Beta-catenin regulates vitamin C biosynthesis and cell survival in murine liver.
Nejak-Bowen, Kari N; Zeng, Gang; Tan, Xinping; Cieply, Benjamin; Monga, Satdarshan P
2009-10-09
Because the Wnt/beta-catenin pathway plays multiple roles in liver pathobiology, it is critical to identify gene targets that mediate such diverse effects. Here we report a novel role of beta-catenin in controlling ascorbic acid biosynthesis in murine liver through regulation of expression of regucalcin or senescence marker protein 30 and L-gulonolactone oxidase. Reverse transcription-PCR, Western blotting, and immunohistochemistry demonstrate decreased regucalcin expression in beta-catenin-null livers and greater expression in beta-catenin overexpressing transgenic livers, HepG2 hepatoma cells (contain constitutively active beta-catenin), regenerating livers, and in hepatocellular cancer tissues that exhibit beta-catenin activation. Interestingly, coprecipitation and immunofluorescence studies also demonstrate an association of beta-catenin and regucalcin. Luciferase reporter and chromatin immunoprecipitation assays verified a functional TCF-4-binding site located between -163 and -157 (CTTTGCA) on the regucalcin promoter to be critical for regulation by beta-catenin. Significantly lower serum ascorbate levels were observed in beta-catenin knock-out mice secondary to decreased expression of regucalcin and also of L-gulonolactone oxidase, the penultimate and last (also rate-limiting) steps in the synthesis of ascorbic acid, respectively. These mice also show enhanced basal hepatocyte apoptosis. To test if ascorbate deficiency secondary to beta-catenin loss and regucalcin decrease was contributing to apoptosis, beta-catenin-null hepatocytes or regucalcin small interfering RNA-transfected HepG2 cells were cultured, which exhibited significant apoptosis that was alleviated by the addition of ascorbic acid. Thus, through regucalcin and L-gulonolactone oxidase expression, beta-catenin regulates vitamin C biosynthesis in murine liver, which in turn may be one of the mechanisms contributing to the role of beta-catenin in cell survival.
Effects of vitamins A and D on the biosynthesis of L-ascorbic acid by rat-liver microsomes
Ghosh, N. C.; Chatterjee, Ipsita; Chatterjee, G. C.
1965-01-01
1. The synthesis of l-ascorbic acid from either d-glucuronolactone or l-gulonolactone by liver microsomes of rats is decreased under conditions of hypervitaminosis A; under hypervitaminosis D the synthesis from d-glucuronolactone is increased and that from l-gulonolactone is not affected. 2. The microsomal conversion of l-gulonolactone into l-ascorbic acid is impaired in liver tissues of rats made deficient with respect to either vitamin A or vitamin D when compared with the controls maintained on stock diet. PMID:16749110
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...
Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).
Beecher, Brian S; Carter, Arron H; See, Deven R
2012-05-01
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.
Vitamin C. Biosynthesis, recycling and degradation in mammals.
Linster, Carole L; Van Schaftingen, Emile
2007-01-01
Vitamin C, a reducing agent and antioxidant, is a cofactor in reactions catalyzed by Cu(+)-dependent monooxygenases and Fe(2+)-dependent dioxygenases. It is synthesized, in vertebrates having this capacity, from d-glucuronate. The latter is formed through direct hydrolysis of uridine diphosphate (UDP)-glucuronate by enzyme(s) bound to the endoplasmic reticulum membrane, sharing many properties with, and most likely identical to, UDP-glucuronosyltransferases. Non-glucuronidable xenobiotics (aminopyrine, metyrapone, chloretone and others) stimulate the enzymatic hydrolysis of UDP-glucuronate, accounting for their effect to increase vitamin C formation in vivo. Glucuronate is converted to l-gulonate by aldehyde reductase, an enzyme of the aldo-keto reductase superfamily. l-Gulonate is converted to l-gulonolactone by a lactonase identified as SMP30 or regucalcin, whose absence in mice leads to vitamin C deficiency. The last step in the pathway of vitamin C synthesis is the oxidation of l-gulonolactone to l-ascorbic acid by l-gulonolactone oxidase, an enzyme associated with the endoplasmic reticulum membrane and deficient in man, guinea pig and other species due to mutations in its gene. Another fate of glucuronate is its conversion to d-xylulose in a five-step pathway, the pentose pathway, involving identified oxidoreductases and an unknown decarboxylase. Semidehydroascorbate, a major oxidation product of vitamin C, is reconverted to ascorbate in the cytosol by cytochrome b(5) reductase and thioredoxin reductase in reactions involving NADH and NADPH, respectively. Transmembrane electron transfer systems using ascorbate or NADH as electron donors serve to reduce semidehydroascorbate present in neuroendocrine secretory vesicles and in the extracellular medium. Dehydroascorbate, the fully oxidized form of vitamin C, is reduced spontaneously by glutathione, as well as enzymatically in reactions using glutathione or NADPH. The degradation of vitamin C in mammals is
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini
2014-06-19
The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Enzymatic production of α-ketoglutaric acid from l-glutamic acid via l-glutamate oxidase.
