Science.gov

Sample records for kras gene amplification

  1. KRAS and MAPK1 Gene Amplification in Type II Ovarian Carcinomas

    PubMed Central

    Rahman, Mohammed Tanjimur; Nakayama, Kentaro; Rahman, Munmun; Katagiri, Hiroshi; Katagiri, Atsuko; Ishibashi, Tomoka; Ishikawa, Masako; Sato, Emi; Iida, Kouji; Nakayama, Naomi; Ishikawa, Noriyuki; Miyazaki, Kohji

    2013-01-01

    In this study, we examined the clinical significance of KRAS and MAPK1 amplification and assessed whether these amplified genes were potential therapeutic targets in type II ovarian carcinoma. Using fluorescence in situ hybridization, immunohistochemistry, and retrospectively collected clinical data, KRAS and MAPK1 amplifications were identified in 9 (13.2%) and 5 (7.4%) of 68 type II ovarian carcinoma tissue samples, respectively. Interestingly, co-amplification of KRAS and MAPK1 seemed to be absent in the type II ovarian carcinomas tested, except one case. Active phospho-ERK1/2 was identified in 26 (38.2%) out of 68 type II ovarian carcinomas and did not correlate with KRAS or MAPK1 amplification. There was no significant relationship between KRAS amplification and overall or progression-free survival in patients with type II ovarian carcinoma. However, patients with MAPK1 amplification had significantly poorer progression-free survival than patients without MAPK1 amplification. Moreover, type II ovarian carcinoma cells with concomitant KRAS amplification and mutation exhibited dramatic growth reduction following treatment with the MEK inhibitor PD0325901. These findings indicate that KRAS/MAPK1 amplification is critical for the growth of a subset of type II ovarian carcinomas. Additionally, RAS/RAF/MEK/ERK pathway-targeted therapy may benefit selected patients with type II ovarian carcinoma harboring KRAS/MAPK1 amplifications. PMID:23820584

  2. Ultra-sensitive biosensor for K-ras gene detection using enzyme capped gold nanoparticles conjugates for signal amplification.

    PubMed

    Fang, Xian; Bai, Lijuan; Han, Xiaowei; Wang, Jiao; Shi, Anqi; Zhang, Yuzhong

    2014-09-01

    In this study, an ultra-sensitive hairpin DNA-based electrochemical DNA biosensor for K-ras gene detection is described. Gold nanoparticles (Au-NPs) and horseradish peroxidase (HRP)-streptavidin capped Au-NPs (HAS) conjugates are used for signal amplification. Initially, hairpin DNA dually labeled with thiol at its 5' end and with biotin at its 3' end is immobilized on the surface of Au-NPs modified electrode, and the hairpin DNA is in a "closed" state; hence, the HAS conjugates are shielded from being approached by the biotin due to steric hindrance. However, in the presence of target DNA, the target DNA hybridizes with the loop structure of hairpin DNA and causes conformational change, resulting in biotin forced away from the electrode surface, thereby becoming accessible for the HAS conjugates. Thus, the HAS conjugates are linked to the electrode surface via the specific interaction between biotin and streptavidin. Electrochemical detection was performed in phosphate-buffered saline (PBS) containing tetramethylbenzidine (TMB) and H2O2. Under optimal conditions, the peak current differences (ΔI) are linear with the target DNA in the range from 0.1 fM to 1 nM with a detection limit of 0.035 fM. Furthermore, this biosensor also demonstrates its excellent specificity for single-base mismatched DNA. PMID:24939462

  3. Discordant cellular response to presurgical letrozole in bilateral synchronous ER+ breast cancers with a KRAS mutation or FGFR1 gene amplification.

    PubMed

    Balko, Justin M; Mayer, Ingrid A; Sanders, Melinda E; Miller, Todd W; Kuba, Maria G; Meszoely, Ingrid M; Wagle, Nikhil; Garraway, Levi A; Arteaga, Carlos L

    2012-10-01

    We describe herein a patient presenting with bilateral estrogen-receptor-positive (ER+) breast tumors who was enrolled in a clinical trial exploring molecular aberrations associated with hormone-refractory tumor cell proliferation. Short-term (two week) hormonal therapy with the aromatase inhibitor letrozole substantially reduced proliferation as measured by Ki67 immunohistochemistry in one tumor, whereas the second was essentially unchanged. Extensive molecular and genetic work-up of the two tumors yielded divergent lesions in the two tumors: an activating KRAS mutation in the responsive tumor and an amplification of the fibroblast growth factor receptor-1 (FGFR1) locus in the treatment-refractory tumor. These findings provide an insight to possible mechanisms of resistance to antiestrogen therapy in ER+ breast cancers. First, they illustrate the necessity of clinically approved assays to identify FGFR1 gene amplification, which occur in approximately 5% of breast tumors and have been linked to antiestrogen resistance. It is quite possible that the addition of FGFR inhibitors to ER-targeted therapy will yield a superior antitumor effect and improved patient outcome. Second, they suggest that the role of activating mutations in RAS, although rare in breast cancer, may need to be explored in the context of ER+ breast tumors.

  4. Novel Methodology for Rapid Detection of KRAS Mutation Using PNA-LNA Mediated Loop-Mediated Isothermal Amplification.

    PubMed

    Itonaga, Masahiro; Matsuzaki, Ibu; Warigaya, Kenji; Tamura, Takaaki; Shimizu, Yuki; Fujimoto, Masakazu; Kojima, Fumiyoshi; Ichinose, Masao; Murata, Shin-Ichi

    2016-01-01

    Detecting point mutation of human cancer cells quickly and accurately is gaining in importance for pathological diagnosis and choice of therapeutic approach. In the present study, we present novel methodology, peptide nucleic acid-locked nucleic acid mediated loop-mediated isothermal amplification (PNA-LNA mediated LAMP), for rapid detection of KRAS mutation using advantages of both artificial DNA and LAMP. PNA-LNA mediated LAMP reactions occurred under isothermal temperature conditions of with 4 primary primers set for the target regions on the KRAS gene, clamping PNA probe that was complimentary to the wild type sequence and LNA primers complementary to the mutated sequences. PNA-LNA mediated LAMP was applied for cDNA from 4 kinds of pancreatic carcinoma cell lines with or without KRAS point mutation. The amplified DNA products were verified by naked-eye as well as a real-time PCR equipment. By PNA-LNA mediated LAMP, amplification of wild type KRAS DNA was blocked by clamping PNA probe, whereas, mutant type KRAS DNA was significantly amplified within 50 min. Mutant alleles could be detected in samples which diluted until 0.1% of mutant-to-wild type ratio. On the other hand, mutant alleles could be reproducibly with a mutant-to-wild type ratio of 30% by direct sequencing and of 1% by PNA-clamping PCR. The limit of detection (LOD) of PNA-LNA mediated LAMP was much lower than the other conventional methods. Competition of LNA clamping primers complementary to two different subtypes (G12D and G12V) of mutant KRAS gene indicated different amplification time depend on subtypes of mutant cDNA. PNA-LNA mediated LAMP is a simple, rapid, specific and sensitive methodology for the detection of KRAS mutation. PMID:26999437

  5. MYCN Gene Amplification

    PubMed Central

    Yoshimoto, Maisa; Caminada de Toledo, Silvia Regina; Monteiro Caran, Eliana Maria; de Seixas, Maria Teresa; de Martino Lee, Maria Lucia; de Campos Vieira Abib, Simone; Vianna, Sonia Maria Rossi; Schettini, Sergio Thomaz; Anderson Duffles Andrade, Joyce

    1999-01-01

    Neuroblastoma is the second most common solid tumor occurring in children. Amplification of the MYCN oncogene is associated with poor prognosis. To identify neuroblastoma tumors with MYCN amplification, we studied the number of copies of MYCN in interphase cells by fluorescence in situ hybridization in 20 neuroblastoma patients. MYCN amplification appeared in 7 tumor specimens. Interphase and metaphase studies showed a tumor cell population with both forms of amplification, double minutes and homogeneously staining regions, in two patients. These patients showed a smaller tumor cell subpopulation with the presence of more than one homogeneously staining region, suggesting that gene amplification was undergoing karyotype evolution. PMID:10550298

  6. PIK3CA Amplification Is Common in Left Side-Tubular Adenomas but Uncommon Sessile Serrated Adenomas Exclusively with KRAS Mutation

    PubMed Central

    Lee, Hyunsu; Lee, Jae-Ho; Kim, Dae-Kwang; Choi, In-Jang; Hwang, Ilseon; Kang, Yu-Na; Kim, Shin

    2015-01-01

    Colorectal cancer is a heterogeneous disorder than arises via multiple distinct pathways, from tubular adenomas (TAs) and sessile serrated adenomas (SSAs), which are clinically, morphologically, and molecularly different. We examined PIK3CA amplification in colorectal precancerous legions, including TAs and SSAs. DNA was isolated from paired normal and tumoral tissues in 64 TAs and 32 SSAs. PIK3CA amplification, KRAS mutation, and BRAF mutation were analyzed by real-time PCR and pyrosequencing. PIK3CA amplification was found in 25% of TAs and 9.4% of SSAs, respectively. KRAS and BRAF mutations were mutually exclusive in both TAs and SSAs. In TAs, PIK3CA amplification was associated with left side and it was mutually exclusive with KRAS mutation. These results suggest that PIK3CA amplification may be early and important event in colorectal carcinogenesis and may drive the development of left-side TAs independently with KRAS mutation. PMID:26019684

  7. Selective targeting of KRAS-Mutant cells by miR-126 through repression of multiple genes essential for the survival of KRAS-Mutant cells

    PubMed Central

    Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish

    2014-01-01

    MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095

  8. Gene amplification and insecticide resistance.

    PubMed

    Bass, Chris; Field, Linda M

    2011-08-01

    Pesticide resistance in arthropods has been shown to evolve by two main mechanisms, the enhanced production of metabolic enzymes, which bind to and/or detoxify the pesticide, and mutation of the target protein, which makes it less sensitive to the pesticide. One route that leads to enhanced metabolism is the duplication or amplification of the structural gene(s) encoding the detoxifying enzyme, and this has now been described for the three main families (esterases, glutathione S-transferases and cytochrome P450 monooxygenases) implicated in resistance. More recently, a direct or indirect role for gene duplication or amplification has been described for target-site resistance in several arthropod species. This mini-review summarises the involvement of gene duplication/amplification in the insecticide/acaricide resistance of insect and mite pests and highlights recent developments in this area in relation to P450-mediated and target-site resistance.

  9. K-ras gene mutation in gall bladder carcinomas and dysplasia.

    PubMed Central

    Ajiki, T; Fujimori, T; Onoyama, H; Yamamoto, M; Kitazawa, S; Maeda, S; Saitoh, Y

    1996-01-01

    Epithelial dysplasia of gall bladder is an important precancerous lesion of gall bladder carcinogenesis. To investigate the frequency of K-ras gene mutation in gall bladder carcinoma and dysplasia, K-ras codon 12 mutations were investigated by the polymerase chain reaction/restriction enzyme based method following direct sequencing. Mutation was detected in 59% (30 of 51) of gall bladder carcinomas, in 73% (8 of 11) of gall bladder dysplasia in gall stone cases, and in 0% of the normal gall bladder epithelium. There was, however, no correlation between K-ras mutation and clinicopathological factors of gall bladder carcinoma. K-ras gene mutation occurs even in gall bladder dysplasia at an incidence similar to that in carcinomas, suggesting that testing for K-ras gene mutation may prove useful as an adjunct to bile cytological or biopsy analysis. Images Figure 1 Figure 2 Figure 3 PMID:8675098

  10. Chromosomal destabilization during gene amplification.

    PubMed Central

    Ruiz, J C; Wahl, G M

    1990-01-01

    Acentric extrachromosomal elements, such as submicroscopic autonomously replicating circular molecules (episomes) and double minute chromosomes, are common early, and in some cases initial, intermediates of gene amplification in many drug-resistant and tumor cell lines. In order to gain a more complete understanding of the amplification process, we investigated the molecular mechanisms by which such extrachromosomal elements are generated and we traced the fate of these amplification intermediates over time. The model system consists of a Chinese hamster cell line (L46) created by gene transfer in which the initial amplification product was shown previously to be an unstable extrachromosomal element containing an inverted duplication spanning more than 160 kilobases (J. C. Ruiz and G. M. Wahl, Mol. Cell. Biol. 8:4302-4313, 1988). In this study, we show that these molecules were formed by a process involving chromosomal deletion. Fluorescence in situ hybridization was performed at multiple time points on cells with amplified sequences. These studies reveal that the extrachromosomal molecules rapidly integrate into chromosomes, often near or at telomeres, and once integrated, the amplified sequences are themselves unstable. These data provide a molecular and cytogenetic chronology for gene amplification in this model system; an early event involves deletion to generate extrachromosomal elements, and subsequent integration of these elements precipitates a cascade of chromosome instability. Images PMID:2188107

  11. Genome-wide gene expression analysis identifies K-ras as a regulator of alcohol intake.

    PubMed

    Repunte-Canonigo, Vez; van der Stap, Lena D; Chen, Jihuan; Sabino, Valentina; Wagner, Ulrich; Zorrilla, Eric P; Schumann, Gunter; Roberts, Amanda J; Sanna, Pietro Paolo

    2010-06-21

    Adaptations in the anterior cingulate cortex (ACC) have been implicated in alcohol and drug addiction. To identify genes that may contribute to excessive drinking, here we performed microarray analyses in laser microdissected rat ACC after a single or repeated administration of an intoxicating dose of alcohol (3 g/kg). Expression of the small G protein K-ras was differentially regulated following both single and repeated alcohol administration. We also observed that voluntary alcohol intake in K-ras heterozygous null mice (K-ras(+/-)) did not increase after withdrawal from repeated cycles of intermittent ethanol vapor exposure, unlike in their wild-type littermates. To identify K-ras regulated pathways, we then profiled gene expression in the ACC of K-ras(+/-), heterozygous null mice for the K-ras negative regulator Nf1 (Nf1(+/-)) and wild-type mice following repeated administration of an intoxicating dose of alcohol. Pathway analysis showed that alcohol differentially affected various pathways in a K-ras dependent manner - some of which previously shown to be regulated by alcohol - including the insulin/PI3K pathway, the NF-kappaB, the phosphodiesterases (PDEs) pathway, the Jak/Stat and the adipokine signaling pathways. Altogether, the data implicate K-ras-regulated pathways in the regulation of excessive alcohol drinking after a history of dependence.

  12. Increasingly branched rolling circle amplification for the cancer gene detection.

    PubMed

    Li, Hongling; Xu, Jianguo; Wang, Zhenmeng; Wu, Zai-Sheng; Jia, Lee

    2016-12-15

    An increasingly branched rolling circle amplification (IB-RCA) which contains a padlock probe (PP) and a structurally tailored molecular beacon (MB) was innovatively developed for highly sensitive detection of cancer gene, Kras gene codon 12. In this system, the PP can be circularized after hybridization with the precisely-matched target DNA, while the stem of MB can be also opened by target DNA, resulting in hybridization with the circularized PP to generate a long tandem single-stranded DNA (ssDNA) product. Since the MB is also designed to hybridize with ssDNA product, the newly-opened MBs are able to trigger the next RCA reactions, therapy producing branched rolling circle amplification (RCA) products and in turn leading to the increasingly branched RCA (IB-RCA). This alternately and continuously operates hybridization-based MB opening and opened MBs-triggered RCA. As a result, a great number of MBs are opened that is associated with a dramatically amplified fluorescent signal, enabling to quantify target DNA down to 100 fM. This sensing method demonstrates a new concept of IB-RCA amplification even in a simple way to efficiently transduce the fluorescence signal, accomplishing the highly sensitive and selective detection of cancer gene. PMID:27569300

  13. Increasingly branched rolling circle amplification for the cancer gene detection.

    PubMed

    Li, Hongling; Xu, Jianguo; Wang, Zhenmeng; Wu, Zai-Sheng; Jia, Lee

    2016-12-15

    An increasingly branched rolling circle amplification (IB-RCA) which contains a padlock probe (PP) and a structurally tailored molecular beacon (MB) was innovatively developed for highly sensitive detection of cancer gene, Kras gene codon 12. In this system, the PP can be circularized after hybridization with the precisely-matched target DNA, while the stem of MB can be also opened by target DNA, resulting in hybridization with the circularized PP to generate a long tandem single-stranded DNA (ssDNA) product. Since the MB is also designed to hybridize with ssDNA product, the newly-opened MBs are able to trigger the next RCA reactions, therapy producing branched rolling circle amplification (RCA) products and in turn leading to the increasingly branched RCA (IB-RCA). This alternately and continuously operates hybridization-based MB opening and opened MBs-triggered RCA. As a result, a great number of MBs are opened that is associated with a dramatically amplified fluorescent signal, enabling to quantify target DNA down to 100 fM. This sensing method demonstrates a new concept of IB-RCA amplification even in a simple way to efficiently transduce the fluorescence signal, accomplishing the highly sensitive and selective detection of cancer gene.

  14. Mutational analyses of the BRAF, KRAS, and PIK3CA genes in oral squamous cell carcinoma

    PubMed Central

    Bruckman, Karl C.; Schönleben, Frank; Qiu, Wanglong; Woo, Victoria L.; Su, Gloria H.

    2010-01-01

    OBJECTIVES The development of oral squamous cell carcinoma (OSCC) is a complex, multistep process. To date, numerous oncogenes and tumor-suppressor genes have been implicated in oral carcinogenesis. Of particular interest in this regard are genes involved in cell cycling and apoptosis, such BRAF, KRAS, and PIK3CA genes. STUDY DESIGN Mutations of BRAF, KRAS, and PIK3CA were evaluated by direct genomic sequencing of exons 1 of KRAS, 11 and 15 of BRAF, and 9 and 20 of PIK3CA in OSCC specimens. RESULTS Both BRAF and KRAS mutations were detected with a mutation frequency of 2% (1/42). PIK3CA mutations were detected at 3% (1/35). CONCLUSIONS This is the first report implicating BRAF mutation in OSCC. Our study supports that mutations in the BRAF, KRAS, and PIK3CA genes make at least a minor contribution to OSCC tumorigenesis, and pathway-specific therapies targeting these two pathways should be considered for OSCC in a subset of patients with these mutations. PMID:20813562

  15. Mutation status of somatic EGFR and KRAS genes in Chinese patients with prostate cancer (PCa).

    PubMed

    Fu, Meng; Zhang, Wei; Shan, Ling; Song, Jian; Shang, Donghao; Ying, Jianming; Zhao, Jimao

    2014-05-01

    Activating mutations of the epidermal growth factor receptor (EGFR) confers sensitivity to tyrosine kinase inhibitors (TKIs). In colorectal cancer and in lung adenocarcinomas, clinical trials have shown a lack of response to anti-EGFR therapy when KRAS gene mutations are present. In this study, the mutation status of specified exons of the EGFR and KRAS genes was profiled in patients with prostate cancer (PCa). Direct Sanger sequencing was used to screen for mutations in exons 19-21 of EGFR and in exon 2 of KRAS in 88 Chinese patients diagnosed with prostate adenocarcinomas. Mutations were detected in 11 patients. In nine cases (10 %), activating mutations in the region of EGFR encoding the tyrosine kinase (TK) domain were present. Deletions in exon 19 and the L858R substitution in exon 21 were "hotspot" mutations, together accounting for five (55 %) of nine cases. Many synonymous substitutions were also detected. KRAS mutations were found in two cases (2.3 % of 88). There were no cases with mutations in both EGFR and KRAS, suggesting that mutations in the two genes might be mutually exclusive. Although prognostic relevance of EGFR expression by immunohistochemistry (IHC) was observed in PCa patients in previous studies, we found no statistically significant association between EGFR or KRAS mutations and clinicopathological features (including age, smoking status, preoperative prostate-specific antigen, Gleason scores, and tumor stage). We contend that accurate profiling of the mutation status of EGFR and KRAS could improve prognostic stratification, and we suggest a potential anti-EGFR therapy for patients with PCa with EGFR mutations. PMID:24595526

  16. The MDM2 gene amplification database.

    PubMed Central

    Momand, J; Jung, D; Wilczynski, S; Niland, J

    1998-01-01

    The p53 tumor suppressor gene is inactivated in human tumors by several distinct mechanisms. The best characterized inactivation mechanisms are: (i) gene mutation; (ii) p53 protein association with viral proteins; (iii) p53 protein association with the MDM2 cellular oncoprotein. The MDM2 gene has been shown to be abnormally up-regulated in human tumors and tumor cell lines by gene amplification, increased transcript levels and enhanced translation. This communication presents a brief review of the spectrum of MDM2 abnormalities in human tumors and compares the tissue distribution of MDM2 amplification and p53 mutation frequencies. In this study, 3889 samples from tumors or xenografts from 28 tumor types were examined for MDM2 amplification from previously published sources. The overall frequency of MDM2 amplification in these human tumors was 7%. Gene amplification was observed in 19 tumor types, with the highest frequency observed in soft tissue tumors (20%), osteosarcomas (16%) and esophageal carcinomas (13%). Tumors which showed a higher incidence of MDM2 amplification than p53 mutation were soft tissue tumors, testicular germ cell cancers and neuro-blastomas. Data from studies where both MDM2 amplification and p53 mutations were analyzed within the same samples showed that mutations in these two genes do not generally occur within the same tumor. In these studies, 29 out of a total of 33 MDM2 amplification-positive tumors had wild-type p53. We hypothesize that heretofore uncharacterized carcinogens favor MDM2 amplification over p53 mutations in certain tumor types. A database listing the MDM2 gene amplifications is available on the World Wide Web at http://www. infosci.coh.org/mdm2 . Charts of MDM2 amplification frequencies and comparisons with p53 genetic alterations are also available at this Web site. PMID:9671804

  17. Alterations in the K-ras and p53 genes in rat lung tumors

    SciTech Connect

    Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E.

    1997-06-01

    Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

  18. Tumor cells with KRAS or BRAF mutations or ERK5/MAPK7 amplification are not addicted to ERK5 activity for cell proliferation.

    PubMed

    Lochhead, Pamela A; Clark, Jonathan; Wang, Lan-Zhen; Gilmour, Lesley; Squires, Matthew; Gilley, Rebecca; Foxton, Caroline; Newell, David R; Wedge, Stephen R; Cook, Simon J

    2016-01-01

    ERK5, encoded by MAPK7, has been proposed to play a role in cell proliferation, thus attracting interest as a cancer therapeutic target. While oncogenic RAS or BRAF cause sustained activation of the MEK1/2-ERK1/2 pathway, ERK5 is directly activated by MEK5. It has been proposed that RAS and RAF proteins can also promote ERK5 activation. Here we investigated the interplay between RAS-RAF-MEK-ERK and ERK5 signaling and studied the role of ERK5 in tumor cell proliferation in 2 disease-relevant cell models. We demonstrate that although an inducible form of CRAF (CRAF:ER*) can activate ERK5 in fibroblasts, the response is delayed and reflects feed-forward signaling. Additionally, oncogenic KRAS and BRAF do not activate ERK5 in epithelial cells. Although KRAS and BRAF do not couple directly to MEK5-ERK5, ERK5 signaling might still be permissive for proliferation. However, neither the selective MEK5 inhibitor BIX02189 or ERK5 siRNA inhibited proliferation of colorectal cancer cells harbouring KRAS(G12C/G13D) or BRAF(V600E). Furthermore, there was no additive or synergistic effect observed when BIX02189 was combined with the MEK1/2 inhibitor Selumetinib (AZD6244), suggesting that ERK5 was neither required for proliferation nor a driver of innate resistance to MEK1/2 inhibitors. Finally, even cancer cells with MAPK7 amplification were resistant to BIX02189 and ERK5 siRNA, showing that ERK5 amplification does not confer addiction to ERK5 for cell proliferation. Thus ERK5 signaling is unlikely to play a role in tumor cell proliferation downstream of KRAS or BRAF or in tumor cells with ERK5 amplification. These results have important implications for the role of ERK5 as an anti-cancer drug target.

  19. Heat induces gene amplification in cancer cells

    SciTech Connect

    Yan, Bin; Ouyang, Ruoyun; Huang, Chenghui; Liu, Franklin; Neill, Daniel; Li, Chuanyuan; Dewhirst, Mark

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer This study discovered that heat exposure (hyperthermia) results in gene amplification in cancer cells. Black-Right-Pointing-Pointer Hyperthermia induces DNA double strand breaks. Black-Right-Pointing-Pointer DNA double strand breaks are considered to be required for the initiation of gene amplification. Black-Right-Pointing-Pointer The underlying mechanism of heat-induced gene amplification is generation of DNA double strand breaks. -- Abstract: Background: Hyperthermia plays an important role in cancer therapy. However, as with radiation, it can cause DNA damage and therefore genetic instability. We studied whether hyperthermia can induce gene amplification in cancer cells and explored potential underlying molecular mechanisms. Materials and methods: (1) Hyperthermia: HCT116 colon cancer cells received water-submerged heating treatment at 42 or 44 Degree-Sign C for 30 min; (2) gene amplification assay using N-(phosphoacetyl)-L-aspartate (PALA) selection of cabamyl-P-synthetase, aspartate transcarbarmylase, dihydro-orotase (cad) gene amplified cells; (3) southern blotting for confirmation of increased cad gene copies in PALA-resistant cells; (4) {gamma}H2AX immunostaining to detect {gamma}H2AX foci as an indication for DNA double strand breaks. Results: (1) Heat exposure at 42 or 44 Degree-Sign C for 30 min induces gene amplification. The frequency of cad gene amplification increased by 2.8 and 6.5 folds respectively; (2) heat exposure at both 42 and 44 Degree-Sign C for 30 min induces DNA double strand breaks in HCT116 cells as shown by {gamma}H2AX immunostaining. Conclusion: This study shows that heat exposure can induce gene amplification in cancer cells, likely through the generation of DNA double strand breaks, which are believed to be required for the initiation of gene amplification. This process may be promoted by heat when cellular proteins that are responsible for checkpoints, DNA replication, DNA repair and

  20. KRAS gene mutations are more common in colorectal villous adenomas and in situ carcinomas than in carcinomas

    PubMed Central

    Zauber, Peter; Marotta, Stephen; Sabbath-Solitare, Marlene

    2013-01-01

    We have evaluated the frequency of KRAS gene mutations during the critical transition from villous adenoma to colorectal carcinoma to assess whether the adenomas contain a KRAS mutation more frequently than carcinomas. We analyzed sporadic villous and tubulovillous adenomas, in situ carcinomas, and primary colorectal carcinomas from multiple patients. The cancers were further evaluated for mucinous status and microsatellite instability. Standard PCR molecular techniques were used for KRAS and microsatellite analyses. A KRAS mutation was found in 61.9% of 134 adenomas, 67.8% of 84 in situ carcinomas, and just 31.6% of 171 carcinomas. Our study clearly demonstrates that tubulovillous and villous adenomas, as well as both the benign and malignant parts of in situ carcinomas, are statistically more likely to contain a somatic KRAS gene mutation than colorectal carcinomas. This difference is confined to the non-mucinous and the microsatellite stable tumors. Our data support the possibility that non-mucinous and microsatellite stable carcinomas with wild-type KRAS gene may have had a mutation in the KRAS gene during their earlier stages, with the mutation lost during further growth. PMID:23565319

  1. Tumor cells with KRAS or BRAF mutations or ERK5/MAPK7 amplification are not addicted to ERK5 activity for cell proliferation

    PubMed Central

    Lochhead, Pamela A.; Clark, Jonathan; Wang, Lan-Zhen; Gilmour, Lesley; Squires, Matthew; Gilley, Rebecca; Foxton, Caroline; Newell, David R.; Wedge, Stephen R.; Cook, Simon J.

    2016-01-01

    Abstract ERK5, encoded by MAPK7, has been proposed to play a role in cell proliferation, thus attracting interest as a cancer therapeutic target. While oncogenic RAS or BRAF cause sustained activation of the MEK1/2-ERK1/2 pathway, ERK5 is directly activated by MEK5. It has been proposed that RAS and RAF proteins can also promote ERK5 activation. Here we investigated the interplay between RAS-RAF-MEK-ERK and ERK5 signaling and studied the role of ERK5 in tumor cell proliferation in 2 disease-relevant cell models. We demonstrate that although an inducible form of CRAF (CRAF:ER*) can activate ERK5 in fibroblasts, the response is delayed and reflects feed-forward signaling. Additionally, oncogenic KRAS and BRAF do not activate ERK5 in epithelial cells. Although KRAS and BRAF do not couple directly to MEK5-ERK5, ERK5 signaling might still be permissive for proliferation. However, neither the selective MEK5 inhibitor BIX02189 or ERK5 siRNA inhibited proliferation of colorectal cancer cells harbouring KRASG12C/G13D or BRAFV600E. Furthermore, there was no additive or synergistic effect observed when BIX02189 was combined with the MEK1/2 inhibitor Selumetinib (AZD6244), suggesting that ERK5 was neither required for proliferation nor a driver of innate resistance to MEK1/2 inhibitors. Finally, even cancer cells with MAPK7 amplification were resistant to BIX02189 and ERK5 siRNA, showing that ERK5 amplification does not confer addiction to ERK5 for cell proliferation. Thus ERK5 signaling is unlikely to play a role in tumor cell proliferation downstream of KRAS or BRAF or in tumor cells with ERK5 amplification. These results have important implications for the role of ERK5 as an anti-cancer drug target. PMID:26959608

  2. Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human KRAS gene.

    PubMed

    Antontseva, Elena V; Matveeva, Marina Yu; Bondar, Natalia P; Kashina, Elena V; Leberfarb, Elena Yu; Bryzgalov, Leonid O; Gervas, Polina A; Ponomareva, Anastasia A; Cherdyntseva, Nadezhda V; Orlov, Yury L; Merkulova, Tatiana I

    2015-12-01

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse K-ras gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T greater than A, rs12226937: G greater than A, and rs61761074: T greater than G) located in the same region of human KRAS. We found that rs12228277 and rs61761074 result in differential binding patterns of lung nuclear proteins to oligonucleotide probes corresponding two alternative alleles; in both cases, the transcription factor NF-Y is involved. G greater than A substitution (rs12226937) had no effect on the binding of lung nuclear proteins. However, all the nucleotide substitutions under study showed functional effects in a luciferase reporter assay. Among them, rs61761074 demonstrated a significant correlation with allele frequency in non-small-cell lung cancer (NSCLC). Taken together, the results of our study suggest that a T greater than G substitution at nucleotide position 615 in the second intron of the KRAS gene (rs61761074) may represent a promising genetic marker of NSCLC. PMID:26648033

  3. Molecular spectrum of KRAS, BRAF, and PIK3CA gene mutation: determination of frequency, distribution pattern in Indian colorectal carcinoma.

    PubMed

    Bisht, Swati; Ahmad, Firoz; Sawaimoon, Satyakam; Bhatia, Simi; Das, Bibhu Ranjan

    2014-09-01

    Molecular evaluation of KRAS, BRAF, and PIK3CA mutation has become an important part in colorectal carcinoma evaluation, and their alterations may determine the therapeutic response to anti-EGFR therapy. The current study demonstrates the evaluation of KRAS, BRAF, and PIK3CA mutation using direct sequencing in 204 samples. The frequency of KRAS, BRAF, and PIK3CA mutations was 23.5, 9.8, and 5.9 %, respectively. Five different substitution mutations at KRAS codon 12 (G12S, G12D, G12A, G12V, and G12C) and one substitution type at codon 13 (G13D) were observed. KRAS mutations were significantly higher in patients who were >50 years, and were associated with moderate/poorly differentiated tumors and adenocarcinomas. All mutations in BRAF gene were of V600E type, which were frequent in patients who were ≤ 50 years. Unlike KRAS mutations, BRAF mutations were more frequent in well-differentiated tumors and right-sided tumors. PIK3CA-E545K was the most recurrent mutation while other mutations detected were T544I, Q546R, H1047R, G1049S, and D1056N. No significant association of PIK3CA mutation with age, tumor differentiation, location, and other parameters was noted. No concomitant mutation of KRAS and BRAF mutations was observed, while, interestingly, five cases showed concurrent mutation of KRAS and PIK3CA mutations. In conclusion, to our knowledge, this is the first study to evaluate the PIK3CA mutation in Indian CRC patients. The frequency of KRAS, BRAF, and PIK3CA was similar to worldwide reports. Furthermore, identification of molecular markers has unique strengths, and can provide insights into the pathogenic process and help optimize personalized prevention and therapy.

  4. Amplification-free In Situ KRAS Point Mutation Detection at 60 copies/mL in Urine in a Background of 1000-fold Wild Type

    PubMed Central

    KirimLi, Ceyhun E.; Shih, Wei-Heng; Shih, Wan Y.

    2016-01-01

    We have examined in situ detection of single-nucleotide KRAS mutation in urine using a (Pb(Mg1/3Nb2/3)O3)0.65(PbTiO3)0.35 (PMN-PT) piezoelectric plate sensor (PEPS) coated with a 17-nucleotide (nt) locked nucleic acid (LNA) probe DNA complementary to the KRAS mutation. To enhance in situ mutant (MT) DNA detection specificity against the wild type (WT), the detection was carried out in a flow with a flow rate of 4 mL/min and at 63°C with the PEPS vertically situated at the center of the flow in which both the temperature and the flow impingement force discriminated the wild type. Under such conditions, PEPS was shown to specifically detect KRAS MT in situ with 60 copies/mL analytical sensitivity in a background of clinically-relevant 1000-fold more WT in 30 min without DNA isolation, amplification, or labeling. For validation, the detection was followed with detection in a mixture of blue MT fluorescent reporter microspheres (FRMs) (MT FRMs) that bound to only the captured MT and orange WT FRMs that bound to only the captured WT. Microscopic examinations showed that the captured blue MT FRMs still outnumbered the orange WT FRMs by a factor of 4 to 1 even though WT was 1000-fold of MT in urine. Finally, multiplexed specific mutation detection was demonstrated using a 6-PEPS array each with a probe DNA targeting one of the 6 codon-12 KRAS mutations. PMID:26783561

  5. Amplification-free in situ KRAS point mutation detection at 60 copies per mL in urine in a background of 1000-fold wild type.

    PubMed

    Kirimli, Ceyhun E; Shih, Wei-Heng; Shih, Wan Y

    2016-02-21

    We have examined the in situ detection of a single-nucleotide KRAS mutation in urine using a (Pb(Mg1/3Nb2/3)O3)0.65(PbTiO3)0.35 (PMN-PT) piezoelectric plate sensor (PEPS) coated with a 17-nucleotide (nt) locked nucleic acid (LNA) probe DNA complementary to the KRAS mutation. To enhance the in situ mutant (MT) DNA detection specificity against the wild type (WT), detection was carried out in a flow with a flow rate of 4 mL min(-1) and at 63 °C with the PEPS vertically situated at the center of the flow in which both the temperature and the flow impingement force discriminated the wild type. Under such conditions, PEPS was shown to specifically detect KRAS MT in situ with 60 copies per mL analytical sensitivity in a background of clinically-relevant 1000-fold more WT in 30 min without DNA isolation, amplification, or labeling. For validation, this detection was followed with detection in a mixture of blue MT fluorescent reporter microspheres (FRMs) (MT FRMs) that bound to only the captured MT and orange WT FRMs that bound to only the captured WT. Microscopic examinations showed that the captured blue MT FRMs still outnumbered the orange WT FRMs by a factor of 4 to 1 even though WT was 1000-fold of MT in urine. Finally, multiplexed specific mutation detection was demonstrated using a 6-PEPS array each with a probe DNA targeting one of the 6 codon-12 KRAS mutations. PMID:26783561

  6. A correction to the research article titled: "Amplification of the driving oncogene, KRAS or BRAF, underpins acquired resistance to MEK1/2 inhibitors in colorectal cancer cells" by A. S. Little, K. Balmanno, M. J. Sale, S. Newman, J. R. Dry, M. Hampson, P. A. W. Edwards, P. D. Smith, S. J. Cook.

    PubMed

    Little, Annette S; Balmanno, Kathryn; Sale, Matthew J; Newman, Scott; Dry, Jonathan R; Hampson, Mark; Edwards, Paul A W; Smith, Paul D; Cook, Simon J

    2011-01-01

    The acquisition of resistance to protein kinase inhibitors is a growing problem in cancer treatment. We modeled acquired resistance to the MEK1/2 (mitogen-activated or extracellular signal–regulated protein kinase kinases 1 and 2) inhibitor selumetinib (AZD6244) in colorectal cancer cell lines harboring mutations in BRAF (COLO205 and HT29 lines) or KRAS (HCT116 and LoVo lines). AZD6244-resistant derivatives were refractory to AZD6244-induced cell cycle arrest and death and exhibited a marked increase in ERK1/2 (extracellular signal–regulated kinases 1 and 2) pathway signaling and cyclin D1 abundance when assessed in the absence of inhibitor. Genomic sequencing revealed no acquired mutations in MEK1 or MEK2, the primary target of AZD6244. Rather, resistant lines showed a marked up-regulation of their respective driving oncogenes, BRAF600E or KRAS13D, due to intrachromosomal amplification. Inhibition of BRAF reversed resistance to AZD6244 in COLO205 cells, which suggested that combined inhibition of MEK1/2 and BRAF may reduce the likelihood of acquired resistance in tumors with BRAF600E. Knockdown of KRAS reversed AZD6244 resistance in HCT116 cells as well as reduced the activation of ERK1/2 and protein kinase B; however, the combined inhibition of ERK1/2 and phosphatidylinositol 3-kinase signaling had little effect on AZD6244 resistance, suggesting that additional KRAS effector pathways contribute to this process. Microarray analysis identified increased expression of an 18-gene signature previously identified as reflecting MEK1/2 pathway output in resistant cells. Thus, amplification of the driving oncogene (BRAF600E or KRAS13D) can drive acquired resistance to MEK1/2 inhibitors by increasing signaling through the ERK1/2 pathway. However, up-regulation of KRAS13D leads to activation of multiple KRAS effector pathways, underlining the therapeutic challenge posed by KRAS mutations. These results may have implications for the use of combination therapies.

  7. Simultaneous gene silencing of KRAS and anti-apoptotic genes as a multitarget therapy.

    PubMed

    Werner, Kristin; Lademann, Franziska; Thepkaysone, May-Linn; Jahnke, Beatrix; Aust, Daniela E; Kahlert, Christoph; Weber, Georg; Weitz, Jürgen; Grützmann, Robert; Pilarsky, Christian

    2016-01-26

    Pancreatic cancer is one of the most lethal tumor types worldwide and an effective therapy is still elusive. Targeted therapy focused against a specific alteration is by definition unable to attack broad pathway signaling modification. Tumor heterogeneity will render targeted therapies ineffective based on the regrowth of cancer cell sub-clones. Therefore multimodal therapy strategies, targeting signaling pathways simultaneously should improve treatment.SiRNAs against KRAS and the apoptosis associated genes BCLXL, FLIP, MCL1L, SURVIVIN and XIAP were transfected into human and murine pancreatic cancer cell lines. Induction of apoptosis was measured by Caspase 3/7 activation, subG1 FACS analysis and PARP cleavage. The therapeutic approach was tested in a subcutaneous allograft model with a murine cancer cell line.By using siRNAs as a systematic approach to remodel signal transduction in pancreatic cancer the results showed increasing inhibition of proliferation and apoptosis induction in vitro and in vivo. Thus, siRNAs are suitable to model multimodal therapy against signaling pathways in pancreatic cancer. Improvements in in vivo delivery of siRNAs against a multitude of targets might therefore be a potential therapeutic approach.

  8. Simultaneous gene silencing of KRAS and anti-apoptotic genes as a multitarget therapy

    PubMed Central

    Werner, Kristin; Lademann, Franziska; Thepkaysone, May-Linn; Jahnke, Beatrix; Aust, Daniela E.; Kahlert, Christoph; Weber, Georg; Weitz, Jürgen; Grützmann, Robert; Pilarsky, Christian

    2016-01-01

    Pancreatic cancer is one of the most lethal tumor types worldwide and an effective therapy is still elusive. Targeted therapy focused against a specific alteration is by definition unable to attack broad pathway signaling modification. Tumor heterogeneity will render targeted therapies ineffective based on the regrowth of cancer cell sub-clones. Therefore multimodal therapy strategies, targeting signaling pathways simultaneously should improve treatment. SiRNAs against KRAS and the apoptosis associated genes BCLXL, FLIP, MCL1L, SURVIVIN and XIAP were transfected into human and murine pancreatic cancer cell lines. Induction of apoptosis was measured by Caspase 3/7 activation, subG1 FACS analysis and PARP cleavage. The therapeutic approach was tested in a subcutaneous allograft model with a murine cancer cell line. By using siRNAs as a systematic approach to remodel signal transduction in pancreatic cancer the results showed increasing inhibition of proliferation and apoptosis induction in vitro and in vivo. Thus, siRNAs are suitable to model multimodal therapy against signaling pathways in pancreatic cancer. Improvements in in vivo delivery of siRNAs against a multitude of targets might therefore be a potential therapeutic approach. PMID:26716649

  9. Kras gene codon 12 mutation detection enabled by gold nanoparticles conducted in a nanobioarray chip.

    PubMed

    Sedighi, Abootaleb; Li, Paul C H

    2014-03-01

    This study employs a nanobioarray (NBA) chip for multiple biodetection of single base pair mutations at the Kras gene codon 12. To distinguish between the mutant and wild-type target DNAs, current bioarray methods use high-temperature hybridization of the targets to the allele-specific probes. However, these techniques need prior temperature optimization and become harder to implement in the case of the detection of multiple mutations. We aimed to detect these mutations at a single temperature (room temperature), enabled by the use of gold nanoparticles (AuNPs) on the bioarray created within nanofluidic channels. In this method, a low amount of target oligonucleotides (5fmol) and polymerase chain reaction (PCR) products (300pg) were first loaded on the AuNP surface, and then these AuNP-bound targets were introduced into the channels of a polydimethylsiloxane (PDMS) glass chip. The targets hybridized to their complementary probes at the intersection of the target channels to the pre-printed oligonucleotide probe lines on the glass surface, creating a bioarray. Using this technique, fast and high-throughput multiple discrimination of the Kras gene codon 12 were achieved at room temperature using the NBA chip, and the specificity of the method was proved to be as high as that with the temperature stringency method.

  10. Gene amplification in Rhynchosciara salivary gland chromosomes.

    PubMed Central

    Glover, D M; Zaha, A; Stocker, A J; Santelli, R V; Pueyo, M T; De Toledo, S M; Lara, F J

    1982-01-01

    Late in the fourth larval instar, several regions of the Rhynchosciara americana salivary gland chromosomes undergo "DNA puffing." We have constructed a library of cloned cDNAs synthesized from poly(A)+RNA isolated from salivary glands during the period of development when the DNA puffs are active. From this library we have studied clones representative of three genes active during this period but not active at earlier developmental periods of the gland. One of these genes is not amplified during the developmental process and encodes a 0.6-kilobase RNA molecule. The other two genes are located within the DNA-puff sites C3 and C8 and encode 1.25-kilobase and 1.95-kilobase RNA molecules, respectively. We estimate from the quantitation of transfer hybridization experiments that each of these genes undergoes 16-fold amplification during DNA puffing. Images PMID:6953439

  11. Evolution of Gene Expression after Gene Amplification

    PubMed Central

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim

    2015-01-01

    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat–maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that γ-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a γ-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. PMID:25912045

  12. Induction of gene amplification in Plasmodium falciparum

    SciTech Connect

    Rogers, P.L.

    1985-01-01

    Human erythrocytic in vitro cultures of Honduras I strain of the malaria parasite Plasmodium falciparum have been stressed stepwise with increasing concentrations of methotrexate (MTX), a folate antagonist. This selection has produced a strain that is 450 times more resistant to the drug than the original culture. Uptake of sublethal doses of radiolabeled MTX by infected red blood cells was 6-36 times greater in the resistant cultures than in the nonresistant controls. DNA isolated from all of the parasites was probed by hybridization with /sup 35/S-labeled DNA derived from a clone of the yeast thymidylate synthetase (TS) gene. This showed 50 to 100 times more increased hybridization of the TS probe to the DNA from the resistant parasites is direct evidence of gene amplification because DHFR and TS are actually one and the same bifunctional enzyme in P. falciparum. Hence, the evidence presented indicates that induced resistance of the malaria parasite to MTX in this case is due to overproduction of DHFR resulting from amplification of the DHFR-TS gene.

  13. KRAS as a Therapeutic Target

    PubMed Central

    McCormick, Frank

    2015-01-01

    KRAS proteins play a major role in human cancer, but have not yielded to therapeutic attack. New technologies in drug discovery and insights into signaling pathways that KRAS controls have promoted renewed efforts to develop therapies, either through direct targeting of KRAS itself, new ways of blocking KRAS processing, or by identifying targets that KRAS cancers depend on for survival. While drugs that block the well-established downstream pathways, RAF-MAPK and PI 3 kinase, are being tested in the clinic, new efforts are underway to exploit previously unrecognized vulnerabilities, such as altered metabolic networks, or novel pathways identified through synthetic lethal screens. Furthermore, new ways of suppressing KRAS gene expression and of harnessing the immune system offer further hope that new ways of treating KRAS are finally coming into view. These issues are discussed in this edition of CCR Focus. PMID:25878360

  14. Gene methylation of SFRP2, P16, DAPK1, HIC1, and MGMT and KRAS mutations in sporadic colorectal cancer.

    PubMed

    Pehlivan, Sacide; Artac, Mehmet; Sever, Tugce; Bozcuk, Hakan; Kilincarslan, Can; Pehlivan, Mustafa

    2010-09-01

    The aim of this study was to investigate the methylation of the SFRP2, P16, DAPK1, HIC1, and MGMT genes, as well as the mutation of amino acid codons 12 and 13 of the KRAS gene in normal and tumor tissue DNA of patients diagnosed with sporadic colorectal cancer (SCRC). The methylation of gene regions and the KRAS mutations of normal (N) and tumor tissue (T) DNA obtained from 17 patients diagnosed with SCRC and 20 healthy controls were investigated using the polymerase chain reaction and reverse-hybridization methods. There was an Asp mutation in four patients, an Asp and Ser mutations in one patient in codon 12 of the KRAS gene, and an Asp mutation in codon 13 in eight patients. Overall promoter methylation (OPM) in the SFRP2 gene was observed in one N and four T, whereas partial promoter methylation (PPM) was observed in two N and five T. OPM in the P16 gene was present in one T. In the DAPK1 gene, OPM existed in seven T and five N, while PPM was present in two N. In the HIC1 gene, OPM was demonstrated in three T, while PPM was noted in two N; however, no methylation existed in N. In the MGMT gene, OPM occurred in five T and two N, and PPM was present in one T. KRAS mutations in Turkish patients with SCRC are similar to those of other population groups. Methylations in the genes, which underwent methylation analysis, were higher in T in comparison with N, and it has been suggested that significant results would be obtained by making a study with a larger population.

  15. Mutualism breakdown by amplification of Wolbachia genes.

    PubMed

    Chrostek, Ewa; Teixeira, Luis

    2015-02-01

    Most insect species are associated with vertically transmitted endosymbionts. Because of the mode of transmission, the fitness of these symbionts is dependent on the fitness of the hosts. Therefore, these endosymbionts need to control their proliferation in order to minimize their cost for the host. The genetic bases and mechanisms of this regulation remain largely undetermined. The maternally inherited bacteria of the genus Wolbachia are the most common endosymbionts of insects, providing some of them with fitness benefits. In Drosophila melanogaster, Wolbachia wMelPop is a unique virulent variant that proliferates massively in the hosts and shortens their lifespan. The genetic bases of wMelPop virulence are unknown, and their identification would allow a better understanding of how Wolbachia levels are regulated. Here we show that amplification of a region containing eight Wolbachia genes, called Octomom, is responsible for wMelPop virulence. Using Drosophila lines selected for carrying Wolbachia with different Octomom copy numbers, we demonstrate that the number of Octomom copies determines Wolbachia titers and the strength of the lethal phenotype. Octomom amplification is unstable, and reversion of copy number to one reverts all the phenotypes. Our results provide a link between genotype and phenotype in Wolbachia and identify a genomic region regulating Wolbachia proliferation. We also prove that these bacteria can evolve rapidly. Rapid evolution by changes in gene copy number may be common in endosymbionts with a high number of mobile elements and other repeated regions. Understanding wMelPop pathogenicity and variability also allows researchers to better control and predict the outcome of releasing mosquitoes transinfected with this variant to block human vector-borne diseases. Our results show that transition from a mutualist to a pathogen may occur because of a single genomic change in the endosymbiont. This implies that there must be constant selection on

  16. Mechanism of Gene Amplification via Yeast Autonomously Replicating Sequences

    PubMed Central

    Dhar, M. K.

    2015-01-01

    The present investigation was aimed at understanding the molecular mechanism of gene amplification. Interplay of fragile sites in promoting gene amplification was also elucidated. The amplification promoting sequences were chosen from the Saccharomyces cerevisiae ARS, 5S rRNA regions of Plantago ovata and P. lagopus, proposed sites of replication pausing at Ste20 gene locus of S. cerevisiae, and the bend DNA sequences within fragile site FRA11A in humans. The gene amplification assays showed that plasmid bearing APS from yeast and human beings led to enhanced protein concentration as compared to the wild type. Both the in silico and in vitro analyses were pointed out at the strong bending potential of these APS. In addition, high mitotic stability and presence of TTTT repeats and SAR amongst these sequences encourage gene amplification. Phylogenetic analysis of S. cerevisiae ARS was also conducted. The combinatorial power of different aspects of APS analyzed in the present investigation was harnessed to reach a consensus about the factors which stimulate gene expression, in presence of these sequences. It was concluded that the mechanism of gene amplification was that AT rich tracts present in fragile sites of yeast serve as binding sites for MAR/SAR and DNA unwinding elements. The DNA protein interactions necessary for ORC activation are facilitated by DNA bending. These specific bindings at ORC promote repeated rounds of DNA replication leading to gene amplification. PMID:25685838

  17. Molecular spectrum of somatic EGFR and KRAS gene mutations in non small cell lung carcinoma: determination of frequency, distribution pattern and identification of novel variations in Indian patients.

    PubMed

    Das, Bibhu Ranjan; Bhaumik, Sangeet; Ahmad, Firoz; Mandsaurwala, Aziz; Satam, Heena

    2015-07-01

    Somatic mutations of EGFR and KRAS gene represent the most common alterations currently known in NSCLC patients. This study explored the frequency, distribution pattern of EGFR and KRAS mutations in Indian patients. The frequencies of EGFR and KRAS mutations were 29 % (116/400) and 4.5 % (6/132) respectively. Both EGFR and KRAS mutations were prevalent in females, and a trend towards higher mutation frequency was seen in patients under ≥ 60 years age. The presence of EGFR and KRAS mutations were higher in adenocarcinomas in comparison to other histological subtype. Sequencing analysis of EGFR exon 18 revealed Inframe deletion (G709_T710 > A) and missense mutation (K713R). Among exon 19 positive cases, 49.3 % (37/75) were in-frame deletions, of which E746_A750del was frequent. Similarly, ~47 % (35/75) cases showed complex mutation involving indel. Among mutations in exon 20 (N = 9), 8 were substitutions, one showed duplication, while all exon 21 mutations were of the missense types with L858R as the most recurrent type. Sequencing analysis of KRAS exon 1 revealed three different types codon 12 substitutions resulting in c34G > T (G12C) (n = 4), c.35G > A (G12D) (n = 1), and c.35G > T (G12V) (n = 1). In conclusion, the present study is an example of molecular diversity of EGFR and KRAS gene in Indian patients and further confirms that the frequency of EGFR and KRAS mutations varies considerably globally. To the best of our knowledge, this is the first Indian study to evaluate KRAS mutation. The current study also served to identify novel variations that added new insights into the genetic heterogeneity of NSCLC.

  18. Reliable amplification of actin genes facilitates deep-level phylogeny.

    PubMed

    Voigt, K; Wöstemeyer, J

    2000-09-01

    The gene for actin as a highly conserved and functionally essential genetic element is developing into a major tool for phylogenetic analysis within a broad organismic range. We therefore propose a set of universally applicable primers that allow reliable amplification of actin genes. For primer construction the amino acid sequences of 57 actin genes comprising fungi, animals, plants and protists were analysed, aligned and used for the definition of six well-conserved regions which are suitable as priming sites in PCR amplification experiments. Ten primers were designed for specific in vitro amplification of actin gene fragments from a wide range of microorganisms. The corresponding gene fragments provide a strong basis to isolate nearly complete actin genes for further molecular characterization and for establishing phylogenies based on actin gene trees.

  19. Picoliter droplet-based digital peptide nucleic acid clamp PCR and dielectric sorting for low abundant K-ras mutations

    NASA Astrophysics Data System (ADS)

    Zhang, Huidan; Sperling, Ralph; Rotem, Assaf; Shan, Lianfeng; Heyman, John; Zhang, Yizhe; Weitz, David

    2012-02-01

    Colorectal cancer (CRC) remains the second leading cause of cancer-related mortality in the US, and the 5-year survival of metastatic CRC (mCRC) is less than 10%. Although monoclonal antibodies against epidermal growth factor receptor (EGFR) provide incremental improvements in survival, approximately 40% of mCRC patients with activating KRAS mutations won't benefit from this therapy. Peptide nucleic acid (PNA), a synthetic non-extendable oligonucleotides, can bind strongly to completely complementary wild-type KRAS by Watson-Crick base pairing and suppress its amplification during PCR, while any mutant allele will show unhindered amplification. The method is particularly suitable for the simultaneously detection of several adjoining mutant sites, just as mutations of codons 12 and 13 of KRAS gene where there are totally 12 possible mutation types. In this work, we describe the development and validation of this method, based on the droplet-based digital PCR. Using a microfluidic system, single target DNA molecule is compartmentalized in microdroplets together with PNA specific for wild-type KRAS, thermocycled and the fluorescence of each droplet was detected, followed by sorting and sequencing. It enables the precise determination of all possible mutant KRAS simultaneously, and the precise quantification of a single mutated KRAS in excess background unmutated KRAS.

  20. Functional variants in CYP1B1, KRAS and MTHFR genes are associated with shorter telomere length in postmenopausal women.

    PubMed

    Cerne, Jasmina Z; Pohar-Perme, Maja; Cerkovnik, Petra; Gersak, Ksenija; Novakovic, Srdjan

    2015-07-01

    Estrogens and antioxidants indirectly alleviate telomere attrition. However, available clinical data on the association between hormone exposure and telomere length are inconclusive. In the present study, we examined the effects of exogenous estrogen use and of some genetic factors implicated in estrogen metabolism and oxidative stress response on mean leukocyte telomere length. We studied 259 postmenopausal women. Genotyping was conducted for CYP1B1 (rs1056836), COMT (rs4680), GSTP1 (rs1695), MnSOD (rs4880), KRAS (rs61764370), and MTHFR (rs1801133 and rs1801131) polymorphisms. Mean leukocyte telomere length was measured using a quantitative real-time PCR assay. In multivariate analysis we found no association between oral contraceptives or hormone replacement therapy (HRT) and mean leukocyte telomere length. The presence of variant alleles in CYP1B1, KRAS and MTHFR genes was statistically significantly associated with shorter mean leukocyte telomere length. Further, the data provided evidence for the effect modification of the association between HRT and mean leukocyte telomere length by the CYP1B1, KRAS and MTHFR genotypes. Our findings suggest that functionally relevant genetic variants within estrogen and folate metabolic pathways may influence telomere length. We propose these genetic factors should be taken into consideration when interpreting associations between hormone exposure and telomere length.

  1. Functional variants in CYP1B1, KRAS and MTHFR genes are associated with shorter telomere length in postmenopausal women.

    PubMed

    Cerne, Jasmina Z; Pohar-Perme, Maja; Cerkovnik, Petra; Gersak, Ksenija; Novakovic, Srdjan

    2015-07-01

    Estrogens and antioxidants indirectly alleviate telomere attrition. However, available clinical data on the association between hormone exposure and telomere length are inconclusive. In the present study, we examined the effects of exogenous estrogen use and of some genetic factors implicated in estrogen metabolism and oxidative stress response on mean leukocyte telomere length. We studied 259 postmenopausal women. Genotyping was conducted for CYP1B1 (rs1056836), COMT (rs4680), GSTP1 (rs1695), MnSOD (rs4880), KRAS (rs61764370), and MTHFR (rs1801133 and rs1801131) polymorphisms. Mean leukocyte telomere length was measured using a quantitative real-time PCR assay. In multivariate analysis we found no association between oral contraceptives or hormone replacement therapy (HRT) and mean leukocyte telomere length. The presence of variant alleles in CYP1B1, KRAS and MTHFR genes was statistically significantly associated with shorter mean leukocyte telomere length. Further, the data provided evidence for the effect modification of the association between HRT and mean leukocyte telomere length by the CYP1B1, KRAS and MTHFR genotypes. Our findings suggest that functionally relevant genetic variants within estrogen and folate metabolic pathways may influence telomere length. We propose these genetic factors should be taken into consideration when interpreting associations between hormone exposure and telomere length. PMID:25987236

  2. Novel approach to abuse the hyperactive K-Ras pathway for adenoviral gene therapy of colorectal cancer

    SciTech Connect

    Naumov, Inna; Kazanov, Dina; Lisiansky, Victoria; Starr, Alex; Aroch, Ilan; Shapira, Shiran; Kraus, Sarah; Arber, Nadir

    2012-01-15

    Background: Functional activation of oncogenic K-Ras signaling pathway plays an important role in the early events of colorectal carcinogenesis (CRC). K-Ras proto-oncogene is involved in 35-40% of CRC cases. Mutations in the Ras gene trigger the transduction of proliferative and anti-apoptotic signals, even in the absence of extra cellular stimuli. The objective of the current study was to use a gene-targeting approach to kill human CRC cells selectively harboring mutated K-Ras. Results: A recombinant adenovirus that carries a lethal gene, PUMA, under the control of a Ras responsive promoter (Ad-Py4-SV40-PUMA) was used selectively to target CRC cells (HCT116, SW480, DLD1 and RIE-Ras) that possess a hyperactive Ras pathway while using HT29 and RIE cells as a control that harbors wild type Ras and exhibit very low Ras activity. Control vector, without the Ras responsive promoter elements was used to assess the specificity of our 'gene therapy' approach. Both adenoviral vectors were assed in vitro and in xenograft model in vivo. Ad-Py4-SV40-PUMA showed high potency to induce {approx} 50% apoptosis in vitro, to abolish completely tumor formation by infecting cells with the Ad-Py4-SV40-PUMA prior xenografting them in nude mice and high ability to suppress by {approx} 35% tumor progression in vivo in already established tumors. Conclusions: Selective targeting of CRC cells with the activated Ras pathway may be a novel and effective therapy in CRC. The high potency of this adenoviral vector may help to overcome an undetectable micro metastasis that is the major hurdle in challenging with CRC.

  3. Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases

    PubMed Central

    Sahoo, Pravas Ranjan; Sethy, Kamadev; Mohapatra, Swagat; Panda, Debasis

    2016-01-01

    India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease. PMID:27284221

  4. Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases.

    PubMed

    Sahoo, Pravas Ranjan; Sethy, Kamadev; Mohapatra, Swagat; Panda, Debasis

    2016-05-01

    India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease. PMID:27284221

  5. Gene amplification system based on double rolling-circle replication as a model for oncogene-type amplification.

    PubMed

    Watanabe, Takaaki; Tanabe, Hideyuki; Horiuchi, Takashi

    2011-09-01

    Gene amplification contributes to a variety of biological phenomena, including malignant progression and drug resistance. However, details of the molecular mechanisms remain to be determined. Here, we have developed a gene amplification system in yeast and mammalian cells that is based on double rolling-circle replication (DRCR). Cre-lox system is used to efficiently induce DRCR utilizing a recombinational process coupled with replication. This system shows distinctive features seen in amplification of oncogenes and drug-resistance genes: (i) intra- and extrachromosomal amplification, (ii) intensive chromosome rearrangement and (iii) scattered-type amplification resembling those seen in cancer cells. This system can serve as a model for amplification of oncogenes and drug-resistance genes, and improve amplification systems used for making pharmaceutical proteins in mammalian cells.

  6. Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

    PubMed Central

    Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha; Baheti, Saurabh; Kachergus, Jennifer M.; Younkin, Curtis S.; Baker, Tiffany; Carr, Jennifer M.; Tang, Xiaojia; Walsh, Michael P.; Chai, High-Seng; Sun, Zhifu; Hart, Steven N.; Leontovich, Alexey A.; Hossain, Asif; Kocher, Jean-Pierre; Perez, Edith A.; Reisman, David N.; Fields, Alan P.; Thompson, E. Aubrey

    2012-01-01

    KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations. PMID:22655260

  7. Multiple pathways of selected gene amplification during adaptive mutation.

    PubMed

    Kugelberg, Elisabeth; Kofoid, Eric; Reams, Andrew B; Andersson, Dan I; Roth, John R

    2006-11-14

    In a phenomenon referred to as "adaptive mutation," a population of bacterial cells with a mutation in the lac operon (lac-) accumulates Lac+ revertants during prolonged exposure to selective growth conditions (lactose). Evidence was provided that selective conditions do not increase the mutation rate but instead favor the growth of rare cells with a duplication of the leaky lac allele. A further increase in copy number (amplification) improves growth and increases the likelihood of a sequence change by adding more mutational targets to the clone (cells and lac copies per cell). These duplications and amplifications are described here. Before selection, cells with large (134-kb) lac duplications and long junction sequences (>1 kb) were common (0.2%). The same large repeats were found after selection in cells with a low-copy-number lac amplification. Surprisingly, smaller repeats (average, 34 kb) were found in high-copy-number amplifications. The small-repeat duplications form when deletions modify a preexisting large-repeat duplication. The shorter repeat size allowed higher lac amplification and better growth on lactose. Thus, selection favors a succession of gene-amplification types that make sequence changes more probable by adding targets. These findings are relevant to genetic adaptation in any biological systems in which fitness can be increased by adding gene copies (e.g., cancer and bacterial drug resistance). PMID:17082307

  8. Visualization of Drosophila melanogaster chorion genes undergoing amplification

    SciTech Connect

    Osheim, Y.N.; Miller, O.L. Jr.; Beyer, A.L.

    1988-07-01

    The authors visualized by electron microscopy the preferential amplification of Drosophila chorion genes in late-stage follicle cells. Chromatin spreads revealed large clusters of actively transcribed genes of the appropriate size, spacing, and orientation for chorion genes that were expressed with the correct temporal specificity. Occasionally the active genes were observed within or contiguous with intact replicons and replication forks. In every case, our micrographs are consistent with the hypothesis that the central region of each chorion domain contains a replication origin(s) used during the amplification event. In one case, a small replication bubble was observed precisely at the site of the essential region of the X chromosome amplification control element. The micrographs also suggest that forks at either end of a replicon frequently progress very different distances, presumably due to different times in initiation or different rates of movement. It appears that all chorion genes (even those coding for minor proteins) are transcribed in a ''fully on'' condition, albeit for varied durations, and that if replication fork passage does inactivate a promoter, it does so very transiently. Furthermore, a DNA segment containing one active gene is likely to have an additional active gene(s). Surprisingly, during the time frame of expected maximum activity, approximately half of the chorion sequences appear transciptionally inactive.

  9. Detection of viral sequences by internally calibrated gene amplification.

    PubMed

    Cheung, R K; Hui, M F; Dosch, H M; Ewart, T E

    1993-05-01

    Inherent pitfalls of the polymerase chain reaction (PCR) can become serious difficulties when transferring research applications to high-volume routine procedures such as biofermentation process control and clinical diagnostics. Difficulties include 1) the danger of accidental sample contamination with positive control templates; 2) variable amplification due to positional effects in thermocycler blocks and unequal primer efficiency for sense/anti-sense strands; and 3) the need for reliable controls, which provide confidence for reporting negative reactions. Using the PCR detection system for Epstein-Barr virus as a model, we have developed a quick process to generate mutant internal co-amplification templates. These can be used for titration of amplification sensitivity. More importantly, single tube co-amplification without titrations allows determination of the minimum sensitivity achieved in each individual reaction; critical information when reporting negative diagnostic results. Mutant and native fragments are easy to distinguish by size, and sample cross contamination can be readily identified. The system should be easily adaptable to gene amplification procedures, which aim to routinely detect the presence of a given gene fragment in a controlled fashion.

  10. Identification of genetic elements associated with EPSPS gene amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved to confer resistance to glyphosate, the world's most important herbicide, in the wee...

  11. Gene amplification confers glyphosate resistance in Amaranthus palmeri

    PubMed Central

    Gaines, Todd A.; Zhang, Wenli; Wang, Dafu; Bukun, Bekir; Chisholm, Stephen T.; Shaner, Dale L.; Nissen, Scott J.; Patzoldt, William L.; Tranel, Patrick J.; Culpepper, A. Stanley; Grey, Timothy L.; Webster, Theodore M.; Vencill, William K.; Sammons, R. Douglas; Jiang, Jiming; Preston, Christopher; Leach, Jan E.; Westra, Philip

    2009-01-01

    The herbicide glyphosate became widely used in the United States and other parts of the world after the commercialization of glyphosate-resistant crops. These crops have constitutive overexpression of a glyphosate-insensitive form of the herbicide target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Increased use of glyphosate over multiple years imposes selective genetic pressure on weed populations. We investigated recently discovered glyphosate-resistant Amaranthus palmeri populations from Georgia, in comparison with normally sensitive populations. EPSPS enzyme activity from resistant and susceptible plants was equally inhibited by glyphosate, which led us to use quantitative PCR to measure relative copy numbers of the EPSPS gene. Genomes of resistant plants contained from 5-fold to more than 160-fold more copies of the EPSPS gene than did genomes of susceptible plants. Quantitative RT-PCR on cDNA revealed that EPSPS expression was positively correlated with genomic EPSPS relative copy number. Immunoblot analyses showed that increased EPSPS protein level also correlated with EPSPS genomic copy number. EPSPS gene amplification was heritable, correlated with resistance in pseudo-F2 populations, and is proposed to be the molecular basis of glyphosate resistance. FISH revealed that EPSPS genes were present on every chromosome and, therefore, gene amplification was likely not caused by unequal chromosome crossing over. This occurrence of gene amplification as an herbicide resistance mechanism in a naturally occurring weed population is particularly significant because it could threaten the sustainable use of glyphosate-resistant crop technology. PMID:20018685

  12. Gene amplification and qRT-PCR.

    PubMed

    Jones, Cerith; Filloux, Alain

    2014-01-01

    This chapter includes methods for the use of the polymerase chain reaction (PCR) with Pseudomonas, and several specific tips for their successful application in this organism. The first part of the chapter includes methods for purifying genomic DNA from, and amplifying genes from, Pseudomonas, in addition to methods which describe how to prepare a cell lysate from Pseudomonas species for colony PCR reactions. The chapter continues with a switch in focus from DNA to RNA, describing methods for RNA isolation from Pseudomonas, cDNA generation, and finally q-RT-PCR to investigate relative changes in gene expression. PMID:24818925

  13. Coamplification in tumors of KRAS2, type 2 inositol 1,4,5 triphosphate receptor gene, and a novel human gene, KRAG

    SciTech Connect

    Heighway, J.; Betticher, D.C.; Altermatt, H.J.

    1996-07-01

    Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.

  14. Functional characterization of EMSY gene amplification in human cancers.

    PubMed

    Wilkerson, Paul M; Dedes, Konstantin J; Wetterskog, Daniel; Mackay, Alan; Lambros, Maryou B; Mansour, Marthe; Frankum, Jessica; Lord, Christopher J; Natrajan, Rachael; Ashworth, Alan; Reis-Filho, Jorge S

    2011-09-01

    The 11q13-q14 locus is frequently amplified in human cancers, with a complex structure harbouring multiple potential oncogenic drivers. The EMSY gene has been proposed as a driver of the third core of the 11q13-q14 amplicon. This gene encodes a protein reported to be a BRCA2-binding partner, which when over-expressed would lead to impairment of BRCA2 functions and could constitute a mechanism for BRCA2 inactivation in non-hereditary breast and ovarian cancers. We hypothesized that if EMSY amplification abrogates BRCA2 functions, cells harbouring this aberration would be unable to elicit competent homologous recombination DNA repair and, therefore, may have increased sensitivity to genotoxic therapies and potent PARP inhibitors. Microarray-based comparative genomic hybridization of cell lines from distinct tumour sites, including breast, ovary, pancreas, oesophagus, lung and the oral cavity, led to the identification of 10 cell lines with EMSY amplification and 18 without. EMSY amplification was shown to correlate with EMSY mRNA levels, although not all cell lines harbouring EMSY amplification displayed EMSY mRNA or protein over-expression. RNA interference-mediated silencing of EMSY did not lead to a reduction in cell viability in tumour models harbouring EMSY amplification. Cell lines with and without EMSY amplification displayed a similar ability to elicit RAD51 foci in response to DNA damaging agents, and similar sensitivity to cisplatin and olaparib. Taken together, this suggests that EMSY is unlikely to be a driver of the 11q13-q14 amplicon and does not have a dominant role in modulating the response to agents targeting cells with defective homologous recombination.

  15. Microevolution of Cryptococcus neoformans driven by massive tandem gene amplification.

    PubMed

    Chow, Eve W L; Morrow, Carl A; Djordjevic, Julianne T; Wood, Ian A; Fraser, James A

    2012-08-01

    The subtelomeric regions of organisms ranging from protists to fungi undergo a much higher rate of rearrangement than is observed in the rest of the genome. While characterizing these ~40-kb regions of the human fungal pathogen Cryptococcus neoformans, we have identified a recent gene amplification event near the right telomere of chromosome 3 that involves a gene encoding an arsenite efflux transporter (ARR3). The 3,177-bp amplicon exists in a tandem array of 2-15 copies and is present exclusively in strains with the C. neoformans var. grubii subclade VNI A5 MLST profile. Strains bearing the amplification display dramatically enhanced resistance to arsenite that correlates with the copy number of the repeat; the origin of increased resistance was verified as transport-related by functional complementation of an arsenite transporter mutant of Saccharomyces cerevisiae. Subsequent experimental evolution in the presence of increasing concentrations of arsenite yielded highly resistant strains with the ARR3 amplicon further amplified to over 50 copies, accounting for up to ~1% of the whole genome and making the copy number of this repeat as high as that seen for the ribosomal DNA. The example described here therefore represents a rare evolutionary intermediate-an array that is currently in a state of dynamic flux, in dramatic contrast to relatively common, static relics of past tandem duplications that are unable to further amplify due to nucleotide divergence. Beyond identifying and engineering fungal isolates that are highly resistant to arsenite and describing the first reported instance of microevolution via massive gene amplification in C. neoformans, these results suggest that adaptation through gene amplification may be an important mechanism that C. neoformans employs in response to environmental stresses, perhaps including those encountered during infection. More importantly, the ARR3 array will serve as an ideal model for further molecular genetic analyses of

  16. A PCR amplification strategy for unrestricted generation of chimeric genes.

    PubMed

    Vos, Michel J; Kampinga, Harm H

    2008-09-15

    For analyzing protein function, protein dynamics, or protein-protein interactions, the use of chimeric proteins has become an indispensable tool. The generation of DNA constructs coding for such fused proteins can, however, be a tedious process. Currently used strategies often make use of available endonuclease sites, leading to limitations in the choice of the site of fusion between two genes and problems in maintaining protein secondary structure. We have developed a cloning strategy to get around these disadvantages that is based on a single round of PCR amplification followed by antibiotic-resistant gene complementation. PMID:18555003

  17. A PCR amplification strategy for unrestricted generation of chimeric genes.

    PubMed

    Vos, Michel J; Kampinga, Harm H

    2008-09-15

    For analyzing protein function, protein dynamics, or protein-protein interactions, the use of chimeric proteins has become an indispensable tool. The generation of DNA constructs coding for such fused proteins can, however, be a tedious process. Currently used strategies often make use of available endonuclease sites, leading to limitations in the choice of the site of fusion between two genes and problems in maintaining protein secondary structure. We have developed a cloning strategy to get around these disadvantages that is based on a single round of PCR amplification followed by antibiotic-resistant gene complementation.

  18. Ultrasensitive DNA chip: gene expression profile analysis without RNA amplification.

    PubMed

    Nagino, Kunihisa; Nomura, Osamu; Takii, Yuki; Myomoto, Akira; Ichikawa, Makiko; Nakamura, Fumio; Higasa, Masashi; Akiyama, Hideo; Nobumasa, Hitoshi; Shiojima, Satoshi; Tsujimoto, Gozoh

    2006-04-01

    We have developed a new DNA chip whose substrate has a unique minute columnar array structure made of plastic. The DNA chip exhibits ultrahigh sensitivity, up to 100-fold higher than that of reference DNA chips, which makes it possible to monitor gene expression profiles even with very small amounts of RNA (0.1-0.01 microg of total RNA) without amplification. Differential expression ratios obtained with the new DNA chip were validated against those obtained with quantitative real-time PCR assays. This novel microarray technology would be a powerful tool for monitoring gene expression profiles, especially for clinical diagnosis.

  19. Frequent mutations in EGFR, KRAS and TP53 genes in human lung cancer tumors detected by ion torrent DNA sequencing.

    PubMed

    Cai, Xin; Sheng, Jianhui; Tang, Chuanning; Nandakumar, Vijayalakshmi; Ye, Hua; Ji, Hong; Tang, Haiying; Qin, Yu; Guan, Hongwei; Lou, Feng; Zhang, Dandan; Sun, Hong; Dong, Haichao; Zhang, Guangchun; Liu, Zhiyuan; Dong, Zhishou; Guo, Baishuai; Yan, He; Yan, Chaowei; Wang, Lu; Su, Ziyi; Li, Yangyang; Jones, Lindsey; Huang, Xue F; Chen, Si-Yi; Wu, Taihua; Lin, Hongli

    2014-01-01

    Lung cancer is the most common malignancy and the leading cause of cancer deaths worldwide. While smoking is by far the leading cause of lung cancer, other environmental and genetic factors influence the development and progression of the cancer. Since unique mutations patterns have been observed in individual cancer samples, identification and characterization of the distinctive lung cancer molecular profile is essential for developing more effective, tailored therapies. Until recently, personalized DNA sequencing to identify genetic mutations in cancer was impractical and expensive. The recent technological advancements in next-generation DNA sequencing, such as the semiconductor-based Ion Torrent sequencing platform, has made DNA sequencing cost and time effective with more reliable results. Using the Ion Torrent Ampliseq Cancer Panel, we sequenced 737 loci from 45 cancer-related genes to identify genetic mutations in 76 human lung cancer samples. The sequencing analysis revealed missense mutations in KRAS, EGFR, and TP53 genes in the breast cancer samples of various histologic types. Thus, this study demonstrates the necessity of sequencing individual human cancers in order to develop personalized drugs or combination therapies to effectively target individual, breast cancer-specific mutations. PMID:24760004

  20. Copy number change: evolving views on gene amplification.

    PubMed

    Elliott, Kathryn T; Cuff, Laura E; Neidle, Ellen L

    2013-07-01

    The rapid pace of genomic sequence analysis is increasing the awareness of intrinsically dynamic genetic landscapes. Gene duplication and amplification (GDA) contribute to adaptation and evolution by allowing DNA regions to expand and contract in an accordion-like fashion. This process affects diverse aspects of bacterial infection, including antibiotic resistance and host-pathogen interactions. In this review, microbial GDA is discussed, primarily using recent bacterial examples that demonstrate medical and evolutionary consequences. Interplay between GDA and horizontal gene transfer further impact evolutionary trajectories. Complementing the discovery of gene duplication in clinical and environmental settings, experimental evolution provides a powerful method to document genetic change over time. New methods for GDA detection highlight both its importance and its potential application for genetic engineering, synthetic biology and biotechnology.

  1. High-Throughput DNA Array for SNP Detection of KRAS Gene Using a Centrifugal Microfluidic Device.

    PubMed

    Sedighi, Abootaleb; Li, Paul C H

    2016-01-01

    Here, we describe detection of single nucleotide polymorphism (SNP) in genomic DNA samples using a NanoBioArray (NBA) chip. Fast DNA hybridization is achieved in the chip when target DNAs are introduced to the surface-arrayed probes using centrifugal force. Gold nanoparticles (AuNPs) are used to assist SNP detection at room temperature. The parallel setting of sample introduction in the spiral channels of the NBA chip enables multiple analyses on many samples, resulting in a technique appropriate for high-throughput SNP detection. The experimental procedure, including chip fabrication, probe array printing, DNA amplification, hybridization, signal detection, and data analysis, is described in detail.

