determines a star’s fate. Understanding the nuclear structure and reaction rates between nuclei is vital to understanding our Universe. Nuclear-transfer reactions make accessible a wealth of knowledge from which we can extract much of the required nuclear physics information. A review of transfer reactions for nuclear astrophysics is presented with an emphasis on the experimental challenges and opportunities for future development.

  6. Experimental Study of Serpentinization Reactions

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Brearley, A. J.; Ganguly, J.; Liermann, H.-P.; Keil, K.

    2004-01-01

    Current carbonaceous chondrite parent-body thermal models [1-3] produce scenarios that are inconsistent with constraints on aqueous alteration conditions based on meteorite mineralogical evidence, such as phase stability relationships within the meteorite matrix minerals [4] and isotope equilibration arguments [5, 6]. This discrepancy arises principally because of the thermal runaway effect produced by silicate hydration reactions (here loosely called serpentinization, as the principal products are serpentine minerals), which are so exothermic as to produce more than enough heat to melt more ice and provide a self-sustaining chain reaction. One possible way to dissipate the heat of reaction is to use a very small parent body [e.g., 2] or possibly a rubble pile model. Another possibility is to release this heat more slowly, which depends on the alteration reaction path and kinetics.

  7. Coping with Traumatic Stress Reactions

    MedlinePlus

    ... Estrés Traumático | Ver todos When trauma survivors take direct action to cope with their stress reactions, they ... impact of trauma on your life and taking direct action to improve things. Active coping occurs even ...

  8. Reaction Dynamics at Liquid Interfaces

    NASA Astrophysics Data System (ADS)

    Benjamin, Ilan

    2015-04-01

    The liquid interface is a narrow, highly anisotropic region, characterized by rapidly varying density, polarity, and molecular structure. I review several aspects of interfacial solvation and show how these affect reactivity at liquid/liquid interfaces. I specifically consider ion transfer, electron transfer, and SN2 reactions, showing that solvent effects on these reactions can be understood by examining the unique structure and dynamics of the liquid interface region.

  9. Reaction dynamics at liquid interfaces.

    PubMed

    Benjamin, Ilan

    2015-04-01

    The liquid interface is a narrow, highly anisotropic region, characterized by rapidly varying density, polarity, and molecular structure. I review several aspects of interfacial solvation and show how these affect reactivity at liquid/liquid interfaces. I specifically consider ion transfer, electron transfer, and SN2 reactions, showing that solvent effects on these reactions can be understood by examining the unique structure and dynamics of the liquid interface region.

  10. Vibrational excitation induces double reaction.

    PubMed

    Huang, Kai; Leung, Lydie; Lim, Tingbin; Ning, Zhanyu; Polanyi, John C

    2014-12-23

    Electron-induced reaction at metal surfaces is currently the subject of extensive study. Here, we broaden the range of experimentation to a comparison of vibrational excitation with electronic excitation, for reaction of the same molecule at the same clean metal surface. In a previous study of electron-induced reaction by scanning tunneling microscopy (STM), we examined the dynamics of the concurrent breaking of the two C-I bonds of ortho-diiodobenzene physisorbed on Cu(110). The energy of the incident electron was near the electronic excitation threshold of E0=1.0 eV required to induce this single-electron process. STM has been employed in the present work to study the reaction dynamics at the substantially lower incident electron energies of 0.3 eV, well below the electronic excitation threshold. The observed increase in reaction rate with current was found to be fourth-order, indicative of multistep reagent vibrational excitation, in contrast to the first-order rate dependence found earlier for electronic excitation. The change in mode of excitation was accompanied by altered reaction dynamics, evidenced by a different pattern of binding of the chemisorbed products to the copper surface. We have modeled these altered reaction dynamics by exciting normal modes of vibration that distort the C-I bonds of the physisorbed reagent. Using the same ab initio ground potential-energy surface as in the prior work on electronic excitation, but with only vibrational excitation of the physisorbed reagent in the asymmetric stretch mode of C-I bonds, we obtained the observed alteration in reaction dynamics.

  11. Cutaneous adverse reactions to lenalidomide.

    PubMed

    Imbesi, S; Allegra, A; Calapai, G; Musolino, C; Gangemi, S

    2015-01-01

    Lenalidomide is an immunomodulatory drug (IMiD) used principally in the treatment of multiple myeloma (MM), myelodysplastic syndromes (MS) and amyloidosis. Adverse reactions related to lenalidomide include myelosuppression (mainly neutropenia but also thrombocytopenia), gastrointestinal problems, skin eruption, atrial fibrillation and asthenia, decreased peripheral blood stem cell yield during stem cell collection, venous thromboembolism, and secondary malignances. In this review we focused our attention on the cutaneous adverse reactions to lenalidomide.

  12. Expert system for predicting reaction conditions: the Michael reaction case.

    PubMed

    Marcou, G; Aires de Sousa, J; Latino, D A R S; de Luca, A; Horvath, D; Rietsch, V; Varnek, A

    2015-02-23

    A generic chemical transformation may often be achieved under various synthetic conditions. However, for any specific reagents, only one or a few among the reported synthetic protocols may be successful. For example, Michael β-addition reactions may proceed under different choices of solvent (e.g., hydrophobic, aprotic polar, protic) and catalyst (e.g., Brønsted acid, Lewis acid, Lewis base, etc.). Chemoinformatics methods could be efficiently used to establish a relationship between the reagent structures and the required reaction conditions, which would allow synthetic chemists to waste less time and resources in trying out various protocols in search for the appropriate one. In order to address this problem, a number of 2-classes classification models have been built on a set of 198 Michael reactions retrieved from literature. Trained models discriminate between processes that are compatible and respectively processes not feasible under a specific reaction condition option (feasible or not with a Lewis acid catalyst, feasible or not in hydrophobic solvent, etc.). Eight distinct models were built to decide the compatibility of a Michael addition process with each considered reaction condition option, while a ninth model was aimed to predict whether the assumed Michael addition is feasible at all. Different machine-learning methods (Support Vector Machine, Naive Bayes, and Random Forest) in combination with different types of descriptors (ISIDA fragments issued from Condensed Graphs of Reactions, MOLMAP, Electronic Effect Descriptors, and Chemistry Development Kit computed descriptors) have been used. Models have good predictive performance in 3-fold cross-validation done three times: balanced accuracy varies from 0.7 to 1. Developed models are available for the users at http://infochim.u-strasbg.fr/webserv/VSEngine.html . Eventually, these were challenged to predict feasibility conditions for ∼50 novel Michael reactions from the eNovalys database (originally

  13. Reaction pathways and possible path bifurcation for the Schmidt reaction.

    PubMed

    Katori, Tetsuji; Itoh, Shuhei; Sato, Makoto; Yamataka, Hiroshi

    2010-03-17

    The N(2) liberation from iminodiazonium ion (2-X) is a key step of the Schmidt rearrangement of ketones. Molecular orbital calculations showed that two concurrent reaction channels, syn-benzyl fragmentation and anti-Me rearrangement, exist for syn-2, whereas anti-2-X proceeds via a single TS. Substituent effect analyses of the reactions of syn-2-X gave concave-upward plots, typical for a concurrent reaction mechanism. On the other hand, the reactions of anti-2-X gave linear Hammett plots, indicative of a single reaction mechanism for all anti-2-X. IRC calculations, however, revealed that the TS led to either an anti-benzyl rearrangement or an anti-benzyl fragmentation product depending on the substituent. Thus, the change of the mechanism (identity of the product) could not be detected by the Hammett plots. Ab initio dynamics simulations for anti-2-X were found to follow the IRC path for X = p-NO(2), giving the rearrangement product, and almost so for X = p-MeO, giving the fragmentation products. However, in borderline cases where X is less donating than p-MeO and less withdrawing than p-NO(2), the trajectories did not follow the minimum energy path on the potential energy surface but gave both rearrangement and fragmentation products directly from the single TS. This is a novel example of path bifurcation for a closed shell anionic reaction. It was concluded that a reactivity-selectivity argument based on the traditional TS theory might not always be applicable even to a well-known textbook organic reaction.

  14. Reactions of stabilized Criegee Intermediates

    NASA Astrophysics Data System (ADS)

    Vereecken, Luc; Harder, Hartwig; Novelli, Anna

    2014-05-01

    Carbonyl oxides (Criegee intermediates) were proposed as key intermediates in the gas phase ozonolysis of alkenes in 1975 by Rudolf Criegee. Despite the importance of ozonolysis in atmospheric chemistry, direct observation of these intermediates remained elusive, with only indirect experimental evidence for their role in the oxidation of hydrocarbons, e.g. through scavenging experiments. Direct experimental observation of stabilized CI has only been achieved since 2008. Since then, a concerted effort using experimental and theoretical means is in motion to characterize the chemistry and kinetics of these reactive intermediates. We present the results of theoretical investigations of the chemistry of Criegee intermediates with a series of coreactants which may be of importance in the atmosphere, in experimental setups, or both. This includes the CI+CI cross-reaction, which proceeds with a rate coefficient near the collision limit and can be important in experimental conditions. The CI + alkene reactions show strong dependence of the rate coefficient depending on the coreactants, but is generally found to be rather slow. The CI + ozone reaction is sufficiently fast to occur both in experiment and the free troposphere, and acts as a sink for CI. The reaction of CI with hydroperoxides, ROOH, is complex, and leads both to the formation of oligomers, as to the formation of reactive etheroxides, with a moderately fast rate coefficient. The importance of these reactions is placed in the context of the reaction conditions in different atmospheric environments ranging from unpolluted to highly polluted.

  15. Kinetics of actinide complexation reactions

    SciTech Connect

    Nash, K.L.; Sullivan, J.C.

    1997-09-01

    Though the literature records extensive compilations of the thermodynamics of actinide complexation reactions, the kinetics of complex formation and dissociation reactions of actinide ions in aqueous solutions have not been extensively investigated. In light of the central role played by such reactions in actinide process and environmental chemistry, this situation is somewhat surprising. The authors report herein a summary of what is known about actinide complexation kinetics. The systems include actinide ions in the four principal oxidation states (III, IV, V, and VI) and complex formation and dissociation rates with both simple and complex ligands. Most of the work reported was conducted in acidic media, but a few address reactions in neutral and alkaline solutions. Complex formation reactions tend in general to be rapid, accessible only to rapid-scan and equilibrium perturbation techniques. Complex dissociation reactions exhibit a wider range of rates and are generally more accessible using standard analytical methods. Literature results are described and correlated with the known properties of the individual ions.

  16. Reciprocity theory of homogeneous reactions

    NASA Astrophysics Data System (ADS)

    Agbormbai, Adolf A.

    1990-03-01

    The reciprocity formalism is applied to the homogeneous gaseous reactions in which the structure of the participating molecules changes upon collision with one another, resulting in a change in the composition of the gas. The approach is applied to various classes of dissociation, recombination, rearrangement, ionizing, and photochemical reactions. It is shown that for the principle of reciprocity to be satisfied it is necessary that all chemical reactions exist in complementary pairs which consist of the forward and backward reactions. The backward reaction may be described by either the reverse or inverse process. The forward and backward processes must satisfy the same reciprocity equation. Because the number of dynamical variables is usually unbalanced on both sides of a chemical equation, it is necessary that this balance be established by including as many of the dynamical variables as needed before the reciprocity equation can be formulated. Statistical transformation models of the reactions are formulated. The models are classified under the titles free exchange, restricted exchange and simplified restricted exchange. The special equations for the forward and backward processes are obtained. The models are consistent with the H theorem and Le Chatelier's principle. The models are also formulated in the context of the direct simulation Monte Carlo method.

  17. A Calibration Reaction For NIF

    NASA Astrophysics Data System (ADS)

    Vande Kolk, B.; Chen, Y.; Deboer, R. J.; Gilardy, G.; Liu, Q.; Lyons, S.; Manukyan, K.; Moran, M.; Seymour, C.; Stech, E.; Strauss, S.; Wiescher, M.

    2016-09-01

    The National Ignition Facility (NIF) can produce a temperature range imitating that which occurs in a star during its hydrogen burning phase. The 10B(p, α)7Be reaction has been selected as a way to determine the temperatures created at NIF. The advantage of this calibration reaction is the product: Be-7 has a half-life of 53.2 days, sufficient for gathering and studying the abundance created while also decaying within several months. A 10 keV resonance exists which dominates the 10B(p, α)7Be reaction as well as 10B(p, γ)11C, another reaction channel of 10B+p. Additionally, another resonance exists for both reactions at 600 keV. There is not reliable extrapolation to the low energies corresponding to those of NIF due to the two mentioned resonances interfering, with a shared spin-parity 5/2+. Measurements were performed and will be presented for the cross-sections of the 10B(p, α)7Be and 10B(p, γ)11C reactions to more confidently extrapolate to lower energies. Research supported by NSF PHY-1419765 and JINA-CEE PHY-1430152.

  18. Concordant chemical reaction networks and the Species-Reaction Graph.

    PubMed

    Shinar, Guy; Feinberg, Martin

    2013-01-01

    In a recent paper it was shown that, for chemical reaction networks possessing a subtle structural property called concordance, dynamical behavior of a very circumscribed (and largely stable) kind is enforced, so long as the kinetics lies within the very broad and natural weakly monotonic class. In particular, multiple equilibria are precluded, as are degenerate positive equilibria. Moreover, under certain circumstances, also related to concordance, all real eigenvalues associated with a positive equilibrium are negative. Although concordance of a reaction network can be decided by readily available computational means, we show here that, when a nondegenerate network's Species-Reaction Graph satisfies certain mild conditions, concordance and its dynamical consequences are ensured. These conditions are weaker than earlier ones invoked to establish kinetic system injectivity, which, in turn, is just one ramification of network concordance. Because the Species-Reaction Graph resembles pathway depictions often drawn by biochemists, results here expand the possibility of inferring significant dynamical information directly from standard biochemical reaction diagrams.

  19. Reaction rates for a generalized reaction-diffusion master equation

    SciTech Connect

    Hellander, Stefan; Petzold, Linda

    2016-01-19

    It has been established that there is an inherent limit to the accuracy of the reaction-diffusion master equation. Specifically, there exists a fundamental lower bound on the mesh size, below which the accuracy deteriorates as the mesh is refined further. In this paper we extend the standard reaction-diffusion master equation to allow molecules occupying neighboring voxels to react, in contrast to the traditional approach in which molecules react only when occupying the same voxel. We derive reaction rates, in two dimensions as well as three dimensions, to obtain an optimal match to the more fine-grained Smoluchowski model, and show in two numerical examples that the extended algorithm is accurate for a wide range of mesh sizes, allowing us to simulate systems that are intractable with the standard reaction-diffusion master equation. In addition, we show that for mesh sizes above the fundamental lower limit of the standard algorithm, the generalized algorithm reduces to the standard algorithm. We derive a lower limit for the generalized algorithm which, in both two dimensions and three dimensions, is on the order of the reaction radius of a reacting pair of molecules.

  20. Reaction rates for a generalized reaction-diffusion master equation.

    PubMed

    Hellander, Stefan; Petzold, Linda

    2016-01-01

    It has been established that there is an inherent limit to the accuracy of the reaction-diffusion master equation. Specifically, there exists a fundamental lower bound on the mesh size, below which the accuracy deteriorates as the mesh is refined further. In this paper we extend the standard reaction-diffusion master equation to allow molecules occupying neighboring voxels to react, in contrast to the traditional approach, in which molecules react only when occupying the same voxel. We derive reaction rates, in two dimensions as well as three dimensions, to obtain an optimal match to the more fine-grained Smoluchowski model and show in two numerical examples that the extended algorithm is accurate for a wide range of mesh sizes, allowing us to simulate systems that are intractable with the standard reaction-diffusion master equation. In addition, we show that for mesh sizes above the fundamental lower limit of the standard algorithm, the generalized algorithm reduces to the standard algorithm. We derive a lower limit for the generalized algorithm which, in both two dimensions and three dimensions, is of the order of the reaction radius of a reacting pair of molecules.