Niu, Panqing; Dong, Xiaoxiang; Wang, Yuancai; Liu, Liming
2014-06-10
In this study, a novel strategy for α-ketoglutaric acid (α-KG) production from l-glutamic acid using recombinant l-glutamate oxidase (LGOX) was developed. First, by analyzing the molecular structure characteristics of l-glutamic acid and α-KG, LGOX was found to be the best catalyst for oxidizing the amino group of l-glutamic acid to a ketonic group without the need for exogenous cofactor. Then the LGOX gene was expressed in Escherichia coli BL21 (DE3) in a soluble and active form, and the recombinant LGOX activity reached to a maximum value of 0.59U/mL at pH 6.5, 30°C. Finally, the maximum α-KG concentration reached 104.7g/L from 110g/L l-glutamic acid in 24h, under the following optimum conditions: 1.5U/mL LGOX, 250U/mL catalase, 3mM MnCl2, 30°C, and pH 6.5. Copyright © 2014. Published by Elsevier B.V.
Condino-Neto, A; Whitney, C; Newburger, P E
1998-11-01
We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.
Snake Venom L-Amino Acid Oxidases: Trends in Pharmacology and Biochemistry
Izidoro, Luiz Fernando M.; Sobrinho, Juliana C.; Mendes, Mirian M.; Costa, Tássia R.; Grabner, Amy N.; Rodrigues, Veridiana M.; da Silva, Saulo L.; Zanchi, Fernando B.; Zuliani, Juliana P.; Fernandes, Carla F. C.; Calderon, Leonardo A.; Stábeli, Rodrigo G.; Soares, Andreimar M.
2014-01-01
L-amino acid oxidases are enzymes found in several organisms, including venoms of snakes, where they contribute to the toxicity of ophidian envenomation. Their toxicity is primarily due to enzymatic activity, but other mechanisms have been proposed recently which require further investigation. L-amino acid oxidases exert biological and pharmacological effects, including actions on platelet aggregation and the induction of apoptosis, hemorrhage, and cytotoxicity. These proteins present a high biotechnological potential for the development of antimicrobial, antitumor, and antiprotozoan agents. This review provides an overview of the biochemical properties and pharmacological effects of snake venom L-amino acid oxidases, their structure/activity relationship, and supposed mechanisms of action described so far. PMID:24738050
Washio, Tsubasa; Oikawa, Tadao
2018-01-01
We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa
Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.
1996-01-01
Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590
Giacomelli, Lisa
2013-01-01
Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417
Molecular evolution of the polyamine oxidase gene family in Metazoa
2012-01-01
Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including
Molecular evolution of the polyamine oxidase gene family in Metazoa.
Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela
2012-06-20
Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all
Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu
2016-01-01
It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene
Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji
2001-01-01
We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947
Babaev, Vladimir R; Li, Liying; Shah, Sanket; Fazio, Sergio; Linton, MacRae F; May, James M
2010-09-01
To assess the role of combined deficiencies of vitamins C and E on the earliest stages of atherosclerosis (an inflammatory condition associated with oxidative stress), 4 combinations of vitamin supplementation (low C/low E, low C/high E, high C/low E, and high C/high E) were studied in atherosclerosis-prone apolipoprotein E-deficient mice also unable to synthesize their own vitamin C (gulonolactone oxidase(-/-)); and to evaluate the effect of a more severe depletion of vitamin C alone in a second experiment using gulonolactone oxidase(-/-) mice carrying the hemizygous deletion of SVCT2 (the vitamin C transporter). After 8 weeks of a high-fat diet (16% lard and 0.2% cholesterol), atherosclerosis developed in the aortic sinus areas of mice in all diet groups. Each vitamin-deficient diet significantly decreased liver and brain contents of the corresponding vitamin. Combined deficiency of both vitamins increased lipid peroxidation, doubled plaque size, and increased plaque macrophage content by 2- to 3-fold in male mice, although only plaque macrophage content was increased in female mice. A more severe deficiency of vitamin C in gulonolactone oxidase(-/-) mice with defective cellular uptake of vitamin C increased both oxidative stress and atherosclerosis in apolipoprotein E(-/-) mice compared with littermates receiving a diet replete in vitamin C, again most clearly in males. Combined deficiencies of vitamins E and C are required to worsen early atherosclerosis in an apolipoprotein E-deficient mouse model. However, a more severe cellular deficiency of vitamin C alone promotes atherosclerosis when vitamin E is replete.
A thermostable L-aspartate oxidase: a new tool for biotechnological applications.
Bifulco, Davide; Pollegioni, Loredano; Tessaro, Davide; Servi, Stefano; Molla, Gianluca
2013-08-01
L-Amino acid oxidases (LAAOs) are homodimeric flavin adenine dinucleotide (FAD)-containing flavoproteins that catalyze the stereospecific oxidative deamination of L-amino acids to α-keto acids, ammonia, and hydrogen peroxide. Unlike the D-selective counterpart, the biotechnological application of LAAOs has not been thoroughly advanced because of the difficulties in their expression as recombinant protein in prokaryotic hosts. In this work, L-aspartate oxidase from the thermophilic archea Sulfolobus tokodaii (StLASPO, specific for L-aspartate and L-asparagine only) was efficiently produced as recombinant protein in E. coli in the active form as holoenzyme. This recombinant flavoenzyme shows the classical properties of FAD-containing oxidases. Indeed, StLASPO shows distinctive features that makes it attractive for biotechnological applications: high thermal stability (it is fully stable up to 80 °C) and high temperature optimum, stable activity in a broad range of pH (7.0-10.0), weak inhibition by the product oxaloacetate and by D-aspartate, and tight binding of the FAD cofactor. This latter property significantly distinguishes StLASPO from the E. coli counterpart. StLASPO represents an appropriate novel biocatalyst for the production of D-aspartate and a well-suited protein scaffold to evolve a LAAO activity by protein engineering.
Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G
1998-01-01
The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?
Kües, Ursula; Rühl, Martin
2011-01-01
Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246
Expression of Ascorbic Acid Oxidase in Zucchini Squash (Cucurbita pepo L.).
Lin, L S; Varner, J E
1991-05-01
The expression of ascorbic acid oxidase was studied in zucchini squash (Cucurbita pepo L.), one of the most abundant natural sources of the enzyme. In the developing fruit, specific activity of ascorbic acid oxidase was highest between 4 and 6 days after anthesis. Protein and mRNA levels followed the same trend as enzyme activity. Highest growth rate of the fruit occurred before 6 days after anthesis. Within a given fruit, ascorbic acid oxidase activity and mRNA level were highest in the epidermis, and lowest in the central placental region. In leaf tissue, ascorbic acid oxidase activity was higher in young leaves, and very low in old leaves. Within a given leaf, enzyme activity was highest in the fast-growing region (approximately the lower third of the blade), and lowest in the slow-growing region (near leaf apex). High expression of ascorbic acid oxidase at a stage when rapid growth is occurring (in both fruits and leaves), and localization of the enzyme in the fruit epidermis, where cells are under greatest tension during rapid growth in girth, suggest that ascorbic acid oxidase might be involved in reorganization of the cell wall to allow for expansion. Based on the known chemistry of dehydroascorbic acid, the end product of the ascorbic acid oxidase-catalyzed reaction, we have proposed several hypotheses to explain how dehydroascorbic acid might cause cell wall "loosening."
Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei
2012-03-01
The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.
Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.
Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio
2013-08-01
A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian
2007-08-01
A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.
Characterization of two brassinosteroid C-6 oxidase genes in pea.
Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B
2007-04-01
C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.
Chen, Wen Ming; Sheu, Fu Sian; Sheu, Shih Yi
2011-09-10
A brownish yellow pigmented bacterial strain, designated antisso-27, was recently isolated from a water area of saltpan in Southern Taiwan. Phylogenetic analyses based on 16S rRNA gene sequences indicate that strain antisso-27 belongs the genus Aquimarina in the family Flavobacteriacea and its only closest neighbor is Aquimarina spongiae (96.6%). Based on screening for algicidal activity, strain antisso-27 exhibits potent activity against the toxic cyanobacterium Microcystis aeruginosa. Both the strain antisso-27 bacterial culture and its culture filtrate show algicidal activity against the toxic cyanobacterium, indicating that an algicidal substance is released from strain antisso-27. The algicidal activity of strain antisso-27 occurs during the late stationary phase of bacterial growth. Strain antisso-27 can synthesize an algicidal protein with a molecular mass of 190 kDa, and its isoelectric point is approximately 9.4. This study explores the nature of this algicidal protein such as L-amino acid oxidase with broad substrate specificity. The enzyme is most active with L-leucine, L-isoleucine, L-methionine and L-valine and the hydrogen peroxide generated by its catalysis mediates algicidal activity. This is the first report on an Aquimarina strain algicidal to the toxic M. aeruginosa and the algicidal activity is generated through its enzymatic activity of L-amino acid oxidase. Copyright © 2011 Elsevier Inc. All rights reserved.
Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan
2010-01-01
In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125
Racemic resolution of some DL-amino acids using Aspergillus fumigatus L-amino acid oxidase.
Singh, Susmita; Gogoi, Binod K; Bezbaruah, Rajib L
2011-07-01
The ability of Aspergillus fumigatus L-amino acid oxidase (L-aao) to cause the resolution of racemic mixtures of DL-amino acids was investigated with DL-alanine, DL-phenylalanine, DL-tyrosine, and DL-aspartic acid. A chiral column, Crownpak CR+ was used for the analysis of the amino acids. The enzyme was able to cause the resolution of the three DL-amino acids resulting in the production of optically pure D-alanine (100% resolution), D-phenylalanine (80.2%), and D-tyrosine (84.1%), respectively. The optically pure D-amino acids have many uses and thus can be exploited industrially. This is the first report of the use of A. fumigatus L: -amino acid oxidase for racemic resolution of DL-amino acids.
Electrochemical l-Lactic Acid Sensor Based on Immobilized ZnO Nanorods with Lactate Oxidase
Ibupoto, Zafar Hussain; Ali Shah, Syed Muhammad Usman; Khun, Kimleang; Willander, Magnus
2012-01-01
In this work, fabrication of gold coated glass substrate, growth of ZnO nanorods and potentiometric response of lactic acid are explained. The biosensor was developed by immobilizing the lactate oxidase on the ZnO nanorods in combination with glutaraldehyde as a cross linker for lactate oxidase enzyme. The potentiometric technique was applied for the measuring the output (EMF) response of l-lactic acid biosensor. We noticed that the present biosensor has wide linear detection range of concentration from 1 × 10−4–1 × 100 mM with acceptable sensitivity about 41.33 ± 1.58 mV/decade. In addition, the proposed biosensor showed fast response time less than 10 s, a good selectivity towards l-lactic acid in presence of common interfering substances such as ascorbic acid, urea, glucose, galactose, magnesium ions and calcium ions. The present biosensor based on immobilized ZnO nanorods with lactate oxidase sustained its stability for more than three weeks. PMID:22736960
Electrochemical L-lactic acid sensor based on immobilized ZnO nanorods with lactate oxidase.