  2. No fitness cost of glyphosate resistance endowed by massive EPSPS gene amplification in Amaranthus palmeri.

    PubMed

    Vila-Aiub, Martin M; Goh, Sou S; Gaines, Todd A; Han, Heping; Busi, Roberto; Yu, Qin; Powles, Stephen B

    2014-04-01

    Amplification of the EPSPS gene has been previously identified as the glyphosate resistance mechanism in many populations of Amaranthus palmeri, a major weed pest in US agriculture. Here, we evaluate the effects of EPSPS gene amplification on both the level of glyphosate resistance and fitness cost of resistance. A. palmeri individuals resistant to glyphosate by expressing a wide range of EPSPS gene copy numbers were evaluated under competitive conditions in the presence or absence of glyphosate. Survival rates to glyphosate and fitness traits of plants under intra-specific competition were assessed. Plants with higher amplification of the EPSPS gene (53-fold) showed high levels of glyphosate resistance, whereas less amplification of the EPSPS gene (21-fold) endowed a lower level of glyphosate resistance. Without glyphosate but under competitive conditions, plants exhibiting up to 76-fold EPSPS gene amplification exhibited similar height, and biomass allocation to vegetative and reproductive organs, compared to glyphosate susceptible A. palmeri plants with no amplification of the EPSPS gene. Both the additive effects of EPSPS gene amplification on the level of glyphosate resistance and the lack of associated fitness costs are key factors contributing to EPSPS gene amplification as a widespread and important glyphosate resistance mechanism likely to become much more evident in weed plant species.

  3. Notch1 Gene Mutations Target KRAS G12D-expressing CD8+ Cells and Contribute to Their Leukemogenic Transformation*

    PubMed Central

    Kong, Guangyao; Du, Juan; Liu, Yangang; Meline, Benjamin; Chang, Yuan-I; Ranheim, Erik A.; Wang, Jinyong; Zhang, Jing

    2013-01-01

    Acute T-cell lymphoblastic leukemia/lymphoma (T-ALL) is an aggressive hematopoietic malignancy affecting both children and adults. Previous studies of T-ALL mouse models induced by different genetic mutations have provided highly diverse results on the issues of T-cell leukemia/lymphoma-initiating cells (T-LICs) and potential mechanisms contributing to T-LIC transformation. Here, we show that oncogenic Kras (Kras G12D) expressed from its endogenous locus is a potent inducer of T-ALL even in a less sensitized BALB/c background. Notch1 mutations, including exon 34 mutations and recently characterized type 1 and 2 deletions, are detected in 100% of Kras G12D-induced T-ALL tumors. Although these mutations are not detected at the pre-leukemia stage, incremental up-regulation of NOTCH1 surface expression is observed at the pre-leukemia and leukemia stages. As secondary genetic hits in the Kras G12D model, Notch1 mutations target CD8+ T-cells but not hematopoietic stem cells to further promote T-ALL progression. Pre-leukemia T-cells without detectable Notch1 mutations do not induce T-ALL in secondary recipient mice compared with T-ALL tumor cells with Notch1 mutations. We found huge variations in T-LIC frequency and immunophenotypes of cells enriched for T-LICs. Unlike Pten deficiency-induced T-ALL, oncogenic Kras-initiated T-ALL is not associated with up-regulation of the Wnt/β-catenin pathway. Our results suggest that up-regulation of NOTCH1 signaling, through either overexpression of surface NOTCH1 or acquired gain-of-function mutations, is involved in both T-ALL initiation and progression. Notch1 mutations and Kras G12D contribute cooperatively to leukemogenic transformation of normal T-cells. PMID:23673656

  4. Gene expression profiling detects gene amplification and differentiates tumor types in breast cancer.

    PubMed

    Dressman, Marlene A; Baras, Alex; Malinowski, Rachel; Alvis, Lisa B; Kwon, Irene; Walz, Thomas M; Polymeropoulos, Mihael H

    2003-05-01

    Global gene expression analysis using microarrays has been used to characterize the molecular profile of tumors. Gene expression variability at the mRNA level can be caused by a number of different events, including novel signaling, downstream activation of transcription enhancers or silencers, somatic mutation, and genetic amplification or deletion. Genomic amplifications are commonly observed in cancer and often include known oncogenes. The tyrosine kinase-type cell surface receptor, ERBB2, is an oncogene located on chromosome 17q21.1 that is amplified in 10-40% of breast tumors. We report for the first time that phenylethanolamine N-methyltransferase (PNMT), proteasome subunit, beta type 3 (PSMB3), ribosomal protein L19 (RPL19), and nuclear receptor subfamily 1, group D, member 1 (NR1D1) are coexpressed with ERBB2 in 34 breast cancer biopsies and also mapped within the same chromosomal location as the ERBB2 gene. Consistent with previous reports, we also observed that the steroidogenic acute regulatory protein-related gene, MLN64, and growth factor receptor bound protein 7 were coexpressed with ERBB2. Coexpression and colocalization of PNMT and MLN64 with ERBB2 suggested that the amplification of ERBB2 includes the chromosomal region harboring these genes. This hypothesis was validated in a subset of 12 biopsies. Gene amplification of ERBB2, PNMT, and MLN64 significantly correlated with increased mRNA gene expression (P < 0.05). These results suggest that gene expression profiling of breast biopsies may become a valuable method for adequately characterizing and choosing treatment modality for patients with breast cancer. PMID:12727839

  5. Deuterium depleted water effects on survival of lung cancer patients and expression of Kras, Bcl2, and Myc genes in mouse lung.

    PubMed

    Gyöngyi, Zoltán; Budán, Ferenc; Szabó, István; Ember, István; Kiss, István; Krempels, Krisztina; Somlyai, Ildikó; Somlyai, Gábor

    2013-01-01

    Although advances in cancer therapies continue to develop, the shortness of the survival of lung cancer patients is still disappointing. Therefore, finding new adjuvant strategies is within the focus of cancer cure. Based on observations that deuterium depletion inhibits the growth of cancer cell lines and suppresses certain proto-oncogenes, we have conducted a clinical study in 129 patients with small cell and nonsmall cell lung cancers who consumed deuterium-depleted drinking water (DDW) as a nontoxic agent in addition to conventional chemotherapy and radiotherapy. Median survival time (MST) was 25.9 mo in males and 74.1 mo in female patients; the difference between genders was statistically significant (p < 0.05). Median survival of subjects with brain metastasis was 27.1 mo. Cumulative 5-yr survival probabilities were 19%, 52%, and 33% in males, females, and all patients with brain metastasis, respectively. Gene expression analysis in mouse lung indicated that DDW attenuates 7,12-dimethylbenz(a)anthracene (DMBA)-induced expression of Bcl2, Kras, and Myc in females. In conclusion, DDW counteracts the DMBA-induced overexpression of Bcl2, Kras and Myc genes in mouse lung, and it may extend survival of lung cancer patients as a nontoxic anticancer dietary supplement, especially for women with tumors overexpressing cancer-related genes, because MST of DDW-consuming group was 2-4 times longer than it is generally observed in lung cancer patients.

  6. Amplification of the MYC Gene in Osteosarcoma Secondary to Paget's Disease of Bone

    PubMed Central

    Ueda, Takafumi; Healey, John H.; Huvos, Andrew G.

    1997-01-01

    Purpose. In a previous series of 25 human osteosarcoma samples studied for MYC gene amplification, we found amplification in two cases (8%), including one arising in association with Paget's disease (pagetic osteosarcoma). Based on this observation, we further investigated the prevalence of MYC gene amplification in pagetic osteosarcomas. Methods. MYC gene amplification was assessed by Southern blot analysis using frozen tissue samples in five cases of pagetic osteosarcoma and 53 cases of primary (non-pagetic) osteosarcoma. Amplification was considered present if the MYC copy number was six or greater. Results. Three out of five patients (60%) with pagetic osteosarcoma showed MYC gene amplification, whereas it was present in only 5/53 patients (9.4%) with primary osteosarcoma. The incidence of MYC amplification in pagetic osteosarcoma was thus significantly higher than that in primary osteosarcoma (p = 0.016). Discussion. The finding that MYC gene amplification may be more common in pagetic than primary osteosarcoma warrants further study and suggests pathogenetic differences between primary osteosarcomas and those arising in the setting of Paget's disease. Three of the four pagetic osteosarcomas from the present study were previously shown to be immunoreactive for p53, suggesting that p53 mutation may also be a frequent genetic lesion in these tumors. PMID:18521214

  7. Somatic mutation analysis of KRAS, BRAF, HER2 and PTEN in EGFR mutation-negative non-small cell lung carcinoma: determination of frequency, distribution pattern and identification of novel deletion in HER2 gene from Indian patients.

    PubMed

    Bhaumik, Sangeet; Ahmad, Firoz; Das, Bibhu Ranjan

    2016-10-01

    Somatic mutations of KRAS, BRAF, HER2, PTEN genes are the most important molecular markers after the EGFR gene mutation. The current study evaluated the frequency and distribution pattern of KRAS, BRAF, HER2, PTEN mutation in Indian non-small cell lung carcinoma patients. The frequency of KRAS, BRAF, HER2, PTEN mutations was 6.4 % (14/204), 1.5 % (3/204), 1.5 % (3/204), 0 % (0/204), respectively. KRAS, BRAF, HER2 mutations were more prevalent in males than in females. KRAS and HER2 showed a trend of a higher frequency of mutation in the age group of <60 years, whereas BRAF mutations were more frequent in the age group of ≥60 years. Sequencing analysis of KRAS gene revealed c.34G>T (G12C) (n = 8), c.35G>A (G12D) (n = 3), c.35G>T (G12 V) (n = 1) and c.34G>T (G12C)/c.41T>C (V14A) (n = 2) mutations. Three different BRAF mutations (L584P: n = 1, V600E: n = 1, K601E: n = 1) were detected. Two cases harboured c.2324_2325ins12 (ATACGTGATGGC duplication) in HER2 gene, and one case was positive for NG_007503.2 (NM_001005862.2):c.2218-4del. It is less certain, but still quite possible that this mutation will affect splicing as the deletion of one C actually brings in one additional purine into the region. In conclusion, the present study demonstrates an instance of diverse nature of KRAS, BRAF, HER2 and PTEN gene in Indian patients and confirms that the frequency of these gene mutations varies globally. To the best of our knowledge, this is the first Indian study to evaluate KRAS, BRAF, HER2 and PTEN gene mutations.

  8. Somatic mutation analysis of KRAS, BRAF, HER2 and PTEN in EGFR mutation-negative non-small cell lung carcinoma: determination of frequency, distribution pattern and identification of novel deletion in HER2 gene from Indian patients.

    PubMed

    Bhaumik, Sangeet; Ahmad, Firoz; Das, Bibhu Ranjan

    2016-10-01

    Somatic mutations of KRAS, BRAF, HER2, PTEN genes are the most important molecular markers after the EGFR gene mutation. The current study evaluated the frequency and distribution pattern of KRAS, BRAF, HER2, PTEN mutation in Indian non-small cell lung carcinoma patients. The frequency of KRAS, BRAF, HER2, PTEN mutations was 6.4 % (14/204), 1.5 % (3/204), 1.5 % (3/204), 0 % (0/204), respectively. KRAS, BRAF, HER2 mutations were more prevalent in males than in females. KRAS and HER2 showed a trend of a higher frequency of mutation in the age group of <60 years, whereas BRAF mutations were more frequent in the age group of ≥60 years. Sequencing analysis of KRAS gene revealed c.34G>T (G12C) (n = 8), c.35G>A (G12D) (n = 3), c.35G>T (G12 V) (n = 1) and c.34G>T (G12C)/c.41T>C (V14A) (n = 2) mutations. Three different BRAF mutations (L584P: n = 1, V600E: n = 1, K601E: n = 1) were detected. Two cases harboured c.2324_2325ins12 (ATACGTGATGGC duplication) in HER2 gene, and one case was positive for NG_007503.2 (NM_001005862.2):c.2218-4del. It is less certain, but still quite possible that this mutation will affect splicing as the deletion of one C actually brings in one additional purine into the region. In conclusion, the present study demonstrates an instance of diverse nature of KRAS, BRAF, HER2 and PTEN gene in Indian patients and confirms that the frequency of these gene mutations varies globally. To the best of our knowledge, this is the first Indian study to evaluate KRAS, BRAF, HER2 and PTEN gene mutations. PMID:27637917

  9. HER2 protein expression and HER2 gene amplification are infrequent in small intestinal carcinomas.

    PubMed

    Gu, Mi Jin; Hong, Seung-Mo; Jung, Soo Jin

    2013-06-01

    Human epidermal growth factor receptor 2 (HER2/neu) gene amplification and HER2 protein overexpression have been associated with clinicopathological parameters and clinical outcome in many carcinomas. The aim of this study was to evaluate the frequency and prognostic impact of HER2 protein overexpression and gene amplification in small intestinal carcinoma (SIC). We performed immunohistochemistry (IHC) for HER2 protein and silver in situ hybridization for the HER2 gene in a total of 194 SICs. A total of 184 cases (94.8 %) were IHC 0 and 6 cases (3.1 %) were IHC 1+ with no gene amplification. HER2 protein overexpression (IHC 3+) with concordant gene amplification was detected in four cases (2.1 %), using the American Society of Clinical Oncology-College of American Pathologists guidelines for breast cancer. HER2 gene amplification was observed in an equivocal (IHC 2+) metastatic tumor in lymph node. No significant correlation was observed between HER2 status and clinicopathological parameters. Although HER2 protein overexpression and amplification were rare and did not correlate with clinicopathological parameters, further studies will be necessary to answer the question as to whether adjuvant therapy targeting the HER2 receptor might improve outcome in patients with a SIC with HER2 gene amplification and protein overexpression. PMID:23703294

  10. Double-hairpin molecular-beacon-based amplification detection for gene diagnosis linked to cancer.

    PubMed

    Xu, Huo; Zhang, Rongbo; Li, Feng; Zhou, Yingying; Peng, Ting; Wang, Xuedong; Shen, Zhifa

    2016-09-01

    A powerful double-hairpin molecular beacon (DHMB) was developed for cancer-related KRAS gene detection based on the one-to-two stoichiometry. During target DNA detection, DHMB can execute signal transduction even if no any exogenous element is involved. Unlike the conventional molecular beacon based on the one-to-one interaction, one target DNA not only hybridizes with one DHMB and opens its hairpin but also promotes the interaction between two DHMBs, causing the separation of two fluorophores from quenchers. This leads to an enhanced fluorescence signal. As a result, the target KRAS gene is able to be detected within a wide dynamic range from 0.05 to 200 nM with the detection limit of 50 pM, indicating a dramatic improvement compared with traditional molecular beacons. Moreover, the point mutations existing in target DNAs can be easily screened. The potential application for target species in real samples was indicated by the analysis of PCR amplicons of DNAs from the DNA extracted from SW620 cell. Besides becoming a promising candidate probe for molecular biology research and clinical diagnosis of genetic diseases, the DHMB is expected to provide a significant insight into the design of DNA probe-based homogenous sensing systems. Graphical Abstract A powerful double-hairpin molecular beacon (DHMB) was developed for cancer-related gene KRAS detection based on the one-to-two stoichiometry. Without the help of any exogenous probe, the point mutation is easily screened, and the target DNA can be quantified down to 50 pM, indicating a dramatic improvement compared with traditional molecular beacons. PMID:27422649

  11. Double-hairpin molecular-beacon-based amplification detection for gene diagnosis linked to cancer.

    PubMed

    Xu, Huo; Zhang, Rongbo; Li, Feng; Zhou, Yingying; Peng, Ting; Wang, Xuedong; Shen, Zhifa

    2016-09-01

    A powerful double-hairpin molecular beacon (DHMB) was developed for cancer-related KRAS gene detection based on the one-to-two stoichiometry. During target DNA detection, DHMB can execute signal transduction even if no any exogenous element is involved. Unlike the conventional molecular beacon based on the one-to-one interaction, one target DNA not only hybridizes with one DHMB and opens its hairpin but also promotes the interaction between two DHMBs, causing the separation of two fluorophores from quenchers. This leads to an enhanced fluorescence signal. As a result, the target KRAS gene is able to be detected within a wide dynamic range from 0.05 to 200 nM with the detection limit of 50 pM, indicating a dramatic improvement compared with traditional molecular beacons. Moreover, the point mutations existing in target DNAs can be easily screened. The potential application for target species in real samples was indicated by the analysis of PCR amplicons of DNAs from the DNA extracted from SW620 cell. Besides becoming a promising candidate probe for molecular biology research and clinical diagnosis of genetic diseases, the DHMB is expected to provide a significant insight into the design of DNA probe-based homogenous sensing systems. Graphical Abstract A powerful double-hairpin molecular beacon (DHMB) was developed for cancer-related gene KRAS detection based on the one-to-two stoichiometry. Without the help of any exogenous probe, the point mutation is easily screened, and the target DNA can be quantified down to 50 pM, indicating a dramatic improvement compared with traditional molecular beacons.

  12. Detection of gene amplification in non-Hodgkins lymphoma (NHL) by comparative genomic hybridization (CGH)

    SciTech Connect

    Mathew, S.; Houldsworth, J.; Rao, P.H.

    1994-09-01

    Gene amplification characterized by distinct cytogenetic structures, such as homogeneously stained regions (hsrs), aberrantly banded marked chromosomes (abms), and double minutes (dmins) chromosomes is commonly found in tumor cells, and is considered as an important mechanism by which tumor cells gain increased levels of expression of critical genes. Very little is known about gene amplification in NHL. So far, no commonly amplified gene(s) have been identified in NHL. DNA in-gel renaturation assay provided evidence for the presence of amplified DNA fragments in NHL. In order to identify the gene(s) amplified in NHL we performed a modified form of CGH (hybridization and normal chromosomes with biotin labeled tumor DNA) to a panel of 10 NHL, which showed cytogenetic evidence for gene amplification in the form of hsrs and dmins. A number of chromosomal regions were found to be non-randomly amplified: 1p32-36(9/10), 1q32-44(6/10), 6p(9/10), 6q26-27(5/10), 16(8/10), 19(7/10) and 22q(7/10). Amplification of DNA from specific chromosomal bands was noted at 4p16(8/10), 11q13(10/10), and 12q24(8/10). Tumor L-10 showed specific amplification of 2p13. This study details the first CGH study performed on a panel of NHLs to identify gene amplification and chromosomal origin of hsrs and dmins identified by conventional cytogenetic analysis. The modified CGH employed in this study indicated that gene amplification is a frequent genetic alteration in NHL.

  13. Higher metastatic efficiency of KRas G12V than KRas G13D in a colorectal cancer model.

    PubMed

    Alamo, Patricia; Gallardo, Alberto; Di Nicolantonio, Federica; Pavón, Miguel Angel; Casanova, Isolda; Trias, Manuel; Mangues, María Antonia; Lopez-Pousa, Antonio; Villaverde, Antonio; Vázquez, Esther; Bardelli, Alberto; Céspedes, María Virtudes; Mangues, Ramón

    2015-02-01

    Although all KRas (protein that in humans is encoded by the KRas gene) point mutants are considered to have a similar prognostic capacity, their transformation and tumorigenic capacities vary widely. We compared the metastatic efficiency of KRas G12V (Kirsten rat sarcoma viral oncogene homolog with valine mutation at codon 12) and KRas G13D (Kirsten rat sarcoma viral oncogene homolog with aspartic mutation at codon 13) oncogenes in an orthotopic colorectal cancer (CRC) model. Following subcutaneous preconditioning, recombinant clones of the SW48 CRC cell line [Kras wild-type (Kras WT)] expressing the KRas G12V or KRas G13D allele were microinjected in the mouse cecum. The percentage of animals developing lymph node metastasis was higher in KRas G12V than in KRas G13D mice. Microscopic, macroscopic, and visible lymphatic foci were 1.5- to 3.0-fold larger in KRas G12V than in KRas G13D mice (P < 0.05). In the lung, only microfoci were developed in both groups. KRas G12V primary tumors had lower apoptosis (7.0 ± 1.2 vs. 7.4 ± 1.0 per field, P = 0.02), higher tumor budding at the invasion front (1.2 ± 0.2 vs. 0.6 ± 0.1, P = 0.04), and a higher percentage of C-X-C chemokine receptor type 4 (CXCR4)-overexpressing intravasated tumor emboli (49.8 ± 9.4% vs. 12.8 ± 4.4%, P < 0.001) than KRas G13D tumors. KRas G12V primary tumors showed Akt activation, and β5 integrin, vascular endothelial growth factor A (VEGFA), and Serpine-1 overexpression, whereas KRas G13D tumors showed integrin β1 and angiopoietin 2 (Angpt2) overexpression. The increased cell survival, invasion, intravasation, and specific molecular regulation observed in KRas G12V tumors is consistent with the higher aggressiveness observed in patients with CRC expressing this oncogene.

  14. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    SciTech Connect

    Heilbronn, R.; zur Hausen, H. )

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  15. Trisomy of the Dscr1 gene suppresses early progression of pancreatic intraepithelial neoplasia driven by oncogenic Kras.

    PubMed

    Lee, Jang Choon; Shin, Jimin; Baek, Kwan-Hyuck

    2013-10-11

    Individuals with Down syndrome exhibit remarkably reduced incidence of most solid tumors including pancreatic cancer. Multiple mechanisms arising from the genetic complexity underlying Down syndrome has been suggested to contribute to such a broad cancer protection. In this study, utilizing a genetically engineered mouse model of pancreatic cancer, we demonstrate that trisomy of the Down syndrome critical region-1 (Dscr1), an endogenous calcineurin inhibitor localized on chromosome 21, suppresses the progression of pancreatic intraepithelial neoplasia-1A (PanIN-1A) to PanIN-1B lesions without affecting the initiation of PanIN lesions mediated by oncogenic Kras(G12D). In addition, we show that Dscr1 trisomy attenuates nuclear localization of nuclear factor of activated T-cells (NFAT) accompanied by upregulation of the p15(Ink4b) tumor suppressor and reduction of cell proliferation in early PanIN lesions. Our data suggest that attenuation of calcineurin-NFAT signaling in neoplastic pancreatic ductal epithelium by a single extra copy of Dscr1 is sufficient to inhibit the progression of early PanIN lesions driven by oncogenic Kras, and thus may be a potential mechanism underlying reduced incidence of pancreatic cancer in Down syndrome individuals. PMID:24041692

  16. PCR primers for the amplification of four insect mitochondrial gene fragments.

    PubMed

    Kambhampati, S; Smith, P T

    1995-11-01

    Insect mitochondrial genome (mtDNA) analysis is a powerful tool for the study of population genetics and phylogenetics. In the past few years primer sequences for the PCR amplification of various insect mtDNA genes have been published. The objectives of this study were (1) present new primer sequences for six insect mitochondrial genes and (2) test primers designed in our laboratory and some previously published primers on a wide range of insects to determine if amplification of the target fragment could be obtained. The primers for the amplification of the two ribosomal RNA gene (16S and 12S rRNA) fragments are universal for insects and related groups; the primers for NADH5 and NADH4 dehydrogenase gene fragments and cytochrome c oxidase I gene fragment are applicable broadly.

  17. Glyphosate selected amplification of the 5-enolpyruvylshikimate-3-phosphate synthase gene in cultured carrot cells.

    PubMed

    Shyr, Y Y; Hepburn, A G; Widholm, J M

    1992-04-01

    CAR and C1, two carrot (Daucus carota L.) suspension cultures of different genotypes, were subjected to stepwise selection for tolerance to the herbicide glyphosate [(N-phosphonomethyl)glycine]. The specific activity of the target enzyme, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), as well as the mRNA level and copy number of the structural gene increased with each glyphosate selection step. Therefore, the tolerance to glyphosate is due to stepwise amplification of the EPSPS genes. During the amplification process, DNA rearrangement did not occur within the EPSPS gene of the CAR cell line but did occur during the selection step from 28 to 35 mM glyphosate for the C1 cell line, as determined by Southern hybridization of selected cell DNA following EcoRI restriction endonuclease digestion. Two cell lines derived from a previously selected glyphosate-tolerant cell line (PR), which also had undergone EPSPS gene amplification but have been maintained in glyphosate-free medium for 2 and 5 years, have lost 36 and 100% of the increased EPSPS activity, respectively. Southern blot analysis of these lines confirms that the amplified DNA is relatively stable in the absence of selection. These studies demonstrate that stepwise selection for glyphosate resistance reproducibly produces stepwise amplification of the EPSPS genes. The relative stability of this amplification indicates that the amplified genes are not extrachromosomal.

  18. Flux variability scanning based on enforced objective flux for identifying gene amplification targets

    PubMed Central

    2012-01-01

    Background In order to reduce time and efforts to develop microbial strains with better capability of producing desired bioproducts, genome-scale metabolic simulations have proven useful in identifying gene knockout and amplification targets. Constraints-based flux analysis has successfully been employed for such simulation, but is limited in its ability to properly describe the complex nature of biological systems. Gene knockout simulations are relatively straightforward to implement, simply by constraining the flux values of the target reaction to zero, but the identification of reliable gene amplification targets is rather difficult. Here, we report a new algorithm which incorporates physiological data into a model to improve the model’s prediction capabilities and to capitalize on the relationships between genes and metabolic fluxes. Results We developed an algorithm, flux variability scanning based on enforced objective flux (FVSEOF) with grouping reaction (GR) constraints, in an effort to identify gene amplification targets by considering reactions that co-carry flux values based on physiological omics data via “GR constraints”. This method scans changes in the variabilities of metabolic fluxes in response to an artificially enforced objective flux of product formation. The gene amplification targets predicted using this method were validated by comparing the predicted effects with the previous experimental results obtained for the production of shikimic acid and putrescine in Escherichia coli. Moreover, new gene amplification targets for further enhancing putrescine production were validated through experiments involving the overexpression of each identified targeted gene under condition-controlled batch cultivation. Conclusions FVSEOF with GR constraints allows identification of gene amplification targets for metabolic engineering of microbial strains in order to enhance the production of desired bioproducts. The algorithm was validated through the

  19. PCR bias toward the wild-type k-ras and p53 sequences: implications for PCR detection of mutations and cancer diagnosis.

    PubMed

    Barnard, R; Futo, V; Pecheniuk, N; Slattery, M; Walsh, T

    1998-10-01

    PCR-based cancer diagnosis requires detection of rare mutations in k-ras, p53 or other genes. The assumption has been that mutant and wild-type sequences amplify with near equal efficiency, so that they are eventually present in proportions representative of the starting material. Work on factor IX suggests that this assumption is invalid for one case of near-sequence identity. To test the generality of this phenomenon and its relevance to cancer diagnosis, primers distant from point mutations in p53 and k-ras were used to amplify wild-type and mutant sequences from these genes. A substantial bias against PCR amplification of mutants was observed for two regions of the p53 gene and one region of k-ras. For k-ras and p53, bias was observed when the wild-type and mutant sequences were amplified separately or when mixed in equal proportions before PCR. Bias was present with proofreading and non-proofreading polymerases. Mutant and wild-type segments of the factor V, cystic fibrosis transmembrane conductance regulator and prothrombin genes were amplified and did not exhibit PCR bias. Therefore, the assumption of equal PCR efficiency for point mutant and wild-type sequences is invalid in several systems. Quantitative or diagnostic PCR will require validation for each locus, and enrichment strategies may be needed to optimize detection of mutants. PMID:9793653

  20. Estrogen receptor alpha gene amplification in breast cancer: 25 years of debate

    PubMed Central

    Holst, Frederik

    2016-01-01

    Twenty-five years ago, Nembrot and colleagues reported amplification of the estrogen receptor alpha gene (ESR1) in breast cancer, initiating a broad and still ongoing scientific debate on the prevalence and clinical significance of this genetic aberration, which affects one of the most important genes in breast cancer. Since then, a multitude of studies on this topic has been published, covering a wide range of divergent results and arguments. The reported prevalence of this alteration in breast cancer ranges from 0% to 75%, suggesting that ESR1 copy number analysis is hampered by technical and interpreter issues. To date, two major issues related to ESR1 amplification remain to be conclusively addressed: (1) The extent to which abundant amounts of messenger RNA can mimic amplification in standard fluorescence in situ hybridization assays in the analysis of strongly expressed genes like ESR1, and (2) the clinical relevance of ESR1 amplification: Such relevance is strongly disputed, with data showing predictive value for response as well as for resistance of the cancer to anti-estrogen therapies, or for subsequent development of cancers in the case of precursor lesions that display amplification of ESR1. This review provides a comprehensive summary of the various views on ESR1 amplification, and highlights explanations for the contradictions and conflicting data that could inform future ESR1 research. PMID:27081639

  1. Trisomy of the Dscr1 gene suppresses early progression of pancreatic intraepithelial neoplasia driven by oncogenic Kras

    SciTech Connect

    Lee, Jang Choon; Shin, Jimin; Baek, Kwan-Hyuck

    2013-10-11

    Highlights: •A single extra copy of Dscr1 restrains progression of PanIN-1A to PanIN-1B lesions. •Dscr1 trisomy attenuates calcineurin–NFAT pathway in neoplastic ductal epithelium. •Dscr1 trisomy leads to upregulation of p15{sup INK4b} in neoplastic ductal epithelium. •A single extra copy of Dscr1 reduces epithelial proliferation in early PanIN lesions. •Dscr1 trisomy may protect Down syndrome individuals from pancreatic cancer. -- Abstract: Individuals with Down syndrome exhibit remarkably reduced incidence of most solid tumors including pancreatic cancer. Multiple mechanisms arising from the genetic complexity underlying Down syndrome has been suggested to contribute to such a broad cancer protection. In this study, utilizing a genetically engineered mouse model of pancreatic cancer, we demonstrate that trisomy of the Down syndrome critical region-1 (Dscr1), an endogenous calcineurin inhibitor localized on chromosome 21, suppresses the progression of pancreatic intraepithelial neoplasia-1A (PanIN-1A) to PanIN-1B lesions without affecting the initiation of PanIN lesions mediated by oncogenic Kras{sup G12D}. In addition, we show that Dscr1 trisomy attenuates nuclear localization of nuclear factor of activated T-cells (NFAT) accompanied by upregulation of the p15{sup Ink4b} tumor suppressor and reduction of cell proliferation in early PanIN lesions. Our data suggest that attenuation of calcineurin–NFAT signaling in neoplastic pancreatic ductal epithelium by a single extra copy of Dscr1 is sufficient to inhibit the progression of early PanIN lesions driven by oncogenic Kras, and thus may be a potential mechanism underlying reduced incidence of pancreatic cancer in Down syndrome individuals.

  2. Preservation of gene expression ratios among multiple complex cDNAs after PCR amplification: application to differential gene expression studies.

    PubMed

    Ji, W; Cai, L; Wright, M B; Walker, G; Salgam, P; Vater, A; Lindpaintner, K

    2000-01-01

    Comparative gene expression studies are often limited by low availability of tissue and poor quality of extractable mRNA. Collective PCR amplification of minute quantities of mRNA has great potential for overcoming these limitations. However, there remains significant concern about the effects of amplification on the absolute and relative abundance of individual mRNAs that could complicate subsequent gene expression studies. To address this problem, we systematically compared the relative abundance of many specific mRNAs from complex cDNA preparations (from tissue and cultured cells) both before and after amplification by PCR. Our results demonstrated that, as expected, the absolute abundance of different mRNAs in a cDNA library is altered in an unpredictable manner by PCR amplification. However, we found that the concentration ratios of specific mRNAs among different cDNA preparations were routinely well conserved after PCR amplification. Thus, for the purpose of comparative expression studies for specific mRNAs in two (or more) complex cDNAs, PCR-amplified cDNA is equally useful as unamplified cDNA. These results provide a rigorous experimental validation and offer a theoretical treatment to support the utility of PCR amplified cDNA for differential gene expression studies. We conclude that the inherent difficulties in performing differential screening studies such as gene chip and array analyses on limited amounts of biological materials can be overcome by a PCR amplification step without compromising data quality.

  3. In silico identification of gene amplification targets for improvement of lycopene production.

    PubMed

    Choi, Hyung Seok; Lee, Sang Yup; Kim, Tae Yong; Woo, Han Min

    2010-05-01

    The identification of genes to be deleted or amplified is an essential step in metabolic engineering for strain improvement toward the enhanced production of desired bioproducts. In the past, several methods based on flux analysis of genome-scale metabolic models have been developed for identifying gene targets for deletion. Genome-wide identification of gene targets for amplification, on the other hand, has been rather difficult. Here, we report a strategy called flux scanning based on enforced objective flux (FSEOF) to identify gene amplification targets. FSEOF scans all the metabolic fluxes in the metabolic model and selects fluxes that increase when the flux toward product formation is enforced as an additional constraint during flux analysis. This strategy was successfully employed for the identification of gene amplification targets for the enhanced production of the red-colored antioxidant lycopene. Additional metabolic engineering based on gene knockout simulation resulted in further synergistic enhancement of lycopene production. Thus, FSEOF can be used as a general strategy for selecting genome-wide gene amplification targets in silico.

  4. Endogenous K-ras signaling in erythroid differentiation.

    PubMed

    Zhang, Jing; Lodish, Harvey F

    2007-08-15

    K-ras is one of the most frequently mutated genes in virtually all types of human cancers. Using mouse fetal liver erythroid progenitors as a model system, we studied the role of endogenous K-ras signaling in erythroid differentiation. When oncogenic K-ras is expressed from its endogenous promoter, it hyperactivates cytokine-dependent signaling pathways and results in a partial block in erythroid differentiation. In erythroid progenitors deficient in K-ras, cytokine-dependent Akt activation is greatly reduced, leading to delays in erythroid differentiation. Thus, both loss- and gain-of-Kras functions affect erythroid differentiation through modulation of cytokine signaling. These results support the notion that in human cancer patients oncogenic Ras signaling might be controlled by antagonizing essential cytokines.

  5. KRAS Mutations in Canine and Feline Pancreatic Acinar Cell Carcinoma.

    PubMed

    Crozier, C; Wood, G A; Foster, R A; Stasi, S; Liu, J H W; Bartlett, J M S; Coomber, B L; Sabine, V S

    2016-07-01

    Companion animals may serve as valuable models for studying human cancers. Although KRAS is the most commonly mutated gene in human ductal pancreatic cancers (57%), with mutations frequently occurring at codons 12, 13 and 61, human pancreatic acinar cell carcinomas (ACCs) lack activating KRAS mutations. In the present study, 32 pancreatic ACC samples obtained from 14 dogs and 18 cats, including seven metastases, were analyzed for six common activating KRAS mutations located in codons 12 (n = 5) and 13 (n = 1) using Sequenom MassARRAY. No KRAS mutations were found, suggesting that, similar to human pancreatic ACC, KRAS mutations do not play a critical role in feline or canine pancreatic ACC. Due to the similarity of the clinical disease in dogs and cats to that of man, this study confirms that companion animals offer potential as a suitable model for investigating this rare subtype of pancreatic carcinoma.

  6. Amplification of Distant Estrogen Response Elements Deregulates Target Genes Associated with Tamoxifen Resistance in Breast Cancer

    PubMed Central

    Hsu, Pei-Yin; Hsu, Hang-Kai; Lan, Xun; Juan, Liran; Yan, Pearlly S.; Labanowska, Jadwiga; Heerema, Nyla; Hsiao, Tzu-Hung; Chiu, Yu-Chiao; Chen, Yidong; Liu, Yunlong; Li, Lang; Li, Rong; Thompson, Ian M.; Nephew, Kenneth P.; Sharp, Zelton D.; Kirma, Nameer B.; Jin, Victor X.; Huang, Tim H.-M.

    2013-01-01

    SUMMARY A causal role of gene amplification in tumorigenesis is well-known, while amplification of DNA regulatory elements as an oncogenic driver remains unclear. In this study, we integrated next-generation sequencing approaches to map distant estrogen response elements (DEREs) that remotely control transcription of target genes through chromatin proximity. Two densely mapped DERE regions located on chromosomes 17q23 and 20q13 were frequently amplified in ERα-positive luminal breast cancer. These aberrantly amplified DEREs deregulated target gene expression potentially linked to cancer development and tamoxifen resistance. Progressive accumulation of DERE copies was observed in normal breast progenitor cells chronically exposed to estrogenic chemicals. These findings may extend to other DNA regulatory elements, the amplification of which can profoundly alter target transcriptome during tumorigenesis. PMID:23948299

  7. Association of epidermal growth factor receptor gene amplification with loss of chromosome 10 in human glioblastoma multiforme.

    PubMed

    von Deimling, A; Louis, D N; von Ammon, K; Petersen, I; Hoell, T; Chung, R Y; Martuza, R L; Schoenfeld, D A; Yaşargil, M G; Wiestler, O D

    1992-08-01

    Although the loss of tumor suppressor genes and the activation of oncogenes have been established as two of the fundamental mechanisms of tumorigenesis in human cancer, little is known about the possible interactions between these two mechanisms. Loss of genetic material on chromosome 10 and amplification of the epidermal growth factor receptor (EGFR) gene are the most frequently reported genetic abnormalities in glioblastoma multiforme. In order to examine a possible correlation between these two genetic aberrations, the authors studied 106 gliomas (58 glioblastomas, 14 anaplastic astrocytomas, five astrocytomas, nine pilocytic astrocytomas, seven mixed gliomas, six oligodendrogliomas, two ependymomas, one subependymoma, one subependymal giant-cell astrocytoma, and three gangliogliomas) with Southern blot analysis for loss of heterozygosity on both arms of chromosome 10 and for amplification of the EGFR gene. Both the loss of genetic material on chromosome 10 and EGFR gene amplification were restricted to the glioblastomas. Of the 58 glioblastoma patients, 72% showed loss of chromosome 10 and 38% showed EGFR gene amplification. The remaining 28% had neither loss of chromosome 10 nor EGFR gene amplification. Without exception, the glioblastomas that exhibited EGFR gene amplification had also lost genetic material on chromosome 10 (p less than 0.001). This invariable association suggests a relationship between the two genetic events. Moreover, the presence of 15 cases of glioblastoma with loss of chromosome 10 but without EGFR gene amplification may further imply that the loss of a tumor suppressor gene (or genes) on chromosome 10 precedes EGFR gene amplification in glioblastoma tumorigenesis.

  8. Genomic markers of panitumumab resistance including ERBB2/HER2 in a phase II study of KRAS wild-type (wt) metastatic colorectal cancer (mCRC)

    PubMed Central

    Barry, Garrett S.; Cheang, Maggie C.; Chang, Hector Li; Kennecke, Hagen F.

    2016-01-01

    A prospective study was conducted to identify biomarkers associated with resistance to panitumumab monotherapy in patients with metastatic colorectal cancer (mCRC). Patients with previously treated, codon 12/13 KRAS wt, mCRC were prospectively administered panitumumab 6 mg/kg IV q2weeks. Of 34 panitumumab-treated patients, 11 (32%) had progressive disease at 8 weeks and were classified as non-responders. A Nanostring nCounter-based assay identified a 5-gene expression signature (ERBB2, MLPH, IRX3, MYRF, and KLK6) associated with panitumumab resistance (P = 0.001). Immunohistochemistry and in situ hybridization determined that the HER2 (ERBB2) protein was overexpressed in 4/11 non-responding and 0/21 responding cases (P = 0.035). Two non-responding tumors had ERBB2 gene amplification only, and one demonstrated both ERBB2 amplification and mutation. A non-codon 12/13 KRAS mutation occurred in one panitumumab-resistant patient and was mutually exclusive with ERBB2/HER2 abnormalities. This study identifies a 5-gene signature associated with non-response to single agent panitumumab, including a subgroup of non-responders with evidence of aberrant ERBB2/HER2 signaling. KRAS wt tumors resistant to EGFRi may be identified by gene signature analysis, and the HER2 pathway plays an important role in resistance to therapy. PMID:26980732

  9. Prognostic and Predictive Significance of MYC and KRAS Alterations in Breast Cancer from Women Treated with Neoadjuvant Chemotherapy

    PubMed Central

    de Souza, Carolina Rosal Teixeira; Montenegro, Raquel Carvalho; Rey, Juan Antonio; Carvalho, Antônio Alberto; Assumpção, Paulo Pimentel; Khayat, André Salim; Pinto, Giovanny Rebouças; Demachki, Sâmia; de Arruda Cardoso Smith, Marília; Burbano, Rommel Rodríguez

    2013-01-01

    Breast cancer is a complex disease, with heterogeneous clinical evolution. Several analyses have been performed to identify the risk factors for breast cancer progression and the patients who respond best to a specific treatment. We aimed to evaluate whether the hormone receptor expression, HER2 and MYC genes and their protein status, and KRAS codon 12 mutations may be prognostic or predictive biomarkers of breast cancer. Protein, gene and mutation status were concomitantly evaluated in 116 breast tumors from women who underwent neoadjuvant chemotherapy with doxorubicin plus cyclophosphamide. We observed that MYC expression was associated with luminal B and HER2 overexpression phenotypes compared to luminal A (p<0.05). The presence of MYC duplication or polysomy 8, as well as KRAS mutation, were also associated with the HER2 overexpression subtype (p<0.05). MYC expression and MYC gain were more frequently observed in early-onset compared to late-onset tumors (p<0.05). KRAS mutation was a risk factor of grade 3 tumors (p<0.05). A multivariate logistic regression demonstrated that MYC amplification defined as MYC/nucleus ratio of ≥2.5 was a protective factor for chemotherapy resistance. On the other hand, age and grade 2 tumors were a risk factor. Additionally, luminal B, HER2 overexpression, and triple-negative tumors presented increased odds of being resistant to chemotherapy relative to luminal A tumors. Thus, breast tumors with KRAS codon 12 mutations seem to present a worse prognosis. Additionally, MYC amplification may help in the identification of tumors that are sensitive to doxorubicin plus cyclophosphamide treatment. If confirmed in a large set of samples, these markers may be useful for clinical stratification and prognosis. PMID:23555992

  10. Genetic Amplification of the VEGF Pathway Genes Including VEGFA in Human Osteosarcoma

    PubMed Central

    Yang, Jilong; Yang, Da; Sun, Yan; Sun, Baocun; Wang, Guowen; Trent, Jonathan; Araujo, Dejka; Chen, Kexin; Zhang, Wei

    2012-01-01

    Background Osteosarcoma is the most common primary tumor of bone. It is a highly vascular and extremely destructive malignancy mainly affecting children and young adults. We performed microarray-based comparative genomic hybridization (aCGH) and carried out pathway analysis to gain a systemic view on the pathway alterations of the genetically altered genes. Methods Recurrent amplified and deleted genes detected by aCGH were subjected to the Kyoto Encyclopedia of Genes and Genomes (KEEG) pathway analysis to identify the altered pathways. Among enriched pathways, vascular endothelial growth factor (VEGF) pathway genes were collectively amplified and the alterations of this pathway were validated by fluorescence in situ hybridization (FISH) and immunohistochemistry in 58 formalin-fixed and paraffin-embedded osteosarcoma archival tissues with clinical follow-up information. Results the pathway enrichment analyses of the aCGH data revealed that VEGF pathway genes, including vascular endothelial growth factor A(VEGFA) gene itself, were significantly amplified in osteosarcoma. Genetic amplification of the VEGFA gene, both focally and in larger fragment, was validated by FISH. Notably, amplification of VEGFA gene and elevated expression of the VEGFA protein were significantly associated with microvascular density (MVD) and adverse tumor-free survival in osteosarcoma. Conclusions We reported for the first time that VEGF pathway genes including VEGFA gene are amplified in osteosarcoma. Amplification of the VEGFA gene is not only an important mechanism for elevated VEGFA protein expression, but also a poor prognostic factor for tumor-free survival. Combined classification of VEGFA gene amplification and positive VEGFA protein expression might provide more accurate patient stratification method for selection of anti-VEGF therapy for osteosarcoma. PMID:21495021

  11. Analysis of the K-ras and p53 pathways in x-ray-induced lung tumors in the rat

    SciTech Connect

    Belinsky, S.A.; Middleton, S.K.; Hahn, F.F.; Nikula, K.J.; Picksley, S.M.

    1996-04-01

    The risk from exposure to low-dose radiation in conjunction with cigarette smoking has not been estimated due in part to lmited knowledge surrounding the molecular mechanisms underlying radiation-induced cancers. The purpose of this investigation was to determine the frequency for alterations in genes within the K-ras and p53 signal and cell cycle regulatory pathways, respectively, in X-ray-induced lung tumors in the F344/N rat. These tumors were examined for genetic alterations in the K-ras, c-raf-1, p53, mdm2 and cip1 genes. No K-ras mutations were detected by sequencing in 18 squamous cell carcinomas (SCCs) or 17 adenocarcinomas. However, using a K-ras codon 12 mutation selection assay, a codon 12 GGT {r_arrow} GAT mutation was detected in one SCC, suggesting that activation of the K-ras proto-oncogene is both a rare and late event. Single-strand conformation polymorphism (SSCP) analysis of the kinase-binding domain of the c-raf-1 gene did not detect any polymorphisms. Three of 18 SCCs but none of the adenocarcinomas showed p53 nuclear immunoreactivity. Single-strand conformation polymorphism analysis of exons 4-9 of the p53 gene detected only an exon 9 mutation in one SCC. Mutations were not detected in the three SCCs with immunoreactive p53 protein. No amplification of the mdm2 gene was detected; however, nuclear mdm2 immunoreactivity was present in one of the three SCCs that stained positive for the p53 protein. The complete cDNA of the rat cip1 gene comprising 810 bases was cloned and sequenced. The frequency of somatic mutations in exon 2 of the cip1 gene was determined by SSCP analysis. No alterations in electrophoretic mobility were detected. The results of this investigation indicate that alterations in the K-ras and p53 pathways do not play a major role in the genesis of X-ray-induced lung tumors in the rat. 49 refs., 5 figs.

  12. Analysis of gene amplification in archival tissue by differential polymerase chain reaction.

    PubMed

    Neubauer, A; Neubauer, B; He, M; Effert, P; Iglehart, D; Frye, R A; Liu, E

    1992-05-01

    Oncogene amplification is found in many human tumors, and its detection may have important prognostic value. However, analysis of gene amplification may be hampered by inadequate tissue or poor DNA quality. We have previously described a polymerase chain reaction (PCR)-based procedure called differential PCR that can detect variations in gene dosage using miniscule amounts of tumor DNA [Frye, R.A., Benz, C.C. & Liu, E. (1989). Oncogene, 4, 1153-1157]. We now report the optimization of this technique for the analysis of oncogene amplification in paraffin-embedded archival tissues. We find that differential PCR is able to detect amplification of the HER2 (c-erbB-2) and the epidermal growth factor receptor (EGFR) genes and can be used to arrive at a semiquantitative estimate of gene dosage. Furthermore, our approach can determine gene amplification in samples in which the DNA is significantly degraded. Using differential PCR on paraffin-embedded tissues from cases previously investigated by standard DNA extraction and dot-blot procedures, good correlation between the two methods was found. Approaches are described to overcome technical problems posed by factors that affect the differential PCR, including the method of DNA extraction and extreme fragmentation of the DNA (less than 200 base pairs). Furthermore, the resulting analytical algorithm reported herein has proved effective in detecting oncogene amplification in archival breast cancer specimens from standard pathology laboratories. Thus, differential PCR will be particularly helpful in the analysis of tumor specimens that are archived, small in size or rare in occurrence.

  13. The significance of HER-2/neu/c-erbB-2 gene amplification in benign and malignant breast disease.

    PubMed

    Supanaranond, K; Sukarayodhin, S; Tanyakaset, M; Balachandra, K; Jullaksorn, D; Rienkijkarn, M; Hoisanka, N; Tantivanich, S

    1997-09-01

    This study was carried out to investigate the amplification of HER-2/neu oncogene in 66 patients with primary breast cancer and 90 samples from benign breast disease (BBD). The amplification of HER-2/neu oncogene in the DNA of paraffin-embedded specimens was determined by differential PCR. Nineteen out of 66 (28.8%) breast cancer patients showed amplification of the gene. No gene amplification was found in benign breast disease. There was no significant correlation of HER-2/neu amplification with, age, menopausal status, the number of positive nodes, tumor size, estrogen receptor, however, amplification of HER-2/neu gene was strongly correlated with nodal status (p = 0.0049). In node positive patients, the incidence of HER-2/neu amplification was high (43%). These findings indicate that the amplification of HER-2/neu gene may be of pathogenetic significance in breast cancer and may have a poor prognosis in node positive breast cancer patients while no gene amplification in benign breast disease suggests that HER-2/neu amplification is a late molecular alteration event in the pathogenesis of breast cancer.

  14. Regulation of oncogenic KRAS signaling via a novel KRAS-integrin-linked kinase-hnRNPA1 regulatory loop in human pancreatic cancer cells.

    PubMed

    Chu, P-C; Yang, M-C; Kulp, S K; Salunke, S B; Himmel, L E; Fang, C-S; Jadhav, A M; Shan, Y-S; Lee, C-T; Lai, M-D; Shirley, L A; Bekaii-Saab, T; Chen, C-S

    2016-07-28

    Integrin-linked kinase (ILK) is a mediator of aggressive phenotype in pancreatic cancer. On the basis of our finding that knockdown of either KRAS or ILK has a reciprocal effect on the other's expression, we hypothesized the presence of an ILK-KRAS regulatory loop that enables pancreatic cancer cells to regulate KRAS expression. This study aimed to elucidate the mechanism by which this regulatory circuitry is regulated and to investigate the translational potential of targeting ILK to suppress oncogenic KRAS signaling in pancreatic cancer. Interplay between KRAS and ILK and the roles of E2F1, c-Myc and heterogeneous nuclear ribonucleoprotein as intermediary effectors in this feedback loop was interrogated by genetic manipulations through small interfering RNA/short hairpin RNA knockdown and ectopic expression, western blotting, PCR, promoter-luciferase reporter assays, chromatin immunoprecipitation and pull-down analyses. In vivo efficacy of ILK inhibition was evaluated in two murine xenograft models. Our data show that KRAS regulated the expression of ILK through E2F1-mediated transcriptional activation, which, in turn, controlled KRAS gene expression via hnRNPA1-mediated destabilization of the G-quadruplex on the KRAS promoter. Moreover, ILK inhibition blocked KRAS-driven epithelial-mesenchymal transition and growth factor-stimulated KRAS expression. The knockdown or pharmacological inhibition of ILK suppressed pancreatic tumor growth, in part, by suppressing KRAS signaling. These studies suggest that this KRAS-E2F1-ILK-hnRNPA1 regulatory loop enables pancreatic cancer cells to promote oncogenic KRAS signaling and to interact with the tumor microenvironment to promote aggressive phenotypes. This regulatory loop provides a mechanistic rationale for targeting ILK to suppress oncogenic KRAS signaling, which might foster new therapeutic strategies for pancreatic cancer.

  15. Microarray amplification bias: loss of 30% differentially expressed genes due to long probe – poly(A)-tail distances

    PubMed Central

    Boelens, Mirjam C; te Meerman, Gerard J; Gibcus, Johan H; Blokzijl, Tjasso; Boezen, H Marike; Timens, Wim; Postma, Dirkje S; Groen, Harry JM; van den Berg, Anke

    2007-01-01

    Background Laser microdissection microscopy has become a rising tool to assess gene expression profiles of pure cell populations. Given the low yield of RNA, a second round of amplification is usually mandatory to yield sufficient amplified-RNA for microarray approaches. Since amplification induces truncation of RNA molecules, we studied the impact of a second round of amplification on identification of differentially expressed genes in relation to the probe – poly(A)-tail distances. Results Disagreement was observed between gene expression profiles acquired after a second round of amplification compared to a single round. Thirty percent of the differentially expressed genes identified after one round of amplification were not detected after two rounds. These inconsistent genes have a significant longer probe – poly(A)-tail distance. qRT-PCR on unamplified RNA confirmed differential expression of genes with a probe – poly(A)-tail distance >500 nucleotides appearing only after one round of amplification. Conclusion Our data demonstrate a marked loss of 30% of truly differentially expressed genes after a second round of amplification. Therefore, we strongly recommend improvement of amplification procedures and importance of microarray probe design to allow detection of all differentially expressed genes in case of limited amounts of RNA. PMID:17697374

  16. Cross-triggered and cascaded recycling amplification for ultrasensitive electrochemical sensing of the mutant human p53 gene.

    PubMed

    Yang, Cuiyun; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun

    2016-07-01

    Based on an endonuclease-assisted, cross-triggered and cascaded recycling amplification strategy, the construction of a simple electrochemical sensing platform for the ultrasensitive detection of the mutant p53 gene in human serum is described. Using this new signal amplification approach, the sub-femtomolar level of the mutant p53 gene can be selectively detected.

  17. A single nucleotide polymorphism in the 3'-untranslated region of the KRAS gene disrupts the interaction with let-7a and enhances the metastatic potential of osteosarcoma cells.

    PubMed

    Zhang, Shiqian; Hou, Chunying; Li, Guojun; Zhong, Yang; Zhang, Jie; Guo, Xinzhen; Li, Baoxin; Bi, Zhenggang; Shao, Ming

    2016-09-01

    The objective of the present study was to explore the molecular mechanism with which a single nucleotide polymorphism (rs61764370) interferes with the interaction between the 3'-untranslated region (3'-UTR) of Kirsten rat sarcoma viral oncogene homolog (KRAS) and let-7a, and its association with the metastasis of osteosarcoma (OS). In this study, we confirmed that KRAS is a target of let-7a in OS cells, and the introduction of rs61764370 minor allele into KRAS 3'-UTR significantly compromised the microRNA (miRNA)/mRNA interaction using a luciferase reporter system. Additionally, a total of 36 OS tissue samples of three different genotypes (TT,22; TG,10; GG,4) were obtained, and the expression of let-7a and KRAS was determined. We showed that let-7a mRNA expression was similar between each group whereas the mRNA and protein expression of KRAS in the TT genotype group was significantly lower than that in the GT or GG genotype groups. Moreover, we identified a negative regulatory relationship between let-7a and KRAS. Furthermore, we demonstrated that let-7a and KRAS interfered with the viability, invasiveness and migration of OS cells genotyped as TT. In the OS cells genotyped as TG, let-7a exerted minimal effects, and the effect of KRAS siRNA remained. Taken together, the findings of the present study demonstrated that the KRAS 3'-UTR rs61764370 polymorphism interfered with miRNA/mRNA interaction, and showed that the minor allele was associated with an elevated risk of developing metastatic disease in OS. PMID:27430246

  18. Gene amplification of the transcription factor DP1 and CTNND1 in human lung cancer.

    PubMed

    Castillo, Sandra D; Angulo, Barbara; Suarez-Gauthier, Ana; Melchor, Lorenzo; Medina, Pedro P; Sanchez-Verde, Lydia; Torres-Lanzas, Juan; Pita, Guillermo; Benitez, Javier; Sanchez-Cespedes, Montse

    2010-09-01

    The search for novel oncogenes is important because they could be the target of future specific anticancer therapies. In the present paper we report the identification of novel amplified genes in lung cancer by means of global gene expression analysis. To screen for amplicons, we aligned the gene expression data according to the position of transcripts in the human genome and searched for clusters of over-expressed genes. We found several clusters with gene over-expression, suggesting an underlying genomic amplification. FISH and microarray analysis for DNA copy number in two clusters, at chromosomes 11q12 and 13q34, confirmed the presence of amplifications spanning about 0.4 and 1 Mb for 11q12 and 13q34, respectively. Amplification at these regions each occurred at a frequency of 3%. Moreover, quantitative RT-PCR of each individual transcript within the amplicons allowed us to verify the increased in gene expression of several genes. The p120ctn and DP1 proteins, encoded by two candidate oncogenes, CTNND1 and TFDP1, at 11q12 and 13q amplicons, respectively, showed very strong immunostaining in lung tumours with gene amplification. We then focused on the 13q34 amplicon and in the TFDP1 candidate oncogene. To further determine the oncogenic properties of DP1, we searched for lung cancer cell lines carrying TFDP1 amplification. Depletion of TFDP1 expression by small interference RNA in a lung cancer cell line (HCC33) with TFDP1 amplification and protein over-expression reduced cell viability by 50%. In conclusion, we report the identification of two novel amplicons, at 13q34 and 11q12, each occurring at a frequency of 3% of non-small cell lung cancers. TFDP1, which encodes the E2F-associated transcription factor DP1 is a candidate oncogene at 13q34. The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series Accession No. GSE21168.

  19. Detection of gene-anchored amplification polymorphism (GAAP) in the vicinity of plant mitochondrial genes.

    PubMed

    Loridon, K; Saumitou-Laprade, P

    2002-05-01

    A simple, semi-automatable method was established for assessing polymorphism in plant mitochondrial genome. A set of 41 mitochondrial markers based on the published Arabidopsis thaliana sequence was developed in Brassicaceae using a gene-anchored amplification polymorphism (GAAP) strategy. PCR primers were selected based on conserved coding regions of mitochondrial genes and used to amplify the corresponding 5' and/or 3' non-coding flanking regions in order to maximise sequence variability between haplotypes. The variations in fragment size were analysed on a LiCor DNA sequencer, but the methodology is compatible with various sequencing systems using denaturing polyacrylamide gels. One advantage of the method is that GAAP products can be directly sequenced (without any cloning steps) through labelled M13 consensus sequences. Mitochondrial GAAP loci gave clear and simple patterns (one or two bands) that were easy to score and highly reproducible. Nearly all mitochondrial loci examined in A. thaliana were conserved within the Brassicaceae family, and half of the primers generated products when DNA from a distant species, Beta vulgaris (Chenopodiaceae), was used as template. The GAAP markers revealed low levels of polymorphism within species but exhibited a high level of polymorphism among genera and families. Our results showed some discrepancies with respect to the published mtDNA sequence of A. thaliana. PMID:12073035

  20. Amplification of the entire kanamycin biosynthetic gene cluster during empirical strain improvement of Streptomyces kanamyceticus.

    PubMed

    Yanai, Koji; Murakami, Takeshi; Bibb, Mervyn

    2006-06-20

    Streptomyces kanamyceticus 12-6 is a derivative of the wild-type strain developed for industrial kanamycin (Km) production. Southern analysis and DNA sequencing revealed amplification of a large genomic segment including the entire Km biosynthetic gene cluster in the chromosome of strain 12-6. At 145 kb, the amplifiable unit of DNA (AUD) is the largest AUD reported in Streptomyces. Striking repetitive DNA sequences belonging to the clustered regularly interspaced short palindromic repeats family were found in the AUD and may play a role in its amplification. Strain 12-6 contains a mixture of different chromosomes with varying numbers of AUDs, sometimes exceeding 36 copies and producing an amplified region >5.7 Mb. The level of Km production depended on the copy number of the Km biosynthetic gene cluster, suggesting that DNA amplification occurred during strain improvement as a consequence of selection for increased Km resistance. Amplification of DNA segments including entire antibiotic biosynthetic gene clusters might be a common mechanism leading to increased antibiotic production in industrial strains.

  1. Super resolution imaging of HER2 gene amplification

    NASA Astrophysics Data System (ADS)

    Okada, Masaya; Kubo, Takuya; Masumoto, Kanako; Iwanaga, Shigeki

    2016-02-01

    HER2 positive breast cancer is currently examined by counting HER2 genes using fluorescence in situ hybridization (FISH)-stained breast carcinoma samples. In this research, two-dimensional super resolution fluorescence microscopy based on stochastic optical reconstruction microscopy (STORM), with a spatial resolution of approximately 20 nm in the lateral direction, was used to more precisely distinguish and count HER2 genes in a FISH-stained tissue section. Furthermore, by introducing double-helix point spread function (DH-PSF), an optical phase modulation technique, to super resolution microscopy, three-dimensional images were obtained of HER2 in a breast carcinoma sample approximately 4 μm thick.

  2. Single Synonymous Mutations in KRAS Cause Transformed Phenotypes in NIH3T3 Cells

    PubMed Central

    Waters, Andrew M.; Bagni, Rachel; Portugal, Franklin; Hartley, James L.

    2016-01-01

    Synonymous mutations in the KRAS gene are clustered at G12, G13, and G60 in human cancers. We constructed 9 stable NIH3T3 cell lines expressing KRAS, each with one of these synonymous mutations. Compared to the negative control cell line expressing the wild type human KRAS gene, all the synonymous mutant lines expressed more KRAS protein, grew more rapidly and to higher densities, and were more invasive in multiple assays. Three of the cell lines showed dramatic loss of contact inhibition, were more refractile under phase contrast, and their refractility was greatly reduced by treatment with trametinib. Codon usage at these glycines is highly conserved in KRAS compared to HRAS, indicating selective pressure. These transformed phenotypes suggest that synonymous mutations found in driver genes such as KRAS may play a role in human cancers. PMID:27684555

  3. Clinical Implications of FADD Gene Amplification and Protein Overexpression in Taiwanese Oral Cavity Squamous Cell Carcinomas

    PubMed Central

    Chien, Huei-Tzu; Cheng, Sou-De; Chuang, Wen-Yu; Liao, Chun-Ta; Wang, Hung-Ming; Huang, Shiang-Fu

    2016-01-01

    Amplification of 11q13.3 is a frequent event in human cancers, including head and neck squamous cell carcinoma. This chromosome region contains several genes that are potentially cancer drivers, including FADD (Fas associated via death domain), an apoptotic effector that was previously identified as a novel oncogene in laryngeal/pharyngeal cancer. This study was designed to explore the role of FADD in oral squamous cell carcinomas (OSCCs) samples from Taiwanese patients, by assessing copy number variations (CNVs) and protein expression and the clinical implications of these factors in 339 male OSCCs. The intensity of FADD protein expression, as determined by immunohistochemistry, was strongly correlated with gene copy number amplification, as analyzed using a TaqMan CNV assay. Both FADD gene copy number amplification and high protein expression were significantly associated with lymph node metastasis (P < 0.001). Patients with both FADD copy number amplification and high protein expression had the shortest disease-free survival (DFS; P = 0.074 and P = 0.002) and overall survival (OS; P = 0.011 and P = 0.027). After adjusting for primary tumor status, tumor differentiation, lymph node metastasis and age at diagnosis, DFS was still significantly lower in patients with either copy number amplification or high protein expression (hazard ratio [H.R.] = 1.483; 95% confidence interval [C.I.], 1.044–2.106). In conclusion, our data reveal that FADD gene copy number and protein expression can be considered potential prognostic markers and are closely associated with lymph node metastasis in patients with OSCC in Taiwan. PMID:27764170

  4. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  5. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  6. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  7. Glucose Deprivation Contributes to the Development of KRAS Pathway Mutations in Tumor Cells

    PubMed Central

    Yun, Jihye; Rago, Carlo; Cheong, Ian; Pagliarini, Ray; Angenendt, Philipp; Rajagopalan, Harith; Schmidt, Kerstin; Wilson, James K. V.; Markowitz, Sandy; Zhou, Shibin; Diaz, Luis A.; Velculescu, Victor; Lengauer, Christoph; Kinzler, Kenneth W.; Vogelstein, Bert; Papadopoulos, Nickolas

    2010-01-01

    Tumor progression is driven by genetic mutations, but little is known about the environmental conditions that select for these mutations. Studying the transcriptomes of paired colorectal cancer cell lines that differed only in the mutational status of their KRAS or BRAF genes, we found that GLUT1, encoding glucose transporter-1, was one of three genes consistently upregulated in cells with KRAS or BRAF mutations. The mutant cells exhibited enhanced glucose uptake and glycolysis and survived in low glucose conditions, phenotypes that all required GLUT1 expression. In contrast, when cells with wild-type KRAS alleles were subjected to a low glucose environment, very few cells survived. Most surviving cells expressed high levels of GLUT1 and 4% of these survivors had acquired new KRAS mutations. The glycolysis inhibitor, 3-bromopyruvate preferentially suppressed the growth of cells with KRAS or BRAF mutations. Together, these data suggest that glucose deprivation can drive the acquisition of KRAS pathway mutations in human tumors. PMID:19661383

  8. Microplitis demolitor Bracovirus Proviral Loci and Clustered Replication Genes Exhibit Distinct DNA Amplification Patterns during Replication

    PubMed Central

    Simmonds, Tyler J.; Thomas, Sarah A.; Strand, Michael R.

    2015-01-01

    ABSTRACT Polydnaviruses are large, double-stranded DNA viruses that are beneficial symbionts of parasitoid wasps. Polydnaviruses in the genus Bracovirus (BVs) persist in wasps as proviruses, and their genomes consist of two functional components referred to as proviral segments and nudivirus-like genes. Prior studies established that the DNA domains where proviral segments reside are amplified during replication and that segments within amplified loci are circularized before packaging into nucleocapsids. One DNA domain where nudivirus-like genes are located is also amplified but never packaged into virions. We recently sequenced the genome of the braconid Microplitis demolitor, which carries M. demolitor bracovirus (MdBV). Here, we took advantage of this resource to characterize the DNAs that are amplified during MdBV replication using a combination of Illumina and Pacific Biosciences sequencing approaches. The results showed that specific nucleotide sites identify the boundaries of amplification for proviral loci. Surprisingly, however, amplification of loci 3, 4, 6, and 8 produced head-to-tail concatemeric intermediates; loci 1, 2, and 5 produced head-to-head/tail-to-tail concatemers; and locus 7 yielded no identified concatemers. Sequence differences at amplification junctions correlated with the types of amplification intermediates the loci produced, while concatemer processing gave rise to the circularized DNAs that are packaged into nucleocapsids. The MdBV nudivirus-like gene cluster was also amplified, albeit more weakly than most proviral loci and with nondiscrete boundaries. Overall, the MdBV genome exhibited three patterns of DNA amplification during replication. Our data also suggest that PacBio sequencing could be useful in studying the replication intermediates produced by other DNA viruses. IMPORTANCE Polydnaviruses are of fundamental interest because they provide a novel example of viruses evolving into beneficial symbionts. All polydnaviruses are

  9. In vitro gene amplification for prenatal diagnosis of congenital adrenal hyperplasia.

    PubMed Central

    Rumsby, G; Honour, J W

    1990-01-01

    A simple, rapid, non-radioactive method for detecting homozygous deletions/conversions of the steroid 21-hydroxylase gene is described. In our experience this method will be useful for first trimester prenatal diagnosis of congenital adrenal hyperplasia in 17% of families of a child with the salt losing form. This test includes an internal control to monitor the success of amplification. Images PMID:2277381

  10. STAT5A/B Gene Locus Undergoes Amplification during Human Prostate Cancer Progression

    PubMed Central

    Haddad, Bassem R.; Gu, Lei; Mirtti, Tuomas; Dagvadorj, Ayush; Vogiatzi, Paraskevi; Hoang, David T.; Bajaj, Renu; Leiby, Benjamin; Ellsworth, Elyse; Blackmon, Shauna; Ruiz, Christian; Curtis, Mark; Fortina, Paolo; Ertel, Adam; Liu, Chengbao; Rui, Hallgeir; Visakorpi, Tapio; Bubendorf, Lukas; Lallas, Costas D.; Trabulsi, Edouard J.; McCue, Peter; Gomella, Leonard; Nevalainen, Marja T.

    2014-01-01

    The molecular mechanisms underlying progression of prostate cancer (PCa) to castrate-resistant (CR) and metastatic disease are poorly understood. Our previous mechanistic work shows that inhibition of transcription factor Stat5 by multiple alternative methods induces extensive rapid apoptotic death of Stat5-positive PCa cells in vitro and inhibits PCa xenograft tumor growth in nude mice. Furthermore, STAT5A/B induces invasive behavior of PCa cells in vitro and in vivo, suggesting involvement of STAT5A/B in PCa progression. Nuclear STAT5A/B protein levels are increased in high-grade PCas, CR PCas, and distant metastases, and high nuclear STAT5A/B expression predicts early disease recurrence and PCa-specific death in clinical PCas. Based on these findings, STAT5A/B represents a therapeutic target protein for advanced PCa. The mechanisms underlying increased Stat5 protein levels in PCa are unclear. Herein, we demonstrate amplification at the STAT5A/B gene locus in a significant fraction of clinical PCa specimens. STAT5A/B gene amplification was more frequently found in PCas of high histologic grades and in CR distant metastases. Quantitative in situ analysis revealed that STAT5A/B gene amplification was associated with increased STAT5A/B protein expression in PCa. Functional studies showed that increased STAT5A/B copy numbers conferred growth advantage in PCa cells in vitro and as xenograft tumors in vivo. The work presented herein provides the first evidence of somatic STAT5A/B gene amplification in clinical PCas. PMID:23660011

  11. STAT5A/B gene locus undergoes amplification during human prostate cancer progression.

    PubMed

    Haddad, Bassem R; Gu, Lei; Mirtti, Tuomas; Dagvadorj, Ayush; Vogiatzi, Paraskevi; Hoang, David T; Bajaj, Renu; Leiby, Benjamin; Ellsworth, Elyse; Blackmon, Shauna; Ruiz, Christian; Curtis, Mark; Fortina, Paolo; Ertel, Adam; Liu, Chengbao; Rui, Hallgeir; Visakorpi, Tapio; Bubendorf, Lukas; Lallas, Costas D; Trabulsi, Edouard J; McCue, Peter; Gomella, Leonard; Nevalainen, Marja T

    2013-06-01

    The molecular mechanisms underlying progression of prostate cancer (PCa) to castrate-resistant (CR) and metastatic disease are poorly understood. Our previous mechanistic work shows that inhibition of transcription factor Stat5 by multiple alternative methods induces extensive rapid apoptotic death of Stat5-positive PCa cells in vitro and inhibits PCa xenograft tumor growth in nude mice. Furthermore, STAT5A/B induces invasive behavior of PCa cells in vitro and in vivo, suggesting involvement of STAT5A/B in PCa progression. Nuclear STAT5A/B protein levels are increased in high-grade PCas, CR PCas, and distant metastases, and high nuclear STAT5A/B expression predicts early disease recurrence and PCa-specific death in clinical PCas. Based on these findings, STAT5A/B represents a therapeutic target protein for advanced PCa. The mechanisms underlying increased Stat5 protein levels in PCa are unclear. Herein, we demonstrate amplification at the STAT5A/B gene locus in a significant fraction of clinical PCa specimens. STAT5A/B gene amplification was more frequently found in PCas of high histologic grades and in CR distant metastases. Quantitative in situ analysis revealed that STAT5A/B gene amplification was associated with increased STAT5A/B protein expression in PCa. Functional studies showed that increased STAT5A/B copy numbers conferred growth advantage in PCa cells in vitro and as xenograft tumors in vivo. The work presented herein provides the first evidence of somatic STAT5A/B gene amplification in clinical PCas.

  12. A system for the targeted amplification of bacterial gene clusters multiplies antibiotic yield in Streptomyces coelicolor.

    PubMed

    Murakami, Takeshi; Burian, Jan; Yanai, Koji; Bibb, Mervyn J; Thompson, Charles J

    2011-09-20

    Gene clusters found in bacterial species classified as Streptomyces encode the majority of known antibiotics as well as many pharmaceutically active compounds. A site-specific recombination system similar to those that mediate plasmid conjugation was engineered to catalyze tandem amplification of one of these gene clusters in a heterologous Streptomyces species. Three genetic elements were known to be required for DNA amplification in S. kanamyceticus: the oriT-like recombination sites RsA and RsB, and ZouA, a site-specific relaxase similar to TraA proteins that catalyze plasmid transfer. We inserted RsA and RsB sequences into the S. coelicolor genome flanking a cluster of 22 genes (act) responsible for biosynthesis of the polyketide antibiotic actinorhodin. Recombination between RsA and RsB generated zouA-dependent DNA amplification resulting in 4-12 tandem copies of the act gene cluster averaging nine repeats per genome. This resulted in a 20-fold increase in actinorhodin production compared with the parental strain. To determine whether the recombination event required taxon-specific genetic effectors or generalized bacterial recombination (recA), it was also analyzed in the heterologous host Escherichia coli. zouA was expressed under the control of an inducible promoter in wild-type and recA mutant strains. A plasmid was constructed with recombination sites RsA and RsB bordering a drug resistance marker. Induction of zouA expression generated hybrid RsB/RsA sites, evidence of site-specific recombination that occurred independently of recA. ZouA-mediated DNA amplification promises to be a valuable tool for increasing the activities of commercially important biosynthetic, degradative, and photosynthetic pathways in a wide variety of organisms.

  13. A system for the targeted amplification of bacterial gene clusters multiplies antibiotic yield in Streptomyces coelicolor

    PubMed Central

    Murakami, Takeshi; Burian, Jan; Yanai, Koji; Bibb, Mervyn J.; Thompson, Charles J.

    2011-01-01

    Gene clusters found in bacterial species classified as Streptomyces encode the majority of known antibiotics as well as many pharmaceutically active compounds. A site-specific recombination system similar to those that mediate plasmid conjugation was engineered to catalyze tandem amplification of one of these gene clusters in a heterologous Streptomyces species. Three genetic elements were known to be required for DNA amplification in S. kanamyceticus: the oriT-like recombination sites RsA and RsB, and ZouA, a site-specific relaxase similar to TraA proteins that catalyze plasmid transfer. We inserted RsA and RsB sequences into the S. coelicolor genome flanking a cluster of 22 genes (act) responsible for biosynthesis of the polyketide antibiotic actinorhodin. Recombination between RsA and RsB generated zouA-dependent DNA amplification resulting in 4–12 tandem copies of the act gene cluster averaging nine repeats per genome. This resulted in a 20-fold increase in actinorhodin production compared with the parental strain. To determine whether the recombination event required taxon-specific genetic effectors or generalized bacterial recombination (recA), it was also analyzed in the heterologous host Escherichia coli. zouA was expressed under the control of an inducible promoter in wild-type and recA mutant strains. A plasmid was constructed with recombination sites RsA and RsB bordering a drug resistance marker. Induction of zouA expression generated hybrid RsB/RsA sites, evidence of site-specific recombination that occurred independently of recA. ZouA-mediated DNA amplification promises to be a valuable tool for increasing the activities of commercially important biosynthetic, degradative, and photosynthetic pathways in a wide variety of organisms. PMID:21903924

  14. Sensitive and specific KRAS somatic mutation analysis on whole-genome amplified DNA from archival tissues.

    PubMed

    van Eijk, Ronald; van Puijenbroek, Marjo; Chhatta, Amiet R; Gupta, Nisha; Vossen, Rolf H A M; Lips, Esther H; Cleton-Jansen, Anne-Marie; Morreau, Hans; van Wezel, Tom

    2010-01-01

    Kirsten RAS (KRAS) is a small GTPase that plays a key role in Ras/mitogen-activated protein kinase signaling; somatic mutations in KRAS are frequently found in many cancers. The most common KRAS mutations result in a constitutively active protein. Accurate detection of KRAS mutations is pivotal to the molecular diagnosis of cancer and may guide proper treatment selection. Here, we describe a two-step KRAS mutation screening protocol that combines whole-genome amplification (WGA), high-resolution melting analysis (HRM) as a prescreen method for mutation carrying samples, and direct Sanger sequencing of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue, from which limited amounts of DNA are available. We developed target-specific primers, thereby avoiding amplification of homologous KRAS sequences. The addition of herring sperm DNA facilitated WGA in DNA samples isolated from as few as 100 cells. KRAS mutation screening using high-resolution melting analysis on wgaDNA from formalin-fixed, paraffin-embedded tissue is highly sensitive and specific; additionally, this method is feasible for screening of clinical specimens, as illustrated by our analysis of pancreatic cancers. Furthermore, PCR on wgaDNA does not introduce genotypic changes, as opposed to unamplified genomic DNA. This method can, after validation, be applied to virtually any potentially mutated region in the genome.

  15. CXCR2 signaling regulates KRAS(G12D)-induced autocrine growth of pancreatic cancer

    PubMed Central

    Purohit, Abhilasha; Varney, Michelle; Rachagani, Satyanarayana; Ouellette, Michel M.; Batra, Surinder K.; Singh, Rakesh K.