  1. Concordant Chemical Reaction Networks and the Species-Reaction Graph

    PubMed Central

    Shinar, Guy; Feinberg, Martin

    2015-01-01

    In a recent paper it was shown that, for chemical reaction networks possessing a subtle structural property called concordance, dynamical behavior of a very circumscribed (and largely stable) kind is enforced, so long as the kinetics lies within the very broad and natural weakly monotonic class. In particular, multiple equilibria are precluded, as are degenerate positive equilibria. Moreover, under certain circumstances, also related to concordance, all real eigenvalues associated with a positive equilibrium are negative. Although concordance of a reaction network can be decided by readily available computational means, we show here that, when a nondegenerate network’s Species-Reaction Graph satisfies certain mild conditions, concordance and its dynamical consequences are ensured. These conditions are weaker than earlier ones invoked to establish kinetic system injectivity, which, in turn, is just one ramification of network concordance. Because the Species-Reaction Graph resembles pathway depictions often drawn by biochemists, results here expand the possibility of inferring significant dynamical information directly from standard biochemical reaction diagrams. PMID:22940368

  2. Reaction rates for a generalized reaction-diffusion master equation

    DOE PAGES

    Hellander, Stefan; Petzold, Linda

    2016-01-19

    It has been established that there is an inherent limit to the accuracy of the reaction-diffusion master equation. Specifically, there exists a fundamental lower bound on the mesh size, below which the accuracy deteriorates as the mesh is refined further. In this paper we extend the standard reaction-diffusion master equation to allow molecules occupying neighboring voxels to react, in contrast to the traditional approach in which molecules react only when occupying the same voxel. We derive reaction rates, in two dimensions as well as three dimensions, to obtain an optimal match to the more fine-grained Smoluchowski model, and show inmore » two numerical examples that the extended algorithm is accurate for a wide range of mesh sizes, allowing us to simulate systems that are intractable with the standard reaction-diffusion master equation. In addition, we show that for mesh sizes above the fundamental lower limit of the standard algorithm, the generalized algorithm reduces to the standard algorithm. We derive a lower limit for the generalized algorithm which, in both two dimensions and three dimensions, is on the order of the reaction radius of a reacting pair of molecules.« less

  3. Reaction rates for mesoscopic reaction-diffusion kinetics

    DOE PAGES

    Hellander, Stefan; Hellander, Andreas; Petzold, Linda

    2015-02-23

    The mesoscopic reaction-diffusion master equation (RDME) is a popular modeling framework frequently applied to stochastic reaction-diffusion kinetics in systems biology. The RDME is derived from assumptions about the underlying physical properties of the system, and it may produce unphysical results for models where those assumptions fail. In that case, other more comprehensive models are better suited, such as hard-sphere Brownian dynamics (BD). Although the RDME is a model in its own right, and not inferred from any specific microscale model, it proves useful to attempt to approximate a microscale model by a specific choice of mesoscopic reaction rates. In thismore » paper we derive mesoscopic scale-dependent reaction rates by matching certain statistics of the RDME solution to statistics of the solution of a widely used microscopic BD model: the Smoluchowski model with a Robin boundary condition at the reaction radius of two molecules. We also establish fundamental limits on the range of mesh resolutions for which this approach yields accurate results and show both theoretically and in numerical examples that as we approach the lower fundamental limit, the mesoscopic dynamics approach the microscopic dynamics. Finally, we show that for mesh sizes below the fundamental lower limit, results are less accurate. Thus, the lower limit determines the mesh size for which we obtain the most accurate results.« less

  4. Reaction rates for mesoscopic reaction-diffusion kinetics

    SciTech Connect

    Hellander, Stefan; Hellander, Andreas; Petzold, Linda

    2015-02-23

    The mesoscopic reaction-diffusion master equation (RDME) is a popular modeling framework frequently applied to stochastic reaction-diffusion kinetics in systems biology. The RDME is derived from assumptions about the underlying physical properties of the system, and it may produce unphysical results for models where those assumptions fail. In that case, other more comprehensive models are better suited, such as hard-sphere Brownian dynamics (BD). Although the RDME is a model in its own right, and not inferred from any specific microscale model, it proves useful to attempt to approximate a microscale model by a specific choice of mesoscopic reaction rates. In this paper we derive mesoscopic scale-dependent reaction rates by matching certain statistics of the RDME solution to statistics of the solution of a widely used microscopic BD model: the Smoluchowski model with a Robin boundary condition at the reaction radius of two molecules. We also establish fundamental limits on the range of mesh resolutions for which this approach yields accurate results and show both theoretically and in numerical examples that as we approach the lower fundamental limit, the mesoscopic dynamics approach the microscopic dynamics. Finally, we show that for mesh sizes below the fundamental lower limit, results are less accurate. Thus, the lower limit determines the mesh size for which we obtain the most accurate results.

  5. Nuclear Reactions for Astrophysics and Other Applications

    SciTech Connect

    Escher, J E; Burke, J T; Dietrich, F S; Scielzo, N D; Ressler, J J

    2011-03-01

    Cross sections for compound-nuclear reactions are required for many applications. The surrogate nuclear reactions method provides an indirect approach for determining cross sections for reactions on unstable isotopes, which are difficult or impossible to measure otherwise. Current implementations of the method provide useful cross sections for (n,f) reactions, but need to be improved upon for applications to capture reactions.

  6. Combustion kinetics and reaction pathways

    SciTech Connect

    Klemm, R.B.; Sutherland, J.W.

    1993-12-01

    This project is focused on the fundamental chemistry of combustion. The overall objectives are to determine rate constants for elementary reactions and to elucidate the pathways of multichannel reactions. A multitechnique approach that features three independent experiments provides unique capabilities in performing reliable kinetic measurements over an exceptionally wide range in temperature, 300 to 2500 K. Recent kinetic work has focused on experimental studies and theoretical calculations of the methane dissociation system (CH{sub 4} + Ar {yields} CH{sub 3} + H + Ar and H + CH{sub 4} {yields} CH{sub 3} + H{sub 2}). Additionally, a discharge flow-photoionization mass spectrometer (DF-PIMS) experiment is used to determine branching fractions for multichannel reactions and to measure ionization thresholds of free radicals. Thus, these photoionization experiments generate data that are relevant to both reaction pathways studies (reaction dynamics) and fundamental thermochemical research. Two distinct advantages of performing PIMS with high intensity, tunable vacuum ultraviolet light at the National Synchrotron Light Source are high detection sensitivity and exceptional selectivity in monitoring radical species.

  7. Dynamical model of surrogate reactions

    SciTech Connect

    Aritomo, Y.; Chiba, S.; Nishio, K.

    2011-08-15

    A new dynamical model is developed to describe the whole process of surrogate reactions: Transfer of several nucleons at an initial stage, thermal equilibration of residues leading to washing out of shell effects, and decay of populated compound nuclei are treated in a unified framework. Multidimensional Langevin equations are employed to describe time evolution of collective coordinates with a time-dependent potential energy surface corresponding to different stages of surrogate reactions. The new model is capable of calculating spin distributions of the compound nuclei, one of the most important quantities in the surrogate technique. Furthermore, various observables of surrogate reactions can be calculated, for example, energy and angular distribution of ejectile and mass distributions of fission fragments. These features are important to assess validity of the proposed model itself, to understand mechanisms of the surrogate reactions, and to determine unknown parameters of the model. It is found that spin distributions of compound nuclei produced in {sup 18}O+{sup 238}U{yields}{sup 16}O+{sup 240}*U and {sup 18}O+{sup 236}U{yields}{sup 16}O+{sup 238}*U reactions are equivalent and much less than 10({h_bar}/2{pi}) and therefore satisfy conditions proposed by Chiba and Iwamoto [Phys. Rev. C 81, 044604 (2010)] if they are used as a pair in the surrogate ratio method.

  8. Enzymatic Reactions in Microfluidic Devices

    NASA Astrophysics Data System (ADS)

    Ristenpart, W. D.; Wan, J.; Stone, H. A.

    2008-11-01

    We establish simple scaling laws for enzymatic reactions in microfluidic devices, and we demonstrate that kinetic parameters obtained conventionally using multiple stop-flow experiments may instead be extracted from a single microfluidic experiment. Introduction of an enzyme and substrate species in different arms of a Y-shaped channel allows the two species to diffuse across the parallel streamlines and to begin reacting. Measurements of the product concentration versus distance down the channel provide information about the kinetics of the reaction. In the limit where the enzyme is much larger (and thus less diffusive) than the substrate, we show that near the entrance the total amount of product (P) formed varies as a power law in the distance x down the channel. For reactions that follow standard Michaelis-Menten kinetics, the power law takes the form P˜(Vmax/Km) x^5/2, where Vmax and Km are the maximum reaction rate and Michaelis constant respectively. If a large excess of substrate is used, then Km is identified by measuring Vmax far downstream where the different species are completely mixed by diffusion. Numerical simulations and experiments using the bioluminescent reaction between luciferase and ATP as a model system are both shown to accord with the model. We discuss the implications for significant savings in the amount of time and enzyme required for determination of kinetic parameters.

  9. Radiation reaction in quantum vacuum

    NASA Astrophysics Data System (ADS)

    Seto, Keita

    2015-02-01

    Since the development of the radiating electron theory by P. A. M. Dirac in 1938 [P. A. M. Dirac, Proc. R. Soc. Lond. A 167, 148 (1938)], many authors have tried to reformulate this model, called the "radiation reaction". Recently, this equation has become important for ultra-intense laser-electron (plasma) interactions. In our recent research, we found a stabilized model of the radiation reaction in quantum vacuum [K. Seto et al., Prog. Theor. Exp. Phys. 2014, 043A01 (2014)]. It led us to an updated Fletcher-Millikan charge-to-mass ratio including radiation. In this paper, I will discuss the generalization of our previous model and the new equation of motion with the radiation reaction in quantum vacuum via photon-photon scatterings and also introduce the new tensor d{E}^{μ ν α β }/dm, as the anisotropy of the charge-to-mass ratio.

  10. Photonuclear reactions on titanium isotopes

    SciTech Connect

    Belyshev, S. S.; Dzhilavyan, L. Z.; Ishkhanov, B. S.; Kapitonov, I. M.; Kuznetsov, A. A. Orlin, V. N.; Stopani, K. A.

    2015-03-15

    The photodisintegration of titanium isotopes in the giant-dipole-resonance energy region is studied by the photon-activation method. Bremsstrahlung photons whose spectrum has the endpoint energy of 55 MeV is used. The yields and integrated cross sections are determined for photoproton reactions on the titanium isotopes {sup 47,48,49,50}Ti. The respective experimental results are compared with their counterparts calculated on the basis of the TALYS code and a combined photonucleon-reaction model. The TALYS code disregards the isospin structure of the giant dipole resonance and is therefore unable to describe the yield of photoproton reactions on the heavy titanium isotopes {sup 49,50}Ti.

  11. Radiation reaction in various dimensions

    NASA Astrophysics Data System (ADS)

    Gal'Tsov, Dmitri V.

    2002-07-01

    We discuss the radiation reaction problem for an electric charge moving in flat space-time of arbitrary dimensions. It is shown that four is the unique dimension where a local differential equation exists accounting for the radiation reaction and admitting a consistent mass renormalization (the Lorentz-Dirac equation). In odd dimensions Huygens's principle does not hold, and, as a result, the radiation reaction force depends on the whole past history of a charge (radiative tail). We show that the divergence in the tail integral can be removed by the mass renormalization only in the 2+1 theory. In even dimensions higher than four, divergences cannot be removed by the mass renormalization.

  12. Surface reactions of natural glasses

    SciTech Connect

    White, A.F.

    1986-12-31

    Reactions at natural glass surfaces are important in studies involving nuclear waste transport due to chemical control on ground water in host rocks such as basalt and tuff, to potential diffusion into natural hydrated glass surfaces and as natural analogs for waste glass stability. Dissolution kinetics can be described by linear surface reaction coupled with cation interdiffusion with resulting rates similar to those of synthetic silicate glasses. Rates of Cs diffusion into hydrated obsidian surfaces between 25{sup 0} and 75{sup 0}C were determined by XPS depth profiles and loss rates from aqueous solutions. Calculated diffusion coefficients were ten others of magnitude more rapid than predicted from an Arrhenius extrapolation of high temperature tracer diffusion data due to surface hydration reactions.

  13. Reaction theory for exotic nuclei

    SciTech Connect

    Bonaccorso, Angela

    2014-05-09

    Exotic nuclei are usually defined as those with unusual N/Z ratios. They can be found in the crust of neutron stars enbedded in a sea of electrons or created in laboratory by fragmentation of a primary beam (in-flight method) or of the target (ISOL method). They are extremely important for nuclear astrophysics, see for example Ref.[1]. Furthermore by studying them we can check the limits of validity of nuclear reaction and structure models. This contribution will be devoted to the understanding of how by using reaction theory and comparing to the data we can extract structure information. We shall discuss the differences between the mechanisms of transfer and breakup reactions, an we will try to explain how nowadays it is possible to do accurate spectroscopy in extreme conditions.

  14. A unified diabatic description for electron transfer reactions, isomerization reactions, proton transfer reactions, and aromaticity.

    PubMed

    Reimers, Jeffrey R; McKemmish, Laura K; McKenzie, Ross H; Hush, Noel S

    2015-10-14

    While diabatic approaches are ubiquitous for the understanding of electron-transfer reactions and have been mooted as being of general relevance, alternate applications have not been able to unify the same wide range of observed spectroscopic and kinetic properties. The cause of this is identified as the fundamentally different orbital configurations involved: charge-transfer phenomena involve typically either 1 or 3 electrons in two orbitals whereas most reactions are typically closed shell. As a result, two vibrationally coupled electronic states depict charge-transfer scenarios whereas three coupled states arise for closed-shell reactions of non-degenerate molecules and seven states for the reactions implicated in the aromaticity of benzene. Previous diabatic treatments of closed-shell processes have considered only two arbitrarily chosen states as being critical, mapping these states to those for electron transfer. We show that such effective two-state diabatic models are feasible but involve renormalized electronic coupling and vibrational coupling parameters, with this renormalization being property dependent. With this caveat, diabatic models are shown to provide excellent descriptions of the spectroscopy and kinetics of the ammonia inversion reaction, proton transfer in N2H7(+), and aromaticity in benzene. This allows for the development of a single simple theory that can semi-quantitatively describe all of these chemical phenomena, as well as of course electron-transfer reactions. It forms a basis for understanding many technologically relevant aspects of chemical reactions, condensed-matter physics, chemical quantum entanglement, nanotechnology, and natural or artificial solar energy capture and conversion.

  15. Coupled Reactions "versus" Connected Reactions: Coupling Concepts with Terms

    ERIC Educational Resources Information Center

    Aledo, Juan Carlos

    2007-01-01

    A hallmark of living matter is its ability to extract and transform energy from the environment. Not surprisingly, biology students are required to take thermodynamics. The necessity of coupling exergonic reactions to endergonic processes is easily grasped by most undergraduate students. However, when addressing the thermodynamic concept of…

  16. Inorganic Reaction Mechanisms Part II: Homogeneous Catalysis

    ERIC Educational Resources Information Center

    Cooke, D. O.

    1976-01-01

    Suggests several mechanisms for catalysis by metal ion complexes. Discusses the principal factors of importance in these catalysis reactions and suggests reactions suitable for laboratory study. (MLH)

  17. Reaction pathway for alkane dehydrocyclization

    SciTech Connect

    Shi, Buchang; Davis, B.H.

    1996-08-01

    Naphtha reforming to produce high octane gasoline is an important process. Many reaction mechanisms are involved in this process. For example, the study of the fundamentals of this process led to the concept of bi- or poly-functional catalysis. The results of this study provide additional mechanistic information about the dehydrocyclization of an n-alkane to produce aromatics. The reaction coordinate diagram advanced to account for the observation of irreversible adsorption should be modified to account for the present results. 32 refs., 1 fig.

  18. Spallation-induced fission reactions

    NASA Astrophysics Data System (ADS)

    Benlliure, J.; Rodríguez-Sánchez, J. L.

    2017-03-01

    During the last decade spallation-induced fission reactions have received particular attention because of their impact in the design of spallation-neutron sources or radioactive beam facilities, but also in the understanding of the fission process at high excitation energy. In this paper, we review the main progress brought by modern experimental techniques, in particular those based in the inverse kinematic, as well as the achievements in modelling these reactions. We will also address future possibilities for improving the investigation of fission dynamics.

  19. Theoretical Studies of Reaction Surfaces

    DTIC Science & Technology

    2007-11-02

    31 Aug 97 4. TITLE AND SUBTITLE 5 . FUNDING NUMBERS AASERT93 THEORETICAL STUDIES OF REACTION SURFACES F49620-93-1-0556 3484/XS 6. AUTHOR(S) 61103D DR...DUNCAN AVE ROOM B115 BOLLING AFB DC 20332- 8050 DR MICHAEL R. BERMAN 11. SUPPLEMENTARY NOTES 12a. DISTRIBUTION i AVAILABILITY STATEMENT Approved f or pill...reaction14 , and solvation of electrolytes1 5 . The EFP method described in the previous section has one drawback: the repulsive 3 potential relies on

  20. Ionic Reactions of Atmospheric Importance.

    DTIC Science & Technology

    1984-08-31

    Kingdom E.E. Ferguson* Laboratoire de Resonance Electronique et Ionique Universitd de Paris-Sud, Orsay, France Abstract Reaction rate coefficients have...reactions from N2(v = 1) to 02+ (v -0) and NO+(v = 0) E. E. Ferguson*) Laboratoire de Resonance Electronique el lonique Universiti de Paris-Sud, Orsay...practice, however, this condition cannot be realised and so ne(z) is first determined in the absence of attaching gas to derive uD , neZ ) then

  1. Learning to predict chemical reactions.

    PubMed

    Kayala, Matthew A; Azencott, Chloé-Agathe; Chen, Jonathan H; Baldi, Pierre

    2011-09-26

    Being able to predict the course of arbitrary chemical reactions is essential to the theory and applications of organic chemistry. Approaches to the reaction prediction problems can be organized around three poles corresponding to: (1) physical laws; (2) rule-based expert systems; and (3) inductive machine learning. Previous approaches at these poles, respectively, are not high throughput, are not generalizable or scalable, and lack sufficient data and structure to be implemented. We propose a new approach to reaction prediction utilizing elements from each pole. Using a physically inspired conceptualization, we describe single mechanistic reactions as interactions between coarse approximations of molecular orbitals (MOs) and use topological and physicochemical attributes as descriptors. Using an existing rule-based system (Reaction Explorer), we derive a restricted chemistry data set consisting of 1630 full multistep reactions with 2358 distinct starting materials and intermediates, associated with 2989 productive mechanistic steps and 6.14 million unproductive mechanistic steps. And from machine learning, we pose identifying productive mechanistic steps as a statistical ranking, information retrieval problem: given a set of reactants and a description of conditions, learn a ranking model over potential filled-to-unfilled MO interactions such that the top-ranked mechanistic steps yield the major products. The machine learning implementation follows a two-stage approach, in which we first train atom level reactivity filters to prune 94.00% of nonproductive reactions with a 0.01% error rate. Then, we train an ensemble of ranking models on pairs of interacting MOs to learn a relative productivity function over mechanistic steps in a given system. Without the use of explicit transformation patterns, the ensemble perfectly ranks the productive mechanism at the top 89.05% of the time, rising to 99.86% of the time when the top four are considered. Furthermore, the system

  2. Incomplete reactions in nanothermite composites

    NASA Astrophysics Data System (ADS)

    Jacob, Rohit J.; Ortiz-Montalvo, Diana L.; Overdeep, Kyle R.; Weihs, Timothy P.; Zachariah, Michael R.

    2017-02-01

    Exothermic reactions between oxophilic metals and transition/post transition metal-oxides have been well documented owing to their fast reaction time scales (≈10 μs). This article examines the extent of the reaction in nano-aluminum based thermite systems through a forensic inspection of the products formed during reaction. Three nanothermite systems (Al/CuO, Al/Bi2O3, and Al/WO3) were selected owing to their diverse combustion characteristics, thereby providing sufficient generality and breadth to the analysis. Microgram quantities of the sample were coated onto a fine platinum wire, which was resistively heated at high heating rates (≈105 K/s) to ignite the sample. The subsequent products were captured/quenched very rapidly (≈500 μs) in order to preserve the chemistry/morphology during initiation and subsequent reaction and were quantitatively analyzed using electron microscopy and focused ion beam cross-sectioning followed by energy dispersive X-ray spectroscopy. Elemental examination of the cross-section of the quenched particles shows that oxygen is predominantly localized in the regions containing aluminum, implying the occurrence of the redox reaction. The Al/CuO system, which has simultaneous gaseous oxygen release and ignition (TIgnition ≈ TOxygen Release), shows a substantially lower oxygen content within the product particles as opposed to Al/Bi2O3 and Al/WO3 thermites, which are postulated to undergo a condensed phase reaction (TIgnition ≪ TOxygen Release). An effective Al:O composition for the interior section was obtained for all the mixtures, with the smaller particles generally showing a higher oxygen content than the larger ones. The observed results were further corroborated with the reaction temperature, obtained using a high-speed spectro-pyrometer, and bomb calorimetry conducted on larger samples (≈15 mg). The results suggest that thermites that produce sufficient amounts of gaseous products generate smaller product particles and

  3. Reactions Induced by Platelet Transfusions

    PubMed Central

    Kiefel, Volker

    2008-01-01

    Summary Platelet transfusions play a central role in therapeutic regimens for patients with hematologic/oncologic diseases who develop severe thrombocytopenia either in the course of their disease or following cytostatic therapy. Like other blood components, platelet transfusions have achieved a high degree of safety as far as transmission of viral diseases is concerned. However, transfusion of platelet concentrates is accompanied by a high frequency of febrile and anaphylactoid reactions. In rare cases, recipients of platelet concentrates are threatened by severe reactions as septic complications due to bacterial contamination of platelet concentrates, transfusion-related acute lung injury and severe anaphylactic episodes. PMID:21512624

  4. Some concepts in reaction dynamics.

    PubMed

    Polanyi, J C

    1987-05-08

    The objective in this work has been one which I have shared with the two other 1986 Nobel lecturers in chemistry, D. R. Herschbach and Y. T. Lee, as well as with a wide group of colleagues and co-workers who have been responsible for bringing this field to its current state. That state is summarized in the title; we now have some concepts relevant to the motions of atoms and molecules in simple reactions, and some examples of the application of these concepts. We are, however, richer in vocabulary than in literature. The great epics of reaction dynamics remain to be written. I shall confine myself to some simple stories.

  5. Learning to Predict Chemical Reactions

    PubMed Central

    Kayala, Matthew A.; Azencott, Chloé-Agathe; Chen, Jonathan H.

    2011-01-01

    Being able to predict the course of arbitrary chemical reactions is essential to the theory and applications of organic chemistry. Approaches to the reaction prediction problems can be organized around three poles corresponding to: (1) physical laws; (2) rule-based expert systems; and (3) inductive machine learning. Previous approaches at these poles respectively are not high-throughput, are not generalizable or scalable, or lack sufficient data and structure to be implemented. We propose a new approach to reaction prediction utilizing elements from each pole. Using a physically inspired conceptualization, we describe single mechanistic reactions as interactions between coarse approximations of molecular orbitals (MOs) and use topological and physicochemical attributes as descriptors. Using an existing rule-based system (Reaction Explorer), we derive a restricted chemistry dataset consisting of 1630 full multi-step reactions with 2358 distinct starting materials and intermediates, associated with 2989 productive mechanistic steps and 6.14 million unproductive mechanistic steps. And from machine learning, we pose identifying productive mechanistic steps as a statistical ranking, information retrieval, problem: given a set of reactants and a description of conditions, learn a ranking model over potential filled-to-unfilled MO interactions such that the top ranked mechanistic steps yield the major products. The machine learning implementation follows a two-stage approach, in which we first train atom level reactivity filters to prune 94.00% of non-productive reactions with a 0.01% error rate. Then, we train an ensemble of ranking models on pairs of interacting MOs to learn a relative productivity function over mechanistic steps in a given system. Without the use of explicit transformation patterns, the ensemble perfectly ranks the productive mechanism at the top 89.05% of the time, rising to 99.86% of the time when the top four are considered. Furthermore, the system

  6. [Allergic reactions to implant materials].

    PubMed

    Thomas, P

    2003-01-01

    The extent of the immune response upon implantation of metallic devices depends on the individual reactivity and on material characteristics. If specific T-cellular sensitization occurs or an allergy to metal preexists, hypersensitive reactions to implant components may develop. They include eczema, impaired wound healing, and sterile osteomyelitis. The existence of allergy-induced implant loosening is still an open question. Further improvement of clinical allergological diagnostics, better understanding of peri-implantar immune reactions, and interdisciplinary collection of epidemiological data concerning allergy to implants will contribute to a better knowledge about tolerance of implant material in humans.

  7. Vision 2020. Reaction Engineering Roadmap

    SciTech Connect

    Klipstein, David H.; Robinson, Sharon

    2001-01-01

    The Reaction Engineering Roadmap is a part of an industry- wide effort to create a blueprint of the research and technology milestones that are necessary to achieve longterm industry goals. This report documents the results of a workshop focused on the research needs, technology barriers, and priorities of the chemical industry as they relate to reaction engineering viewed first by industrial use (basic chemicals; specialty chemicals; pharmaceuticals; and polymers) and then by technology segment (reactor system selection, design, and scale-up; chemical mechanism development and property estimation; dealing with catalysis; and new, nonstandard reactor types).

  8. Severe allergic reaction to Dermabond.

    PubMed

    Perry, Arthur W; Sosin, Michael

    2009-01-01

    The use of 2-octyl cyanoacrylate (Dermabond; Ethicon, Somerville, NJ) for wound closure is increasingly popular. Problems with Dermabond are generally related to application techniques and rarely relate to the chemical nature of the adhesive. This article describes a severe allergic reaction to Dermabond following breast augmentation/mastopexy.

  9. Reduction of chemical reaction models

    NASA Technical Reports Server (NTRS)

    Frenklach, Michael

    1991-01-01

    An attempt is made to reconcile the different terminologies pertaining to reduction of chemical reaction models. The approaches considered include global modeling, response modeling, detailed reduction, chemical lumping, and statistical lumping. The advantages and drawbacks of each of these methods are pointed out.

  10. Knoevenagel Reaction of Unprotected Sugars

    NASA Astrophysics Data System (ADS)

    Scherrmann, Marie-Christine

    The Knoevenagel reaction of unprotected sugars was investigated in the 1950s using zinc chloride as promoter. The so-called Garcia Gonzalez reaction had been almost forgotten for 50 years, until the emergence of new water tolerant catalysts having Lewis acid behavior. The reaction was thus reinvestigated and optimal conditions have been found to prepare trihydroxylated furan derivatives from pentose or β-tetrahydrofuranylfuran from hexoses with non-cyclic β-keto ester or β-diketones. Other valuable compounds such as β-linked tetrahydrobenzofuranyl glycosides or hydroxyalkyl-3,3,6,6,-tetramethyl-3,4,5,6,7,9-hexahydro-1H-xanthene-1,8(2H)-dione can be obtained using cyclic β-dicarbonylic derivatives. Apart from one report in the 1950s, the Knoevenagel reaction of unprotected carbohydrate in basic condition has been studied only in the mid-1980s to prepare C-glycosyl barbiturates from barbituric acids and, later on, from non-cyclic β-diketones, β-C-glycosidic ketones. The efficient method exploited to prepare such compounds has found an industrial development in cosmetics.

  11. Reaction profiles in porous electrodes

    NASA Astrophysics Data System (ADS)

    Katan, T.; Carlen, P. J.

    1985-05-01

    An experimental program was conducted to ascertain causes of alkaline zinc electrode shape change and to determine the development of reaction profiles within the pores of porous zinc electrodes. Various analog electrochemical cells were operated to isolate and evaluate the individual processes occurring during charge and discharge. It was found that both edge effects and osmosis can be responsible for the shape change phenomenon.

  12. HADES results in elementary reactions

    NASA Astrophysics Data System (ADS)

    Ramstein, B.; Adamczewski-Musch, J.; Arnold, O.; Atomssa, E. T.; Behnke, C.; Berger-Chen, J. C.; Biernat, J.; Blanco, A.; Blume, C.; Böhmer, M.; Bordalo, P.; Chernenko, S.; Deveaux, C.; Dybczak, A.; Epple, E.; Fabbietti, L.; Fateev, O.; Fonte, P.; Franco, C.; Friese, J.; Fröhlich, I.; Galatyuk, T.; Garzón, J. A.; Gill, K.; Golubeva, M.; Guber, F.; Gumberidze, M.; Harabasz, S.; Hennino, T.; Hlavac, S.; Höhne, C.; Holzmann, R.; Ierusalimov, A.; Ivashkin, A.; Jurkovic, M.; Kämpfer, B.; Karavicheva, T.; Kardan, K.; Koenig, I.; Koenig, W.; Kolb, B. W.; Korcyl, G.; Kornakov, G.; Kotte, R.; Krása, A.; Krebs, E.; Kuc, H.; Kugler, A.; Kunz, T.; Kurepin, A.; Kurilkin, A.; Kurilkin, P.; Ladygin, V.; Lalik, R.; Lapidus, K.; Lebedev, A.; Lopes, L.; Lorenz, M.; Mahmoud, T.; Maier, L.; Mangiarotti, A.; Markert, J.; Metag, V.; Michel, J.; Müntz, C.; Münzer, R.; Naumann, L.; Palka, M.; Parpottas, Y.; Pechenov, V.; Pechenova, O.; Petousis, V.; Pietraszko, J.; Przygoda, W.; Rehnisch, L.; Reshetin, A.; Rost, A.; Rustamov, A.; Sadovsky, A.; Salabura, P.; Scheib, T.; Schmidt-Sommerfeld, K.; Schuldes, H.; Sellheim, P.; Siebenson, J.; Silva, L.; Sobolev, Yu. G.; Spataro, S.; Ströbele, H.; Stroth, J.; Strzempek, P.; Sturm, C.; Svoboda, O.; Tarantola, A.; Teilab, K.; Tlusty, P.; Traxler, M.; Tsertos, H.; Vasiliev, T.; Wagner, V.; Wendisch, C.; Wirth, J.; Wüstenfeld, J.; Zanevsky, Y.; Zumbruch, P.

    2014-11-01

    Recent results obtained with the HADES experimental set-up at GSI are presented with a focus on dielectron production and strangeness in pp and quasi-free np reactions. Perspectives related to the very recent experiment using the pion beam at GSI are also discussed.

  13. Fission Reaction Event Yield Algorithm

    SciTech Connect

    Hagmann, Christian; Verbeke, Jerome; Vogt, Ramona; Roundrup, Jorgen

    2016-05-31

    FREYA (Fission Reaction Event Yield Algorithm) is a code that simulated the decay of a fissionable nucleus at specified excitation energy. In its present form, FREYA models spontaneous fission and neutron-induced fission up to 20 MeV. It includes the possibility of neutron emission from the nuclear prior to its fussion (nth chance fission).

  14. The Pitfalls of Precipitation Reactions.

    ERIC Educational Resources Information Center

    Slade, Peter W.; Rayner-Canham, Geoffrey W.

    1990-01-01

    Described are some of the difficulties presented in these reactions by competing equilibria that are usually ignored. Situations involving acid-base equilibria, solubility product calculations, the use of ammonia as a complexing agent, and semiquantitative comparisons of solubility product values are discussed. (CW)

  15. Humanism and science: a reaction.

    PubMed

    Wampold, Bruce E

    2012-12-01

    Authors in this section have noted that humanism is intrinsic to psychotherapy, although disagreements remain. One of the disagreements is about the role of science in humanism. In this reaction, I contend that humanism, as discussed in these articles, is a legitimate theory to be subjected to scientific scrutiny.

  16. Teachers' Reactions to Children's Aggression

    ERIC Educational Resources Information Center

    Nesdale, Drew; Pickering, Kaye

    2006-01-01

    Drawing on social schema theory (Fiske & Taylor, 1991) and social identity theory (Tajfel & Turner, 1979), this study examined the impact on teachers' reactions to children's aggression of three variables, two of which were related to the aggressors and one was related to the teachers. Experienced female elementary school teachers (N=90) each read…

  17. Vibrational Participation in Chemical Reactions.

    DTIC Science & Technology

    1986-08-22

    Cesaro Xue-Feng Yang .. V-. V 8. IV. BIBLIOGRAPHY, AFOSR-SPONSORED RESEARCH, 1981 - 1984 1981 Vibrational Excitation of Ozone and Molecular Fluorine...Phys. Chem. 87, 2142 (1983). G.C. Pimentel, S.N. Cesaro and H. Frei. 11. Selective Vibronic Excitation of Singlet Oxygen-Furan Reactions in Cryogenic

  18. Severe immediate reaction to nabumetone.

    PubMed

    Gonzalo-Garijo, M A; Cordobés-Duran, C; Lamilla-Yerga, A M; Moreno-Gastón, I

    2007-01-01

    Nabumetone is a nonsteroidal antiinflammatory (NSAID) prodrug that inhibits cyclooxygenase-2. It has been recommended as a safe alternative in most patients with hypersensitivity reactions to NSAIDs. Systemic reactions caused by nabumetone are not frequent. We report 2 cases of immediate systemic reactions due to nabumetone. The first case involved a 68-year-old woman who developed immediate generalized pruritus, erythema, morbilliform eruption, swollen tongue sensation, diarrhea, and hypotension after the ingestion of a single dose of nabumetone. In the second case, a 77-year-old woman developed generalized pruritus, palm erythema, colic abdominal pain, diarrhea, dizziness, tightness of the chest, dyspnea, and hypotension immediately after oral intake of nabumetone. Both patients had previously tolerated this drug. Since these episodes, they have avoided nabumetone. Skin prick tests with nabumetone (10 and 100 mg/mL) were negative. Oral challenge tests with other NSAIDs, even of the same group as nabumetone, were negative in both patients. The mechanisms responsible for the reaction were not established.