    2016-01-01

    Pharmacological inhibition of RAS, the master regulator of pancreatic ductal adenocarcinoma (PDAC), continues to be a challenge. Mutations in various isoforms of RAS gene, including KRAS are known to upregulate CXC chemokines; however, their precise role in KRAS-driven pancreatic cancer remains unclear. In this report, we reveal a previously unidentified tumor cell-autonomous role of KRAS(G12D)-induced CXCR2 signaling in mediating growth of neoplastic PDAC cells. Progressively increasing expression of mCXCR2 and its ligands was detected in the malignant ductal cells of Pdx1-cre;LSL-Kras(G12D) mice. Knocking-down CXCR2 in KRAS(G12D)-bearing human pancreatic duct-derived cells demonstrated a significant decrease in the in vitro and in vivo tumor cell proliferation. Furthermore, CXCR2 antagonists showed selective growth inhibition of KRAS(G12D)-bearing cells in vitro. Intriguingly, both genetic and pharmacological inhibition of CXCR2 signaling in KRAS(G12D)-bearing pancreatic ductal cells reduced the levels of KRAS protein, strongly implying the presence of a KRAS-CXCR2 feed-forward loop. Together, these data demonstrate the role of CXCR2 signaling in KRAS(G12D)-induced growth transformation and progression in PDAC. PMID:26771140

  16. Gene amplification-associated overexpression of the RNA editing enzyme ADAR1 enhances human lung tumorigenesis.

    PubMed

    Anadón, C; Guil, S; Simó-Riudalbas, L; Moutinho, C; Setien, F; Martínez-Cardús, A; Moran, S; Villanueva, A; Calaf, M; Vidal, A; Lazo, P A; Zondervan, I; Savola, S; Kohno, T; Yokota, J; de Pouplana, L R; Esteller, M

    2016-08-18

    The introduction of new therapies against particular genetic mutations in non-small-cell lung cancer is a promising avenue for improving patient survival, but the target population is small. There is a need to discover new potential actionable genetic lesions, to which end, non-conventional cancer pathways, such as RNA editing, are worth exploring. Herein we show that the adenosine-to-inosine editing enzyme ADAR1 undergoes gene amplification in non-small cancer cell lines and primary tumors in association with higher levels of the corresponding mRNA and protein. From a growth and invasion standpoint, the depletion of ADAR1 expression in amplified cells reduces their tumorigenic potential in cell culture and mouse models, whereas its overexpression has the opposite effects. From a functional perspective, ADAR1 overexpression enhances the editing frequencies of target transcripts such as NEIL1 and miR-381. In the clinical setting, patients with early-stage lung cancer, but harboring ADAR1 gene amplification, have poor outcomes. Overall, our results indicate a role for ADAR1 as a lung cancer oncogene undergoing gene amplification-associated activation that affects downstream RNA editing patterns and patient prognosis. PMID:26640150

  17. Gene amplification-associated overexpression of the RNA editing enzyme ADAR1 enhances human lung tumorigenesis

    PubMed Central

    Anadón, C; Guil, S; Simó-Riudalbas, L; Moutinho, C; Setien, F; Martínez-Cardús, A; Moran, S; Villanueva, A; Calaf, M; Vidal, A; Lazo, P A; Zondervan, I; Savola, S; Kohno, T; Yokota, J; de Pouplana, L R; Esteller, M

    2016-01-01

    The introduction of new therapies against particular genetic mutations in non-small-cell lung cancer is a promising avenue for improving patient survival, but the target population is small. There is a need to discover new potential actionable genetic lesions, to which end, non-conventional cancer pathways, such as RNA editing, are worth exploring. Herein we show that the adenosine-to-inosine editing enzyme ADAR1 undergoes gene amplification in non-small cancer cell lines and primary tumors in association with higher levels of the corresponding mRNA and protein. From a growth and invasion standpoint, the depletion of ADAR1 expression in amplified cells reduces their tumorigenic potential in cell culture and mouse models, whereas its overexpression has the opposite effects. From a functional perspective, ADAR1 overexpression enhances the editing frequencies of target transcripts such as NEIL1 and miR-381. In the clinical setting, patients with early-stage lung cancer, but harboring ADAR1 gene amplification, have poor outcomes. Overall, our results indicate a role for ADAR1 as a lung cancer oncogene undergoing gene amplification-associated activation that affects downstream RNA editing patterns and patient prognosis. PMID:26640150

  18. Gonadotropic pituitary carcinoma: HER-2/neu expression and gene amplification. Report of two cases.

    PubMed

    Roncaroli, Federico; Nosé, Vania; Scheithauer, Bernd W; Kovacs, Kalman; Horvath, Eva; Young, William F; Lloyd, Ricardo V; Bishop, Mari C; Hsi, Bradley; Fletcher, Jonathan A

    2003-08-01

    The authors report on two gonadotropic carcinomas of the adenohypophysis that occurred in a55-year-old man (Case 1) and a 53-year-old woman (Case 2), with signs of mass effect and amenorrhea, respectively. Both lesions were macroadenomas. The tumor in Case 1 metastasized to dura mater, skull, nasal sinus, and larynx 2 years after patient presentation, whereas that in Case 2 spread to vertebral bodies and ribs after a 19-year latency. Histologically, the primary, recurrent, and metastatic lesions in Case 1 featured brisk mitotic activity and high MIB-1 levels as well as p53 labeling indices. Immunoreactivity for HER-2/neu was assessable only in rare neoplastic cells of the second recurrence and in 80% of cells of the dural metastasis. Low-level HER-2/neu gene amplification was evident in the recurrent tumors and metastasis. The sellar and metastatic tumors in Case 2 resembled benign gonadotropic adenoma with oncocytic change; p53 accumulation, HER-2/neu overexpression, and HER-2/neu gene amplification were not present. The results indicate that low-level amplification of the HER-2/neu gene might be associated with pituitary carcinomas in which more aggressive behavior is seen. Further studies are needed to determine whether HER-2/neu plays a role in the pathogenesis of pituitary carcinoma.

  19. Amplification of thermostable lipase genes fragment from thermogenic phase of domestic waste composting process

    NASA Astrophysics Data System (ADS)

    Nurhasanah, Nurbaiti, Santi; Madayanti, Fida; Akhmaloka

    2015-09-01

    Lipases are lipolytic enzymes, catalyze the hydrolysis of fatty acid ester bonds of triglycerides to produce free fatty acids and glycerol. The enzyme is widely used in various fields of biotechnological industry. Hence, lipases with unique properties (e.g.thermostable lipase) are still being explored by variation methods. One of the strategy is by using metagenomic approach to amplify the gene directly from environmental sample. This research was focused on amplification of lipase gene fragment directly from the thermogenic phase of domestic waste composting in aerated trenches. We used domestic waste compost from waste treatment at SABUGA, ITB for the sample. Total chromosomal DNA were directly extracted from several stages at thermogenic phase of compost. The DNA was then directly used as a template for amplification of thermostable lipase gene fragments using a set of internal primers namely Flip-1a and Rlip-1a that has been affixed with a GC clamp in reverse primer. The results showed that the primers amplified the gene from four stages of thermogenic phase with the size of lipase gene fragment of approximately 570 base pairs (bp). These results were further used for Denaturing Gradient Gel Electrophoresis (DGGE) analysis to determine diversity of thermostable lipase gene fragments.

  20. Site-specific in situ amplification of the integrated polyomavirus genome: a case for a context-specific over-replication model of gene amplification.

    PubMed

    Syu, L J; Fluck, M M

    1997-08-01

    The fate of the genome of the polyoma (Py) tumor virus following integration in the chromosomes of transformed rat FR3T3 cells was re-examined. The viral sequences were integrated at a single transformant-specific chromosomal site in each of 22 transformants tested. In situ amplification of the viral sequences was observed in 24 of 34 transformants analyzed. Large T antigen, the unique viral function involved in initiating DNA replication from the viral origin, was essential for the amplification process. There was an absolute requirement for a reiteration of viral sequences and the extent of the reiteration affected the degree of amplification. The reiteration may be important for homologous recombination-mediated resolution of in situ amplified sequences. Among 11 transformants harboring a 1 to 2 kb repeat, the degree of amplification was transformant-specific and varied over a wide range. At the high end of the spectrum, the genome copy number increased 1300-fold at steady state, while at the low end, amplification was below twofold. Some aspect of the host chromatin at the site integration that affected viral gene expression, also directly or indirectly modulated the amplification. Use of high-resolution electrophoresis for the analysis of the integrated amplified sequences revealed a recurring novel pattern, consisting of a ladder with numerous bands separated by a constant distance approximately the size of the Py genome. We suggest that this pattern was generated by conversion of the amplified viral genomes to head to tail linear arrays with cell to cell variations in the number of genome repeats at single, transformant-specific, chromosomal sites. In light of the known "out of schedule" firing of the Py origin, we propose an "onion skin" structure intermediate and present a homologous recombination model for the conversion from onion skins to linear arrays. The relevance of the in situ amplification of the Py genome to cellular gene amplification is

  1. Clinicopathologic and prognostic associations of KRAS and BRAF mutations in small intestinal adenocarcinoma.

    PubMed

    Jun, Sun-Young; Kim, Misung; Jin Gu, Mi; Kyung Bae, Young; Chang, Hee-Kyung; Sun Jung, Eun; Jang, Kee-Taek; Kim, Jihun; Yu, Eunsil; Woon Eom, Dae; Hong, Seung-Mo

    2016-04-01

    Activating KRAS and/or BRAF mutations have been identified as predictors of resistance to anti-epidermal growth factor receptor (EGFR) chemotherapy in colorectal cancer. But the status of KRAS and BRAF mutations and their clinicopathologic and prognostic significance has not been extensively evaluated in small intestinal adenocarcinomas. In this work, the KRAS and BRAF genes in 190 surgically resected small intestinal adenocarcinoma cases were sequenced and their association with various clinicopathologic variables, including survival of the patients, was analyzed. KRAS or BRAF mutations were observed in 63 (33%) cases. Sixty-one cases had KRAS mutations and 2 had BRAF mutations and the two types of mutation were mutually exclusive. The majority of KRAS mutations were G>A transition (43/61 cases, 71%) or p.G12D (31/61 cases, 51%). The patients with mutant KRAS tended to have higher pT classifications (P=0.034) and more frequent pancreatic invasion (P=0.020) than those with wild-type KRAS. Multivariate logistic regression analysis showed that certain mutated KRAS subtypes (G>A transitions and G12D mutations) were significantly correlated with higher pT classification (P=0.015 and 0.004, respectively) than wild-type KRAS and other KRAS mutations. The patients with KRAS or BRAF mutation had a tendency to shorter overall survival than those with wild-type KRAS and BRAF (P=0.148), but subgroup analysis demonstrated the patients with KRAS mutations showed worse survival (median, 46.0 months; P=0.046) than those with wild-type KRAS (85.4 months) in lower pT classification (pT1-pT3) group. In summary, KRAS and, infrequently, BRAF mutations are observed in a subset of small intestinal adenocarcinomas, and are associated with higher pT classification and more frequent pancreatic invasion. KRAS mutation is a poor prognostic predictor in patients with lower pT classification tumors. Anti-EGFR targeted therapy could be applied to about two-thirds of small intestinal

  2. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  3. Nested polymerase chain reaction for amplification of the Cryptosporidium oocyst wall protein gene.

    PubMed Central

    Pedraza-Díaz, S.; Amar, C.; Nichols, G. L.; McLauchlin, J.

    2001-01-01

    We developed a sensitive nested polymerase chain reaction procedure for the Cryptosporidium oocyst wall protein (COWP) gene. Amplification and genotyping were successful in 95.2% of 1,680 fecal samples, 77.6% by the unnested and 17.6% by the nested COWP procedure. The COWP gene was amplified from 2,128 fecal samples: 71 from livestock animals and 2,057 from humans. This series included 706 cases from seven drinking water-associated outbreaks and 51 cases from five swimming pool-associated outbreaks, as well as 1,300 sporadic cases. PMID:11266294

  4. Concurrent Targeting of KRAS and AKT by MiR-4689 Is a Novel Treatment Against Mutant KRAS Colorectal Cancer

    PubMed Central

    Hiraki, Masayuki; Nishimura, Junichi; Takahashi, Hidekazu; Wu, Xin; Takahashi, Yusuke; Miyo, Masaaki; Nishida, Naohiro; Uemura, Mamoru; Hata, Taishi; Takemasa, Ichiro; Mizushima, Tsunekazu; Soh, Jae-Won; Doki, Yuichiro; Mori, Masaki; Yamamoto, Hirofumi

    2015-01-01

    KRAS mutations are a major cause of drug resistance to molecular-targeted therapies. Aberrant epidermal growth factor receptor (EGFR) signaling may cause dysregulation of microRNA (miRNA) and gene regulatory networks, which leads to cancer initiation and progression. To address the functional relevance of miRNAs in mutant KRAS cancers, we transfected exogenous KRASG12V into human embryonic kidney 293 and MRC5 cells with wild-type KRAS and BRAF genes, and we comprehensively profiled the dysregulated miRNAs. The result showed that mature miRNA oligonucleotide (miR)-4689, one of the significantly down-regulated miRNAs in KRASG12V overexpressed cells, was found to exhibit a potent growth-inhibitory and proapoptotic effect both in vitro and in vivo. miR-4689 expression was significantly down-regulated in cancer tissues compared to normal mucosa, and it was particularly decreased in mutant KRAS CRC tissues. miR-4689 directly targets v-ki-ras2 kirsten rat sarcoma viral oncogene homolog (KRAS) and v-akt murine thymoma viral oncogene homolog 1(AKT1), key components of two major branches in EGFR pathway, suggesting KRAS overdrives this signaling pathway through inhibition of miR-4689. Overall, this study provided additional evidence that mutant KRAS functions as a broad regulator of the EGFR signaling cascade by inhibiting miR-4689, which negatively regulates both RAS/mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K)/AKT pathways. These activities indicated that miR-4689 may be a promising therapeutic agent in mutant KRAS CRC. PMID:25756961

  5. Gene amplification in thyroid cancer: A new mechanism defined by comparative genomic hybridization

    SciTech Connect

    Chen, X.N.; Lai, E.; Fagin, J.A.

    1994-09-01

    More than 12,000 new cases of thyroid cancer develop each year in the USA for which scant information is available on cytogenetic abnormalities. Comparative genomic hybridization (CGH) now permits the detection and mapping of amplified regions in DNAs without the need for metaphase tumor preparations. Using CGH, we have analyzed the DNA copy number changes in 10 human thyroid tumors. Further, the procedure of CGH was modified by using a chromomycin and sitamycin reverse-banding technique to provide a high resolution assignment of amplified regions. The results revealed a series of copy number changes including amplifications of chromosome bands 1p36, 1q42, 2p13, 2p21, 19q13.1 and losses of chromosome bands 16q12-13 and 16q22-23. The most striking regions of amplifications, band 2p21 and 2p13 were further analyzed by constructing a 90-member chromosome 2 BAC map and using 9 members of this to analyze WRO, a thyroid follicular carcinoma cell line containing double minutes (dm). Eight BACs revealed three copies of chromosome 2; one BAC mapping at the 2p21-22 border revealed significant and variable amplification in all of the metaphase dm`s suggesting a local amplification. Interphase analyses revealed about 40-70 signals per nucleus. The variable signals seen in the WRO cell population suggest the existence of a minor population with higher copy number and smaller amplicon size. In summary, high resolution CGH has been combined with BAC contig construction for the analysis of thyroid tumor to reveal a very specific region amplification on chromosome 2p21 likely to contain a new gene involved in thyroid cancer tumorigenesis.

  6. The dynamics of gene amplification described as a multitype compartmental model and as a branching process.

    PubMed

    Harnevo, L E; Agur, Z

    1991-02-01

    The present work is aimed at developing the mathematical tools by which the dynamics of gene amplification (GA) can be described in detail. Some discrete compartmental models of GA by disproportionate replication and a general model for other putative GA mechanisms are presented and analyzed. The dynamical distribution of gene copy number in the cell population is calculated with the loss of cells taken either as constant or as copy-number-dependent. Our analysis shows that for a one-copy GA process with constant loss of cells, the relative frequency of single-gene-copy cells (sensitive cells) converges to zero, with the rate of convergence depending on the amplification probability. In contrast, for a one-copy GA process with copy-number-dependent loss of cells, the relative frequency of single-copy cells is bounded, implying a bounded compartment of many-gene-copy cells. Using branching processes theory we calculate the dynamical distribution of the single-gene-copy compartment as well as its extinction probability. Our models are used for estimating treatment prognosis as affected by drug resistance due to GA, showing significant differences in prognosis resulting from small changes in drug dose.

  7. De novo amplification within a silent human cholinesterase gene in a family subjected to prolonged exposure to organophosphorus insecticides

    SciTech Connect

    Prody, C.A.; Dreyfus, P.; Soreq, H. ); Zamir, R. Tel-Aviv Univ. ); Zakut, H. )

    1989-01-01

    A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genes in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.

  8. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    SciTech Connect

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  9. KRAS and YAP1 converge to regulate EMT and tumor survival

    PubMed Central

    Shao, Diane D.; Xue, Wen; Krall, Elsa B.; Bhutkar, Arjun; Piccioni, Federica; Wang, Xiaoxing; Schinzel, Anna C.; Sood, Sabina; Rosenbluh, Joseph; Kim, Jong W.; Zwang, Yaara; Roberts, Thomas M.; Root, David E.; Jacks, Tyler; Hahn, William C.

    2014-01-01

    Summary Cancer cells that express oncogenic alleles of RAS typically require sustained expression of the mutant allele for survival, but the molecular basis of this oncogene dependency remains incompletely understood. To identify genes that can functionally substitute for oncogenic RAS, we systematically expressed 15,294 open reading frames in a human KRAS-dependent colon cancer cell line engineered to express an inducible KRAS-specific shRNA. We found 147 genes that promoted survival upon KRAS suppression. In particular, the transcriptional co-activator YAP1 rescued cell viability in KRAS-dependent cells upon suppression of KRAS and was required for KRAS-induced cell transformation. Acquired resistance to Kras suppression in a Kras-driven murine lung cancer model also involved increased YAP1 signaling. KRAS and YAP1 converge on the transcription factor FOS and activate a transcriptional program involved in regulating the epithelial-mesenchymal transition (EMT). Together, these findings implicate transcriptional regulation of EMT by YAP1 as a significant component of oncogenic RAS signaling. PMID:24954536

  10. Duplication and amplification of antibiotic resistance genes enable increased resistance in isolates of multidrug-resistant Salmonella Typhimurium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    During normal bacterial DNA replication, gene duplication and amplification (GDA) events occur randomly at a low frequency in the genome throughout a population. In the absence of selection, GDA events that increase the number of copies of a bacterial gene (or a set of genes) are lost. Antibiotic ...

  11. Gene deletions and amplifications in human hepatocellular carcinomas: correlation with hepatocyte growth regulation.

    PubMed

    Nalesnik, Michael A; Tseng, George; Ding, Ying; Xiang, Guo-Sheng; Zheng, Zhong-liang; Yu, YanPing; Marsh, James W; Michalopoulos, George K; Luo, Jian-Hua

    2012-04-01

    Tissues from 98 human hepatocellular carcinomas (HCCs) obtained from hepatic resections were subjected to somatic copy number variation (CNV) analysis. Most of these HCCs were discovered in livers resected for orthotopic transplantation, although in a few cases, the tumors themselves were the reason for the hepatectomies. Genomic analysis revealed deletions and amplifications in several genes, and clustering analysis based on CNV revealed five clusters. The LSP1 gene had the most cases with CNV (46 deletions and 5 amplifications). High frequencies of CNV were also seen in PTPRD (21/98), GNB1L (18/98), KIAA1217 (18/98), RP1-1777G6.2 (17/98), ETS1 (11/98), RSU1 (10/98), TBC1D22A (10/98), BAHCC1 (9/98), MAML2 (9/98), RAB1B (9/98), and YIF1A (9/98). The existing literature regarding hepatocytes or other cell types has connected many of these genes to regulation of cytoskeletal architecture, signaling cascades related to growth regulation, and transcription factors directly interacting with nuclear signaling complexes. Correlations with existing literature indicate that genomic lesions associated with HCC at the level of resolution of CNV occur on many genes associated directly or indirectly with signaling pathways operating in liver regeneration and hepatocyte growth regulation.

  12. Amplification of complete gag gene sequences from geographically distinct equine infectious anemia virus isolates.

    PubMed

    Boldbaatar, Bazartseren; Bazartseren, Tsevel; Koba, Ryota; Murakami, Hironobu; Oguma, Keisuke; Murakami, Kenji; Sentsui, Hiroshi

    2013-04-01

    In the current study, primers described previously and modified versions of these primers were evaluated for amplification of full-length gag genes from different equine infectious anemia virus (EIAV) strains from several countries, including the USA, Germany and Japan. Each strain was inoculated into a primary horse leukocyte culture, and the full-length gag gene was amplified by reverse transcription polymerase chain reaction. Each amplified gag gene was cloned into a plasmid vector for sequencing, and the detectable copy numbers of target DNA were determined. Use of a mixture of two forward primers and one reverse primer in the polymerase chain reaction enabled the amplification of all EIAV strains used in this study. However, further study is required to confirm these primers as universal for all EIAV strains. The nucleotide sequence of gag is considered highly conserved, as evidenced by the use of gag-encoded capsid proteins as a common antigen for the detection of EIAV in serological tests. However, significant sequence variation in the gag genes of different EIAV strains was found in the current study. PMID:23318370

  13. Arsenic-induced instrumental genes of apoptotic signal amplification in death-survival interplay

    PubMed Central

    Roy, Sonali; Narzary, Bardwi; Ray, Atish; Bordoloi, Manobjyoti

    2016-01-01

    Arsenic is a global health concern at present and it is well reported for causing systemic toxicity. It is also well known for generation of free radical and inducing apoptosis in different cell types. Paradoxically arsenic is reported to be a susceptible carcinogen as well. There are several reports demonstrating diverse mechanism of apoptosis in different cell types. However, the universal scenario of instrumental genes and their interaction leading to amplification of apoptotic signal are yet to be completely uncovered, which is predicted here. Conventional studies on signaling pathway aided by time and concentration kinetics data are inadequate for prediction of anchored genes for apoptotic signal amplification. Therefore, expression profile-based approach is adopted. Core apoptosis related and glutathione metabolism genes in 1 and 10 μM of arsenic-treated HepG2 cells were analyzed after 12 h of incubation. An arsenic treatment of 1 μM exhibits no cell death at 12 h, whereas 10 μM arsenic treatment reveals around 50% cell death at 12 h. Results depict 28 and 44 affected genes in 1 and 10 μM arsenic-treated cells, respectively. Early initiation of apoptotic signaling is detected in no cell death regimens (at 1 μM), whereas amplified apoptotic signal is demonstrated at 50% cell death regimens (at 10 μM). Instrumental genes involved in progression of apoptosis in the concourse of cell death and survival is designated from the responsive genes common to both the condition. We predict the initiation process is fairly aided by the activation of intrinsic pathway, which is amplified via TNF signaling and extrinsic pathway. Furthermore, regulatory genes involved in interplay between apoptosis/anti-apoptosis and their interactions are demonstrated here. PMID:27785370

  14. Developmental regulation of DNA replication: replication fork barriers and programmed gene amplification in Tetrahymena thermophila.

    PubMed

    Zhang, Z; Macalpine, D M; Kapler, G M

    1997-10-01

    The palindromic Tetrahymena ribosomal DNA (rDNA) minichromosome is amplified 10,000-fold during development. Subsequent vegetative replication is cell cycle regulated. rDNA replication differs fundamentally in cycling vegetative and nondividing amplifying cells. Using two-dimensional gel electrophoresis, we show for the first time that replication origins that direct gene amplification also function in normal dividing cells. Two classes of amplification intermediates were identified. The first class is indistinguishable from vegetative rDNA, initiating in just one of the two 5' nontranscribed spacer (NTS) copies in the rDNA palindrome at either of two closely spaced origins. Thus, these origins are active throughout the life cycle and their regulation changes at different developmental stages. The second, novel class of amplification intermediates is generated by multiple initiation events. Intermediates with mass greater than fully replicated DNA were observed, suggesting that onionskin replication occurs at this stage. Unlike amplified rDNA in Xenopus laevis, the novel Tetrahymena species are not produced by random initiation; replication also initiates in the 5' NTS. Surprisingly, a replication fork barrier which is activated only in these amplifying molecules blocks the progression of forks near the center of the palindrome. Whereas barriers have been previously described, this is the first instance in which programmed regulation of replication fork progression has been demonstrated in a eukaryote.

  15. Complete surgical resection of lung tumor decreases exhalation of mutated KRAS oncogene.

    PubMed

    Kordiak, Jacek; Szemraj, Janusz; Hamara, Katarzyna; Bialasiewicz, Piotr; Nowak, Dariusz

    2012-09-01

    Exhaled breath condensate (EBC) contains extracellular DNA that may originate from pathological lesions of the respiratory tract and can be a genetic marker of pulmonary malignancy. We tested whether complete surgical excision of lung cancer will decrease exhalation of mutated KRAS oncogene. Fifty seven patients with clinical diagnosis of lung cancer and detectable KRAS mutations in pre-surgery EBC-DNA were qualified for surgical treatment. Point mutations at codon 12 of KRAS oncogene were detected using mutant-enriched PCR technique in DNA from pre-surgery blood, EBC collected before, 7 and 30 days after surgery and from specimens of resected tumor and normal pulmonary parenchyma. The ratio of mutated to wild type KRAS DNA (R mut/wild KRAS) was calculated for each specimen after electrophoresis and densitometry of the final amplification and digestion product. In 46 patients non-small cell lung cancer (NSCLC) and in 11 benign lesion (BL) were confirmed. All blood and tumor specimens were positive for KRAS mutations, while 41 specimens of normal pulmonary parenchyma were negative. In NSCLC patients pre-surgery EBC R mut/wild KRAS of 0.20 ± 0.03 decreased by 1.3- and 3.7-times (p < 0.001) at 7th and 30th day and 10 EBC specimens at day 30th became negative. The highest R mut/wild KRAS was found in NSCLC specimens - 1.36 ± 0.29 while the lowest in pulmonary parenchyma - 0.02 ± 0.03 (p < 0.001). R mut/wild KRAS in EBC did not correlate with the blood and cancer ratios. Determination of mutated KRAS oncogene in EBC can be potentially helpful in the follow-up of surgical treatment of pulmonary malignancy. PMID:22795503

  16. Higher prevalence and gene amplification of HPV16 in oropharynx as compared to oral cavity

    PubMed Central

    SHIGEISHI, Hideo; SUGIYAMA, Masaru; OHTA, Kouji; RAHMAN, Mohammad Zeshaan; TAKECHI, Masaaki

    2016-01-01

    ABSTRACT Objective The objective of this study was to clarify differences regarding HPV16 infection and gene amplification between the oral cavity and oropharynx in healthy individuals. Material and Methods The subjects were 94 healthy asymptomatic individuals (41 males, 53 females; mean age 58.6 years, range 16-97 years) who visited the Department of Oral and Maxillofacial Reconstructive Surgery of the Hiroshima University Hospital from 2014 to 2015. Oral epithelial cells were collected from oral rinse and pharynx gargle samples and placed in saline. The human endogenous retrovirus gene ERV3-1 was used as a reference to estimate the number of human cells in each sample. DNA samples were extracted from approximately 10,000 human cells and tested for HPV16 DNA by PCR using a type-specific primer. Similarly, we analyzed the HPV16 viral copy number in HPV16-positive cases using real-time PCR to examine genomic amplification. Results The percentage of HPV16-positive cases was higher in the gargle (28.7%) as compared to the rinse (16.0%) samples. In the oral rinse samples, males (26.8%) showed a significantly higher rate of HPV16 than females (7.5%) (P=0.021). Importantly, in older subjects (aged 60-89 years), gargle samples showed a significantly higher rate of HPV16 (33.3%) than oral rinse samples (13.7%) (P=0.034). The average number of viral copies was approximately 8 times higher in the gargle than in the oral rinse samples (0.16±0.27 vs. 1.35±1.26 copy numbers per cell), a significant difference (P<0.001). Conclusion Our findings suggest that the oropharynx is more susceptible to HPV16 infection as compared to the oral cavity, while HPV16 gene amplification is also more commonly found in the oropharynx. PMID:27556212

  17. Silencing KRAS overexpression in arsenic-transformed prostate epithelial and stem cells partially mitigates malignant phenotype.

    PubMed

    Ngalame, Ntube N O; Tokar, Erik J; Person, Rachel J; Waalkes, Michael P

    2014-12-01

    Inorganic arsenic is a human carcinogen that likely targets the prostate. Chronic arsenic exposure malignantly transforms the RWPE-1 human prostate epithelial line to chronic arsenic exposed-prostate epithelial (CAsE-PE) cells, and a derivative normal prostate stem cell (SC) line, WPE-stem to arsenic-cancer SCs (As-CSCs). The KRAS oncogene is highly overexpressed in CAsE-PE cells and activation precedes transformation, inferring mechanistic significance. As-CSCs also highly overexpress KRAS. Thus, we hypothesize KRAS activation is key in causing and maintaining an arsenic-induced malignant phenotype, and hence, KRAS knockdown (KD) may reverse this malignant phenotype. RNA interference using shRNAmirs to obtain KRAS KD was used in CAsE-PE and As-CSC cells. Cells analyzed 2 weeks post transduction showed KRAS protein decreased to 5% of control after KD, confirming stable KD. KRAS KD decreased phosphorylated ERK, indicating inhibition of RAS/ERK signaling, a proliferation/survival pathway activated with arsenic transformation. Secreted metalloproteinase (MMP) activity was increased by arsenic-induced malignant transformation, but KRAS KD from 4 weeks on decreased secreted MMP-9 activity by 50% in As-CSCs. Colony formation, a characteristic of cancer cells, was decreased in both KRAS KD transformants. KRAS KD also decreased the invasive capacity of both cell types. KRAS KD decreased proliferation in As-CSCs, consistent with loss of rapid tumor growth. Genes predicted to impact cell proliferation (eg, Cyclin D1, p16, and p21) changed accordingly in both KD cell types. Thus, KRAS silencing impacts aspects of arsenic-induced malignant phenotype, inducing loss of many typical cancer characteristics particularly in As-CSCs.

  18. Amplification and loss of dihydrofolate reductase genes in a Chinese hamster ovary cell line

    SciTech Connect

    Kaufman, R.J.; Schimke, R.T.

    1981-12-01

    During stepwise increases in the methotrexate concentration in culture medium, the authors selected Chinese hamster ovary cells that contained elevated dihydrofolate reductase levels which were proportional to the number of dihydrofolate reductase gene copies (i.e., gene amplification). The authors studied the dihydrofolate reductase levels in individual cells that underwent the initial steps of methotrexate resistance by using the fluorescence-activated cell sorter technique. Such cells constituted a heterogeneous population with differing dihydrofolate reductase levels, and they characteristically lost the elevated enzyme levels when they were grown in the absence of methotrexate. The progeny of individual cells with high enzyme levels behaved differently and could lose all or variable numbers of the amplified genes.

  19. Selective Amplification of the Genome Surrounding Key Placental Genes in Trophoblast Giant Cells.

    PubMed

    Hannibal, Roberta L; Baker, Julie C

    2016-01-25

    While most cells maintain a diploid state, polyploid cells exist in many organisms and are particularly prevalent within the mammalian placenta [1], where they can generate more than 900 copies of the genome [2]. Polyploidy is thought to be an efficient method of increasing the content of the genome by avoiding the costly and slow process of cytokinesis [1, 3, 4]. Polyploidy can also affect gene regulation by amplifying a subset of genomic regions required for specific cellular function [1, 3, 4]. This mechanism is found in the fruit fly Drosophila melanogaster, where polyploid ovarian follicle cells amplify genomic regions containing chorion genes, which facilitate secretion of eggshell proteins [5]. Here, we report that genomic amplification also occurs in mammals at selective regions of the genome in parietal trophoblast giant cells (p-TGCs) of the mouse placenta. Using whole-genome sequencing (WGS) and digital droplet PCR (ddPCR) of mouse p-TGCs, we identified five amplified regions, each containing a gene family known to be involved in mammalian placentation: the prolactins (two clusters), serpins, cathepsins, and the natural killer (NK)/C-type lectin (CLEC) complex [6-12]. We report here the first description of amplification at selective genomic regions in mammals and present evidence that this is an important mode of genome regulation in placental TGCs.

  20. Clinical significance of hTERC gene amplification detection by FISH in the screening of cervical lesions.

    PubMed

    Zhang, Yuan; Wang, Xiaobei; Ma, Ling; Wang, Zehua; Hu, Lihua

    2009-06-01

    This study evaluated the clinical significance of hTERC gene amplification detection by fluorescence in situ hybridization (FISH) in the screening of cervical lesions. Cervical specimens of 50 high risk patients were detected by thin liquid-based cytology. The patients whose cytological results were classified as ASCUS or above were subjected to the subsequent colposcopic biopsies. Slides prepared from these 50 cervical specimens were analyzed for hTERC gene amplification using interphase FISH with the two-color hTERC probe. The results of the cytological analysis and those of subsequent biopsies, when available, were compared with the FISH-detected hTERC abnormalities. It was found that the positive rates of hTERC gene amplification in NILM, ASCUS, LSIL, HSIL, and SCC groups were 0.00, 28.57%, 57.14%, 100%, and 100%, respectively. The positive rates of hTERC gene amplification in HSIL and SCC groups were significantly higher than those in NILM, ASCUS and LSIL groups (all P<0.05). The mean percentages of cells with hTERC gene amplification in NILM, ASCUS, LSIL, HSIL, and SCC groups were 0.00, 10.50%, 36.00%, 79.00%, and 96.50%, respectively. Patients with HSIL or SCC cytological diagnoses had significantly higher mean percentages of cells with hTERC gene amplification than did patients with NILM, ASCUS or LSIL cytological diagnoses (all P<0.05). It was concluded that two-color interphase FISH could detect hTERC gene amplification to accurately distinguish HSIL and ISIL of cervical cells. It may be an adjunct to cytology screening, especially high-risk patients.

  1. Amplification-free digital gene expression profiling from minute cell quantities

    PubMed Central

    Ozsolak, Fatih; Ting, David T; Wittner, Ben S; Brannigan, Brian W; Paul, Suchismita; Bardeesy, Nabeel; Ramaswamy, Sridhar; Milos, Patrice M; Haber, Daniel A

    2010-01-01

    Generating reliable expression profiles from minute cell quantities is critical for scientific discovery and potential clinical applications. Here we present low-quantity digital gene expression (LQ-DGE), an amplification-free approach involving capture of poly(A)+ RNAs from cellular lysates onto poly(dT)-coated sequencing surfaces, followed by on-surface reverse transcription and sequencing. We applied LQ-DGE to profile malignant and nonmalignant mouse and human cells, demonstrating its quantitative power and potential applicability to archival specimens. PMID:20639869

  2. Rapid PCR amplification protocols decrease the turn-around time for detection of antibiotic resistance genes in Gram-negative pathogens.

    PubMed

    Geyer, Chelsie N; Hanson, Nancy D

    2013-10-01

    A previously designed end-point multiplex PCR assay and singleplex assays used to detect β-lactamase genes were evaluated using rapid PCR amplification methodology. Amplification times were 16-18 minutes with an overall detection time of 1.5 hours. Rapid PCR amplifications could decrease the time required to identify resistance mechanisms in Gram-negative organisms.

  3. Detection by in vitro amplification of the alpha-toxin (phospholipase C) gene from Clostridium perfringens.

    PubMed

    Fach, P; Guillou, J P

    1993-01-01

    A polymerase chain reaction (PCR) with thermostable DNA polymerase from Thermus aquaticus is described for the specific amplification of the phospholipase C (alpha-toxin) gene of Clostridium perfringens. A set of primers selected for their high specificity could detect Cl. perfringens in stools with a detection limit of approximately 5 x 10(2) bacteria, after bi-amplification. A modified PCR without thermal steps was performed to rapidly amplify, with a yield of 60%, the DNA template. With this PCR method Cl. perfringens alpha-toxin gene could be detected within 2 h. The PCR method detected alpha-toxin positive Cl. perfringens but did not react with phospholipase C-producing Bacillus cereus, Pseudomonas aeruginosa, Cl. sordellii and Cl. bifermentans. The amplified PCR products were screened through ethidium bromide agarose gel electrophoresis or, in only 1 h, with the PhastSystem (Pharmacia). This PCR satisfies the criteria of specificity, sensitivity and rapidity required for a useful tool in epidemiology and for the diagnosis of the pathogen Cl. perfringens as it may be used directly on stool samples.

  4. Sensitive colorimetric detection of Listeria monocytogenes based on isothermal gene amplification and unmodified gold nanoparticles.

    PubMed

    Fu, Zhongyu; Zhou, Xiaoming; Xing, Da

    2013-12-15

    Listeria monocytogenes (L. monocytogenes), one of most problematic food-borne bacteria, is mainly transmitted through the food chain and may cause listeriosis. Therefore, the development of rapid and sensitive L. monocytogenes detection technique has become an urgent task. In this study, we proposed a method using hyperbranching rolling circle amplification (HRCA) combined with gold nanoparticle (GNP) based colorimetric strategy to offer an isothermal, highly sensitive and specific assay for the detection of L. monocytogenes. First, a linear padlock probe targeting a specific sequence in the hly gene was designed and followed with a ligation by Taq DNA ligase. After ligation, further amplification by HRCA with a thiolated primer and an unlabeled primer is performed. The resulting thiolated HRCA products were then captured onto GNP surface and made GNP more salt-tolerant. Detection of the bacteria can be achieved by a facilitated GNP based colorimetric testing using naked eyes. Through this approach, as low as 100 aM synthetic hly gene targets and about 75 copies of L. monocytogenes can be detected. The specificity is evaluated by distinguishing target L. monocytogenes from other bacteria. The artificial contaminated food samples were also detected for its potential applications in real food detection. This method described here is ideal for bacteria detection due to its simplicity and high sensitivity. PMID:23948710

  5. Loop-mediated isothermal amplification targeting the apxIVA gene for detection of Actinobacillus pleuropneumoniae.

    PubMed

    Yang, Wang; Pin, Chen; Haibing, Guo; Yang, Chen; Hui, Liu; Qigai, He

    2009-11-01

    Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification method performed under isothermal conditions with high specificity and efficiency. We developed a diagnostic method based on LAMP for detection of Actinobacillus pleuropneumoniae. Using six specific primers targeting the apxIVA gene, the LAMP assay rapidly amplified the target gene within 30 min, requiring only a laboratory water bath for the reaction to occur. The resulting amplificon was visualized by adding SYBR Green I to the mixture. The results obtained from testing 15 A. pleuropneumoniae reference strains and other seven bacterial species strains showed that the LAMP was as specific as and 10 times more sensitive than nested PCR. Sixty-five tonsil samples were collected from 65 healthy pigs. All the samples were negative for A. pleuropneumoniae by immunomagnetic separation-based (IMS) bacterial isolation, nested PCR and LAMP, respectively. Meanwhile, 115 tonsil samples were also collected from 115 pigs with apparent respiratory problems. Twenty-two were positive by IMS bacterial isolation. All the samples that were positive by IMS bacterial isolation were also positive by nested PCR and LAMP. The LAMP assay demonstrated exceptionally higher sensitivity than nested PCR by picking up 14 additional positive cases (chi(2) test, P<0.0001); we concluded that LAMP was a highly sensitive and reliable method for detection of A. pleuropneumoniae infection.

  6. Directed gene copy number amplification in Pichia pastoris by vector integration into the ribosomal DNA locus.

    PubMed

    Marx, Hans; Mecklenbräuker, Astrid; Gasser, Brigitte; Sauer, Michael; Mattanovich, Diethard

    2009-12-01

    The yeast Pichia pastoris is a widely used host organism for heterologous protein production. One of the basic steps for strain improvement is to ensure a sufficient level of transcription of the heterologous gene, based on promoter strength and gene copy number. To date, high-copy-number integrants of P. pastoris are achievable only by screening of random events or by cloning of gene concatemers. Methods for rapid and reliable multicopy integration of the expression cassette are therefore desirable. Here we present such a method based on vector integration into the rDNA locus and post-transformational vector amplification by repeated selection on increased antibiotic concentrations. Data are presented for two exemplary products: human serum albumin, which is secreted into the supernatant, and human superoxide dismutase, which is accumulated in the cytoplasm of the cells. The striking picture evolving is that intracellular protein production is tightly correlated with gene copy number, while use of the secretory pathway introduces a high clonal variability and the correlation with gene copy number is valid only for low gene copy numbers. PMID:19799640

  7. Amplification of the E2F1 transcription factor gene in the HEL erythroleukemia cell line

    SciTech Connect

    Saito, M.; Valentine, M.B.; Look, A.T.

    1995-01-01

    The E2F transcription factor plays an important regulatory role in cell proliferation, mediating the expression of genes whose products are essential for inducing resting cells to enter the cell cycle and synthesize DNA. To investigate the possible involvement of E2F in hematopoietic malignancies, we isolated genomic clones encompassing the human E2F1 gene. We then used fluorescence in situ hybridization to localize E2F1 to human chromosome 20q11, telomeric to the p107 locus, a gene whose product is related to the retinoblastoma gene product (pRb). This finding contrasts with the 1p36 and 6q22 chromosomal locations previously assigned E2F2 and E2F3, two additional members of the E2F family. Although deletions or structural rearrangements of E2F1 were not detected in 14 primary acute leukemia or myelodysplasia samples with structural abnormalities of chromosome 20q11, the gene was amplified and overexpressed in HEL erythroleukemia cells and translocated to other chromosomes in several established human leukemia cell lines. This study provides the first evidence of gene amplification involving a member of the E2F family of transcription factors. We propose that E2F1 overexpression in erythroid progenitors may stimulate abnormal cell proliferation by overriding negative regulatory signals mediated by tumor suppressor proteins such as pRb. 76 refs., 5 figs., 2 tabs.

  8. Isolation of genes from the Batten candidate region using exon amplification

    SciTech Connect

    Lerner, T.J.; D`Arigo, K.L.; Haines, J.L.

    1995-06-05

    In order to identify genes originating from the Batten disease candidate region, we have used the technique of exon amplification to identify transcribed sequences. This procedure produces trapped exon clones, which can represent single exons or multiple exons spliced together and is an efficient method for obtaining probes for physical mapping and for screening cDNA libraries. The source of DNA for these experiments was a collection of chromosome 16 cosmid contigs isolated by the direct subcloning of region-specific yeast artificial chromosomes (YACs) and hybridization of inter-alu PCR products from these YACs to the flow-sorted Los Alamos chromosome 16 cosmid library. We are now using the resulting exon probes to screen retina and brain cDNA libraries for candidate JNCL genes. 23 refs., 1 fig.

  9. Silencing KRAS Overexpression in Cadmium-Transformed Prostate Epithelial Cells Mitigates Malignant Phenotype.

    PubMed

    Ngalame, Ntube N O; Waalkes, Michael P; Tokar, Erik J

    2016-09-19

    Cadmium (Cd) is a potential human prostate carcinogen. Chronic Cd exposure malignantly transforms RWPE-1 human prostate epithelial cells into CTPE cells by an unclear mechanism. Previous studies show that RWPE-1 can also be malignantly transformed by arsenic, and KRAS activation is key to causation and maintenance of this phenotype. Although Cd and arsenic can both transform prostate epithelial cells, it is uncertain whether their mechanisms are similar. Thus, here we determined whether KRAS activation is critical in causing and maintaining Cd-induced malignant transformation in CTPE cells. Expression of KRAS, miRNAs, and other genes of interest was analyzed by Western blot and RT-PCR. Following stable KRAS knockdown (KD) by RNA interference using shRNAmir, the malignant phenotype was assessed by various physical and genetic parameters. CTPE cells greatly overexpressed KRAS by 20-fold, indicating a likely role in Cd transformation. Thus, we attempted to reverse the malignant phenotype via KRAS KD. Two weeks after shRNAmir transduction, KRAS protein was undetectable in CTPE KD cells, confirming stable KD. KRAS KD reduced stimulated RAS/ERK and PI3K/AKT signaling pathways and markedly mitigated multiple physical and molecular malignant cell characteristics including: hypersecretion of MMP-2, colony formation, cell survival, and expression of cancer-relevant genes (reduced proliferation and cell cycle-related genes; activated tumor suppressor PTEN). However, KRAS KD did not reverse miRNA expression originally down-regulated by Cd transformation. These data strongly suggest KRAS is a key gene in development and maintenance of the Cd-induced malignant phenotype, at least in the prostate. It is not, however, the only genetic factor sustaining this phenotype. PMID:27510461

  10. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    PubMed

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-09-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  11. Monosomy of chromosome 17 in breast cancer during interpretation of HER2 gene amplification

    PubMed Central

    Brunelli, Matteo; Nottegar, Alessia; Bogina, Giuseppe; Caliò, Anna; Cima, Luca; Eccher, Albino; Vicentini, Caterina; Marcolini, Lisa; Scarpa, Aldo; Pedron, Serena; Brunello, Eleonora; Knuutila, Sakari; Sapino, Anna; Marchiò, Caterina; Bria, Emilio; Molino, Annamaria; Carbognin, Luisa; Tortora, Giampaolo; Jasani, Bharat; Miller, Keith; Merdol, Ibrahim; Zanatta, Lucia; Laurino, Licia; Wirtanen, Tiina; Zamboni, Giuseppe; Marconi, Marcella; Chilosi, Marco; Manfrin, Erminia; Martignoni, Guido; Bonetti, Franco

    2015-01-01

    Monosomy of chromosome 17 may affect the assessment of HER2 amplification. Notably, the prevalence ranges from 1% up to 49% due to lack of consensus in recognition. We sought to investigate the impact of monosomy of chromosome 17 to interpretation of HER2 gene status. 201 breast carcinoma were reviewed for HER2 gene amplification and chromosome 17 status. FISH analysis was performed by using double probes (LSI/CEP). Absolute gene copy number was also scored per each probe. HER2 FISH test was repeated on serial tissue sections, ranging in thickness from 3 to 20 µm. Ratio was scored and subsequently corrected by monosomy after gold control test using the aCGH method to overcome false interpretation due to artefactual nuclear truncation. HER2 immunotests was performed on all cases. 26/201 cases were amplified (13%). Single signals per CEP17 were revealed in 7/201 (3.5%) cases. Five out of 7 cases appeared monosomic with aCGH (overall, 5/201, 2.5%) and evidenced single signals in >60% of nuclei after second-look on FISH when matching both techniques. Among 5, one case showed amplification with a pattern 7/1 (HER2/CEP17>2) of copies (3+ at immunotest); three cases revealed single signals per both probes (LSI/CEP=1) and one case revealed a 3:1 ratio; all last 4 cases showed 0/1+ immunoscore. We concluded that: 1) monosomy of chromosome 17 may be observed in 2.5% of breast carcinoma; 2) monosomy of chromosome 17 due to biological reasons rather than nuclear truncation was observed when using the cut-off of 60% of nuclei harboring single signals; 3) the skewing of the ratio due to single centromeric 17 probe may lead to false positive evaluation; 4) breast carcinomas showing a 3:1 ratio (HER2/CEP17) usually show negative 0/1+ immunoscore and <6 gene copy number at FISH. PMID:26328251

  12. Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes.

    PubMed

    Soh, Y Q Shirleen; Alföldi, Jessica; Pyntikova, Tatyana; Brown, Laura G; Graves, Tina; Minx, Patrick J; Fulton, Robert S; Kremitzki, Colin; Koutseva, Natalia; Mueller, Jacob L; Rozen, Steve; Hughes, Jennifer F; Owens, Elaine; Womack, James E; Murphy, William J; Cao, Qing; de Jong, Pieter; Warren, Wesley C; Wilson, Richard K; Skaletsky, Helen; Page, David C

    2014-11-01

    We sequenced the MSY (male-specific region of the Y chromosome) of the C57BL/6J strain of the laboratory mouse Mus musculus. In contrast to theories that Y chromosomes are heterochromatic and gene poor, the mouse MSY is 99.9% euchromatic and contains about 700 protein-coding genes. Only 2% of the MSY derives from the ancestral autosomes that gave rise to the mammalian sex chromosomes. Instead, all but 45 of the MSY's genes belong to three acquired, massively amplified gene families that have no homologs on primate MSYs but do have acquired, amplified homologs on the mouse X chromosome. The complete mouse MSY sequence brings to light dramatic forces in sex chromosome evolution: lineage-specific convergent acquisition and amplification of X-Y gene families, possibly fueled by antagonism between acquired X-Y homologs. The mouse MSY sequence presents opportunities for experimental studies of a sex-specific chromosome in its entirety, in a genetically tractable model organism.

  13. Non-Mendelian inheritance induced by gene amplification in the germ nucleus of Paramecium tetraurelia.

    PubMed

    Matsuda, Atsushi; Takahashi, Mihoko

    2005-01-01

    A genetic investigation of strain d4-95, which carries a recessive mutant allele (pwB(95)) of pawn-B, one of the controlling elements of voltage-dependent calcium channels in Paramecium tetraurelia, revealed a non-Mendelian feature. Progeny of the cross between d4-95 and wild type often expressed a clonally stable mutant phenotype, even when they had a wild-type gene. The mutant phenotype was also expressed after self-fertilization of theoretical wild-type homozygotes recovered from the cross. Our molecular analysis demonstrated that the copy number of the mutant pwB gene in the micro- and macronucleus of d4-95 was much greater than that of the wild type. Most of the amplified, extra pwB gene copies in d4-95 were heritable independently from the original pwB locus. Repeated backcrossing of d4-95 with the wild type to dilute extra pwB genes in the strain produced segregants with a completely normal Mendelian trait in testcrosses. These results strongly suggest that a non-Mendelian inheritance of d4-95 was induced by gene amplification in the micronucleus. PMID:15371356

  14. Coordinate amplification of metallothionein I and II gene sequences in cadmium-resistant CHO variants

    SciTech Connect

    Hildebrand, C.E.; Crawford, B.D.; Enger, M.D.

    1983-01-01

    Cadmium-resistanc (Cd/sup r/) variants of the Chinese hamster cell line, CHO, have been derived by stepwise selection for growth in medium containing CdCl/sub 2/. These variants show coordinately increased production of both metallothionein (MT) I and II and were stably resistant to Cd/sup 2 +/ in the absence of continued selection. Genomic DNAs from these Cd/sup r/ sublines were analyzed for both MT gene copy number and MT gene organization, using cDNA sequence probes specific for each of the two Chinese hamster isometallothioneins. These analyses revealed coordinate amplification of MT I and II genes in all Cd/sup r/ variants which had increased copies of MT-encoding sequences. In situ hybridization of an MT-encoding probe to mitotic chromosomes of a Cd/sup r/ variant, which has amplified MT genes at least 14-fold, revealed a single chromosomal site of hybridization. These results suggest that the isoMTs constitute a functionally related gene cluster which amplifies coordinately in response to toxic metal stress.

  15. Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes

    PubMed Central

    Soh, Y.Q. Shirleen; Alföldi, Jessica; Pyntikova, Tatyana; Brown, Laura G.; Graves, Tina; Minx, Patrick J.; Fulton, Robert S.; Kremitzki, Colin; Koutseva, Natalia; Mueller, Jacob L.; Rozen, Steve; Hughes, Jennifer F.; Owens, Elaine; Womack, James E.; Murphy, William J.; Cao, Qing; de Jong, Pieter; Warren, Wesley C.; Wilson, Richard K.; Skaletsky, Helen; Page, David C.

    2014-01-01

    Summary We sequenced the MSY (Male-Specific region of the Y chromosome) of the C57BL/6J strain of the laboratory mouse Mus musculus. In contrast to theories that Y chromosomes are heterochromatic and gene poor, the mouse MSY is 99.9% euchromatic and contains about 700 protein-coding genes. Only two percent of the MSY derives from the ancestral autosomes that gave rise to the mammalian sex chromosomes. Instead, all but 50 of the MSY's genes belong to three acquired, massively amplified gene families that have no homologs on primate MSYs, but do have acquired, amplified homologs on the mouse X chromosome. The complete mouse MSY sequence brings to light dramatic forces in sex chromosome evolution: lineage-specific convergent acquisition and amplification of X-Y gene families, possibly fueled by antagonism between acquired X-Y homologs. The mouse MSY sequence presents opportunities for experimental studies of a sex-specific chromosome in its entirety, in a genetically tractable model organism. PMID:25417157

  16. [Specific features of gene amplification on the long arm of chromosome 17 in different molecular genetic subtypes of breast cancer].

    PubMed

    Zavalishina, L E; Danilova, N V; Matsionis, A E; Pavlenko, I A

    2014-01-01

    The frequency of gene amplification and coamplification of HER2/neu, TOP2A and the centromeric region of chromosome 17 (CEP17) was examined in 265 breast cancer (BC) cases belonging to different molecular genetic subgroups. Luminal B breast cancer was found to be characterized by the increased probability of coamplifications (CEP17 and HER/neu, HER2/neu, and TOP2A) on chromosome 17. At the same time, the amplification of just three loci on one chromosome is a rare event and encountered in 17% of luminal B breast cancer cases (or 1.1% of all BC cases). That of HER2/neu in conjunction with elevated CEP17 count is statistically significantly more rarely accompanied by deletion of TOP2A rather than its amplification. The findings suggest that there are different amplification mechanisms in different BC molecular genetic subgroups. PMID:25051718

  17. Amplification of a Gene Related to Mammalian mdr Genes in Drug-Resistant Plasmodium falciparum

    NASA Astrophysics Data System (ADS)

    Wilson, Craig M.; Serrano, Adelfa E.; Wasley, Annemarie; Bogenschutz, Michael P.; Shankar, Anuraj H.; Wirth, Dyann F.

    1989-06-01

    The malaria parasite Plasmodium falciparum contains at least two genes related to the mammalian multiple drug resistance genes, and at least one of the P. falciparum genes is expressed at a higher level and is present in higher copy number in a strain that is resistant to multiple drugs than in a strain that is sensitive to the drugs.

  18. Lable-free quadruple signal amplification strategy for sensitive electrochemical p53 gene biosensing.

    PubMed

    Wang, Zonghua; Xia, Jianfei; Song, Daimin; Zhang, Feifei; Yang, Min; Gui, Rijun; Xia, Lin; Bi, Sai; Xia, Yanzhi

    2016-03-15

    A versatile label-free quadruple signal amplification biosensing platform for p53 gene (target DNA) detection was proposed. The chitosan-graphene (CS-GR) modified electrode with excellent electron transfer ability could provide a large specific surface for high levels of AuNPs-DNA attachment. The large amount of AuNPs could immobilize more capture probes and enhance the electrochemical signal with the excellent electrocatalytic activity. Furthermore, with the assist of N.BstNB I (the nicking endonuclease), target DNA could be reused and more G-quadruplex-hemin DNAzyme could be formed, allowing significant signal amplification in the presence of H2O2. Such strategy can enhance the oxidation-reduction reaction of adsorbed methylene blue (MB) and efficiently improve the sensitivity of the proposed biosensor. The morphologies of materials and the stepwise biosensor were characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and cyclic voltammetry (CV). Differential pulse voltammetry (DPV) signals of MB provided quantitative measures of the concentrations of target DNA, with a linear calibration range of 1.0 × 10(-15)-1.0 × 10(-9)M and a detection limit of 3.0 × 10(-16)M. Moreover, the resulting biosensor also exhibited good specificity, acceptable reproducibility and stability, indicating that the present strategy was promising for broad potential application in clinic assay.

  19. Ultrasensitive Electrochemical Biosensor for HIV Gene Detection Based on Graphene Stabilized Gold Nanoclusters with Exonuclease Amplification.

    PubMed

    Wang, Yijia; Bai, Xiaoning; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

    2015-08-26

    Because human immunodeficiency virus (HIV) has been one of the most terrible viruses in recent decades, early diagnosis of the HIV gene is of great importance for all scientists around the world. In our work, we developed a novel electrochemical biosensor based on one-step ultrasonic synthesized graphene stabilized gold nanocluster (GR/AuNC) modified glassy carbon electrode (GCE) with an exonuclease III (Exo III)-assisted target recycling amplification strategy for the detection of HIV DNA. It is the first time that GR/AuNCs have been used as biosensor platform and aptamer with cytosine-rich base set as capture probe to construct the biosensor. With the combination of cytosine-rich capture probe, good conductivity and high surfaces of GR/AuNCs, and Exo III-assisted target recycling amplification, we realized high sensitivity and good selectivity detection of target HIV DNA with a detection limit of 30 aM (S/N = 3). Furthermore, the proposed biosensor has a promising potential application for target detection in human serum analysis.

  20. [Differentiation among cutaneous Leishmania species upon amplification of a sequence of dipeptidyl peptidase III encoding gene].

    PubMed

    Kbaier-Hachemi, H; Barhoumi, M; Chakroun, A S; Ben Fadhel, M; Guizani, I

    2008-01-01

    Leishmaniasis are a group of vector-born, parasitic diseases caused by protozoan of the Leishmania genus, that includes visceral or cutaneous forms. Cutaneous leishmaniasis (CL) refers to a group of diseases because of the variability of clinical manifestations, caused by a large number of Leishmania species. In Tunisia, three different forms of CL are encountered, having different causal agents L. infantum, L. major and L. tropica. For the purpose of this study, we assessed the potential of polymorphic sites in dipeptidyl peptidase III (DPP III) encoding gene to differentiate among Leishmania species encountered in Tunisia. A pair of forward and reverse primers amplifying a 664 bp DPP III sequence were designed in regions including 2 mutations in the forward primer and 1 in the reverse, and were used to amplify DNA from diverse species of Leishmania parasites including L. infantum, L. major, L. tropica, L. donovani, L. chagasi, L. arabica, L. aethiopica and L. tarentolae. Amplification was positive for all tested Leishmania species except for L. infantum, L. chagasi, L. archibaldi, L. donovani and L. tarentolae. In case of cutaneous Leishmania species encountered in Tunisia, amplification was positive for both L. tropica and L. major and negative in case of L. infantum. This ability to differentiate L. infantum from L. tropica/L. major constitutes a first step in the taxonomy of cutaneous species prevalent in Tunisia.

  1. Overproduction of Magnetosomes by Genomic Amplification of Biosynthesis-Related Gene Clusters in a Magnetotactic Bacterium

    PubMed Central

    Lohße, Anna; Kolinko, Isabel; Raschdorf, Oliver; Uebe, René; Borg, Sarah; Brachmann, Andreas; Plitzko, Jürgen M.; Müller, Rolf; Zhang, Youming

    2016-01-01

    ABSTRACT Magnetotactic bacteria biosynthesize specific organelles, the magnetosomes, which are membrane-enclosed crystals of a magnetic iron mineral that are aligned in a linear chain. The number and size of magnetosome particles have to be critically controlled to build a sensor sufficiently strong to ensure the efficient alignment of cells within Earth's weak magnetic field while at the same time minimizing the metabolic costs imposed by excessive magnetosome biosynthesis. Apart from their biological function, bacterial magnetosomes have gained considerable interest since they provide a highly useful model for prokaryotic organelle formation and represent biogenic magnetic nanoparticles with exceptional properties. However, potential applications have been hampered by the difficult cultivation of these fastidious bacteria and their poor yields of magnetosomes. In this study, we found that the size and number of magnetosomes within the cell are controlled by many different Mam and Mms proteins. We present a strategy for the overexpression of magnetosome biosynthesis genes in the alphaproteobacterium Magnetospirillum gryphiswaldense by chromosomal multiplication of individual and multiple magnetosome gene clusters via transposition. While stepwise amplification of the mms6 operon resulted in the formation of increasingly larger crystals (increase of ∼35%), the duplication of all major magnetosome operons (mamGFDC, mamAB, mms6, and mamXY, comprising 29 genes in total) yielded an overproducing strain in which magnetosome numbers were 2.2-fold increased. We demonstrate that the tuned expression of the mam and mms clusters provides a powerful strategy for the control of magnetosome size and number, thereby setting the stage for high-yield production of tailored magnetic nanoparticles by synthetic biology approaches. IMPORTANCE Before our study, it had remained unknown how the upper sizes and numbers of magnetosomes are genetically regulated, and overproduction of

  2. KRAS (but not BRAF) mutations in ovarian serous borderline tumor are associated with recurrent low-grade serous carcinoma

    PubMed Central

    Tsang, Yvonne T.; Deavers, Michael T.; Sun, Charlotte C.; Kwan, Suet-Yan; Kuo, Eric; Malpica, Anais; Mok, Samuel C.; Gershenson, David M.; Wong, Kwong-Kwok

    2014-01-01

    BRAF and KRAS mutations in ovarian serous borderline tumors (OSBTs) and ovarian low-grade serous carcinomas (LGSCs) have been previously described. However, whether those OSBTs would progress to LGSCs or those LGSCs were developed from OSBT precursors in previous studies is unknown. Therefore, we assessed KRAS and BRAF mutations in tumor samples from 23 recurrent LGSC patients with known initial diagnosis of OSBT. Paraffin blocks from both OSBT and LGSC samples were available for 5 patients, and either OSBT or LGSC were available for another 18 patients. Tumor cells from paraffin-embedded tissues were dissected out for mutation analysis by conventional polymerase chain reaction (PCR) and Sanger sequencing. Tumors that appeared to have wild-type KRAS by conventional PCR–Sanger sequencing were further analyzed by full COLD (coamplification at lower denaturation temperature)-PCR and deep sequencing. Full COLD-PCR was able to enrich the amplification of mutated alleles. Deep sequencing was performed with the Ion Torrent personal genome machine (PGM). By conventional PCR–Sanger sequencing, BRAF mutation was detected only in one patient and KRAS mutations were detected in 10 patients. Full COLD-PCR deep sequencing detected low-abundance KRAS mutations in eight additional patients. Three of the five patients with both OSBT and LGSC samples available had the same KRAS mutations detected in both OSBT and LGSC samples. The remaining two patients had only KRAS mutations detected in their LGSC samples. For patients with either OSBT or LGSC samples available, KRAS mutations were detected in 7 OSBT samples and 6 LGSC samples. To our surprise, patients with the KRAS G12V mutation appeared to have shorter survival times. In summary, KRAS mutations are very common in recurrent LGSC, while BRAF mutations are rare. The findings indicate that recurrent LGSC can arise from proliferation of OSBT tumor cells with or without detectable KRAS mutations. PMID:24549645

  3. Suppression of TET1-Dependent DNA Demethylation is Essential for KRAS-Mediated Transformation

    PubMed Central

    Wu, Bo-Kuan

    2014-01-01

    Summary Hypermethylation-mediated tumor suppressor gene (TSG) silencing is a central epigenetic alteration in RAS-dependent tumorigenesis. Ten-eleven translocation (TET) enzymes can depress DNA methylation by hydroxylation of 5-methylcytosine (5mC) bases to 5-hydroxymethylcytosine (5hmC). Here we report that suppression of TET1 is required for KRAS-induced DNA hypermethylation and cellular transformation. In distinct non-malignant cell lines, oncogenic KRAS promotes transformation by inhibiting TET1 expression via the ERK signaling pathway. This reduces chromatin occupancy of TET1 at TSG promoters, lowers levels of 5hmC, and increases levels of 5mC and 5mC-dependent transcriptional silencing. Restoration of TET1 expression by ERK pathway inhibition or ectopic TET1 reintroduction in KRAS-transformed cells reactivates TSGs and inhibits colony formation. KRAS knockdown increases TET1 expression and diminishes colony-forming ability, while KRAS/TET1 double knockdown bypasses the KRAS dependence of KRAS-addicted cancer cells. Thus, suppression of TET1-dependent DNA demethylation is critical for KRAS-mediated transformation. PMID:25466250

  4. Specific amplification by PCR of rearranged genomic variable regions of immunoglobulin genes from mouse hybridoma cells.

    PubMed

    Berdoz, J; Monath, T P; Kraehenbuhl, J P

    1995-04-01

    We have designed a novel strategy for the isolation of the rearranged genomic fragments encoding the L-VH-D-JH and L-V kappa/lambda-J kappa/lambda regions of mouse immunoglobulin genes. This strategy is based on the PCR amplification of genomic DNA from mouse hybridomas using multiple specific primers chosen in the 5'-untranslated region and in the intron downstream of the rearranged JH/J kappa/lambda sequences. Variable regions with intact coding sequences, including full-length leader peptides (L) can be obtained without previous DNA sequencing. Our strategy is based on a genomic template that produces fragments that do not need to be adapted for recombinant antibody expression, thus facilitating the generation of chimeric and isotype-switched immunoglobulins.

  5. Cell type-specific targeted mutations of Kras and Pten document proliferation arrest in granulosa cells versus oncogenic insult to ovarian surface epithelial cells.

    PubMed

    Fan, Heng-Yu; Liu, Zhilin; Paquet, Marilene; Wang, Jinrong; Lydon, John P; DeMayo, Francesco J; Richards, JoAnne S

    2009-08-15

    The small G-protein KRAS is crucial for mediating gonadotropin-induced events associated with ovulation. However, constitutive expression of KrasG12D in granulosa cells disrupted normal follicle development leading to the persistence of abnormal follicle-like structures containing nonmitotic cells. To determine what factors mediate this potent effect of KrasG12D, gene profiling analyses were done. We also analyzed KrasG12D;Cyp19-Cre and KrasG12;Pgr-Cre mutant mouse models that express Cre prior to or after the initiation of granulosa cell differentiation, respectively. KrasG12D induced cell cycle arrest in granulosa cells of the KrasG12D;Cyp19-Cre mice but not in the KrasG12D;Pgr-Cre mice, documenting the cell context-specific effect of KrasG12D. Expression of KrasG12D silenced the Kras gene, reduced cell cycle activator genes, and impaired the expression of granulosa cell and oocyte-specific genes. Conversely, levels of PTEN and phosphorylated p38 mitogen-activated protein kinase (MAPK) increased markedly in the mutant granulosa cells. Because disrupting Pten in granulosa cells leads to increased proliferation and survival, Pten was disrupted in the KrasG12D mutant mice. The Pten/Kras mutant mice were infertile but lacked granulosa cell tumors. By contrast, the Ptenfl/fl;KrasG12D;Amhr2-Cre mice developed aggressive ovarian surface epithelial cell tumors that did not occur in the Ptenfl/fl;KrasG12D;Cyp19-Cre or Ptenfl/fl;KrasG12D;Pgr-Cre mouse strains. These data document unequivocally that Amhr2-Cre is expressed in and mediates allelic recombination of oncogenic genes in ovarian surface epithelial cells. That KrasG12D/Pten mutant granulosa cells do not transform but rather undergo cell cycle arrest indicates that they resist the oncogenic insults of Kras/Pten by robust self-protecting mechanisms that silence the Kras gene and elevate PTEN and phosphorylated p38 MAPK.

  6. PCR-sequencing is a complementary method to amplification refractory mutation system for EGFR gene mutation analysis in FFPE samples.

    PubMed

    Jiang, Junchang; Wang, Chunhua; Yu, Xiaoli; Sheng, Danli; Zuo, Chen; Ren, Minpu; Wu, Yaqin; Shen, Jie; Jin, Mei; Xu, Songxiao

    2015-12-01

    Amplification Refractory Mutation System (ARMS) is the most popular technology for EGFR gene mutation analysis in China. Cutoff Ct or ΔCt values were used to differentiate low mutation abundance cases from no mutation cases. In this study, all of 359 NSCLC samples were tested by ARMS. Seventeen samples with larger Ct or ΔCt than cutoff values were retested by PCR-sequencing. TKI treatment responses were monitored on the cases with ARMS negative and PCR-sequencing positive results. One exon 18 G719X case, 67 exon 19 deletion cases, 2 exon 20 insertion cases, 1 exon 20 T790M case, 60 exon 21 L858R cases, 5 exon 21 L861Q cases and 201 wild type cases were identified by ARMS. Another 22 cases were evaluated as wild type but had later amplification fluorescent curves. Seventeen out of these 22 cases were retested by PCR-sequencing. It turns out that 3 out of 3 cases with exon 19 deletion later amplifications, 2 out of 2 cases with L858R later amplifications and 4 out of 12 cases with T790M later amplifications were identified as mutation positive. Two cases with exon 19 deletion and L858R respectively were treated by TKI and got responses. Our study indicated that PCR-sequencing might be a complementary way to confirm ARMS results with later amplifications.

  7. PCR-sequencing is a complementary method to amplification refractory mutation system for EGFR gene mutation analysis in FFPE samples.

    PubMed

    Jiang, Junchang; Wang, Chunhua; Yu, Xiaoli; Sheng, Danli; Zuo, Chen; Ren, Minpu; Wu, Yaqin; Shen, Jie; Jin, Mei; Xu, Songxiao

    2015-12-01

    Amplification Refractory Mutation System (ARMS) is the most popular technology for EGFR gene mutation analysis in China. Cutoff Ct or ΔCt values were used to differentiate low mutation abundance cases from no mutation cases. In this study, all of 359 NSCLC samples were tested by ARMS. Seventeen samples with larger Ct or ΔCt than cutoff values were retested by PCR-sequencing. TKI treatment responses were monitored on the cases with ARMS negative and PCR-sequencing positive results. One exon 18 G719X case, 67 exon 19 deletion cases, 2 exon 20 insertion cases, 1 exon 20 T790M case, 60 exon 21 L858R cases, 5 exon 21 L861Q cases and 201 wild type cases were identified by ARMS. Another 22 cases were evaluated as wild type but had later amplification fluorescent curves. Seventeen out of these 22 cases were retested by PCR-sequencing. It turns out that 3 out of 3 cases with exon 19 deletion later amplifications, 2 out of 2 cases with L858R later amplifications and 4 out of 12 cases with T790M later amplifications were identified as mutation positive. Two cases with exon 19 deletion and L858R respectively were treated by TKI and got responses. Our study indicated that PCR-sequencing might be a complementary way to confirm ARMS results with later amplifications. PMID:26477713

  8. Lack of correlation between BRCA1 carrier status and HER-2/neu (ERBB2) gene amplification in breast cancer

    SciTech Connect

    Sanford, J.S.; Giraldez, R.A.; Flom, K.

    1994-09-01

    We examined 4{mu}m paraffin-embedded tissue sections from twenty female breast tumors for the presence of HER-2/neu (ERBB2) gene amplification. The study population consisted of ten BRCA1 carriers and ten non-BRCA1 carriers. Carrier status was assessed through linkage analysis. Detection of HER-2/neu gene amplification was performed blinded with respect to BRCA1 status. Forty cells representing at least two different areas of each tumor were analyzed by fluorescence in situ hybridization (FISH) using a HER-2/neu cosmid probe. We did not find any cases which showed the typical HER-2/neu gene amplification profile (homogeneous distribution of cells with > 4 signals per cell). In half of the cases, small foci that appeared amplified were identified as clusters of cells with > 4 signals. Modifying our analysis to compensate for this, cases were considered to be amplified if nine or more cells out of forty contained over four HER-2/neu signals. For the 10 BRCA1 carrier positive samples, 5 were HER-2/neu amplified and 5 were not. Similarly, of the 10 BRCA1 carrier negative samples, 5 were HER-2/neu amplified and 5 were not. Therefore, we found no statistical correlation between BRCA1 carrier status and amplification of the HER-2/neu gene in the tumors studied.

  9. Antifreeze protein gene amplification facilitated niche exploitation and speciation in wolffish.

    PubMed

    Desjardins, Mariève; Graham, Laurie A; Davies, Peter L; Fletcher, Garth L

    2012-06-01

    During winter, the coastal waters of Newfoundland can be considered a 'freeze risk ecozone' for teleost fishes, where the shallower habitats pose a high (and the deeper habitats a low) risk of freezing. Atlantic (Anarhichas lupus) and spotted (Anarhichas minor) wolffish, which inhabit these waters, reside at opposite ends of this ecozone, with the Atlantic wolffish being the species facing the greatest risk, because of its shallower niche. In order to resist freezing, this species secretes five times the level of antifreeze protein (AFP) activity into the plasma than does the spotted wolffish. The main basis for this interspecific difference in AFP levels is gene dosage, as the Atlantic wolffish has approximately three times as many AFP gene copies as the spotted wolffish. In addition, AFP transcript levels in liver (the primary source of circulating AFPs) are several times higher in the Atlantic wolffish. One explanation for the difference in gene dosage and transcript levels is the presence of tandemly arrayed repeats in the latter, which make up two-thirds of its AFP gene pool. Such repeats are not present in the spotted wolffish. The available evidence indicates that the two species diverged from a common ancestor at a time when the ebb and flow of northern glaciations would have resulted in the emergence of shallow water 'freeze risk ecozones'. The results of this study suggest that the duplication/amplification of AFP genes in a subpopulation of ancestral wolffish would have facilitated the exploitation of this high-risk habitat, resulting in the divergence and evolution of modern-day Atlantic and spotted wolffish species. PMID:22520964

  10. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    PubMed Central

    Wong, Lee-Jun C; Dai, Pu; Lu, Jyh-Feng; Lou, Mary Ann; Clarke, Robert; Nazarov, Viktor

    2006-01-01

    Background The poly Q polymorphism in AIB1 (amplified in breast cancer) gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds) of AIB1 gene were found in 2 out of 9 (22%) ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330). The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1) and resistance to 4-hydroxy tamoxifen (4-OH TAM) (LCC2 and R27), ICI 182,780 (LCC9) or 4-OH TAM, KEO and LY 117018 (LY-2), AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (<20%) extra poly Q encoding sequence patterns that were derived from the original allele, presumably due to somatic instability. Although all MCF-7 cells and their variants had the same predominant poly Q encoding sequence pattern of (CAG)3CAA(CAG)9(CAACAG)3(CAACAGCAG)2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is

  11. The Mutant KRAS Gene Up-regulates BCL-XL Protein via STAT3 to Confer Apoptosis Resistance That Is Reversed by BIM Protein Induction and BCL-XL Antagonism.

    PubMed

    Zaanan, Aziz; Okamoto, Koichi; Kawakami, Hisato; Khazaie, Khashayarsha; Huang, Shengbing; Sinicrope, Frank A

    2015-09-25

    In colorectal cancers with oncogenic GTPase Kras (KRAS) mutations, inhibition of downstream MEK/ERK signaling has shown limited efficacy, in part because of failure to induce a robust apoptotic response. We studied the mechanism of apoptosis resistance in mutant KRAS cells and sought to enhance the efficacy of a KRAS-specific MEK/ERK inhibitor, GDC-0623. GDC-0623 was shown to potently up-regulate BIM expression to a greater extent versus other MEK inhibitors in isogenic KRAS HCT116 and mutant KRAS SW620 colon cancer cells. ERK silencing enhanced BIM up-regulation by GDC-0623 that was due to its loss of phosphorylation at Ser(69), confirmed by a BIM-EL phosphorylation-defective mutant (S69G) that increased protein stability and blocked BIM induction. Despite BIM and BIK induction, the isogenic KRAS mutant versus wild-type cells remained resistant to GDC-0623-induced apoptosis, in part because of up-regulation of BCL-XL. KRAS knockdown by a doxycycline-inducible shRNA attenuated BCL-XL expression. BCL-XL knockdown sensitized KRAS mutant cells to GDC-0623-mediated apoptosis, as did the BH3 mimetic ABT-263. GDC-0623 plus ABT-263 induced a synergistic apoptosis by a mechanism that includes release of BIM from its sequestration by BCL-XL. Furthermore, mutant KRAS activated p-STAT3 (Tyr(705)) in the absence of IL-6 secretion, and STAT3 knockdown reduced BCL-XL mRNA and protein expression. These data suggest that BCL-XL up-regulation by STAT3 contributes to mutant KRAS-mediated apoptosis resistance. Such resistance can be overcome by potent BIM induction and concurrent BCL-XL antagonism to enable a synergistic apoptotic response.

  12. Association Between Amplification and Expression of C-MYC Gene and Clinicopathological Characteristics of Stomach Cancer

    PubMed Central

    Khaleghian, Malihea; Jahanzad, Issa; Shakoori, Abbas; Emami Razavi, Amirnader; Azimi, Cyrus

    2016-01-01

    Background: The incidence rate of gastric cancer in western countries has shown a remarkable decline in the recent years while it is still the most common cancer among males in Iran. The proto-oncogene MYC, located at 8q24.1, regulates almost 15% of human genes and is activated in 20% of all tumors. The amplification of MYC and overexpression of its protein product are observed in 15 - 30% of gastric neoplasias. Objectives: The objective of this study was to find the preferences of Chromogenic In Situ Hybridization (CISH) and Immunohistochemistry (IHC) in diagnosis and prognosis of gastric cancer. Patients and Methods: We studied 102 samples of gastric cancer in Iran and all the patients had undergone primary surgical resection at the Cancer Institute Hospital, Tehran University of Medical Sciences. The CISH and IHC techniques were applied for all our samples. All of the samples had adenocarcinoma gastric cancer and were selected randomly. Also, the type of study was cross sectional. The sample size was 100 patients. Results: Our data revealed that both diffuse and intestinal types of gastric cancer occurred significantly more in males than females. Our results showed that there was an indication of some correlation between grades and CISH, although the difference was not significant. Our data also showed that CISH positive patients (43%) were more frequent compared to IHC positive patients (14.7%). There was a correlation between CISH and IHC. These results revealed that there was a significant difference between grades and IHC. There was also no statistical difference between CISH amplification in diffuse and intestinal types. Conclusions: From the results, it could be concluded that for administration of the treatment of stomach cancer, and progress and prognosis of tumor, which is important for patients and clinicians, the CISH is a better and more feasible test than IHC, in regards to sensitivity and specificity. PMID:27175302

  13. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    PubMed

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  14. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  15. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  16. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

  17. Amplification of the IMP dehydrogenase gene in Chinese hamster cells resistant to mycophenolic acid.

    PubMed Central

    Collart, F R; Huberman, E

    1987-01-01

    The regulation of IMP dehydrogenase (IMPDH) was analyzed in Chinese hamster V79 cell variants that exhibit different degrees of resistance to the cytotoxic effect of mycophenolic acid, a specific inhibitor of IMPDH. Western blot (immunoblot) analysis with an IMPDH antiserum revealed a 14- to 27-fold increase in the amount of enzyme in the mycophenolic acid-resistant cells. The antiserum was also used to screen for a phage containing the IMPDH cDNA sequence from a lambda gt11 expression library. Northern blot (RNA blot) analyses of total cellular and poly(A)+ RNA showed that an IMPDH cDNA probe hybridized to a 2.2-kilobase transcript, the amount of which was associated with increased resistance. Southern blotting with the probe indicated an amplification of the IMPDH gene in the mycophenolic acid-resistant cells. Our findings suggest that the acquired mycophenolic acid resistance of the V79 cell variants is associated with increases in the amount and activity of IMPDH and the number of IMPDH gene copies. Images PMID:2890098

  18. Short inverted repeats initiate gene amplification through the formation of a large DNA palindrome in mammalian cells.