  19. Multifractality in intracellular enzymatic reactions.

    PubMed

    Aranda, Juan S; Salgado, Edgar; Muñoz-Diosdado, Alejandro

    2006-05-21

    Enzymatic kinetics adjust well to the Michaelis-Menten paradigm in homogeneous media with dilute, perfectly mixed reactants. These conditions are quite different from the highly structured cell plasm, so applications of the classic kinetics theory to this environment are rather limited. Cytoplasmic structure produces molecular crowding and anomalous diffusion of substances, modifying the mass action kinetic laws. The reaction coefficients are no longer constant but time-variant, as stated in the fractal kinetics theory. Fractal kinetics assumes that enzymatic reactions on such heterogeneous media occur within a non-Euclidian space characterized by a certain fractal dimension, this fractal dimension gives the dependence on time of the kinetic coefficients. In this work, stochastic simulations of enzymatic reactions under molecular crowding have been completed, and kinetic coefficients for the reactions, including the Michaelis-Menten parameter KM, were calculated. The simulations results led us to confirm the time dependence of michaelian kinetic parameter for the enzymatic catalysis. Besides, other chaos related phenomena were pointed out from the obtained KM time series, such as the emergence of strange attractors and multifractality.

  20. Interfacial Reaction Studies Using ONIOM

    NASA Technical Reports Server (NTRS)

    Cardelino, Beatriz H.

    2003-01-01

    In this report, we focus on the calculations of the energetics and chemical kinetics of heterogeneous reactions for Organometallic vapor phase epitaxy (OMVPE). The work described in this report builds upon our own previous thermochemical and chemical kinetics studies. The first of these articles refers to the prediction of thermochemical properties, and the latter one deals with the prediction of rate constants for gaseous homolytic dissociation reactions. The calculations of this investigation are at the microscopic level. The systems chosen consisted of a gallium nitride (GaN) substrate, and molecular nitrogen (N2) and ammonia (NH3) as adsorbants. The energetics for the adsorption and the adsorbant dissociation processes were estimated, and reaction rate constants for the dissociation reactions of free and adsorbed molecules were predicted. The energetics for substrate decomposition was also computed. The ONIOM method, implemented in the Gaussian98 program, was used to perform the calculations. This approach has been selected since it allows dividing the system into two layers that can be treated at different levels of accuracy. The atoms of the substrate were modeled using molecular mechanics6 with universal force fields, whereas the adsorbed molecules were approximated using quantum mechanics, based on density functional theory methods with B3LYP functionals and 6-311G(d,p) basis sets. Calculations for the substrate were performed in slabs of several unit cells in each direction. The N2 and NH3 adsorbates were attached to a central location at the Ga-lined surface.

  1. Surface science of heterogeneous reactions.

    PubMed

    White, J M

    1982-10-29

    Some of the present and future directions for surface science as a growing and naturally interdisciplinary subject are reviewed. Particular attention is given to surface reaction chemistry as it is related to heterogenous catalysis, a subject area where there are abundant opportunities for detailed measurements of structure and dynamics at the molecular level.

  2. Anaphylactic reactions to tolperisone (Mydocalm).

    PubMed

    Ribi, Camillo; Vermeulen, Christophe; Hauser, Conrad

    2003-06-28

    Four patients with anaphylaxis attributed to the intake of the centrally acting muscle relaxant tolperisone hydrochloride (Mydocalm) were observed at the Emergency Department of the Geneva University Hospital between November 2001 and March 2003. All patients were middle-aged women who took tolperisone for chronic muscular pain. All reactions occurred within an hour after oral intake of this drug frequently prescribed in Switzerland. The severity of anaphylaxis ranged from urticarial reactions to shock with arterial hypotension. Prick-to-prick skin testing performed in one patient with a tablet of tolperisone diluted in water was negative. Its globally restricted commercialisation may explain the lack of reports on such adverse effects in the MedLine database. Anaphylactic reactions to this drug, however, are mentioned in other sources such as the Swiss Drug Compendium and the WHO drug reaction database. Together, these findings suggest that anaphylaxis to tolperisone is not uncommon and should be known to physicians in countries where this drug is available.

  3. Reactions of arsine with hemoglobin

    SciTech Connect

    Hatlelid, K.M.; Brailsford, C.; Carter, D.E.

    1996-02-09

    The mechanism of arsine (AsH{sub 3}) induced hemolysis was studied in vitro using isolated red blood cells (RBCs) from the rat or dog. AsH{sub 3}-induced hemolysis of dog red blood cells was completely blocked by carbon monoxide (CO) preincubation and was reduced by pure oxygen (O{sub 2}) compared to incubations in air. Since CO and O{sub 2} bind to heme and also reduced hemolysis, these results suggested a reaction between AsH{sub 3} and hemoglobin in the hemeligand binding pocket or with the heme iron. Further, sodium nitrite induction of methemoglobin (metHb) to 85% and 34% of total Hb in otherwise intact RBCs resulted in 56% and 16% decreases in hemolysis, respectively, after incubation for 4 h. This provided additional evidence for the involvement of hemoglobin in the AsH{sub 3}-induced hemolysis mechanism. Reactions between AsH{sub 3} and hemoglobin were studied in solutions of purified dog hemoglobin. Spectrophotometric studies of the reaction of AsH{sub 3} with various purified hemoglobin species revealed that AsH{sub 3} reacted with HbO{sub 2} to produce metHb and, eventually, degraded Hb characterized by gross precipitation of the protein. AsH{sub 3} did not alter the spectrum of deoxyHb and did not cause degradation of metHb in oxygen, but bound to and reduced metHb in the absence of oxygen. These data indicate that a reaction of AsH{sub 3} with oxygenated hemoglobin, HbO{sub 2}, may lead to hemolysis, but there are reactions between AsH{sub 3} and metHb that may not be directly involved in the hemolytic process. 17 refs., 6 figs.

  4. Modeling the complex bromate-iodine reaction.

    PubMed

    Machado, Priscilla B; Faria, Roberto B

    2009-05-07

    In this article, it is shown that the FLEK model (ref 5 ) is able to model the experimental results of the bromate-iodine clock reaction. Five different complex chemical systems, the bromate-iodide clock and oscillating reactions, the bromite-iodide clock and oscillating reactions, and now the bromate-iodine clock reaction are adequately accounted for by the FLEK model.

  5. Experimental Demonstrations in Teaching Chemical Reactions.

    ERIC Educational Resources Information Center

    Hugerat, Muhamad; Basheer, Sobhi

    2001-01-01

    Presents demonstrations of chemical reactions by employing different features of various compounds that can be altered after a chemical change occurs. Experimental activities include para- and dia-magnetism in chemical reactions, aluminum reaction with base, reaction of acid with carbonates, use of electrochemical cells for demonstrating chemical…

  6. Finding reaction paths using the potential energy as reaction coordinate.

    PubMed

    Aguilar-Mogas, Antoni; Giménez, Xavier; Bofill, Josep Maria

    2008-03-14

    The intrinsic reaction coordinate curve (IRC), normally proposed as a representation of a reaction path, is parametrized as a function of the potential energy rather than the arc-length. This change in the parametrization of the curve implies that the values of the energy of the potential energy surface points, where the IRC curve is located, play the role of reaction coordinate. We use Caratheodory's relation to derive in a rigorous manner the proposed parametrization of the IRC path. Since this Caratheodory's relation is the basis of the theory of calculus of variations, then this fact permits to reformulate the IRC model from this mathematical theory. In this mathematical theory, the character of the variational solution (either maximum or minimum) is given through the Weierstrass E-function. As proposed by Crehuet and Bofill [J. Chem. Phys. 122, 234105 (2005)], we use the minimization of the Weierstrass E-function, as a function of the potential energy, to locate an IRC path between two minima from an arbitrary curve on the potential energy surface, and then join these two minima. We also prove, from the analysis of the Weierstrass E-function, the mathematical bases for the algorithms proposed to locate the IRC path. The proposed algorithm is applied to a set of examples. Finally, the algorithm is used to locate a discontinuous, or broken, IRC path, namely, when the path connects two first order saddle points through a valley-ridged inflection point.

  7. Thermodynamics of Enzyme-Catalyzed Reactions Database

    National Institute of Standards and Technology Data Gateway

    SRD 74 Thermodynamics of Enzyme-Catalyzed Reactions Database (Web, free access)   The Thermodynamics of Enzyme-Catalyzed Reactions Database contains thermodynamic data on enzyme-catalyzed reactions that have been recently published in the Journal of Physical and Chemical Reference Data (JPCRD). For each reaction the following information is provided: the reference for the data, the reaction studied, the name of the enzyme used and its Enzyme Commission number, the method of measurement, the data and an evaluation thereof.

  8. Electrochemical promotion of catalytic reactions

    NASA Astrophysics Data System (ADS)

    Imbihl, R.

    2010-05-01

    The electrochemical promotion of heterogeneously catalyzed reactions (EPOC) became feasible through the use of porous metal electrodes interfaced to a solid electrolyte. With the O 2- conducting yttrium stabilized zirconia (YSZ), the Na + conducting β″-Al 2O 3 (β-alumina), and several other types of solid electrolytes the EPOC effect has been demonstrated for about 100 reaction systems in studies conducted mainly in the mbar range. Surface science investigations showed that the physical basis for the EPOC effect lies in the electrochemically induced spillover of oxygen and alkali metal, respectively, onto the surface of the metal electrodes. For the catalytic promotion effect general concepts and mechanistic schemes were proposed but these concepts and schemes are largely speculative. Applying surface analytical tools to EPOC systems the proposed mechanistic schemes can be verified or invalidated. This report summarizes the progress which has been achieved in the mechanistic understanding of the EPOC effect.

  9. Adverse drug reactions: part II.

    PubMed

    Wooten, James M

    2010-11-01

    Pharmacovigilance is the process of identifying, monitoring, and effectively reducing adverse drug reactions. Adverse drug reactions (ADRs) are an important consideration when assessing a patient's health. The proliferation of new pharmaceuticals means that the incidence of ADRs is increasing. The goal for all health care providers must be to minimize the risk of ADRs as much as possible. Steps to achieve this include understanding the pharmacology for all drugs prescribed and proactively assessing and monitoring those patients at greatest risk for developing an ADR. Groups at greatest risk for developing ADRs include the elderly, children, and pregnant patients, as well as others. Pharmacovigilance must be effectively practiced by all health care providers in order to avoid ADRs.

  10. Adverse drug reactions: Part I.

    PubMed

    Wooten, James M

    2010-10-01

    Pharmacovigilance is the process of identifying, monitoring, and effectively reducing adverse drug reactions. Adverse drug reactions (ADRs) are an important consideration when assessing a patient's health. The proliferation of new pharmaceuticals means that the incidence of ADRs is increasing. The goal for all health care providers must be to minimize the risk of ADRs as much as possible. Steps to achieve this include understanding the pharmacology for all drugs prescribed and proactively assessing and monitoring those patients at greatest risk for developing an ADR. Groups at greatest risk for developing ADRs include the elderly, children, and pregnant patients, as well as others. Pharmacovigilance must effectively be practiced by all health providers in order to avoid ADRs.

  11. Modelling reaction kinetics inside cells

    PubMed Central

    Grima, Ramon; Schnell, Santiago

    2009-01-01

    In the past decade, advances in molecular biology such as the development of non-invasive single molecule imaging techniques have given us a window into the intricate biochemical activities that occur inside cells. In this article we review four distinct theoretical and simulation frameworks: (1) non-spatial and deterministic, (2) spatial and deterministic, (3) non-spatial and stochastic and (4) spatial and stochastic. Each framework can be suited to modelling and interpreting intracellular reaction kinetics. By estimating the fundamental length scales, one can roughly determine which models are best suited for the particular reaction pathway under study. We discuss differences in prediction between the four modelling methodologies. In particular we show that taking into account noise and space does not simply add quantitative predictive accuracy but may also lead to qualitatively different physiological predictions, unaccounted for by classical deterministic models. PMID:18793122

  12. Investigating Reaction-Driven Cracking

    NASA Astrophysics Data System (ADS)

    Kelemen, P. B.; Hirth, G.; Savage, H. M.

    2013-12-01

    Many metamorphic reactions lead to large volume changes, and potentially to reaction-driven cracking [1,2]. Large-scale hydration of mantle peridotite to produce serpentine or talc is invoked to explain the rheology of plate boundaries, the nature of earthquakes, and the seismic properties of slow-spread ocean crust and the 'mantle wedge' above subduction zones. Carbonation of peridotite may be an important sink in the global carbon cycle. Zones of 100% magnesite + quartz replacing peridotite, up to 200 m thick, formed where oceanic mantle was thrust over carbonate-bearing metasediments in Oman. Talc + carbonate is an important component of the matrix in subduction mélanges at Santa Catalina Island , California, and the Sanbagawa metamorphic belt, Japan. Engineered systems to emulate natural mineral carbonation could provide relatively inexpensive CO2 capture and storage [3]. More generally, engineered reaction-driven cracking could supplement or replace hydraulic fracture in geothermal systems, solution mining, and extraction of tight oil and gas. The controls on reaction-driven cracking are poorly understood. Hydration and carbonation reactions can be self-limiting, since they potentially reduce permeability and armor reactive surfaces [4]. Also, in some cases, hydration or carbonation may take place at constant volume. Small changes in volume due to precipitation of solid products increases stress, destabilizing solid reactants, until precipitation and dissolution rates become equal at a steady state stress [5]. In a third case, volume change due to precipitation of solid products causes brittle failure. This has been invoked on qualitative grounds to explain, e.g., complete serpentinization of mantle peridotite [6]. Below ~ 300°C, the available potential energy for hydration and carbonation of olivine could produce stresses of 100's of MPa [2], sufficient to fracture rocks to 10 km depth or more, causing brittle failure below the steady state stress required

  13. Propulsive Reaction Control System Model

    NASA Technical Reports Server (NTRS)

    Brugarolas, Paul; Phan, Linh H.; Serricchio, Frederick; San Martin, Alejandro M.

    2011-01-01

    This software models a propulsive reaction control system (RCS) for guidance, navigation, and control simulation purposes. The model includes the drive electronics, the electromechanical valve dynamics, the combustion dynamics, and thrust. This innovation follows the Mars Science Laboratory entry reaction control system design, and has been created to meet the Mars Science Laboratory (MSL) entry, descent, and landing simulation needs. It has been built to be plug-and-play on multiple MSL testbeds [analysis, Monte Carlo, flight software development, hardware-in-the-loop, and ATLO (assembly, test and launch operations) testbeds]. This RCS model is a C language program. It contains two main functions: the RCS electronics model function that models the RCS FPGA (field-programmable-gate-array) processing and commanding of the RCS valve, and the RCS dynamic model function that models the valve and combustion dynamics. In addition, this software provides support functions to initialize the model states, set parameters, access model telemetry, and access calculated thruster forces.

  14. MEANS FOR TERMINATING NUCLEAR REACTIONS

    DOEpatents

    Cooper, C.M.

    1959-02-17

    An apparatus is presented for use in a reactor of the heterogeneous, fluid cooled type for the purpose of quickly terminating the reaction, the coolant being circulated through coolant tubes extending through the reactor core. Several of the tubes in the critical region are connected through valves to a tank containing a poisoning fluid having a high neutron capture crosssection and to a reservoir. When it is desired to quickly terminate the reaction, the valves are operated to permit the flow of the poisoning fluid through these particular tubes and into the reservoir while normal coolant is being circulated through the remaining tubes. The apparatus is designed to prevent contamination of the primary coolant by the poisoning fluid.

  15. Synchrotron radiation with radiation reaction

    NASA Astrophysics Data System (ADS)

    Nelson, Robert W.; Wasserman, Ira

    1991-04-01

    A rigorous discussion is presented of the classical motion of a relativistic electron in a magnetic field and the resulting electromagnetic radiation when radiation reaction is important. In particular, for an electron injected with initial energy gamma(0), a systematic perturbative solution to the Lorentz-Dirac equation of motion is developed for field strengths satisfying gamma(0) B much less than 6 x 10 to the 15th G. A particularly accurate solution to the electron orbital motion in this regime is found and it is demonstrated how lowest-order corrections can be calculated. It is shown that the total energy-loss rate corresponds to what would be found using the exact Larmor power formula without including radiation reaction. Provided that the particle energy and field strength satisfy the same contraint, it is explicitly demonstrated that the intuitive prescription for calculating the time-integrated radiation spectrum described above is correct.