    PubMed

    Tanaka, Hisashi; Tapscott, Stephen J; Trask, Barbara J; Yao, Meng-Chao

    2002-06-25

    Gene amplification is a common form of genomic instability in a wide variety of organisms and is often associated with tumor progression in mammals. One striking feature of many amplified genes is their organization as large inverted duplications (palindromes). Here, we describe a molecular mechanism for palindrome formation in mammalian cells that is also conserved in protists. We introduced a short (79 or 229 bp) inverted repeat into the genome of Chinese hamster ovary cells and showed that it promoted the formation of a large DNA palindrome after an adjacent DNA double-strand break. This finding suggests that short inverted repeats in the mammalian genome can have a critical role in the initiation of gene amplification. This specific mechanism may provide a novel target for cancer therapies.

  19. Intrachromosomal Amplification, Locus Deletion and Point Mutation in the Aquaglyceroporin AQP1 Gene in Antimony Resistant Leishmania (Viannia) guyanensis

    PubMed Central

    Monte-Neto, Rubens; Laffitte, Marie-Claude N.; Leprohon, Philippe; Reis, Priscila; Frézard, Frédéric; Ouellette, Marc

    2015-01-01

    Background Antimony resistance complicates the treatment of infections caused by the parasite Leishmania. Methodology/Principal Findings Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR) mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1). Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion. Conclusions/Significance This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites. PMID:25679388

  20. Towards in vivo amplification: Overcoming hurdles in the use of hematopoietic stem cells in transplantation and gene therapy

    PubMed Central

    Nagree, Murtaza S; López-Vásquez, Lucía; Medin, Jeffrey A

    2015-01-01

    With the advent of safer and more efficient gene transfer methods, gene therapy has become a viable solution for many inherited and acquired disorders. Hematopoietic stem cells (HSCs) are a prime cell compartment for gene therapy aimed at correcting blood-based disorders, as well as those amenable to metabolic outcomes that can effect cross-correction. While some resounding clinical successes have recently been demonstrated, ample room remains to increase the therapeutic output from HSC-directed gene therapy. In vivo amplification of therapeutic cells is one avenue to achieve enhanced gene product delivery. To date, attempts have been made to provide HSCs with resistance to cytotoxic drugs, to include drug-inducible growth modules specific to HSCs, and to increase the engraftment potential of transduced HSCs. This review aims to summarize amplification strategies that have been developed and tested and to discuss their advantages along with barriers faced towards their clinical adaptation. In addition, next-generation strategies to circumvent current limitations of specific amplification schemas are discussed. PMID:26730268

  1. Clinicopathologic characteristics of EGFR, KRAS, and ALK alterations in 6,595 lung cancers

    PubMed Central

    Lee, Boram; Lee, Taebum; Lee, Se-Hoon; Choi, Yoon-La; Han, Joungho

    2016-01-01

    Background EGFR, KRAS, and ALK alterations are major genetic changes found in non-small cell lung cancers (NSCLCs). Testing advanced lung adenocarcinoma tumors for these three genes is now standard care. The purpose of this study was to investigate the clinicopathologic expression pattern of these three genes in East Asian NSCLC patients. Patients and methods We conducted a retrospective study of all patients tested for mutations of these three genes at a single institute in Korea between 2006 and 2014. Study data were extracted from electronic medical records. Univariate and multivariate logistic regression analyses were used to measure associations between clinicopathologic features and alterations of EGFR, KRAS, and ALK. Results We detected 12 EGFR-mutated tumors with additional mutations in KRAS (N=6, 0.1%) or ALK (N=6, 0.1%). General clinicopathologic characteristics of tumors with EGFR, KRAS, or ALK mutations were similar to previous reports. Patients having EGFR L858R point mutations were older than patients having EGFR exon 19 deletions. EGFR G719X point mutations were more common in men and smokers than exon 19 deletions or L858R point mutations. Tumors having KRAS G12C mutations were less often of mucinous type than those with G12D or G12V, mutations. Conclusions This is the largest three gene molecular epidemiology study in East Asian NSCLC patients. Each genetic alteration was associated with distinct clinicopathologic characteristics. Furthermore, different age and sex are associated with different subtypes of EGFR and KRAS mutations. PMID:26992209

  2. Nitrative and oxidative DNA damage caused by K-ras mutation in mice

    SciTech Connect

    Ohnishi, Shiho; Saito, Hiromitsu; Suzuki, Noboru; Ma, Ning; Hiraku, Yusuke; Murata, Mariko; Kawanishi, Shosuke

    2011-09-23

    Highlights: {yields} Mutated K-ras in transgenic mice caused nitrative DNA damage, 8-nitroguanine. {yields} The mutagenic 8-nitroguanine seemed to be generated by iNOS via Ras-MAPK signal. {yields} Mutated K-ras produces additional mutagenic lesions, as a new oncogenic role. -- Abstract: Ras mutation is important for carcinogenesis. Carcinogenesis consists of multi-step process with mutations in several genes. We investigated the role of DNA damage in carcinogenesis initiated by K-ras mutation, using conditional transgenic mice. Immunohistochemical analysis revealed that mutagenic 8-nitroguanine and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) were apparently formed in adenocarcinoma caused by mutated K-ras. 8-Nitroguanine was co-localized with iNOS, eNOS, NF-{kappa}B, IKK, MAPK, MEK, and mutated K-ras, suggesting that oncogenic K-ras causes additional DNA damage via signaling pathway involving these molecules. It is noteworthy that K-ras mutation mediates not only cell over-proliferation but also the accumulation of mutagenic DNA lesions, leading to carcinogenesis.

  3. DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila.

    PubMed

    Liu, Jun; Zimmer, Kurt; Rusch, Douglas B; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R

    2015-10-15

    Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC.

  4. Detection of sequences homologous to human retroviral DNA in multiple sclerosis by gene amplification

    SciTech Connect

    Greenberg, S.J.; Ehrlich, G.D.; Abbott, M.A.; Hurwitz, B.J.; Waldmann, T.A.; Poiesz, B.J. )

    1989-04-01

    Twenty-one patients with multiple sclerosis, chronic progressive type, were examined for DNA sequences homologous to a human retrovirus. Genomic DNA from peripheral blood mononuclear cells was analyzed for the presence of homologous sequences to the human T-cell leukemia/lymphoma virus type I (HTLV-I) long terminal repeat, 3{prime} gag, pol, and env domains by the enzymatic in vitro gene amplification technique, polymerase chain reaction. Positive identification of homologous pol sequences was made in the amplified DNA from six of these patients (29%). Three of these six patients (14%) also tested positive for the env region, but not for the other regions tested. In contrast, none of the samples from 35 normal individuals studied was positive when amplified and tested with the same primers and probes. Comparison of patterns obtained from controls and from patients with adult T-cell leukemia or tropical spastic paraparesis suggests that the DNA sequences identified are exogenous to the human genome and may correspond to a human retroviral species. The data support the detection of a human retroviral agent in some patients with multiple sclerosis.

  5. Activating HER2 mutations in HER2 gene amplification negative breast cancer

    PubMed Central

    Bose, Ron; Kavuri, Shyam M.; Searleman, Adam C.; Shen, Wei; Shen, Dong; Koboldt, Daniel C.; Monsey, John; Goel, Nicholas; Aronson, Adam B.; Li, Shunqiang; Ma, Cynthia X.; Ding, Li; Mardis, Elaine R.; Ellis, Matthew J.

    2012-01-01

    Data from eight breast cancer genome sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized thirteen HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGFR exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings demonstrate that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. PMID:23220880

  6. BHK cell lines with increased rates of gene amplification are hypersensitive to ultraviolet light

    SciTech Connect

    Giulotto, E.; Bertoni, L.; Attolini, C.; Rainaldi, G.; Anglana, M. )

    1991-04-15

    Four cell lines (MP1, -4, -5, -7), isolated from baby hamster kidney cells after simultaneous selection with N-(phosphonacetyl)-L-aspartate and methotrexate, have previously been shown to amplify their DNA at an increased rate. We now show that all four lines are hypersensitive to killing by UV light and mitomycin C. At high doses of UV light or mitomycin C, the MP lines survived less than 10% or less than 5% as well as parental cells, respectively. After UV irradiation, inhibition of DNA and RNA synthesis was greater in MP than in parental cells, and recovery was slower or absent. A 2- to 3.5-fold increase in the frequency of UV-induced sister chromatid exchange was also seen in the four cell lines. In MP5, unscheduled DNA replication after treatment with UV light was only approximately 70% as great as in parental cells and the other MP lines. In MP4 and MP7 cells S phase was elongated. Although their individual properties confirm that the four cell lines are independent, their common properties suggest a relationship between tolerance of DNA damage and gene amplification.

  7. Complex Oncogenic Translocations with Gene Amplification are Initiated by Specific DNA Breaks in Lymphocytes

    PubMed Central

    Wright, Sarah M.; Woo, Yong H.; Alley, Travis L.; Shirley, Bobbi-Jo; Akeson, Ellen C.; Snow, Kathy J.; Maas, Sarah A.; Elwell, Rachel L.; Foreman, Oded; Mills, Kevin D.

    2009-01-01

    Chromosomal instability is a hallmark of many tumor types. Complex chromosomal rearrangements with associated gene amplification, known as complicons, characterize many hematologic and solid cancers. While chromosomal aberrations, including complicons, are useful diagnostic and prognostic cancer markers, their molecular origins are not known. Although accumulating evidence has implicated DNA double strand break repair in suppression of oncogenic genome instability, the genomic elements required for chromosome rearrangements, especially complex lesions, have not been elucidated. Using a mouse model of B-lineage lymphoma, characterized by complicon formation involving the immunoglobulin heavy chain (Igh) locus and the c-myc oncogene, we have now investigated the requirement for specific genomic segments as donors for complex rearrangements. We now demonstrate that specific DNA double strand breaks, occurring within a narrow segment of Igh are necessary to initiate complicon formation. By contrast, neither specific DNA breaks nor the powerful intronic enhancer Eμ are required for complicon-independent oncogenesis. This study is the first to delineate mechanisms of complex versus simple instability, and the first to identify specific chromosomal elements required for complex chromosomal aberrations. These findings will illuminate genomic cancer susceptibility and risk factors. PMID:19435904

  8. Complex oncogenic translocations with gene amplification are initiated by specific DNA breaks in lymphocytes.

    PubMed

    Wright, Sarah M; Woo, Yong H; Alley, Travis L; Shirley, Bobbi-Jo; Akeson, Ellen C; Snow, Kathy J; Maas, Sarah A; Elwell, Rachel L; Foreman, Oded; Mills, Kevin D

    2009-05-15

    Chromosomal instability is a hallmark of many tumor types. Complex chromosomal rearrangements with associated gene amplification, known as complicons, characterize many hematologic and solid cancers. Whereas chromosomal aberrations, including complicons, are useful diagnostic and prognostic cancer markers, their molecular origins are not known. Although accumulating evidence has implicated DNA double-strand break repair in suppression of oncogenic genome instability, the genomic elements required for chromosome rearrangements, especially complex lesions, have not been elucidated. Using a mouse model of B-lineage lymphoma, characterized by complicon formation involving the immunoglobulin heavy chain (Igh) locus and the c-myc oncogene, we have now investigated the requirement for specific genomic segments as donors for complex rearrangements. We now show that specific DNA double-strand breaks, occurring within a narrow segment of Igh, are necessary to initiate complicon formation. By contrast, neither specific DNA breaks nor the powerful intronic enhancer Emu are required for complicon-independent oncogenesis. This study is the first to delineate mechanisms of complex versus simple instability and the first to identify specific chromosomal elements required for complex chromosomal aberrations. These findings will illuminate genomic cancer susceptibility and risk factors.

  9. An improved amplification and sequencing strategy for phylogenetic studies using the mitochondrial large subunit rRNA gene.

    PubMed

    Parker, A; Kornfield, I

    1996-08-01

    Numerous molecular systematic studies have employed variation in the mitochondrial large subunit (16s) rRNA gene to infer patterns of relationship among species and higher taxa. The primers most commonly employed in 16s rRNA amplification and sequencing bracket an approximately 600 bp portion of this gene. However, most of the informative variation occurs within a 200 bp subset of this segment. We describe a novel primer pair designed to amplify this variable region in a wide range of taxa, allowing broader application and considerable streamlining of data acquisition for studies using this gene.

  10. Rapid Divergence of Prolamin Gene Promoters of Maize After Gene Amplification and Dispersal

    PubMed Central

    Wu, Yongrui; Messing, Joachim

    2012-01-01

    Seeds have evolved to accommodate complicated processes like senescence, dormancy, and germination. Central to these is the storage of carbohydrates and proteins derived from sugars and amino acids synthesized during photosynthesis. In the grasses, the bulk of amino acids is stored in the prolamin superfamily that specifically accumulates in seed endosperm during senescence. Their promoters contain a conserved cis-element, called prolamin-box (P-box), recognized by the trans-activator P-box binding factor (PBF). Because of the lack of null mutants in all grass species, its physiological role in storage–protein gene expression has been elusive. In contrast, a null mutant of another endosperm-specific trans-activator Opaque2 (O2) has been shown to be required for the transcriptional activation of subsets of this superfamily by binding to the O2 box. Here, we used RNAi to knockdown Pbf expression and found that only 27-kDa γ- and 22-kDa α-zein gene expression were affected, whereas the level of other zeins remained unchanged. Still, transgenic seeds had an opaque seed phenotype. Combination of PbfRNAi and o2 resulted in further reduction of α-zein expression. We also tested the interaction of promoters and constitutively expressed PBF and O2. Whereas transgenic promoters could be activated, endogenous promoters appeared to be not accessible to transcriptional activation, presumably due to differential chromatin states. Although analysis of the methylation of binding sites of PBF and O2 correlated with the expression of endogenous 22-kDa α-zein promoters, a different mechanism seems to apply to the 27-kDa γ-zein promoter, which does not undergo methylation changes. PMID:22798485

  11. BRAF, PIK3CA, and HER2 Oncogenic Alterations According to KRAS Mutation Status in Advanced Colorectal Cancers with Distant Metastasis

    PubMed Central

    Koh, Jiwon; Kwak, Yoonjin; Seo, An Na; Park, Kyoung Un; Kim, Duck-Woo; Kang, Sung-Bum; Kim, Woo Ho; Lee, Hye Seung

    2016-01-01

    Background Anti-EGFR antibody–based treatment is an important therapeutic strategy for advanced colorectal cancer (CRC); despite this, several mutations—including KRAS, BRAF, and PIK3CA mutations, and HER2 amplification—are associated with the mechanisms underlying the development of resistance to anti-EGFR therapy. The aim of our study was to investigate the frequencies and clinical implications of these genetic alterations in advanced CRC. Methods KRAS, BRAF, and PIK3CA mutations were determined by Cobas real-time polymerase chain reaction (PCR) in 191 advanced CRC patients with distant metastasis. Microsatellite instability (MSI) status was determined by a fragmentation assay and HER2 amplification was assessed by silver in situ hybridization. In addition, KRAS mutations were investigated by the Sanger sequencing method in 97 of 191 CRC cases. Results Mutations in KRAS, BRAF, and PIK3CA were found in 104 (54.5%), 6 (3.1%), and 25 (13.1%) cases of advanced CRC, respectively. MSI-high status and HER2 amplification were observed in 3 (1.6%) and 16 (8.4%) cases, respectively. PIK3CA mutations were more frequently found in KRAS mutant type (18.3%) than KRAS wild type (6.9%) (P = 0.020). In contrast, HER2 amplifications and BRAF mutations were associated with KRAS wild type with borderline significance (P = 0.052 and 0.094, respectively). In combined analyses with KRAS, BRAF and HER2 status, BRAF mutations or HER2 amplifications were associated with the worst prognosis in the wild type KRAS group (P = 0.004). When comparing the efficacy of detection methods, the results of real time PCR analysis revealed 56 of 97 (57.7%) CRC cases with KRAS mutations, whereas Sanger sequencing revealed 49 cases (50.5%). Conclusions KRAS mutations were found in 54.5% of advanced CRC patients. Our results support that subgrouping using PIK3CA and BRAF mutation or HER2 amplification status, in addition to KRAS mutation status, is helpful for managing advanced CRC patients. PMID

  12. Polymorphisms, Mutations, and Amplification of the EGFR Gene in Non-Small Cell Lung Cancers

    PubMed Central

    Nomura, Masaharu; Shigematsu, Hisayuki; Li, Lin; Suzuki, Makoto; Takahashi, Takao; Estess, Pila; Siegelman, Mark; Feng, Ziding; Kato, Harubumi; Marchetti, Antonio; Shay, Jerry W; Spitz, Margaret R; Wistuba, Ignacio I; Minna, John D; Gazdar, Adi F

    2007-01-01

    Background The epidermal growth factor receptor (EGFR) gene is the prototype member of the type I receptor tyrosine kinase (TK) family and plays a pivotal role in cell proliferation and differentiation. There are three well described polymorphisms that are associated with increased protein production in experimental systems: a polymorphic dinucleotide repeat (CA simple sequence repeat 1 [CA-SSR1]) in intron one (lower number of repeats) and two single nucleotide polymorphisms (SNPs) in the promoter region, −216 (G/T or T/T) and −191 (C/A or A/A). The objective of this study was to examine distributions of these three polymorphisms and their relationships to each other and to EGFR gene mutations and allelic imbalance (AI) in non-small cell lung cancers. Methods and Findings We examined the frequencies of the three polymorphisms of EGFR in 556 resected lung cancers and corresponding non-malignant lung tissues from 336 East Asians, 213 individuals of Northern European descent, and seven of other ethnicities. We also studied the EGFR gene in 93 corresponding non-malignant lung tissue samples from European-descent patients from Italy and in peripheral blood mononuclear cells from 250 normal healthy US individuals enrolled in epidemiological studies including individuals of European descent, African–Americans, and Mexican–Americans. We sequenced the four exons (18–21) of the TK domain known to harbor activating mutations in tumors and examined the status of the CA-SSR1 alleles (presence of heterozygosity, repeat number of the alleles, and relative amplification of one allele) and allele-specific amplification of mutant tumors as determined by a standardized semiautomated method of microsatellite analysis. Variant forms of SNP −216 (G/T or T/T) and SNP −191 (C/A or A/A) (associated with higher protein production in experimental systems) were less frequent in East Asians than in individuals of other ethnicities (p < 0.001). Both alleles of CA-SSR1 were

  13. Distribution of KRAS and BRAF mutations in Moroccan patients with advanced colorectal cancer.

    PubMed

    Marchoudi, N; Amrani Hassani Joutei, H; Jouali, F; Fekkak, J; Rhaissi, H

    2013-12-01

    Targeted therapies have an increasing importance in digestive oncology. To our knowledge, we are the first to report the distribution of KRAS and BRAF mutations in Moroccan patients with advanced colorectal cancer (CRC) in order to introduce targeted therapy in the arsenal of therapeutic modalities for management of this cancer in Morocco. In this study, 92 samples obtained from patients with CRC were tested for the presence of the nine most common mutations in the KRAS gene and BRAF gene. Among the tested patients, 76.09% of patients had wt-KRAS genotype and 23.91% were KRAS mutants and the majority of mutations would result in an amino acid substitution of glycine by aspartic acid (68.2%) The predominant mutations are G>A transitions and G>T transversions. Around 5% (5.43%) of the tested patients bore the V600E mutation in BRAF gene. Only one patient showing to have the V600E mutation in BRAF was also mutated-KRAS. Summing up the results about the KRAS and the BRAF mutation carriers from our study, the portion of potentially non responsive patients for the anti-EGFR treatment is 28.26%.

  14. Quantification of Kras mutant fraction in the lung DNA of mice exposed to aerosolized particulate vanadium pentoxide by inhalation.

    PubMed

    Banda, Malathi; McKim, Karen L; Haber, Lynne T; MacGregor, Judith A; Gollapudi, B Bhaskar; Parsons, Barbara L

    2015-08-01

    This study investigated whether Kras mutation is an early event in the development of lung tumors induced by inhalation of particulate vanadium pentoxide (VP) aerosols. A National Toxicology Program tumor bioassay of inhaled particulate VP aerosols established that VP-induced alveolar/bronchiolar carcinomas of the B6C3F1 mouse lung carried Kras mutations at a higher frequency than observed in spontaneous mouse lung tumors. Therefore, this study sought to: (1) characterize any Kras mutational response with respect to VP exposure concentration, and (2) investigate the possibility that amplification of preexisting Kras mutation is an early event in VP-induced mouse lung tumorigenesis. Male Big Blue B6C3F1 mice (6 mice/group) were exposed to aerosolized particulate VP by inhalation, 6h/day, 5 days/week for 4 or 8 weeks, using VP exposure concentrations of 0, 0.1, and 1 mg/m(3). The levels of two different Kras codon 12 mutations [GGT → GAT (G12D) and GGT → GTT (G12V)] were measured in lung DNAs by Allele-specific Competitive Blocker PCR (ACB-PCR). For both exposure concentrations (0.1 and 1.0mg/m(3)) and both time points (4 and 8 weeks), the mutant fractions observed in VP-exposed mice were not significantly different from the concurrent controls. Given that 8 weeks of inhalation of a tumorigenic concentration of particulate aerosols of VP did not result in a significant change in levels of lung Kras mutation, the data do not support either a direct genotoxic effect of VP on Kras or early amplification of preexisting mutation as being involved in the genesis of VP-induced mouse lung tumors under the exposure conditions used. Rather, the data suggest that accumulation of Kras mutation occurs later with chronic VP exposure and is likely not an early event in VP-induced mouse lung carcinogenesis. PMID:26232258

  15. KRAS mutation testing in clinical practice.

    PubMed

    Perincheri, Sudhir; Hui, Pei

    2015-03-01

    Activating mutation of KRAS plays a significant role in the pathogenesis of common human malignancies and molecular testing of KRAS mutation has emerged as an essential biomarker in the current practice of clinical oncology. The presence of KRAS mutation is generally associated with clinical aggressiveness of the cancer and reduced survival of the patient. Therapeutically, KRAS mutation testing has maximum utility in stratifying metastatic colorectal carcinoma and lung cancer patients for treatment with targeted therapy. Diagnostically, KRAS mutation testing is useful in the workup of pancreaticobiliary and thyroid cancers, particularly using cytological specimens. In the era of precision medicine, the role of KRAS mutation testing is poised to expand, likely in a setting of combinatorial therapeutic strategy and requiring additional mutation testing of its upstream and/or downstream effectors.

  16. Performance of a novel KRAS mutation assay for formalin-fixed paraffin embedded tissues of colorectal cancer.

    PubMed

    Sakai, Kazuko; Yoneshige, Azusa; Ito, Akihiko; Ueda, Yoji; Kondo, Satoshi; Nobumasa, Hitoshi; Fujita, Yoshihiko; Togashi, Yosuke; Terashima, Masato; De Velasco, Marco A; Tomida, Shuta; Nishio, Kazuto

    2015-01-01

    We compared the performance of the 3D-Gene® mutation assay (3D-Gene® KRAS mutation assay kit) with the Scorpion-ARMS (therascreen® KRAS RGQ PCR Kit) and Luminex (MEBGEN™ KRAS kit) assays for the detection of KRAS mutations in formalin-fixed, paraffin-embedded tissue samples from 150 patients diagnosed with colorectal cancer. DNA was extracted from the paraffin-embedded tissue samples with or without macrodissection under hematoxylin and eosin staining and the KRAS mutation status was independently determined using these assays. Discordant results were re-analyzed by Sanger sequencing. Mutation detection analysis was successfully performed in all 150 specimens using the 3D-Gene® mutation assay without an invalid case. The concordance rate between the 3D-Gene® mutation assay and Scorpion-ARMS or Luminex was 98.7% (148/150). KRAS mutations were detected at a frequency of 35.3% (53/150) in colorectal cancer specimens. Three discrepant cases were found between the three assays. Overall, our results demonstrate a high concordance rate of between the 3D-Gene® mutation assay and the two existing in-vitro diagnostics kits. All three assays proved to be validated methods for detecting clinically significant KRAS mutations in paraffin-embedded tissue samples. PMID:25674493

  17. HER-2 gene amplification, serum nucleosomes, CEA and CA15.3 tumor markers in breast cancer patients.

    PubMed

    Zeiwar, M M; Zaki, Seham M; Mohammad, Lamiaa A; Zidan, Amal A; El Nagar, Mona Roshdy

    2007-01-01

    Breast cancer is the most frequently diagnosed cancer in women in the world, for which tumor markers are needed for early detection, clinical prognistication and monitoring. The study was designed to assess the usefulness of HER-2 gene amplification, serum nucleosomes, CEA and CA15.3 tumor markers in the diagnosis of invasive ductal carcinoma and analyze whether their levels correlate with the clinicopathological features. The study was carried out on fifty patients with invasive ductal carcinoma and 25 age matched women with benign breast diseases (BBD). Cancer patients were categorised into three subgroups according to absence (-) or presence (+) of axillary lymph nodes (N) or presence of distant metastasis (M+) into: subgroup I (N-) included 15 patients, subgroup II (N+) included 20 patients and subgroup III (M+) included 15 patients. All individuals were subjected to CBC, fasting blood sugar, liver & kidney function tests, CEA and CA15.3 by electrochemiluminescence, serum nucleosomes by cell death detection ELISA and amplification of HER-2 gene by differential PCR. The HER-2 gene PCR results were + ve in 28% of cancer patients; 20% of subgroup I, 25% of subgroup II and 40% of subgroup III, but in none of the BBD patients. HER-2 gene amplification results showed significant positive correlation with tumor grade. Serum nucleosomes showed significant increase in cancer patients as compared to that of BBD group, significant negative correlation with HER-2 gene amplification and significant positive correlation with CA15.3. Serum nucleosomes was the most sensitive marker (76% versus 32% and 50% for CEA & CA15.3 respectively) but the least specific (72% versus 92% and 96% for CEA & CA15.3 respectively). Elevated CEA and CA15.3 levels were detected in 13.3% and 33.3% respectively in node negative patients, these percentage increased in node positive patients to 20% and 40% and in metastatic patients to 66.7% and 80% respectively. In conclusion, serum nucleosomes is

  18. Fendiline Inhibits K-Ras Plasma Membrane Localization and Blocks K-Ras Signal Transmission

    PubMed Central

    van der Hoeven, Dharini; Cho, Kwang-jin; Ma, Xiaoping; Chigurupati, Sravanthi; Parton, Robert G.

    2013-01-01

    Ras proteins regulate signaling pathways important for cell growth, differentiation, and survival. Oncogenic mutant Ras proteins are commonly expressed in human tumors, with mutations of the K-Ras isoform being most prevalent. To be active, K-Ras must undergo posttranslational processing and associate with the plasma membrane. We therefore devised a high-content screening assay to search for inhibitors of K-Ras plasma membrane association. Using this assay, we identified fendiline, an L-type calcium channel blocker, as a specific inhibitor of K-Ras plasma membrane targeting with no detectable effect on the localization of H- and N-Ras. Other classes of L-type calcium channel blockers did not mislocalize K-Ras, suggesting a mechanism that is unrelated to calcium channel blockade. Fendiline did not inhibit K-Ras posttranslational processing but significantly reduced nanoclustering of K-Ras and redistributed K-Ras from the plasma membrane to the endoplasmic reticulum (ER), Golgi apparatus, endosomes, and cytosol. Fendiline significantly inhibited signaling downstream of constitutively active K-Ras and endogenous K-Ras signaling in cells transformed by oncogenic H-Ras. Consistent with these effects, fendiline blocked the proliferation of pancreatic, colon, lung, and endometrial cancer cell lines expressing oncogenic mutant K-Ras. Taken together, these results suggest that inhibitors of K-Ras plasma membrane localization may have utility as novel K-Ras-specific anticancer therapeutics. PMID:23129805

  19. Selective Targeting of CTNNB1-, KRAS- or MYC-Driven Cell Growth by Combinations of Existing Drugs

    PubMed Central

    Uitdehaag, Joost C. M.; de Roos, Jeroen A. D. M.; van Doornmalen, Antoon M.; Prinsen, Martine B. W.; Spijkers-Hagelstein, Jill A. P.; de Vetter, Judith R. F.; de Man, Jos; Buijsman, Rogier C.; Zaman, Guido J. R.

    2015-01-01

    The aim of combination drug treatment in cancer therapy is to improve response rate and to decrease the probability of the development of drug resistance. Preferably, drug combinations are synergistic rather than additive, and, ideally, drug combinations work synergistically only in cancer cells and not in non-malignant cells. We have developed a workflow to identify such targeted synergies, and applied this approach to selectively inhibit the proliferation of cell lines with mutations in genes that are difficult to modulate with small molecules. The approach is based on curve shift analysis, which we demonstrate is a more robust method of determining synergy than combination matrix screening with Bliss-scoring. We show that the MEK inhibitor trametinib is more synergistic in combination with the BRAF inhibitor dabrafenib than with vemurafenib, another BRAF inhibitor. In addition, we show that the combination of MEK and BRAF inhibitors is synergistic in BRAF-mutant melanoma cells, and additive or antagonistic in, respectively, BRAF-wild type melanoma cells and non-malignant fibroblasts. This combination exemplifies that synergistic action of drugs can depend on cancer genotype. Next, we used curve shift analysis to identify new drug combinations that specifically inhibit cancer cell proliferation driven by difficult-to-drug cancer genes. Combination studies were performed with compounds that as single agents showed preference for inhibition of cancer cells with mutations in either the CTNNB1 gene (coding for β-catenin), KRAS, or cancer cells expressing increased copy numbers of MYC. We demonstrate that the Wnt-pathway inhibitor ICG-001 and trametinib acted synergistically in Wnt-pathway-mutant cell lines. The ERBB2 inhibitor TAK-165 was synergistic with trametinib in KRAS-mutant cell lines. The EGFR/ERBB2 inhibitor neratinib acted synergistically with the spindle poison docetaxel and with the Aurora kinase inhibitor GSK-1070916 in cell lines with MYC amplification

  20. Prognostic role of KRAS mutations in Sardinian patients with colorectal carcinoma

    PubMed Central

    Palomba, Grazia; Cossu, Antonio; Paliogiannis, Panagiotis; Pazzola, Antonio; Baldino, Giovanni; Scartozzi, Mario; Ionta, Maria Teresa; Ortu, Salvatore; Capelli, Francesca; Lanzillo, Annamaria; Sedda, Tito; Sanna, Giovanni; Barca, Michela; Virdis, Luciano; Budroni, Mario; Palmieri, Giuseppe

    2016-01-01

    The presence of mutations in the KRAS gene is a predictor of a poor clinical response to EGFR-targeted agents in patients affected by colorectal cancer (CRC), but its significance as a global prognostic factor remains unclear. The aim of the present study was to evaluate the impact of the KRAS mutational status on time to first metastasis (TTM) and overall survival (OS) in a cohort of Sardinian CRC patients. A total of 551 patients with metastatic CRC at the time of enrolment were included. Clinical and pathological features of the disease, including follow-up information, were obtained from medical records and cancer registry data. For mutational analysis formalin-fixed paraffin-embedded tissue samples were processed using a standard protocol. The coding sequence and splice junctions of exons 2 and 3 of the KRAS gene were screened for mutations by direct automated sequencing. Overall, 186 KRAS mutations were detected in 183/551 (33%) patients: 125 (67%) were located in codon 12, 36 (19%) in codon 13, and 18 (10%) in codon 61. The remaining mutations (7; 4%) were detected in uncommonly-affected codons. No significant correlation between KRAS mutations and gender, age, anatomical location and stage of the disease at the time of diagnosis was identified. Furthermore, no prognostic value of KRAS mutations was found considering either TTM or OS. When patients were stratified by KRAS mutational status and gender, males were significantly associated with a longer TTM. The results of the present study indicate that KRAS mutation correlated with a slower metastatic progression in males with CRC from Sardinia, irrespective of the age at diagnosis and the codon of the mutation. PMID:27446446

  1. Optimized Multiplex Detection of 7 KRAS Mutations by Taqman Allele-Specific qPCR

    PubMed Central

    Orue, Andrea; Rieber, Manuel

    2016-01-01

    Establishing the KRAS mutational status of tumor samples is essential to manage patients with colorectal or lung cancer, since these mutations preclude treatment with monoclonal anti-epidermal growth factor receptor (EGFR) antibodies. We report an inexpensive, rapid multiplex allele-specific qPCR method detecting the 7 most clinically relevant KRAS somatic mutations with concomitant amplification of non-mutated KRAS in tumor cells and tissues from CRC patients. Positive samples evidenced in the multiplex assay were further subjected to individual allele-specific analysis, to define the specific mutation. Reference human cancer DNA harbouring either G12A, G12C, G12D, G12R, G12S, G12V and G13D confirmed assay specificity with ≤1% sensitivity of mutant alleles. KRAS multiplex mutation analysis usefulness was also demonstrated with formalin-fixed paraffin embedded (FFPE) from CRC biopsies. Conclusion. Co-amplification of non-mutated DNA avoided false negatives from degraded samples. Moreover, this cost effective assay is compatible with mutation detection by DNA sequencing in FFPE tissues, but with a greater sensitivity when mutant DNA concentrations are limiting. PMID:27632281

  2. Assessment of epidermal growth factor receptor mutation/copy number and K-ras mutation in esophageal cancer

    PubMed Central

    Guo, Kang; Wang, Wu-Ping; Jiang, Tao; Wang, Ju-Zheng; Chen, Zhao; Li, Yong; Zhou, Yong-An; Li, Xiao-Fei

    2016-01-01

    Background The molecular status of epidermal growth factor receptor (EGFR) in esophageal cancer has not been well elucidated. The purpose of the study was to investigate the prevalence of EGFR and K-ras mutation, and EGFR gene copy number status as well as its association with clinicopathologic characteristics, and also to identify the prognostic value of EGFR gene copy number in esophageal cancer. Methods EGFR mutation in exon 19/exon 21 and K-ras mutation in codon 12/codon 13 were detected by real-time PCR method, while EGFR gene copy number status was analyzed by fluorescent in situ hybridization (FISH). EGFR gene amplification and high polysomy were defined as high EGFR gene copy number status (FISH-positive), and all else were defined as low EGFR gene copy number status (FISH-negative). The relationship between EGFR gene copy number status and clinicpathologic characteristics was analyzed. Kaplan-Meier method and Cox proportional hazards regression model were employed to evaluate the effects of EGFR gene copy number status on the patients’ survival. Results A total of 57 esophageal squamous cell carcinoma (ESCC) patients and 9 esophageal adenocarcinoma (EADC) patients were enrolled in the study. EGFR mutation was identified in one patient who was diagnosed as ESCC with stage IIIC disease. K-ras mutation was identified in one patient who was diagnosed as EADC. In all, 34 of 66 (51.5%) samples were detected as FISH-positive, which includes 30 ESCC and 4 EADC tumor samples. The correlation analysis showed that FISH-positive was significantly associated with the tumor stage (P=0.019) and lymph node metastasis (P=0.005) in esophageal cancer patients, and FISH-positive was also significantly associated with the tumor stage (P=0.007) and lymph node metastasis (P=0.008) in ESCC patients. Cox regression analysis showed that high EGFR gene copy number was not a significant predictor of a poor outcome for esophageal cancer patients (P=0.251) or for ESCC patients (P=0

  3. Construction of cell lines that regulate by temperature the amplification and expression of influenza virus non-structural protein genes.

    PubMed Central

    Portela, A; Melero, J A; de la Luna, S; Ortín, J

    1986-01-01

    Monkey cell lines have been transformed with a mixture of plasmids pSV2neo and pSLVa232N, a derivative of plasmid pSLVa232 (Portela et al., 1985b). Plasmid pSLVa232N contained the influenza virus genes encoding non-structural proteins under the control of the SV40 late promoter in pSLts1 vector that includes the SV40 ori and the tsA209 T-antigen gene. At restrictive temperature, plasmid sequences remained stably integrated in the cell genome, but upon temperature shift-down, defined circular DNA molecules were generated and amplified up to 2000-5000 copies/cell. Restriction analysis, Southern blot hybridization and partial sequencing indicate that one such episome, pC5, was derived from the integrated plasmid sequences by a homologous recombination event that led to deletion of the pBR322 sequences included in pSLVa232N. Concomitant with gene amplification, an induction of 20-65-fold in the expression of NS1 and NS2 proteins was observed after temperature shift-down. Thus, gene cloning into vector pSLts1 and transformation at restrictive temperature of cells permissive for SV40 DNA replication, appears to be a useful strategy for the controlled amplification and expression of cloned genes. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3023072

  4. EPSPS Gene Amplification in Glyphosate-Resistant Italian Ryegrass (Lolium perenne ssp. multiflorum) Populations from Arkansas (United States).

    PubMed

    Salas, Reiofeli A; Scott, Robert C; Dayan, Franck E; Burgos, Nilda R

    2015-07-01

    Glyphosate-resistant Italian ryegrass was detected in Arkansas (United States) in 2007. In 2014, 45 populations were confirmed resistant in eight counties across the state. The level of resistance and resistance mechanisms in six populations were studied to assess the severity of the problem and identify alternative management approaches. Dose-response bioassays, glyphosate absorption and translocation experiments, herbicide target (EPSPS) gene sequence analysis, and gene amplification assays were conducted. The dose causing 50% growth reduction (GR50) was 7-19 times higher for the resistant population than for the susceptible standard. Uptake and translocation of (14)C-glyphosate were similar in resistant and susceptible plants, and no mutation in the EPSPS gene known to be associated with resistance to glyphosate was detected. Resistant plants contained from 11- to >100-fold more copies of the EPSPS gene than the susceptible plants, whereas the susceptible plants had only one copy of EPSPS. Plants surviving the recommended dose of glyphosate contained at least 10 copies. The EPSPS copy number was positively related to glyphosate resistance level (r = 80). Therefore, resistance to glyphosate in these populations is due to multiplication of the target site. Resistance mechanisms could be location-specific. Suppressing the mechanism for gene amplification may overcome resistance.

  5. Use of aiiA gene amplification for AHL-lactonase production from endophytic bacterium Enterobacter species.

    PubMed

    Rajesh, P S; Rai, V Ravishankar

    2015-01-01

    AHL-lactonase has gained renewed interest due to biotechnological applications such as antiquorum sensing, antibiofilm strategies, biofouling, etc. In our study, the production of AHL-lactonase from endophytic bacteria Enterobacter aerogenes VT66 was optimized by response surface methodology (RSM) using central composite design (CCD) for four different cultural conditions. The relative activity of AHL-lactonase was correlated with amplification of aiiA homologous gene amplification with respect to cultural conditions. Statistical analysis by ANOVA of the quadratic regression model showed that the RSM model constructed is highly significant, as indicated by F-test with a low probability value (p(model) < 0.0001) and high regression coefficient (0.9997) as well as lower coefficient of variation (1.86%) indicate that suitability of variable parameters. The quadratic regression model of AHL-lactonase production in terms of relative activity was built and the optimal cultural conditions for maximum enzyme production were determined as 32.5 °C temperature, pH 7.0, 350 μM of substrate concentration and 33 h of incubation time. The enhanced AHL-lactonase yielded 1.33 fold increases in relative activity and it positively correlated with the amplification of aiiA gene. PMID:25451751

  6. Oncogenic KRAS triggers MAPK-dependent errors in mitosis and MYC-dependent sensitivity to anti-mitotic agents

    PubMed Central

    Perera, David; Venkitaraman, Ashok R.

    2016-01-01

    Oncogenic KRAS induces cell proliferation and transformation, but little is known about its effects on cell division. Functional genetic screens have recently revealed that cancer cell lines expressing oncogenic KRAS are sensitive to interference with mitosis, but neither the mechanism nor the uniformity of anti-mitotic drug sensitivity connected with mutant KRAS expression are yet clear. Here, we report that acute expression of oncogenic KRAS in HeLa cells induces mitotic delay and defects in chromosome segregation through mitogen-activated protein kinase (MAPK) pathway activation and de-regulated expression of several mitosis-related genes. These anomalies are accompanied by increased sensitivity to anti-mitotic agents, a phenotype dependent on the transcription factor MYC and its downstream target anti-apoptotic protein BCL-XL. Unexpectedly, we find no correlation between KRAS mutational status or MYC expression levels and anti-mitotic drug sensitivity when surveying a large database of anti-cancer drug responses. However, we report that the co-existence of KRAS mutations and high MYC expression predicts anti-mitotic drug sensitivity. Our findings reveal a novel function of oncogenic KRAS in regulating accurate mitotic progression and suggest new avenues to therapeutically target KRAS-mutant tumours and stratify patients in ongoing clinical trials of anti-mitotic drugs. PMID:27412232

  7. Oncogenic KRAS triggers MAPK-dependent errors in mitosis and MYC-dependent sensitivity to anti-mitotic agents.

    PubMed

    Perera, David; Venkitaraman, Ashok R

    2016-01-01

    Oncogenic KRAS induces cell proliferation and transformation, but little is known about its effects on cell division. Functional genetic screens have recently revealed that cancer cell lines expressing oncogenic KRAS are sensitive to interference with mitosis, but neither the mechanism nor the uniformity of anti-mitotic drug sensitivity connected with mutant KRAS expression are yet clear. Here, we report that acute expression of oncogenic KRAS in HeLa cells induces mitotic delay and defects in chromosome segregation through mitogen-activated protein kinase (MAPK) pathway activation and de-regulated expression of several mitosis-related genes. These anomalies are accompanied by increased sensitivity to anti-mitotic agents, a phenotype dependent on the transcription factor MYC and its downstream target anti-apoptotic protein BCL-XL. Unexpectedly, we find no correlation between KRAS mutational status or MYC expression levels and anti-mitotic drug sensitivity when surveying a large database of anti-cancer drug responses. However, we report that the co-existence of KRAS mutations and high MYC expression predicts anti-mitotic drug sensitivity. Our findings reveal a novel function of oncogenic KRAS in regulating accurate mitotic progression and suggest new avenues to therapeutically target KRAS-mutant tumours and stratify patients in ongoing clinical trials of anti-mitotic drugs. PMID:27412232

  8. Oncogenic KRAS triggers MAPK-dependent errors in mitosis and MYC-dependent sensitivity to anti-mitotic agents.

    PubMed

    Perera, David; Venkitaraman, Ashok R

    2016-07-14

    Oncogenic KRAS induces cell proliferation and transformation, but little is known about its effects on cell division. Functional genetic screens have recently revealed that cancer cell lines expressing oncogenic KRAS are sensitive to interference with mitosis, but neither the mechanism nor the uniformity of anti-mitotic drug sensitivity connected with mutant KRAS expression are yet clear. Here, we report that acute expression of oncogenic KRAS in HeLa cells induces mitotic delay and defects in chromosome segregation through mitogen-activated protein kinase (MAPK) pathway activation and de-regulated expression of several mitosis-related genes. These anomalies are accompanied by increased sensitivity to anti-mitotic agents, a phenotype dependent on the transcription factor MYC and its downstream target anti-apoptotic protein BCL-XL. Unexpectedly, we find no correlation between KRAS mutational status or MYC expression levels and anti-mitotic drug sensitivity when surveying a large database of anti-cancer drug responses. However, we report that the co-existence of KRAS mutations and high MYC expression predicts anti-mitotic drug sensitivity. Our findings reveal a novel function of oncogenic KRAS in regulating accurate mitotic progression and suggest new avenues to therapeutically target KRAS-mutant tumours and stratify patients in ongoing clinical trials of anti-mitotic drugs.

  9. KRAS mutation leads to decreased expression of regulator of calcineurin 2, resulting in tumor proliferation in colorectal cancer

    PubMed Central

    Niitsu, H; Hinoi, T; Kawaguchi, Y; Sentani, K; Yuge, R; Kitadai, Y; Sotomaru, Y; Adachi, T; Saito, Y; Miguchi, M; Kochi, M; Sada, H; Shimomura, M; Oue, N; Yasui, W; Ohdan, H

    2016-01-01

    KRAS mutations occur in 30–40% of all cases of human colorectal cancer (CRC). However, to date, specific therapeutic agents against KRAS-mutated CRC have not been developed. We previously described the generation of mouse models of colon cancer with and without Kras mutations (CDX2P-G22Cre;Apcflox/flox; LSL-KrasG12D and CDX2P-G22Cre;Apcflox/flox mice, respectively). Here, the two mouse models were compared to identify candidate genes, which may represent novel therapeutic targets or predictive biomarkers. Differentially expressed genes in tumors from the two mouse models were identified using microarray analysis, and their expression was compared by quantitative reverse transcription–PCR (qRT–PCR) and immunohistochemical analyses in mouse tumors and surgical specimens of human CRC, with or without KRAS mutations, respectively. Furthermore, the functions of candidate genes were studied using human CRC cell lines. Microarray analysis of 34 000 transcripts resulted in the identification of 19 candidate genes. qRT–PCR analysis data showed that four of these candidate genes (Clps, Irx5, Bex1 and Rcan2) exhibited decreased expression in the Kras-mutated mouse model. The expression of the regulator of calcineurin 2 (RCAN2) was also observed to be lower in KRAS-mutated human CRC. Moreover, inhibitory function for cancer cell proliferation dependent on calcineurin was indicated with overexpression and short hairpin RNA knockdown of RCAN2 in human CRC cell lines. KRAS mutations in CRC lead to a decrease in RCAN2 expression, resulting in tumor proliferation due to derepression of calcineurin–nuclear factor of activated T cells (NFAT) signaling. Our findings suggest that calcineurin–NFAT signal may represent a novel molecular target for the treatment of KRAS-mutated CRC. PMID:27526107

  10. Profiling of transcripts and proteins modulated by K-ras oncogene in the lung tissues of K-ras transgenic mice by omics approaches.

    PubMed

    Lee, Sojung; Kang, Jungwoo; Cho, Minchul; Seo, Eunhee; Choi, Heesook; Kim, Eunjin; Kim, Junghee; Kim, Heejong; Kang, Gum Yong; Kim, Kwang Pyo; Park, Young-Ho; Yu, Dae-Yeul; Yum, Young Na; Park, Sue-Nie; Yoon, Do-Young

    2009-01-01

    The mutated K-ras gene is involved in approximately 30% of human cancers. In order to search for K-ras oncogene-induced modulators in lung tissues of K-ras transgenic mice, we performed microarray and proteomics (LC/ESI-MS/MS) analysis. Genes (RAB27b RAS family, IL-1RA, IL-33, chemokine ligand 6, epiregulin, EGF-like domain and cathepsin) related to cancer development (Wnt signaling pathway) and inflammation (chemokine/cytokine signaling pathway, Toll receptor signaling) were up-regulated while genes (troponin, tropomodulin 2, endothelial lipase, FGFR4, integrin alpha8 and adenylate cyclase 8) related to the tumor suppression such as p53 pathway, TGF-beta signaling pathway and cadherin signaling pathway were down-regulated by K-ras oncogene. Proteomics approach revealed that up-regulated proteins in lung adenomas of K-ras mice were classified as follows: proteins related to the metabolism/catabolism (increased from 7 to 22% by K-ras gene), proteins related to translation/transcription and nucleotide (from 4 to 6%), proteins related to signal transduction (from 3 to 5%), proteins related to phosphorylation (from 1 to 2%). ATP synthase, Ras oncogene family, cytochrome c oxidase, flavoprotein, TEF 1, adipoprotein A-1 BP, glutathione oxidase, fatty acid BP 4, diaphorase 1, MAPK4 and transgelin were up-regulated by K-ras oncogene. However, integrin alpha1, Ras-interacting protein (Rain), endothelin-converting enzyme-1d and splicing factor 3b were down-regulated. These studies suggest that genes related to cancer development and inflammation were up-regulated while genes related to the tumor suppression were down-regulated by K-ras, resulting in the tumor growth. Putative biomarkers such as cell cycle related genes (Cdc37), cancer cell adhesion (Glycam 1, integrin alpha8, integrin alphaX and Clec4n), signal transduction (Tlr2, IL-33, and Ccbp2), migration (Ccr1, Ccl6, and diaphorase 1 (Cyb5r3) and cancer development (epiregulin) can be useful for diagnosis and as

  11. Profiling of transcripts and proteins modulated by K-ras oncogene in the lung tissues of K-ras transgenic mice by omics approaches.

    PubMed

    Lee, Sojung; Kang, Jungwoo; Cho, Minchul; Seo, Eunhee; Choi, Heesook; Kim, Eunjin; Kim, Junghee; Kim, Heejong; Kang, Gum Yong; Kim, Kwang Pyo; Park, Young-Ho; Yu, Dae-Yeul; Yum, Young Na; Park, Sue-Nie; Yoon, Do-Young

    2009-01-01

    The mutated K-ras gene is involved in approximately 30% of human cancers. In order to search for K-ras oncogene-induced modulators in lung tissues of K-ras transgenic mice, we performed microarray and proteomics (LC/ESI-MS/MS) analysis. Genes (RAB27b RAS family, IL-1RA, IL-33, chemokine ligand 6, epiregulin, EGF-like domain and cathepsin) related to cancer development (Wnt signaling pathway) and inflammation (chemokine/cytokine signaling pathway, Toll receptor signaling) were up-regulated while genes (troponin, tropomodulin 2, endothelial lipase, FGFR4, integrin alpha8 and adenylate cyclase 8) related to the tumor suppression such as p53 pathway, TGF-beta signaling pathway and cadherin signaling pathway were down-regulated by K-ras oncogene. Proteomics approach revealed that up-regulated proteins in lung adenomas of K-ras mice were classified as follows: proteins related to the metabolism/catabolism (increased from 7 to 22% by K-ras gene), proteins related to translation/transcription and nucleotide (from 4 to 6%), proteins related to signal transduction (from 3 to 5%), proteins related to phosphorylation (from 1 to 2%). ATP synthase, Ras oncogene family, cytochrome c oxidase, flavoprotein, TEF 1, adipoprotein A-1 BP, glutathione oxidase, fatty acid BP 4, diaphorase 1, MAPK4 and transgelin were up-regulated by K-ras oncogene. However, integrin alpha1, Ras-interacting protein (Rain), endothelin-converting enzyme-1d and splicing factor 3b were down-regulated. These studies suggest that genes related to cancer development and inflammation were up-regulated while genes related to the tumor suppression were down-regulated by K-ras, resulting in the tumor growth. Putative biomarkers such as cell cycle related genes (Cdc37), cancer cell adhesion (Glycam 1, integrin alpha8, integrin alphaX and Clec4n), signal transduction (Tlr2, IL-33, and Ccbp2), migration (Ccr1, Ccl6, and diaphorase 1 (Cyb5r3) and cancer development (epiregulin) can be useful for diagnosis and as

  12. Optimization of direct whole blood PCR amplification with applications on a static thermostat chip.

    PubMed

    Qu, Bai-Yan; Wu, Zhi-Yong; Tian, Xiao-Xi; Chen, Kun; Fang, Fang

    2007-11-01

    In this paper, direct whole blood PCR amplifications on a static chip thermostat without sample purifications are demonstrated; in these amplifications, problems such as cross-interferences and contaminations could be avoided. The amplification conditions, such as the compositions of reagents and thermal programs, were investigated systematically by a GeneAmp PCR system with a native p53 gene segment (about 543 bp) of human genome and an exterior lambda DNA segment (about 500 bp) as targets. Direct amplifications of p53 and K-ras (about 157 bp) gene segments from 0.5 microL blood samples were successfully demonstrated by a static PCR chip with an indium tin oxide glass substrate. The chip thermostat has a typical size of 25 mm x 25 mm, and a polyethylene tube was used as the PCR vial on the glass surface of the chip. Fuzzy proportional integration-differentiation algorithms were adopted in temperature controls of the chip with an aid of a micro-Pt100 sensor. In the direct PCR with the thermostat chip, the whole process only involves automatic thermal programs. This work demonstrated that a chip PCR for field test without desktop facilities is possible either for a point of care test or for forensic analysis.

  13. Amplification of TLO Mediator Subunit Genes Facilitate Filamentous Growth in Candida Spp.

    PubMed Central

    Liu, Zhongle; Moran, Gary P.; Myers, Lawrence C.

    2016-01-01

    Filamentous growth is a hallmark of C. albicans pathogenicity compared to less-virulent ascomycetes. A multitude of transcription factors regulate filamentous growth in response to specific environmental cues. Our work, however, suggests the evolutionary history of C. albicans that resulted in its filamentous growth plasticity may be tied to a change in the general transcription machinery rather than transcription factors and their specific targets. A key genomic difference between C. albicans and its less-virulent relatives, including its closest relative C. dubliniensis, is the unique expansion of the TLO (TeLOmere-associated) gene family in C. albicans. Individual Tlo proteins are fungal-specific subunits of Mediator, a large multi-subunit eukaryotic transcriptional co-activator complex. This amplification results in a large pool of ‘free,’ non-Mediator associated, Tlo protein present in C. albicans, but not in C. dubliniensis or other ascomycetes with attenuated virulence. We show that engineering a large ‘free’ pool of the C. dubliniensis Tlo2 (CdTlo2) protein in C. dubliniensis, through overexpression, results in a number of filamentation phenotypes typically associated only with C. albicans. The amplitude of these phenotypes is proportional to the amount of overexpressed CdTlo2 protein. Overexpression of other C. dubliniensis and C. albicans Tlo proteins do result in these phenotypes. Tlo proteins and their orthologs contain a Mediator interaction domain, and a potent transcriptional activation domain. Nuclear localization of the CdTlo2 activation domain, facilitated naturally by the Tlo Mediator binding domain or artificially through an appended nuclear localization signal, is sufficient for the CdTlo2 overexpression phenotypes. A C. albicans med3 null mutant causes multiple defects including the inability to localize Tlo proteins to the nucleus and reduced virulence in a murine systemic infection model. Our data supports a model in which the

  14. Lack of evidence for KRAS oncogenic mutations in triple-negative breast cancer

    PubMed Central

    2010-01-01

    Background Mutational analysis of the KRAS gene has recently been established as a complementary in vitro diagnostic tool for the identification of patients with colorectal cancer who will not benefit from anti-epidermal growth factor receptor (EGFR) therapies. Assessment of the mutation status of KRAS might also be of potential relevance in other EGFR-overexpressing tumors, such as those occurring in breast cancer. Although KRAS is mutated in only a minor fraction of breast tumors (5%), about 60% of the basal-like subtype express EGFR and, therefore could be targeted by EGFR inhibitors. We aimed to study the mutation frequency of KRAS in that subtype of breast tumors to provide a molecular basis for the evaluation of anti-EGFR therapies. Methods Total, genomic DNA was obtained from a group of 35 formalin-fixed paraffin-embedded, triple-negative breast tumor samples. Among these, 77.1% (27/35) were defined as basal-like by immunostaining specific for the established surrogate markers cytokeratin (CK) 5/6 and/or EGFR. KRAS mutational status was determined in the purified DNA samples by Real Time (RT)-PCR using primers specific for the detection of wild-type KRAS or the following seven oncogenic somatic mutations: Gly12Ala, Gly12Asp, Gly12Arg, Gly12Cys, Gly12Ser, Gly12Val and Gly13Asp. Results We found no evidence of KRAS oncogenic mutations in all analyzed tumors. Conclusions This study indicates that KRAS mutations are very infrequent in triple-negative breast tumors and that EGFR inhibitors may be of potential benefit in the treatment of basal-like breast tumors, which overexpress EGFR in about 60% of all cases. PMID:20385028

  15. Across the universe of K-RAS mutations in non-small-cell-lung cancer.

    PubMed

    Piva, Sheila; Ganzinelli, Monica; Garassino, Marina Chiara; Caiola, Elisa; Farina, Gabriella; Broggini, Massimo; Marabese, Mirko

    2014-01-01

    RAS family proteins are important signaling molecules that regulate cell growth, survival and differentiation by coupling receptor activation to downstream effector pathways. Three distinct genes encode for the three different proteins H-, K-, and N- RAS. These proteins share high sequence homology, particularly at the N-Terminal domain. Among them, K-RAS is one of the most frequently mutated in human cancer. The majority of the mutations present in K-RAS are at codon 12 (from 80 to 100%) followed by codon 13 and 61. In all cases, aminoacid change leads to a constitutively activated protein. K-RAS mutations have a role in tumor development as well as in tumor progression and resistance. Despite the various studies which have been published, the prognostic and predictive role of K-RAS mutations is still under debate. Keeping in mind that the glycine present at position 12 can be substituted by valine, aspartic acid or cysteine, it could be well understood that each different substitution plays a different role in K-RAS-dependent processes. The present article focuses on the molecular and biological characteristics of K-RAS protein, its role in NSCLC tumor development and progression. We also present an overview of the preclinical models both in vitro and in vivo available to determine the role of K-RAS in tumor progression and response to treatment and on the recent results obtained in this field. Finally, we have considered the impact of KRAS mutations in clinical practice, analyzing the different recent trials that have taken into consideration K-RAS.

  16. Complex intrachromosomal rearrangement in the process of amplification of the L-myc gene in small-cell lung cancer

    SciTech Connect

    Sekido, Yoshitaka; Shimokata, Kaoru; Hibi, Kenji ); Takahashi, Takashi; Ueda, Ryuzo; Hida, Toyoaki; Takahashi, Toshitada ); Maekelae, T.P.; Alitalo, K. )

    1992-04-01

    The L-myc gene was first isolated from a human small-cell lung cancer (SCLC) cell line on the basis of its amplification and sequence similarity to c-myc and N-myc. A new mechanism of L-myc activation which results from the production of rlf-L-myc fusion protein was recently reported. On the basis of our earlier observation of a rearrangement involving amplified L-myc in an SCLC cell line, ACC-LC-49, we decided to investigate this rearrangement in detail along with the structure of L-myc amplification units in five additional SCLC cell lines. We report the identification of a novel genomic region, termed jal, which is distinct from rlf and is juxtaposed to and amplified with L-myc during the process of DNA amplification of the region encompassing L-myc. Long-range analysis using pulse-field gel electrophoresis revealed that the amplified L-myc locus is involved in highly complex intrachromosomal rearrangements with jal and/or rlf. Our results also suggest that the simultaneous presence of rearrangements both in rlf intron 1 and in regions immediately upstream of L-myc may be necessary for the expression of rlf-L-myc chimeric transcripts. 26 refs., 6 figs., 1 tab.

  17. Whole-genome amplification: a useful approach to characterize new genes in unculturable protozoan parasites such as Bonamia exitiosa.

    PubMed

    Prado-Alvarez, Maria; Couraleau, Yann; Chollet, Bruno; Tourbiez, Delphine; Arzul, Isabelle

    2015-10-01

    Bonamia exitiosa is an intracellular parasite (Haplosporidia) that has been associated with mass mortalities in oyster populations in the Southern hemisphere. This parasite was recently detected in the Northern hemisphere including Europe. Some representatives of the Bonamia genus have not been well categorized yet due to the lack of genomic information. In the present work, we have applied Whole-Genome Amplification (WGA) technique in order to characterize the actin gene in the unculturable protozoan B. exitiosa. This is the first protein coding gene described in this species. Molecular analysis revealed that B. exitiosa actin is more similar to Bonamia ostreae actin gene-1. Actin phylogeny placed the Bonamia sp. infected oysters in the same clade where the herein described B. exitiosa actin resolved, offering novel information about the classification of the genus. Our results showed that WGA methodology is a promising and valuable technique to be applied to unculturable protozoans whose genomic material is limited. PMID:26282916

  18. Peripheral-type benzodiazepine receptor (PBR) gene amplification in MDA-MB-231 aggressive breast cancer cells.

    PubMed

    Hardwick, Matthew; Cavalli, Luciane R; Barlow, Keith D; Haddad, Bassem R; Papadopoulos, Vassilios

    2002-11-01

    Recent studies using human breast cancer cell lines, animal models, and human tissue biopsies have suggested a close correlation between the expression of the peripheral-type benzodiazepine receptor (PBR) and the progression of breast cancer. This study investigates the genetic status of the PBR gene in two human breast cancer cell lines: MDA-MB-231 cells, which are an aggressive breast cancer cell line that contains high levels of PBR, and MCF-7 cells, which are a nonaggressive cell line that contains low levels of PBR. Both DNA (Southern) blot and fluorescence in situ hybridization analyses indicate that the PBR gene is amplified in MDA-MB-231 relative to MCF-7 cells. These data suggest that PBR gene amplification may be an important indicator of breast cancer progression.

  19. The PRKD1 promoter is a target of the KRas-NF-κB pathway in pancreatic cancer

    PubMed Central

    Döppler, Heike; Panayiotou, Richard; Reid, Elizabeth M.; Maimo, Willibroad; Bastea, Ligia; Storz, Peter

    2016-01-01

    Increased expression of PRKD1 and its gene product protein kinase D1 (PKD1) are linked to oncogenic signaling in pancreatic ductal adenocarcinoma, but a direct functional relationship to oncogenic KRas has not been established so far. We here describe the PRKD1 gene promoter as a target for oncogenic KRas signaling. We demonstrate that KRas-induced activation of the canonical NF-κB pathway is one mechanism of how PRKD1 expression is increased and identify the binding sites for NF-κB in the PRKD1 promoter. Altogether, these results describe a novel mechanism governing PRKD1 gene expression in PDA and provide a functional link between oncogenic KRas, NF-κB and expression of PRKD1. PMID:27649783

  20. An electrochemical biosensor for double-stranded Wnt7B gene detection based on enzymatic isothermal amplification.

    PubMed

    Li, Junlong; Chen, Zhongping; Xiang, Yu; Zhou, Lili; Wang, Ting; Zhang, Zhang; Sun, Kexin; Yin, Dan; Li, Yi; Xie, Guoming

    2016-12-15

    Wnt7B gene plays an important role in the development and progression of breast cancer, gastric cancer, esophageal cancer and pancreatic cancer. While, the natural state of DNA is double stranded, which makes it difficult to be directly detected. Here, we develop an electrochemical biosensor method for Wnt7B gene detection without the need to denature the target. This method firstly used nicking enzyme for exploiting in the double-stranded DNA (dsDNA). Then, long single-stranded DNA (ssDNA) was generated from the cutting site through polymerase extension reaction. Whereafter, the long ssDNA triggered a hairpin self-assembly recycling reaction, which gave rise to another isothermal amplification reaction. Last, short ssDNA was formed after the this amplification process, which could hybridize with the capture probe immobilized on Au electrode and result in signal variation. This method showed excellent analytical performance for dsDNA, of which the linear range was 2fM to 500pM and the detection limit was 1.6fM (S/N=3). It also showed an good results when applied to the real sample of Wnt7B gene detection. PMID:27326913

  1. Comprehensive characterization of the DNA amplification at 13q34 in human breast cancer reveals TFDP1 and CUL4A as likely candidate target genes

    PubMed Central

    2009-01-01

    Introduction Breast cancer subtypes exhibit different genomic aberration patterns with a tendency for high-level amplifications in distinct chromosomal regions. These genomic aberrations may drive carcinogenesis through the upregulation of proto-oncogenes. We have characterized DNA amplification at the human chromosomal region 13q34 in breast cancer. Methods A set of 414 familial and sporadic breast cancer cases was studied for amplification at region 13q34 by fluorescence in situ hybridization (FISH) analysis on tissue microarrays. Defining the minimal common region of amplification in those cases with amplification at 13q34 was carried out using an array-based comparative genomic hybridization platform. We performed a quantitative real-time - polymerase chain reaction (qRT-PCR) gene expression analysis of 11 candidate genes located within the minimal common region of amplification. Protein expression levels of two of these genes (TFDP1 and CUL4A) were assessed by immunohistochemical assays on the same tissue microarrays used for FISH studies, and correlated with the expression of a panel of 33 antibodies previously analyzed. Results We have found 13q34 amplification in 4.5% of breast cancer samples, but the frequency increased to 8.1% in BRCA1-associated tumors and to 20% in basal-like tumors. Tumors with 13q34 amplification were associated with high grade, estrogen receptor negativity, and expression of EGFR, CCNE, CK5, and P-Cadherin, among other basal cell markers. We have defined a 1.83 megabases minimal common region of genomic amplification and carried out mRNA expression analyses of candidate genes located therein, identifying CUL4A and TFDP1 as the most likely target genes. Moreover, we have confirmed that tumors with 13q34 amplification significantly overexpress CUL4A and TFDP1 proteins. Tumors overexpressing either CUL4A or TFDP1 were associated with tumor proliferation and cell cycle progression markers. Conclusions We conclude that 13q34 amplification

  2. Amplification of the c-erbB-2 (HER-2/neu) gene in gastric cancer cells. Detection by fluorescence in situ hybridization.

    PubMed Central

    Ishikawa, T.; Kobayashi, M.; Mai, M.; Suzuki, T.; Ooi, A.

    1997-01-01

    Amplification of the c-erbB-2 gene was examined in 120 gastric adenocarcinomas by dual-color fluorescence in situ hybridization (FISH) using probes for centromere 17 and the 17q11.2-12. The results were compared with Southern blot analysis and immunohistochemistry of c-erbB-2 overexpression. FISH was successful in 105 tumors, and the amplification was found in 19 tumors. FISH on 17 tumors revealed high-level amplification; in 15, the predominant cancer populations had amplified c-erbB-2 gene with the signals forming one or two clusters, indicating that the amplified gene was present in homogeneously staining regions. In two tumors, most cancer cells had multiple scattered c-erbB-2 signals, indicating that the amplicon was within double-minute chromosomes. The other two tumors had a few additional copies of the c-erbB-2 gene. Seventeen tumors had increased numbers of the gene probably due to polysomy 17, and sixty-nine tumors had no aberrations of chromosome 17. Immunohistochemically, distinct membrane staining was found only in the 17 tumors with the high-level amplification. It is concluded that, in gastric adenocarcinomas, high-level amplification produces the c-erbB-2 gene principally in homogeneously staining region form and occasionally in double-minute form and is thought to control the over-expression of the protein in the cytoplasmic membrane. Images Figure 1 Figure 2 Figure 3 PMID:9284825

  3. MicroRNA-224 is associated with colorectal cancer progression and response to 5-fluorouracil-based chemotherapy by KRAS-dependent and -independent mechanisms

    PubMed Central

    Amankwatia, E B; Chakravarty, P; Carey, F A; Weidlich, S; Steele, R J C; Munro, A J; Wolf, C R; Smith, G

    2015-01-01

    Background: Colorectal cancers arise from benign adenomas, although not all adenomas progress to cancer and there are marked interpatient differences in disease progression. We have previously associated KRAS mutations with disease progression and reduced survival in colorectal cancer patients. Methods: We used TaqMan low-density array (TLDA) qRT–PCR analysis to identify miRNAs differentially expressed in normal colorectal mucosa, adenomas and cancers and in isogeneic KRAS WT and mutant HCT116 cells, and used a variety of phenotypic assays to assess the influence of miRNA expression on KRAS activity, chemosensitivity, proliferation and invasion. Results: MicroRNA-224 was differentially expressed in dysplastic colorectal disease and in isogeneic KRAS WT and mutant HCT116 cells. Antagomir-mediated miR-224 silencing in HCT116 KRAS WT cells phenocopied KRAS mutation, increased KRAS activity and ERK and AKT phosphorylation. 5-FU chemosensitivity was significantly increased in miR-224 knockdown cells, and in NIH3T3 cells expressing KRAS and BRAF mutant proteins. Bioinformatics analysis of predicted miR-224 target genes predicted altered cell proliferation, invasion and epithelial–mesenchymal transition (EMT) phenotypes that were experimentally confirmed in miR-224 knockdown cells. Conclusions: We describe a novel mechanism of KRAS regulation, and highlight the clinical utility of colorectal cancer-specific miRNAs as disease progression or clinical response biomarkers. PMID:25919696

  4. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients

    PubMed Central

    Seekhuntod, Sirirat; Thavarungkul, Paninee; Chaichanawongsaroj, Nuntaree

    2016-01-01

    Background Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR) inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC). The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR) assay to detect KRAS mutations. Methods We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D). We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE) colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay. Results Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%), G12D (25.83%) and G12V (12.50%) in codon 12. Conclusion The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues. PMID:26812617

  5. Gene amplification and microsatellite instability induced in tumorigenic human bronchial epithelial cells by alpha particles and heavy ions

    NASA Technical Reports Server (NTRS)

    Piao, C. Q.; Hei, T. K.; Hall, E. J. (Principal Investigator)

    2001-01-01

    Gene amplification and microsatellite alteration are useful markers of genomic instability in tumor and transformed cell lines. It has been suggested that genomic instability contributes to the progression of tumorigenesis by accumulating genetic changes. In this study, amplification of the carbamyl-P-synthetase, aspartate transcarbamylase, dihydro-orotase (CAD) gene in transformed and tumorigenic human bronchial epithelial (BEP2D) cells induced by either alpha particles or (56)Fe ions was assessed by measuring resistance to N-(phosphonacetyl)-l-aspartate (PALA). In addition, alterations of microsatellite loci located on chromosomes 3p and 18q were analyzed in a series of primary and secondary tumor cell lines generated in nude mice. The frequency of PALA-resistant colonies was 1-3 x 10(-3) in tumor cell lines, 5-8 x 10(-5) in transformed cells prior to inoculation into nude mice, and less than 10(-7) in control BEP2D cells. Microsatellite alterations were detected in all 11 tumor cell lines examined at the following loci: D18S34, D18S363, D18S877, D3S1038 and D3S1607. No significant difference in either PALA resistance or microsatellite instability was found in tumor cell lines that were induced by alpha particles compared to those induced by (56)Fe ions.

  6. Rapid and Sensitive Detection of Listeria ivanovii by Loop-Mediated Isothermal Amplification of the smcL Gene

    PubMed Central

    Wang, Yi; Wang, Yan; Xu, Huaqing; Dai, Hang; Meng, Shuang; Ye, Changyun

    2014-01-01

    A loop-mediated isothermal amplification (LAMP) assay for rapid and sensitive detection of the L. ivanovii strains had been developed and evaluated in this study. Oligonucleotide primers specific for L. ivanovii species were designed corresponding to smcL gene sequences. The primers set comprise six primers targeting eight regions on the species-specific gene smcL. The LAMP assay could be completed within 1 h at 64°C in a water bath. Amplification products were directly observed by the Loopamp Fluorescent Detection Reagent (FD) or detected by agarose gel electrophoresis. Moreover, the LAMP reactions were also detected by real-time measurement of turbidity. The exclusivity of 77 non-L. ivanovii and the inclusivity of 17 L. ivanovii were both 100% in the assay. Sensitivity of the LAMP assay was 250 fg DNA and 16 CFU per reaction for detection of L. ivanovii in pure cultures and simulated human stool. The LAMP assay was 10 and 100-fold more sensitive than quantitative PCR (qPCR) and conventional PCR assays,respectively. When applied to human stool samples spiked with low level (8 CFU/0.5 g) of L. ivanovii strains, the new LAMP assay described here achieved positive detection after 6 hours enrichment. In conclusion, the new LAMP assay in this study can be used as a valuable, rapid and sensitive detection tool for the detection of L. ivanovii in field, medical and veterinary laboratories. PMID:25549337

  7. Amplification-Free Detection of Gene Fusions in Prostate Cancer Urinary Samples Using mRNA-Gold Affinity Interactions.

    PubMed

    Koo, Kevin M; Carrascosa, Laura G; Shiddiky, Muhammad J A; Trau, Matt

    2016-07-01

    A crucial issue in present-day prostate cancer (PCa) detection is the lack of specific biomarkers for accurately distinguishing between benign and malignant cancer forms. This is causing a high degree of overdiagnosis and overtreatment of otherwise clinically insignificant cases. As around half of all malignant PCa cases display a detectable gene fusion mutation between the TMPRSS2 promoter sequence and the ERG coding sequence (TMPRSS2:ERG) in urine, noninvasive screening of TMPRSS2:ERG mRNA in patient urine samples could improve the specificity of current PCa diagnosis. However, current gene fusion detection methodologies are largely dependent on RNA enzymatic amplification, which requires extensive sample manipulation, costly labels for detection, and is prone to bias/artifacts. Herein we introduce the first successful amplification-free electrochemical assay for direct detection of TMPRSS2:ERG mRNA in PCa urinary samples by selectively isolating and adsorbing TMPRSS2:ERG mRNA onto bare gold electrodes without requiring any surface modification. We demonstrated excellent limit-of-detection (10 cells) and specificity using PCa cell line models, and showcased clinical utility by accurately detecting TMPRSS2:ERG in a collection of 17 urinary samples obtained from PCa patients. Furthermore, these results were validated with the current gold standard reverse transcription (RT)-PCR approach with 100% concordance. PMID:27299694

  8. Development of a rapid and specific loop-mediated isothermal amplification detection method that targets Marek's disease virus meq gene.

    PubMed

    Wei, Xiuying; Shi, Xingming; Zhao, Yan; Zhang, Jing; Wang, Mei; Liu, Changjun; Cui, Hongyu; Hu, Shunlei; Quan, Yanming; Chen, Hongyan; Wang, Yunfeng

    2012-08-01

    A rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) method was developed and evaluated for the detection of Marek's disease virus (MDV) by amplification of conserved MDV meq gene sequences. LAMP is an innovative technique that allows the rapid detection of targeted nucleic acid sequences under isothermal conditions without the need for complex instrumentation. In this study, meq gene sequences were amplified successfully from different MDV strains by LAMP within 60min and no cross-reactivity was observed in a panel of related viruses that were associated with diseases of chickens. The detection limit of LAMP was 3.2 copies/million cells compared with 320 copies/million cells required for conventional PCR. Positive detection rates were assessed using either LAMP or PCR by examination of feather follicles that were collected from chickens infected experimentally with either strain J-1 (n=20) or strain Md5 (n=17), In addition to these samples, three isolates that were suspected to have been infected in the clinic were also tested. Results showed that the positive detection rate for LAMP was 95% (38/40), compared with 87.5% (35/40) and 90% (38/40) for strains J-1 and Md5 by PCR, respectively. These results indicated that the LAMP assay was more sensitive, rapid and specific than conventional PCR for the detection of MDV. This easy-to-perform technique will be useful for the detection of MDV and will aid in the establishment of disease control protocols.

  9. Loop-mediated isothermal amplification (LAMP) assay for detection of Theileria sergenti infection targeting the p33 gene.

    PubMed

    Wang, L X; He, L; Fang, R; Song, Q Q; Tu, P; Jenkins, A; Zhou, Y Q; Zhao, J L

    2010-07-15

    Theileria is a widespread, intraerythrocytic tick-borne protozoan parasite. Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification method offering rapid, accurate and cost-effective diagnosis of infectious diseases. In this study, the LAMP method was developed for detecting Theileria sergenti. Four primers were designed from six distinct regions of the target gene, a 33-kDa major piroplasm surface protein (p33) gene in T. sergenti. The specificity assay showed it was specific for T. sergenti whilst the LAMP was able to detect a parasitemia level of 0.000002% which was more sensitive than conventional PCR. 154 field samples from water buffalo and 159 field samples from cattle were analyzed using the LAMP method. About 60.4% (96/159) of cattle samples were positive by LAMP, compared to 30.0% (46/154) of water buffalo samples that were positive. Compared with conventional PCR, the LAMP method exhibited higher detection abilities than conventional PCR. All the results indicated that the LAMP assay is a simple and convenient diagnostic tool for theileriosis.

  10. Cloning of the alpha-adducin gene from the Huntington's disease candidate region of chromosome 4 by exon amplification.

    PubMed

    Taylor, S A; Snell, R G; Buckler, A; Ambrose, C; Duyao, M; Church, D; Lin, C S; Altherr, M; Bates, G P; Groot, N

    1992-11-01

    We have applied the technique of exon amplification to the isolation of genes from the chromosome 4p16.3 Huntington's disease (HD) candidate region. Exons recovered from cosmid Y24 identified cDNA clones corresponding to the alpha-subunit of adducin, a calmodulin-binding protein that is thought to promote assembly of spectrin-actin complexes in the formation of the membrane cytoskeleton, alpha-adducin is widely expressed and, at least in brain, is encoded by alternatively spliced mRNAs. The alpha-adducin gene maps immediately telomeric to D4S95, in a region likely to contain the HD defect, and must be scrutinized to establish whether it is the site of the HD mutation.