  16. Invariant Coordinates in Breakup Reactions

    NASA Astrophysics Data System (ADS)

    Skwira-Chalot, I.; Ciepał, I.; Kistryn, St.; Kozela, A.; Parol, W.; Stephan, E.

    2017-03-01

    Systematic experimental studies of few-nucleon systems expose various dynamical ingredients which play an important role in correct description of observables, such as three-nucleon force, Coulomb force and relativistic effects. A large set of existing experimental data for ^1H(d, p p)n reaction allows for systematic investigations of these dynamical effects, which vary with energy and appear with different strength in certain observables and phase space regions. Moreover, systematic comparisons with exact theoretical calculations, done in variables related to the system dynamics in a possibly direct ways is a very important tool to verify and improve the existing description of the nucleon interaction. Examples of experimental data for a breakup reaction, transformed to the variables based on Lorentz-invariants are compared with modern theoretical calculations.

  17. Immediate reactions to rubber products.

    PubMed

    Fuchs, T; Wahl, R

    1992-01-01

    There is an increasing incidence of contact urticaria (CU) and systemic reactions to rubber products. Thirty-one patients are presented: most were atopic (20/31) and women (26/31); 71% worked in the medical field; 32.2% (10/31) showed signs of hand dermatitis. In 28 patients (90.3%), rub and/or prick tests with liquid latex in different dilutions and with latex gloves led to an immediate type of positive reaction. The allergen(s) appear in part to be water soluble: 20 of 28 patients (71.4%) revealed positive test reactions to an aqueous glove extract. In two patients, urticarial test reactions to tetramethylthiuram disulfide (TMTD), mercapto mix, and p-phenylenediamine (PPD mix) were considered as possible contributing factors of CU. Cornstarch was negative in all patients (scratch). Sixteen of 27 sera (59.2%) showed radioallergosorbent (RAST) class 0 using latex allergen disks. Sodium dodecyl sulfate-polyacoyl-amide (SDS-PAGE) determined protein bands of less than or equal to 14 kD (not allergen specific) and approx 28 kD. The Western blot detected the 28 kD protein as allergen in the sera of three patients. Isoelectric focusing (IEF) proved no protein bands. Immunoprinting performed with sera of five patients presented allergen bands in a pH range between 3.8 and 4.55. This shows the radio staining (immunoprint) is more sensitive than is the Coomassie blue staining. Although three sera showed RAST class 0, immunoblotting detected allergen bands. In this case the immunoblot appears to be more sensitive than the RAST. A cross reactivity between latex and banana could not be established. Alternative gloves are Neolon (neoprene) or Elastyren (styrene-butadiene polymer).

  18. Molecular screening in nuclear reactions

    NASA Astrophysics Data System (ADS)

    Cvetinovic, A.; Lipoglavsek, M.; Markelj, S.; Vesic, J.

    2015-12-01

    The dependence of electron screening in nuclear reactions on projectile or target atomic number has been studied by bombarding different hydrogen-containing targets with beams of 7Li , 11B , and 19F . The largest electron screening potentials were obtained in a graphite target containing hydrogen as an impurity. Some measured potentials are almost two orders of magnitude above the theoretical predictions. To explain the measurements, a new concept of electron screening is introduced.

  19. [Pain as adverse drug reaction].

    PubMed

    Böhmdorfer, Birgit; Schaffarzick, Daniel; Nagano, Marietta; Janowitz, Susanne Melitta; Schweitzer, Ekkehard

    2012-09-01

    We present a multidisciplinary (anaesthesiology--clinical pharmacy--bioinformatics) analysis of pain as possible adverse drug reaction taking different manifestations of pain, indication groups, relevance to the Austrian drug market and possible mechanistic influence of drugs on development and apprehension of pain into consideration.We designed an overview that shows how transmitters that play a part in nociception and antinociception can be influenced by drugs. This allows conclusions to the dolorigene potential of therapeutics.

  20. Multicomponent reactions in nucleoside chemistry

    PubMed Central

    Buchowicz, Włodzimierz

    2014-01-01

    Summary This review covers sixty original publications dealing with the application of multicomponent reactions (MCRs) in the synthesis of novel nucleoside analogs. The reported approaches were employed for modifications of the parent nucleoside core or for de novo construction of a nucleoside scaffold from non-nucleoside substrates. The cited references are grouped according to the usually recognized types of the MCRs. Biochemical properties of the novel nucleoside analogs are also presented (if provided by the authors). PMID:25161730

  1. Stratospheric Reactions of Peroxynitric Acid.

    DTIC Science & Technology

    1981-04-23

    was always at least 10 times greater than the HOONO2 concentration at the time of the 03 addition. Because of the small absorption coefficient [ Herzberg ...and J. N. Pitts, Jr., Pressure and temperature dependence of the unimolecular decomposition of HO2N02, J. Chem. Phys., 68, 4505, 1978. Herzberg ... Gerhard , Infrared and Raman Spectra, Vol. II, van Nostrand Reinhold Company, 1945, p. 286. Howard, C. J., Kinetics of the reaction of HO2 with NO2, J. Chem

  2. Statistical Theory of Breakup Reactions

    NASA Astrophysics Data System (ADS)

    Bertulani, Carlos A.; Descouvemont, Pierre; Hussein, Mahir S.

    2014-04-01

    We propose an alternative for Coupled-Channels calculations with looselybound exotic nuclei(CDCC), based on the the Random Matrix Model of the statistical theory of nuclear reactions. The coupled channels equations are divided into two sets. The first set, described by the CDCC, and the other set treated with RMT. The resulting theory is a Statistical CDCC (CDCCs), able in principle to take into account many pseudo channels.

  3. Force approach to radiation reaction

    SciTech Connect

    López, Gustavo V.

    2016-02-15

    The difficulty of the usual approach to deal with the radiation reaction is pointed out, and under the condition that the radiation force must be a function of the external force and is zero whenever the external force be zero, a new and straightforward approach to radiation reaction force and damping is proposed. Starting from the Larmor formula for the power radiated by an accelerated charged particle, written in terms of the applied force instead of the acceleration, an expression for the radiation force is established in general, and applied to the examples for the linear and circular motion of a charged particle. This expression is quadratic in the magnitude of the applied force, inversely proportional to the speed of the charged particle, and directed opposite to the velocity vector. This force approach may contribute to the solution of the very old problem of incorporating the radiation reaction to the motion of the charged particles, and future experiments may tell us whether or not this approach point is in the right direction.

  4. Transfer reactions with heavy elements

    SciTech Connect

    Hoffman, D.C.

    1986-04-01

    Transfer reactions for several transuranium elements are studied. (/sup 248/Cm, /sup 249/Bk, /sup 249/CF, /sup 254/Es), /sup 16,18/O, /sup 20,22/Ne, and /sup 40,48/Ca projectiles are used. The production of neutron-rich heavy actinides is enhanced by the use of neutron-rich projectiles /sup 18/O and /sup 22/Ne. The maxima of the isotopic distributions occur at only 2 to 3 mass numbers larger for /sup 48/Ca than for /sup 40/Ca reactions with /sup 248/Cm. The cross sections decrease rapidly with the number of nucleons transferred. The use of neutron-rich targets favors the production of neutron-rich isotopes. ''Cold'' heavy targets are produced. Comparisons with simple calculations of the product excitation energies assuming binary transfers indicate that the maxima of the isotopic distributions occur at the lightest product isotope for which the energy exceeds the reaction barrier. The cross sections for transfer of the same nucleon clusters appear to be comparable for a wide variety of systems. 23 refs., 4 figs., 4 tabs.

  5. Reaction Selectivity in Heterogeneous Catalysis

    SciTech Connect

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  6. Force approach to radiation reaction

    NASA Astrophysics Data System (ADS)

    López, Gustavo V.

    2016-02-01

    The difficulty of the usual approach to deal with the radiation reaction is pointed out, and under the condition that the radiation force must be a function of the external force and is zero whenever the external force be zero, a new and straightforward approach to radiation reaction force and damping is proposed. Starting from the Larmor formula for the power radiated by an accelerated charged particle, written in terms of the applied force instead of the acceleration, an expression for the radiation force is established in general, and applied to the examples for the linear and circular motion of a charged particle. This expression is quadratic in the magnitude of the applied force, inversely proportional to the speed of the charged particle, and directed opposite to the velocity vector. This force approach may contribute to the solution of the very old problem of incorporating the radiation reaction to the motion of the charged particles, and future experiments may tell us whether or not this approach point is in the right direction.

  7. CHLORINATION OF AMINO ACIDS: REACTION PATHWAYS AND REACTION RATES.

    PubMed

    How, Zuo Tong; Linge, Kathryn; Busetti, Francesco; Joll, Cynthia A

    2017-03-15

    Chlorination of amino acids can result in the formation of organic monochloramines or organic dichloramines, depending on the chlorine to amino acid ratio (Cl:AA). After formation, organic chloramines degrade into aldehydes, nitriles and N-chloraldimines. In this paper, the formation of organic chloramines from chlorination of lysine, tyrosine and valine were investigated. Chlorination of tyrosine and lysine demonstrated that the presence of a reactive secondary group can increase the Cl:AA ratio required for the formation of N,N-dichloramines, and potentially alter the reaction pathways between chlorine and amino acids, resulting in the formation of unexpected by-products. In a detailed investigation, we report rate constants for all reactions in the chlorination of valine, for the first time, using experimental results and modelling. At Cl:AA = 2.8, the chlorine was found to first react quickly with valine (5.4x104 M-1 s-1) to form N-monochlorovaline, with a slower subsequent reaction with N-monochlorovaline to form N,N-dichlorovaline (4.9x102 M-1 s-1), although some N-monochlorovaline degraded into isobutyraldehyde (1.0x10-4 s-1). The N,N-dichlorovaline then competitively degraded into isobutyronitrile (1.3x10-4 s-1) and N-chloroisobutyraldimine (1.2x10-4 s-1). In conventional drinking water disinfection, N-chloroisobutyraldimine can potentially be formed in concentrations higher than its odour threshold concentration, resulting in aesthetic challenges and an unknown health risk.

  8. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  9. [Reactions to insect stings and bites].

    PubMed

    Ljubojević, Suzana; Lipozencić, Jasna

    2011-01-01

    Reaction to insect sting and bite may be local, such as erythema, edema and pruritus, or systemic, such as anaphylactic reaction. Diagnosis can be made by patient history, clinical picture, skin testing, total and specific IgE level, and provocation test. Local reactions are treated with cold compresses, topical corticosteroids and oral antihistamines. Oral and intramuscular antihistamines and corticosteroids are used for the treatment of mild systemic reactions, and in severe reaction epinephrine injections are added. Hyposensitization is indicated in patients with severe systemic reaction, positive skin tests and high level of specific IgE antibodies.

  10. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  11. Radiation reaction at ultrahigh intensities

    NASA Astrophysics Data System (ADS)

    Hammond, Richard T.

    2010-06-01

    Intensities of 1022 W cm-2 have been reached and it is expected that this will be increased by two orders of magnitude in the near future. At these intensities the radiation reaction force is important, especially in calculating the terminal velocity of an electron. The following briefly describes some of the problems of the existing most well-known equations and describes an approach based on conservation of energy. The resulting equation is compared to the Landau Lifshitz and Ford O’Connell equations, and laboratory tests are proposed.

  12. Control Electronics For Reaction Wheel

    NASA Technical Reports Server (NTRS)

    Chamberlin, Keith

    1995-01-01

    Bidirectional operation achieved with single-polarity main power supply. Control circuitry generates pulse-width-modulated 800-Hz waveforms to drive two-phase ac motor and reaction wheel. Operates partly in response to digital magnitude-and-direction torque command generated by external control subsystem and partly in response to tachometric feedback in form of two once-per-revolution sinusoids with amplitudes proportional to speed. Operation in either of two modes called "normal" and "safehold." In normal mode, drive pulses timed so that, on average over one or few cycles, motor applies commanded torque. In safehold mode, pulses timed to keep motor running at set speed in one direction.

  13. Chemical reactions at aqueous interfaces

    NASA Astrophysics Data System (ADS)

    Vecitis, Chad David

    2009-12-01

    Interfaces or phase boundaries are a unique chemical environment relative to individual gas, liquid, or solid phases. Interfacial reaction mechanisms and kinetics are often at variance with homogeneous chemistry due to mass transfer, molecular orientation, and catalytic effects. Aqueous interfaces are a common subject of environmental science and engineering research, and three environmentally relevant aqueous interfaces are investigated in this thesis: 1) fluorochemical sonochemistry (bubble-water), 2) aqueous aerosol ozonation (gas-water droplet), and 3) electrolytic hydrogen production and simultaneous organic oxidation (water-metal/semiconductor). Direct interfacial analysis under environmentally relevant conditions is difficult, since most surface-specific techniques require relatively `extreme' conditions. Thus, the experimental investigations here focus on the development of chemical reactors and analytical techniques for the completion of time/concentration-dependent measurements of reactants and their products. Kinetic modeling, estimations, and/or correlations were used to extract information on interfacially relevant processes. We found that interfacial chemistry was determined to be the rate-limiting step to a subsequent series of relatively fast homogeneous reactions, for example: 1) Pyrolytic cleavage of the ionic headgroup of perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA) adsorbed to cavitating bubble-water interfaces during sonolysis was the rate-determining step in transformation to their inorganic constituents carbon monoxide, carbon dioxide, and fluoride; 2) ozone oxidation of aqueous iodide to hypoiodous acid at the aerosol-gas interface is the rate-determining step in the oxidation of bromide and chloride to dihalogens; 3) Electrolytic oxidation of anodic titanol surface groups is rate-limiting for the overall oxidation of organics by the dichloride radical. We also found chemistry unique to the interface, for example: 1

  14. Reaction time in Parkinson's disease.

    PubMed

    Evarts, E V; Teräväinen, H; Calne, D B

    1981-03-01

    Both reaction time and movement time tend to be prolonged in Parkinson's disease, but they are often impaired independently of each other. Prolongation of RT is relatively slight, while MT undergoes more substantial and consistent disturbance. Choice RT and kinaesthetic RT do not have any advantage over simple visual RT as measurements of neurological deficit in parkinsonism, since they are all impaired to the same extent. MT is more useful than RT as an objective indicator of therapeutic efficacy, but further studies of RT (with tests requiring programming of displacement, velocity, and accuracy) may provide insights into the nature of the central motor disorder in Parkinson's disease.

  15. Competing reaction channels in IR-laser-induced unimolecular reactions

    SciTech Connect

    Berman, M.R.

    1981-01-01

    The competing reaction channels in the unimolecular decomposition of two molecules, formaldehyde and tetralin were studied. A TEA CO/sub 2/ laser was used as the excitation source in all experiments. The dissociation of D/sub 2/CO was studied by infrared multiphoton dissociation (MPD) and the small-molecule nature of formaldehyde with regard to MPD was explored. The effect of collisions in MPD were probed by the pressure dependence of the MPD yield and ir fluorescence from multiphoton excited D/sub 2/CO. MPD yield shows a near cubic dependence in pure D/sub 2/CO which is reduced to a 1.7 power dependence when 15 torr of NO is added. The peak amplitude of 5 ..mu..m ir fluorescence from D/sub 2/CO is proportional to the square of the D/sub 2/CO pressure in pure D/sub 2/CO or in the presence of 50 torr of Ar. Results are explained in terms of bottlenecks to excitation at the v = 1 level which are overcome by a combination of vibrational energy transfer and rotational relaxation. The radical/molecule branching ratio in D/sub 2/CO MPD was 0.10 +- 0.02 at a fluence of 125 J/cm/sup 2/ at 946.0 cm/sup -1/. The barrier height to molecular dissociation was calculated to be 3.6 +- 2.0 kcal/mole below the radical threshold or 85.0 +- 3.0 kcal/mole above the ground state of D/sub 2/CO. In H/sub 2/CO, this corresponds to 2.5 +- 2.0 kcal/mole below the radical threshold or 83.8 +- 3.0 kcal/mole above the ground state. Comparison with uv data indicate that RRKM theory is an acceptable description of formaldehyde dissociation in the 5 to 10 torr pressure range. The unimolecular decomposition of tetralin was studied by MPD and SiF/sub 4/ - sensitized pyrolysis. Both techniques induce decomposition without the interference of catalytic surfaces. Ethylene loss is identified as the lowest energy reaction channel. Dehydrogenation is found to result from step-wise H atom loss. Isomerization via disproportionation is also identified as a primary reaction channel.