  11. Concordance of KRAS/BRAF Mutation Status in Metastatic Colorectal Cancer before and after Anti-EGFR Therapy.

    PubMed

    Gattenlöhner, S; Etschmann, B; Kunzmann, V; Thalheimer, A; Hack, M; Kleber, G; Einsele, H; Germer, C; Müller-Hermelink, H-K

    2009-01-01

    Anti-EGFR targeted therapy is a potent strategy in the treatment of metastatic colorectal cancer (mCRC) but activating mutations in the KRAS gene are associated with poor response to this treatment. Therefore, KRAS mutation analysis is employed in the selection of patients for EGFR-targeted therapy and various studies have shown a high concordance between the mutation status in primary CRC and corresponding metastases. However, although development of therapy related resistance occurs also in the context of novel drugs such as tyrosine kinase-inhibitors the effect of the anti-EGFR treatment on the KRAS/BRAF mutation status itself in recurrent mCRC has not yet been clarified. Therefore, we analyzed 21 mCRCs before/after anti-EGFR therapy and found a pre-/posttherapeutic concordance of the KRAS/BRAF mutation status in 20 of the 21 cases examined. In the one discordant case, further analyses revealed that a tumor mosaicism or multiple primary tumors were present, indicating that anti-EGFR therapy has no influence on KRAS/BRAF mutation status in mCRC. Moreover, as the preselection of patients with a KRAS(wt) genotype for anti-EGFR therapy has become a standard procedure, sample sets such ours might be the basis for future studies addressing the identification of potential anti-EGFR therapy induced genetic alterations apart from KRAS/BRAF mutations.

  12. From amplification to gene in thyroid cancer: A high-resolution mapped bacterial-artificial-chromosome resource for cancer chromosome aberrations guides gene discovery after comparative genome hybridization

    SciTech Connect

    Chen, X.N.; Gonsky, R.; Korenberg, J.R.; Knauf, J.A.; Fagin, J.A.; Chissoe, S.

    1998-08-01

    Chromosome rearrangements associated with neoplasms provide a rich resource for definition of the pathways of tumorigenesis. The power of comparative genome hybridization (CGH) to identify novel genes depends on the existence of suitable markers, which are lacking throughout most of the genome. The authors now report a general approach that translates CGH data into higher-resolution genomic-clone data that are then used to define the genes located in aneuploid regions. They used CGH to study 33 thyroid-tumor DNAs and two tumor-cell-line DNAs. The results revealed amplifications of chromosome band 2p21, with less-intense amplification on 2p13, 19q13.1, and 1p36 and with least-intense amplification on 1p34, 1q42, 5q31, 5q33-34, 9q32-34, and 14q32. To define the 2p21 region amplified, a dense array of 373 FISH-mapped chromosome 2 bacterial artificial chromosomes (BACs) was constructed, and 87 of these were hybridized to a tumor-cell line. Four BACs carried genomic DNA that was amplified in these cells. The maximum amplified region was narrowed to 3--6 Mb by multicolor FISH with the flanking BACs, and the minimum amplicon size was defined by a contig of 420 kb. Sequence analysis of the amplified BAC 1D9 revealed a fragment of the gene, encoding protein kinase C epsilon (PKC{epsilon}), that was then shown to be amplified and rearranged in tumor cells. In summary, CGH combined with a dense mapped resource of BACs and large-scale sequencing has led directly to the definition of PKC{epsilon} as a previously unmapped candidate gene involved in thyroid tumorigenesis.

  13. Mutations of KRAS/NRAS/BRAF predict cetuximab resistance in metastatic colorectal cancer patients

    PubMed Central

    Hsu, Hung-Chih; Thiam, Tan Kien; Lu, Yen-Jung; Yeh, Chien Yuh; Tsai, Wen-Sy; You, Jeng Fu; Hung, Hsin Yuan; Tsai, Chi-Neu; Hsu, An; Chen, Hua-Chien; Chen, Shu-Jen; Yang, Tsai-Sheng

    2016-01-01

    Approximately 45% of metastatic colorectal cancer (mCRC) patients with wild-type KRAS exon 2 are resistant to cetuximab treatment. We set out to identify additional genetic markers that might predict the response to cetuximab treatment. Fifty-three wild-type KRAS exon 2 mCRC patients were treated with cetuximab/irinotecan-based chemotherapy as a first- or third-line therapy. The mutational statuses of 10 EGFR pathway genes were analyzed in primary tumors using next-generation sequencing. BRAF, PIK3CA, KRAS (exons 3 and 4), NRAS, PTEN, and AKT1 mutations were detected in 6, 6, 5, 4, 1, and 1 patient, respectively. Four of the BRAF mutations were non-V600 variants. Four tumors harbored multiple co-existing (complex) mutations. All patients with BRAF mutations or complex mutation patterns were cetuximab non-responders. All patients but one harboring KRAS, NRAS, or BRAF mutations were non-responders. Mutations in any one of these three genes were associated with a poor response rate (7.1%) and reduced survival (PFS = 8.0 months) compared to wild-type patients (74.4% and 11.6 months). Our data suggest that KRAS, NRAS, and BRAF mutations predict response to cetuximab treatment in mCRC patients. PMID:26989027

  14. Mutant K-RAS Promotes Invasion and Metastasis in Pancreatic Cancer Through GTPase Signaling Pathways

    PubMed Central

    Padavano, Julianna; Henkhaus, Rebecca S; Chen, Hwudaurw; Skovan, Bethany A; Cui, Haiyan; Ignatenko, Natalia A

    2015-01-01

    Pancreatic ductal adenocarcinoma is one of the most aggressive malignancies, characterized by the local invasion into surrounding tissues and early metastasis to distant organs. Oncogenic mutations of the K-RAS gene occur in more than 90% of human pancreatic cancers. The goal of this study was to investigate the functional significance and downstream effectors of mutant K-RAS oncogene in the pancreatic cancer invasion and metastasis. We applied the homologous recombination technique to stably disrupt K-RAS oncogene in the human pancreatic cell line MiaPaCa-2, which carries the mutant K-RASG12C oncogene in both alleles. Using in vitro assays, we found that clones with disrupted mutant K-RAS gene exhibited low RAS activity, reduced growth rates, increased sensitivity to the apoptosis inducing agents, and suppressed motility and invasiveness. In vivo assays showed that clones with decreased RAS activity had reduced tumor formation ability in mouse xenograft model and increased survival rates in the mouse orthotopic pancreatic cancer model. We further examined molecular pathways downstream of mutant K-RAS and identified RhoA GTP activating protein 5, caveolin-1, and RAS-like small GTPase A (RalA) as key effector molecules, which control mutant K-RAS-dependent migration and invasion in MiaPaCa-2 cells. Our study provides rational for targeting RhoA and RalA GTPase signaling pathways for inhibition of pancreatic cancer metastasis. PMID:26512205

  15. Gene expression profiling of RNA extracted from FFPE tissues: NuGEN technologies' whole-transcriptome amplification system.

    PubMed

    Turner, Leah; Heath, Joe Don; Kurn, Nurith

    2011-01-01

    Gene expression profiling of RNA isolated from formalin fixed, paraffin-embedded (FFPE) tissue samples has been historically challenging. Yet FFPE samples are sought-after because of the in-depth retrospective records typically associated with them rendering these samples a valuable resource for translational medicine studies. Extensive degradation, chemical modifications, and cross-linking have made it difficult to isolate RNA of sufficient quality required for large-scale gene expression profiling studies. NuGEN Technologies' WT-Ovation™ FFPE System linearly amplifies RNA from FFPE samples through a robust and simple whole-transcriptome approach using as little as 50 ng total RNA isolated from FFPE samples. The amplified material may be labeled with validated kits and/or protocols from NuGEN for analysis on any of the major gene expression microarray platforms, including: Affymetrix, Agilent, and Illumina gene expression arrays. Results compare well with those obtained using RNA from fresh-frozen samples. RNA quality from FFPE samples varies significantly and neither sample age nor sample size analysis via gel electrophoresis or the Agilent Bioanalyzer system accurately predict materials suitable for amplification. Therefore, NuGEN has validated a correlative qPCR-based analytical method for the RNA derived from FFPE samples which effectively predicts array results. The NuGEN approach enables fast and successful analysis of samples previously thought to be too degraded for gene expression analysis.

  16. A prognostic analysis of pediatrics central nervous system small cell tumors: evaluation of EGFR family gene amplification and overexpression

    PubMed Central

    2014-01-01

    Background Central nervous system (CNS) tumors are the most common solid tumors that occur in children, however there were few big-data follow-up analysis published in China. Overexpression of epidermal growth factor receptor (EGFR) family members was reported on glioblastoma (GBM) and medulloblastoma (MB) before. However, the correlation between EGFR family members expression with prognosis of MB, supratentorial primitive neuroectodermal tumor (PNET) and small cell GBM is unclear in Chinese children. Methods A retrospective and survival analysis was performed on children (age ≤ 16 years) diagnosed as CNS primary small cell tumors in the Affiliated Provincial Hospital, Shandong University from 2000 to 2012, including MB (n = 44), PNET (n = 8) and small cell GBM (n = 19). The expression of EGFR, ERBB-2, ERBB-3 and ERBB-4 were detected by immunohistochemistry (IHC). The fluorescence in situ hybridization (FISH) was used to observe the amplification of EGFR and ERBB-2 gene. Results Median survival times of MBs, small GBMs and PNETs were 23 ± 6.7 months, 8 ± 4.7 months and 10 ± 1.4 months. Expression and amplification of ERBB-2, ERBB-3 and ERBB-4 were not observed in all tumor samples. The multiply Cox regression suggested the overexpression and amplification of EGFR were negative prognostic factors for MB. Radiotherapy had the positive function for all pediatric patients. Conclusion Overexpression of EGFR predicts poor outcomes of MBs, small cell GBMs and PNETs, suggesting those three CNS tumor subtypes can be considered as one group for the potential common mechanism. The current individual treatment and big data analysis of pediatric CNS embryonal tumors and GBM continues to be very challenging in China. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/7649640001237474 PMID:24986561

  17. Development of a reliable dual-gene amplification RT-PCR assay for the detection of Turkey Meningoencephalitis virus in Turkey brain tissues.

    PubMed

    Davidson, Irit; Raibstein, Israel; Al-Tori, Amira; Khinich, Yevgeny; Simanov, Michael; Yuval, Chanoch; Perk, Shimon; Lublin, Avishai

    2012-11-01

    The Turkey Meningoencephalitis virus (TMEV) causes neuroparalytic signs, paresis, in-coordination, morbidity and mortality in turkeys. In parallel to the increased worldwide scientific interest in veterinary avian flaviviruses, including the Bagaza, Tembusu and Tembusu-related BYD virus, TMEV-caused disease also reemergence in commercial turkeys during late summer of 2010. While initially TMEV was detected by NS5-gene RT-PCR, subsequently, the env-gene RT-PCR was employed. As lately several inconsistencies were observed between the clinical, serological and molecular detection of the TMEV env gene, this study evaluated whether genetic changes occurred in the recently isolated viruses, and sought to optimize and improve the direct TMEV amplification from brain tissues of affected turkeys. The main findings indicated that no changes occurred during the years in the TMEV genome, but the PCR detection sensitivities of the env and NS5 genes differed. The RT-PCR and RNA purification were optimized for direct amplification from brain tissues without pre-replication of clinical samples in tissue cultures or in embryonated eggs. The amplification sensitivity of the NS5-gene was 10-100 times more than the env-gene when separate. The new dual-gene amplification RT-PCR was similar to that of the NS5 gene, therefore the assay can be considered as a reliable diagnostic assay. Cases where one of the two amplicons would be RT-PCR negative would alert and warn on the virus identity, and possible genetic changes. In addition, the biochemical environment of the dual-gene amplification reaction seemed to contribute in deleting non-specific byproducts that occasionally appeared in the singular RT-PCR assays on RNA purified from brain tissues.

  18. KRAS Testing for Anti-EGFR Therapy in Advanced Colorectal Cancer

    PubMed Central

    2010-01-01

    Executive Summary In February 2010, the Medical Advisory Secretariat (MAS) began work on evidence-based reviews of the literature surrounding three pharmacogenomic tests. This project came about when Cancer Care Ontario (CCO) asked MAS to provide evidence-based analyses on the effectiveness and cost-effectiveness of three oncology pharmacogenomic tests currently in use in Ontario. Evidence-based analyses have been prepared for each of these technologies. These have been completed in conjunction with internal and external stakeholders, including a Provincial Expert Panel on Pharmacogenomics (PEPP). Within the PEPP, subgroup committees were developed for each disease area. For each technology, an economic analysis was also completed by the Toronto Health Economics and Technology Assessment Collaborative (THETA) and is summarized within the reports. The following reports can be publicly accessed at the MAS website at: www.health.gov.on.ca/mas or at www.health.gov.on.ca/english/providers/program/mas/mas_about.html Gene Expression Profiling for Guiding Adjuvant Chemotherapy Decisions in Women with Early Breast Cancer: An Evidence-Based and Economic Analysis Epidermal Growth Factor Receptor Mutation (EGFR) Testing for Prediction of Response to EGFR-Targeting Tyrosine Kinase Inhibitor (TKI) Drugs in Patients with Advanced Non-Small-Cell Lung Cancer: an Evidence-Based and Economic Analysis K-RAS testing in Treatment Decisions for Advanced Colorectal Cancer: an Evidence-Based and Economic Analysis. Objective The objective of this systematic review is to determine the predictive value of KRAS testing in the treatment of metastatic colorectal cancer (mCRC) with two anti-EGFR agents, cetuximab and panitumumab. Economic analyses are also being conducted to evaluate the cost-effectiveness of KRAS testing. Clinical Need: Condition and Target Population Metastatic colorectal cancer (mCRC) is usually defined as stage IV disease according to the American Joint Committee on Cancer

  19. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins

    NASA Astrophysics Data System (ADS)

    Tang, Nicholas C.; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  20. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins.

    PubMed

    Tang, Nicholas C; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  1. Rapid visual detection of phytase gene in genetically modified maize using loop-mediated isothermal amplification method.

    PubMed

    Huang, Xin; Chen, Lili; Xu, Jiangmin; Ji, Hai-Feng; Zhu, Shuifang; Chen, Hongjun

    2014-08-01

    Transgenic maize plant expressing high phytase activity has been reported and approved by Chinese government in 2009. Here, we report a highly specific loop-mediated isothermal amplification (LAMP) method to detect the phytase gene in the GMO maize. The LAMP reaction takes less than 20min and the amplification is visible without gel electrophoresis. The detection sensitivity of the LAMP method is about 30 copies of phytase genomic DNA, which is 33.3 times greater than the conventional PCR method with gel electrophoresis. The quantitative detection results showed that the LAMP method has a good linear correlation between the DNA copy number and the associated Tt values over a large dynamic range of template concentration from 6×10(1) to 6×10(7) copies, with a quantification limit of 60 copies. Therefore, the LAMP method is visual, faster, and more sensitive, and does not need special equipment compared to traditional PCR technique, which is very useful for field tests and fast screening of GMO feeds. PMID:24629956

  2. Rapid visual detection of phytase gene in genetically modified maize using loop-mediated isothermal amplification method.

    PubMed

    Huang, Xin; Chen, Lili; Xu, Jiangmin; Ji, Hai-Feng; Zhu, Shuifang; Chen, Hongjun

    2014-08-01

    Transgenic maize plant expressing high phytase activity has been reported and approved by Chinese government in 2009. Here, we report a highly specific loop-mediated isothermal amplification (LAMP) method to detect the phytase gene in the GMO maize. The LAMP reaction takes less than 20min and the amplification is visible without gel electrophoresis. The detection sensitivity of the LAMP method is about 30 copies of phytase genomic DNA, which is 33.3 times greater than the conventional PCR method with gel electrophoresis. The quantitative detection results showed that the LAMP method has a good linear correlation between the DNA copy number and the associated Tt values over a large dynamic range of template concentration from 6×10(1) to 6×10(7) copies, with a quantification limit of 60 copies. Therefore, the LAMP method is visual, faster, and more sensitive, and does not need special equipment compared to traditional PCR technique, which is very useful for field tests and fast screening of GMO feeds.

  3. Predictive value of EGFR overexpression and gene amplification on icotinib efficacy in patients with advanced esophageal squamous cell carcinoma

    PubMed Central

    Fan, Qingxia; Lu, Ping; Ma, Changwu; Liu, Wei; Liu, Ying; Li, Weiwei; Hu, Shaoxuan; Ling, Yun; Guo, Lei; Ying, Jianming; Huang, Jing

    2016-01-01

    This study aimed to search for a molecular marker for targeted epithelial growth factor receptor (EGFR) inhibitor Icotinib by analyzing protein expression and amplification of EGFR proto-oncogene in esophageal squamous cell carcinoma (ESCC) patients. Immunohistochemistry and fluorescence in situ hybridization (FISH) was used to assess EGFR expression and gene amplification status in 193 patients with ESCC. We also examined the association between EGFR overexpression and the efficacy of a novel EGFR TKI, icotinib, in 62 ESCC patients. Of the 193 patients, 95 (49.2%) patients showed EGFR overexpression (3+), and 47(24.4%) patients harbored EGFR FISH positivity. EGFR overexpression was significantly correlated with clinical stage and lymph node metastasis (p<0.05). In addition, EGFR overexpression was significantly correlated with EGFR FISH positivity (p<0.001). Among the 62 patients who received icotinib, the response rate was 17.6% for patients with high EGFR-expressing tumors, which was markedly higher than the rate (0%) for patients with low to moderate EGFR-expressing tumors (p=0.341). Furthermore, all cases responded to icotinib showed EGFR overexpression. In conclusion, our study suggests that EGFR overexpression might potentially be used in predicting the efficacy in patients treated with Icotinib. These data have implications for both clinical trial design and therapeutic strategies. PMID:27013591

  4. Loop-mediated isothermal amplification (LAMP) assays for detection of Theileria parva infections targeting the PIM and p150 genes.

    PubMed

    Thekisoe, Oriel M M; Rambritch, Natasha E; Nakao, Ryo; Bazie, Raoul S; Mbati, Peter; Namangala, Boniface; Malele, Imna; Skilton, Robert A; Jongejan, Frans; Sugimoto, Chihiro; Kawazu, Shin-Ichiro; Inoue, Noboru

    2010-01-01

    We have developed two loop-mediated isothermal amplification (LAMP) assays for the detection of Theileria parva, the causative agent of East Coast fever (ECF), an economically important cattle disease in eastern, central and southern Africa. These assays target the polymorphic immunodominant molecule (PIM) and p150 LAMP genes. The primer set for each gene target consists of six primers, and each set recognises eight distinct regions on the target gene to give highly specific detection of T. parva. The detection limit of each primer set is 1fg, which is equivalent to one copy of the PIM and p150 T. parva genes. These PIM and p150 LAMP primer sets amplify DNA of T. parva isolates from cattle and buffalo from different countries including Kenya, South Africa, Tanzania, Rwanda, Uganda and Burundi, indicating their ability to detect T. parva from different countries. With the advantages of simplicity, rapidity and cost effectiveness, these LAMP assays are good candidates for molecular epidemiology studies and for monitoring control programs in ECF-endemic, resource poor countries.

  5. Loop-mediated isothermal amplification (LAMP) assays for detection of Theileria parva infections targeting the PIM and p150 genes.

    PubMed

    Thekisoe, Oriel M M; Rambritch, Natasha E; Nakao, Ryo; Bazie, Raoul S; Mbati, Peter; Namangala, Boniface; Malele, Imna; Skilton, Robert A; Jongejan, Frans; Sugimoto, Chihiro; Kawazu, Shin-Ichiro; Inoue, Noboru

    2010-01-01

    We have developed two loop-mediated isothermal amplification (LAMP) assays for the detection of Theileria parva, the causative agent of East Coast fever (ECF), an economically important cattle disease in eastern, central and southern Africa. These assays target the polymorphic immunodominant molecule (PIM) and p150 LAMP genes. The primer set for each gene target consists of six primers, and each set recognises eight distinct regions on the target gene to give highly specific detection of T. parva. The detection limit of each primer set is 1fg, which is equivalent to one copy of the PIM and p150 T. parva genes. These PIM and p150 LAMP primer sets amplify DNA of T. parva isolates from cattle and buffalo from different countries including Kenya, South Africa, Tanzania, Rwanda, Uganda and Burundi, indicating their ability to detect T. parva from different countries. With the advantages of simplicity, rapidity and cost effectiveness, these LAMP assays are good candidates for molecular epidemiology studies and for monitoring control programs in ECF-endemic, resource poor countries. PMID:19654009

  6. Study of gene-specific DNA repair in the comet assay with padlock probes and rolling circle amplification.

    PubMed

    Henriksson, Sara; Shaposhnikov, Sergey; Nilsson, Mats; Collins, Andrew

    2011-04-25

    We used padlock probes to study the rate of gene specific repair of three genes, OGG1 (8-oxoguanine-DNA glycosylase-1), XPD (xeroderma pigmentosum group D), and HPRT (hypoxanthine-guanine phosphoribosyltransferase) in human lymphocytes, in relation to the repair rate of Alu repeats and total genomic DNA. Padlock probes offer highly specific detection of short target sequences by combining detection by ligation and signal amplification. In this approach only genes in sequences containing strand breaks, which become single-stranded in the tail, are available for hybridisation. Thus the total number of signals from the padlock probes per comet gives a direct measure of the amount of damage (strand-breaks) present and allows the repair process to be monitored. This method could provide insights on the organisation of genomic DNA in the comet tail. Alu repeat containing DNA was repaired rapidly in comparison with total genomic DNA, and the studied genes were generally repaired more rapidly than the Alu repeats.

  7. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    PubMed

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings.

  8. Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification

    SciTech Connect

    Kamb, A.; Weir, M.; Rudy, B.; Varmus, H.; Kenyon, C. )

    1989-06-01

    The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this method to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.

  9. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella.

    PubMed

    Rahn, K; De Grandis, S A; Clarke, R C; McEwen, S A; Galán, J E; Ginocchio, C; Curtiss, R; Gyles, C L

    1992-08-01

    Amplification of nucleotide sequences within the invA gene of Salmonella typhimurium was evaluated as a means of detecting Salmonella. A collection of 630 strains of Salmonella comprising over 100 serovars, including the 20 most prevalent serovars isolated from animals and humans in Canada, was examined. Controls consisted of 142 non-Salmonella strains comprising 21 genera of bacteria. Cultures were screened by inoculating a single colony of bacteria directly into a polymerase chain reaction (PCR) mixture which contained a pair of primers specific for the invA gene. The specific PCR product was a 284 bp DNA fragment which was visualized in 2% agarose gels. With the exception of two S. litchfield and two S. senftenberg strains, all Salmonella strains were detected. In contrast, none of the non-Salmonella strains yielded the specific amplification product. Non-specific amplification of a few non-Salmonella strains resulted in a product that was distinctly different in size from the specific 284 bp product. Specificity of amplification was further confirmed by demonstration of hybridization of a 32P-labelled invA gene fragment only to the specific 284 bp product. The detection of 99.4% of Salmonella strains tested and the failure to specifically amplify DNA from non-Salmonella strains confirm that the invA gene contains sequences unique to Salmonella and demonstrate that this gene is a suitable PCR target, with potential diagnostic applications.

  10. EGFR, KRAS, BRAF, and HER-2 molecular status in brain metastases from 77 NSCLC patients

    PubMed Central

    Villalva, Claire; Duranton-Tanneur, Valérie; Guilloteau, Karline; Burel-Vandenbos, Fanny; Wager, Michel; Doyen, Jérôme; Levillain, Pierre Marie; Fontaine, Denys; Blons, Hélène; Pedeutour, Florence; Karayan-Tapon, Lucie

    2013-01-01

    The aim of this study was to determine the frequency of EGFR, KRAS, BRAF, and HER-2 mutations in brain metastases from non-small cell lung carcinomas (BM-NSCLC). A total of 77 samples of BM-NSCLC were included and 19 samples of BM from breast, kidney, and colorectal tumors were also studied as controls. These samples were collected from patients followed between 2008 and 2011 at Poitiers and Nice University Hospitals in France. The frequencies of EGFR, KRAS, BRAF, and HER-2 mutations in BM-NSCLC were 2.6, 38.5, 0, and 0% respectively. The incidence of KRAS mutation was significantly higher in female and younger patients (P < 0.05). No mutations of the four genes were found in BM from breast or kidney. However, among six BM from colorectal tumors, we identified KRAS mutations in three cases and BRAF mutations in two other cases. This study is the largest analysis on genetic alterations in BM-NSCLC performed to date. Our results suggest a low frequency of EGFR mutations in BM-NSCLC whereas KRAS mutations are as frequent in BM-NSCLC as in primitive NSCLC. These results raise the question of the variability of the brain metastatic potential of NSCLC cells in relation to the mutation pattern. PMID:23930206

  11. EVI1 oncogene promotes KRAS pathway through suppression of microRNA-96 in pancreatic carcinogenesis.

    PubMed

    Tanaka, M; Suzuki, H I; Shibahara, J; Kunita, A; Isagawa, T; Yoshimi, A; Kurokawa, M; Miyazono, K; Aburatani, H; Ishikawa, S; Fukayama, M

    2014-05-01

    Despite frequent KRAS mutation, the early molecular mechanisms of pancreatic ductal adenocarcinoma (PDAC) development have not been fully elucidated. By tracking a potential regulator of another feature of PDAC precursors, acquisition of foregut or gastric epithelial gene signature, we herein report that aberrant overexpression of ecotropic viral integration site 1 (EVI1) oncoprotein, which is usually absent in normal pancreatic duct, is a widespread marker across the full spectrum of human PDAC precursors and PDAC. In pancreatic cancer cells, EVI1 depletion caused remarkable inhibition of cell growth and migration, indicating its oncogenic roles. Importantly, we found that EVI1 upregulated KRAS expression through suppression of a potent KRAS suppressor, miR-96, in pancreatic cancer cells. Collectively, the present findings suggest that EVI1 overexpression and KRAS mutation converge on activation of the KRAS pathway in early phases of pancreatic carcinogenesis and propose EVI1 and/or miR-96 as early markers and therapeutic targets in this dismal disease.

  12. Mutational landscape of EGFR-, MYC-, and Kras-driven genetically engineered mouse models of lung adenocarcinoma

    PubMed Central

    McFadden, David G.; Politi, Katerina; Bhutkar, Arjun; Chen, Frances K.; Song, Xiaoling; Pirun, Mono; Santiago, Philip M.; Kim-Kiselak, Caroline; Platt, James T.; Lee, Emily; Hodges, Emily; Rosebrock, Adam P.; Bronson, Roderick T.; Socci, Nicholas D.; Hannon, Gregory J.; Jacks, Tyler; Varmus, Harold

    2016-01-01

    Genetically engineered mouse models (GEMMs) of cancer are increasingly being used to assess putative driver mutations identified by large-scale sequencing of human cancer genomes. To accurately interpret experiments that introduce additional mutations, an understanding of the somatic genetic profile and evolution of GEMM tumors is necessary. Here, we performed whole-exome sequencing of tumors from three GEMMs of lung adenocarcinoma driven by mutant epidermal growth factor receptor (EGFR), mutant Kirsten rat sarcoma viral oncogene homolog (Kras), or overexpression of MYC proto-oncogene. Tumors from EGFR- and Kras-driven models exhibited, respectively, 0.02 and 0.07 nonsynonymous mutations per megabase, a dramatically lower average mutational frequency than observed in human lung adenocarcinomas. Tumors from models driven by strong cancer drivers (mutant EGFR and Kras) harbored few mutations in known cancer genes, whereas tumors driven by MYC, a weaker initiating oncogene in the murine lung, acquired recurrent clonal oncogenic Kras mutations. In addition, although EGFR- and Kras-driven models both exhibited recurrent whole-chromosome DNA copy number alterations, the specific chromosomes altered by gain or loss were different in each model. These data demonstrate that GEMM tumors exhibit relatively simple somatic genotypes compared with human cancers of a similar type, making these autochthonous model systems useful for additive engineering approaches to assess the potential of novel mutations on tumorigenesis, cancer progression, and drug sensitivity. PMID:27702896

  13. Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

    PubMed Central

    Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

    2012-01-01

    KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

  14. Characterization of a novel oncogenic K-ras mutation in colon cancer

    SciTech Connect

    Akagi, Kiwamu . E-mail: akagi@cancer-c.pref.saitama.jp; Uchibori, Ryosuke; Yamaguchi, Kensei; Kurosawa, Keiko; Tanaka, Yoichiro; Kozu, Tomoko

    2007-01-19

    Activating mutations of RAS are frequently observed in subsets of human cancers, indicating that RAS activation is involved in tumorigenesis. Here, we identified and characterized a novel G to T transversion mutation of the K-ras gene at the third position of codon 19 (TTG) which substituted phenylalanine for leucine in 3 primary colon carcinomas. Biological and biochemical activity was examined using transformed NIH3T3 cells expressing mutant or wild-type K-ras. Transformants harboring the K-ras mutation at codon 19 showed proliferative capacity under serum-starved conditions, less contact inhibition, anchorage-independent growth, tumorigenicity in nude mice and elevation of active Ras-GTP levels. These results indicated that this novel mutation possesses high oncogenic activity.

  15. Deregulation of c-myc gene expression in human colon carcinoma is not accompanied by amplification or rearrangement of the gene.

    PubMed Central

    Erisman, M D; Rothberg, P G; Diehl, R E; Morse, C C; Spandorfer, J M; Astrin, S M

    1985-01-01

    The structure and expression of the c-myc oncogene were examined in 29 primary human colon adenocarcinomas. Dot blot hybridization of total RNA showed that 21 tumors (72%) had considerably elevated expression of c-myc (5- to 40-fold) relative to normal colonic mucosa. These data were corroborated by Northern blots of polyadenylated RNA, which showed a 2.3-kilobase transcript. Southern analysis of the c-myc locus in these tumors indicated the absence of amplification or DNA rearrangement in a 35-kilobase region encompassing the gene. In a parallel study, elevated expression of c-myc without amplification or DNA rearrangement was also observed in three of six colon carcinoma cell lines examined; in addition, unlike a normal colon cell line control, these three cell lines exhibited constitutive, high-level expression of the gene during their growth in cultures. These results indicate that elevated expression of the c-myc oncogene occurs frequently in primary human colon carcinomas and that the mechanism involved in the regulation of c-myc expression is altered in tumor-derived cell lines. Images PMID:3837853

  16. A new rapid amplification of cDNA ends method for extremely guanine plus cytosine-rich genes.

    PubMed

    Shi, Xianzong; Jarvis, Donald L

    2006-09-15

    Rapid amplification of cDNA ends (RACE) is widely used to determine the 5'- and 3'-terminal nucleotide sequences of genes. Many different RACE methods have been developed to meet various requirements, but none addresses the difficult problems that arise when trying to isolate the ends of extremely guanine plus cytosine (GC)-rich genes. In this study, we found that we were unable to isolate the correct 5' or 3' end of an insect gene, which appeared to include extremely GC-rich sequences, using current RACE methods. Thus, we developed a new RACE method that can be used for this purpose. This new method entails first-strand cDNA synthesis at 70 degrees C with Thermo-X reverse transcriptase in the presence of homoectoine, followed by a polymerase chain reaction with 98 degrees C denaturation steps and Phusion DNA polymerase in the presence of 1M betaine and 5% dimethyl sulfoxide (DMSO). The use of these conditions yielded 5'- and 3'-RACE products that were approximately 80% GC over 213 and 162bp, respectively, and included shorter internal regions of 82 to 89% GC. PMID:16875657

  17. Oncogenic KRAS sensitizes premalignant, but not malignant cells, to Noxa-dependent apoptosis through the activation of the MEK/ERK pathway

    PubMed Central

    Conti, Annalisa; Majorini, Maria Teresa; Elliott, Richard; Ashworth, Alan; Lord, Christopher J.; Cancelliere, Carlotta; Bardelli, Alberto; Seneci, Pierfausto; Walczak, Henning; Delia, Domenico; Lecis, Daniele

    2015-01-01

    KRAS is mutated in about 20-25% of all human cancers and especially in pancreatic, lung and colorectal tumors. Oncogenic KRAS stimulates several pro-survival pathways, but it also triggers the trans-activation of pro-apoptotic genes. In our work, we show that G13D mutations of KRAS activate the MAPK pathway, and ERK2, but not ERK1, up-regulates Noxa basal levels. Accordingly, premalignant epithelial cells are sensitized to various cytotoxic compounds in a Noxa-dependent manner. In contrast to these findings, colorectal cancer cell sensitivity to treatment is independent of KRAS status and Noxa levels are not up-regulated in the presence of mutated KRAS despite the fact that ERK2 still promotes Noxa expression. We therefore speculated that other survival pathways are counteracting the pro-apoptotic effect of mutated KRAS and found that the inhibition of AKT restores sensitivity to treatment, especially in presence of oncogenic KRAS. In conclusion, our work suggests that the pharmacological inhibition of the pathways triggered by mutated KRAS could also switch off its oncogene-activated pro-apoptotic stimulation. On the contrary, the combination of chemotherapy to inhibitors of specific pro-survival pathways, such as the one controlled by AKT, could enhance treatment efficacy by exploiting the pro-death stimulation derived by oncogene activation. PMID:26028667

  18. Mutations in PI3K/AKT pathway genes and amplifications of PIK3CA are associated with patterns of recurrence in gastric cancers

    PubMed Central

    Fang, Wen-Liang; Huang, Kuo-Hung; Lan, Yuan-Tzu; Lin, Chien-Hsing; Chen, Ming-Huang; Chao, Yee; Lin, Wen-Chang; Lo, Su-Shun; Li, Anna Fen-Yau; Wu, Chew-Wun; Chiou, Shih-Hwa

    2016-01-01

    Mutations in genes involved in the PI3K/AKT pathway and amplifications of the PIK3CA gene in gastric cancer and their associations with clinicopathological characteristics and EBV infection were analyzed in this study. A total of 431 patients with gastric adenocarcinomas were enrolled, and 39 mutation hotspots were evaluated in these patients using MALDI-TOF mass spectrometry were analyzed. PIK3CA amplifications were analyzed using real-time quantitative PCR. Regarding patients with intestinal-type gastric cancer, those with mutations in PI3K/AKT pathway genes were also more likely to have tumors located in the lower-third of the stomach than were those without mutations. Regarding patients with diffuse-type gastric cancer, those with PI3K/AKT pathway mutations were more likely to have tumors located in the upper-third of the stomach and to have more hematogenous metastases, particularly in the liver and lungs, than were patients without such mutations (22.2% vs. 4.5%). No significant survival difference was observed between patients with vs. without PI3K/AKT pathway mutations. Mutations in PI3K/AKT pathway genes were associated with hematogenous metastasis in patients with diffuse-type gastric cancer. Only when the tumors were located in the middle-third of stomach, tumor with mutations of the PIK3CA gene or mutations of the PI3K/AKT pathway genes were associated with more EBV infection than those without mutations. Patients with PIK3CA amplifications were more likely to have diffuse-type and poorly differentiated gastric cancers and were more likely to experience peritoneal recurrence compared with those without PIK3CA amplifications. Even upon subgroup analysis, PI3KCA amplifications were found to not affect the patients’ outcomes. PMID:26701847

  19. KRAS and the Reality of Personalized Medicine in Non-Small Cell Lung Cancer

    PubMed Central

    Kilgoz, Havva O; Bender, Guzide; Scandura, Joseph M; Viale, Agnes; Taneri, Bahar

    2016-01-01

    Lung cancer is the leading cause of mortality among all cancer types worldwide. The latest available global statistics of the World Health Organization report 1.59 million casualities in 2012. Worldwide, 1 in 5 cancer deaths are caused by lung cancer. In 2016, in the United States alone, there are an estimated 224,390 new cases of lung cancer, of which 158,080 are expected to result in death, as reported by the National Cancer Institute. Non-small cell lung cancer (NSCLC), a histological subtype, comprises about 85% of all cases, which is nearly 9 out of 10 lung cancer patients. Efforts are under way to develop and improve targeted therapy strategies. Certain mutations are being clinically targeted, such as those in EGFR and ALK genes. However, one of the most frequently mutated genes in NSCLC is the Kirsten rat sarcoma viral oncogene homolog (KRAS), which is currently not targetable. Approximately 25% of all types of NSCLC tumors contain KRAS mutations, which remain as an undruggable challenge. These mutations are indicative of poor prognosis and show negative response to standard chemotherapy. Furthermore, tumors harboring KRAS mutations are unlikely to respond to currently available targeted treatments such as tyrosine kinase inhibitors. Therefore, there is a definitive, urgent need to generate new targeted therapy approaches for KRAS mutations. Current strategies have major limitations and revolve around targeting molecules upstream and downstream of KRAS. Direct targeting is not available in the clinic. Combination therapies using multiple agents are being sought. Concentrated efforts are needed to accelerate basic research and consecutive clinical trials to achieve effective targeting of KRAS. PMID:27447490

  20. Extended KRAS and NRAS Mutation Profiling by Pyrosequencing®.

    PubMed

    Jung, Andreas

    2015-01-01

    With the advent of targeted therapies-drugs that specifically target molecules of tumor-driving signalling pathways-and the availability of biomarkers that predict the response of an individual patient on such a targeted therapy, the analysis of the status of the biomarker became an integral part of the therapy. For metastatic colorectal cancer, anti-EGFR-targeted antibodies (Cetuximab/Erbitux(®), Panitumumab/Vectibix(®)) fall into this category of drugs as it was shown in several clinical studies that oncogenic mutations in exons 2-4 of the RAS genes KRAS or NRAS result in therapeutic resistance of the metastatic colorectal cancers against the action of both targeted drugs. Therefore, mutations in the RAS genes exclude patients from this kind of targeted therapy (negative biomarker). Thus the molecular-pathological testing of the mutational status of KRAS and NRAS has become an important cornerstone in planning oncological strategies in the treatment of metastatic colorectal cancer. As the profile of mutations in the RAS genes is characterized by hotspot mutations in only a small number of codons (12, 13 in exon 2-59, 61 in exon 3-117, 146 in exon 4). Pyrosequencing(®) is an ideal and robust tool in the molecular-pathological detection. A detailed protocol for this detection procedure employing Pyrosequencing® is given here.

  1. KRAS mutation detection in Tunisian sporadic coloractal cancer patients with direct sequencing, high resolution melting and denaturating high performance liquid chromatography.

    PubMed

    Karim, Bougatef; Florence, Coulet; Kamel, Rouissi; Nadia, Kourda; Ines, Omrane; Raja, Marrakchi; Sarra, Ben Jileni; Florent, Soubrier; Amel, Ben Ammar-Elgaaied

    The Kirsten Rat Sarcoma (KRAS) oncogene has been introduced recently as a genetic biomarker for metastatic sporadic colorectal cancer prior to anti-EGFR treatment. Identifying patients with KRAS mutations that not respond to EGFR targeted therapies require sensitive, rapid and efficacious routine technique. We have attempted to evaluate the efficiency of three conventional methods: direct sequencing, HRM and DHPLC, to detect mutations in codon 12 and 13 of the KRAS exon2 gene. For this first Tunisian study on KRAS, we detected 45.83% of altered KRAS gene among 48 formalin-fixed paraffin-embedded sporadic colorectal adenocarcinoma patients. The use of HRM-sequencing allowed as enlarging the detected KRAS exon 2 mutations (22/48) in comparison with direct sequencing (17/48). DHPLC was used to confirm results when consensus was not observed between HRM and direct sequencing. This study brings an interesting data concerning an inter-method validation between sequencing and HRM in the investigation of sporadic colorectal cancer biomarker. It also shows that KRAS mutations occur at similar frequencies in Tunisian patients as in other populations; and suggests that the same genes are at play in sporadic CRC cancer, despite ethnic, geographical and environmental differences between countries.

  2. Fusion of the Dhfr/Mtx and IR/MAR gene amplification methods produces a rapid and efficient method for stable recombinant protein production.

    PubMed

    Noguchi, Chiemi; Araki, Yoshio; Miki, Daisuke; Shimizu, Noriaki

    2012-01-01

    Amplification of the dihydrofolate reductase gene (Dhfr) by methotrexate (Mtx) exposure is commonly used for recombinant protein expression in Chinese hamster ovary (CHO) cells. However, this method is both time- and labor-intensive, and the high-producing cells that are generated are frequently unstable in culture. Another gene amplification method is based on using a plasmid bearing a mammalian replication initiation region (IR) and a matrix attachment region (MAR), which result in the spontaneous initiation of gene amplification in transfected cells. The IR/MAR and Dhfr/Mtx methods of gene amplification are based on entirely different principles. In this study, we combine these two methods to yield a novel method, termed the IR/MAR-Dhfr fusion method, which was used to express three proteins, the Fc receptor, GFP, and recombinant antibody. The fusion method resulted in a dramatic increase in expression of all three proteins in two CHO sub-lines, DXB-11, and DG44. The IR/MAR-Dhfr fusion amplified the genes rapidly and efficiently, and produced larger amounts of antibody than the Dhfr/Mtx or IR/MAR methods alone. While the amplified structure produced by the Dhfr/Mtx method was highly unstable, and the antibody production rate rapidly decreased with the culture time of the cells, the IR/MAR-Dhfr fusion method resulted in stable amplification and generated clonal cells that produced large amounts of antibody protein over a long period of time. In summary, the novel IR/MAR-Dhfr fusion method enables isolation of stable cells that produce larger amounts of a target recombinant protein more rapidly and easily than either the Dhfr/Mtx or IR/MAR methods alone.

  3. Fusion of the Dhfr/Mtx and IR/MAR Gene Amplification Methods Produces a Rapid and Efficient Method for Stable Recombinant Protein Production

    PubMed Central

    Miki, Daisuke; Shimizu, Noriaki

    2012-01-01

    Amplification of the dihydrofolate reductase gene (Dhfr) by methotrexate (Mtx) exposure is commonly used for recombinant protein expression in Chinese hamster ovary (CHO) cells. However, this method is both time- and labor-intensive, and the high-producing cells that are generated are frequently unstable in culture. Another gene amplification method is based on using a plasmid bearing a mammalian replication initiation region (IR) and a matrix attachment region (MAR), which result in the spontaneous initiation of gene amplification in transfected cells. The IR/MAR and Dhfr/Mtx methods of gene amplification are based on entirely different principles. In this study, we combine these two methods to yield a novel method, termed the IR/MAR-Dhfr fusion method, which was used to express three proteins, the Fc receptor, GFP, and recombinant antibody. The fusion method resulted in a dramatic increase in expression of all three proteins in two CHO sub-lines, DXB-11, and DG44. The IR/MAR-Dhfr fusion amplified the genes rapidly and efficiently, and produced larger amounts of antibody than the Dhfr/Mtx or IR/MAR methods alone. While the amplified structure produced by the Dhfr/Mtx method was highly unstable, and the antibody production rate rapidly decreased with the culture time of the cells, the IR/MAR-Dhfr fusion method resulted in stable amplification and generated clonal cells that produced large amounts of antibody protein over a long period of time. In summary, the novel IR/MAR-Dhfr fusion method enables isolation of stable cells that produce larger amounts of a target recombinant protein more rapidly and easily than either the Dhfr/Mtx or IR/MAR methods alone. PMID:23300841

  4. Increased methotrexate resistance and dhfr gene amplification as a consequence of induced Ha-ras expression in NIH 3T3 cells.

    PubMed

    Wani, M A; Xu, X; Stambrook, P J

    1994-05-01

    Oncogene activation and loss of tumor suppressor genes are known to play a role in tumor initiation as well as its progression. The potential roles of these genes in perturbation of genome stability has become a major interest. To better understand the relationship between expression of an oncogene and genetic instability, we have studied a cell line expressing an activated human Ha-ras under the control of bacterial lactose operon regulatory elements for changes in methotrexate resistance and dihydrofolate reductase (dhfr) gene amplification following mutant Ha-ras induction. In these cells mutant Ha-ras is directed by an inducible SV40 promoter containing a bacterial lac operator sequence which is repressed due to constitutive expression of bacterial lac repressor gene. The expression of this Ha-ras is specifically induced by the addition of isopropyl-1-thio-beta-D-galactopyranoside (IPTG), a lactose analogue, to the culture medium. During single-step methotrexate selection, these cells showed an increased frequency of methotrexate resistance in the presence of IPTG. More than 60% of the methotrexate-resistant colonies showed a 2-6-fold amplification of the dhfr gene. One clone with rearranged dhfr had about 100-fold amplification of the gene. The increased capacity to amplify DNA in response to mutant Ha-ras induction was not locus specific since cells also displayed an increased frequency of resistance to N-(phosphonacetyl)-L-aspartic acid in the presence of ITPG. Four of the methotrexate-resistant clones with amplified dhfr gene were cultured further in the presence or absence of IPTG and subsequently compared for their ability to grow in soft agar as a measure of transformation. In medium containing methotrexate but no IPTG, the clones were unable to grow in soft agar, indicating that methotrexate resistance due to gene amplification is separable from transformation. PMID:8162600

  5. A novel universal DNA labeling and amplification system for rapid microarray-based detection of 117 antibiotic resistance genes in Gram-positive bacteria.

    PubMed

    Strauss, Christian; Endimiani, Andrea; Perreten, Vincent

    2015-01-01

    A rapid and simple DNA labeling system has been developed for disposable microarrays and has been validated for the detection of 117 antibiotic resistance genes abundant in Gram-positive bacteria. The DNA was fragmented and amplified using phi-29 polymerase and random primers with linkers. Labeling and further amplification were then performed by classic PCR amplification using biotinylated primers specific for the linkers. The microarray developed by Perreten et al. (Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J.Clin.Microbiol. 43, 2291-2302.) was improved by additional oligonucleotides. A total of 244 oligonucleotides (26 to 37 nucleotide length and with similar melting temperatures) were spotted on the microarray, including genes conferring resistance to clinically important antibiotic classes like β-lactams, macrolides, aminoglycosides, glycopeptides and tetracyclines. Each antibiotic resistance gene is represented by at least 2 oligonucleotides designed from consensus sequences of gene families. The specificity of the oligonucleotides and the quality of the amplification and labeling were verified by analysis of a collection of 65 strains belonging to 24 species. Association between genotype and phenotype was verified for 6 antibiotics using 77 Staphylococcus strains belonging to different species and revealed 95% test specificity and a 93% predictive value of a positive test. The DNA labeling and amplification is independent of the species and of the target genes and could be used for different types of microarrays. This system has also the advantage to detect several genes within one bacterium at once, like in Staphylococcus aureus strain BM3318, in which up to 15 genes were detected. This new microarray-based detection system offers a large potential for applications in clinical diagnostic, basic research, food safety and

  6. A comparison of Direct sequencing, Pyrosequencing, High resolution melting analysis, TheraScreen DxS, and the K-ras StripAssay for detecting KRAS mutations in non small cell lung carcinomas

    PubMed Central

    2012-01-01

    Background It is mandatory to confirm the absence of mutations in the KRAS gene before treating metastatic colorectal cancers with epidermal growth factor receptor inhibitors, and similar regulations are being considered for non-small cell lung carcinomas (NSCLC) and other tumor types. Routine diagnosis of KRAS mutations in NSCLC is challenging because of compromised quantity and quality of biological material. Although there are several methods available for detecting mutations in KRAS, there is little comparative data regarding their analytical performance, economic merits, and workflow parameters. Methods We compared the specificity, sensitivity, cost, and working time of five methods using 131 frozen NSCLC tissue samples. We extracted genomic DNA from the samples and compared the performance of Sanger cycle sequencing, Pyrosequencing, High-resolution melting analysis (HRM), and the Conformité Européenne (CE)-marked TheraScreen DxS and K-ras StripAssay kits. Results and conclusions Our results demonstrate that TheraScreen DxS and the StripAssay, in that order, were most effective at diagnosing mutations in KRAS. However, there were still unsatisfactory disagreements between them for 6.1% of all samples tested. Despite this, our findings are likely to assist molecular biologists in making rational decisions when selecting a reliable, efficient, and cost-effective method for detecting KRAS mutations in heterogeneous clinical tumor samples. PMID:22995035

  7. PCR amplification of the hrcV gene through specific primers for detecting Pseudomonas syringae pathovars.

    PubMed

    Vaseghi, Akbar; Bakhshinejad, Babak; Safaie, Naser; Parchin, Reza Ashrafi; Sadeghizadeh, Majid

    2014-02-01

    Pseudomonas syringae pathovars are important pathogens among phytopathogenic bacteria causing a variety of diseases in plants. These pathogens can rapidly disseminate in a large area leading to infection and destruction of plants. To prevent the incidence of the bacteria, appropriate detection methods should be employed. Routinely serological tests, being time-consuming and costly, are exploited to detect these pathogens in plants, soil, water and other resources. Over the recent years, DNA-based detection approaches which are stable, rapid, specific and reliable have been developed and sequence analysis of various genes are widely utilized to identify different strains of P. syringe. However, the greatest limitation of these genes is inability to detect numerous pathovars of P. syringae. Herein, by using bioinformatic analysis, we found the hrcV gene located at pathogenicity islands of bacterial genome with the potential of being used as a new marker for phylogenetic detection of numerous pathovars of P. syringae. Following design of specific primers to hrcV, we amplified a 440 bp fragment. Of 13 assayed pathovars, 11 were detected. Also, through experimental procedures and bioinformatic analysis it was revealed that the designed primers have the capacity to detect 19 pathovars. Our findings suggest that hrcV could be used as a gene with the merit of detecting more pathovars of P. syringae in comparison with other genes used frequently for detection purposes.

  8. Modified PCR methods for 3' end amplification from serial analysis of gene expression (SAGE) tags.

    PubMed

    Xu, Wang-Jie; Wang, Zhao-Xia; Qiao, Zhong-Dong

    2009-05-01

    Serial analysis of gene expression (SAGE) is a powerful technique to study gene expression at the genome level. However, a disadvantage of the shortness of SAGE tags is that it prevents further study of SAGE library data, thus limiting extensive application of the SAGE method in gene expression studies. However, this problem can be solved by extension of the SAGE tags to 3' cDNAs. Therefore, several methods based on PCR have been developed to generate a 3' longer fragment cDNA corresponding to a SAGE tag. The list of modified methods is extensive, and includes rapid RT-PCR analysis of unknown SAGE tags (RAST-PCR), generation of longer cDNA fragments from SAGE tags for gene identification (GLGI), a high-throughput GLGI procedure, reverse SAGE (rSAGE), two-step analysis of unknown SAGE tags (TSAT-PCR), etc. These procedures are constantly being updated because they have characteristics and advantages that can be shared. Development of these methods has promoted the widespread use of the SAGE technique, and has accelerated the speed of studies of large-scale gene expression.

  9. Visual detection of Potato Leafroll virus by loop-mediated isothermal amplification of DNA with the GeneFinder™ dye.

    PubMed

    Almasi, Mohammad Amin; Erfan Manesh, Maryam; Jafary, Hossein; Dehabadi, Seyed Mohammad Hosseini

    2013-09-01

    The most common virus affecting potatoes in the field worldwide is Potato Leafroll virus (PLRV), belonging to the family Luteoviridae, genius Plerovirus. There are several molecular methods to detect PLRV including polymerase chain reaction (PCR), Multiplex AmpliDet RNA and double antibody sandwich ELISA (DAS-ELISA). But these techniques take a long time for 3h to two days, requiring sophisticated tools. The aim of this study was to reduce the time required to detect PLRV, using a newly designed loop-mediated isothermal amplification (LAMP) technique requiring only an ordinary water bath or thermoblock. PLRV RNA was extracted from overall 80 infected naturally potato leaves. A set of six novel primers for the LAMP reaction was designed according to the highly conserved sequence of the viral coat protein (CP) gene. LAMP was carried out under isothermal conditions, applying the Bst DNA polymerase enzyme; the LAMP products were detected visually using the GeneFinder™ florescence dye. A positive result using the GeneFinder™ dye was a color change from the original orange to green. Results confirmed LAMP with GeneFinder™ provides a rapid and safe assay for detection of PLRV. Since with other molecular methods, equipping laboratories with a thermocycler or expensive detector systems is unavoidable, this assay was found to be a simple, cost-effective molecular method that has the potential to replace other diagnostic methods in primary laboratories without the need for expensive equipment or specialized techniques. It can also be considered as a reliable alternative viral detection system in further investigations.

  10. Loop-Mediated Isothermal Amplification of Specific Endoglucanase Gene Sequence for Detection of the Bacterial Wilt Pathogen Ralstonia solanacearum

    PubMed Central

    Pirc, Manca; Llop, Pablo; Ravnikar, Maja; Dreo, Tanja

    2014-01-01

    The increased globalization of crops production and processing industries also promotes the side-effects of more rapid and efficient spread of plant pathogens. To prevent the associated economic losses, and particularly those related to bacterial diseases where their management relies on removal of the infected material from production, simple, easy-to-perform, rapid and cost-effective tests are needed. Loop-mediated isothermal amplification (LAMP) assays that target 16S rRNA, fliC and egl genes were compared and evaluated as on-site applications. The assay with the best performance was that targeted to the egl gene, which shows high analytical specificity for diverse strains of the betaproteobacterium Ralstonia solanacearum, including its non-European and non-race 3 biovar 2 strains. The additional melting curve analysis provides confirmation of the test results. According to our extensive assessment, the egl LAMP assay requires minimum sample preparation (a few minutes of boiling) for the identification of pure cultures and ooze from symptomatic material, and it can also be used in a high-throughput format in the laboratory. This provides sensitive and reliable detection of R. solanacearum strains of different phylotypes. PMID:24763488

  11. Loop-mediated isothermal amplification of specific endoglucanase gene sequence for detection of the bacterial wilt pathogen Ralstonia solanacearum.

    PubMed

    Lenarčič, Rok; Morisset, Dany; Pirc, Manca; Llop, Pablo; Ravnikar, Maja; Dreo, Tanja

    2014-01-01

    The increased globalization of crops production and processing industries also promotes the side-effects of more rapid and efficient spread of plant pathogens. To prevent the associated economic losses, and particularly those related to bacterial diseases where their management relies on removal of the infected material from production, simple, easy-to-perform, rapid and cost-effective tests are needed. Loop-mediated isothermal amplification (LAMP) assays that target 16S rRNA, fliC and egl genes were compared and evaluated as on-site applications. The assay with the best performance was that targeted to the egl gene, which shows high analytical specificity for diverse strains of the betaproteobacterium Ralstonia solanacearum, including its non-European and non-race 3 biovar 2 strains. The additional melting curve analysis provides confirmation of the test results. According to our extensive assessment, the egl LAMP assay requires minimum sample preparation (a few minutes of boiling) for the identification of pure cultures and ooze from symptomatic material, and it can also be used in a high-throughput format in the laboratory. This provides sensitive and reliable detection of R. solanacearum strains of different phylotypes. PMID:24763488

  12. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity.

  13. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity. PMID:26225482

  14. [Isolation and amplification cDNA of 8H07 gene conservative region of nematode Heterodera schachtii with high relationship to its rape homolog].

    PubMed

    Tsyhankova, V A; Andrusevych, Ia V; Ponomarenko, S P; Halkin, A P; Blium, Ia B

    2012-01-01

    Original method of small regulatory si/miRNA isolation from plant cells was elaborated. PCR amplification of fragment cDNA 8H07 nematode Heterodera schachtii gene was carried out. Using Northern-blot method hybridization of plant si/miRNA with cDNA fragment of conservative region 8H07 gene the presence of their high homology is found out. The amplified cDNA fragment of nematode 8H07 gene in future will be used for creation recombinant gene with complementary antisense dsRNA sequence for increasing resistance of rape plants to parasitic nematodes.

  15. Molecular Genetic Analysis of Ovarian Brenner Tumors and Associated Mucinous Epithelial Neoplasms: High Variant Concordance and Identification of Mutually Exclusive RAS Driver Mutations and MYC Amplification.

    PubMed

    Tafe, Laura J; Muller, Kristen E; Ananda, Guruprasad; Mitchell, Talia; Spotlow, Vanessa; Patterson, Sara E; Tsongalis, Gregory J; Mockus, Susan M

    2016-03-01

    Benign ovarian Brenner tumors often are associated with mucinous cystic neoplasms, which are hypothesized to share a histogenic origin and progression, however, supporting molecular characterization is limited. Our goal was to identify molecular mechanisms linking these tumors. DNA from six Brenner tumors with paired mucinous tumors, two Brenner tumors not associated with a mucinous neoplasm, and two atypical proliferative (borderline) Brenner tumors was extracted from formalin-fixed, paraffin-embedded tumor samples and sequenced using a 358-gene next-generation sequencing assay. Variant calls were compared within tumor groups to assess somatic mutation profiles. There was high concordance of the variants between paired samples (40% to 75%; P < 0.0001). Four of the six tumor pairs showed KRAS hotspot driver mutations specifically in the mucinous tumor. In the two paired samples that lacked KRAS mutations, MYC amplification was detected in both of the mucinous and the Brenner components; MYC amplification also was detected in a third Brenner tumor. Five of the Brenner tumors had no reportable potential driver alterations. The two atypical proliferative (borderline) Brenner tumors both had RAS mutations. The high degree of coordinate variants between paired Brenner and mucinous tumors supports a shared origin or progression. Differences observed in affected genes and pathways, particularly involving RAS and MYC, may point to molecular drivers of a divergent phenotype and progression of these tumors.

  16. Prognostic value of BRAF and KRAS mutation status in stage II and III microsatellite instable colon cancers.

    PubMed

    de Cuba, E M V; Snaebjornsson, P; Heideman, D A M; van Grieken, N C T; Bosch, L J W; Fijneman, R J A; Belt, E; Bril, H; Stockmann, H B A C; Hooijberg, E; Punt, C J A; Koopman, M; Nagtegaal, I D; Coupé, V H M; Carvalho, B; Meijer, G A

    2016-03-01

    Microsatellite instability (MSI) has been associated with favourable survival in early stage colorectal cancer (CRC) compared to microsatellite stable (MSS) CRC. The BRAF V600E mutation has been associated with worse survival in MSS CRC. This mutation occurs in 40% of MSI CRC and it is unclear whether it confers worse survival in this setting. The prognostic value of KRAS mutations in both MSS and MSI CRC remains unclear. We examined the effect of BRAF and KRAS mutations on survival in stage II and III MSI colon cancer patients. BRAF exon 15 and KRAS exon 2-3 mutation status was assessed in 143 stage II (n = 85) and III (n = 58) MSI colon cancers by high resolution melting analysis and sequencing. The relation between mutation status and cancer-specific (CSS) and overall survival (OS) was analyzed using Kaplan-Meier and Cox regression analysis. BRAF V600E mutations were observed in 51% (n = 73) and KRAS mutations in 16% of cases (n = 23). Patients with double wild-type cancers (dWT; i.e., BRAF and KRAS wild-type) had a highly favourable survival with 5-year CSS of 93% (95% CI 84-100%), while patients with cancers harbouring mutations in either BRAF or KRAS, had 5-year CSS of 76% (95% CI 67-85%). In the subgroup of stage II patients with dWT cancers no cancer-specific deaths were observed. On multivariate analysis, mutation in either BRAF or KRAS vs. dWT remained significantly prognostic. Mutations in BRAF as well as KRAS should be analyzed when considering these genes as prognostic markers in MSI colon cancers.

  17. Identification of druggable cancer driver genes amplified across TCGA datasets.

    PubMed

    Chen, Ying; McGee, Jeremy; Chen, Xianming; Doman, Thompson N; Gong, Xueqian; Zhang, Youyan; Hamm, Nicole; Ma, Xiwen; Higgs, Richard E; Bhagwat, Shripad V; Buchanan, Sean; Peng, Sheng-Bin; Staschke, Kirk A; Yadav, Vipin; Yue, Yong; Kouros-Mehr, Hosein

    2014-01-01

    The Cancer Genome Atlas (TCGA) projects have advanced our understanding of the driver mutations, genetic backgrounds, and key pathways activated across cancer types. Analysis of TCGA datasets have mostly focused on somatic mutations and translocations, with less emphasis placed on gene amplifications. Here we describe a bioinformatics screening strategy to identify putative cancer driver genes amplified across TCGA datasets. We carried out GISTIC2 analysis of TCGA datasets spanning 16 cancer subtypes and identified 486 genes that were amplified in two or more datasets. The list was narrowed to 75 cancer-associated genes with potential "druggable" properties. The majority of the genes were localized to 14 amplicons spread across the genome. To identify potential cancer driver genes, we analyzed gene copy number and mRNA expression data from individual patient samples and identified 42 putative cancer driver genes linked to diverse oncogenic processes. Oncogenic activity was further validated by siRNA/shRNA knockdown and by referencing the Project Achilles datasets. The amplified genes represented a number of gene families, including epigenetic regulators, cell cycle-associated genes, DNA damage response/repair genes, metabolic regulators, and genes linked to the Wnt, Notch, Hedgehog, JAK/STAT, NF-KB and MAPK signaling pathways. Among the 42 putative driver genes were known driver genes, such as EGFR, ERBB2 and PIK3CA. Wild-type KRAS was amplified in several cancer types, and KRAS-amplified cancer cell lines were most sensitive to KRAS shRNA, suggesting that KRAS amplification was an independent oncogenic event. A number of MAP kinase adapters were co-amplified with their receptor tyrosine kinases, such as the FGFR adapter FRS2 and the EGFR family adapters GRB2 and GRB7. The ubiquitin-like ligase DCUN1D1 and the histone methyltransferase NSD3 were also identified as novel putative cancer driver genes. We discuss the patient tailoring implications for existing cancer

  18. Gene Amplification Is A Mechanism For Rapid Weed Evolution To Herbicide Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The herbicide glyphosate became widely used in the U.S. and other parts of the world following the introduction of glyphosate-resistant crops. These crops were created by introduction of a modified 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, the herbicide target site. Increased use of ...

  19. Accidental Amplification and Inactivation of a Methyltransferase Gene Eliminates Cytosine Methylation in Mycosphaerella Graminicola

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A de novo search for repetitive elements in the genome sequence of the wheat pathogen Mycosphaerella graminicola identified a family of repeats containing a DNA methyltransferase sequence (MgDNMT), which is a homologue of the Neurospora crassa Dim-2 gene. A total of 28 MgDNMT sequences was identifie...

  20. Prognostic significance of K-Ras mutation rate in metastatic colorectal cancer patients

    PubMed Central

    Vincenzi, Bruno; Cremolini, Chiara; Sartore-Bianchi, Andrea; Russo, Antonio; Mannavola, Francesco; Perrone, Giuseppe; Pantano, Francesco; Loupakis, Fotios; Rossini, Daniele; Ongaro, Elena; Bonazzina, Erica; Dell'Aquila, Emanuela; Imperatori, Marco; Zoccoli, Alice; Bronte, Giuseppe; De Maglio, Giovanna; Fontanini, Gabriella; Natoli, Clara; Falcone, Alfredo; Santini, Daniele; Onetti-Muda, Andrea; Siena, Salvatore; Tonini, Giuseppe; Aprile, Giuseppe

    2015-01-01

    Introduction: Activating mutations of K-Ras gene have a well-established role as predictors of resistance to anti-EGFR monoclonal antibodies in metastatic colorectal cancer (mCRC) patients. Their prognostic value is controversial, and no data regarding the prognostic value of mutation rate, defined as the percentage of mutated alleles/tumor sample, are available. We aimed to evaluate the prognostic value of K-Rasmutation rate in a homogenous cohort of mCRC patients receiving first-line doublet plus bevacizumab. Patients and Methods: This retrospective study enrolled 397 K-Ras mutant mCRC patients from 6 Italian centers, and 263 patients were fully evaluable for our analysis. K-Ras mutation rate was assessed by pyrosequencing. Patients with less than 60% of cancer cells in tumor tissue were excluded. No patients received anti-EGFR containing anticancer therapy, at any time. Median mutation rate was 40% and was adopted as cut-off. The primary and secondary endpoints were PFS and OS respectively. Results: At univariate analysis, K-Ras mutation rate higher than 40% was significantly associated with lower PFS (7.3 vs 9.1 months; P < 0.0001) and OS (21 vs 31 months; P = 0.004). A multivariate model adjusted for age at diagnosis, site of origin of tumor tissue (primary vs metastases), referral center, number of metastatic sites, and first-line chemotherapy backbone, showed that K-Ras mutation rate remained a significant predictor of PFS and OS in the whole population. Discussion: Our data demonstrate an association between K-Ras mutation rate and prognosis in mCRC patients treated with bevacizumab-containing first-line therapy. These data deserve to be verified in an independent validation set. PMID:26384309

  1. A primer vector system that allows temperature dependent gene amplification and expression in mammalian cells: regulation of the influenza virus NS1 gene expression.

    PubMed

    Portela, A; Melero, J A; Martínez, C; Domingo, E; Ortín, J

    1985-11-25

    Influenza virus RNA segment 8 has been cloned into primer-vector pSLts1. This vector was designed to replicate in simian cells in a temperature dependent fashion by use of the SV40 tsA209 T-antigen gene. The oriented synthesis of cDNA on dT-tailed pSLts1 was performed on in vitro synthesized mRNA, and the second DNA strand was primed with an influenza-specific terminal oligodeoxynucleotide. Recombinant pSLVa232 contained the RNA segment 8 sequence directly fused to the SV40 late promoter contained in pSLts1, and followed by the SV40 polyadenylation signal. Expression of NS1 gene in transfected COS cells took place at a level comparable to that found in infected cells. When VERO cell cultures were transfected with recombinant pSLVa232, expression of the NS1 gene was temperature dependent. Close to one hundred fold increase in the amplification and expression of the cloned gene was observed after shift down of the transfected cells to permissive temperature. Vector pSLts1 and the cloning strategy described may be useful for the specific cloning and regulated expression of mRNAs of known 5'-terminal sequence.

  2. Amplification of human beta-actin gene by the reverse transcriptase-polymerase chain reaction: implications for assessment of RNA from formalin-fixed, paraffin-embedded material.

    PubMed

    Dakhama, A; Macek, V; Hogg, J C; Hegele, R G

    1996-10-01

    The polymerase chain reaction (PCR) is a powerful method that allows enzymatic amplification of rate target nucleic acid sequences. It has been applied to the amplification of viral genomes from paraffin-embedded pathology specimens. However, interpretation of negative results requires amplification of a housekeeping gene such as beta-actin. In the present study we used specific oligonucleotide primers previously designed to amplify both the genomic DNA and the mRNA transcript from paraffin-embedded tissue. These products have predicted sizes of 250 BP and 154 BP, respectively, but our results showed that PCR amplification only (without reverse transcription) unexpectedly generated the 154-BP product. Further investigation of the nature of this product demonstrated that it originated from the amplification of DNA, not RNA. We conclude that the 154-BP product generated by these primers cannot be exclusively considered as beta-actin RNA product and should not be used to assess successful extraction of RNA, to ascertain its integrity, or to normalize for the total amount of RNA assayed by RT-PCR from paraffin-embedded tissue.

  3. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae1

    PubMed Central

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W. Brad; Stacy, Elizabeth A.

    2014-01-01

    • Premise of the study: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Methods and Results: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • Conclusions: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae. PMID:25309837

  4. Amplification of a DEAD box protein gene in retinoblastoma cell lines.

    PubMed Central

    Godbout, R; Squire, J

    1993-01-01

    DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp, are putative RNA helicases implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Here, we report that the mRNA encoding a DEAD box protein, designated HuDBP-RB, is present at elevated levels in two of six retinoblastoma (RB) cell lines tested and is preferentially expressed in fetal tissues of neuroectodermal origin. It is not possible to classify HuDBP-RB as a member of any of the DEAD box protein subgroups identified to date since the regions of amino acid similarity between HuDBP-RB and other DEAD box proteins are restricted to the conserved motifs found in all members of this family. The HuDBP-RB gene, which has been mapped to chromosome band 2p24, is amplified in the RB cell lines that overexpress HuDBP-RB RNA. Furthermore, the MYCN gene is also present in multiple copies in these two cell lines, suggesting coamplification of the two genes. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:7689221

  5. Reduced cohesin destabilizes high-level gene amplification by disrupting pre-replication complex bindings in human cancers with chromosomal instability

    PubMed Central

    Yun, Jiyeon; Song, Sang-Hyun; Kang, Jee-Youn; Park, Jinah; Kim, Hwang-Phill; Han, Sae-Won; Kim, Tae-You

    2016-01-01

    Gene amplification is a hallmark of cancer with chromosomal instability although the underlying mechanism by which altered copy numbers are maintained is largely unclear. Cohesin, involved in sister chromatid cohesion, DNA repair, cell cycle progression and transcriptional regulation of key developmental genes, is frequently overexpressed in human cancer. Here we show that cohesin-dependent change in DNA replication controls the copy numbers of amplified genes in cancer cells with chromosomal instability. We found that the down-regulation of elevated cohesin leads to copy number-associated gene expression changes without disturbing chromosomal segregation. Highly amplified genes form typical long-range chromatin interactions, which are stabilized by enriched cohesin. The spatial proximities among cohesin binding sites within amplified genes are decreased by RAD21-knockdown, resulting in the rapid decline of amplified gene expression. After several passages, cohesin depletion inhibits DNA replication initiation by reducing the recruitment of pre-replication complexes such as minichromosome maintenance subunits 7 (MCM7), DNA polymerase α, and CDC45 at replication origins near the amplified regions, and as a result, decreases the DNA copy numbers of highly amplified genes. Collectively, our data demonstrate that cohesin-mediated chromatin organization and DNA replication are important for stabilizing gene amplification in cancer cells with chromosomal instability. PMID:26420833

  6. Amplification of TGFβ Induced ITGB6 Gene Transcription May Promote Pulmonary Fibrosis.

    PubMed

    Tatler, Amanda L; Goodwin, Amanda T; Gbolahan, Olumide; Saini, Gauri; Porte, Joanne; John, Alison E; Clifford, Rachel L; Violette, Shelia M; Weinreb, Paul H; Parfrey, Helen; Wolters, Paul J; Gauldie, Jack; Kolb, Martin; Jenkins, Gisli

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a devastating, progressive disease with poor survival rates and limited treatment options. Upregulation of αvβ6 integrins within the alveolar epithelial cells is a characteristic feature of IPF and correlates with poor patient survival. The pro-fibrotic cytokine TGFβ1 can upregulate αvβ6 integrin expression but the molecular mechanisms driving this effect have not previously been elucidated. We confirm that stimulation with exogenous TGFβ1 increases expression of the integrin β6 subunit gene (ITGB6) and αvβ6 integrin cell surface expression in a time- and concentration-dependent manner. TGFβ1-induced ITGB6 expression occurs via transcriptional activation of the ITGB6 gene, but does not result from effects on ITGB6 mRNA stability. Basal expression of ITGB6 in, and αvβ6 integrins on, lung epithelial cells occurs via homeostatic αvβ6-mediated TGFβ1 activation in the absence of exogenous stimulation, and can be amplified by TGFβ1 activation. Fundamentally, we show for the first time that TGFβ1-induced ITGB6 expression occurs via canonical Smad signalling since dominant negative constructs directed against Smad3 and 4 inhibit ITGB6 transcriptional activity. Furthermore, disruption of a Smad binding site at -798 in the ITGB6 promoter abolishes TGFβ1-induced ITGB6 transcriptional activity. Using chromatin immunoprecipitation we demonstrate that TGFβ1 stimulation of lung epithelial cells results in direct binding of Smad3, and Smad4, to the ITGB6 gene promoter within this region. Finally, using an adenoviral TGFβ1 over-expression model of pulmonary fibrosis we demonstrate that Smad3 is crucial for TGFβ1-induced αvβ6 integrin expression within the alveolar epithelium in vivo. Together, these data confirm that a homeostatic, autocrine loop of αvβ6 integrin activated TGFβ1-induced ITGB6 gene expression regulates epithelial basal αvβ6 integrin expression, and demonstrates that this occurs via Smad

  7. Amplification of TGFβ Induced ITGB6 Gene Transcription May Promote Pulmonary Fibrosis

    PubMed Central

    Tatler, Amanda L.; Goodwin, Amanda T.; Gbolahan, Olumide; Saini, Gauri; Porte, Joanne; John, Alison E.; Clifford, Rachel L.; Violette, Shelia M.; Weinreb, Paul H.; Parfrey, Helen; Wolters, Paul J.; Gauldie, Jack; Kolb, Martin; Jenkins, Gisli

    2016-01-01

    Idiopathic pulmonary fibrosis (IPF) is a devastating, progressive disease with poor survival rates and limited treatment options. Upregulation of αvβ6 integrins within the alveolar epithelial cells is a characteristic feature of IPF and correlates with poor patient survival. The pro-fibrotic cytokine TGFβ1 can upregulate αvβ6 integrin expression but the molecular mechanisms driving this effect have not previously been elucidated. We confirm that stimulation with exogenous TGFβ1 increases expression of the integrin β6 subunit gene (ITGB6) and αvβ6 integrin cell surface expression in a time- and concentration-dependent manner. TGFβ1-induced ITGB6 expression occurs via transcriptional activation of the ITGB6 gene, but does not result from effects on ITGB6 mRNA stability. Basal expression of ITGB6 in, and αvβ6 integrins on, lung epithelial cells occurs via homeostatic αvβ6-mediated TGFβ1 activation in the absence of exogenous stimulation, and can be amplified by TGFβ1 activation. Fundamentally, we show for the first time that TGFβ1-induced ITGB6 expression occurs via canonical Smad signalling since dominant negative constructs directed against Smad3 and 4 inhibit ITGB6 transcriptional activity. Furthermore, disruption of a Smad binding site at -798 in the ITGB6 promoter abolishes TGFβ1-induced ITGB6 transcriptional activity. Using chromatin immunoprecipitation we demonstrate that TGFβ1 stimulation of lung epithelial cells results in direct binding of Smad3, and Smad4, to the ITGB6 gene promoter within this region. Finally, using an adenoviral TGFβ1 over-expression model of pulmonary fibrosis we demonstrate that Smad3 is crucial for TGFβ1-induced αvβ6 integrin expression within the alveolar epithelium in vivo. Together, these data confirm that a homeostatic, autocrine loop of αvβ6 integrin activated TGFβ1-induced ITGB6 gene expression regulates epithelial basal αvβ6 integrin expression, and demonstrates that this occurs via Smad

  8. Detection and identification of Entamoeba gingivalis by specific amplification of rRNA gene.

    PubMed

    Kikuta, N; Yamamoto, A; Goto, N

    1996-12-01

    A pair of oligonucleotide primers were designed from the nucleotide sequence of the gene encoding the small subunit ribosomal RNA (SrRNA) of the oral protozoan parasite Entamoeba gingivalis. The primers amplified a 1.4-kb DNA fragment by polymerase chain reaction and were specific for Entamoeba gingivalis but not for other protozoa, oral protists and bacteria, or human leukocytes. With this method, the DNA from as few as 30 cells of Entamoeba gingivalis could be detected. These results suggest that this approach is applicable to the detection and identification of Entamoeba gingivalis in the human oral cavity.

  9. Kras activation in p53-deficient myoblasts results in high-grade sarcoma formation with impaired myogenic differentiation

    PubMed Central

    McKinnon, Timothy; Venier, Rosemarie; Dickson, Brendan C.; Kabaroff, Leah; Alkema, Manon; Chen, Li; Shern, Jack F.; Yohe, Marielle E.; Khan, Javed; Gladdy, Rebecca A.

    2015-01-01

    While genomic studies have improved our ability to classify sarcomas, the molecular mechanisms involved in the formation and progression of many sarcoma subtypes are unknown. To better understand developmental origins and genetic drivers involved in rhabdomyosarcomagenesis, we describe a novel sarcoma model system employing primary murine p53-deficient myoblasts that were isolated and lentivirally transduced with KrasG12D. Myoblast cell lines were characterized and subjected to proliferation, anchorage-independent growth and differentiation assays to assess the effects of transgenic KrasG12D expression. KrasG12D overexpression transformed p53−/− myoblasts as demonstrated by an increased anchorage-independent growth. Induction of differentiation in parental myoblasts resulted in activation of key myogenic regulators. In contrast, Kras-transduced myoblasts had impaired terminal differentiation. p53−/− myoblasts transformed by KrasG12D overexpression resulted in rapid, reproducible tumor formation following orthotopic injection into syngeneic host hindlimbs. Pathological analysis revealed high-grade sarcomas with myogenic differentiation based on the expression of muscle-specific markers, such as Myod1 and Myog. Gene expression patterns of murine sarcomas shared biological pathways with RMS gene sets as determined by gene set enrichment analysis (GSEA) and were 61% similar to human RMS as determined by metagene analysis. Thus, our novel model system is an effective means to model high-grade sarcomas along the RMS spectrum. PMID:25992772

  10. Copy number variants and rasopathies: germline KRAS duplication in a patient with syndrome including pigmentation abnormalities.

    PubMed

    Gilbert-Dussardier, Brigitte; Briand-Suleau, Audrey; Laurendeau, Ingrid; Bilan, Frédéric; Cavé, Hélène; Verloes, Alain; Vidaud, Michel; Vidaud, Dominique; Pasmant, Eric

    2016-01-01

    RAS/MAPK pathway germline mutations were described in Rasopathies, a class of rare genetic syndromes combining facial abnormalities, heart defects, short stature, skin and genital abnormalities, and mental retardation. The majority of the mutations identified in the Rasopathies are point mutations which increase RAS/MAPK pathway signaling. Duplications encompassing RAS/MAPK pathway genes (PTPN11, RAF1, MEK2, or SHOC2) were more rarely described. Here we report, a syndromic familial case of a 12p duplication encompassing the dosage sensitive gene KRAS, whose phenotype overlapped with rasopathies. The patient was referred because of a history of mild learning disabilities, small size, facial dysmorphy, and pigmentation abnormalities (café-au-lait and achromic spots, and axillar lentigines). This phenotype was reminiscent of rasopathies. No mutation was identified in the most common genes associated with Noonan, cardio-facio-cutaneous, Legius, and Costello syndromes, as well as neurofibromatosis type 1. The patient constitutional DNA exhibited a ~10.5 Mb duplication at 12p, including the KRAS gene. The index case's mother carried the same chromosome abnormality and also showed development delay with short stature, and numerous café-au-lait spots. Duplication of the KRAS gene may participate in the propositus phenotype, in particular of the specific pigmentation abnormalities. Array-CGH or some other assessment of gene/exon CNVs of RAS/MAPK pathway genes should be considered in the evaluation of individuals with rasopathies. PMID:27450488

  11. Sequence Variation in Amplification Target Genes and Standards Influences Interlaboratory Comparison of BK Virus DNA Load Measurement.

    PubMed

    Solis, Morgane; Meddeb, Mariam; Sueur, Charlotte; Domingo-Calap, Pilar; Soulier, Eric; Chabaud, Angeline; Perrin, Peggy; Moulin, Bruno; Bahram, Seiamak; Stoll-Keller, Françoise; Caillard, Sophie; Barth, Heidi; Fafi-Kremer, Samira

    2015-12-01

    International guidelines define a BK virus (BKV) load of ≥4 log10 copies/ml as presumptive of BKV-associated nephropathy (BKVN) and a cutoff for therapeutic intervention. To investigate whether BKV DNA loads (BKVL) are comparable between laboratories, 2 panels of 15 and 8 clinical specimens (urine, whole blood, and plasma) harboring different BKV genotypes were distributed to 20 and 27 French hospital centers in 2013 and 2014, respectively. Although 68% of the reported results fell within the acceptable range of the expected result ±0.5 log10, the interlaboratory variation ranged from 1.32 to 5.55 log10. Polymorphisms specific to BKV genotypes II and IV, namely, the number and position of mutations in amplification target genes and/or deletion in standards, arose as major sources of interlaboratory disagreements. The diversity of DNA purification methods also contributed to the interlaboratory variability, in particular for urine samples. Our data strongly suggest that (i) commercial external quality controls for BKVL assessment should include all major BKV genotypes to allow a correct evaluation of BKV assays, and (ii) the BKV sequence of commercial standards should be provided to users to verify the absence of mismatches with the primers and probes of their BKV assays. Finally, the optimization of primer and probe design and standardization of DNA extraction methods may substantially decrease interlaboratory variability and allow interinstitutional studies to define a universal cutoff for presumptive BKVN and, ultimately, ensure adequate patient care. PMID:26468499

  12. Direct PCR amplification of the 16S rRNA gene from single microbial cells isolated from an Antarctic iceberg using laser microdissection microscopy

    NASA Astrophysics Data System (ADS)

    Yanagihara, Katsuhiko; Niki, Hironori; Baba, Tomoya

    2011-09-01

    Here, we describe a technique that allows the genetic linage analysis of 16S rRNA genes in bacteria observed under a microscope. The technique includes the isolation of microbial cells using a laser microdissection microscope, lysis of the cells, and amplification of the 16S rRNA genes in the isolated cells without interference by bacterial DNA contamination from the experimental environment or reagents. Using this technique, we successfully determined 15 16S rRNA gene sequences in cells isolated from an Antarctic iceberg. These sequences showed 94%-100% identity to their closest strains, which included bacteria that occur in aqueous, marine, and soil environments.

  13. A protein tagging system for signal amplification in gene expression and fluorescence imaging

    PubMed Central

    Tanenbaum, Marvin E.; Gilbert, Luke A.; Qi, Lei S.; Weissman, Jonathan S.; Vale, Ronald D.

    2014-01-01

    Summary Signals in many biological processes can be amplified by recruiting multiple copies of regulatory proteins to a site of action. Harnessing this principle, we have developed a novel protein scaffold, a repeating peptide array termed SunTag, which can recruit multiple copies of an antibody-fusion protein. We show that the SunTag can recruit up to 24 copies of GFP, thereby enabling long-term imaging of single protein molecules in living cells. We also use the SunTag to create a potent synthetic transcription factor by recruiting multiple copies of a transcriptional activation domain to a nuclease-deficient CRISPR/Cas9 protein and demonstrate strong activation of endogenous gene expression and re-engineered cell behavior with this system. Thus, the SunTag provides a versatile platform for multimerizing proteins on a target protein scaffold and is likely to have many applications in imaging and in controlling biological outputs. PMID:25307933

  14. ABCG2 gene amplification and expression in esophageal cancer cells with acquired adriamycin resistance.

    PubMed

    Liu, Liang; Zuo, Lian Fu; Guo, Jian Wen

    2014-04-01

    Resistance to chemotherapeutic agents is the main reason for treatment failure in patients with cancer. The primary mechanism of multidrug resistance (MDR) is the overexpression of drug efflux transporters, including ATP‑binding cassette transporter G2 (ABCG2). To the best of our knowledge, the MDR mechanisms of esophageal cancer have not been described. An adriamycin (ADM)-resistant subline, Eca109/ADM, was generated from the Eca109 esophageal cancer cell line by a stepwise selection in ADM from 0.002 to 0.02 ng/µl. The resulting subline, designated Eca109/ADM, revealed a 3.29-fold resistance against ADM compared with the Eca109 cell line. The ABCG2 gene expression in the Eca109/ADM cells was increased compared with that of the Eca109 cells. The cellular properties of the Eca109/ADM cells were detected by reverse transcription polymerase chain reaction (RT-PCR), flow cytometry and western blotting. The ABCG2 expression levels were detected by RT-PCR and flow cytometry, and the drug efflux effect was detected by flow cytometry. The present study detected the correlation between ABCG2 and the multidrug resistance of esophageal cancer. ABCG2 gene expression and the drug efflux effect of the Eca109/ADM cells were increased compared with those of the Eca109 cells. Collectively, the results of this study indicated that the overexpression of ABCG2 in the Eca109/ADM cells resulted in drug efflux, which may be responsible for the development of esophageal cancer MDR.

  15. Involvement of facultative apomixis in inheritance of EPSPS gene amplification in glyphosate-resistant Amaranthus palmeri.

    PubMed

    Ribeiro, Daniela N; Pan, Zhiqiang; Duke, Stephen O; Nandula, Vijay K; Baldwin, Brian S; Shaw, David R; Dayan, Franck E

    2014-01-01

    The inheritance of glyphosate resistance in two Amaranthus palmeri populations (R1 and R2) was examined in reciprocal crosses (RC) and second reciprocal crosses (2RC) between glyphosate-resistant (R) and -susceptible (S) parents of this dioecious species. R populations and Female-R × Male-S crosses contain higher 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene copy numbers than the S population. EPSPS expression, EPSPS enzyme activity, EPSPS protein quantity, and level of resistance to glyphosate correlated positively with genomic EPSPS relative copy number. Transfer of resistance was more influenced by the female than the male parent in spite of the fact that the multiple copies of EPSPS are amplified in the nuclear genome. This led us to hypothesize that this perplexing pattern of inheritance may result from apomictic seed production in A. palmeri. We confirmed that reproductively isolated R and S female plants produced seeds, indicating that A. palmeri can produce seeds both sexually and apomictically (facultative apomixis). This apomictic trait accounts for the low copy number inheritance in the Female-S × Male-R offsprings. Apomixis may also enhance the stability of the glyphosate resistance trait in the R populations in the absence of reproductive partners. PMID:24142112

  16. Involvement of facultative apomixis in inheritance of EPSPS gene amplification in glyphosate-resistant Amaranthus palmeri.

    PubMed

    Ribeiro, Daniela N; Pan, Zhiqiang; Duke, Stephen O; Nandula, Vijay K; Baldwin, Brian S; Shaw, David R; Dayan, Franck E

    2014-01-01

    The inheritance of glyphosate resistance in two Amaranthus palmeri populations (R1 and R2) was examined in reciprocal crosses (RC) and second reciprocal crosses (2RC) between glyphosate-resistant (R) and -susceptible (S) parents of this dioecious species. R populations and Female-R × Male-S crosses contain higher 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene copy numbers than the S population. EPSPS expression, EPSPS enzyme activity, EPSPS protein quantity, and level of resistance to glyphosate correlated positively with genomic EPSPS relative copy number. Transfer of resistance was more influenced by the female than the male parent in spite of the fact that the multiple copies of EPSPS are amplified in the nuclear genome. This led us to hypothesize that this perplexing pattern of inheritance may result from apomictic seed production in A. palmeri. We confirmed that reproductively isolated R and S female plants produced seeds, indicating that A. palmeri can produce seeds both sexually and apomictically (facultative apomixis). This apomictic trait accounts for the low copy number inheritance in the Female-S × Male-R offsprings. Apomixis may also enhance the stability of the glyphosate resistance trait in the R populations in the absence of reproductive partners.

  17. Peripheral amplification of sweating – a role for calcitonin gene-related peptide

    PubMed Central

    Schlereth, Tanja; Dittmar, Jan Oliver; Seewald, Bianca; Birklein, Frank

    2006-01-01

    Neuropeptides are the mediators of neurogenic inflammation. Some pain disorders, e.g. complex regional pain syndromes, are characterized by increased neurogenic inflammation and by exaggerated sudomotor function. The aim of this study was to explore whether neuropeptides have a peripheral effect on human sweating. We investigated the effects of different concentrations of calcitonin gene-related peptide (CGRP), vasoactive intestinal peptide (VIP) and substance P (SP) on acetylcholine-induced axon reflex sweating in healthy subjects (total n = 18). All substances were applied via dermal microdialysis. The experiments were done in a parallel setting: ACh alone and ACh combined with CGRP, VIP or SP in various concentrations were applied. Acetylcholine (10−2m) always elicited a sweating response, neuropeptides alone did not. However, CGRP significantly enhanced ACh-induced sweating (P < 0.01). Post hoc tests revealed that CGRP in physiological concentrations of 10−7–10−9m was most effective. VIP at any concentration had no significant effect on axon reflex sweating. The duration of the sweating response (P < 0.01), but not the amount of sweat, was reduced by SP. ACh-induced skin blood flow was significantly increased by CGRP (P < 0.01), but unaltered by VIP and SP. The results indicate that CGRP amplifies axon reflex sweating in human skin. PMID:16931551

  18. Intensity of Mutualism Breakdown Is Determined by Temperature Not Amplification of Wolbachia Genes

    PubMed Central

    Frentiu, Francesca D.; Horn, Emilie; Ritchie, Fiona K.; van Swinderen, Bruno; Weible, Michael W.; O’Neill, Scott L.; Brownlie, Jeremy C.

    2016-01-01

    Wolbachia are maternally transmitted intracellular bacterial symbionts that infect approximately 40% of all insect species. Though several strains of Wolbachia naturally infect Drosophila melanogaster and provide resistance against viral pathogens, or provision metabolites during periods of nutritional stress, one virulent strain, wMelPop, reduces fly lifespan by half, possibly as a consequence of over-replication. While the mechanisms that allow wMelPop to over-replicate are still of debate, a unique tandem repeat locus in the wMelPop genome that contains eight genes, referred to as the “Octomom” locus has been identified and is thought to play an important regulatory role. Estimates of Octomom locus copy number correlated increasing copy number to both Wolbachia bacterial density and increased pathology. Here we demonstrate that infected fly pathology is not dependent on an increased Octomom copy number, but does strongly correlate with increasing temperature. When measured across developmental time, we also show Octomom copy number to be highly variable across developmental time within a single generation. Using a second pathogenic strain of Wolbachia, we further demonstrate reduced insect lifespan can occur independently of a high Octomom locus copy number. Taken together, this data demonstrates that the mechanism/s of wMelPop virulence is more complex than has been previously described. PMID:27661080

  19. Discordance of Mutation Statuses of Epidermal Growth Factor Receptor and K-ras between Primary Adenocarcinoma of Lung and Brain Metastasis.

    PubMed

    Rau, Kun-Ming; Chen, Han-Ku; Shiu, Li-Yen; Chao, Tsai-Ling; Lo, Yi-Ping; Wang, Chin-Chou; Lin, Meng-Chih; Huang, Chao-Cheng

    2016-01-01

    Mutations on epidermal growth factor receptor (EGFR) of adenocarcinomas of lung have been found to be associated with increased sensitivity to EGFR tyrosine kinase inhibitors and K-ras mutations may correlate with primary resistance. We aimed to explore the discordant mutation statuses of EGFR and K-ras between primary tumors and matched brain metastases in adenocarcinomas of lung. We used a sensitive Scorpion ARMS method to analyze EGFR mutation, and Sanger sequencing followed by allele-specific real-time polymerase chain reaction to analyze K-ras mutation. Forty-nine paired tissues with both primary adenocarcinoma of lung and matched brain metastasis were collected. Thirteen patients (26.5%) were discordant for the status of EGFR between primary and metastatic sites. K-ras gene could be checked in paired specimens from 33 patients, thirteen patients (39.6%) were discordant for the status of K-ras. In primary lung adenocarcinoma, there were 14 patients of mutant EGFR had mutant K-ras synchronously. This study revealed that the status of EGFR mutation in lung adenocarcinomas is relatively consistent between primary and metastatic sites compared to K-ras mutation. However, there are still a few cases of adenocarcinoma of lung showing discordance for the status of EGFR mutation. Repeated analysis of EGFR mutation is highly recommended if tissue from metastatic or recurrent site is available for the evaluation of target therapy. PMID:27070580

  20. SMAC Mimetic Birinapant plus Radiation Eradicates Human Head and Neck Cancers with Genomic Amplifications of Cell Death Genes FADD and BIRC2.

    PubMed

    Eytan, Danielle F; Snow, Grace E; Carlson, Sophie; Derakhshan, Adeeb; Saleh, Anthony; Schiltz, Stephen; Cheng, Hui; Mohan, Suresh; Cornelius, Shaleeka; Coupar, Jamie; Sowers, Anastasia L; Hernandez, Lidia; Mitchell, James B; Annunziata, Christina M; Chen, Zhong; Van Waes, Carter

    2016-09-15

    Comparison of tumors from The Cancer Genome Atlas (TCGA) reveals that head and neck squamous cell carcinomas (HNSCC) harbor the most frequent genomic amplifications of Fas-associated death domain (FADD), with or without Baculovirus inhibitor of apoptosis repeat containing BIRC2 (cIAP1), affecting about 30% of patients in association with worse prognosis. Here, we identified HNSCC cell lines harboring FADD/BIRC2 amplifications and overexpression by exome sequencing, RT-PCR, and Western blotting. In vitro, FADD or BIRC2 siRNA knockdown inhibited HNSCC displaying amplification and increased expression of these genes, supporting their functional importance in promoting proliferation. Birinapant, a novel SMAC mimetic, sensitized multiple HNSCC lines to cell death by agonists TNFα or TRAIL and inhibited cIAP1>XIAP>IAP2. Combination of birinapant and TNFα induced sub-G0 DNA fragmentation in sensitive lines and birinapant alone also induced significant G2-M cell-cycle arrest and cell death in UM-SCC-46 cells. Gene transfer and expression of FADD sensitized resistant UM-SCC-38 cells lacking FADD amplification to birinapant and TNFα, supporting a role for FADD in sensitization to IAP inhibitor and death ligands. HNSCC varied in mechanisms of cell death, as indicated by reversal by inhibitors or protein markers of caspase-dependent apoptosis and/or RIPK1/MLKL-mediated necroptosis. In vivo, birinapant inhibited tumor growth and enhanced radiation-induced TNFα, tumor responses, and host survival in UM-SCC-46 and -11B xenograft models displaying amplification and overexpression of FADD+/- BIRC2 These findings suggest that combination of SMAC mimetics such as birinapant plus radiation may be particularly active in HNSCC, which harbor frequent FADD/BIRC2 genomic alterations. Cancer Res; 76(18); 5442-54. ©2016 AACR. PMID:27469115

  1. Antibiotic sensitivity and sequence amplification patterns of genes in multidrug resistant enterobacteria isolates from processed foods in some West African countries.

    PubMed

    Owoseni, Abimbola Adetokunboh; Onilude, Abiodun Anthony

    2011-01-01

    Diarrhoea, dysentery and other diseases due to other enteric bacteria have reportedly been found to resist chemotherapeutic treatment in some West African communities with fatal consequences in some cases. This study was carried out to determine multidrug resistance patterns of Enterobacteria isolates from processed ready-to-eat foods. Indigenously processed food samples of different types were collected from two Francophone and two Anglophone countries in the West African sub-region during the wet and dry seasons of a sampling period of two years. Enterobacteria were isolated from the samples using standard techniques. Amplification of chromosomal DNA of the isolates using the Polymerase Chain Reaction was carried out. The results obtained were subjected to statistical analyses. All isolates showed resistance to cefuroxime (90.7%), nitrofurantoin (90.6%), augmentin (86.1%) and ampicillin (51.2%) while all were sensitive to gentamycin and ciprofloxacin. There was amplification indicating the presence of invA gene at a position of 240 bp. There was no amplification at all for the spvC gene in any of the isolates tested. Multidrug resistant enteric bacteria in these foods containing the invA gene could lead to infections with uncontrolled antibiotic use. The presence of enteric bacteria in the foods analyzed which provide undeniable evidence of the poor microbiological quality of these foods could form the basis of a useful databank in formulation of food-borne disease control and prevention strategies.

  2. ATDC induces an invasive switch in KRAS-induced pancreatic tumorigenesis.

    PubMed

    Wang, Lidong; Yang, Huibin; Abel, Ethan V; Ney, Gina M; Palmbos, Phillip L; Bednar, Filip; Zhang, Yaqing; Leflein, Jacob; Waghray, Meghna; Owens, Scott; Wilkinson, John E; Prasad, Jayendra; Ljungman, Mats; Rhim, Andrew D; Pasca di Magliano, Marina; Simeone, Diane M

    2015-01-15

    The initiation of pancreatic ductal adenocarcinoma (PDA) is linked to activating mutations in KRAS. However, in PDA mouse models, expression of oncogenic mutant KRAS during development gives rise to tumors only after a prolonged latency or following induction of pancreatitis. Here we describe a novel mouse model expressing ataxia telangiectasia group D complementing gene (ATDC, also known as TRIM29 [tripartite motif 29]) that, in the presence of oncogenic KRAS, accelerates pancreatic intraepithelial neoplasia (PanIN) formation and the development of invasive and metastatic cancers. We found that ATDC up-regulates CD44 in mouse and human PanIN lesions via activation of β-catenin signaling, leading to the induction of an epithelial-to-mesenchymal transition (EMT) phenotype characterized by expression of Zeb1 and Snail1. We show that ATDC is up-regulated by oncogenic Kras in a subset of PanIN cells that are capable of invading the surrounding stroma. These results delineate a novel molecular pathway for EMT in pancreatic tumorigenesis, showing that ATDC is a proximal regulator of EMT.

  3. MUC1-C confers EMT and KRAS independence in mutant KRAS lung cancer cells

    PubMed Central

    Kharbanda, Akriti; Rajabi, Hasan; Jin, Caining; Alam, Maroof; Wong, Kwok-Kin; Kufe, Donald

    2014-01-01

    Non-small cell lung cancers (NSCLCs) that harbor an oncogenic KRAS mutation are often associated with resistance to targeted therapies. The MUC1-C transmembrane protein is aberrantly overexpressed in NSCLCs and confers a poor outcome; however, the functional role for MUC1-C in mutant KRAS NSCLC cells has remained unclear. The present studies demonstrate that silencing MUC1-C in A549/KRAS(G12S) and H460/KRAS(Q61H) NSCLC cells is associated with downregulation of AKT signaling and inhibition of growth. Overexpression of a MUC1-C(CQC→AQA) mutant, which inhibits MUC1-C homodimerization and function, suppressed both AKT and MEK activation. Moreover, treatment with GO-203, an inhibitor of MUC1-C homodimerization, blocked AKT and MEK signaling and decreased cell survival. The results further demonstrate that targeting MUC1-C suppresses expression of the ZEB1 transcriptional repressor by an AKT-mediated mechanism, and in turn induces miR-200c. In concert with these effects on the ZEB1/miR-200c regulatory loop, targeting MUC1-C was associated with reversal of the epithelial-mesenchymal transition (EMT) and inhibition of self-renewal capacity. Loss of MUC1-C function also attenuated KRAS independence and inhibited growth of KRAS mutant NSCLC cells as tumors in mice. These findings support a model in which targeting MUC1-C inhibits mutant KRAS signaling in NSCLC cells and thereby reverses the EMT phenotype and decreases self-renewal. PMID:25245423

  4. Mutational analysis of BRAF and KRAS in ovarian serous borderline (atypical proliferative) tumours and associated peritoneal implants

    PubMed Central

    Ardighieri, Laura; Zeppernick, Felix; Hannibal, Charlotte G; Vang, Russell; Cope, Leslie; Junge, Jette; Kjaer, Susanne K; Kurman, Robert J; Shih, Ie-Ming

    2014-01-01

    There is debate as to whether peritoneal implants associated with serous borderline tumours/atypical proliferative serous tumours (SBT/APSTs) of the ovary are derived from the primary ovarian tumour or arise independently in the peritoneum. We analysed 57 SBT/APSTs from 45 patients with advanced-stage disease identified from a nation-wide tumour registry in Denmark. Mutational analysis for hotspots in KRAS and BRAF was successful in 55 APSTs and demonstrated KRAS mutations in 34 (61.8%) and BRAF mutations in eight (14.5%). Mutational analysis was successful in 56 peritoneal implants and revealed KRAS mutations in 34 (60.7%) and BRAF mutations in seven (12.5%). Mutational analysis could not be performed in two primary tumours and in nine implants, either because DNA amplification failed or because there was insufficient tissue for mutational analysis. For these specimens we performed VE1 immunohistochemistry, which was shown to be a specific and sensitive surrogate marker for a V600E BRAF mutation. VE1 staining was positive in one of two APSTs and seven of nine implants. Thus, among 63 implants for which mutation status was known (either by direct mutational analysis or by VE1 immunohistochemistry), 34 (53.9%) had KRAS mutations and 14 (22%) had BRAF mutations, of which identical KRAS mutations were found in 34 (91%) of 37 SBT/APST–implant pairs and identical BRAF mutations in 14 (100%) of 14 SBT/APST–implant pairs. Wild-type KRAS and BRAF (at the loci investigated) were found in 11 (100%) of 11 SBT/APST–implant pairs. Overall concordance of KRAS and BRAF mutations was 95% in 59 of 62 SBT/APST–implant (non-invasive and invasive) pairs (p < 0.00001). This study provides cogent evidence that the vast majority of peritoneal implants, non-invasive and invasive, harbour the identical KRAS or BRAF mutations that are present in the associated SBT/APST, supporting the view that peritoneal implants are derived from the primary ovarian tumour. PMID:24307542

  5. KRAS G13D Mutation and Sensitivity to Cetuximab or Panitumumab in a Colorectal Cancer Cell Line Model

    PubMed Central

    Kumar, Shalini Sree; Price, Timothy J.; Mohyieldin, Omar; Borg, Matthew; Townsend, Amanda

    2014-01-01

    ABSTRACT BACKGROUND: The treatment of metastatic colorectal cancer (mCRC) includes drugs targeting the epidermal growth factor receptor (EGFR). Mutation in codon 12 or 13 in the Kirsten rat sarcoma viral oncogene homolog (KRAS) gene, downstream of the EGFR, evokes constitutive activation of the RAS/RAF/MAPK signaling pathway and correlates with resistance to anti-EGFR monoclonal antibody (mAb) therapies. However, a retrospective study reported that a proportion of patients with the KRAS G13D mutation may respond to cetuximab. A similar analysis for panitumumab was not as conclusive. We sought to determine the sensitivity of CRC cell lines to cetuximab or panitumumab treatment and to investigate the correlation of the KRAS mutational status of the CRC cell lines to the responsiveness to cetuximab or panitumumab. METHODS: To determine the responsiveness of CRC cell lines to cetuximab or panitumumab, cell lines were treated with an optimized concentration of each mAb, and proliferation assays were conducted. RESULTS: After treatment with cetuximab or panitumumab, at the optimum concentration of 8 μg/well, the KRAS G13D mutant cell lines HCT-116, LoVo, and T84 showed intermediate sensitivity to both treatments, between the resistant KRAS G12V mutant cell line SW480 and the sensitive KRAS wild-type cell line LIM1215. One of the G13D cell lines was significantly more sensitive to panitumumab than to cetuximab (P = .02). CONCLUSION: The specific KRAS mutation determines the responsiveness to anti-EGFR monoclonal antibody treatment, corresponding to reported clinical observations. PMID:24558511

  6. The well-accepted notion that gene amplification contributes to increased expression still remains, after all these years, a reasonable but unproven assumption

    PubMed Central

    Jia, Yuping; Chen, Lichan; Jia, Qingwen; Dou, Xixi; Xu, Ningzhi; Liao, Dezhong Joshua

    2016-01-01

    Gene amplification causes overexpression” is a longstanding and well-accepted concept in cancer genetics. However, raking the whole literature, we find only statistical analyses showing a positive correlation between gene copy number and expression level, but do not find convincing experimental corroboration for this notion, for most of the amplified oncogenes in cancers. Since an association does not need to be an actual causal relation, in our opinion, this widespread notion still remains a reasonable but unproven assumption awaiting experimental verification. PMID:27298590

  7. Amplification of the MET receptor drives resistance to anti-EGFR therapies in colorectal cancer

    PubMed Central

    Bardelli, Alberto; Corso, Simona; Bertotti, Andrea; Hobor, Sebastijan; Valtorta, Emanuele; Siravegna, Giulia; Sartore-Bianchi, Andrea; Scala, Elisa; Cassingena, Andrea; Zecchin, Davide; Apicella, Maria; Migliardi, Giorgia; Galimi, Francesco; Lauricella, Calogero; Zanon, Carlo; Perera, Timothy; Veronese, Silvio; Corti, Giorgio; Amatu, Alessio; Gambacorta, Marcello; Diaz, Luis A.; Sausen, Mark; Velculescu, Victor E.; Comoglio, Paolo; Trusolino, Livio; Di Nicolantonio, Federica; Giordano, Silvia; Siena, Salvatore

    2014-01-01

    EGFR targeted monoclonal antibodies are effective in a subset of metastatic colorectal tumors (mCRC). Inevitably, all patients develop resistance, which occurs through emergence of KRAS mutations in approximately 50% of the cases. We show that amplification of the MET proto-oncogene is associated with acquired resistance in patients who do not develop KRAS mutations during anti-EGFR therapy. Amplification of the MET locus was present in circulating tumor DNA before relapse was clinically evident. Functional studies demonstrate that MET activation confers resistance to anti-EGFR therapy both in vitro and in vivo. Notably, in patient-derived CRC xenografts, MET amplification correlated with resistance to EGFR blockade which could be overcome by MET kinase inhibitors. These results highlight the role of MET in mediating primary and secondary resistance to anti-EGFR therapies in CRC and encourage the use of MET inhibitors in patients displaying resistance as a result of MET amplification. PMID:23729478

  8. K-ras genetic mutation and influencing factor analysis for Han and Uygur nationality colorectal cancer patients.

    PubMed

    Eli, Mayinur; Mollayup, Ablikim; Muattar; Liu, Chao; Zheng, Chao; Bao, Yong-Xing

    2015-01-01

    To investigate the K-ras genetic mutation status in colorectal cancer patients, compare the difference of K-ras genetic mutation rate in Han and Uygur nationality and analyze the influencing factor. 91 cases (52 cases of Han nationality and 39 cases of Uygur nationality) of colorectal biopsy or surgical ablation pathology specimen from the first affiliated hospital of Xinjiang Medical University during January, 2010 to March, 2013 were collected to detect the 12th and 13th code mutation status of K-ras gene exon 2 with pyrosequencing method and compare the difference of K-ras gene mutation rate between Han and Uygur nationality patients. Single factor analysis and multiple factor logistic regression analysis were utilized to analyze the influencing factor for K-ras genetic mutation. 33 cases of patients with K-ras genetic mutation were found from the 91 cases colorectal cancer patients and the total mutation rate was 36.3%. Among them, 24 cases (72.7%) were found with mutation only in the 12th code, 9 cases (27.3%) were found with mutation only in the 13th code and no one case was found with mutation in both the two codes. Mutation rate of the 12th code in the Uygur nationality was significantly higher than that in the Han nationality (P<0.05), but there were no significant difference in the comparison of the total mutation rate and the 13th code mutation rate between the two groups (P>0.05). There were no associativity (P>0.05) between the K-ras genetic mutation and sex, age, smoking history, drinking history, tumor location, macropathology type, differentiation level, staging, invasive depth, lymph nodes transferring and metastasis in colorectal cancer patients (P>0.05). K-ras genetic mutation rate is high in colorectal cancer patients. The mutation rate of 12th code in Uygur nationality is higher than that in Han nationality. There is no significant associativity between K-ras genetic mutation rate and patients' clinical pathology characteristic.

  9. Detection and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to the hrp genes of Xanthomonas campestris pv. vesicatoria.

    PubMed Central

    Leite, R P; Minsavage, G V; Bonas, U; Stall, R E

    1994-01-01

    Three pairs of oligonucleotide primers specific for different regions of the hrp gene (hypersensitive reaction and pathogenicity) cluster of Xanthomonas campestris pv. vesicatoria were designed and tested for amplification of DNA isolated from a large number of different bacteria. DNA sequences related to the hrp genes were successfully amplified from X. fragariae and from 28 pathovars of X. campestris. No DNA amplification occurred with genomic DNA from phytopathogenic strains of X. campestris pv. secalis, X. campestris pv. translucens, and X. albilineans or from nonpathogenic opportunistic xanthomonads and phytopathogenic strains of the genera Acidovorax, Agrobacterium, Clavibacter, Erwinia, Pseudomonas, and Xylella. The DNA from those bacteria also failed to hybridize to hrp-specific fragments in Southern blot analysis. DNA fragments amplified with a particular primer pair were of identical size from each of the different phytopathogenic xanthomonads. However, restriction analysis of these fragments by using frequently cutting endonucleases revealed variation in the pattern for these hrp-related fragments amplified from the different Xanthomonas strains. The restriction patterns generated for the different fragments allowed distinction of the strains representing a pathovar or species of phytopathogenic xanthomonads. We believe that DNA amplification with hrp-specific oligonucleotide primers is a highly sensitive and specific method that can be applied for detection and identification of phytopathogenic xanthomonads. Images PMID:8017904

  10. Persistent nicotine treatment potentiates amplification of the dihydrofolate reductase gene in rat lung epithelial cells as a consequence of Ras activation.

    PubMed

    Guo, Jinjin; Chu, Michelle; Abbeyquaye, Tetteh; Chen, Chang-Yan

    2005-08-26

    Although nicotine has been suggested to promote lung carcinogenesis, the mechanism of its action in this process remains unknown. The present investigation demonstrates that the treatment of rat lung epithelial cells with nicotine for various periods differentially mobilizes multiple intracellular pathways. Protein kinase C and phosphoinositide 3-OH-kinase are transiently activated after the treatment. Also, Ras and its downstream effector ERK1/2 are activated after long term exposure to nicotine. The activation of Ras by nicotine treatment is responsible for the subsequent perturbation of the methotrexate (MTX)-mediated G1 cell cycle restriction as well as an increase in production of reactive oxygen species. When p53 expression is suppressed by introducing E6, persistent exposure to nicotine enables dihydrofolate reductase gene amplification in the presence of methotrexate (MTX) and the formation of the MTX-resistant colonies. Altering the activity of phosphoinositide 3-OH-kinase has no effect on dihydrofolate reductase amplification. However, the suppression of protein kinase C dramatically affects the colony formation in soft agar. Thus, our data suggest that persistent exposure to nicotine perturbs the G1 checkpoint and causes DNA damage through the increase of the production of reactive oxygen species. However, a third element rendered by loss of p53 is required for the initiation of the process of gene amplification. Under p53-deficient conditions, the establishment of a full oncogenic transformation, in response to long term nicotine exposure, is achieved through the cooperation of multiple signaling pathways. PMID:15983034

  11. Development and application of loop-mediated isothermal amplification methods targeting the seM gene for detection of Streptococcus equi subsp. equi.

    PubMed

    Hobo, Seiji; Niwa, Hidekazu; Oku, Kazuomi

    2012-03-01

    Loop-mediated isothermal amplification (LAMP) constitutes a potentially valuable diagnostic tool for rapid diagnosis of contagious diseases. In this study, we developed a novel LAMP method (seM-LAMP) to detect the seM gene of Streptococcus equi subsp. equi (S. equi), the causative agent of strangles in equids. The seM-LAMP successfully amplified the target sequence of the seM gene at 63°C within 60 min. The sensitivity of the seM-LAMP was slightly lower than the 2nd reaction of the seM semi-nested PCR. To evaluate the species specificity of the seM-LAMP, we tested 100 S. equi and 189 non-S. equi strains. Significant amplification of the DNA originating from S. equi was observed within 60 min incubation, but no amplification of non-S. equi DNA occurred. The results were identical to those of seM semi-nested PCR. To investigate the clinical usefulness of the methods, the seM-LAMP and the seM semi-nested PCR were used to screen 590 nasal swabs obtained during an outbreak of strangles. Both methods showed that 79 and 511 swabs were S. equi positive and negative, respectively, and the results were identical to those of the culture examination. These results indicate that the seM-LAMP is potentially useful for the reliable routine diagnosis of Streptococcus equi subsp. equi infections.

  12. Limitations to the development of recombinant human embryonic kidney 293E cells using glutamine synthetase-mediated gene amplification: Methionine sulfoximine resistance.

    PubMed

    Yu, Da Young; Noh, Soo Min; Lee, Gyun Min

    2016-08-10

    To investigate the feasibility of glutamine synthetase (GS)-mediated gene amplification in HEK293 cells for the high-level stable production of therapeutic proteins, HEK293E cells were transfected by the GS expression vector containing antibody genes and were selected at various methionine sulfoximine (MSX) concentrations in 96-well plates. For a comparison, CHOK1 cells were transfected by the same GS expression vector and selected at various MSX concentrations. Unlike CHOK1 cells, HEK293E cells producing high levels of antibodies were not selected at all. For HEK293E cells, the number of wells with the cell pool did not decrease with an increase in the concentration of MSX up to 500μM MSX. A q-RT-PCR analysis confirmed that the antibody genes in the HEK293E cells, unlike the CHOK1 cells, were not amplified after increasing the MSX concentration. It was found that the GS activity in HEK293E cells was much higher than that in CHOK1 cells (P<0.05). In a glutamine-free medium, the GS activity of HEK293E cells was approximately 4.8 times higher than that in CHOK1 cells. Accordingly, it is inferred that high GS activity of HEK293E cells results in elevated resistance to MSX and therefore hampers GS-mediated gene amplification by MSX. Thus, in order to apply the GS-mediated gene amplification system to HEK293 cells, the endogenous GS expression level in HEK293 cells needs to be minimized by knock-out or down-regulation methods. PMID:27288593

  13. Limitations to the development of recombinant human embryonic kidney 293E cells using glutamine synthetase-mediated gene amplification: Methionine sulfoximine resistance.

    PubMed

    Yu, Da Young; Noh, Soo Min; Lee, Gyun Min

    2016-08-10

    To investigate the feasibility of glutamine synthetase (GS)-mediated gene amplification in HEK293 cells for the high-level stable production of therapeutic proteins, HEK293E cells were transfected by the GS expression vector containing antibody genes and were selected at various methionine sulfoximine (MSX) concentrations in 96-well plates. For a comparison, CHOK1 cells were transfected by the same GS expression vector and selected at various MSX concentrations. Unlike CHOK1 cells, HEK293E cells producing high levels of antibodies were not selected at all. For HEK293E cells, the number of wells with the cell pool did not decrease with an increase in the concentration of MSX up to 500μM MSX. A q-RT-PCR analysis confirmed that the antibody genes in the HEK293E cells, unlike the CHOK1 cells, were not amplified after increasing the MSX concentration. It was found that the GS activity in HEK293E cells was much higher than that in CHOK1 cells (P<0.05). In a glutamine-free medium, the GS activity of HEK293E cells was approximately 4.8 times higher than that in CHOK1 cells. Accordingly, it is inferred that high GS activity of HEK293E cells results in elevated resistance to MSX and therefore hampers GS-mediated gene amplification by MSX. Thus, in order to apply the GS-mediated gene amplification system to HEK293 cells, the endogenous GS expression level in HEK293 cells needs to be minimized by knock-out or down-regulation methods.

  14. Heterogeneity of Colorectal Cancer (CRC) in reference to KRAS proto-oncogene utilizing WAVE technology

    PubMed Central

    Perez, K; Walsh, R; Brilliant, K; Noble, L; Yakerivich, E; Breese, V; Jackson, C; Chatterjee, D; Pricolo, V; Roth, L; Shah, N; Cataldo, T; Safran, H; Hixson, D; Quesenberry, P

    2014-01-01

    Background New drugs targeting specific genes required for unregulated growth and metastases have improved survival rates for patients with metastatic colorectal cancer. Resistance to monoclonal antibodies specific for the epidermal growth factor receptor (EGFR) has been attributed to the presence of activating point mutations in the proto-oncogene KRAS. The use of EGFR inhibitor monotherapy in patients that have KRAS wild type has produced response rates of only 10–20%. The molecular basis for clinical resistance remains poorly understood. We propose two possible explanations to explain these low response rates; 1) levels of resistant CRC cells carrying mutated KRAS are below the sensitivity of standard direct sequencing modalities (<5%) or 2) the standard practice of analyzing a single area within a heterogeneous tumor is a practice that can overlook areas with mutated KRAS. Methods In a collaborative effort with the surgical and molecular pathology departments, 3 formalin fixed paraffin embedded tissue blocks of human CRC were obtained from the human tissue bank maintained by Lifespan Pathology Department and/or the human tissue bank maintained by the Molecular Pathology Core of the COBRE for Cancer Research Development. The three specimens previously demonstrated KRAS mutations detected by the Applied Biosystems Kit. The Wave system 4500 (High performance ion-pairing liquid chromatography (IP-HPLC)) was utilized to evaluate tissue for presence of KRAS proto-oncogene mutations at codon 12 and 13. Results Initially, sensitivity of WAVE technology was compared with direct sequencing by evaluating a dilutional series. WAVE detected mutant alleles at levels of 2.5% compared to 20% performed with standard direct sequencing. Samples from three patients were evaluated by WAVE technology. Eight samples from patient 1 were analyzed. In two of eight samples, no mutations were detected at concentrations as low as 5%. In one sample a mutation was noted by WAVE and not by

  15. KRAS2 oncogene overexpression in myelodysplastic syndrome with translocation 5;12.

    PubMed

    Srivastava, A; Boswell, H S; Heerema, N A; Nahreini, P; Lauer, R C; Antony, A C; Hoffman, R; Tricot, G J

    1988-10-01

    The factors that initiate and maintain the abnormal hematopoietic clone in the myelo-dysplastic syndromes (MDS) remain largely unknown. We describe a patient with MDS associated with an abnormal karyotype, 46,XY,t(5;12)(q31;p12). According to the FAB cooperative group classification, the patient was classified as chronic myelomonocytic leukemia. Because of the particular chromosomal translocation, the structure-function relationship of three genes relevant to the translocation breakpoints, CSF2, FMS, and KRAS2, was studied in bone marrow and peripheral blood lymphocytes in this patient. No major structural alterations were observed at these three genetic loci. Although the levels of expression of the CSF2 and FMS genes remained unaltered, the KRAS2 oncogene was overexpressed approximately six-fold in bone marrow cells from the MDS patient compared with normal donors. We postulate that the RAS oncogene activation may be instrumental in the genesis of MDS.

  16. Combined inhibition of DDR1 and Notch signaling is a therapeutic strategy for KRAS-driven lung adenocarcinoma.

    PubMed

    Ambrogio, Chiara; Gómez-López, Gonzalo; Falcone, Mattia; Vidal, August; Nadal, Ernest; Crosetto, Nicola; Blasco, Rafael B; Fernández-Marcos, Pablo J; Sánchez-Céspedes, Montserrat; Ren, Xiaomei; Wang, Zhen; Ding, Ke; Hidalgo, Manuel; Serrano, Manuel; Villanueva, Alberto; Santamaría, David; Barbacid, Mariano

    2016-03-01

    Patients with advanced Kirsten rat sarcoma viral oncogene homolog (KRAS)-mutant lung adenocarcinoma are currently treated with standard chemotherapy because of a lack of efficacious targeted therapies. We reasoned that the identification of mediators of Kras signaling in early mouse lung hyperplasias might bypass the difficulties that are imposed by intratumor heterogeneity in advanced tumors, and that it might unveil relevant therapeutic targets. Transcriptional profiling of Kras(G12V)-driven mouse hyperplasias revealed intertumor diversity with a subset that exhibited an aggressive transcriptional profile analogous to that of advanced human adenocarcinomas. The top-scoring gene in this profile encodes the tyrosine kinase receptor DDR1. The genetic and pharmacological inhibition of DDR1 blocked tumor initiation and tumor progression, respectively. The concomitant inhibition of both DDR1 and Notch signaling induced the regression of KRAS;TP53-mutant patient-derived lung xenografts (PDX) with a therapeutic efficacy that was at least comparable to that of standard chemotherapy. Our data indicate that the combined inhibition of DDR1 and Notch signaling could be an effective targeted therapy for patients with KRAS-mutant lung adenocarcinoma.

  17. 5-Fluorouracil preferentially sensitizes mutant KRAS non-small cell lung carcinoma cells to TRAIL-induced apoptosis.

    PubMed

    Wang, Haizhen; Yang, Tao; Wu, Xiangwei

    2015-11-01

    Mutations in the KRAS gene are very common in non-small cell lung cancer (NSCLC), but effective therapies targeting KRAS have yet to be developed. Interest in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a potent inducer of cell death, has increased following the observation that TRAIL can selectively kill a wide variety of human cancer cells without killing normal cells both in vitro and in xenograft models. However, results from clinical trials of TRAIL-based therapy are disappointingly modest at best and many have demonstrated a lack of therapeutic benefit. Current research has focused on selecting a subpopulation of cancer patients who may benefit from TRAIL-based therapy and identifying best drugs to work with TRAIL. In the current study, we found that NSCLC cells with a KRAS mutation were highly sensitive to treatment with TRAIL and 5-fluorouracil (5FU). Compared with other chemotherapeutic agents, 5FU displayed the highest synergy with TRAIL in inducing apoptosis in mutant KRAS NSCLC cells. We also found that, on a mechanistic level, 5FU preferentially repressed survivin expression and induced expression of TRAIL death receptor 5 to sensitize NSCLC cells to TRAIL. The combination of low-dose 5FU and TRAIL strongly inhibited xenograft tumor growth in mice. Our results suggest that the combination of TRAIL and 5FU may be beneficial for patients with mutant KRAS NSCLC.

  18. Differential gene expression in neurospora crassa cell types: amplification of rRNA genes. Progress report, July 1979-30 June 1980

    SciTech Connect

    Dutta, S.K.

    1980-01-01

    The significant results obtained during 1979 to 1980 of the current research program are as follows: (1) the differential rRNA gene amplification in germinated conidia of N.crassa was confirmed. N.crassa rDNAs showed differences in degrees of homology with isolated DNAs from other Neurospora species which could be due to heterogeneity in internal spacers. Studies with N.crassa rDNA clones were initiated to study their heterogeneities. The organization of the Institutional Biohazard Committee (IBC) for Recombinant DNA research was completed and necessary certifications for the laboratory and the workers were obtained in accordance with the P/sub 2/EK/sub 1/ containment regulation of N.I.H. Known 17S and 26S N.crassa rDNA probes are being used to detect differences, if any, in restriction cleavage sites in rDNAs of different cell types and developmental mutants of N.crassa. DNAs from these N.crassa cells are restricted with EcoR/sub 1/ and Hind III and cleaved fragments separated by gel electrophoresis are transferred into nitrocellulose papers. Experiments are underway now to see if there are any changes in cleavage sites by annealing with /sup 32/P or /sup 3/H-17S or 26S rDNA probes followed by autoradiography.

  19. Increased expression of Solute carrier family 12 member 5 via gene amplification contributes to tumour progression and metastasis and associates with poor survival in colorectal cancer

    PubMed Central

    Xu, Lixia; Li, Xiaoxing; Cai, Muyan; Chen, Jinna; Li, Xiangchun; Wu, William K K; Kang, Wei; Tong, Joanna; To, Ka-Fai; Guan, Xin-Yuan; Sung, Joseph J Y; Chan, Francis K L; Yu, Jun

    2016-01-01

    Objective Using whole genome sequencing, we identified gene amplification of solute carrier family 12 member 5 (SLC12A5) located at 20q13.12 in colorectal cancer (CRC). We analysed its amplification, overexpression, biological effects and prognostic significance in CRC. Design SLC12A5 amplification status was evaluated by fluorescence in situ hybridisation (FISH). The effects of SLC12A5 re-expression or knockdown were determined in proliferation, apoptosis, invasion and metastasis assays. SLC12A5 target genes and related pathways were identified by reporter activity and cDNA microarray analyses. Clinical impact of SLC12A5 overexpression was assessed in 195 patients with CRC. Results Amplification of SLC12A5 was verified in 78 out of 191 (40.8%) patients with primary CRC by FISH, which was positively correlated with its protein overexpression (p<0.001). Biofunctional investigation of SLC12A5 revealed that SLC12A5 significantly increased cell proliferation, G1-S cell cycle transition, invasion/migration abilities, but suppressed apoptosis in vitro and promoted xenograft tumour growth as well as lung metastasis in vivo. The antiapoptosis effect by SLC12A5 was mediated through inhibiting apoptosis-inducing factor and endonuclease G-dependent apoptotic signalling pathway; and the pro-metastasis role was by regulating key elements of the matrix architecture, including matrix metallopeptidase and fibronectin. After a median follow-up of 50.16 months, multivariate analysis revealed that patients with SLC12A5 protein overexpression had a significant decrease in overall survival. Kaplan–Meier survival curves showed that SLC12A5 overexpression was significantly associated with shortened survival in patients with CRC. Conclusions SLC12A5 plays a pivotal oncogenic role in colorectal carcinogenesis; its overexpression is an independent prognostic factor of patients with CRC. PMID:25947013

  20. Frederick National Lab and the Pancreatic Cancer Action Network Award Fellowships for KRAS Research | Poster

    Cancer.gov

    By Nancy Parrish, Staff Writer The Frederick National Laboratory for Cancer Research (FNLCR) recently formed a partnership with the Pancreatic Cancer Action Network (PanCAN) to award a one-year fellowship to two scientists whose research will help lead to new therapies for pancreatic cancer. The scientists will focus on KRAS, a gene in the RAS family that is mutated in 95 percent of pancreatic cancers, according to the National Cancer Institute (NCI).

  1. Loop-Mediated Isothermal Amplification (LAMP) for Rapid Detection and Quantification of Dehalococcoides Biomarker Genes in Commercial Reductive Dechlorinating Cultures KB-1 and SDC-9.

    PubMed

    Kanitkar, Yogendra H; Stedtfeld, Robert D; Steffan, Robert J; Hashsham, Syed A; Cupples, Alison M

    2016-01-08

    Real-time quantitative PCR (qPCR) protocols specific to the reductive dehalogenase (RDase) genes vcrA, bvcA, and tceA are commonly used to quantify Dehalococcoides spp. in groundwater from chlorinated solvent-contaminated sites. In this study, loop-mediated isothermal amplification (LAMP) was developed as an alternative approach for the quantification of these genes. LAMP does not require a real-time thermal cycler (i.e., amplification is isothermal), allowing the method to be performed using less-expensive and potentially field-deployable detection devices. Six LAMP primers were designed for each of three RDase genes (vcrA, bvcA, and tceA) using Primer Explorer V4. The LAMP assays were compared to conventional qPCR approaches using plasmid standards, two commercially available bioaugmentation cultures, KB-1 and SDC-9 (both contain Dehalococcoides species). DNA was extracted over a growth cycle from KB-1 and SDC-9 cultures amended with trichloroethene and vinyl chloride, respectively. All three genes were quantified for KB-1, whereas only vcrA was quantified for SDC-9. A comparison of LAMP and qPCR using standard plasmids indicated that quantification results were similar over a large range of gene concentrations. In addition, the quantitative increase in gene concentrations over one growth cycle of KB-1 and SDC-9 using LAMP was comparable to that of qPCR. The developed LAMP assays for vcrA and tceA genes were validated by comparing quantification on the Gene-Z handheld platform and a real-time thermal cycler using DNA isolated from eight groundwater samples obtained from an SDC-9-bioaugmented site (Tulsa, OK). These assays will be particularly useful at sites subject to bioaugmentation with these two commonly used Dehalococcoides species-containing cultures.

  2. Loop-Mediated Isothermal Amplification (LAMP) for Rapid Detection and Quantification of Dehalococcoides Biomarker Genes in Commercial Reductive Dechlorinating Cultures KB-1 and SDC-9

    PubMed Central

    Kanitkar, Yogendra H.; Stedtfeld, Robert D.; Steffan, Robert J.; Hashsham, Syed A.

    2016-01-01

    Real-time quantitative PCR (qPCR) protocols specific to the reductive dehalogenase (RDase) genes vcrA, bvcA, and tceA are commonly used to quantify Dehalococcoides spp. in groundwater from chlorinated solvent-contaminated sites. In this study, loop-mediated isothermal amplification (LAMP) was developed as an alternative approach for the quantification of these genes. LAMP does not require a real-time thermal cycler (i.e., amplification is isothermal), allowing the method to be performed using less-expensive and potentially field-deployable detection devices. Six LAMP primers were designed for each of three RDase genes (vcrA, bvcA, and tceA) using Primer Explorer V4. The LAMP assays were compared to conventional qPCR approaches using plasmid standards, two commercially available bioaugmentation cultures, KB-1 and SDC-9 (both contain Dehalococcoides species). DNA was extracted over a growth cycle from KB-1 and SDC-9 cultures amended with trichloroethene and vinyl chloride, respectively. All three genes were quantified for KB-1, whereas only vcrA was quantified for SDC-9. A comparison of LAMP and qPCR using standard plasmids indicated that quantification results were similar over a large range of gene concentrations. In addition, the quantitative increase in gene concentrations over one growth cycle of KB-1 and SDC-9 using LAMP was comparable to that of qPCR. The developed LAMP assays for vcrA and tceA genes were validated by comparing quantification on the Gene-Z handheld platform and a real-time thermal cycler using DNA isolated from eight groundwater samples obtained from an SDC-9-bioaugmented site (Tulsa, OK). These assays will be particularly useful at sites subject to bioaugmentation with these two commonly used Dehalococcoides species-containing cultures. PMID:26746711

  3. Loop-Mediated Isothermal Amplification (LAMP) for Rapid Detection and Quantification of Dehalococcoides Biomarker Genes in Commercial Reductive Dechlorinating Cultures KB-1 and SDC-9.

    PubMed

    Kanitkar, Yogendra H; Stedtfeld, Robert D; Steffan, Robert J; Hashsham, Syed A; Cupples, Alison M

    2016-03-01

    Real-time quantitative PCR (qPCR) protocols specific to the reductive dehalogenase (RDase) genes vcrA, bvcA, and tceA are commonly used to quantify Dehalococcoides spp. in groundwater from chlorinated solvent-contaminated sites. In this study, loop-mediated isothermal amplification (LAMP) was developed as an alternative approach for the quantification of these genes. LAMP does not require a real-time thermal cycler (i.e., amplification is isothermal), allowing the method to be performed using less-expensive and potentially field-deployable detection devices. Six LAMP primers were designed for each of three RDase genes (vcrA, bvcA, and tceA) using Primer Explorer V4. The LAMP assays were compared to conventional qPCR approaches using plasmid standards, two commercially available bioaugmentation cultures, KB-1 and SDC-9 (both contain Dehalococcoides species). DNA was extracted over a growth cycle from KB-1 and SDC-9 cultures amended with trichloroethene and vinyl chloride, respectively. All three genes were quantified for KB-1, whereas only vcrA was quantified for SDC-9. A comparison of LAMP and qPCR using standard plasmids indicated that quantification results were similar over a large range of gene concentrations. In addition, the quantitative increase in gene concentrations over one growth cycle of KB-1 and SDC-9 using LAMP was comparable to that of qPCR. The developed LAMP assays for vcrA and tceA genes were validated by comparing quantification on the Gene-Z handheld platform and a real-time thermal cycler using DNA isolated from eight groundwater samples obtained from an SDC-9-bioaugmented site (Tulsa, OK). These assays will be particularly useful at sites subject to bioaugmentation with these two commonly used Dehalococcoides species-containing cultures. PMID:26746711

  4. Miniature Inverted–Repeat Transposable Elements (MITEs) Have Been Accumulated through Amplification Bursts and Play Important Roles in Gene Expression and Species Diversity in Oryza sativa

    PubMed Central

    Lu, Chen; Chen, Jiongjiong; Zhang, Yu; Hu, Qun; Su, Wenqing; Kuang, Hanhui

    2012-01-01

    Miniature inverted–repeat transposable elements (MITEs) are predicted to play important roles on genome evolution. We developed a BLASTN-based approach for de novo identification of MITEs and systematically analyzed MITEs in rice genome. The genome of rice cultivar Nipponbare (Oryza sativa ssp. japonica) harbors 178,533 MITE-related sequences classified into 338 families. Pairwise nucleotide diversity and phylogenetic tree analysis indicated that individual MITE families were resulted from one or multiple rounds of amplification bursts. The timing of amplification burst varied considerably between different MITE families or subfamilies. MITEs are associated with 23,623 (58.2%) genes in rice genome. At least 7,887 MITEs are transcribed and more than 3,463 were transcribed with rice genes. The MITE sequences transcribed with rice coding genes form 1,130 pairs of potential natural sense/antisense transcripts. MITEs generate 23.5% (183,837 of 781,885) of all small RNAs identified from rice. Some MITE families generated small RNAs mainly from the terminals, while other families generated small RNAs predominantly from the central region. More than half (51.8%) of the MITE-derived small RNAs were generated exclusively by MITEs located away from genes. Genome-wide analysis showed that genes associated with MITEs have significantly lower expression than genes away from MITEs. Approximately 14.8% of loci with full-length MITEs have presence/absence polymorphism between rice cultivars 93-11 (O. sativa ssp. indica) and Nipponbare. Considering that different sets of genes may be regulated by MITE-derived small RNAs in different genotypes, MITEs provide considerable diversity for O. sativa. PMID:22096216

  5. The full-length E1-circumflexE4 protein of human papillomavirus type 18 modulates differentiation-dependent viral DNA amplification and late gene expression

    SciTech Connect

    Wilson, Regina; Ryan, Gordon B.; Knight, Gillian L.; Laimins, Laimonis A.; Roberts, Sally . E-mail: s.roberts@bham.ac.uk

    2007-06-05

    Activation of the productive phase of the human papillomavirus (HPV) life cycle in differentiated keratinocytes is coincident with high-level expression of E1-circumflexE4 protein. To determine the role of E1-circumflexE4 in the HPV replication cycle, we constructed HPV18 mutant genomes in which expression of the full-length E1-circumflexE4 protein was abrogated. Undifferentiated keratinocytes containing mutant genomes showed enhanced proliferation when compared to cells containing wildtype genomes, but there were no differences in maintenance of viral episomes. Following differentiation, cells with mutant genomes exhibited reduced levels of viral DNA amplification and late gene expression, compared to wildtype genome-containing cells. This indicates that HPV18 E1-circumflexE4 plays an important role in regulating HPV late functions, and it may also function in the early phase of the replication cycle. Our finding that full-length HPV18 E1-circumflexE4 protein plays a significant role in promoting viral genome amplification concurs with a similar report with HPV31, but is in contrast to an HPV11 study where viral DNA amplification was not dependent on full-length E1-circumflexE4 expression, and to HPV16 where only C-terminal truncations in E1-circumflexE4 abrogated vegetative genome replication. This suggests that type-specific differences exist between various E1-circumflexE4 proteins.

  6. Atorvastatin overcomes gefitinib resistance in KRAS mutant human non-small cell lung carcinoma cells.

    PubMed

    Chen, J; Bi, H; Hou, J; Zhang, X; Zhang, C; Yue, L; Wen, X; Liu, D; Shi, H; Yuan, J; Liu, J; Liu, B

    2013-09-26

    The exact influence of statins on gefitinib resistance in human non-small cell lung cancer (NSCLC) cells with KRAS mutation alone or KRAS/PIK3CA and KRAS/PTEN comutations remains unclear. This work found that transfection of mutant KRAS plasmids significantly suppressed the gefitinib cytotoxicity in Calu3 cells (wild-type KRAS). Gefitinib disrupted the Kras/PI3K and Kras/Raf complexes in Calu3 cells, whereas not in Calu3 KRAS mutant cells. These trends were corresponding to the expression of pAKT and pERK in gefitinib treatment. Atorvastatin (1 μM) plus gefitinib treatment inhibited proliferation, promoted cell apoptosis, and reduced the AKT activity in KRAS mutant NSCLC cells compared with gefitinib alone. Atorvastatin (5 μM) further enhanced the gefitinib cytotoxicity through concomitant inhibition of AKT and ERK activity. Atorvastatin could interrupt Kras/PI3K and Kras/Raf complexes, leading to suppression of AKT and ERK activity. Similar results were also obtained in comutant KRAS/PTEN or KRAS/PIK3CA NSCLC cells. Furthermore, mevalonate administration reversed the effects of atorvastatin on the Kras/Raf and Kras/PI3K complexes, as well as AKT and ERK activity in both A549 and Calu1 cells. The in vivo results were similar to those obtained in vitro. Therefore, mutant KRAS-mediated gefitinib insensitivity is mainly derived from failure to disrupt the Kras/Raf and Kras/PI3K complexes in KRAS mutant NSCLC cells. Atorvastatin overcomes gefitinib resistance in KRAS mutant NSCLC cells irrespective of PIK3CA and PTEN statuses through inhibition of HMG-CoA reductase-dependent disruption of the Kras/Raf and Kras/PI3K complexes.

  7. Clinical Next-Generation Sequencing Pipeline Outperforms a Combined Approach Using Sanger Sequencing and Multiplex Ligation-Dependent Probe Amplification in Targeted Gene Panel Analysis.

    PubMed

    Schenkel, Laila C; Kerkhof, Jennifer; Stuart, Alan; Reilly, Jack; Eng, Barry; Woodside, Crystal; Levstik, Alexander; Howlett, Christopher J; Rupar, Anthony C; Knoll, Joan H M; Ainsworth, Peter; Waye, John S; Sadikovic, Bekim

    2016-09-01

    Advances in next-generation sequencing (NGS) have facilitated parallel analysis of multiple genes enabling the implementation of cost-effective, rapid, and high-throughput methods for the molecular diagnosis of multiple genetic conditions, including the identification of BRCA1 and BRCA2 mutations in high-risk patients for hereditary breast and ovarian cancer. We clinically validated a NGS pipeline designed to replace Sanger sequencing and multiplex ligation-dependent probe amplification analysis and to facilitate detection of sequence and copy number alterations in a single test focusing on a BRCA1/BRCA2 gene analysis panel. Our custom capture library covers 46 exons, including BRCA1 exons 2, 3, and 5 to 24 and BRCA2 exons 2 to 27, with 20 nucleotides of intronic regions both 5' and 3' of each exon. We analyzed 402 retrospective patients, with previous Sanger sequencing and multiplex ligation-dependent probe amplification results, and 240 clinical prospective patients. One-hundred eighty-three unique variants, including sequence and copy number variants, were detected in the retrospective (n = 95) and prospective (n = 88) cohorts. This standardized NGS pipeline demonstrated 100% sensitivity and 100% specificity, uniformity, and high-depth nucleotide coverage per sample (approximately 7000 reads per nucleotide). Subsequently, the NGS pipeline was applied to the analysis of larger gene panels, which have shown similar uniformity, sample-to-sample reproducibility in coverage distribution, and sensitivity and specificity for detection of sequence and copy number variants.

  8. Rapid detection of Candida albicans in clinical samples by DNA amplification of common regions from C. albicans-secreted aspartic proteinase genes.

    PubMed

    Flahaut, M; Sanglard, D; Monod, M; Bille, J; Rossier, M

    1998-02-01

    Laboratory diagnosis based on genomic amplification methods such as PCR may provide an alternative and more sensitive method than conventional culture for the early detection of deep-seated candidiasis, an increasing cause of morbidity and mortality among immunocompromised patients. A novel method of DNA extraction from clinical samples based on treatment with proteinase K and isolation of DNA on a silica membrane was developed. The targets used for DNA amplification were the Candida albicans-secreted aspartic proteinase (SAP) genes, a multiple-gene family of at least seven members in C. albicans. A single pair of primers was designed in order to detect six of these SAP genes and, subsequently, to increase the sensitivity of the test. Detection of the PCR product by enzyme-linked immunosorbent assay was found to be as sensitive as Southern blotting with an SAP-labeled probe. The sensitivity of the assay was 1 cell/ml from serially diluted Candida cultures and 1 to 4 cells/ml from seeded blood specimens. The sensitivity and specificity of the present assay were tested in a retrospective study performed blindly with 156 clinical samples and were 100 and 98%, respectively, compared with the results of culture. For the subset of blood culture samples (n = 124), the sensitivity and the specificity were 100%. The two false-positive PCR samples came from patients treated with azole antifungal agents, indicating that PCR was probably able to detect damaged organisms that could not be recovered by culture.

  9. Enhanced detection of DNA sequences using end-point PCR amplification and online gel electrophoresis (GE)-ICP-MS: determination of gene copy number variations.

    PubMed

    González, T Iglesias; Espina, M; Sierra, L M; Bettmer, J; Blanco-González, E; Montes-Bayón, M; Sanz-Medel, A

    2014-11-18

    The design and evaluation of analytical methods that permit quantitative analysis of specific DNA sequences is exponentially increasing. For this purpose, highly sensitive methodologies usually based on labeling protocols with fluorescent dyes or nanoparticles are often explored. Here, the possibility of label-free signal amplification using end-point polymerase chain reaction (PCR) are exploited using on-column agarose gel electrophoresis as separation and inductively coupled plasma-mass spectrometry (ICP-MS) for the detection of phosphorus in amplified DNA sequences. The calibration of the separation system with a DNA ladder permits direct estimation of the size of the amplified gene fragment after PCR. With this knowledge, and considering the compound-independent quantification capabilities exhibited by ICP-MS for phosphorus (it is only dependent on the number of P atoms per molecule), the correlation of the P-peak area of the amplified gene fragment, with respect to the gene copy numbers (in the starting DNA), is then established. Such a relationship would permit the determination of copy number variations (CNVs) in genomic DNA using ICP-MS measurements. The method detection limit, in terms of the required amount of starting DNA, is ∼6 ng (or 1000 cells if 100% extraction efficiency is expected). The suitability of the proposed label-free amplification strategy is applied to CNVs monitoring in cells exposed to a chemical agent capable of deletion induction, such as cisplatin. PMID:25312744

  10. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    PubMed

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  11. MicroRNA-27a directly targets KRAS to inhibit cell proliferation in esophageal squamous cell carcinoma

    PubMed Central

    JIANG, YUZHI; DUAN, YUTING; ZHOU, HAIBIN

    2015-01-01

    MicroRNAs (miRNAs) are a type of small non-coding RNA that negatively regulate gene expression levels by binding to the 3′-untranslated region of specific target mRNAs. To investigate the role of miR-27a in esophageal squamous cell carcinoma (ESCC), TargetScan software was used to predict the target gene of miR-27a. Kirsten rat sarcoma viral oncogene homolog (KRAS), which has been implicated as a regulator of cell proliferation, differentiation and transformation, was identified as a potential target gene of miR-27a and, thus, was the focus of the present study. Luciferase activity in cells transfected with miR-27a mimics was 48% lower when compared with that of the miRNA-negative control. Furthermore, expression levels of the K-ras protein were reduced by ≤50% in cells cotransfected with an expression vector containing miR-27a and miR-27a binding sequences, when compared with the control. The expression level of miR-27a was significantly lower in ESCC cell lines and tissues when compared with healthy esophageal epithelial cells and tissues. However, the expression level of the target gene, KRAS was upregulated and ESCC cell proliferation was significantly inhibited following miR-27a mimic or small interfering K-ras transfection. In conclusion, the present study demonstrated that the expression level of miR-27a was low in ESCC and that miR-27a directly targets the KRAS gene, resulting in inhibited cell proliferation in esophageal cancer. PMID:25436011

  12. K-Ras mutation detection in liquid biopsy and tumor tissue as prognostic biomarker in patients with pancreatic cancer: a systematic review with meta-analysis.

    PubMed

    Li, Tao; Zheng, Yuanting; Sun, Hong; Zhuang, Rongyuan; Liu, Jing; Liu, Tianshu; Cai, Weimin

    2016-07-01

    K-Ras gene mutations have been found in most pancreatic cancers; however, conflicting data on the prognostic value of K-Ras mutations in pancreatic cancer have been published. We conducted a meta-analysis to assess its prognostic significance. Literature searches of PubMed, EMBASE, Cochrane Library, Web of Science and Google Scholar were performed through December 2015 to identify publications exploring the association of K-Ras mutation with overall survival. Forty eligible studies involving 3427 patients with pancreatic cancer were included in the present meta-analysis. Our analysis showed a hazard ratio (HR) of negative association with survival of 1.61 [95 % confidence interval (CI) 1.36-1.90; p < 0.01] in K-Ras mutant pancreatic cancer patients. In subgroup analyses, K-Ras mutations detected in tumor tissues and in liquid biopsies had HRs of 1.37 (95 % CI 1.20-1.57; p < 0.01) and 3.16 (95 % CI 2.1-4.71; p < 0.01), respectively. In addition, the HR was higher when K-Ras mutations were detected in fresh frozen samples (HR = 2.01, 95 % CI 1.28-3.16, p = 0.002) than in formalin-fixed, paraffin-embedded (FFPE) samples (HR = 1.29, 95 % CI 1.12-1.49, p < 0.01). Though K-Ras alterations are more frequent among non-East Asian individuals than East Asian individuals, there were no significant differences in HRs of survival between the two ethnic subgroups. In conclusion, this meta-analysis suggests that K-Ras mutations are associated with a worse overall survival in pancreatic cancer patients, especially when mutations are detected in liquid biopsies or fresh frozen tumor tissue samples.

  13. K-Ras mutation detection in liquid biopsy and tumor tissue as prognostic biomarker in patients with pancreatic cancer: a systematic review with meta-analysis.

    PubMed

    Li, Tao; Zheng, Yuanting; Sun, Hong; Zhuang, Rongyuan; Liu, Jing; Liu, Tianshu; Cai, Weimin

    2016-07-01

    K-Ras gene mutations have been found in most pancreatic cancers; however, conflicting data on the prognostic value of K-Ras mutations in pancreatic cancer have been published. We conducted a meta-analysis to assess its prognostic significance. Literature searches of PubMed, EMBASE, Cochrane Library, Web of Science and Google Scholar were performed through December 2015 to identify publications exploring the association of K-Ras mutation with overall survival. Forty eligible studies involving 3427 patients with pancreatic cancer were included in the present meta-analysis. Our analysis showed a hazard ratio (HR) of negative association with survival of 1.61 [95 % confidence interval (CI) 1.36-1.90; p < 0.01] in K-Ras mutant pancreatic cancer patients. In subgroup analyses, K-Ras mutations detected in tumor tissues and in liquid biopsies had HRs of 1.37 (95 % CI 1.20-1.57; p < 0.01) and 3.16 (95 % CI 2.1-4.71; p < 0.01), respectively. In addition, the HR was higher when K-Ras mutations were detected in fresh frozen samples (HR = 2.01, 95 % CI 1.28-3.16, p = 0.002) than in formalin-fixed, paraffin-embedded (FFPE) samples (HR = 1.29, 95 % CI 1.12-1.49, p < 0.01). Though K-Ras alterations are more frequent among non-East Asian individuals than East Asian individuals, there were no significant differences in HRs of survival between the two ethnic subgroups. In conclusion, this meta-analysis suggests that K-Ras mutations are associated with a worse overall survival in pancreatic cancer patients, especially when mutations are detected in liquid biopsies or fresh frozen tumor tissue samples. PMID:27225938

  14. KRAS and PIK3CA mutation frequencies in patient-derived xenograft models of pancreatic and colorectal cancer are reflective of patient tumors and stable across passages.

    PubMed

    Tignanelli, Christopher J; Herrera Loeza, Silvia G; Yeh, Jen Jen

    2014-09-01

    One obstacle in the translation of advances in cancer research into the clinic is a deficiency of adequate preclinical models that recapitulate human disease. Patient-derived xenograft (PDX) models are established by engrafting patient tumor tissue into mice and are advantageous because they capture tumor heterogeneity. One concern with these models is that selective pressure could lead to mutational drift and thus be an inaccurate reflection of patient tumors. Therefore, we evaluated if mutational frequency in PDX models is reflective of patient populations and if crucial mutations are stable across passages. We examined KRAS and PIK3CA gene mutations from pancreatic ductal adenocarcinoma (PDAC) (n = 30) and colorectal cancer (CRC) (n = 37) PDXs for as many as eight passages. DNA was isolated from tumors and target sequences were amplified by polymerase chain reaction. KRAS codons 12/13 and PIK3CA codons 542/545/1047 were examined using pyrosequencing. Twenty-three of 30 (77%) PDAC PDXs had KRAS mutations and one of 30 (3%) had PIK3CA mutations. Fifteen of 37 (41%) CRC PDXs had KRAS mutations and three of 37 (8%) had PIK3CA mutations. Mutations were 100 per cent preserved across passages. We found that the frequency of KRAS (77%) and PIK3CA (3%) mutations in PDAC PDX was similar to frequencies in patient tumors (71 to 100% KRAS, 0 to 11% PIK3CA). Similarly, KRAS (41%) and PIK3CA (8%) mutations in CRC PDX closely paralleled patient tumors (35 to 51% KRAS, 12 to 21% PIK3CA). The accurate mirroring and stability of genetic changes in PDX models compared with patient tumors suggest that these models are good preclinical surrogates for patient tumors.

  15. KRAS and GNAS Mutations in Pancreatic Juice Collected From the Duodenum of Patients at High Risk for Neoplasia Undergoing Endoscopic Ultrasound

    PubMed Central

    Eshleman, James R.; Norris, Alexis L.; Sadakari, Yoshihiko; Debeljak, Marija; Borges, Michael; Harrington, Colleen; Lin, Elaine; Brant, Aaron; Barkley, Thomas; Almario, J. Alejandro; Topazian, Mark; Farrell, James; Syngal, Sapna; Lee, Jeffrey H.; Yu, Jun; Hruban, Ralph H.; Kanda, Mitsuro; Canto, Marcia Irene; Goggins, Michael

    2014-01-01

    BACKGROUND & AIMS Pancreatic imaging can identify neoplastic cysts but not microscopic neoplasms. Mutation analysis of pancreatic fluid following secretin stimulation might identify microscopic neoplasias in the pancreatic duct system. We determined the prevalence of mutations in KRAS and GNAS genes in pancreatic juice from subjects undergoing endoscopic ultrasound for suspected pancreatic intraepithelial neoplasia (PanIN), intraductal papillary mucinous neoplasms, or pancreatic adenocarcinoma. METHODS Secretin-stimulated juice samples were collected from the duodenum of 272 subjects enrolled in Cancer of the Pancreas Screening studies; 194 subjects were screened because of a family history of, or genetic predisposition to, pancreatic cancer and 78 were evaluated for pancreatic cancer (n=30) or other disorders (controls: pancreatic cysts, pancreatitis, or normal pancreata, n=48). Mutations were detected by digital high-resolution melt-curve analysis and pyrosequencing. The number of replicates containing a mutation determined the mutation score. RESULTS KRAS mutations were detected in pancreatic juice from larger percentages of subjects with pancreatic cancer (73%) or undergoing cancer screening (50%) than controls (19%) (P=.0005). A greater proportion of patients with pancreatic cancer had at least 1 KRAS mutation detected 3 or more times (47%) than screened subjects (21%) or controls (6%, P=.002). Among screened subjects, mutations in KRAS (but not GNAS) were found in similar percentages of patients with or without pancreatic cysts. However, a greater proportion of patients over 50 ys old had KRAS mutations (54.6%) than younger patients (36.3%) (P=.032); the older subjects also more mutations in KRAS (P=.02). CONCLUSIONS Mutations in KRAS are detected in pancreatic juice from the duodenum of 73% of patients with pancreatic cancer, and 50% of asymptomatic individuals with a high risk for pancreatic cancer. However, KRAS mutations are detected in pancreatic juice

  16. Prognostic Significance of ESR1 Gene Amplification, mRNA/Protein Expression and Functional Profiles in High-Risk Early Breast Cancer: A Translational Study of the Hellenic Cooperative Oncology Group (HeCOG)

    PubMed Central

    Pentheroudakis, George; Kotoula, Vassiliki; Eleftheraki, Anastasia G.; Tsolaki, Eleftheria; Wirtz, Ralph M.; Kalogeras, Konstantine T.; Batistatou, Anna; Bobos, Mattheos; Dimopoulos, Meletios A.; Timotheadou, Eleni; Gogas, Helen; Christodoulou, Christos; Papadopoulou, Kyriaki; Efstratiou, Ioannis; Scopa, Chrisoula D.; Papaspyrou, Irene; Vlachodimitropoulos, Dimitrios; Linardou, Helena; Samantas, Epaminontas; Pectasides, Dimitrios; Pavlidis, Nicholas; Fountzilas, George

    2013-01-01

    Background Discrepant data have been published on the incidence and prognostic significance of ESR1 gene amplification in early breast cancer. Patients and Methods Formalin-fixed paraffin-embedded tumor blocks were collected from women with early breast cancer participating in two HeCOG adjuvant trials. Messenger RNA was studied by quantitative PCR, ER protein expression was centrally assessed using immunohistochemistry (IHC) and ESR1 gene copy number by dual fluorescent in situ hybridization probes. Results In a total of 1010 women with resected node-positive early breast adenocarcinoma, the tumoral ESR1/CEP6 gene ratio was suggestive of deletion in 159 (15.7%), gene gain in 551 (54.6%) and amplification in 42 cases (4.2%), with only 30 tumors (3%) harboring five or more ESR1 copies. Gene copy number ratio showed a significant, though weak correlation to mRNA and protein expression (Spearman's Rho <0.23, p = 0.01). ESR1 clusters were observed in 9.5% (57 gain, 38 amplification) of cases. In contrast to mRNA and protein expression, which were favorable prognosticators, gene copy number changes did not obtain prognostic significance. When ESR1/CEP6 gene ratio was combined with function (as defined by ER protein and mRNA expression) in a molecular classifier, the Gene Functional profile, it was functional status that impacted on prognosis. In univariate analysis, patients with functional tumors (positive ER protein expression and gene ratio normal or gain/amplification) fared better than those with non-functional tumors with ESR1 gain (HR for relapse or death 0.49–0.64, p = 0.003). Significant interactions were observed between gene gain/amplification and paclitaxel therapy (trend for DFS benefit from paclitaxel only in patients with ESR1 gain/amplification, p = 0.066) and Gene Functional profile with HER2 amplification (Gene Functional profile prognostic only in HER2-normal cases, p = 0.029). Conclusions ESR1 gene deletion and amplification do not

  17. KRAS, BRAF, PIK3CA, and PTEN mutations: implications for targeted therapies in metastatic colorectal cancer.

    PubMed

    De Roock, Wendy; De Vriendt, Veerle; Normanno, Nicola; Ciardiello, Fortunato; Tejpar, Sabine

    2011-06-01

    The discovery of mutant KRAS as a predictor of resistance to epidermal growth-factor receptor (EGFR) monoclonal antibodies brought a major change in the treatment of metastatic colorectal cancer. This seminal finding also highlighted our sparse knowledge about key signalling pathways in colorectal tumours. Drugs that inhibit oncogenic alterations such as phospho-MAP2K (also called MEK), phospho-AKT, and mutant B-RAF seem promising as single treatment or when given with EGFR inhibitors. However, our understanding of the precise role these potential drug targets have in colorectal tumours, and the oncogenic dependence that tumours might have on these components, has not progressed at the same rate. As a result, patient selection and prediction of treatment effects remain problematic. We review the role of mutations in genes other than KRAS on the efficacy of anti-EGFR therapy, and discuss strategies to target these oncogenic alterations alone or in combination with receptor tyrosine-kinase inhibition.