  16. Laser-induced tissue reactions and dermatology.

    PubMed

    Weber, Rebecca J; Taylor, Brent R; Engelman, Dendy E

    2011-01-01

    Knowledge of laser tissue reactions and tissue properties allows the practitioner to tailor a treatment to an individual patient's need and goals. A laser's power, spot size and pulse duration may be manipulated to yield different tissue reactions. Five tissue reactions, each the result of varying laser pulse durations and energy densities, may be achieved. They are photochemical, photothermal, photoablation, plasma-induced ablation and photomechanical. Of these, photothermal reactions are most utilized in dermatology. When higher powered pulses are applied, tissue often undergoes multiple reactions simultaneously. An understanding of these reactions allows their effects to be predicted. In this chapter, the various reactions are reviewed, and the reactions caused by many of the most commonly used lasers in dermatology are discussed.

  17. A New Look at Reaction Rates

    NASA Astrophysics Data System (ADS)

    Cvitas, Tomislav

    1999-11-01

    Both rates of radioactive decays and rates of chemical reactions can be thought of as numbers of transformations per time. The rate of reaction, as an intensive quantity characteristic of the process, is obtained by dividing the amount of chemical transformations per time by the volume of the reaction system. The practical definition of the reaction rate found in the literature can then be derived by defining the stoichiometric numbers as changes in the number of specific molecules taking part in the reaction per chemical transformation. The name concentration of chemical transformations is introduced for what was previously called reaction variable. It is suggested that the conceptual definition of the advancement of reaction and reaction rate be introduced in general chemistry courses.

  18. The carbon (formerly dark) reactions of photosynthesis.

    PubMed

    Buchanan, Bob B

    2016-05-01

    In this brief account, I describe the background for dividing photosynthesis into "light" and "dark" reactions and show how this concept changed to "light" and "carbon" reactions as science in the field advanced.

  19. [Adverse reaction to not iodinated contrast].

    PubMed

    Palma-Gómez, Samuel; González-Díaz, Sandra Nora; Arias-Cruz, Alfredo; Macías-Weinmann, Alejandra; Amaro-Vivian, Laura Elizabeth; Pérez-Vanzzini, Rafael; Gutiérrez-Mujica, José Julio; Yong-Rodríguez, Adrián

    2014-01-01

    Adverse reactions to drugs are relatively frequent in clinical practice, and some of them can be life threatening. Reactions to contrast material (CM) represent an important percentage of these adverse reactions. It has been found that 70% of reactions to contrast material happen within the first five minutes of their administration. Despite the fact that hypersensitivity reactions are traditionally classified as non-allergic, in recent years investigators have reported positive skin prick tests in patients with immediate and late reactions to contrast material. This paper reports the case of a female patient with non-Hodgkin lymphoma that has presented on two distinct occasions adverse reactions to contrast material. We discuss on the type of reaction, severity, suggested prophylaxis, prognosis and recommendations, keeping in mind the underlying disease and the need to have further image studies performed.

  20. Heavy atom isotope effects on enzymatic reactions

    NASA Astrophysics Data System (ADS)

    Paneth, Piotr

    1994-05-01

    The theory of isotope effects, which has proved to be extremely useful in providing geometrical details of transition states in a variety of chemical reactions, has recently found an application in studies of enzyme-catalyzed reactions. These reactions are multistep in nature with few steps being partially rate-limiting, thus interpretation of these isotope effects is more complex. The theoretical framework of heavy-atom isotope effects on enzymatic reactions is critically analyzed on the basis of recent results of: carbon kinetic isotope effects on carbonic anhydrase and catalytic antibodies; multiple carbon, deuterium isotope effects on reactions catalyzed by formate decarboxylase; oxygen isotope effects on binding processes in reactions catalyzed by pyruvate kinase; and equilibrium oxygen isotope effect on binding an inhibitor to lactate dehydrogenase. The advantages and disadvantages of reaction complexity in learning details of formal and molecular mechanisms are discussed in the examples of reactions catalyzed by phosphoenolpyruvate carboxylase, orotidine decarboxylase and glutamine synthetase.

  1. A Light-Activated Reaction Manifold.

    PubMed

    Hiltebrandt, Kai; Elies, Katharina; D'hooge, Dagmar R; Blinco, James P; Barner-Kowollik, Christopher

    2016-06-08

    We introduce an efficient reaction manifold where the rate of a thermally induced ligation can be controlled by a photonic field via two competing reaction channels. The effectiveness of the reaction manifold is evidenced by following the transformations of macromolecular chain termini via high-resolution mass spectrometry and subsequently by selective block copolymer formation. The light-controlled reaction manifold consists of a so-called o-quinodimethane species, a photocaged diene, that reacts in the presence of light with suitable enes in a Diels-Alder reaction and undergoes a transformation into imines with amines in the absence of light. The chemical selectivity of the manifold is controlled by the amount of ene present in the reaction and can be adjusted from 100% imine formation (0% photo product) to 5% imine formation (95% photo product). The reported light-controlled reaction manifold is highly attractive because a simple external field is used to switch the selectivity of specific reaction channels.

  2. Nuclear reactions from lattice QCD

    NASA Astrophysics Data System (ADS)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-02-01

    One of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, quantum chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three-nucleon (and higher) interactions in a consistent manner. Currently, lattice quantum chromodynamics (LQCD) provides the only reliable option for performing calculations of some of the low-energy hadronic observables. With the aim of bridging the gap between LQCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from LQCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.

  3. Radiation Reaction and Thomson Scattering

    SciTech Connect

    Koga, James

    2007-07-11

    In recent years high power high irradiance lasers of peta-watt order have been or are under construction. In addition, in the next 10 years lasers of unprecedented powers, exa-watt, could be built If lasers such as these are focused to very small spot sizes, extremely high laser irradiances will be achieved. When electrons interact with such a laser, they become highly relativistic over very short time and spatial scales. Usually the motion of an electron under the influence of electromagnetic fields is influenced to a small extent by radiation emission from acceleration. However, under such violent acceleration the amount of radiation emitted by electrons can become so large that significant damping of the electron motion by the emission of this radiation can occur. In this lecture note we will study this problem of radiation reaction by first showing how the equations of motion are obtained. Then, we will examine the problems with such equations and what approximations are made. We will specifically examine the effects of radiation reaction on the Thomson scattering of radiation from counter-streaming laser pulses and high energy electrons through the numerical integration of the equations of motion. We will briefly address the fundamental physics, which can be addressed by using such high irradiance lasers interacting with high energy electrons.

  4. Affective reactions to acoustic stimuli.

    PubMed

    Bradley, M M; Lang, P J

    2000-03-01

    Emotional reactions to naturally occurring sounds (e.g., screams, erotica, bombs, etc.) were investigated in two studies. In Experiment 1, subjects rated the pleasure and arousal elicited when listening to each of 60 sounds, followed by an incidental free recall task. The shape of the two-dimensional affective space defined by the mean ratings for each sound was similar to that previously obtained for pictures, and, like memory for pictures, free recall was highest for emotionally arousing stimuli. In Experiment 2, autonomic and facial electromyographic (EMG) activity were recorded while a new group of subjects listened to the same set of sounds; the startle reflex was measured using visual probes. Listening to unpleasant sounds resulted in larger startle reflexes, more corrugator EMG activity, and larger heart rate deceleration compared with listening to pleasant sounds. Electrodermal reactions were larger for emotionally arousing than for neutral materials. Taken together, the data suggest that acoustic cues activate the appetitive and defensive motivational circuits underlying emotional expression in ways similar to pictures.

  5. Nuclear reactions from lattice QCD

    DOE PAGES

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculationsmore » of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.« less

  6. Nuclear reactions from lattice QCD

    SciTech Connect

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculations of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.

  7. The chlorate-iodine clock reaction.

    PubMed

    Oliveira, André P; Faria, Roberto B

    2005-12-28

    A clock reaction produced by mixing chlorate and iodine solutions in perchloric acid media is reported. This is the first example of a clock reaction using chlorate as a reagent. Increasing chlorate and acid concentration reduces the induction period. Changing the initial iodine concentration does not affect the length of the induction period. The discovery of this clock reaction opens the possibility that a new family of oscillation reactions can be built using chlorate as reagent.

  8. Reactions of Tributylstannyl Anioniods with Alkyl Bromides.

    DTIC Science & Technology

    1981-09-28

    g (12 mmol) of cesium tert-butoxide was added to the reaction vessel before the addition of n-butyllithium. Alkylation of Tributylstannyl Anionoids...Dry reaction vessels were purged with argon. The desired alkyl halide (1.0 mmol unless noted) and any desired additive were added to the reaction ...OFFICE OF NAVAL RESEARCH Contract N00014-79-C-0584 Task No. NR 053-714 TECHNICAL REPORT No. 2 Reactions of Tributylstannyl Anionoids with Alkyl

  9. Redox reaction rates using potentiostatic coulometry

    SciTech Connect

    Ramette, R.W.; Harris, R.Z.; Bengali, A.A.; Noll, R.J.

    1987-01-01

    A new method based on potentiostatic coulometry was used to study the kinetics of the aqueous redox reactions between the ions chlorate/iodide, bromate/iodide, and bromate/bromide. The halogen product was continuously and rapidly reduced back to halide at a large platinum gauze cathode, the current being a direct measure of reaction rate and the accumulated charge serving to measure the extent of reaction. The reactions were studied at several temperatures, and activation entropies and enthalpies were calculated.

  10. Infrared Emission from Gas-Aerosol Reactions

    DTIC Science & Technology

    1982-09-01

    Gaseous Amonia Infrared (IR) "Gas-aerosol Reactions Sulfuric Acid- amonia IR Luminescence Exothermic Reactions Octanoic Acid- amonia IR Laser Acid-base...of radiation observed from the reactions of chloro- sulfuric acid aerosol with gaseous amonia and water. Other systems which were screened including...phase diffusion, diffusion of reactants and/or products in the particle, by the bulk chemical reaction, or by processes occurring in the droplet

  11. Reactions of butadiyne. 1: The reaction with hydrogen atoms

    NASA Technical Reports Server (NTRS)

    Schwanebeck, W.; Warnatz, J.

    1984-01-01

    The reaction of hydrogen (H) atoms with butadiene (C4H2) was studied at room temperature in a pressure range between w mbar and 10 mbar. The primary step was an addition of H to C4H2 which is in its high pressure range at p 1 mbar. Under these conditions the following addition of a second H atom lies in the transition region between low and high pressure range. Vibrationally excited C4H4 can be deactivated to form buten-(1)-yne-(3)(C4H4) or decomposes into two C2H2 molecules. The rate constant at room temperature for primary step is given. The second order rate constant for the consumption of buten-(1)-yne-(3) is an H atom excess at room temperature is given.

  12. Surface catalyzed mercury transformation reactions

    NASA Astrophysics Data System (ADS)

    Varanasi, Patanjali

    Mercury is a known pollutant that has detrimental effect on human health and environment. The anthropogenic emissions of mercury account for 10 to 30% of worldwide mercury emissions. There is a need to control/reduce anthropogenic mercury emissions. Many mercury control technologies are available but their effectiveness is dependent on the chemical form of mercury, because different chemical forms of mercury have different physical and chemical properties. Mercury leaves the boiler in its elemental form but goes through various transformations in the post-combustion zone. There is a need to understand how fly ash and flue gas composition affect speciation, partitioning, and reactions of mercury under the full range of post-combustion zone conditions. This knowledge can then be used to predict the chemical transformation of mercury (elemental, oxidized or particulate) in the post combustion zone and thus help with the control of mercury emissions from coal-burning power plants. To accomplish this goal present study was conducted using five coal fly ashes. These ashes were characterized and their catalytic activity was compared under selected reaction conditions in a fixed bed reactor. Based on the results from these fly ash experiments, three key components (carbon, iron oxide and calcium oxide) were chosen. These three components were then used to prepare model fly ashes. Silica/alumina was used as a base for these model fly ashes. One, two or three component model fly ashes were then prepared to investigate mercury transformation reactions. The third set of experiments was performed with five different oxidation catalysts to further understand the mercury oxidation process. Based on the results of these three studies the key components were predicted for different fly ash compositions under variety of flue gas conditions. A fixed bed reactor system was used to conduct this study. In all the experiments, the inlet concentration of Hg0(g) was maintained at 35 mug

  13. New reaction tester accurate within 56 microseconds

    NASA Technical Reports Server (NTRS)

    Brown, H.

    1972-01-01

    Testing device measures simple and disjunctive reaction time of human subject to light stimuli. Tester consists of reaction key, logic card, panel mounted neon indicators, and interconnecting wiring. Device is used for determining reaction times of patients undergoing postoperative neurological therapy.

  14. Reactions to Termination of Individual Treatment.

    ERIC Educational Resources Information Center

    Fortune, Anne E.; And Others

    1992-01-01

    Queried 69 social workers about termination reactions in most recently terminated individual cases. Clients' strongest reactions were positive affect, evaluation of success, evaluation of therapeutic experience, and positive flight. Least strong client reactions were nihilistic flight, regression, denial, recapitulation, and expression of need for…

  15. The Rate Laws for Reversible Reactions.

    ERIC Educational Resources Information Center

    King, Edward L.

    1986-01-01

    Provides background information for teachers on the rate laws for reversible reactions. Indicates that although prediction of the form of the rate law for a reverse reaction given the rate law for the forward reaction is not certain, the number of possibilities is limited because of relationships described. (JN)

  16. Method of controlling fusion reaction rates

    DOEpatents

    Kulsrud, Russell M.; Furth, Harold P.; Valeo, Ernest J.; Goldhaber, Maurice

    1988-01-01

    A method of controlling the reaction rates of the fuel atoms in a fusion reactor comprises the step of polarizing the nuclei of the fuel atoms in a particular direction relative to the plasma confining magnetic field. Fusion reaction rates can be increased or decreased, and the direction of emission of the reaction products can be controlled, depending on the choice of polarization direction.

  17. Method of controlling fusion reaction rates

    DOEpatents

    Kulsrud, Russell M.; Furth, Harold P.; Valeo, Ernest J.; Goldhaber, Maurice

    1988-03-01

    A method of controlling the reaction rates of the fuel atoms in a fusion reactor comprises the step of polarizing the nuclei of the fuel atoms in a particular direction relative to the plasma confining magnetic field. Fusion reaction rates can be increased or decreased, and the direction of emission of the reaction products can be controlled, depending on the choice of polarization direction.

  18. Parental Reactions to Cleft Palate Children.

    ERIC Educational Resources Information Center

    Vanpoelvoorde, Leah

    This literature review examines parental reactions following the birth of a cleft lip/palate child, focusing primarily on the mother's reactions. The research studies cited have explored such influences on maternal reactions as her feelings of lack of control over external forces and her feelings of guilt that the deformity was her fault. Delays…

  19. 'GREENER' CHEMICAL SYNTHESES USING ALTERNATE REACTION CONDITIONS

    EPA Science Inventory

    Microwave (MW) irradiation in conjunction with water as reaction media has proven to be a greener chemical approach for expeditious N-alkylation reactions of amines and hydrazines wherein the reactions under mildly basic conditions afford tertiary amines and double N-alkylation t...

  20. Infant Defensive Reactions to Visual Occlusion.

    ERIC Educational Resources Information Center

    Adamson, Lauren; Tronick, Edward

    This paper describes the initial organization of the infant's reaction to having his vision occluded by an opaque cloth; traces the development of this reaction over the first six months; and probes the role the occlusion of vision plays in provoking the reaction. Fifty videotaped sessions of infants during two conditions - eyes covered with an…

  1. Ultracold chemistry and its reaction kinetics

    NASA Astrophysics Data System (ADS)

    Richter, Florian; Becker, Daniel; Bény, Cédric; Schulze, Torben A.; Ospelkaus, Silke; Osborne, Tobias J.

    2015-05-01

    We study the reaction kinetics of chemical processes occurring in the ultracold regime and systematically investigate their dynamics. Quantum entanglement is found to play a key role in driving an ultracold reaction towards a dynamical equilibrium. In case of multiple concurrent reactions Hamiltonian chaos dominates the phase space dynamics in the mean field approximation.

  2. Reaction Order Ambiguity in Integrated Rate Plots

    ERIC Educational Resources Information Center

    Lee, Joe

    2008-01-01

    Integrated rate plots are frequently used in reaction kinetics to determine orders of reactions. It is often emphasised, when using this methodology in practice, that it is necessary to monitor the reaction to a substantial fraction of completion for these plots to yield unambiguous orders. The present article gives a theoretical and statistical…

  3. An Iodine Fluorescence Quenching Clock Reaction

    ERIC Educational Resources Information Center

    Weinberg, Richard B.; Muyskens, Mark

    2007-01-01

    Clock reactions based upon competing oxidation and reduction reactions of iodine and starch as the most popular type of chemistry example is presented to illustrate the redox phenomena, reaction kinetics, and principles of chemical titration. The examination of the photophysical principles underlying the iodine fluorescence quenching clock…

  4. Modified triglyceride oil through reactions with phenyltriazolinedione

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a modified triglyceride oil was achieved through the reactions with 4-phenyl-1,2-4-triazoline-3,5-dione (PTAD). 1H NMR was used for structure determination and to monitor the reactions. Several reaction products were produced, and their relative yields depended on the stoichiometry ...

  5. Relay cross metathesis reactions of vinylphosphonates.

    PubMed

    Malla, Raj K; Ridenour, Jeremy N; Spilling, Christopher D

    2014-01-01

    Dimethyl (β-substituted) vinylphosphonates do not readily undergo cross metathesis reactions with Grubbs catalyst and terminal alkenes. However, the corresponding mono- or diallyl vinylphosphonate esters undergo facile cross metathesis reactions. The improved reactivity is attributed to a relay step in the cross metathesis reaction mechanism.

  6. Reaction-Map of Organic Chemistry

    ERIC Educational Resources Information Center

    Murov, Steven

    2007-01-01

    The Reaction-Map of Organic Chemistry lists all the most commonly studied reactions in organic chemistry on one page. The discussed Reaction-Map will act as another learning aide for the students, making the study of organic chemistry much easier.

  7. Indirect Methods for Nuclear Reaction Data

    SciTech Connect

    Escher, J E; Dietrich, F S

    2005-11-18

    Several indirect approaches for obtaining reaction cross sections are briefly reviewed. The Surrogate Nuclear Reactions method, which aims at determining cross sections for compound-nuclear reactions, is discussed in some detail. The validity of the Weisskopf-Ewing approximation in the Surrogate approach is studied for the example of neutron-induced fission of an actinide nucleus.

  8. Kinetic studies of elementary chemical reactions

    SciTech Connect

    Durant, J.L. Jr.

    1993-12-01

    This program concerning kinetic studies of elementary chemical reactions is presently focussed on understanding reactions of NH{sub x} species. To reach this goal, the author is pursuing experimental studies of reaction rate coefficients and product branching fractions as well as using electronic structure calculations to calculate transition state properties and reaction rate calculations to relate these properties to predicted kinetic behavior. The synergy existing between the experimental and theoretical studies allow one to gain a deeper insight into more complex elementary reactions.

  9. Incidents of chemical reactions in cell equipment

    SciTech Connect

    Baldwin, N.M.; Barlow, C.R.

    1991-12-31

    Strongly exothermic reactions can occur between equipment structural components and process gases under certain accident conditions in the diffusion enrichment cascades. This paper describes the conditions required for initiation of these reactions, and describes the range of such reactions experienced over nearly 50 years of equipment operation in the US uranium enrichment program. Factors are cited which can promote or limit the destructive extent of these reactions, and process operations are described which are designed to control the reactions to minimize equipment damage, downtime, and the possibility of material releases.

  10. Interfacial reactions in titanium-matrix composites

    SciTech Connect

    Yang, J.M.; Jeng, S.M. )

    1989-11-01

    A study of the interfacial reaction characteristics of SiC fiber-reinforced titanium aluminide and disordered titanium alloy composites has determined that the matrix alloy compositions affect the microstructure and the distribution of the reaction products, as well as the growth kinetics of the reaction zones. The interfacial reaction products in the ordered titanium aluminide composite are more complicated than those in the disordered titanium-alloy composite. The activation energy of the interfacial reaction in the ordered titanium aluminide composite is also higher than that in the disordered titanium alloy composite. Designing an optimum interface is necessary to enhance the reliability and service life at elevated temperatures. 16 refs.

  11. Scratching the surface of allergic transfusion reactions

    PubMed Central

    Savage, William J; Tobian, Aaron AR; Savage, Jessica H; Wood, Robert A; Schroeder, John T; Ness, Paul M

    2013-01-01

    Allergic transfusion reactions (ATRs) are a spectrum of hypersensitivity reactions that are the most common adverse reaction to platelets and plasma, occurring in up to 2% of transfusions. Despite the ubiquity of these reactions, little is known about their mechanism. In a small subset of severe reactions, specific antibody has been implicated as causal, although this mechanism does not explain all ATRs. Evidence suggests that donor, product, and recipient factors are involved, and it is possible that many ATRs are multi-factorial. Further understanding of the mechanisms of ATRs is necessary so that rationally designed and cost-effective prevention measures can be developed. PMID:22998777

  12. Electromagnetic effects on explosive reaction and plasma

    SciTech Connect

    Tasker, Douglas G; Whitley, Von H; Mace, Jonathan L; Pemberton, Steven J; Sandoval, Thomas D; Lee, Richard J

    2010-01-01

    A number of studies have reported that electric fields can have quantifiable effects on the initiation and growth of detonation, yet the mechanisms of these effects are not clear. Candidates include Joule heating of the reaction zone, perturbations to the activation energy for chemical reaction, reduction of the Peierls energy barrier that facilitates dislocation motion, and acceleration of plasma projected from the reaction zone. In this study the possible role of plasma in the initiation and growth of explosive reaction is investigated. The effects of magnetic and electric field effects on reaction growth will be reviewed and recent experiments reported.

  13. The OH + HBr reaction revisited

    NASA Technical Reports Server (NTRS)

    Ravishankara, A. R.; Wine, P. H.; Wells, J. R.

    1985-01-01

    Variable-temperature measurements of the rate coefficient /k(1)/ for the reaction OH + HBr yield Br + H2O are presented. The measurements are verified by two techniques: one involved a 266-nm pulsed-laser photolysis of O3/H2O/HBr/He mixtures in conjunction with time-resolved resonance fluorescence detection of OH, the second comprised pulsed laser-induced fluorescence detection of OH following 248-nm pulsed-laser photolysis of H2O2/HBr/Ar mixtures. It is reported that k(1) = (11.9 + or -1.4 x 10 to the -12th (cu cm)/(molecule)(s) independent of temperature. The measurements are compared with other available results.

  14. Adverse Reactions of Ferric Carboxymaltose

    PubMed Central

    Patil, Navin; Shenoy, Smita; Bairy, K L; Sarma, Yashdeep

    2014-01-01

    The author reports a 55-year-old female diagnosed of chronic kidney disease grade-5 with associated co-morbidities like type 2 diabetes mellitus, diabetic retinopathy and hypothyroidism was admitted for arteriovenous fistula construction. She was started on ferric carboxymaltose for the treatment of anaemia. She was given a test dose before administering the drug intravenously and she did not develop any reaction. The drug ferric carboxymaltose was then administered over a period of one hour. About half an hour after drug administration, the patient developed breathlessness and myalgia. After half hour of the above episode of breathlessness and myalgia she also developed vomiting (one episode). Patient was managed with oxygen therapy, IV fluids and other drugs like corticosteroids, phenaramine maleate and nalbuphine which controlled the above symptoms. PMID:25478369

  15. [Periodontal reaction versus dental movement].

    PubMed

    Ionescu, Ecaterina; Preoteasa, Elena; Duduca, Ioana

    2005-01-01

    In orthodontics the relation between the force (natural or artificial) and the structures that must be modified or led towards a normal situation is in fact a complex equation would multiple aspects determined by the biological part. The orthodontic forces imply, both in action as in effect, all the elements of the dental system, meaning bones, teeth, periodontal tissue. On the other side, the structures of the dental system may help, limit ate, or even erase the action of the orthodontic forces. Our article brings into discussion the relation between the teeth' sustaining structures and their movements determined by the orthodontic forces both as a reaction to a therapeutical treatment and as their direct implication into the result and the stability of the orthodontic treatment, on a long-term.

  16. Chemical reactions in endoreversible thermodynamics

    NASA Astrophysics Data System (ADS)

    Wagner, Katharina; Hoffmann, Karl Heinz

    2016-01-01

    Endoreversible thermodynamics is a theory for the (approximate) description of thermodynamic non-equilibrium systems, which allows us to capture the ever present irreversibilities of real processes. For instance in heat engines the dissipation due to finite heat transport capabilities, as well as the resulting limitations in the energy fluxes, can be incorporated into the theory. It has thus been very successful in closing the gap between observed and theoretically predicted efficiencies. Here an extension of the theory is provided, with which chemical reactions can be included in the formalism. This opens up a wide field of applications for endoreversible modeling and the investigation of dissipative processes, for instance in fuel cells or batteries.

  17. [Paranoid syndrome, paranoid reaction, paranoia].

    PubMed

    Pavlovský, P

    2006-01-01

    The term paranoid is derived from the Greek word paranoia meaning nadnese. It does not only mean self-reference, but there are various personality features as they are hostility, a tendency towards aggressiveness, irritability, a lack of sense of humour, feelings of overestimation of one-self and a tendency towards accusations. These features may appear also within normal psychology and they becomeclinically important after thein increase of intensity and conspicuousness (los sof hearing, long-term abuse of alcohol and psychostimulants) and organic disorders of the brain may contribute to the development of paranoidity. A mechanism of projection is considered as a decivise factor from the point of view of dynamic psychiatry. Clinically unimportant sign sof paranoidity can be observed due to unusual situations. If a paranoid reaction becomes more serious, formation of a paranoid delusion should be taken to account. In our koncept the term paranoid and paranoidity should be used only as a psychopathological term.

  18. Transport and Reactions of Pollutants

    NASA Astrophysics Data System (ADS)

    Gekas, Vassilis; Paraskaki, Ioanna

    The aim of this chapter is to provide the food scientist and engineer with tools for understanding the principles of transport and reaction of pollutants and their fate after being released or deposited into the environment. Furthermore, on the grounds of this understanding of basic principles, the food scientist and engineer will possess the ability to model these processes. Mathematical modeling nowadays is facilitated through the use of appropriate computer software programs. There are, generally speaking, a large number of programs available for such modeling and especially for the prediction of the fate of pollutants. When working with these programs it is advisable to understand the principles behind the program rather than treating it as a black box

  19. Epidemiology of cutaneous drug-induced reactions.

    PubMed

    Naldi, L; Crotti, S

    2014-04-01

    Cutaneous reactions represent in many surveillance systems, the most frequent adverse events attributable to drugs. The spectrum of clinical manifestations is wide and virtually encompasses any known dermatological disease. The introduction of biological agents and so-called targeted therapies has further enlarged the number of reaction patterns especially linked with cytokine release or in balance. The frequency and clinical patterns of cutaneous reactions are influenced by drug use, prevalence of specific conditions (e.g., HIV infection) and pharmacogenetic traits of a population, and they may vary greatly among the different populations around the world. Studies of reaction rates in cohorts of hospitalized patients revealed incidence rates ranging from, 1 out 1000 to 2 out 100 of all hospitalized patients. For drugs such as aminopenicillines and sulfamides the incidence of skin reactions is in the order of 3-5 cases out of 100 exposed people. Although the majority of cutaneous reactions are mild and self-limiting, there are reactions such as Stevens Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), and drug reaction with eosinophilia and systemic symptoms (DRESS) which are associated with significant morbidity and mortality. Surveillance systems routed on sound epidemiologic methodology, are needed to raise signals and to assess risks associated with specific reactions and drug exposures. Identification of risk factors for adverse reactions and appropriate genetic screening of groups at higher risk may improve the outcomes of skin reactions.

  20. Computed potential energy surfaces for chemical reactions

    NASA Technical Reports Server (NTRS)

    Walch, Stephen P.

    1994-01-01

    Quantum mechanical methods have been used to compute potential energy surfaces for chemical reactions. The reactions studied were among those believed to be important to the NASP and HSR programs and included the recombination of two H atoms with several different third bodies; the reactions in the thermal Zeldovich mechanism; the reactions of H atom with O2, N2, and NO; reactions involved in the thermal De-NO(x) process; and the reaction of CH(squared Pi) with N2 (leading to 'prompt NO'). These potential energy surfaces have been used to compute reaction rate constants and rates of unimolecular decomposition. An additional application was the calculation of transport properties of gases using a semiclassical approximation (and in the case of interactions involving hydrogen inclusion of quantum mechanical effects).

  1. Computed potential energy surfaces for chemical reactions

    NASA Technical Reports Server (NTRS)

    Walch, Stephen P.

    1990-01-01

    The objective was to obtain accurate potential energy surfaces (PES's) for a number of reactions which are important in the H/N/O combustion process. The interest in this is centered around the design of the SCRAM jet engine for the National Aerospace Plane (NASP), which was envisioned as an air-breathing hydrogen-burning vehicle capable of reaching velocities as large as Mach 25. Preliminary studies indicated that the supersonic flow in the combustor region of the scram jet engine required accurate reaction rate data for reactions in the H/N/O system, some of which was not readily available from experiment. The most important class of combustion reactions from the standpoint of the NASP project are radical recombinaton reactions, since these reactions result in most of the heat release in the combustion process. Theoretical characterizations of the potential energy surfaces for these reactions are presented and discussed.

  2. The Ozone-Iodine-Chlorate Clock Reaction

    PubMed Central

    Sant'Anna, Rafaela T. P.; Monteiro, Emily V.; Pereira, Juliano R. T.; Faria, Roberto B.

    2013-01-01

    This work presents a new clock reaction based on ozone, iodine, and chlorate that differs from the known chlorate-iodine clock reaction because it does not require UV light. The induction period for this new clock reaction depends inversely on the initial concentrations of ozone, chlorate, and perchloric acid but is independent of the initial iodine concentration. The proposed mechanism considers the reaction of ozone and iodide to form HOI, which is a key species for producing non-linear autocatalytic behavior. The novelty of this system lies in the presence of ozone, whose participation has never been observed in complex systems such as clock or oscillating reactions. Thus, the autocatalysis demonstrated in this new clock reaction should open the possibility for a new family of oscillating reactions. PMID:24386257

  3. The ozone-iodine-chlorate clock reaction.

    PubMed

    Sant'Anna, Rafaela T P; Monteiro, Emily V; Pereira, Juliano R T; Faria, Roberto B

    2013-01-01

    This work presents a new clock reaction based on ozone, iodine, and chlorate that differs from the known chlorate-iodine clock reaction because it does not require UV light. The induction period for this new clock reaction depends inversely on the initial concentrations of ozone, chlorate, and perchloric acid but is independent of the initial iodine concentration. The proposed mechanism considers the reaction of ozone and iodide to form HOI, which is a key species for producing non-linear autocatalytic behavior. The novelty of this system lies in the presence of ozone, whose participation has never been observed in complex systems such as clock or oscillating reactions. Thus, the autocatalysis demonstrated in this new clock reaction should open the possibility for a new family of oscillating reactions.

  4. A Networks Approach to Modeling Enzymatic Reactions.

    PubMed

    Imhof, P

    2016-01-01

    Modeling enzymatic reactions is a demanding task due to the complexity of the system, the many degrees of freedom involved and the complex, chemical, and conformational transitions associated with the reaction. Consequently, enzymatic reactions are not determined by precisely one reaction pathway. Hence, it is beneficial to obtain a comprehensive picture of possible reaction paths and competing mechanisms. By combining individually generated intermediate states and chemical transition steps a network of such pathways can be constructed. Transition networks are a discretized representation of a potential energy landscape consisting of a multitude of reaction pathways connecting the end states of the reaction. The graph structure of the network allows an easy identification of the energetically most favorable pathways as well as a number of alternative routes.

  5. An Iodine Fluorescence Quenching Clock Reaction

    NASA Astrophysics Data System (ADS)

    Weinberg, Richard B.

    2007-05-01

    A fluorescent clock reaction is described that is based on the principles of the Landolt iodine reaction but uses the potent fluorescence quenching properties of triiodide to abruptly extinguish the ultraviolet fluorescence of optical brighteners present in liquid laundry detergents. The reaction uses easily obtained household products. One variation illustrates the sequential steps and mechanisms of the reaction; other variations maximize the dramatic impact of the demonstration; and a variation that uses liquid detergent in the Briggs Rauscher reaction yields a striking oscillating luminescence. The iodine fluorescence quenching clock reaction can be used in the classroom to explore not only the principles of redox chemistry and reaction kinetics, but also the photophysics of fluorescent pH probes and optical quenching.