  18. Molecular spectrum of KRAS, NRAS, BRAF and PIK3CA mutations in Chinese colorectal cancer patients: analysis of 1,110 cases

    PubMed Central

    Zhang, Jing; Zheng, Jianming; Yang, Yinghong; Lu, Junliang; Gao, Jie; Lu, Tao; Sun, Jian; Jiang, Hui; Zhu, Yan; Zheng, Yuhui; Liang, Zhiyong; Liu, Tonghua

    2015-01-01

    Mutations in genes such as KRAS, NRAS, BRAF and PIK3CA have become an important part of colorectal carcinoma evaluation. The aim of this study was to screen for mutations in these genes in Chinese patients with colorectal cancer (CRC) and to explore their correlations with certain clinicopathological parameters. We tested mutations in the KRAS (exons 2, 3 and 4), NRAS (exons 2, 3 and 4), PIK3CA (exon 20) and BRAF (exon 15) genes using reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing in a large cohort of 1,110 Chinese CRC patients who underwent surgical resection at one of three major teaching hospitals located in different regions of China. The prevalence rates of KRAS, NRAS, BRAF and PIK3CA mutations were 45.4%, 3.9%, 3.1% and 3.5%, respectively. Mutant KRAS was associated with the mucinous subtype and greater differentiation, while mutant BRAF was associated with right-sided tumors and poorer differentiation. Our results revealed differences in the genetic profiles of KRAS, NRAS, PIK3CA and BRAF at mutation hotspots between Chinese CRC patients and those of Western countries, while some of these gene features were shared among patients from other Asian countries. PMID:26691448

  19. Suppression of KRas-mutant cancer through the combined inhibition of KRAS with PLK1 and ROCK

    PubMed Central

    Wang, Jieqiong; Hu, Kewen; Guo, Jiawei; Cheng, Feixiong; Lv, Jing; Jiang, Wenhao; Lu, Weiqiang; Liu, Jinsong; Pang, Xiufeng; Liu, Mingyao

    2016-01-01

    No effective targeted therapies exist for cancers with somatic KRAS mutations. Here we develop a synthetic lethal chemical screen in isogenic KRAS-mutant and wild-type cells to identify clinical drug pairs. Our results show that dual inhibition of polo-like kinase 1 and RhoA/Rho kinase (ROCK) leads to the synergistic effects in KRAS-mutant cancers. Microarray analysis reveals that this combinatory inhibition significantly increases transcription and activity of cyclin-dependent kinase inhibitor p21WAF1/CIP1, leading to specific G2/M phase blockade in KRAS-mutant cells. Overexpression of p21WAF1/CIP1, either by cDNA transfection or clinical drugs, preferentially impairs the growth of KRAS-mutant cells, suggesting a druggable synthetic lethal interaction between KRAS and p21WAF1/CIP1. Co-administration of BI-2536 and fasudil either in the LSL-KRASG12D mouse model or in a patient tumour explant mouse model of KRAS-mutant lung cancer suppresses tumour growth and significantly prolongs mouse survival, suggesting a strong synergy in vivo and a potential avenue for therapeutic treatment of KRAS-mutant cancers. PMID:27193833

  20. Targeting KRAS Oncogene in Colon Cancer Cells with 7-Carboxylate Indolo[3,2-b]quinoline Tri-Alkylamine Derivatives

    PubMed Central

    Brito, Hugo; Martins, Ana Cláudia; Lavrado, João; Mendes, Eduarda; Francisco, Ana Paula; Santos, Sofia A.; Ohnmacht, Stephan A.; Kim, Nam-Soon; Rodrigues, Cecília M. P.; Moreira, Rui; Neidle, Stephen; Borralho, Pedro M.; Paulo, Alexandra

    2015-01-01

    Background A guanine-rich strand within the promoter of the KRAS gene can fold into an intra-molecular G-quadruplex structure (G4), which has an important role in the regulation of KRAS transcription. We have previously identified indolo[3,2-b]quinolines with a 7-carboxylate group and three alkylamine side chains (IQ3A) as effective G4 stabilizers and promising selective anticancer leads. Herein we investigated the anticancer mechanism of action of these compounds, which we hypothesized due to stabilization of the G4 sequence in the KRAS promoter and subsequent down-regulation of gene expression. Methodology/Principal Findings IQ3A compounds showed greater stabilization of G4 compared to duplex DNA structures and reduced KRAS promoter activity in a dual luciferase reporter assay. Moreover, IQ3A compounds showed high anti-proliferative activity in HCT116 and SW620 colon cancer cells (IC50 < 2.69 μM), without eliciting cell death in non-malignant HEK293T human embryonic kidney, and human colon fibroblasts CCD18co. IQ3A compounds significantly reduced KRAS mRNA and protein steady-state levels at IC50 concentrations, and increased p53 protein steady-state levels and cell death by apoptosis in HCT116 cells (mut KRAS, wt p53). Furthermore, KRAS silencing in HCT116 p53 wild-type (p53(+/+)) and null (p53(-/-)) isogenic cell lines induced a higher level of cell death, and a higher IQ3A-induced cell death in HCT116 p53(+/+) compared to HCT116 p53(-/-). Conclusions Herein we provide evidence that G4 ligands such as IQ3A compounds can target G4 motifs present in KRAS promoter, down-regulate the expression of the mutant KRAS gene through inhibition of transcription and translation, and induce cell death by apoptosis in colon cancer cell lines. Thus, targeting KRAS at the genomic level with G4 ligands may be a new anticancer therapy strategy for colon cancer. PMID:26024321

  1. Integrated biochip for PCR-based DNA amplification and detection on capacitive biosensors

    NASA Astrophysics Data System (ADS)

    Moschou, D.; Vourdas, N.; Filippidou, M. K.; Tsouti, V.; Kokkoris, G.; Tsekenis, G.; Zergioti, I.; Chatzandroulis, S.; Tserepi, A.

    2013-05-01

    Responding to an increasing demand for LoC devices to perform bioanalytical protocols for disease diagnostics, the development of an integrated LoC device consisting of a μPCR module integrated with resistive microheaters and a biosensor array for disease diagnostics is presented. The LoC is built on a Printed Circuit Board (PCB) platform, implementing both the amplification of DNA samples and DNA detection/identification on-chip. The resistive microheaters for PCR and the wirings for the sensor read-out are fabricated by means of standard PCB technology. The microfluidic network is continuous-flow, designed to perform 30 PCR cycles with heated zones at constant temperatures, and is built onto the PCB utilizing commercial photopatternable polyimide layers. Following DNA amplification, the product is driven in a chamber where a Si-based biosensor array is placed for DNA detection through hybridization. The sensor array is tested for the detection of mutations of the KRAS gene, responsible for colon cancer.

  2. Analysis of a large cluster of SLC22 transporter genes, including novel USTs, reveals species-specific amplification of subsets of family members.

    PubMed

    Wu, Wei; Baker, Michael E; Eraly, Satish A; Bush, Kevin T; Nigam, Sanjay K

    2009-07-01

    When the organic anion transporter Oat1 was first identified as NKT (Lopez-Nieto CE, You G, Bush KT, Barros EJ, Beier DR, Nigam SK. J Biol Chem 272: 6471-6478, 1997), it was argued that it, together with Oct1, may be part of a larger subfamily (now known as SLC22) involved in organic ion and xenobiotic transport. The least studied among SLC22 transporters are the so-called unknown substrate transporters (USTs). Here, five novel genes located in a cluster on mouse chromosome 19, immediately between Slc22a8 (Oat3)/Slc22a6 (Oat1) and Slc22a19 (Oat5), were identified as homologs of human USTs. These genes display preferential expression in liver and kidney, and one gene, AB056422, has several splicing variants with differential tissue expression and embryonic expression. Along with Slc22a6, Slc22a8, and Slc22a19, these Usts define the largest known cluster of mammalian Slc22 genes. Given the established functions of Oats, these genes may also be involved in organic anion transport. Usts have characteristic motifs and share a signature residue in the possible active site of transmembrane domain 7, a conserved, positively charged, amino acid, Arg356, possibly a site for interaction with organic anions. In certain species, Oat1 and Oat3 appeared to be highly conserved, whereas the Ust part of this cluster appeared to undergo repeated species-specific amplification, suggesting strong environmental selection pressure, and perhaps providing an explanation for copy number variation in the human locus. One Ust amplification in mouse appears to be recent. This cluster may be coordinately regulated and under selective pressure in a species-specific manner. PMID:19417012

  3. Bartonella quintana Aortitis in a Man with AIDS, Diagnosed by Needle Biopsy and 16S rRNA Gene Amplification

    PubMed Central

    Plett, Sara K.; Luetkemeyer, Anne F.; Borgo, Gina M.; Ohliger, Michael A.; Conrad, Miles B.; Cookson, Brad T.; Sengupta, Dhruba J.; Koehler, Jane E.

    2015-01-01

    A man with newly diagnosed AIDS presented with months of back pain and fever. Computed tomography (CT) results demonstrated aortitis with periaortic tissue thickening. DNA amplification of biopsy tissue revealed Bartonella quintana, and Bartonella serologies were subsequently noted to be positive. The patient improved with prolonged doxycycline and rifabutin treatment. This case illustrates how molecular techniques are increasingly important in diagnosing Bartonella infections. PMID:26063867

  4. Either Kras activation or Pten loss similarly enhance the dominant-stable CTNNB1-induced genetic program to promote granulosa cell tumor development in the ovary and testis.

    PubMed

    Richards, J S; Fan, H-Y; Liu, Z; Tsoi, M; Laguë, M-N; Boyer, A; Boerboom, D

    2012-03-22

    WNT, RAS or phosphoinositide 3-kinase signaling pathways control specific stages of ovarian follicular development. To analyze the functional interactions of these pathways in granulosa cells during follicular development in vivo, we generated specific mutant mouse models. Stable activation of the WNT signaling effector β-catenin (CTNNB1) in granulosa cells results in the formation of premalignant lesions that develop into granulosa cell tumors (GCTs) spontaneously later in life or following targeted deletion of the tumor suppressor gene Pten. Conversely, expression of oncogenic KRAS(G12D) dramatically arrests proliferation, differentiation and apoptosis in granulosa cells, and consequently, small abnormal follicle-like structures devoid of oocytes accumulate in the ovary. Because of the potent anti-proliferative effects of KRAS(G12D) in granulosa cells, we sought to determine whether KRAS(G12D) would block precancerous lesion and tumor formation in follicles of the CTNNB1-mutant mice. Unexpectedly, transgenic Ctnnb1;Kras-mutant mice exhibited increased GC proliferation, decreased apoptosis and impaired differentiation and developed early-onset GCTs leading to premature death in a manner similar to the Ctnnb1;Pten-mutant mice. Microarray and reverse transcription-PCR analyses revealed that gene regulatory processes induced by CTNNB1 were mostly enhanced by either KRAS activation or Pten loss in remarkably similar patterns and degree. The concomitant activation of CTNNB1 and KRAS in Sertoli cells also caused testicular granulosa cell tumors that showed gene expression patterns that partially overlapped those observed in GCTs of the ovary. Although the mutations analyzed herein have not yet been linked to adult GCTs in humans, they may be related to juvenile GCTs or to tumors in other tissues where CTNNB1 is mutated. Importantly, the results provide strong evidence that CTNNB1 is the driver in these contexts and that KRAS(G12D) and Pten loss promote the program set

  5. Frequent amplification of ORAOV1 gene in esophageal squamous cell cancer promotes an aggressive phenotype via proline metabolism and ROS production

    PubMed Central

    Togashi, Yosuke; Arao, Tokuzo; Kato, Hiroaki; Matsumoto, Kazuko; Terashima, Masato; Hayashi, Hidetoshi; de Velasco, Marco A; Fujita, Yoshihiko; Kimura, Hideharu; Yasuda, Takushi; Shiozaki, Hitoshi; Nishio, Kazuto

    2014-01-01

    Chromosomal band 11q13 seems to be one of the most frequently amplified lesions in human cancer, including esophageal squamous cell cancer (ESCC). The oral cancer overexpressed 1 (ORAOV1) gene has been identified within this region, but its detailed biological function in human ESCC remains largely unclear. In our clinical samples of stage III ESCC, ORAOV1 amplification was observed in 49 of 94 cases (53%). ORAOV1 amplification was significantly associated with a poorly differentiated histology and tumors located in the upper or middle esophagus. Patients with ORAOV1 amplification tended to have a shorter survival period, although the difference was not significant. To investigate the function of ORAOV1, we created ORAOV1-overexpressed ESCC cell lines that exhibited increased cellular proliferation and colony formation, compared with in vitro controls. In vivo, ORAOV1-overexpressed cells exhibited a significantly increased tumorigenicity and a significantly larger tumor volume and poorer differentiation than controls. The peptide mass fingerprinting technique demonstrated that ORAOV1 bound to pyrroline-5-carboxylate reductase (PYCR), which is associated with proline metabolism and reactive oxygen species (ROS) production. Then, ORAOV1-overexpressed cell lines were resistant to stress treatment, which was cancelled by PYCR-knockdown. In addition, the ORAOV1-overexpressed cell line had a higher intracellular proline concentration and a lower ROS level. Our findings indicate that the ORAOV1 gene is frequently amplified in ESCC, enhances tumorigenicity and tumor growth, and is associated with a poorly differentiated tumor histology via proline metabolism and ROS production. ORAOV1 could be a novel target for the treatment of ESCC. PMID:24930674

  6. Validation of whole genome amplification for analysis of the p53 tumor suppressor gene in limited amounts of tumor samples.

    PubMed

    Hasmats, Johanna; Green, Henrik; Solnestam, Beata Werne; Zajac, Pawel; Huss, Mikael; Orear, Cedric; Validire, Pierre; Bjursell, Magnus; Lundeberg, Joakim

    2012-08-24

    Personalized cancer treatment requires molecular characterization of individual tumor biopsies. These samples are frequently only available in limited quantities hampering genomic analysis. Several whole genome amplification (WGA) protocols have been developed with reported varying representation of genomic regions post amplification. In this study we investigate region dropout using a φ29 polymerase based WGA approach. DNA from 123 lung cancers specimens and corresponding normal tissue were used and evaluated by Sanger sequencing of the p53 exons 5-8. To enable comparative analysis of this scarce material, WGA samples were compared with unamplified material using a pooling strategy of the 123 samples. In addition, a more detailed analysis of exon 7 amplicons were performed followed by extensive cloning and Sanger sequencing. Interestingly, by comparing data from the pooled samples to the individually sequenced exon 7, we demonstrate that mutations are more easily recovered from WGA pools and this was also supported by simulations of different sequencing coverage. Overall this data indicate a limited random loss of genomic regions supporting the use of whole genome amplification for genomic analysis.

  7. Detection of β-globin Gene Mutations Among β-thalassaemia Carriers and Patients in Malaysia: Application of Multiplex Amplification Refractory Mutation System–Polymerase Chain Reaction

    PubMed Central

    Hassan, Syahzuwan; Ahmad, Rahimah; Zakaria, Zubaidah; Zulkafli, Zefarina; Abdullah, Wan Zaidah

    2013-01-01

    Background: β-thalassaemia is one of the most common single-gene disorders worldwide. Each ethnic population has its own common mutations, accounting for the majority of cases, with a small number of mutations for the rarer alleles. Due to the heterogeneity of β-thalassaemia and the multi-ethnicity of Malaysians, molecular diagnostics may be expensive and time consuming. Methods: A simple polymerase chain reaction (PCR) approach involving a multiplex amplification refractory mutation system (MARMS) and one amplification refractory mutation system (ARMS), consisting of 20 β-globin gene mutations, were designed and employed to investigate β-thalassaemia patients and carriers. Results: Out of 169 carriers tested with the MARMS, Cd 41/42 (–TTCT), Cd 26 (A–G) HbE, IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 78.1%. Among the Malays, Cd 26 (A–G) HbE, Cd 41/42 (–TTCT), IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 81.4%, whereas Cd 41/42 (–TTCT) and IVS 2–654 (C–T) were most common among the Chinese (79.1%). Conclusion: We propose the use of this cheap, easy to interpret, and simple system for the molecular diagnostics of β-thalassaemia among Malaysians at the Institute for Medical Research (IMR). PMID:23613656

  8. Allele loss on chromosomes 10 and 17p and epidermal growth factor receptor gene amplification in human malignant astrocytoma related to prognosis.

    PubMed Central

    Leenstra, S.; Bijlsma, E. K.; Troost, D.; Oosting, J.; Westerveld, A.; Bosch, D. A.; Hulsebos, T. J.

    1994-01-01

    Patients with high-grade astrocytomas have a poor prognosis. However, considerable variation exists within this group of patients with respect to post-operative survival. In order to determine whether genetic alterations might be of help in subdividing this group, we used allele loss on chromosomes 10 and 17p and epidermal growth factor receptor (EGFR) gene amplification in the tumours as genetic parameters and determined their prognostic value. A series of 47 malignant (grade III and grade IV) tumours were genetically characterised, and four types of tumours were found. Type 1 tumours had loss of heterozygosity on chromosome arm 17p (LOH 17p) as the sole genetic alteration. Patients with this type of tumour were relatively young (mean age 39 years) and had a median survival period of 17 months. Type 2 tumours displayed only allele loss on chromosome 10 (LOH 10), type 3 tumours had LOH 10 + LOH 17p and type 4 tumours contained LOH 10 + EGFR gene amplification. Patients with types 2, 3 and 4 tumours were older (mean ages 59, 65 and 54 years respectively) and had a shorter survival (median duration 6, 3 and 2 months respectively) than type 1 patients. Multivariate analysis indicated that the genetic subdivision was a significant prognostic variable. In this study, age proved to be of minor importance with regard to survival. Our study revealed a predominance of frontally located tumours in patients with type 1 tumours, i.e. with LOH 17p only. Images Figure 2 PMID:7917918

  9. MET Gene Amplification and MET Receptor Activation Are Not Sufficient to Predict Efficacy of Combined MET and EGFR Inhibitors in EGFR TKI-Resistant NSCLC Cells.

    PubMed

    Presutti, Dario; Santini, Simonetta; Cardinali, Beatrice; Papoff, Giuliana; Lalli, Cristiana; Samperna, Simone; Fustaino, Valentina; Giannini, Giuseppe; Ruberti, Giovina

    2015-01-01

    Epidermal growth factor receptor (EGFR), member of the human epidermal growth factor receptor (HER) family, plays a critical role in regulating multiple cellular processes including proliferation, differentiation, cell migration and cell survival. Deregulation of the EGFR signaling has been found to be associated with the development of a variety of human malignancies including lung, breast, and ovarian cancers, making inhibition of EGFR the most promising molecular targeted therapy developed in the past decade against cancer. Human non small cell lung cancers (NSCLC) with activating mutations in the EGFR gene frequently experience significant tumor regression when treated with EGFR tyrosine kinase inhibitors (TKIs), although acquired resistance invariably develops. Resistance to TKI treatments has been associated to secondary mutations in the EGFR gene or to activation of additional bypass signaling pathways including the ones mediated by receptor tyrosine kinases, Fas receptor and NF-kB. In more than 30-40% of cases, however, the mechanisms underpinning drug-resistance are still unknown. The establishment of cellular and mouse models can facilitate the unveiling of mechanisms leading to drug-resistance and the development or validation of novel therapeutic strategies aimed at overcoming resistance and enhancing outcomes in NSCLC patients. Here we describe the establishment and characterization of EGFR TKI-resistant NSCLC cell lines and a pilot study on the effects of a combined MET and EGFR inhibitors treatment. The characterization of the erlotinib-resistant cell lines confirmed the association of EGFR TKI resistance with loss of EGFR gene amplification and/or AXL overexpression and/or MET gene amplification and MET receptor activation. These cellular models can be instrumental to further investigate the signaling pathways associated to EGFR TKI-resistance. Finally the drugs combination pilot study shows that MET gene amplification and MET receptor activation

  10. MET Gene Amplification and MET Receptor Activation Are Not Sufficient to Predict Efficacy of Combined MET and EGFR Inhibitors in EGFR TKI-Resistant NSCLC Cells

    PubMed Central

    Presutti, Dario; Santini, Simonetta; Cardinali, Beatrice; Papoff, Giuliana; Lalli, Cristiana; Samperna, Simone; Fustaino, Valentina; Giannini, Giuseppe; Ruberti, Giovina

    2015-01-01

    Epidermal growth factor receptor (EGFR), member of the human epidermal growth factor receptor (HER) family, plays a critical role in regulating multiple cellular processes including proliferation, differentiation, cell migration and cell survival. Deregulation of the EGFR signaling has been found to be associated with the development of a variety of human malignancies including lung, breast, and ovarian cancers, making inhibition of EGFR the most promising molecular targeted therapy developed in the past decade against cancer. Human non small cell lung cancers (NSCLC) with activating mutations in the EGFR gene frequently experience significant tumor regression when treated with EGFR tyrosine kinase inhibitors (TKIs), although acquired resistance invariably develops. Resistance to TKI treatments has been associated to secondary mutations in the EGFR gene or to activation of additional bypass signaling pathways including the ones mediated by receptor tyrosine kinases, Fas receptor and NF-kB. In more than 30–40% of cases, however, the mechanisms underpinning drug-resistance are still unknown. The establishment of cellular and mouse models can facilitate the unveiling of mechanisms leading to drug-resistance and the development or validation of novel therapeutic strategies aimed at overcoming resistance and enhancing outcomes in NSCLC patients. Here we describe the establishment and characterization of EGFR TKI-resistant NSCLC cell lines and a pilot study on the effects of a combined MET and EGFR inhibitors treatment. The characterization of the erlotinib-resistant cell lines confirmed the association of EGFR TKI resistance with loss of EGFR gene amplification and/or AXL overexpression and/or MET gene amplification and MET receptor activation. These cellular models can be instrumental to further investigate the signaling pathways associated to EGFR TKI-resistance. Finally the drugs combination pilot study shows that MET gene amplification and MET receptor activation

  11. Screening for tumor suppressors: Loss of ephrin receptor A2 cooperates with oncogenic KRas in promoting lung adenocarcinoma

    PubMed Central

    Yeddula, Narayana; Xia, Yifeng; Ke, Eugene; Beumer, Joep; Verma, Inder M.

    2015-01-01

    Lung adenocarcinoma, a major form of non-small cell lung cancer, is the leading cause of cancer deaths. The Cancer Genome Atlas analysis of lung adenocarcinoma has identified a large number of previously unknown copy number alterations and mutations, requiring experimental validation before use in therapeutics. Here, we describe an shRNA-mediated high-throughput approach to test a set of genes for their ability to function as tumor suppressors in the background of mutant KRas and WT Tp53. We identified several candidate genes from tumors originated from lentiviral delivery of shRNAs along with Cre recombinase into lungs of Loxp-stop-Loxp-KRas mice. Ephrin receptorA2 (EphA2) is among the top candidate genes and was reconfirmed by two distinct shRNAs. By generating knockdown, inducible knockdown and knockout cell lines for loss of EphA2, we showed that negating its expression activates a transcriptional program for cell proliferation. Loss of EPHA2 releases feedback inhibition of KRAS, resulting in activation of ERK1/2 MAP kinase signaling, leading to enhanced cell proliferation. Intriguingly, loss of EPHA2 induces activation of GLI1 transcription factor and hedgehog signaling that further contributes to cell proliferation. Small molecules targeting MEK1/2 and Smoothened hamper proliferation in EphA2-deficient cells. Additionally, in EphA2 WT cells, activation of EPHA2 by its ligand, EFNA1, affects KRAS–RAF interaction, leading to inhibition of the RAS-RAF-MEK-ERK pathway and cell proliferation. Together, our studies have identified that (i) EphA2 acts as a KRas cooperative tumor suppressor by in vivo screen and (ii) reactivation of the EphA2 signal may serve as a potential therapeutic for KRas-induced human lung cancers. PMID:26542681

  12. Matrix Metalloproteinase-10 Promotes Kras-Mediated Bronchio-Alveolar Stem Cell Expansion and Lung Cancer Formation

    PubMed Central

    Regala, Roderick P.; Justilien, Verline; Walsh, Michael P.; Weems, Capella; Khoor, Andras; Murray, Nicole R.; Fields, Alan P.

    2011-01-01

    Matrix metalloproteinase 10 (MMP-10; stromelysin 2) is a member of a large family of structurally related matrix metalloproteinases, many of which have been implicated in tumor progression, invasion and metastasis. We recently identified Mmp10 as a gene that is highly induced in tumor-initiating lung bronchioalveolar stem cells (BASCs) upon activation of oncogenic Kras in a mouse model of lung adenocarcinoma. However, the potential role of Mmp10 in lung tumorigenesis has not been addressed. Here, we demonstrate that Mmp10 is overexpressed in lung tumors induced by either the smoke carcinogen urethane or oncogenic Kras. In addition, we report a significant reduction in lung tumor number and size after urethane exposure or genetic activation of oncogenic Kras in Mmp10 null (Mmp10−/−) mice. This inhibitory effect is reflected in a defect in the ability of Mmp10-deficient BASCs to expand and undergo transformation in response to urethane or oncogenic Kras in vivo and in vitro, demonstrating a role for Mmp10 in the tumor-initiating activity of Kras-transformed lung stem cells. To determine the potential relevance of MMP10 in human cancer we analyzed Mmp10 expression in publicly-available gene expression profiles of human cancers. Our analysis reveals that MMP10 is highly overexpressed in human lung tumors. Gene set enhancement analysis (GSEA) demonstrates that elevated MMP10 expression correlates with both cancer stem cell and tumor metastasis genomic signatures in human lung cancer. Finally, Mmp10 is elevated in many human tumor types suggesting a widespread role for Mmp10 in human malignancy. We conclude that Mmp10 plays an important role in lung tumor initiation via maintenance of a highly tumorigenic, cancer-initiating, stem-like cell population, and that Mmp10 expression is associated with stem-like, highly metastatic genotypes in human lung cancers. These results indicate that Mmp10 may represent a novel therapeutic approach to target lung cancer stem cells

  13. Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer.

    PubMed

    Hutton, Josiah E; Wang, Xiaojing; Zimmerman, Lisa J; Slebos, Robbert J C; Trenary, Irina A; Young, Jamey D; Li, Ming; Liebler, Daniel C

    2016-09-01

    Metabolic reprogramming, in which altered utilization of glucose and glutamine supports rapid growth, is a hallmark of most cancers. Mutations in the oncogenes KRAS and BRAF drive metabolic reprogramming through enhanced glucose uptake, but the broader impact of these mutations on pathways of carbon metabolism is unknown. Global shotgun proteomic analysis of isogenic DLD-1 and RKO colon cancer cell lines expressing mutant and wild type KRAS or BRAF, respectively, failed to identify significant differences (at least 2-fold) in metabolic protein abundance. However, a multiplexed parallel reaction monitoring (PRM) strategy targeting 73 metabolic proteins identified significant protein abundance increases of 1.25-twofold in glycolysis, the nonoxidative pentose phosphate pathway, glutamine metabolism, and the phosphoserine biosynthetic pathway in cells with KRAS G13D mutations or BRAF V600E mutations. These alterations corresponded to mutant KRAS and BRAF-dependent increases in glucose uptake and lactate production. Metabolic reprogramming and glucose conversion to lactate in RKO cells were proportional to levels of BRAF V600E protein. In DLD-1 cells, these effects were independent of the ratio of KRAS G13D to KRAS wild type protein. A study of 8 KRAS wild type and 8 KRAS mutant human colon tumors confirmed the association of increased expression of glycolytic and glutamine metabolic proteins with KRAS mutant status. Metabolic reprogramming is driven largely by modest (<2-fold) alterations in protein expression, which are not readily detected by the global profiling methods most commonly employed in proteomic studies. The results indicate the superiority of more precise, multiplexed, pathway-targeted analyses to study functional proteome systems. Data are available through MassIVE Accession MSV000079486 at ftp://MSV000079486@massive.ucsd.edu. PMID:27340238

  14. A combinatorial strategy for treating KRAS-mutant lung cancer.

    PubMed

    Manchado, Eusebio; Weissmueller, Susann; Morris, John P; Chen, Chi-Chao; Wullenkord, Ramona; Lujambio, Amaia; de Stanchina, Elisa; Poirier, John T; Gainor, Justin F; Corcoran, Ryan B; Engelman, Jeffrey A; Rudin, Charles M; Rosen, Neal; Lowe, Scott W

    2016-06-30

    Therapeutic targeting of KRAS-mutant lung adenocarcinoma represents a major goal of clinical oncology. KRAS itself has proved difficult to inhibit, and the effectiveness of agents that target key KRAS effectors has been thwarted by activation of compensatory or parallel pathways that limit their efficacy as single agents. Here we take a systematic approach towards identifying combination targets for trametinib, a MEK inhibitor approved by the US Food and Drug Administration, which acts downstream of KRAS to suppress signalling through the mitogen-activated protein kinase (MAPK) cascade. Informed by a short-hairpin RNA screen, we show that trametinib provokes a compensatory response involving the fibroblast growth factor receptor 1 (FGFR1) that leads to signalling rebound and adaptive drug resistance. As a consequence, genetic or pharmacological inhibition of FGFR1 in combination with trametinib enhances tumour cell death in vitro and in vivo. This compensatory response shows distinct specificities: it is dominated by FGFR1 in KRAS-mutant lung and pancreatic cancer cells, but is not activated or involves other mechanisms in KRAS wild-type lung and KRAS-mutant colon cancer cells. Importantly, KRAS-mutant lung cancer cells and patients’ tumours treated with trametinib show an increase in FRS2 phosphorylation, a biomarker of FGFR activation; this increase is abolished by FGFR1 inhibition and correlates with sensitivity to trametinib and FGFR inhibitor combinations. These results demonstrate that FGFR1 can mediate adaptive resistance to trametinib and validate a combinatorial approach for treating KRAS-mutant lung cancer. PMID:27338794

  15. Rapid KRAS Mutation Detection via Hybridization-Induced Aggregation of Microbeads.

    PubMed

    Sloane, Hillary S; Kelly, Kimberly A; Landers, James P

    2015-10-20

    Using hybridization-induced aggregation (HIA), a unique bead-based DNA detection technology scalable for a microchip platform, we describe a simplistic, low-cost method for rapid mutation testing. HIA utilizes a pair of sequence-specific oligonucleotide probes bound to magnetic microbeads. Hybridization to a target DNA strand tethers the beads together, inducing bead aggregation. By simply using the extent of bead aggregation as a measure of the hybridization efficiency, we avoid the need for additional labels and sophisticated analytical equipment. Through strategic manipulation of the assay design and experimental parameters, we use HIA to facilitate, for the first time, the detection of single base mutations in a gene segment and, specifically, the detection of activating KRAS mutations. Following the development and optimization of the assay, we apply it for KRAS mutation analysis of four human cancer cell lines. Ultimately, we present a proof-of-principle method for detecting any of the common KRAS mutations in a single-step, 2 min assay, using only one set of oligonucleotide probes, for a total analysis time of less than 10 min post-PCR. The assay is performed at room temperature and uses simple, inexpensive instrumentation that permits multiplexed analysis. PMID:26339780

  16. Anti-tumor activity of ESX1 on cancer cells harboring oncogenic K-ras mutation

    SciTech Connect

    Nakajima, Junta; Ishikawa, Susumu; Hamada, Jun-Ichi; Yanagihara, Masatomo; Koike, Takao; Hatakeyama, Masanori

    2008-05-23

    Human ESX1 is a 65-kilodalton (kDa) paired-like homeoprotein that is proteolytically processed into N-terminal 45-kDa and C-terminal 20-kDa fragments. The N-terminal ESX1 fragment, which contains the homeodomain, localizes to the nucleus and represses mRNA transcription from the K-ras gene. When we inoculated human colorectal carcinoma HCT116 constitutive expressing N-terminal region of ESX1 (N-ESX1) into nude mice, transfectant cells uniformly showed decreased tumor-forming activity compared with that of the parental cells. Furthermore, pretreatment of HCT116 carcinoma cells with a fusion protein consisting of N-ESX1 and the protein-transduction domain derived from the human immunodeficiency virus type-1 TAT protein gave rise to a dramatic reduction in the tumorigenicity of HCT116 cells in nude mice. Our results provide first in vivo evidence for the molecular targeting therapeutic application of the K-ras repressor ESX1, especially TAT-mediated transduction of N-ESX1, in the treatment of human cancers having oncogenic K-ras mutations.

  17. Cancer stem cell drugs target K-ras signaling in a stemness context

    PubMed Central

    Najumudeen, A K; Jaiswal, A; Lectez, B; Oetken-Lindholm, C; Guzmán, C; Siljamäki, E; Posada, I M D; Lacey, E; Aittokallio, T; Abankwa, D

    2016-01-01

    Cancer stem cells (CSCs) are considered to be responsible for treatment relapse and have therefore become a major target in cancer research. Salinomycin is the most established CSC inhibitor. However, its primary mechanistic target is still unclear, impeding the discovery of compounds with similar anti-CSC activity. Here, we show that salinomycin very specifically interferes with the activity of K-ras4B, but not H-ras, by disrupting its nanoscale membrane organization. We found that caveolae negatively regulate the sensitivity to this drug. On the basis of this novel mechanistic insight, we defined a K-ras-associated and stem cell-derived gene expression signature that predicts the drug response of cancer cells to salinomycin. Consistent with therapy resistance of CSC, 8% of tumor samples in the TCGA-database displayed our signature and were associated with a significantly higher mortality. Using our K-ras-specific screening platform, we identified several new candidate CSC drugs. Two of these, ophiobolin A and conglobatin A, possessed a similar or higher potency than salinomycin. Finally, we established that the most potent compound, ophiobolin A, exerts its K-ras4B-specific activity through inactivation of calmodulin. Our data suggest that specific interference with the K-ras4B/calmodulin interaction selectively inhibits CSC. PMID:26973241

  18. Identification and Sequencing of Candida krusei Aconitate Hydratase Gene Using Rapid Amplification of cDNA Ends Method and Phylogenetic Analysis

    PubMed Central

    Fateh, Roohollah; Zaini, Farideh; Kordbacheh, Parivash; Falahati, Mehraban; Rezaie, Sasan; Daie Ghazvini, Roshanak; Borhani, Nahid; Safara, Mahin; Fattahi, Azam; Kanani, Ali; Farahyar, Shirin; Bolhassani, Manzar; Heidari, Mansour

    2015-01-01

    Background: The production and development of an effective fungicidal drug requires the identification of an essential fungal protein as a drug target. Aconitase (ACO) is a mitochondrial protein that plays a vital role in tricarboxylic acid (TCA) cycle and thus production of energy within the cell. Objectives: The current study aimed to sequence Candida krusei ACO gene and determine any amino acid residue differences between human and fungal aconitases to obtain selective inhibition. Materials and Methods: Candida krusei (ATCC: 6258) aconitase gene was determined by 5’Rapid Amplification of cDNA Ends (RACE) method and degenerate Polymerase Chain Reaction (PCR) and analyzed using bioinformatics softwares. Results: One thousand-four hundred-nineteen nucleotide of C. krusei aconitase gene were clarified and submitted in Genbank as a partial sequence and then taxonomic location of C. krusei was determined by nucleotide and amino acid sequences of this gene. The comparison of nucleotide and amino acid sequences of Candida species ACO genes showed that C. krusei possessed characteristic sequences. No significant differences were observed between C. krusei and human aconitases within the active site amino acid residues. Conclusions: Results of the current study indicated that aconitase was not a suitable target to design new anti-fungal drugs that selectively block this enzyme. PMID:26855741

  19. Novel deletion of the E3A ubiquitin protein ligase gene detected by multiplex ligation-dependent probe amplification in a patient with Angelman syndrome

    PubMed Central

    Calì, Francesco; Ragalmuto, Alda; Chiavetta, Valeria; Calabrese, Giuseppe; Fichera, Marco; Vinci, Mirella; Ruggeri, Giuseppa; Schinocca, Pietro; Sturnio, Maurizio; Romano, Salvatore; Elia, Maurizio

    2010-01-01

    Angelman syndrome (AS) is a severe neurobehavioural disorder caused by failure of expression of the maternal copy of the imprinted domain located on 15q11-q13. There are different mechanisms leading to AS: maternal microdeletion, uniparental disomy, defects in a putative imprinting centre, mutations of the E3 ubiquitin protein ligase (UBE3A) gene. However, some of suspected cases of AS are still scored negative to all the latter mutations. Recently, it has been shown that a proportion of negative cases bear large deletions overlapping one or more exons of the UBE3A gene. These deletions are difficult to detect by conventional gene-scanning methods due to the masking effect by the non-deleted allele. In this study, we have used for the first time multiplex ligation-dependent probe amplification (MLPA) and comparative multiplex dosage analysis (CMDA) to search for large deletions affecting the UBE3A gene. Using this approach, we identified a novel causative deletion involving exon 8 in an affected sibling. Based on our results, we propose the use of MLPA as a fast, accurate and inexpensive test to detect large deletions in the UBE3A gene in a small but significant percentage of AS patients. PMID:21072004

  20. Multiplex Ligation-Dependent Probe Amplification Analysis of GATA4 Gene Copy Number Variations in Patients with Isolated Congenital Heart Disease

    PubMed Central

    Guida, Valentina; Lepri, Francesca; Vijzelaar, Raymon; De Zorzi, Andrea; Versacci, Paolo; Digilio, Maria Cristina; Marino, Bruno; De Luca, Alessandro; Dallapiccola, Bruno

    2010-01-01

    GATA4 mutations are found in patients with different isolated congenital heart defects (CHDs), mostly cardiac septal defects and tetralogy of Fallot. In addition, GATA4 is supposed to be the responsible gene for the CHDs in the chromosomal 8p23 deletion syndrome, which is recognized as a malformation syndrome with clinical symptoms of facial anomalies, microcephaly, mental retardation, and congenital heart defects. Thus far, no study has been carried out to investigate the role of GATA4 copy number variations (CNVs) in non-syndromic CHDs. To explore the possible occurrence of GATA4 gene CNVs in isolated CHDs, we analyzed by multiplex ligation-dependent probe amplification (MLPA) a cohort of 161 non-syndromic patients with cardiac anomalies previously associated with GATA4 gene mutations. The patients were mutation-negative for GATA4, NKX2.5, and FOG2 genes after screening with denaturing high performance liquid chromatography. MLPA analysis revealed that normalized MLPA signals were all found within the normal range values for all exons in all patients, excluding a major contribution of GATA4 gene CNVs in CHD pathogenesis. PMID:20592452

  1. Heterogeneity of KRAS Mutation Status in Rectal Cancer

    PubMed Central

    Jo, Peter; König, Alexander; Schirmer, Markus; Kitz, Julia; Conradi, Lena-Christin; Azizian, Azadeh; Bernhardt, Markus; Wolff, Hendrik A.; Grade, Marian; Ghadimi, Michael; Ströbel, Philipp; Schildhaus, Hans-Ulrich; Gaedcke, Jochen

    2016-01-01

    Introduction Anti-EGFR targeted therapy is of increasing importance in advanced colorectal cancer and prior KRAS mutation testing is mandatory for therapy. However, at which occasions this should be performed is still under debate. We aimed to assess in patients with locally advanced rectal cancer whether there is intra-specimen KRAS heterogeneity prior to and upon preoperative chemoradiotherapy (CRT), and if there are any changes in KRAS mutation status due to this intervention. Materials and Methods KRAS mutation status analyses were performed in 199 tumor samples from 47 patients with rectal cancer. To evaluate the heterogeneity between different tumor areas within the same tumor prior to preoperative CRT, 114 biopsies from 34 patients (mean 3 biopsies per patient) were analyzed (pre-therapeutic intratumoral heterogeneity). For the assessment of heterogeneity after CRT residual tumor tissue (85 samples) from 12 patients (mean 4.2 tissue samples per patient) were analyzed (post-therapeutic intratumoral heterogeneity) and assessment of heterogeneity before and after CRT was evaluated in corresponding patient samples (interventional heterogeneity). Primer extension method (SNaPshot™) was used for initial KRAS mutation status testing for Codon 12, 13, 61, and 146. Discordant results by this method were reevaluated by using the FDA-approved KRAS Pyro Kit 24, V1 and the RAS Extension Pyro Kit 24, V1 Kit (therascreen® KRAS test). Results For 20 (43%) out of the 47 patients, a KRAS mutation was detected. With 12 out of 20, the majority of these mutations affected codon 35. We did not obtained evidence that CRT results in changes of the KRAS mutation pattern. In addition, no intratumoral heterogeneity in the KRAS mutational status could be proven. This was true for both the biopsies prior to CRT and the resection specimens thereafter. The discrepancy observed in some samples when using the SNaPshot™ assay was due to insufficient sensitivity of this technique upon

  2. Human papillomavirus multiplex ligation-dependent probe amplification assay for the assessment of viral load, integration, and gain of telomerase-related genes in cervical malignancies.

    PubMed

    Theelen, Wendy; Litjens, Rogier J N T M; Vinokurova, Svetlana; Haesevoets, Annick; Reijans, Martin; Simons, Guus; Smedts, Frank; Herrington, C Simon; Ramaekers, Frans C S; von Knebel Doeberitz, Magnus; Speel, Ernst-Jan M; Hopman, Anton H N

    2013-11-01

    We evaluated the reliability of a novel multiplex ligation-dependent probe amplification (MLPA) assay in detecting integration of human papillomavirus (HPV) based on the viral E2/E6 copy number ratio in formalin-fixed and paraffin-embedded cervical lesions. The MLPA results were compared with those of amplification of papillomavirus oncogene transcripts for RNA, detection of integrated papillomavirus sequences for DNA, and HPV fluorescence in situ hybridization (FISH). DNA was isolated from 41 formalin-fixed and paraffin-embedded HPV-positive cervical lesions (cervical intraepithelial neoplasia grade 3 lesions, squamous cell carcinomas, and adenocarcinomas) for MLPA analysis. From 13 matching frozen samples, DNA and RNA were isolated for the detection of integrated papillomavirus sequences and/or the amplification of papillomavirus oncogene transcripts, respectively. Integrated HPV16, HPV18, or both were identified. The MLPA assay detected viral integration in 12 of these 13 cases, and episomal copies also were detected in 7 cases. In 20 of the 24 cases with exclusive viral integration or episomal viral copies as detected by FISH, MLPA confirmed the physical status of the virus. In the cases classified as mixed by FISH, the presence of excess episomal copies complicated the recognition of viral integration by MLPA. Furthermore, the feasibility of detecting gain of the telomerase genes with the HPV MLPA assay was evaluated. The MLPA confirmed the FISH data in 12 of 13 cases in which the status of copy number gain for telomerase RNA component was known. In conclusion, the HPV MLPA assay can be performed on routinely processed cervical lesions for the detection of viral load and HPV integration.

  3. Rapid detection of human rotavirus using NSP4 gene specific reverse transcription loop-mediated isothermal amplification assay.

    PubMed

    Malik, Yashpal Singh; Sharma, Kuldeep; Kumar, Naveen; Shivachandra, Sathish B; Rawat, Vinita; Rakholia, Ritu; Ranjan, Rajeev; Ganesh, Balasubramanian; Parida, Manmohan

    2013-09-01

    The seasonal outbreaks of human rotavirus (RV) infection occur every winter. Most patients are diagnosed clinically by a rapid latex agglutination detection kit or polymerase chain reaction assays for RV from stool samples, but some problems have been reported on the specificity and sensitivity of such rapid detection assays. To ratify these issues, a sensitive, specific, simple, and rapid nucleic acid based diagnostic method is expected to be introduced and the reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect the RV in human stool samples by incubation at 60 °C for 1 h and amplification was confirmed by electrophoretic laddering, restriction enzyme digestion, and hydroxynapthol blue discoloration. The assay established in this study was found to detect only the RVs and no cross-reaction with other viruses, demonstrating its high specificity. By using serial samples dilution as template, the detection limit of LAMP was 10 times more than that of PCR. The results showed the potential clinical feasibility of RT-LAMP as a useful diagnostic tool for the detection of RV with high sensitivity in comparison to conventional RT-PCR.

  4. Real-time microfluidic recombinase polymerase amplification for the toxin B gene of Clostridium difficile on a SlipChip platform.

    PubMed

    Tsaloglou, M-N; Watson, R J; Rushworth, C M; Zhao, Y; Niu, X; Sutton, J M; Morgan, H

    2015-01-01

    Clostridium difficile is one of the key bacterial pathogens that cause infectious diarrhoea both in the developed and developing world. Isothermal nucleic acid amplification methods are increasingly used for identification of toxinogenic infection by clinical labs. For this purpose, we developed a low-cost microfluidic platform based on the SlipChip concept and implemented real-time isothermal recombinase polymerase amplification (RPA). The on-chip RPA assay targets the Clostridium difficile toxin B gene (tcdB) coding for toxin B, one of the proteins responsible for bacterial toxicity. The device was fabricated in clear acrylic using rapid prototyping methods. It has six replicate 500 nL reaction wells as well as two sets of 500 nL control wells. The reaction can be monitored in real-time using exonuclease fluorescent probes with an initial sample volume of as little as 6.4 μL. We demonstrated a limit of detection of 1000 DNA copies, corresponding to 1 fg, at a time-to-result of <20 minutes. This miniaturised platform for pathogen detection has potential for use in resource-limited environments or at the point-of-care because of its ease of use and low cost, particularly if combined with preserved reagents.

  5. Met gene amplification and protein hyperactivation is a mechanism of resistance to both first and third generation EGFR inhibitors in lung cancer treatment.

    PubMed

    Shi, Puyu; Oh, You-Take; Zhang, Guojing; Yao, Weilong; Yue, Ping; Li, Yikun; Kanteti, Rajani; Riehm, Jacob; Salgia, Ravi; Owonikoko, Taofeek K; Ramalingam, Suresh S; Chen, Mingwei; Sun, Shi-Yong

    2016-10-01

    The 3rd generation epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs; e.g., AZD9291), which selectively and irreversibly inhibit EGFR activating and T790M mutants, represent very promising therapeutic options for patients with non-small cell lung cancer (NSCLC) that has become resistant to 1st generation EGFR-TKIs due to T790M mutation. However, eventual resistance to the 3rd generation EGFR-TKIs has already been described in the clinic, resulting in disease progression. Therefore, there is a great challenge and urgent need to understand how this resistance occurs and to develop effective strategies to delay or overcome the resistance. The current study has demonstrated that Met amplification and hyperactivation is a resistance mechanism to both 1st and 3rd generation EGFR-TKIs since both erlotinib- and AZD9291-resistant HCC827 cell lines possessed amplified Met gene and hyperactivated Met, and were cross-resistant to AZD9291 or erlotinib. Met inhibition overcame the resistance of these cell lines to AZD9291 both in vitro and in vivo, including enhancement of apoptosis or G1 cell cycle arrest. Hence, we suggest that Met inhibition is also an effective strategy to overcome resistance of certain EGFR-mutated NSCLCs with Met amplification to AZD9291, warranting the further clinical validation of our findings. PMID:27450722

  6. miR-181a shows tumor suppressive effect against oral squamous cell carcinoma cells by downregulating K-ras

    SciTech Connect

    Shin, Ki-Hyuk; Bae, Susan D.; Hong, Hannah S.; Kim, Reuben H.; Kang, Mo K.; Park, No-Hee

    2011-01-28

    Research highlights: {yields} MicroRNA-181a (miR-181a) was frequently downregulated in oral squamous cell carcinoma (OSCC). {yields} Overexpression of miR-181a suppressed OSCC growth. {yields} K-ras is a novel target of miR-181a. {yields} Decreased miR-181a expression is attributed to its lower promoter activity in OSCC. -- Abstract: MicroRNAs (miRNAs) are epigenetic regulators of gene expression, and their deregulation plays an important role in human cancer, including oral squamous cell carcinoma (OSCC). Recently, we found that miRNA-181a (miR-181a) was upregulated during replicative senescence of normal human oral keratinocytes. Since senescence is considered as a tumor suppressive mechanism, we thus investigated the expression and biological role of miR-181a in OSCC. We found that miR-181a was frequently downregulated in OSCC. Ectopic expression of miR-181a suppressed proliferation and anchorage independent growth ability of OSCC. Moreover, miR-181a dramatically reduces the growth of OSCC on three dimensional organotypic raft culture. We also identified K-ras as a novel target of miR-181a. miR-181a decreased K-ras protein level as well as the luciferase activity of reporter vectors containing the 3'-untranslated region of K-ras gene. Finally, we defined a minimal regulatory region of miR-181a and found a positive correlation between its promoter activity and the level of miR-181a expression. In conclusion, miR-181a may function as an OSCC suppressor by targeting on K-ras oncogene. Thus, miR-181a should be considered for therapeutic application for OSCC.

  7. Immunophenotype and K-RAS mutation in mucinous ovarian adenocarcinoma with mural nodule of high-grade sarcoma: case report.

    PubMed

    Desouki, Mohamed M; Fadare, Oluwole; Kanbour, Anisa; Kanbour-Shakir, Amal

    2014-03-01

    Ovarian mucinous tumors with mural nodules are rare. The mural nodules are microscopically divergent neoplasms of varying sizes that may be benign (eg, sarcoma-like and carcinosarcoma-like), or malignant (eg, anaplastic carcinoma and sarcoma). The K-RAS gene mutation in ovarian mucinous neoplasms with mural nodules has not been previously reported. This is a case report of a 25-year-old female diagnosed with ovarian invasive mucinous adenocarcinoma with mural nodule of high-grade sarcoma. The mucinous tumor component demonstrated a K-RAS codon 12/13 mutation (p.G12V, c.35 G>T), whereas the sarcomatous component demonstrated a K-RAS codon 12/13 mutation (p.G12D, c.35 G>A). Although both tumor components revealed a mutation in codon 12 of K-RAS, they were of different nucleotide substitutions, indicating that these 2 tumor components were of different clonal origins. However, the fact that the 2 mutations identified in the tumor components are the most common mutations reported in mucinous tumors of the ovary, raises the possibility that sarcomatous mural nodules simply represent a form of dedifferentiation in mucinous tumors.

  8. Rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria by loop-mediated isothermal amplification.

    PubMed

    Cheng, Cancan; Zheng, Fen; Rui, Yongyu

    2014-12-01

    A loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for rapid detection of blaKPC, blaNDM, blaIMP, and blaVIM carbapenemase genes. Six oligonucleotides, including outer, inner, and loop primers, were designed for eight distinct regions in each target gene. Two qualitative criteria were used to evaluate LAMP reactions: visual inspection of color change and real-time detection of fluorescence change. The lower detection limit was 10 colony forming units (CFU) per reaction for real-time detection and 100 CFU per reaction for visual inspection for each gene. Two hundred twenty-two carbapenem-resistant clinical isolates (including 100 Pseudomonas aeruginosa, 100 Acinetobacter sp., and 22 Enterobacteriaceae) were tested by LAMP assay. At the same time, these isolates were confirmed by conventional polymerase chain reaction (PCR) and sequencing analysis. In these clinical isolates, the results of 11 strains with blaNDM, 11 strains with blaKPC, 11 strains with blaVIM, and 2 strains with blaIMP obtained using LAMP assays were concordant with conventional PCR. The LAMP method reported here may be a useful and powerful tool for rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria. PMID:25000338

  9. Target-induced reconfiguration of DNA probes for recycling amplification and signal-on electrochemical detection of hereditary tyrosinemia type I gene.

    PubMed

    Dou, Baoting; Yang, Cuiyun; Chai, Yaqin; Yuan, Ruo; Xiang, Yun

    2015-09-01

    By coupling target DNA-induced reconfiguration of the dsDNA probes with enzyme-assisted target recycling amplification, we describe the development of a signal-on electrochemical sensing approach for sensitive detection of hereditary tyrosinemia type I gene. The dsDNA probes are self-assembled on the sensing electrode, and the addition of the target DNA reconfigures and switches the dsDNA probes into active substrates for exonuclease III, which catalytically digests the probes and leads to cyclic reuse of the target DNA. The target DNA recycling and the removal of one of the ssDNA from the dsDNA probes by exonuclease III result in the formation of many hairpin structures on the sensor surface, which brings the electroactive methylene blue labels into proximity with the electrode and produces a significantly amplified current response for sensitive detection of the target gene down to 0.24 pM. This method is also selective to discriminate single-base mismatch and can be employed to detect the target gene in human serum samples. With the demonstration for the detection of the target gene, we expect the developed method to be a universal sensitive sensing platform for the detection of different nucleic acid sequences.

  10. Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

    PubMed

    Pathak, Deepali; Srivastava, Jyoti; Samad, Rana; Parwez, Iqbal; Kumar, Sudhir; Ali, Sher

    2010-06-01

    Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

  11. Rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria by loop-mediated isothermal amplification.

    PubMed

    Cheng, Cancan; Zheng, Fen; Rui, Yongyu

    2014-12-01

    A loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for rapid detection of blaKPC, blaNDM, blaIMP, and blaVIM carbapenemase genes. Six oligonucleotides, including outer, inner, and loop primers, were designed for eight distinct regions in each target gene. Two qualitative criteria were used to evaluate LAMP reactions: visual inspection of color change and real-time detection of fluorescence change. The lower detection limit was 10 colony forming units (CFU) per reaction for real-time detection and 100 CFU per reaction for visual inspection for each gene. Two hundred twenty-two carbapenem-resistant clinical isolates (including 100 Pseudomonas aeruginosa, 100 Acinetobacter sp., and 22 Enterobacteriaceae) were tested by LAMP assay. At the same time, these isolates were confirmed by conventional polymerase chain reaction (PCR) and sequencing analysis. In these clinical isolates, the results of 11 strains with blaNDM, 11 strains with blaKPC, 11 strains with blaVIM, and 2 strains with blaIMP obtained using LAMP assays were concordant with conventional PCR. The LAMP method reported here may be a useful and powerful tool for rapid detection of blaNDM, blaKPC, blaIMP, and blaVIM carbapenemase genes in bacteria.

  12. Loop-mediated isothermal amplification: Rapid and sensitive detection of the antibiotic resistance gene ISAba1-blaOXA-51-like in Acinetobacter baumannii.

    PubMed

    Mu, Xiaoqin; Nakano, Ryuichi; Nakano, Akiyo; Ubagai, Tsuneyuki; Kikuchi-Ueda, Takane; Tansho-Nagakawa, Shigeru; Kikuchi, Hirotoshi; Kamoshida, Go; Endo, Shiro; Yano, Hisakazu; Ono, Yasuo

    2016-02-01

    Carbapenem-resistant Acinetobacter baumannii, which are mainly induced by the production of OXA-type β-lactamases, are among the leading causes of nosocomial infections worldwide. Among the β-lactamase genes, the presence of the OXA-51-like gene carrying the upstream insertion sequence, ISAba1, was found to be one of the most prevalent carbapenem resistance mechanisms utilized by these bacteria. Consequently, it is necessary to develop a rapid detection method for ISAba1-blaOXA-51-like sequence for the timely and appropriate antibiotic treatment of A. baumannii infection. In this study, a loop-mediated isothermal amplification (LAMP) assay was optimized for ISAba1-blaOXA-51-like detection. The LAMP primer set was designed to recognize distinct sequences in the ISAba1-blaOXA-51-like gene and could amplify the gene within 25 min at an isothermal temperature of 60°C. This LAMP assay was able to detect the ISAba1-blaOXA-51-like gene with high specificity; in addition, no cross-reactivity was observed for other types of β-lactamase producers (OXA-23-like, OXA-40-like, OXA-58-like, and IMP-1), as indicated by the absence of false positive or false negative results. The detection limit for this assay was found to be 10(0)CFU per tube which was 100-fold more sensitive than a polymerase chain reaction assay for ISAba1-blaOXA-51-like detection. Furthermore, the LAMP assay provided swift detection of the ISAba1-blaOXA-51-like gene, even directly from clinical specimens. In summary, we have described a new, rapid assay for the detection of the ISAba1-blaOXA-51-like gene from A. baumannii that could be useful in a clinical setting. This method might facilitate epidemiological studies and allow monitoring of the emergence of drug resistant strains.

  13. [Research advances of K-ras mutation in the prognosis and targeted therapy of gastric cancer].

    PubMed

    Huang, Y; Wei, J; Liu, B R

    2016-02-01

    K-ras mutations have been described in 30% of human cancers with significantly different mutation frequencies. High K-ras mutation frequency is found in many cancers such as pancreas and lung cancers, whereas, gastric cancer has a relatively low K-ras mutation frequency. In recent years, numerous researches have focused on the K-ras mutation in gastric cancer. This review summarizes the K-ras mutation frequency in gastric cancer, the relationship of K-ras mutation with clinicopathologic features and prognosis of gastric cancer patients, targeted therapy for K-ras mutated gastric cancer, some small-molecular inhibitors of K-ras, and development of targeted therapy drugs for K-ras signaling pathway in gastric cancer.

  14. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  15. The Key Role of Calmodulin in KRAS-Driven Adenocarcinomas.

    PubMed

    Nussinov, Ruth; Muratcioglu, Serena; Tsai, Chung-Jung; Jang, Hyunbum; Gursoy, Attila; Keskin, Ozlem

    2015-09-01

    KRAS4B is a highly oncogenic splice variant of the KRAS isoform. It is the only isoform associated with initiation of adenocarcinomas. Insight into why and how KRAS4B can mediate ductal adenocarcinomas, particularly of the pancreas, is vastly important for its therapeutics. Here we point out the overlooked critical role of calmodulin (CaM). Calmodulin selectively binds to GTP-bound K-Ras4B; but not to other Ras isoforms. Cell proliferation and growth require the MAPK (Raf/MEK/ERK) and PI3K/Akt pathways. We propose that Ca(2+)/calmodulin promote PI3Kα/Akt signaling, and suggest how. The elevated calcium levels clinically observed in adenocarcinomas may explain calmodulin's involvement in recruiting and stimulating PI3Kα through interaction with its n/cSH2 domains as well as K-Ras4B; importantly, it also explains why K-Ras4B specifically is a key player in ductal carcinomas, such as pancreatic (PDAC), colorectal (CRC), and lung cancers. We hypothesize that calmodulin recruits and helps activate PI3Kα at the membrane, and that this is the likely reason for Ca(2+)/calmodulin dependence in adenocarcinomas. Calmodulin can contribute to initiation/progression of ductal cancers via both PI3Kα/Akt and Raf/MEK/ERK pathways. Blocking the K-Ras4B/MAPK pathway and calmodulin/PI3Kα binding in a K-Ras4B/calmodulin/PI3Kα trimer could be a promising adenocarcinoma-specific therapeutic strategy.

  16. Sensitive and Rapid Detection of the New Delhi Metallo-Beta-Lactamase Gene by Loop-Mediated Isothermal Amplification

    PubMed Central

    Liu, Wei; Zou, Dayang; Li, Yan; Wang, Xuesong; He, Xiang; Wei, Xiao; Shao, Changlin; Li, Xuelian; Shang, Wei; Yu, Kaitao; Liu, Dawei; Li, Yunmei; Guo, Jing; Yin, Zhitao

    2012-01-01

    New Delhi metallo-β-lactamase 1 (NDM-1), which is associated with resistance to carbapenem, was first reported in 2008. A sensitive and rapid molecular assay to detect the plasmid blaNDM-1 in clinical isolates is needed to control its spread. We describe a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of blaNDM-1 from pure culture and sputum, urine, and fecal samples. Eight sets of primers were designed to recognize six or eight distinct sequences on target blaNDM-1, and one set was selected as the most appropriate set of primers for its rapid detection. The specificity and sensitivity of the primers in the LAMP reactions for blaNDM-1 detection were determined. The sensitivity of the LAMP assay for blaNDM-1 detection in sputum, urine, and fecal samples was also tested. Two methods, namely, monitoring of turbidity and addition of calcein to the reaction tube, were used to determine negative and positive results. The results showed that target DNA was amplified and visualized by the two detection methods within 70 min at an isothermal temperature of 65°C. The sensitivity of LAMP, with a detection limit of 10.70 pg/μl DNA, was 100-fold greater than that of PCR. Thirteen infection bacterial strains without blaNDM-1 were selected for testing of specificity, and the results of the amplification were negative, which showed that the primers had good levels of specificity. The LAMP method reported here is demonstrated to be a potentially valuable means for the detection of blaNDM-1 and rapid clinical diagnosis, being fast, simple, and low in cost. PMID:22357496

  17. Diagnosis and follow-up of Whipple's disease by amplification of the 16S rRNA gene of Tropheryma whippelii.

    PubMed

    Pron, B; Poyart, C; Abachin, E; Fest, T; Belanger, C; Bonnet, C; Capelle, P; Bretagne, J F; Fabianek, A; Girard, L; Hagège, H; Berche, P

    1999-01-01

    Amplification of the 16S rRNA gene of Tropheryma whippelii was performed in eight patients with Whipple's disease and 34 control patients to confirm a diagnosis of Whipple's disease and to monitor the course of disease. Polymerase chain reaction (PCR) tests were positive before treatment in 13 of 15 tissue samples from Whipple's disease patients (gut 8/8; lymph nodes 2/2; bone marrow 1/2; peripheral blood 2/3), in contrast to none of 54 tissue samples from controls. PCR tests converted to negative within 4-6 months in six of the Whipple's disease patients undergoing therapy. These results show that PCR is a reliable and useful tool for diagnosis of Whipple's disease and for monitoring bacterial elimination during antibiotic therapy.

  18. Diagnostic application of KRAS mutation testing in uterine microglandular proliferations.

    PubMed

    Hong, Wei; Abi-Raad, Rita; Alomari, Ahmed K; Hui, Pei; Buza, Natalia

    2015-07-01

    Microglandular proliferations often pose a diagnostic challenge in small endocervical and endometrial biopsies. Microglandular hyperplasia (MGH) is one of the most common pseudoneoplastic glandular proliferations of uterine cervix, which can closely mimic endometrial adenocarcinomas (EAC) with a microglandular pattern (microglandular EAC). Although MGH is typically characterized by relatively uniform nuclei and rare to absent mitoses, atypical forms with architectural and/or cytologic deviation from the usual morphology have been previously described. Recently, a series of MGH with high mitotic activity has also been documented. Although careful morphological assessment and immunohistochemical workup can resolve the diagnostic dilemma in some cases, additional differential diagnostic tools are needed to separate both the common and atypical variants of MGH from EAC with microglandular pattern. Frequent KRAS mutation has been previously reported in endometrial complex mucinous lesions and endometrial mucinous carcinomas. However, the diagnostic utility of KRAS mutation analysis has not yet been explored in the context of cervical and endometrial microglandular lesions. Twelve mitotically active MGH cases and 15 cases of EAC with microglandular growth pattern were selected for the study. KRAS mutation analysis was performed in all cases by highly sensitive single-strand conformation polymorphism analysis. Clinical history and follow-up data were retrieved from electronic medical records. KRAS mutation was absent in all MGH cases, whereas 9 (60%) of 15 microglandular EAC cases tested positive for KRAS mutation. Our data indicate that KRAS mutation analysis may offer additional discriminatory power in separating benign MGH from EAC with microglandular pattern.

  19. Let-7 Sensitizes KRAS Mutant Tumor Cells to Chemotherapy

    PubMed Central

    Dai, Xin; Jiang, Ying; Tan, Chalet

    2015-01-01

    KRAS is the most commonly mutated oncogene in human cancers and is associated with poor prognosis and drug resistance. Let-7 is a family of tumor suppressor microRNAs that are frequently suppressed in solid tumors, where KRAS mutations are highly prevalent. In this study, we investigated the potential use of let-7 as a chemosensitizer. We found that let-7b repletion selectively sensitized KRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type KRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEK/ERK and PI3K/AKT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in KRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of β-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of KRAS mutant tumors. PMID:25946136

  20. Correlation of HER2 overexpression with gene amplification and its relation to chromosome 17 aneuploidy: a 5-year experience with invasive ductal and lobular carcinomas.

    PubMed

    Nassar, Aziza; Khoor, Andras; Radhakrishnan, Reshmitha; Radhakrishnan, Anu; Cohen, Cynthia

    2014-01-01

    The HER2 oncogene shows expression or amplification, or both, in approximately 15% to 20% of breast cancers and has been associated with poor prognosis and a response to trastuzumab therapy. HER2 gene status determines the eligibility of breast cancer patients for trastuzumab therapy and a large fraction (41-56%) of these patients respond to targeted therapy. Several studies have related the increased expression of HER2 to an increased copy number of chromosome 17, rather than amplification of the HER2 gene. We compared the results of immunohistochemistry and fluorescence in situ hybridization in both invasive ductal and invasive lobular carcinomas, to determine the frequency of chromosome 17 aneuploidy associated with discordant results. In total, 390 invasive ductal carcinomas and 180 invasive lobular carcinomas diagnosed from January 2000 to December 2005 were included in the study only if results were available for immunohistochemistry (HercepTest; DAKO, Carpinteria, California) and fluorescence in situ hybridization (PathVysion HER2 DNA Probe Kit; Abbott Laboratories, Des Plaines, Illinois). Tumors classified as invasive ductal carcinomas were graded according to the Bloom-Richardson grading system. Correlation between the results of immunohistochemistry and fluorescence in situ hybridization was performed for all categories. Among invasive ductal carcinomas, 29% (115/390) showed chromosome 17 aneuploidy, mostly associated with grade 3/HER2 2+ (45%) or grade 2/HER2 3+ (55%) that were not amplified. Also, 34% (12/35) of invasive lobular carcinomas showed chromosome 17 aneuploidy; approximately one-third of these cases were HER2 2+ (33%) and HER2 3+ (37%) that were not amplified. Discordance between the results of immunohistochemistry and fluorescence in situ hybridization in both ductal and lobular carcinomas is largely associated with chromosome 17 aneuploidy.

  1. Development and application of loop-mediated isothermal amplification assays for rapid visual detection of cry2Ab and cry3A genes in genetically-modified crops.

    PubMed

    Li, Feiwu; Yan, Wei; Long, Likun; Qi, Xing; Li, Congcong; Zhang, Shihong

    2014-01-01

    The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field. PMID:25167136

  2. Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops

    PubMed Central

    Li, Feiwu; Yan, Wei; Long, Likun; Qi, Xing; Li, Congcong; Zhang, Shihong

    2014-01-01

    The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field. PMID:25167136

  3. Development and application of loop-mediated isothermal amplification assays for rapid visual detection of cry2Ab and cry3A genes in genetically-modified crops.

    PubMed

    Li, Feiwu; Yan, Wei; Long, Likun; Qi, Xing; Li, Congcong; Zhang, Shihong

    2014-01-01

    The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

  4. K-Ras4B phosphorylation at Ser181 is inhibited by calmodulin and modulates K-Ras activity and function.

    PubMed

    Alvarez-Moya, B; López-Alcalá, C; Drosten, M; Bachs, O; Agell, N

    2010-11-01

    Fine tuning of Ras activity is widely known as a mechanism to induce different cellular responses. Recently, we have shown that calmodulin (CaM) binds to K-Ras and that K-Ras phosphorylation inhibits its interaction with CaM. In this study we report that CaM inhibits K-Ras phosphorylation at Ser181 by protein kinase C (PKC) in vivo, and this is a mechanism to modulate K-Ras activity and signaling. Although CaM inhibition increased the activation of endogenous K-Ras, PKC inhibition decreased its activation status. We demonstrate that K-Ras phosphorylation decreased susceptibility to p120GAP activity. Accordingly, we also observed that non-phosphorylable K-Ras mutant exhibits a less sustained activation profile and do not efficiently activate AKT at low growth factor doses compared with wild-type K-Ras. It is interesting that the physiological responses induced by K-Ras are affected by this phosphorylation; when K-Ras cannot be phosphorylated it exhibits a remarkably decreased ability to stimulate proliferation in non-saturated serum conditions. Finally, we demonstrate that phosphorylation also regulates oncogenic K-Ras functions, as focus formation capacity, mobility and apoptosis resistance upon adriamycin treatment of cells expressing oncogenic K-Ras that cannot be phosphorylated are highly compromised. Moreover, at low serum concentration proliferation and survival is practically inhibited when cells cannot phosphorylate oncogenic K-Ras. In this condition, K-Ras phosphorylation is essential to ensure a proper activation of mitogen-activated protein kinase and PI3K/AKT pathways. In summary, our findings suggest that the interplay between CaM interaction and PKC phosphorylation is essential to regulate non-oncogenic and oncogenic K-Ras activity and functionality.

  5. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

    PubMed

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

    2014-09-15

    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples.

  6. A regulatory gene (ccaR) required for cephamycin and clavulanic acid production in Streptomyces clavuligerus: amplification results in overproduction of both beta-lactam compounds.

    PubMed Central

    Pérez-Llarena, F J; Liras, P; Rodríguez-García, A; Martín, J F

    1997-01-01

    A regulatory gene (ccaR), located within the cephamycin gene cluster of Streptomyces clavuligerus, is linked to a gene (blp) encoding a protein similar to a beta-lactamase-inhibitory protein. Expression of ccaR is required for cephamycin and clavulanic acid biosynthesis in S. clavuligerus. The ccaR-encoded protein resembles the ActII-ORF4, RedD, AfsR, and DnrI regulatory proteins of other Streptomyces species, all of which share several motifs. Disruption of ccaR by targeted double recombination resulted in the loss of the ability to synthesize cephamycin and clavulanic acid. Complementation of the disrupted mutant with ccaR restored production of both secondary metabolites. ccaR was expressed as a monocistronic transcript at 24 and 48 h in S. clavuligerus cultures (preceding the phase of antibiotic accumulation), but no transcript hybridization signals were observed at 72 or 96 h. This expression pattern is consistent with those of regulatory proteins required for antibiotic biosynthesis. Amplification of ccaR in S. clavuligerus resulted in a two- to threefold increase in the production of cephamycin and clavulanic acid. PMID:9068654

  7. Association between coffee drinking and K-ras mutations in exocrine pancreatic cancer. PANKRAS II Study Group

    PubMed Central

    Porta, M.; Malats, N.; Guarner, L.; Carrato, A.; Rifa, J.; Salas, A.; Corominas, J. M.; Andreu, M.; Real, F. X.

    1999-01-01

    STUDY OBJECTIVE: To analyse the relation between coffee consumption and mutations in the K-ras gene in exocrine pancreatic cancer. DESIGN: Case- case study. Consumption of coffee among cases with the activating mutation in the K-ras gene was compared with that of cases without the mutation. SETTING AND PATIENTS: All cases of pancreatic cancer newly diagnosed at five hospitals in Spain during three years were included in the PANKRAS II Study (n = 185, of whom 121 whose tissue was available for molecular analysis are the object of the present report). Over 88% were personally interviewed in hospital. DNA was amplified from paraffin wax embedded tissues, and mutations in codon 12 of K-ras were detected by the artificial RFLP technique. MAIN RESULTS: Mutations were found in tumours from 94 of 121 patients (77.7%). Mutations were more common among regular coffee drinkers than among non-regular coffee drinkers (82.0% v 55.6%, p = 0.018, n = 107). The odds ratio adjusted by age, sex, smoking and alcohol drinking was 5.41 (95% CI 1.64, 17.78). The weekly intake of coffee was significantly higher among patients with a mutated tumour (mean of 14.5 cups/week v 8.8 among patients with a wild type tumour, p < 0.05). With respect to non- regular coffee drinkers, the odds ratio of a mutated tumour adjusted by age, sex, smoking and alcohol drinking was 3.26 for drinkers of 2-7 cups/week, 5.77 for drinkers of 8-14 cups/week and 9.99 for drinkers of > or = 15 cups/week (p < 0.01, test for trend). CONCLUSIONS: Pancreatic cancer cases without activating mutations in the K-ras gene had drank significantly less coffee than cases with a mutation, with a significant dose response relation: the less they drank, the less likely their tumours were to harbour a mutation. In exocrine pancreatic cancer the K-ras gene may be activated less often among non-regular coffee drinkers than among regular drinkers. Caffeine, other coffee compounds or other factors with which coffee drinking is

  8. Crosstalk of Ras and Rho: activation of RhoA abates Kras-induced liver tumorigenesis in transgenic zebrafish models.

    PubMed

    Chew, T W; Liu, X J; Liu, L; Spitsbergen, J M; Gong, Z; Low, B C

    2014-05-22

    RAS and Rho small GTPases are key molecular switches that control cell dynamics, cell growth and tissue development through their distinct signaling pathways. Although much has been learnt about their individual functions in both cell and animal models, the physiological and pathophysiological consequences of their signaling crosstalk in multi-cellular context in vivo remain largely unknown, especially in liver development and liver tumorigenesis. Furthermore, the roles of RhoA in RAS-mediated transformation and their crosstalk in vitro remain highly controversial. When challenged with carcinogens, zebrafish developed liver cancer that resembles the human liver cancer both molecularly and histopathologically. Capitalizing on the growing importance and relevance of zebrafish (Danio rerio) as an alternate cancer model, we have generated liver-specific, Tet-on-inducible transgenic lines expressing oncogenic Kras(G12V), RhoA, constitutively active RhoA(G14V) or dominant-negative RhoA(T19N). Double-transgenic lines expressing Kras(G12V) with one of the three RhoA genes were also generated. Based on quantitative bioimaging and molecular markers for genetic and signaling aberrations, we showed that the induced expression of oncogenic Kras during early development led to liver enlargement and hepatocyte proliferation, associated with elevated Erk phosphorylation, activation of Akt2 and modulation of its two downstream targets, p21Cip and S6 kinase. Such an increase in liver size and Akt2 expression was augmented by dominant-negative RhoA(T19N), but was abrogated by the constitutive-active RhoA(G14V). Consequently, induced expression of the oncogenic Kras in adult transgenic fish led to the development of hepatocellular carcinomas. Survival studies further revealed that the co-expression of dominant-negative RhoA(T19N) with oncogenic Kras increased the mortality rate compared with the other single or double-transgenic lines. This study provides evidence of the previously

  9. Impact of KRAS, BRAF, PIK3CA, TP53 status and intraindividual mutation heterogeneity on outcome after liver resection for colorectal cancer metastases

    PubMed Central

    Løes, Inger Marie; Immervoll, Heike; Sorbye, Halfdan; Angelsen, Jon‐Helge; Horn, Arild; Knappskog, Stian

    2016-01-01

    We determined prognostic impact of KRAS, BRAF, PIK3CA and TP53 mutation status and mutation heterogeneity among 164 colorectal cancer (CRC) patients undergoing liver resections for metastatic disease. Mutation status was determined by Sanger sequencing of a total of 422 metastatic deposits. In univariate analysis, KRAS (33.5%), BRAF (6.1%) and PIK3CA (13.4%) mutations each predicted reduced median time to relapse (TTR) (7 vs. 22, 3 vs. 16 and 4 vs. 17 months; p < 0.001, 0.002 and 0.023, respectively). KRAS and BRAF mutations also predicted a reduced median disease‐specific survival (DSS) (29 vs. 51 and 16 vs. 49 months; p <0.001 and 0.008, respectively). No effect of TP53 (60.4%) mutation status was observed. Postoperative, but not preoperative chemotherapy improved both TTR and DSS (p < 0.001 for both) with no interaction with gene mutation status. Among 94 patients harboring two or more metastatic deposits, 13 revealed mutation heterogeneity across metastatic deposits for at least one gene. Mutation heterogeneity predicted reduced median DSS compared to homogeneous mutations (18 vs. 37 months; p = 0.011 for all genes; 16 vs. 26 months; p < 0.001 analyzing BRAF or KRAS mutations separately). In multivariate analyses, KRAS or BRAF mutations consistently predicted poor TRR and DSS. Mutation heterogeneity robustly predicted DSS but not TTR, while postoperative chemotherapy improved both TTR and DSS. Our findings indicate that BRAF and KRAS mutations as well as mutation heterogeneity predict poor outcome in CRC patients subsequent to liver resections and might help guide treatment decisions. PMID:26991344

  10. IS THE AMPLIFICATION OF c-MYC, MLL AND RUNX1 GENES IN AML AND MDS PATIENTS WITH TRISOMY 8, 11 AND 21 A FACTOR FOR A CLONAL EVOLUTION IN THEIR KARYOTYPE?

    PubMed

    Angelova, S; Spassov, B; Nikolova, V; Christov, I; Tzvetkov, N; Simeonova, M

    2015-01-01

    The aim of our study was 1) to define if the amplification of c-MYC, MLL and RUNX1 genes is related to the progressive changes of the karyotype in patients with AML and MDS with trisomy 8, 11 and 21 (+8, +11 and +21) in bone marrow and 2) can that amplification be accepted as part of the clonal evolution (CE). Karyotype analysis was performed in 179 patients with AML or MDS with the different chromosomal aberrations (CA) aged 16-81. The findings were distributed as follow: initiating balanced CA (n = 60), aneuploidia (n = 55), unbalanced CA (n = 64). Amplification of c-MYC, MLL and RUNX1 genes by means of fluorescence in situ hybridization (FISH) was found in 35% (7 out of 20) of AML and MDS patients with +8, +11 u +21 as single CA in their karyotype; in 63.6% of pts (7 out of 11)--with additional numerical or structural CA and in 75% (9 out of 12)--with complex karyotype. We assume that the amplification of the respective chromosomal regions in patients with +8, +11 and +21 is related to CE. Considering the amplification as a factor of CE, we established 3 patterns of karyotype development depending on the type of the initiating CA in it. Significant statistical differences were found between the three patterns regarding the karyotype distribution in the different stages of progression (p < 0.001). PMID:26214902

  11. Mutation of NRAS but not KRAS significantly reduces myeloma sensitivity to single-agent bortezomib therapy

    PubMed Central

    Lichter, David I.; Di Bacco, Alessandra; Blakemore, Stephen J.; Berger, Allison; Koenig, Erik; Bernard, Hugues; Trepicchio, William; Li, Bin; Neuwirth, Rachel; Chattopadhyay, Nibedita; Bolen, Joseph B.; Dorner, Andrew J.; van de Velde, Helgi; Ricci, Deborah; Jagannath, Sundar; Berenson, James R.; Richardson, Paul G.; Stadtmauer, Edward A.; Orlowski, Robert Z.; Lonial, Sagar; Anderson, Kenneth C.; Sonneveld, Pieter; San Miguel, Jesús F.; Esseltine, Dixie-Lee; Schu, Matthew

    2014-01-01

    Various translocations and mutations have been identified in myeloma, and certain aberrations, such as t(4;14) and del17, are linked with disease prognosis. To investigate mutational prevalence in myeloma and associations between mutations and patient outcomes, we tested a panel of 41 known oncogenes and tumor suppressor genes in tumor samples from 133 relapsed myeloma patients participating in phase 2 or 3 clinical trials of bortezomib. DNA mutations were identified in 14 genes. BRAF as well as RAS genes were mutated in a large proportion of cases (45.9%) and these mutations were mutually exclusive. New recurrent mutations were also identified, including in the PDGFRA and JAK3 genes. NRAS mutations were associated with a significantly lower response rate to single-agent bortezomib (7% vs 53% in patients with mutant vs wild-type NRAS, P = .00116, Bonferroni-corrected P = .016), as well as shorter time to progression in bortezomib-treated patients (P = .0058, Bonferroni-corrected P = .012). However, NRAS mutation did not impact outcome in patients treated with high-dose dexamethasone. KRAS mutation did not reduce sensitivity to bortezomib or dexamethasone. These findings identify a significant clinical impact of NRAS mutation in myeloma and demonstrate a clear example of functional differences between the KRAS and NRAS oncogenes. PMID:24335104

  12. Marker production by PCR amplification with primer pairs from conserved sequences of WRKY genes in chili pepper.

    PubMed

    Kim, Hyoun-Joung; Lee, Heung-Ryul; Han, Jung-Heon; Yeom, Seon-In; Harn, Chee-Hark; Kim, Byung-Dong

    2008-04-30

    Despite increasing awareness of the importance of WRKY genes in plant defense signaling, the locations of these genes in the Capsicum genome have not been established. To develop WRKY-based markers, primer sequences were deduced from the conserved sequences of the DNA binding motif within the WRKY domains of tomato and pepper genes. These primers were derived from upstream and downstream parts of the conserved sequences of the three WRKY groups. Six primer combinations of each WRKY group were tested for polymorphisms between the mapping parents, C. annuum 'CM334' and C. annuum 'Chilsungcho'. DNA fragments amplified by primer pairs deduced from WRKY Group II genes revealed high levels of polymorphism. Using 32 primer pairs to amplify upstream and downstream parts of the WRKY domain of WRKY group II genes, 60 polymorphic bands were detected. Polymorphisms were not detected with primer pairs from downstream parts of WRKY group II genes. Half of these primers were subjected to F2 genotyping to construct a linkage map. Thirty of 41 markers were located evenly spaced on 20 of the 28 linkage groups, without clustering. This linkage map also consisted of 199 AFLP and 26 SSR markers. This WRKY-based marker system is a rapid and simple method for generating sequence-specific markers for plant gene families.

  13. Low prevalence of K-RAS, EGF-R and BRAF mutations in sinonasal adenocarcinomas. Implications for anti-EGFR treatments.

    PubMed

    Franchi, Alessandro; Innocenti, Duccio Rossi Degli; Palomba, Annarita; Miligi, Lucia; Paiar, Fabiola; Franzese, Ciro; Santucci, Marco

    2014-07-01

    We have previously shown that a subset of sinonasal intestinal-type adenocarcinomas (ITAC) shows activation of the epidermal growth factor-receptor (EGFR) pathway. In this study we examine the status of the EGFR, KRAS and BRAF genes in a series of sinonasal intestinal (ITAC) and non-intestinal type adenocarcinomas (non-ITAC). Eighteen ITACs and 12 non-ITACs were studied immunohistochemically for EGFR expression. Point mutations were analyzed for EGFR exons 19 and 21, KRAS exon 2 and BRAF exon 15 by direct sequencing. Non-ITACs showed significantly higher expression of EGFR (p = 0.015). Mutation analysis revealed one ITAC with EGFR and one ITAC with KRAS mutation, while two non-ITACs presented mutation of BRAF. We conclude that a subset of sinonasal adenocarcinomas shows overexpression of EGFR, while activating mutations of the signaling cascade downstream of EGFR are rare, suggesting that these tumors could be good candidates for anti-EGFR therapies.

  14. A new morphologically distinct avian malaria parasite that fails detection by established polymerase chain reaction-based protocols for amplification of the cytochrome B gene.

    PubMed

    Zehtindjiev, Pavel; Križanauskienė, Asta; Bensch, Staffan; Palinauskas, Vaidas; Asghar, Muhammad; Dimitrov, Dimitar; Scebba, Sergio; Valkiūnas, Gediminas

    2012-06-01

    Plasmodium polymorphum n. sp. (Haemosporida, Plasmodiidae) was found in the skylark, Alauda arvensis (Passeriformes: Alaudidae), during autumnal migration in southern Italy. This organism is illustrated and described based on the morphology of its blood stages. The most distinctive feature of this malaria parasite is the clear preference of its blood stages (trophozoites, meronts, and gametocytes) for immature red blood cells, including erythroblasts. Based on preference of erythrocytic meronts for immature red blood cells, P. polymorphum is most similar to species of the subgenus Huffia . This parasite can be readily distinguished from all other bird malaria parasites, including Plasmodium ( Huffia ) spp., due to preferential development and maturation of its gametocytes in immature red blood cells, a unique character for avian Plasmodium spp. In addition, the margins of nuclei in blood stages of P. polymorphum are markedly smooth and distinct; this is also a distinct diagnostic feature of this parasite. Plasmodium polymorphum has been recorded only in the skylark; it is probably a rare parasite, whose host range and geographical distribution remain unclear. Microscopic examination detected a light infection of Plasmodium relictum (lineage GRW11, parasitemia of <0.01%) in the same sample with P. polymorphum ; the latter parasite clearly predominated (3.5% parasitemia). However, experienced researchers were unable to detect sequences of mitochondrial cytochrome b gene (cyt b ) of P. polymorphum from the microscopically positive sample by using published and newly designed primers for DNA amplification of avian Plasmodium spp. The light parasitemia of P. relictum was easily detectable using several polymerase chain reaction (PCR)-based assays, but P. polymorphum was undetectable in all applied assays. Quantitative PCR also showed the presence of light parasitemia (0.06%) of the lineage GRW11 in this sample. This supports the conclusion that the morphologically

  15. The SPANX gene family of cancer/testis-specific antigens: rapid evolution and amplification in African great apes and hominids.

    PubMed

    Kouprina, Natalay; Mullokandov, Michael; Rogozin, Igor B; Collins, N Keith; Solomon, Greg; Otstot, John; Risinger, John I; Koonin, Eugene V; Barrett, J Carl; Larionov, Vladimir

    2004-03-01

    Human sperm protein associated with the nucleus on the X chromosome (SPANX) genes comprise a gene family with five known members (SPANX-A1, -A2, -B, -C, and -D), encoding cancer/testis-specific antigens that are potential targets for cancer immunotherapy. These highly similar paralogous genes cluster on the X chromosome at Xq27. We isolated and sequenced primate genomic clones homologous to human SPANX. Analysis of these clones and search of the human genome sequence revealed an uncharacterized group of genes, SPANX-N, which are present in all primates as well as in mouse and rat. In humans, four SPANX-N genes comprise a series of tandem duplicates at Xq27; a fifth member of this subfamily is located at Xp11. Similarly to SPANX-A/D, human SPANX-N genes are expressed in normal testis and some melanoma cell lines; testis-specific expression of SPANX is also conserved in mouse. Analysis of the taxonomic distribution of the long and short forms of the intron indicates that SPANX-N is the ancestral form, from which the SPANX-A/D subfamily evolved in the common ancestor of the hominoid lineage. Strikingly, the coding sequences of the SPANX genes evolved much faster than the intron and the 5' untranslated region. There is a strong correlation between the rates of evolution of synonymous and nonsynonymous codon positions, both of which are accelerated 2-fold or more compared to the noncoding sequences. Thus, evolution of the SPANX family appears to have involved positive selection that affected not only the protein sequence but also the synonymous sites in the coding sequence.

  16. EVI1, a target gene for amplification at 3q26, antagonizes transforming growth factor-β-mediated growth inhibition in hepatocellular carcinoma.

    PubMed

    Yasui, Kohichiroh; Konishi, Chika; Gen, Yasuyuki; Endo, Mio; Dohi, Osamu; Tomie, Akira; Kitaichi, Tomoko; Yamada, Nobuhisa; Iwai, Naoto; Nishikawa, Taichiro; Yamaguchi, Kanji; Moriguchi, Michihisa; Sumida, Yoshio; Mitsuyoshi, Hironori; Tanaka, Shinji; Arii, Shigeki; Itoh, Yoshito

    2015-07-01

    EVI1 (ecotropic viral integration site 1) is one of the most aggressive oncogenes associated with myeloid leukemia. We investigated DNA copy number aberrations in human hepatocellular carcinoma (HCC) cell lines using a high-density oligonucleotide microarray. We found that a novel amplification at the chromosomal region 3q26 occurs in the HCC cell line JHH-1, and that MECOM (MDS1 and EVI1 complex locus), which lies within the 3q26 region, was amplified. Quantitative PCR analysis of the three transcripts transcribed from MECOM indicated that only EVI1, but not the fusion transcript MDS1-EVI1 or MDS1, was overexpressed in JHH-1 cells and was significantly upregulated in 22 (61%) of 36 primary HCC tumors when compared with their non-tumorous counterparts. A copy number gain of EVI1 was observed in 24 (36%) of 66 primary HCC tumors. High EVI1 expression was significantly associated with larger tumor size and higher level of des-γ-carboxy prothrombin, a tumor marker for HCC. Knockdown of EVI1 resulted in increased induction of the cyclin-dependent kinase inhibitor p15(INK) (4B) by transforming growth factor (TGF)-β and decreased expression of c-Myc, cyclin D1, and phosphorylated Rb in TGF-β-treated cells. Consequently, knockdown of EVI1 led to reduced DNA synthesis and cell viability. Collectively, our results suggest that EVI1 is a probable target gene that acts as a driving force for the amplification at 3q26 in HCC and that the oncoprotein EVI1 antagonizes TGF-β-mediated growth inhibition of HCC cells.

  17. Serum-Based Quantification of MYCN Gene Amplification in Young Patients with Neuroblastoma: Potential Utility as a Surrogate Biomarker for Neuroblastoma

    PubMed Central

    Yagyu, Shigeki; Iehara, Tomoko; Tanaka, Shiro; Gotoh, Takahiro; Misawa-Furihata, Akiko; Sugimoto, Tohru; London, Wendy B.; Hogarty, Michael D.; Teramukai, Satoshi; Nakagawara, Akira; Hiyama, Eiso; Maris, John M.; Hosoi, Hajime

    2016-01-01

    We previously developed a method for determining MYCN gene amplification status using cell-free DNA fragments released from cancer cells into the blood of patients with neuroblastoma (NB). Here, we analyzed the relationship between MYCN amplification (MNA) status and neuroblastoma prognosis. We screened serum samples from 151 patients with NB for MNA, using real-time quantitative PCR, and compared the results with MYCN status determined using paired tumor samples. We additionally investigated whether MNA status correlates with patient survival. When a cut-off value of 5 was used, serum-based MNA analysis was found to show good sensitivity (86%) and very high specificity (95%). The sensitivities for stage 1 and 2 might be acceptable, even though it is not as good as for stage 3 and 4 (67% for stage 1 and 2, 92% for stage 3, and 87% for stage 4). MNA status correlated with overall survival in our cohort of 82 patients, with survival data available (p < 0.01). The hazard ratio of MNA status was 4.98 in patients diagnosed at less than 18 months of age (95% confidence interval, 1.00–24.78), and 1.41 (95% confidence interval, 0.63–3.14) for those diagnosed at 18 months of age or older. Serum-based MNA analysis is rapid and non-invasive compared with tumor-based MNA analysis, and has potential to predict tumor MNA status. There is still a room to improve the sensitivity of the test for tumors of stages 1 and 2, nonetheless this assay might help to determine therapeutic strategies prior to tumor biopsy, especially for patients with a life-threatening condition, as well as for patients of less than 18 months of age whose risk-grouping and treatment allocation depends on their MNA status. PMID:27513929

  18. Serum-Based Quantification of MYCN Gene Amplification in Young Patients with Neuroblastoma: Potential Utility as a Surrogate Biomarker for Neuroblastoma.

    PubMed

    Yagyu, Shigeki; Iehara, Tomoko; Tanaka, Shiro; Gotoh, Takahiro; Misawa-Furihata, Akiko; Sugimoto, Tohru; London, Wendy B; Hogarty, Michael D; Teramukai, Satoshi; Nakagawara, Akira; Hiyama, Eiso; Maris, John M; Hosoi, Hajime

    2016-01-01

    We previously developed a method for determining MYCN gene amplification status using cell-free DNA fragments released from cancer cells into the blood of patients with neuroblastoma (NB). Here, we analyzed the relationship between MYCN amplification (MNA) status and neuroblastoma prognosis. We screened serum samples from 151 patients with NB for MNA, using real-time quantitative PCR, and compared the results with MYCN status determined using paired tumor samples. We additionally investigated whether MNA status correlates with patient survival. When a cut-off value of 5 was used, serum-based MNA analysis was found to show good sensitivity (86%) and very high specificity (95%). The sensitivities for stage 1 and 2 might be acceptable, even though it is not as good as for stage 3 and 4 (67% for stage 1 and 2, 92% for stage 3, and 87% for stage 4). MNA status correlated with overall survival in our cohort of 82 patients, with survival data available (p < 0.01). The hazard ratio of MNA status was 4.98 in patients diagnosed at less than 18 months of age (95% confidence interval, 1.00-24.78), and 1.41 (95% confidence interval, 0.63-3.14) for those diagnosed at 18 months of age or older. Serum-based MNA analysis is rapid and non-invasive compared with tumor-based MNA analysis, and has potential to predict tumor MNA status. There is still a room to improve the sensitivity of the test for tumors of stages 1 and 2, nonetheless this assay might help to determine therapeutic strategies prior to tumor biopsy, especially for patients with a life-threatening condition, as well as for patients of less than 18 months of age whose risk-grouping and treatment allocation depends on their MNA status. PMID:27513929

  19. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression.

    PubMed

    Piscuoglio, Salvatore; Ng, Charlotte Ky; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; Bruijn, Ino De; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S

    2016-03-01

    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs; six, six and 13 benign, borderline and malignant PTs, respectively, and their matched normal tissue, were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (eg TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (-124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%) to borderline (57%) and to malignant PTs (68%; p < 0.01), and TERT alterations were associated with increased levels of TERT mRNA (p < 0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38-100%) and 100% (CI 85.86-100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65-51.36%) and 68% (CI 60.21-75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential diagnosis

  20. Massively parallel sequencing of phyllodes tumours of the breast reveals actionable mutations, and TERT promoter hotspot mutations and TERT gene amplification as likely drivers of progression.

    PubMed

    Piscuoglio, Salvatore; Ng, Charlotte Ky; Murray, Melissa; Burke, Kathleen A; Edelweiss, Marcia; Geyer, Felipe C; Macedo, Gabriel S; Inagaki, Akiko; Papanastasiou, Anastasios D; Martelotto, Luciano G; Marchio, Caterina; Lim, Raymond S; Ioris, Rafael A; Nahar, Pooja K; Bruijn, Ino De; Smyth, Lillian; Akram, Muzaffar; Ross, Dara; Petrini, John H; Norton, Larry; Solit, David B; Baselga, Jose; Brogi, Edi; Ladanyi, Marc; Weigelt, Britta; Reis-Filho, Jorge S

    2016-03-01

    Phyllodes tumours (PTs) are breast fibroepithelial lesions that are graded based on histological criteria as benign, borderline or malignant. PTs may recur locally. Borderline PTs and malignant PTs may metastasize to distant sites. Breast fibroepithelial lesions, including PTs and fibroadenomas, are characterized by recurrent MED12 exon 2 somatic mutations. We sought to define the repertoire of somatic genetic alterations in PTs and whether these may assist in the differential diagnosis of these lesions. We collected 100 fibroadenomas, 40 benign PTs, 14 borderline PTs and 22 malignant PTs; six, six and 13 benign, borderline and malignant PTs, respectively, and their matched normal tissue, were subjected to targeted massively parallel sequencing (MPS) using the MSK-IMPACT sequencing assay. Recurrent MED12 mutations were found in 56% of PTs; in addition, mutations affecting cancer genes (eg TP53, RB1, SETD2 and EGFR) were exclusively detected in borderline and malignant PTs. We found a novel recurrent clonal hotspot mutation in the TERT promoter (-124 C>T) in 52% and TERT gene amplification in 4% of PTs. Laser capture microdissection revealed that these mutations were restricted to the mesenchymal component of PTs. Sequencing analysis of the entire cohort revealed that the frequency of TERT alterations increased from benign (18%) to borderline (57%) and to malignant PTs (68%; p < 0.01), and TERT alterations were associated with increased levels of TERT mRNA (p < 0.001). No TERT alterations were observed in fibroadenomas. An analysis of TERT promoter sequencing and gene amplification distinguished PTs from fibroadenomas with a sensitivity and a positive predictive value of 100% (CI 95.38-100%) and 100% (CI 85.86-100%), respectively, and a sensitivity and a negative predictive value of 39% (CI 28.65-51.36%) and 68% (CI 60.21-75.78%), respectively. Our results suggest that TERT alterations may drive the progression of PTs, and may assist in the differential diagnosis

  1. Diagnosis and Differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis Infections in Pigs by PCR Amplification of the p36 and p46 Genes

    PubMed Central

    Caron, J.; Ouardani, M.; Dea, S.

    2000-01-01

    The genome of Mycoplasma hyopneumoniae encodes several immunodominant proteins, including a cytosolic protein (p36), three membranous proteins (p46, p65, and p74), and an adhesin (p97). Cross-reactions with M. flocculare and M. hyorhinis reduce the specificity of conventional serological detection methods. However, certain antigenic determinants of the p36 and p46 proteins have been shown to be specific for M. hyopneumoniae. In the present study, pairs of oligonucleotide primers were designed to permit PCR amplification of entire p36 and p46 genes and of internal fragments of these genes. Specific amplicons could be obtained with as low as 0.5 to 50 pg of extracted chromosomal DNA. No amplification product was obtained when testing p36 and p46 primer pairs with genomic DNA or RNA from other mycoplasma species, bacteria, and viruses commonly associated with respiratory diseases in pigs. By using the single p36-PCR method, a positive reaction was demonstrated in 100% (30 of 30) of lungs from pigs that developed typical lesions associated with an M. hyopneumoniae infection, and no false-positive results were detected when 62 apparently normal lungs were tested. On the other hand, with the single p46-PCR method a sensitivity of 86.6% (26 of 30) and a specificity of 96.7% (60 of 62) were obtained in comparison with the necropsy findings. A mixed infection with M. hyorhinis was diagnosed in 13.3% (4 of 30) of the cases by using species-specific primers for the heterologous p37 gene. The sensitivity of the single p36-PCR method for the detection of M. hyopneumoniae, when tested on tracheobronchial swabs, was 100% (20 positive samples), with a specificity of 93.3% (14 of 15 negative samples), compared to the necropsy findings. Both expected amplicons were obtained with 86.6% (26 of 30) positive lungs when p36 and p46 primers were used simultaneously (multiplex PCR) to further increase the specificity of the PCR assay. PMID:10747113

  2. A Novel Gene Amplification Causes Upregulation of the PatAB ABC Transporter and Fluoroquinolone Resistance in Streptococcus pneumoniae

    PubMed Central

    Baylay, Alison J.; Ivens, Alasdair

    2015-01-01

    Overexpression of the ABC transporter genes patA and patB confers efflux-mediated fluoroquinolone resistance in Streptococcus pneumoniae and is also linked to pneumococcal stress responses. Although upregulation of patAB has been observed in many laboratory mutants and clinical isolates, the regulatory mechanisms controlling expression of these genes are unknown. In this study, we aimed to identify the cause of high-level constitutive overexpression of patAB in M184, a multidrug-resistant mutant of S. pneumoniae R6. Using a whole-genome transformation and sequencing approach, we identified a novel duplication of a 9.2-kb region of the M184 genome which included the patAB genes. This duplication did not affect growth and was semistable with a low segregation rate. The expression levels of patAB in M184 were much higher than those that could be fully explained by doubling of the gene dosage alone, and inactivation of the first copy of patA had no effect on multidrug resistance. Using a green fluorescent protein reporter system, increased patAB expression was ascribed to transcriptional read-through from a tRNA gene upstream of the second copy of patAB. This is the first report of a large genomic duplication causing antibiotic resistance in S. pneumoniae and also of a genomic duplication causing antibiotic resistance by a promoter switching mechanism. PMID:25779578

  3. Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

    PubMed

    Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

    2013-03-01

    Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. PMID:23228525

  4. Enumeration of total bacteria and bacteria with genes for proteolytic activity in pure cultures and in environmental samples by quantitative PCR mediated amplification.

    PubMed

    Bach, H-J; Tomanova, J; Schloter, M; Munch, J C

    2002-05-01

    Real-time quantitative PCR assays were developed for the absolute quantification of different groups of bacteria in pure cultures and in environmental samples. 16S rRNA genes were used as markers for eubacteria, and genes for extracellular peptidases were used as markers for potentially proteolytic bacteria. For the designed 16S rDNA TaqMan assay, specificity of the designed primer-probe combination for eubacteria, a high amplification efficiency over a wide range of starting copy numbers and a high reproducibility is demonstrated. Cell concentrations of Bacillus cereus, B. subtilis and Pseudomonas fluorescens in liquid culture were monitored by TaqMan-PCR using the 16S rDNA target sequence of Escherichia coli as external standard for quantification. Results agree with plate counts and microscopic counts of DAPI stained cells. The significance of 16S rRNA operon multiplicity to the quantification of bacteria is discussed.Furthermore, three sets of primer pair together with probe previously designed for targeting different classes of bacterial extracellular peptidases were tested for their suitability for TaqMan-PCR based quantification of proteolytic bacteria. Since high degeneracy of the probes did not allow accurate quantification, SybrGreen was used instead of molecular probes to visualize and quantify PCR products during PCR. The correlation between fluorescence and starting copy number was of the same high quality as for the 16S rDNA TaqMan assay for all the three peptidase gene classes. The detected amount of genes for neutral metallopeptidase of B. cereus, for subtilisin of B. subtilis and for alkaline metallopeptidase of P. fluorescens corresponded exactly to the numbers of bacteria investigated by the 16S rDNA targeting assay. The developed assays were applied for the quantification of bacteria in soil samples.

  5. Specific amplification of gene encoding N-terminal region of catalase-peroxidase protein (KatG-N) for diagnosis of disseminated MAC disease in HIV patients.

    PubMed

    Latawa, Romica; Singh, Krishna Kumar; Wanchu, Ajay; Sethi, Sunil; Sharma, Kusum; Sharma, Aman; Laal, Suman; Verma, Indu

    2014-10-01

    Disseminated Mycobacterium avium-intracellulare complex (MAC) infection is considered as severe complication of advanced HIV/AIDS disease. Currently available various laboratory investigations have not only limited ability to discriminate between MAC infection and tuberculosis but are also laborious and time consuming. The aim of this study was, therefore, to design a molecular-based strategy for specific detection of MAC and its differentiation from Mycobacterium tuberculosis (M. tb) isolated from the blood specimens of HIV patients. A simple PCR was developed based on the amplification of 120-bp katG-N gene corresponding to the first 40 amino acids of N-terminal catalase-peroxidase (KatG) protein of Mycobacterium avium that shows only ~13% sequence homology by clustal W alignment to N-terminal region of M. tb KatG protein. This assay allowed the accurate and rapid detection of MAC bacteremia, distinguishing it from M. tb in a single PCR reaction without any need for sequencing or hybridization protocol to be performed thereafter. This study produced enough evidence that a significant proportion of Indian HIV patients have disseminated MAC bacteremia, suggesting the utility of M. avium katG-N gene PCR for early detection of MAC disease in HIV patients.

  6. Loop-Mediated Isothermal Amplification of the sefA Gene for Rapid Detection of Salmonella Enteritidis and Salmonella Gallinarum in Chickens.

    PubMed

    Gong, Jiansen; Zhuang, Linlin; Zhu, Chunhong; Shi, Shourong; Zhang, Di; Zhang, Linji; Yu, Yan; Dou, Xinhong; Xu, Bu; Wang, Chengming

    2016-04-01

    Salmonella spp. pose a threat to both human and animal health, with more than 2600 serovars having been reported to date. Salmonella serovars are usually identified by slide agglutination tests, which are labor intensive and time consuming. In an attempt to develop a more rapid screening method for the major poultry Salmonella serovars, we developed a loop-mediated isothermal amplification (LAMP) assay, which directly detected the sefA gene, a fimbrial operon gene existing in several specific serovars of Salmonella enterica including the major poultry serovars, namely Salmonella enterica serovar Enteritidis (Salmonella Enteritidis) and Salmonella enterica serovar Gallinarum (Salmonella Gallinarum). With the 177 bacterial strains we tested, positive reactions were only observed with 85 strains of serovar Salmonella Enteritidis and Salmonella Gallinarum. The detection limit of the LAMP assay was 4 CFU/reaction with genomic DNAs of Salmonella Enteritidis (ATCC 13076) from pure culture and 400 CFU/ reaction with DNA extracted from spiked chicken feces. The LAMP assay was more sensitive than conventional culture, especially without enrichment, in detecting Salmonella Enteritidis (CMCC 50041) in the spiked fecal samples. The results show the sefA LAMP method is a rapid, sensitive, specific, and practical method for directly detection of Salmonella Enteritidis and Salmonella Gallinarum in chickens. The sefA LAMP assay can potentially serve as new on-site diagnostics in the poultry industry. PMID:26840841

  7. Development of a whole community genome amplification-assisted DNA microarray method to detect functional genes involved in the nitrogen cycle.

    PubMed

    Inoue, Daisuke; Pang, Junqin; Matsuda, Masami; Sei, Kazunari; Nishida, Kei; Ike, Michihiko

    2014-11-01

    A novel DNA microarray analysis targeting key functional genes involved in most nitrogen cycling reactions was developed to comprehensively analyze microbial populations associated with the nitrogen cycle. The developed microarray contained 876 oligonucleotide probes based on the nucleotide sequences of the nif, amo, hao/hzo, nap, nar, nirK, nirS, nrf, cnor, qnor and nos genes. An analytical method combining detection by the designed microarray with whole community genome amplification was then applied to monitor the nitrogen cycling microorganisms in river water and wastewater treatment sludge samples. The developed method revealed that nitrogen cycling microorganisms in river water appeared to become less diverse in response to input of effluent from municipal wastewater treatment plants. Additionally, the nitrogen cycling community associated with anaerobic ammonium oxidation and partial nitrification reactors could be reasonably analyzed by the developed method. However, the results obtained for two activated sludge samples from municipal wastewater treatment plants with almost equivalent wastewater treatment performance differed greatly from each other. These results suggested that the developed method is useful for comprehensive analysis of nitrogen cycling microorganisms, although its applicability to complex samples with abundant untargeted populations should be further examined.

  8. Development of a loop-mediated isothermal amplification (LAMP) for the detection of F5 fimbriae gene in enterotoxigenic Escherichia coli (ETEC).

    PubMed

    Jiang, Kuiyu; Zhu, Ying; Liu, Wenxin; Feng, Yufei; He, Lili; Guan, Weikun; Hu, Wenxia; Shi, Dongfang

    2012-11-01

    The objective of this study was to establish a loop-mediated isothermal amplification (LAMP) method for the detection of F5 fimbriae gene in Enterotoxigenic Escherichia coli. A set of four primers were designed based on the conservative sequence of coding F5 fimbriae. Temperature and time condition, specificity test, and sensitivity test were performed with the DNA of Escherichia coli (F5+). The results showed that the optimal reaction condition for LAMP was achieved at 61 °C for 45 min in a water bath. Ladder-like products were produced with those F5-positive samples by LAMP, while no product was generated with other negative samples. The assay of LAMP had a detection limit equivalent to 72 cfu/tube, which was more sensitive than PCR (7.2 × 10(2) cfu/tube). The agreement rate between LAMP and PCR was 100 % in detecting simulation samples. Thus, the LAMP assay may be a new method for rapid detection of F5 fimbriae gene of ETEC. PMID:22890294

  9. Determination of EGFR and KRAS mutational status in Greek non-small-cell lung cancer patients

    PubMed Central

    PAPADOPOULOU, EIRINI; TSOULOS, NIKOLAOS; TSIRIGOTI, ANGELIKI; APESSOS, ANGELA; AGIANNITOPOULOS, KONSTANTINOS; METAXA-MARIATOU, VASILIKI; ZAROGOULIDIS, KONSTANTINOS; ZAROGOULIDIS, PAVLOS; KASARAKIS, DIMITRIOS; KAKOLYRIS, STYLIANOS; DAHABREH, JUBRAIL; VLASTOS, FOTIS; ZOUBLIOS, CHARALAMPOS; RAPTI, AGGELIKI; PAPAGEORGIOU, NIKI GEORGATOU; VELDEKIS, DIMITRIOS; GAGA, MINA; ARAVANTINOS, GERASIMOS; KARAVASILIS, VASILEIOS; KARAGIANNIDIS, NAPOLEON; NASIOULAS, GEORGE

    2015-01-01

    It has been reported that certain patients with non-small-cell lung cancer (NSCLC) that harbor activating somatic mutations within the tyrosine kinase domain of the epidermal growth factor receptor (EGFR) gene may be effectively treated using targeted therapy. The use of EGFR inhibitors in patient therapy has been demonstrated to improve response and survival rates; therefore, it was suggested that clinical screening for EGFR mutations should be performed for all patients. Numerous clinicopathological factors have been associated with EGFR and Kirsten-rat sarcoma oncogene homolog (KRAS) mutational status including gender, smoking history and histology. In addition, it was reported that EGFR mutation frequency in NSCLC patients was ethnicity-dependent, with an incidence rate of ~30% in Asian populations and ~15% in Caucasian populations. However, limited data has been reported on intra-ethnic differences throughout Europe. The present study aimed to investigate the frequency and spectrum of EGFR mutations in 1,472 Greek NSCLC patients. In addition, KRAS mutation analysis was performed in patients with known smoking history in order to determine the correlation of type and mutation frequency with smoking. High-resolution melting curve (HRM) analysis followed by Sanger sequencing was used to identify mutations in exons 18–21 of the EGFR gene and in exon 2 of the KRAS gene. A sensitive next-generation sequencing (NGS) technology was also employed to classify samples with equivocal results. The use of sensitive mutation detection techniques in a large study population of Greek NSCLC patients in routine diagnostic practice revealed an overall EGFR mutation frequency of 15.83%. This mutation frequency was comparable to that previously reported in other European populations. Of note, there was a 99.8% concordance between the HRM method and Sanger sequencing. NGS was found to be the most sensitive method. In addition, female non-smokers demonstrated a high prevalence of

  10. Hybrid Chirped Pulse Amplification

    SciTech Connect

    Jovanovic, I; Barty, C P J

    2002-05-07

    We present a novel chirped pulse amplification method which combines optical parametric amplification and laser amplification. We have demonstrated this hybrid CPA concept with a combination of beta-barium borate and Ti:sapphire. High-efficiency, multi-terawatt compatible amplification is achieved without gain narrowing and without electro-optic modulators using a simple commercial pump laser.

  11. Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

    ERIC Educational Resources Information Center

    Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

    2004-01-01

    A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

  12. KRAS insertion mutations are oncogenic and exhibit distinct functional properties

    PubMed Central

    White, Yasmine; Bagchi, Aditi; Van Ziffle, Jessica; Inguva, Anagha; Bollag, Gideon; Zhang, Chao; Carias, Heidi; Dickens, David; Loh, Mignon; Shannon, Kevin; Firestone, Ari J.

    2016-01-01

    Oncogenic KRAS mutations introduce discrete amino acid substitutions that reduce intrinsic Ras GTPase activity and confer resistance to GTPase-activating proteins (GAPs). Here we discover a partial duplication of the switch 2 domain of K-Ras encoding a tandem repeat of amino acids G60_A66dup in a child with an atypical myeloproliferative neoplasm. K-Ras proteins containing this tandem duplication or a similar five amino acid E62_A66dup mutation identified in lung and colon cancers transform the growth of primary myeloid progenitors and of Ba/F3 cells. Recombinant K-RasG60_A66dup and K-RasE62_A66dup proteins display reduced intrinsic GTP hydrolysis rates, accumulate in the GTP-bound conformation and are resistant to GAP-mediated GTP hydrolysis. Remarkably, K-Ras proteins with switch 2 insertions are impaired for PI3 kinase binding and Akt activation, and are hypersensitive to MEK inhibition. These studies illuminate a new class of oncogenic KRAS mutations and reveal unexpected plasticity in oncogenic Ras proteins that has diagnostic and therapeutic implications. PMID:26854029

  13. New Nitrogen-Fixing Microorganisms Detected in Oligotrophic Oceans by Amplification of Nitrogenase (nifH) Genes

    PubMed Central

    Zehr, Jonathan P.; Mellon, Mark T.; Zani, Sabino

    1998-01-01

    Oligotrophic oceanic waters of the central ocean gyres typically have extremely low dissolved fixed inorganic nitrogen concentrations, but few nitrogen-fixing microorganisms from the oceanic environment have been cultivated. Nitrogenase gene (nifH) sequences amplified directly from oceanic waters showed that the open ocean contains more diverse diazotrophic microbial populations and more diverse habitats for nitrogen fixers than previously observed by classical microbiological techniques. Nitrogenase genes derived from unicellular and filamentous cyanobacteria, as well as from the α and γ subdivisions of the class Proteobacteria, were found in both the Atlantic and Pacific oceans. nifH sequences that cluster phylogenetically with sequences from sulfate reducers or clostridia were found associated with planktonic crustaceans. Nitrogenase sequence types obtained from invertebrates represented phylotypes distinct from the phylotypes detected in the picoplankton size fraction. The results indicate that there are in the oceanic environment several distinct potentially nitrogen-fixing microbial assemblages that include representatives of diverse phylotypes. PMID:9726895

  14. New nitrogen-fixing microorganisms detected in oligotrophic oceans by amplification of nitrogenase (nifH) genes

    SciTech Connect

    Zehr, J.P.; Mellon, M.T.; Zani, S.

    1998-09-01

    Oligotrophic oceanic waters of the central ocean gyres typically have extremely low dissolved fixed inorganic nitrogen concentrations, but few nitrogen-fixing microorganisms from the oceanic environment have been cultivated. Nitrogenase gene (nifH) sequences amplified directly from oceanic waters showed that the open ocean contains more diverse diazotrophic microbial populations and more diverse habitats for nitrogen fixers than previously observed by classical microbiological techniques. Nitrogenase genes derived from unicellular and filamentous cyanobacteria, as well as from the {alpha} and {gamma} subdivisions of the class Proteobacteria, were found in both the Atlantic and Pacific oceans. nifH sequences that cluster phylogenetically with sequences from sulfate reducers or clostridia were found associated with planktonic crustaceans. Nitrogenase sequence types obtained from invertebrates represented phylotypes distinct from the phylotypes detected in the picoplankton size fraction. The results indicate that there are in the oceanic environment several distinct potentially nitrogen-fixing microbial assemblages that include representatives of diverse phylotypes.

  15. Amplification and over-expression of MAP3K3 gene in human breast cancer promotes formation and survival of breast cancer cells

    PubMed Central

    Fan, Yihui; Ge, Ningling; Wang, Xiaosong; Sun, Wenjing; Mao, Renfang; Bu, Wen; Creighton, Chad J; Zheng, Pingju; Vasudevan, Sanjeev; An, Lei; Yang, Jinshu; Zhao, Yi-Jue; Zhang, Huiyuan; Li, Xiao-Nan; Rao, Pulivarthi H; Leung, Eastwood; Lu, Yong-Jie; Gray, Joe W; Schiff, Rachel; Hilsenbeck, Susan G; Osborne, C Kent; Yang, Jianhua; Zhang, Hong

    2014-01-01

    Gene amplifications in the 17q chromosomal region are observed frequently in breast cancers. An integrative bioinformatics analysis of this region nominated the MAP3K 3 gene as a potential therapeutic target in breast cancer. This gene encodes mitogen-activated protein kinase kinase kinase 3 (MAP3K3/MEKK3), which has not yet been reported to be associated with cancer-causing genetic aberrations. We found that MAP3K3 was amplified in approximately 8–20% of breast cancers. Knockdown of MAP3K3 expression significantly inhibited cell proliferation and colony formation in MAP3K3-amplified breast cancer cell lines MCF-7 and MDA-MB-361 but not in MAP3K3 non-amplified breast cancer cells. Knockdown of MAP3K3 expression in MAP3K3-amplified breast cancer cells sensitized breast cancer cells to apoptotic induction by TNFα and TRAIL, as well as doxorubicin, VP-16 and fluorouracil, three commonly used chemotherapeutic drugs for treating breast cancer. In addition, ectopic expression of MAP3K3, in collaboration with Ras, induced colony formation in both primary mouse embryonic fibroblasts and immortalized human breast epithelial cells (MCF-10A). Combined, these results suggest that MAP3K3 contributes to breast carcinogenesis and may endow resistance of breast cancer cells to cytotoxic chemotherapy. Therefore, MAP3K3 may be a valuable therapeutic target in patients with MAP3K3-amplified breast cancers, and blocking MAP3K3 kinase activity with a small molecule inhibitor may sensitize MAP3K3-amplified breast cancer cells to chemotherapy. PMID:24122835

  16. DNA deamination enables direct PCR amplification of the cystatin B (CSTB) gene-associated dodecamer repeat expansion in myoclonus epilepsy type Unverricht-Lundborg.

    PubMed

    Weinhaeusel, Andreas; Morris, Michael A; Antonarakis, Stylianos E; Haas, Oskar A

    2003-11-01

    The Unverricht-Lundborg type of progressive myoclonus epilepsy (EPM1) is an autosomal recessive disorder that is caused by the dysfunction of the cystatin B (CSTB) gene product. In the vast majority of affected cases, mRNA transcription is impaired by a biallelic expansion of a dodecamer repeat within the 5'-untranslated region of the respective gene. Since this minisatellite contains exclusively G and C nucleotides, direct PCR analysis of allele expansion is extremely difficult and error prone. To circumvent these problems, we have developed a PCR assay that is based on the deamination of the DNA prior to amplification. We have developed a method based on PCR after DNA deamination of the GC-rich repeat region, which improves the PCR condition to such an extent that we were not only able to reliably amplify expanded alleles of affected individuals (homozygotes and compound heterozygotes), but also the two alleles of full mutation carriers, whose analysis is particularly difficult because of PCR bias and heteroduplex formation between the two alleles. We used promoter- and repeat-specific primer combinations to investigate whether dodecamer repeat expansion concurs with de novo methylation of the CSTB gene promoter in a similar fashion to other repeat expansion syndromes. We confirmed previous evidence obtained by HpaII digestion and Southern blot analysis that both the promoter and the repeat regions are unmethylated, in both healthy and affected individuals. Thus, in contrast to certain trinucleotide repeat expansion-associated diseases, such as fragile X syndrome (FRAXA) and myotonic dystrophy, methylation analyses can not be utilized for indirect diagnostic testing.

  17. Inhibition of Acid Sphingomyelinase Depletes Cellular Phosphatidylserine and Mislocalizes K-Ras from the Plasma Membrane.

    PubMed

    Cho, Kwang-Jin; van der Hoeven, Dharini; Zhou, Yong; Maekawa, Masashi; Ma, Xiaoping; Chen, Wei; Fairn, Gregory D; Hancock, John F

    2015-01-01

    K-Ras must localize to the plasma membrane for biological activity; thus, preventing plasma membrane interaction blocks K-Ras signal output. Here we show that inhibition of acid sphingomyelinase (ASM) mislocalizes both the K-Ras isoforms K-Ras4A and K-Ras4B from the plasma membrane to the endomembrane and inhibits their nanoclustering. We found that fendiline, a potent ASM inhibitor, reduces the phosphatidylserine (PtdSer) and cholesterol content of the inner plasma membrane. These lipid changes are causative because supplementation of fendiline-treated cells with exogenous PtdSer rapidly restores K-Ras4A and K-Ras4B plasma membrane binding, nanoclustering, and signal output. Conversely, supplementation with exogenous cholesterol restores K-Ras4A but not K-Ras4B nanoclustering. These experiments reveal different operational pools of PtdSer on the plasma membrane. Inhibition of ASM elevates cellular sphingomyelin and reduces cellular ceramide levels. Concordantly, delivery of recombinant ASM or exogenous ceramide to fendiline-treated cells rapidly relocalizes K-Ras4B and PtdSer to the plasma membrane. K-Ras4B mislocalization is also recapitulated in ASM-deficient Neimann-Pick type A and B fibroblasts. This study identifies sphingomyelin metabolism as an indirect regulator of K-Ras4A and K-Ras4B signaling through the control of PtdSer plasma membrane content. It also demonstrates the critical and selective importance of PtdSer to K-Ras4A and K-Ras4B plasma membrane binding and nanoscale spatial organization. PMID:26572827

  18. Early recognition of lung cancer by integrin targeted imaging in K-ras mouse model.

    PubMed

    Ermolayev, Vladimir; Mohajerani, Pouyan; Ale, Angelique; Sarantopoulos, Athanasios; Aichler, Michaela; Kayser, Gian; Walch, Axel; Ntziachristos, Vasilis

    2015-09-01

    Non-small cell lung cancer is characterized by slow progression and high heterogeneity of tumors. Integrins play an important role in lung cancer development and metastasis and were suggested as a tumor marker; however their role in anticancer therapy remains controversial. In this work, we demonstrate the potential of integrin-targeted imaging to recognize early lesions in transgenic mouse model of lung cancer based on spontaneous introduction of mutated human gene bearing K-ras mutation. We conducted ex vivo and fluorescence molecular tomography-X-ray computed tomography (FMT-XCT) in vivo imaging and analysis for specific targeting of early lung lesions and tumors in rodent preclinical model for lung cancer. The lesions and tumors were characterized by histology, immunofluorescence and immunohistochemistry using a panel of cancer markers. Ex vivo, the integrin-targeted fluorescent signal significantly differed between wild type lung tissue and K-ras pulmonary lesions (PL) at all ages studied. The panel of immunofluorescence experiments demonstrated that PL, which only partially show cancer cell features were detected by αvβ3-integrin targeted imaging. Human patient material analysis confirmed the specificity of target localization in different lung cancer types. Most importantly, small tumors in the lungs of 4-week-old animals could be noninvasively detected in vivo on the fluorescence channel of FMT-XCT. Our findings demonstrated αvβ3-integrin targeted fluorescent imaging to specifically detect premalignant pleural lesions in K-ras mice. Integrin targeted imaging may find application areas in preclinical research and clinical practice, such as early lung cancer diagnostics, intraoperative assistance or therapy monitoring.

  19. Dietary acrylamide intake and the risk of colorectal cancer with specific mutations in KRAS and APC.

    PubMed

    Hogervorst, Janneke G F; de Bruijn-Geraets, Daisy; Schouten, Leo J; van Engeland, Manon; de Kok, Theo M C M; Goldbohm, R Alexandra; van den Brandt, Piet A; Weijenberg, Matty P

    2014-05-01

    Acrylamide, a probable human carcinogen, is present in heat-treated carbohydrate-rich foods. Epidemiological studies have not shown a clear association between acrylamide intake and colorectal cancer (CRC) risk. This may be due to the molecular heterogeneity in colorectal tumors, which was not taken into consideration before. Since the acrylamide metabolite glycidamide induces specific DNA mutations in rodents, we investigated whether acrylamide is associated with CRC risk characterized by mutations in Kirsten-ras (KRAS) and adenomatous polyposis coli (APC); key genes in colorectal carcinogenesis. This case-cohort analysis, within the Netherlands Cohort Study on diet and cancer, was based on 7.3 years of follow-up. Acrylamide intake was assessed with a food frequency questionnaire. Mutation analysis of codons 1286-1520 in exon 15 in APC and codons 12 and 13 in exon 1 in KRAS was performed on tumor tissue of 733 cases. Hazard ratios (HR) were calculated using Cox proportional hazards analysis. Among men, acrylamide intake was statistically significantly associated with an increased risk of particularly tumors with an activating KRAS mutation {HR fourth versus first quartile: 2.12 [95% confidence interval (CI): 1.16-3.87], P trend: 0.01}. Among women, acrylamide intake was statistically significantly associated with a decreased risk of particularly tumors with a truncating APC mutation (fourth versus first quartile: 0.47 (95% CI: 0.23-0.94), P trend: 0.02), but only in the highest quartile of intake. This is the first study to show that acrylamide might be associated with CRC with specific somatic mutations, differentially in men and women. More research is needed to corroborate or refute these findings.

  20. [The amplification of CYP9 genes as a preadaptation of the black garden ant Lasius niger to urban conditions].

    PubMed

    Konorov, E A; Nikitin, M A

    2015-01-01

    Ants are one of the most ancient and successful groups of eusocial animals and they are spread all over the world. The nucleotide sequences of the genomes of eight ant species were determined by the year 2014. In these species, the mechanisms of ecological success, cast differentiation, and social communication were studied at genomic level. In ants, the genes of the cytochromes P450 involved in metabolism of xenobiotics and various endogenic substances are amplified. Although the substrates for several cytochrome P450 families have been identified, the functions of the ninth family, which is one of the most amplified, remain unknown. The black garden ant Lasius niger is one of the spices that have successfully adapted to urban conditions. To study the mechanisms of adaptation, we have read and annotated the nucleotide sequence of the L. niger genome; we have predicted the functions of the CYP9 genes using virtual screening. The obtained data allow us to suggest that cytochromes P450 are involved in the metabolism of various xenobiotics such as phytotoxins, mycotoxins, and insecticides. We assume that the functional divergence of the new CYP9 duplications was initially aimed at developing resistance to various mycotoxins, in particular to those produced by Fusarium fungi and, subsequently, to other xenobiotics. PMID:26107899

  1. [The amplification of CYP9 genes as a preadaptation of the black garden ant Lasius niger to urban conditions].

    PubMed

    Konorov, E A; Nikitin, M A

    2015-01-01

    Ants are one of the most ancient and successful groups of eusocial animals and they are spread all over the world. The nucleotide sequences of the genomes of eight ant species were determined by the year 2014. In these species, the mechanisms of ecological success, cast differentiation, and social communication were studied at genomic level. In ants, the genes of the cytochromes P450 involved in metabolism of xenobiotics and various endogenic substances are amplified. Although the substrates for several cytochrome P450 families have been identified, the functions of the ninth family, which is one of the most amplified, remain unknown. The black garden ant Lasius niger is one of the spices that have successfully adapted to urban conditions. To study the mechanisms of adaptation, we have read and annotated the nucleotide sequence of the L. niger genome; we have predicted the functions of the CYP9 genes using virtual screening. The obtained data allow us to suggest that cytochromes P450 are involved in the metabolism of various xenobiotics such as phytotoxins, mycotoxins, and insecticides. We assume that the functional divergence of the new CYP9 duplications was initially aimed at developing resistance to various mycotoxins, in particular to those produced by Fusarium fungi and, subsequently, to other xenobiotics.

  2. K-ras activation occurs frequently in mucinous adenocarcinomas and rarely in other common epithelial tumors of the human ovary.

    PubMed Central

    Enomoto, T.; Weghorst, C. M.; Inoue, M.; Tanizawa, O.; Rice, J. M.

    1991-01-01

    To explore the role of mutational activation of members of the ras family of cellular protooncogenes in the development of human ovarian neoplasms, a series of 37 ovarian tumors from Japanese patients was studied. These included 30 common epithelial tumors (1 mucinous tumor of borderline malignancy, 7 mucinous adenocarcinomas, and 22 nonmucinous carcinomas: 10 serous, 3 clear cell, 8 endometrioid, and 1 undifferentiated), 5 tumors of germ cell origin, and 2 sex cord/stromal cell tumors. Polymerase chain reaction was performed from selected areas of deparaffinized sections of formalin-fixed paraffin-embedded tissue, and the presence of activating point mutations in codons 12, 13, and 61 of the H-, N-, and K-ras genes was probed by dot-blot hybridization analysis with mutation specific oligonucleotides. Mutations in K-ras were also looked for by direct genomic sequencing. The overall frequency of ras gene mutations was 10/37 (27%). Mutations were detected only in K-ras, and were found in most of the mucinous tumors, including the one such tumor of borderline malignancy (6/8; 75%). In one mucinous adenocarcinoma, two mutations were detected in paraffin-embedded material that had not previously been found in high molecular weight DNA isolated from frozen tissue from the same case. K-ras mutations occurred significantly more frequently in mucinous tumors (6/8, 75%) than in serous carcinomas (2/10, 20%; P = 0.031) or in all nonmucinous types of epithelial ovarian tumors combined (3/22, 14%; P = 0.0031). Images Figure 1 Figure 2 PMID:1656759

  3. DNA extraction, preservation, and amplification.

    PubMed

    Knebelsberger, Thomas; Stöger, Isabella

    2012-01-01

    The effectiveness of DNA barcoding as a routine practice in biodiversity research is strongly dependent on the quality of the source material, DNA extraction method, and selection of adequate primers in combination with optimized polymerase chain reaction (PCR) conditions. For the isolation of nucleic acids, silica-gel membrane methods are to be favored because they are easy to handle, applicable for high sample throughput, relatively inexpensive, and provide high DNA quality, quantity, and purity which are pre-requisites for successful PCR amplification and long-term storage of nucleic acids in biorepositories, such as DNA banks. In this section, standard protocols and workflow schemes for sample preparation, DNA isolation, DNA storage, PCR amplification, PCR product quality control, and PCR product cleanup are proposed and described in detail. A PCR troubleshooting and primer design section may help to solve problems that hinder successful amplification of the desired barcoding gene region.

  4. Molecular and functional characteristics of ovarian surface epithelial cells transformed by KrasG12D and loss of Pten in a mouse model in vivo.

    PubMed

    Mullany, L K; Fan, H-Y; Liu, Z; White, L D; Marshall, A; Gunaratne, P; Anderson, M L; Creighton, C J; Xin, L; Deavers, M; Wong, K-K; Richards, J S

    2011-08-11

    Ovarian cancer is a complex and deadly disease that remains difficult to detect at an early curable stage. Furthermore, although some oncogenic (Kras, Pten/PI3K and Trp53) pathways that are frequently mutated, deleted or amplified in ovarian cancer are known, how these pathways initiate and drive specific morphological phenotypes and tumor outcomes remain unclear. We recently generated Pten(fl/fl); Kras(G12D); Amhr2-Cre mice to disrupt the Pten gene and express a stable mutant form of Kras(G12D) in ovarian surface epithelial (OSE) cells. On the basis of histopathologic criteria, the mutant mice developed low-grade ovarian serous papillary adenocarcinomas at an early age and with 100% penetrance. This highly reproducible phenotype provides the first mouse model in which to study this ovarian cancer subtype. OSE cells isolated from ovaries of mutant mice at 5 and 10 weeks of age exhibit temporal changes in the expression of specific Mullerian epithelial marker genes, grow in soft agar and develop ectopic invasive tumors in recipient mice, indicating that the cells are transformed. Gene profiling identified specific mRNAs and microRNAs differentially expressed in purified OSE cells derived from tumors of the mutant mice compared with wild-type OSE cells. Mapping of transcripts or genes between the mouse OSE mutant data sets, the Kras signature from human cancer cell lines and the human ovarian tumor array data sets, documented significant overlap, indicating that KRAS is a key driver of OSE transformation in this context. Two key hallmarks of the mutant OSE cells in these mice are the elevated expression of the tumor-suppressor Trp53 (p53) and its microRNA target, miR-34a-c. We propose that elevated TRP53 and miR-34a-c may exert negatively regulatory effects that reduce the proliferative potential of OSE cells leading to the low-grade serous adenocarcinoma phenotype.

  5. Development and Diagnostic Evaluation of Loop-Mediated Isothermal Amplification Using a New Gene Target for Rapid Detection of Helicobacter pylori

    PubMed Central

    Bakhtiari, Somaye; Alvandi, Amirhooshang; Pajavand, Hamid; Navabi, Jafar; Najafi, Farid; Abiri, Ramin

    2016-01-01

    Background Helicobacter pylori cause chronic gastritis and subsequent diseases like gastric and duodenal ulcers and gastric adenocarcinoma. Current methods for detecting H. pylori have several disadvantages and it is of utmost importance to develop a simple, quick, accurate, and cost-effective diagnostic test. Objectives The aim of this study was to set up and evaluate a diagnostic value of loop- mediated isothermal amplification (LAMP) for detecting H. pylori. Patients and Methods The analytical sensitivity values (limit of detection) of LAMP and polymerase chain reaction (PCR) were determined using serial dilutions of H. pylori DNA. Analytical specificity of the methods using new designed primers targeted ureC gene was also determined. Results The detection limits of the LAMP and PCR assay were similar and were 10 fg of pure DNA of H. pylori, which is equal to 6 copy numbers of H. pylori genome. Analytical specificity of the tests was 100% because the tests were positive only with H. pylori DNA. Conclusions The analytical sensitivity of LAMP and PCR methods, using the designed primers, was 8 times more than any other reported methods. The designed methods are specific and sensitive for detection of H. pylori in different clinical and environmental samples. PMID:27540449

  6. Molecular beacon-based fluorescence biosensor for the detection of gene fragment and PCR amplification products related to chronic myelogenous leukemia.

    PubMed

    Liu, Ailin; Sun, Zhouliang; Wang, Kun; Chen, Xuhai; Xu, Xiongwei; Wu, Yong; Lin, Xinhua; Chen, Yuanzhong; Du, Min

    2012-01-01

    A novel fluorescence method has been established for the determination of gene fragment and PCR amplification products related to chronic myelogenous leukemia (CML). A molecular beacon (MB) which comprises a DNA loop section, a pair of fluorophore (tetramethoxyl rhodamine, TAMRA), and a quencher (4-(2-methyl-on-amino-azobenzene) benzoate, DABCYL) was designed. The loop sequence of MB was designed according to the DNA sequence relating to CML (type b3a2) which contained a single-stranded oligonucleotide. Before hybridization, the fluorescence from the TAMRA had been quenched by the DABCYL. After hybridization with the complementary DNA, the quencher will become far away from the TAMRA, and the fluorescence intensity detected will increase. Changes in the fluorescence intensity have a linear relationship with the concentration of complementary DNA (C) in the range of 4.0 × 10(-9)-3.2 × 10(-8) mol/L, with a correlation coefficient of 0.9973; the detection limit was 6.0 × 10(-10) mol/L (S/N = 3). The developed method has high selectivity, which can be used to discriminate single-base mismatch sequence. The method has been applied to detect the short-stranded CML DNA fragment (278 bp) with high sensitivity. This approach is a promising method for the detection of CML in real samples for medical diagnostics.

  7. Amplification of genome sections in mammalian somatic cells resistant to colchicine. VII. Localization of original and amplified copes of the mdr gene in the same segment of chromosome 4 of the Dzungarian hamster

    SciTech Connect

    Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.

    1988-11-01

    Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of /open quotes/MDR genes/closed quotes/ (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences.

  8. Evidence for a novel mechanism for gene amplification in multiple myeloma: 1q12 pericentromeric heterochromatin mediates breakage-fusion-bridge cycles of a 1q12 approximately 23 amplicon.

    PubMed

    Sawyer, Jeffrey R; Tian, Erming; Thomas, Edward; Koller, Mark; Stangeby, Colin; Sammartino, Gael; Goosen, Linda; Swanson, Charles; Binz, Regina L; Barlogie, Bart; Shaughnessy, John

    2009-11-01

    Gene amplification is defined as a copy number (CN) increase in a restricted region of a chromosome arm, and is a mechanism for acquired drug resistance and oncogene activation. In multiple myeloma (MM), high CNs of genes in a 1q12 approximately 23 amplicon have been associated with disease progression and poor prognosis. To investigate the mechanisms for gene amplification in this region in MM, we performed a comprehensive metaphase analysis combining G-banding, fluorescence in situ hybridization, and spectral karyotyping in 67 patients with gain of 1q. In six patients (9%), evidence for at least one breakage-fusion-bridge (BFB) cycle was found. In three patients (4%), extended ladders of 1q12 approximately 23 amplicons were identified. Several key structures that are predicted intermediates in BFB cycles were observed, including: equal-spaced organization of amplicons, inverted repeat organization of amplicons along the same chromosome arm, and deletion of sequences distal to the amplified region. The 1q12 pericentromeric heterochromatin region served as both a recurrent breakpoint as well as a fusion point for sister chromatids, and ultimately bracketed both the proximal and distal boundaries of the amplicon. Our findings provide evidence for a novel BFB mechanism involving 1q12 pericentromeric breakage in the amplification of a large number of genes within a 1q12 approximately 23 amplicon.

  9. Role of the RS1 sequence of the cholera vibrio in amplification of the segment of plasmid DNA carrying the gene of resistance to tetracycline and the genes of cholera toxin

    SciTech Connect

    Fil'kova, S.L.; Il'ina, T.S.; Gintsburg, A.L.; Yanishevskii, N.V.; Smirnov, G.B.

    1988-11-01

    The hybrid plasmid pCO107, representing cointegrate 14(2)-5(2) of two plasmids, an F-derivative (pOX38) and a PBR322-derivative (pCT105) with an RS1 sequence of the cholera vibrio cloned in its makeup, contains two copes of RS1 at the sites of union of the two plasmids. Using a tetracycline resistance marker (Tc/sup R/) of the plasmid pCT105, clones were isolated which have an elevated level of resistance to tetracycline (an increase of from 4- to 30-fold). Using restriction analysis and the Southern blot method of hybridization it was shown that the increase in the level of resistance of tetracycline is associated with the amplification of pCT105 portion of the cointegrate, and that the process of amplification is governed by the presence of direct repeats of the RS1 sequence at its ends. The increase in the number of copies of the pCT105 segment, which contains in its composition the genes of cholera toxin (vct), is accompanied by an increase in toxin production.

  10. Clinical and metabolic parameters in non-small cell lung carcinoma and colorectal cancer patients with and without KRAS mutations.

    PubMed

    Yilmaz, Ahmet; Mohamed, Nehad; Patterson, Kara A; Tang, Yan; Shilo, Konstantin; Villalona-Calero, Miguel A; Davis, Michael E; Zhou, Xiao-Ping; Frankel, Wendy; Otterson, Gregory A; Zhao, Weiqiang

    2014-09-01

    Lung cancer (LC) and colorectal cancer (CRC) are the first and second deadliest types of cancer worldwide. EGFR-based therapy has been used in the treatment of these cancers with variable success. Presence of mutations in the KRAS driver oncogene, possibly induced by environmental factors such as carcinogens in diet and cigarette smoke, may confer worse prognosis and resistance to treatment for reasons not fully understood. Data on possible associations between KRAS mutational status and clinical and metabolic parameters, which may help in clinical management, as well as in identifying risk factors for developing these cancers, are limited in the current literature. We sequenced the KRAS gene and investigated the associations of variations in 108 patients with non-small cell lung carcinoma (NSCLC), the most common form of LC, and in 116 patients with CRC. All of the mutations originated from the guanosine nucleotide and over half of all transversions in NSCLC and CRC were c.34 G>T and c.35 G>T, respectively. c.35 G>A was the most frequent type of transition in both cancers. Excluding smoking, the clinical and metabolic parameters in patients carrying mutant and wild type KRAS were similar except that the CRC patients with transversion mutations were 8.6 years younger than those carrying the transitions (P < 0.01). Dyslipidemia, hypertension, family cancer history, and age of diagnosis older than 60 years were more frequent in NSCLC than CRC (P ≤ 0.04). These results suggest that most of the clinical and metabolic parameters investigated in this study are probably not associated with the more aggressive phenotype and differences in response to EGFR-based treatment previously reported in patients with KRAS mutations. However, the increased rates of abnormal metabolic parameters in patients with NSCLC in comparison to CRC indicate that these parameters may be more important in the management of NSCLC. CRC patients carrying transition mutations are older than those

  11. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    PubMed Central

    Johnson, G.; Ayers, M.; McClure, S. C. C.; Richardson, S. E.; Tellier, R.

    2003-01-01

    Several Bartonella species have now been implicated as human pathogens. The recovery of these fastidious organisms in the clinical microbiology laboratory remains difficult, and current methods are still relatively insensitive. Thus, the bartonellae are good candidates for detection by PCR. We have developed a PCR assay which uses a single primer pair targeting the riboflavin synthase gene (ribC) and detected six Bartonella species that have been implicated in human disease, B. henselae, B. quintana, B. bacilliformis, B. clarridgeiae, B. elizabethae, and B. vinsonii subsp. berkhoffii. Species identification is achieved simply by restriction enzyme digestion of the amplicon. This PCR assay appears to be specific for the Bartonella genus because it failed to amplify DNA from several other bacterial species. PMID:12624031

  12. Development and evaluation of a loop-mediated isothermal amplification assay for detection of Ehrlichia canis DNA in naturally infected dogs using the p30 gene.

    PubMed

    Pinhanelli, V C; Costa, P N M; Silva, G; Aguiar, D M; Silva, C M L; Fachin, A L; Marins, M

    2015-01-01

    Canine monocytic ehrlichiosis (CME) is a common tick-borne disease caused by the rickettsial bacterium Ehrlichia canis (Rickettsiales: Anaplasmataceae). In view of the different stages and variable clinical signs of CME, which can overlap with those of other infections, a conclusive diagnosis can more readily be obtained by combining clinical and hematological evaluations with molecular diagnostic methods. In this study, a loop-mediated isothermal amplification (LAMP) assay targeting the p30 gene of E. canis was developed. The assay was developed using DNA extracted from E. canis-infected cultures of the macrophage cell line DH82 and samples from dogs testing positive for E. canis DNA by PCR. The LAMP assay was compared to a p30-based PCR assay, using DNA extracted from EDTA-anticoagulated blood samples of 137 dogs from an endemic region in Brazil. The LAMP assay was sensitive enough to detect a single copy of the target gene, and identified 74 (54.0%) E. canis DNA-positive samples, while the p30 PCR assay detected 50 positive samples (36.5%) among the field samples. Agreement between the two assays was observed in 42 positive and 55 negative samples. However, 32 positive samples that were not detected by the PCR assay were identified by the LAMP assay, while eight samples identified as E. canis-positive by PCR showed negative results in LAMP. The developed E. canis LAMP assay showed the potential to maximize the use of nucleic acid tests in a veterinary clinical laboratory, and to improve the diagnosis of CME. PMID:26782434

  13. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) rapidly identified a critical missense mutation (P236T) of bovine ACADVL gene affecting growth traits.

    PubMed

    Zhang, Sihuan; Dang, Yonglong; Zhang, Qingfeng; Qin, Qiaomei; Lei, Chuzhao; Chen, Hong; Lan, Xianyong

    2015-04-01

    Acyl-CoA dehydrogenase, very long chain (ACADVL), encoding ACADVL protein, targets the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway and plays an important role in body metabolism and oxidation of long chain fatty acid releasing energy. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is an easy-to-operate, rapid, inexpensive, and exact method for SNP genotyping. Herein, T-ARMS-PCR was carried out to detect a critical missense mutation (AC_000176:g.2885C>A; Pro236Thr) within the ACADVL gene in 644 individuals from two cattle breeds. In order to evaluate the accuracy of the T-ARMS-PCR at this locus, the genotype of the sampled individuals was also identified by PCR-RFLP. The concordance between these two methods was 98.76%. Statistical analysis showed that the bovine ACADVL gene had a significant effect on chest width (P<0.05), chest depth (P<0.05), and hip width (P<0.05) in the Qinchuan breed. The cattle with AA genotype had superior growth traits compared to cattle with AC and/or CC genotypes. The "A" allele had positive effects on growth traits. Therefore, T-ARMS-PCR can replace PCR-RFLP for rapid genotyping of this mutation, which could be used as a DNA marker for selecting individuals with superior growth traits in the Qinchuan breed. These findings contribute to breeding and genetics in beef cattle industry.

  14. Rapid and Sensitive Detection of Bartonella bacilliformis in Experimentally Infected Sand Flies by Loop-Mediated Isothermal Amplification (LAMP) of the Pap31 Gene

    PubMed Central

    Angkasekwinai, Nasikarn; Atkins, Erin H.; Johnson, Richard N.; Grieco, John P.; Ching, Wei Mei; Chao, Chien Chung

    2014-01-01

    Background Carrion' disease, caused by Bartonella bacilliformis, remains truly neglected due to its focal geographical nature. A wide spectrum of clinical manifestations, including asymptomatic bacteremia, and lack of a sensitive diagnostic test can potentially lead to a spread of the disease into non-endemic regions where competent sand fly vectors may be present. A reliable test capable of detecting B. bacilliformis is urgently needed. Our objective is to develop a loop-mediated isothermal amplification (LAMP) assay targeting the pap31 gene to detect B. bacilliformis. Methods and Findings The sensitivity of the LAMP was evaluated in comparison to qPCR using plasmid DNA containing the target gene and genomic DNA in the absence and presence of human or sand fly DNA. The detection limit of LAMP was 1 to 10 copies/µL, depending on the sample metrics. No cross-reaction was observed when testing against a panel of various closely related bacteria. The utility of the LAMP was further compared to qPCR by the examination of 74 Lutzomyia longipalpis sand flies artificially fed on blood spiked with B. bacilliformis and harvested at days (D) 1, 3, 5, 7 and 9 post feeding. Only 86% of sand flies at D1 and 63% of flies at D3 were positive by qPCR. LAMP was able to detect B. bacilliformis in all those flies confirmed positive by qPCR. However, none of the flies after D3 were positive by either LAMP or qPCR. In addition to demonstrating the sensitivity of the LAMP assay, these results suggest that B. bacilliformis cannot propagate in artificially fed L. longipalpis. Conclusions The LAMP assay is as sensitive as qPCR for the detection of B. bacilliformis and could be useful to support diagnosis of patients in low-resource settings and also to identify B. bacilliformis in the sand fly vector. PMID:25522230

  15. Absolute Quantitation of Met Using Mass Spectrometry for Clinical Application: Assay Precision, Stability, and Correlation with MET Gene Amplification in FFPE Tumor Tissue

    PubMed Central

    Catenacci, Daniel V. T.; Liao, Wei-Li; Thyparambil, Sheeno; Henderson, Les; Xu, Peng; Zhao, Lei; Rambo, Brittany; Hart, John; Xiao, Shu-Yuan; Bengali, Kathleen; Uzzell, Jamar; Darfler, Marlene; Krizman, David B.; Cecchi, Fabiola; Bottaro, Donald P.; Karrison, Theodore; Veenstra, Timothy D.; Hembrough, Todd; Burrows, Jon

    2014-01-01

    Background Overexpression of Met tyrosine kinase receptor is associated with poor prognosis. Overexpression, and particularly MET amplification, are predictive of response to Met-specific therapy in preclinical models. Immunohistochemistry (IHC) of formalin-fixed paraffin-embedded (FFPE) tissues is currently used to select for ‘high Met’ expressing tumors for Met inhibitor trials. IHC suffers from antibody non-specificity, lack of quantitative resolution, and, when quantifying multiple proteins, inefficient use of scarce tissue. Methods After describing the development of the Liquid-Tissue-Selected Reaction Monitoring-mass spectrometry (LT-SRM-MS) Met assay, we evaluated the expression level of Met in 130 FFPE gastroesophageal cancer (GEC) tissues. We assessed the correlation of SRM Met expression to IHC and mean MET gene copy number (GCN)/nucleus or MET/CEP7 ratio by fluorescence in situ hybridization (FISH). Results Proteomic mapping of recombinant Met identified 418TEFTTALQR426 as the optimal SRM peptide. Limits of detection (LOD) and quantitation (LOQ) for this peptide were 150 and 200 amol/µg tumor protein, respectively. The assay demonstrated excellent precision and temporal stability of measurements in serial sections analyzed one year apart. Expression levels of 130 GEC tissues ranged (<150 amol/µg to 4669.5 amol/µg. High correlation was observed between SRM Met expression and both MET GCN and MET/CEP7 ratio as determined by FISH (n = 30; R2 = 0.898). IHC did not correlate well with SRM (n = 44; R2 = 0.537) nor FISH GCN (n = 31; R2 = 0.509). A Met SRM level of ≥1500 amol/µg was 100% sensitive (95% CI 0.69–1) and 100% specific (95% CI 0.92–1) for MET amplification. Conclusions The Met SRM assay measured the absolute Met levels in clinical tissues with high precision. Compared to IHC, SRM provided a quantitative and linear measurement of Met expression, reliably distinguishing between non-amplified and amplified MET

  16. Colorectal cancer-related mutant KRAS alleles function as positive regulators of autophagy

    PubMed Central

    Alves, Sara; Castro, Lisandra; Fernandes, Maria Sofia; Francisco, Rita; Castro, Paula; Priault, Muriel; Chaves, Susana Rodrigues; Moyer, Mary Pat; Oliveira, Carla; Seruca, Raquel; Côrte-Real, Manuela

    2015-01-01

    The recent interest to modulate autophagy in cancer therapy has been hampered by the dual roles of this conserved catabolic process in cancer, highlighting the need for tailored approaches. Since RAS isoforms have been implicated in autophagy regulation and mutation of the KRAS oncogene is highly frequent in colorectal cancer (CRC), we questioned whether/how mutant KRAS alleles regulate autophagy in CRC and its implications. We established two original models, KRAS-humanized yeast and KRAS-non-cancer colon cells and showed that expression of mutated KRAS up-regulates starvation-induced autophagy in both. Accordingly, KRAS down-regulation inhibited autophagy in CRC-derived cells harboring KRAS mutations. We further show that KRAS-induced autophagy proceeds via up-regulation of the MEK/ERK pathway in both colon models and that KRAS and autophagy contribute to CRC cell survival during starvation. Since KRAS inhibitors have proven difficult to develop, our results suggest using autophagy inhibitors as a combined/alternative therapeutic approach in CRCs with mutant KRAS. PMID:26418750

  17. Erbin is a novel substrate of the Sag-βTrCP E3 ligase that regulates KrasG12D-induced skin tumorigenesis

    PubMed Central

    Xie, Chuan-Ming; Wei, Dongping; Zhao, Lili; Marchetto, Sylvie; Mei, Lin; Borg, Jean-Paul

    2015-01-01

    SAG/RBX2 is the RING (really interesting new gene) component of Cullin-RING ligase, which is required for its activity. An organ-specific role of SAG in tumorigenesis is unknown. We recently showed that Sag/Rbx2, upon lung-targeted deletion, suppressed KrasG12D-induced tumorigenesis via inactivating NF-κB and mammalian target of rapamycin pathways. In contrast, we report here that, upon skin-targeted deletion, Sag significantly accelerated KrasG12D-induced papillomagenesis. In KrasG12D-expressing primary keratinocytes, Sag deletion promotes proliferation by inhibiting autophagy and senescence, by inactivating the Ras–Erk pathway, and by blocking reactive oxygen species (ROS) generation. This is achieved by accumulation of Erbin to block Ras activation of Raf and Nrf2 to scavenge ROS and can be rescued by knockdown of Nrf2 or Erbin. Simultaneous one-allele deletion of the Erbin-encoding gene Erbb2ip partially rescued the phenotypes. Finally, we characterized Erbin as a novel substrate of SAG-βTrCP E3 ligase. By degrading Erbin and Nrf2, Sag activates the Ras–Raf pathway and causes ROS accumulation to trigger autophagy and senescence, eventually delaying KrasG12D-induced papillomagenesis and thus acting as a skin-specific tumor suppressor. PMID:26056141

  18. Refinement of the BCL2/immunoglobulin heavy chain fusion gene in t(14;18)(q32;q21) by polymerase chain reaction amplification for long targets.

    PubMed

    Akasaka, T; Akasaka, H; Yonetani, N; Ohno, H; Yamabe, H; Fukuhara, S; Okuma, M

    1998-01-01

    The t(14;18)(q32;q21) translocation, involving the BCL2 gene and junctional segments (JH) of the immunoglobulin heavy chain gene (IGH), constitutes the most common chromosomal translocation in non-Hodgkin's lymphoma of B-cell type. Although the breakpoints in BCL2 are largely clustered within the major breakpoint region (MBR) and minor cluster region (mcr), it is known that some breakpoints map away from these regions, resulting in negative amplification of the junctional sequence by polymerase chain reaction (PCR) for < 1 kb targets. To circumvent this problem, we applied a novel PCR technology for long DNA targets, long-distance (LD-) PCR, to the detection of t(14;18) in clinical materials. Oligonucleotide primers were designed to be quite distant from the two known cluster regions in BCL2, and those for the corresponding IGH were complementary to the enhancer and constant regions. In all 52 cases identified as carrying BCL2/JH fusion by conventional Southern blot analysis, LD-PCR successfully amplified fragments encompassing the junctions, which were readily identifiable on ethidium bromide-stained gel. The size of the LD-PCR products ranged from 3.9 kb to 10.7 kb in MBR/IGH fusion and 1.9 kb to 16 kb in mcr/IGH fusion. Furthermore, we established an LD-PCR protocol for > 20 kb targets, which covered the intervening region between the MBR and mcr. Restriction analysis of the LD-PCR products revealed that breakpoints in 33 cases fell within the 150 bp-MBR region, and in 3 cases were within the mcr determined previously by others. In contrast, the breakpoints of the remaining 16 cases were distributed over a large region from the MBR through mcr. Nucleotide sequence analysis of a potential cluster region revealed the presence of an Alu repeat sequence. Restriction analysis of LD-PCR products with BstEII demonstrated a predominant usage of the JH6 segment (71%) at the BCL2/JH junctions. LD-PCR using primers for the constant region genes showed that class switch

  19. Cloning of DNA from double minutes of Y1 mouse adrenocortical tumor cells: evidence for gene amplification.

    PubMed

    George, D L; Powers, V E

    1981-04-01

    We have isolated a metaphase chromosome fraction highly enriched in double minutes (dm) from a mouse adrenocortical tumor cell line (Y1-DM). We have cloned DNA from this dm-enriched fraction in the lambda vector Charon 4A, and have characterized two randomly chosen recombinant bacteriophage clones from this dm DNA library. When 32 P-labeled DNA from each recombinant was hybridized to Southern blots of restriction endonuclease-digested DNA from different mouse cell lines, large differences were seen in the intensity of the resulting autoradiographic images, depending on the source of the genomic DNA. A very strong signal was obtained with DNA from the Y1-DM cells and with DNA from a related Y1 subline that lacks dm but contains a marker chromosome bearing a large homogeneously staining region (HSR). Hybridization to DNA from parental inbred mice and from two unrelated mouse cell lines produced a significantly weaker signal than that obtained with DNA from the Y1 cells, but the DNA fragments from the sources were of similar size. Based on results from filter hybridization analysis, we estimate that sequences homologous to the cloned fragments are approximately 100- to 200-fold more abundant in the genome of the Y1-DM cells than in the parental mouse cells. The data are consistent with the hypothesis that dm and HSRs in these cells contain amplified genes.

  20. PCR amplification and high throughput sequencing of immunoglobulin heavy chain genes</