  6. Adverse drug reactions in Sjögren's syndrome. Frequent allergic reactions and a specific trimethoprim-associated systemic reaction.

    PubMed

    Antonen, J A; Markula, K P; Pertovaara, M I; Pasternack, A I

    1999-01-01

    Trimethoprim-associated systemic reactions, including aseptic meningitis, have been reported to be very rare adverse drug reactions. Patients with Sjögren's syndrome have been overrepresented, but no epidemiological surveys of the reaction have been conducted. To study the overall frequency of adverse drug reactions, and especially trimethoprim-associated reactions, we interviewed 85 primary Sjögren's syndrome patients and compared the results with those of 45 similarly interviewed osteoarthritis patients. Antimicrobial allergy was more common among Sjögren's syndrome patients than in osteoarthritis patients (46% vs. 27%). Eleven Sjögren's syndrome patients (13%), but no osteoarthritis patient, had experienced at least a partial, non-allergic systemic reaction with trimethoprim. Of them five (6%) had had a full-blown systemic reaction including both chills/fever and headache/backache and at least one of the following: malaise, vomiting, dizziness, confusion or meningeal irritation. Our findings confirm that allergic reactions to antimicrobials are frequent in Sjögren's syndrome. In addition to allergic reactions Sjögren's syndrome patients are prone to a specific trimethoprim-associated systemic reaction. This should be remembered when prescribing antimicrobials.

  7. Subdiffusion-reaction processes with A →B reactions versus subdiffusion-reaction processes with A +B→B reactions

    NASA Astrophysics Data System (ADS)

    Kosztołowicz, Tadeusz; Lewandowska, Katarzyna D.

    2014-09-01

    We consider the subdiffusion-reaction process with reactions of a type A +B→B (in which particles A are assumed to be mobile, whereas B are assumed to be static) in comparison to the subdiffusion-reaction process with A →B reactions which was studied by Sokolov, Schmidt, and Sagués [Phys. Rev. E 73, 031102 (2006), 10.1103/PhysRevE.73.031102]. In both processes a rule that reactions can only occur between particles which continue to exist is taken into account. Although in both processes a probability of the vanishing of particle A due to a reaction is independent of both time and space variables (assuming that in the system with the A +B→B reactions, particles B are distributed homogeneously), we show that subdiffusion-reaction equations describing these processes as well as their Green's functions are qualitatively different. The reason for this difference is as follows. In the case of the former reaction, particles A and B have to meet with some probability before the reaction occurs in contradiction with the case of the latter reaction. For the subdiffusion process with the A +B→B reactions we consider three models which differ in some details concerning a description of the reactions. We base the method considered in this paper on a random walk model in a system with both discrete time and discrete space variables. Then the system with discrete variables is transformed into a system with both continuous time and continuous space variables. Such a method seems to be convenient in analyzing subdiffusion-reaction processes with partially absorbing or partially reflecting walls. The reason is that within this method we can determine Green's functions without a necessity of solving a fractional differential subdiffusion-reaction equation with boundary conditions at the walls. As an example, we use the model to find the Green's functions for a subdiffusive reaction system (with the reactions mentioned above), which is bounded by a partially absorbing wall

  8. Explorations into Chemical Reactions and Biochemical Pathways.

    PubMed

    Gasteiger, Johann

    2016-12-01

    A brief overview of the work in the research group of the present author on extracting knowledge from chemical reaction data is presented. Methods have been developed to calculate physicochemical effects at the reaction site. It is shown that these physicochemical effects can quite favourably be used to derive equations for the calculation of data on gas phase reactions and on reactions in solution such as aqueous acidity of alcohols or carboxylic acids or the hydrolysis of amides. Furthermore, it is shown that these physicochemical effects are quite effective for assigning reactions into reaction classes that correspond to chemical knowledge. Biochemical reactions constitute a particularly interesting and challenging task for increasing our understanding of living species. The BioPath.Database is a rich source of information on biochemical reactions and has been used for a variety of applications of chemical, biological, or medicinal interests. Thus, it was shown that biochemical reactions can be assigned by the physicochemical effects into classes that correspond to the classification of enzymes by the EC numbers. Furthermore, 3D models of reaction intermediates can be used for searching for novel enzyme inhibitors. It was shown in a combined application of chemoinformatics and bioinformatics that essential pathways of diseases can be uncovered. Furthermore, a study showed that bacterial flavor-forming pathways can be discovered.

  9. Reaction products of chlorine dioxide.

    PubMed Central

    Stevens, A A

    1982-01-01

    Inspection of the available literature reveals that a detailed investigation of the aqueous organic chemistry of chlorine dioxide and systematic identification of products formed during water disinfection has not been considered. This must be done before an informed assessment can be made of the relative safety of using chlorine dioxide as a disinfectant alternative to chlorine. Although trihalomethanes are generally not formed by the action of chlorine dioxide, the products of chlorine dioxide treatment of organic materials are oxidized species, some of which also contain chlorine. The relative amounts of species types may depend on the amount of chlorine dioxide residual maintained and the concentration and nature of the organic material present in the source water. The trend toward lower concentrations of chlorinated by-products with increasing ClO2 concentration, which was observed with phenols, has not been observed with natural humic materials as measured by the organic halogen parameter. Organic halogen concentrations have been shown to increase with increasing chlorine dioxide dose, but are much lower than those observed when chlorine is applied. Aldehydes have been detected as apparent by-products of chlorine dioxide oxidation reactions in a surface water that is a drinking water source. Some other nonchlorinated products of chlorine dioxide treatment may be quinones and epoxides. The extent of formation of these moieties within the macromolecular humic structure is also still unknown. PMID:7151750

  10. 2005 Chemical Reactions at Surfaces

    SciTech Connect

    Cynthia M. Friend

    2006-03-14

    The Gordon Research Conference (GRC) on 2005 Chemical Reactions at Surfaces was held at Ventura Beach Marriott, Ventura California from February 13, 2005 through February 18, 2005. The Conference was well-attended with 124 participants (attendees list attached). The attendees represented the spectrum of endeavor in this field coming from academia, industry, and government laboratories, both U.S. and foreign scientists, senior researchers, young investigators, and students. In designing the formal speakers program, emphasis was placed on current unpublished research and discussion of the future target areas in this field. There was a conscious effort to stimulate lively discussion about the key issues in the field today. Time for formal presentations was limited in the interest of group discussions. In order that more scientists could communicate their most recent results, poster presentation time was scheduled. Attached is a copy of the formal schedule and speaker program and the poster program. In addition to these formal interactions, 'free time' was scheduled to allow informal discussions. Such discussions are fostering new collaborations and joint efforts in the field.

  11. Fusion reactions at low energy

    SciTech Connect

    Beckerman, M.

    1985-01-01

    Fusion measurement methods at low energies are briefly described, and experimental and theoretical fusion cross sections for /sup 58/Ni + /sup 58/Ni, /sup 58/Ni + /sup 64/Ni and /sup 64/Ni + /sup 64/Ni reactions are discussed. It is shown that quantal tunneling calculations do not describe the near- and sub-barrier behavior of the fusion data. Instead, the WKB predictions fall progressively further blow the experimental results as the energy is lowered. At far subbarrier energies the measured cross sections exceed the WKB predictions by more than three orders of magnitude. The unexpectedly strong dependence of the fusion probability upon the nuclear valence structure is illustrated and discussed. The relationship of channel coupling and quantal tunneling is discussed. In conclusion, it was established that atomic nuclei fuse far more readily at low energies that would be expected from quantal tunneling considerations alone. It was found that the behavior of the cross sections for fusion depends strongly upon the valence structure of the collision partners. This structural dependence extends from light 1p-shell systems to systems involving nearly 200 nucleons. These new phenomena may be viewed as characterizing the tunneling of a quantal system with many degrees of freedom. The failure of standard tunneling models may be understood as resulting from the ability of the dinuclear system to tunnel into the classically forbidden region by means of couplings to intrinsic degrees of freedom. 38 refs. (WHK)

  12. Myofibroblasts reaction in urothelial carcinomas.

    PubMed

    Alexa, Aurora; Baderca, Flavia; Lighezan, Rodica; Izvernariu, D

    2009-01-01

    The myofibroblast is a connective tissue cell with intermediate features between the fibroblast and the smooth muscle cell and unknown origin, which normally is present in only a few organs, but with increased incidence in malignancies. The patterns of myofibroblastic reaction may be synchronous, metachronous and mixed. The presence of the myofibroblasts has been demonstrated into the stroma of breast carcinomas, particularly in firm, retracted tumors with no inflammatory infiltrate. The present literature lacks data regarding the presence and the behavior of the myofibroblasts in urothelial carcinomas. Fifty-nine urothelial carcinoma specimens from patients admitted into the Urology Clinic of the Emergency County Hospital of Timisoara between 1999 and 2004 were stained with usual HE stain for the morphological diagnosis and immunohistochemically stained with smooth muscle actin, vimentin, and desmin for the detection of myofibroblasts. In biopsies sampled from normal urinary bladder and in urothelial carcinomas of the superior urinary tract Ta, we have not noticed any cells with myofibroblast morphology or immunophenotype. In Ta tumors, no matter the differentiation grade, we have not noticed myofibroblasts neither between the tumor cells nor at distance. The myofibroblasts were identified in seven of the 26 (26.92%) tumors in T1 stage. In T2 and T3 stage tumors the number of myofibroblasts differs from case to case, being significantly higher in tumors with high differentiation grade, G3.

  13. Demisable Reaction-Wheel Assembly

    NASA Technical Reports Server (NTRS)

    Roder, Russell; Ahronovich, Eliezer; Davis, Milton C., III

    2008-01-01

    A document discusses the concept of a demisable motor-drive-and-flywheel assembly [reaction-wheel assembly (RWA)] used in controlling the attitude of a spacecraft. Demisable as used here does not have its traditional legal meaning; instead, it signifies susceptible to melting, vaporizing, and/or otherwise disintegrating during re-entry of the spacecraft into the atmosphere of the Earth so as not to pose a hazard to anyone or anything on the ground. Prior RWAs include parts made of metals (e.g., iron, steel, and titanium) that melt at high temperatures and include structures of generally closed character that shield some parts (e.g., magnets) against re-entry heating. In a demisable RWA, the flywheel would be made of aluminum, which melts at a lower temperature. The flywheel web would not be a solid disk but would have a more open, nearly-spoke-like structure so that it would disintegrate more rapidly; hence, the flywheel rim would separate more rapidly so that parts shielded by the rim would be exposed sooner to re-entry heating. In addition, clearances between the flywheel and other components would be made greater, imparting a more open character and thus increasing the exposure of those components.

  14. Vertical two chamber reaction furnace

    DOEpatents

    Blaugher, R.D.

    1999-03-16

    A vertical two chamber reaction furnace is disclosed. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700 and 800 C) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800 to 950 C to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product. 2 figs.

  15. Vertical two chamber reaction furnace

    DOEpatents

    Blaugher, Richard D.

    1999-03-16

    A vertical two chamber reaction furnace. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700.degree. and 800.degree. C.) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800.degree. to 950.degree. C. to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product.

  16. Glycation Reactions of Casein Micelles.

    PubMed

    Moeckel, Ulrike; Duerasch, Anja; Weiz, Alexander; Ruck, Michael; Henle, Thomas

    2016-04-13

    After suspensions of micellar casein or nonmicellar sodium caseinate had been heated, respectively, in the presence and absence of glucose for 0-4 h at 100 °C, glycation compounds were quantitated. The formation of Amadori products as indicators for the "early" Maillard reaction were in the same range for both micellar and nonmicellar caseins, indicating that reactive amino acid side chains within the micelles are accessible for glucose in a comparable way as in nonmicellar casein. Significant differences, however, were observed concerning the formation of the advanced glycation end products (AGEs), namely, N(ε)-carboxymethyllysine (CML), pyrraline, pentosidine, and glyoxal-lysine dimer (GOLD). CML could be observerd in higher amounts in nonmicellar casein, whereas in the micelles the pyrraline formation was increased. Pentosidine and GOLD were formed in comparable amounts. Furthermore, the extent of protein cross-linking was significantly higher in the glycated casein micelles than in the nonmicellar casein samples. Dynamic light scattering and scanning electron microscopy showed that glycation has no influence on the size of the casein micelles, indicating that cross-linking occurs only in the interior of the micelles, but altered the surface morphology. Studies on glycation and nonenzymatic cross-linking can contribute to the understanding of the structure of casein micelles.

  17. ReactionPredictor: prediction of complex chemical reactions at the mechanistic level using machine learning.

    PubMed

    Kayala, Matthew A; Baldi, Pierre

    2012-10-22

    Proposing reasonable mechanisms and predicting the course of chemical reactions is important to the practice of organic chemistry. Approaches to reaction prediction have historically used obfuscating representations and manually encoded patterns or rules. Here we present ReactionPredictor, a machine learning approach to reaction prediction that models elementary, mechanistic reactions as interactions between approximate molecular orbitals (MOs). A training data set of productive reactions known to occur at reasonable rates and yields and verified by inclusion in the literature or textbooks is derived from an existing rule-based system and expanded upon with manual curation from graduate level textbooks. Using this training data set of complex polar, hypervalent, radical, and pericyclic reactions, a two-stage machine learning prediction framework is trained and validated. In the first stage, filtering models trained at the level of individual MOs are used to reduce the space of possible reactions to consider. In the second stage, ranking models over the filtered space of possible reactions are used to order the reactions such that the productive reactions are the top ranked. The resulting model, ReactionPredictor, perfectly ranks polar reactions 78.1% of the time and recovers all productive reactions 95.7% of the time when allowing for small numbers of errors. Pericyclic and radical reactions are perfectly ranked 85.8% and 77.0% of the time, respectively, rising to >93% recovery for both reaction types with a small number of allowed errors. Decisions about which of the polar, pericyclic, or radical reaction type ranking models to use can be made with >99% accuracy. Finally, for multistep reaction pathways, we implement the first mechanistic pathway predictor using constrained tree-search to discover a set of reasonable mechanistic steps from given reactants to given products. Webserver implementations of both the single step and pathway versions of Reaction

  18. Reaction Coordinates and Mechanistic Hypothesis Tests

    NASA Astrophysics Data System (ADS)

    Peters, Baron

    2016-05-01

    Reaction coordinates are integral to several classic rate theories that can (a) predict kinetic trends across conditions and homologous reactions, (b) extract activation parameters with a clear physical interpretation from experimental rates, and (c) enable efficient calculations of free energy barriers and rates. New trajectory-based rare events methods can provide rates directly from dynamical trajectories without a reaction coordinate. Trajectory-based frameworks can also generate ideal (but abstract) reaction coordinates such as committors and eigenfunctions of the master equation. However, rates and mechanistic insights obtained from trajectory-based methods and abstract coordinates are not readily generalized across simulation conditions or reaction families. We discuss methods for identifying physically meaningful reaction coordinates, including committor analysis, variational transition state theory, Kramers-Langer-Berezhkovskii-Szabo theory, and statistical inference methods that can use path sampling data to screen, mix, and optimize thousands of trial coordinates. Special focus is given to likelihood maximization and inertial likelihood maximization approaches.

  19. Antibody-mediated cofactor-driven reactions

    DOEpatents

    Schultz, Peter G.

    1993-01-01

    Chemical reactions capable of being rate-enhanced by auxiliary species which interact with the reactants but do not become chemically bound to them in the formation of the final product are performed in the presence of antibodies which promote the reactions. The antibodies contain regions within their antigen binding sites which recognize the auxiliary species in a conformation which promotes the reaction. The antigen binding site frequently recognizes a particular transition state complex or other high energy complex along the reaction coordinate, thereby promoting the progress of the reaction along the desired route as opposed to other less favorable routes. Various classes of reaction together with appropriate antigen binding site specificities tailored for each are disclosed.

  20. Triple click reaction strategy for macromolecular diversity.

    PubMed

    Tunca, Umit

    2013-01-11

    This Feature Article focuses on the rapidly emerging concept of the "triple click reactions" towards the design and synthesis of macromolecules with well-defined topology and chemical composition, and also precise molecular weight and narrow molecular weight distribution. The term "triple click reaction" used in this feature article is based on the utilization of three chemically and mechanistically different click reactions for polymer-polymer conjugation and post-modification of the polymers. Three sequential click reactions of which two are identical should not be considered to be triple click reactions. The triple click reaction strategy for polymer conjugation and post-modification of polymers is classified in this article based on the resultant architectures: linear and non-linear structures.