Ibupoto, Zafar Hussain; Shah, Syed Muhammad Usman Ali; Khun, Kimleang; Willander, Magnus
2012-01-01
In this work, fabrication of gold coated glass substrate, growth of ZnO nanorods and potentiometric response of lactic acid are explained. The biosensor was developed by immobilizing the lactate oxidase on the ZnO nanorods in combination with glutaraldehyde as a cross linker for lactate oxidase enzyme. The potentiometric technique was applied for the measuring the output (EMF) response of l-lactic acid biosensor. We noticed that the present biosensor has wide linear detection range of concentration from 1 × 10(-4)-1 × 10(0) mM with acceptable sensitivity about 41.33 ± 1.58 mV/decade. In addition, the proposed biosensor showed fast response time less than 10 s, a good selectivity towards l-lactic acid in presence of common interfering substances such as ascorbic acid, urea, glucose, galactose, magnesium ions and calcium ions. The present biosensor based on immobilized ZnO nanorods with lactate oxidase sustained its stability for more than three weeks.
Screening of Bothrops snake venoms for L-amino acid oxidase activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pessati, M.L.; Fontana, J.D.; Guimaraes, M.F.
1995-12-31
Toxins, enzymes, and biologically active peptides are the main components of snake venoms from the genus Bothrops. Following the venom inoculation, the local effects are hemorrhage, edema, and myonecrosis. Nineteen different species of Brazilian Bothrops were screened for protein content and L-amino acid oxidase activity. B. cotiara, formerly found in the South of Brazil, is now threatened with extinction. Its venom contains a highly hemorrhagic fraction and, as expected from the deep yellow color of the corresponding lyophilized powder, a high L-amino acid oxidase (LAO) activity was also characterized. Flavin adenine dinucleotide (FAD) is its associate coenzyme. B. cotiara venommore » LAO catalyzed the oxidative deamination of several L-amino acids, and the best substrates were methionine, leucine, tryptophan, and phenylalanine, hence, its potential application for the use in biosensors for aspartame determination and for the removal of amino acids from plasma. High levels for LAO were also found in other species than B. cotiara. In addition, the technique of isoelectric focusing (IEF) was employed as a powerful tool to study the iso- or multi-enzyme distribution for LAO activity in the B. cotiara snake venom.« less
Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.
Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro
2002-07-19
The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.
MONOAMINE OXIDASE: From Genes to Behavior
Shih, J. C.; Chen, K.; Ridd, M. J.
2010-01-01
Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537
Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.
2014-01-01
Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264
Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu
2014-03-11
Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
2014-01-01
Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.
Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C
2003-05-01
Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...
Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R
2003-10-01
Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.
Im, Dohyun; Matsui, Daisuke; Arakawa, Takatoshi; Isobe, Kimiyasu; Asano, Yasuhisa; Fushinobu, Shinya
2018-03-01
l-Amino acid oxidase/monooxygenase from Pseudomonas sp. AIU 813 (l-AAO/MOG) catalyzes both the oxidative deamination and oxidative decarboxylation of the α-group of l-Lys to produce a keto acid and amide, respectively. l-AAO/MOG exhibits limited specificity for l-amino acid substrates with a basic side chain. We previously determined its ligand-free crystal structure and identified a key residue for maintaining the dual activities. Here, we determined the structures of l-AAO/MOG complexed with l-Lys, l-ornithine, and l-Arg and revealed its substrate recognition. Asp238 is located at the ceiling of a long hydrophobic pocket and forms a strong interaction with the terminal, positively charged group of the substrates. A mutational analysis on the D238A mutant indicated that the interaction is critical for substrate binding but not for catalytic control between the oxidase/monooxygenase activities. The catalytic activities of the D238E mutant unexpectedly increased, while the D238F mutant exhibited altered substrate specificity to long hydrophobic substrates. In the ligand-free structure, there are two channels connecting the active site and solvent, and a short region located at the dimer interface is disordered. In the l-Lys complex structure, a loop region is displaced to plug the channels. Moreover, the disordered region in the ligand-free structure forms a short helix in the substrate complex structures and creates the second binding site for the substrate. It is assumed that the amino acid substrate enters the active site of l-AAO/MOG through this route. The atomic coordinates and structure factors (codes 5YB6, 5YB7, and 5YB8) have been deposited in the Protein Data Bank (http://wwpdb.org/). 1.4.3.2 (l-amino acid oxidase), 1.13.12.2 (lysine 2-monooxygenase).
Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.
Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo
2004-10-01
The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
OPHIDIAN L-AMINO ACID OXIDASE. THE NATURE OF THE ENZYME-SUBSTRATE COMPLEXES.
ZELLER, E A; RAMACHANDER, G; FLEISHER, G A; ISHIMARU, T; ZELLER, V
1965-04-01
1. To investigate the kinetics of ophidian l-amino acid oxidase, V and K(m) were determined for phenylalanines that were substituted in every ring position with groups of various size and reactivity, and for a few ring-substituted tryptophans and histidines. The venom of one representative from each of three major classes of poisonous snakes, Naja melanoleuca, Vipera russelli and Crotalus adamanteus, served as a source of the ophidian l-amino acid oxidase. Both crude and crystalline enzyme from the venom of C. adamanteus were tested. 2. The introduction of a benzene ring into glycine and alanine caused some increase of V and a very marked depression of K(m). 3. With the exception of fluorine, residues in the ortho position of phenylalanine led to a decrease of V. The rates induced by various substitutions follow the pattern: meta >/= para >/= ortho. Within the halogen series, the effects become more pronounced with increasing atomic number. 4. Ring substitution in heterocyclic amino acids also affected the V values markedly. For methyl-substituted tryptophans the pattern was: 5-methyl >/= 6-methyl >/= 4-methyl. In a few instances ring substitution accounts for a considerable elevation of V, as shown for beta-quinol-4-ylalanine and its 6-methoxy derivative. 5. The kinetic constants appear to be unaffected by relatively high concentrations of the corresponding d-amino acids. 6. A general principle that permits a uniform interpretation of a vast body of information is suggested. It is based on the assumption that most substrates form not only eutopic but also dystopic complexes with the enzyme. The latter, in contrast with the former, do not permit the formation of reaction products. K values for eutopic and dystopic complexes are computed. Similar concepts have been presented to elucidate the action of alpha-chymotrypsin (Hein & Niemann, 1962) and of monoamine oxidase.
Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P
2011-03-01
"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.
ERIC Educational Resources Information Center
May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.
2009-01-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab
2015-06-01
Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.
Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.
2015-01-01
Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614
Nawathean, P; Maslov, D A
2000-08-01
By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.
A novel proteolytic processing of prolysyl oxidase
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo
2012-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931
A novel proteolytic processing of prolysyl oxidase.
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo
2011-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.
Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.
Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J
1979-12-01
Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Yang, Chia-Ann; Cheng, Chi-Hua; Lo, Chaur-Tsuen; Liu, Shu-Ying; Lee, Jeng-Woei; Peng, Kou-Cheng
2011-05-11
Trichoderma spp. are used as biocontrol agents against phytopathogens such as Rhizoctonia solani, but their biocontrol mechanisms are poorly understood. A novel L-amino oxidase (Th-LAAO) was identified from the extracellular proteins of Trichoderma harzianum ETS 323. Here, we show a FAD-binding glycoprotein with the best substrate specificity constant for L-phenylalanine. Although the amino acid sequence of Th-LAAO revealed limited homology (16-24%) to other LAAO members, a highly conserved FAD-binding motif was identified in the N-terminus. Th-LAAO was shown to be a homodimeric protein, but the monomeric form was predominant when grown in the presence of deactivated Rhizoctonia solani. Furthermore, in vitro assays demonstrated that Th-LAAO had an antagonistic effect against Rhizoctonia solani and a stimulatory one on hyphal density and sporulation in T. harzianum ETS 323. These findings further our understanding of T. harzianum as a biocontrol agent and provide insight into the biological function of l-amino acid oxidase.
Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki
2013-02-01
In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.
Isolation and characterization of the pea cytochrome c oxidase Vb gene.
Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi
2006-11-01
Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.
Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N
2011-01-01
The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.
Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus
Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds
2016-01-01
The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...
Sugie, Atsushi; Murai, Koji; Takumi, Shigeo
2007-06-01
Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.
Allam, Mai A; Saker, Mahmoud M
2017-01-01
The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.
Sircar, Debabrata; Cardoso, Hélia G; Mukherjee, Chiranjit; Mitra, Adinpunya; Arnholdt-Schmitt, Birgit
2012-05-01
Methyl-jasmonate (MJ)-treated hairy roots of Daucus carota L. were used to study the influence of alternative oxidase (AOX) in phenylpropanoid metabolism. Phenolic acid accumulation, as well as total flavonoids and lignin content of the MJ-treated hairy roots were decreased by treatment with salicylhydroxamic acid (SHAM), a known inhibitor of AOX. The inhibitory effect of SHAM was concentration dependent. Treatment with propyl gallate (PG), another inhibitor of AOX, also had a similar inhibitory effect on accumulation of phenolic acid, total flavonoids and lignin. The transcript levels of two DcAOX genes (DcAOX2a and DcAOX1a) were monitored at selected post-elicitation time points. A notable rise in the transcript levels of both DcAOX genes was observed preceding the MJ-induced enhanced accumulation of phenolics, flavonoids and lignin. An appreciable increase in phenylalanine ammonia-lyase (PAL) transcript level was also observed prior to enhanced phenolics accumulation. Both DcAOX genes showed differential transcript accumulation patterns after the onset of elicitation. The transcript levels of DcAOX1a and DcAOX2a attained peak at 6hours post elicitation (hpe) and 12hpe, respectively. An increase in the transcript levels of both DcAOX genes preceding the accumulation of phenylpropanoid-derivatives and lignin showed a positive correlation between AOX activity and phenylpropanoid biosynthesis. The results provide important new insight about the influence of AOX in phenylpropanoid biosynthesis. Copyright © 2012 Elsevier GmbH. All rights reserved.
Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks
Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong
2009-01-01
Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo
2018-05-15
Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.
Katayama-Ikegami, Ayako; Suehiro, Yuka; Katayama, Takane; Jindo, Kazushi; Itamura, Hiroyuki; Esumi, Tomoya
2017-12-01
Polyphenol oxidases (PPOs) catalyze browning reactions in various plant organs, therefore controlling the reactions is important for the food industry. PPOs have been assumed to be involved in skin browning of white grape cultivars; however, the molecular mechanism underlying PPO-mediated browning process remains elusive. We have recently identified a new PPO gene named VvPPO2 from "Shine Muscat" (Vitis labruscana Bailey × V. vinifera L.), and have shown that the gene is transcribed at a higher level than the previously identified VvPPO1 in browning, physiologically disordered berry skins at the maturation stage. In this study, we expressed VvPPO2 in Escherichia coli and, using the purified preparation, revealed unique physicochemical characteristics of the enzyme. Our study opens up a way to not only understand the berry skin browning process but also to elucidate the enzymatic maturation process of grape PPOs.
PROLINE OXIDASES IN HANSENULA SUBPELLICULOSA
Ling, Chung-Mei; Hedrick, L. R.
1964-01-01
Ling, Chung-Mei (Illinois Institute of Technology, Chicago), and L. R. Hedrick. Proline oxidases in Hansenula subpelliculosa. J. Bacteriol. 87:1462–1470. 1964—Cells of Hansenula subpelliculosa can use l-proline as a carbon and a nitrogen source after a 6- to 8-hr induction period. However, they cannot use l-glutamate as both nitrogen and carbon sources unless the induction period is of several days' duration. Two l-proline oxidases were demonstrated in the mitochondrial preparation of this yeast. One forms the product Δ′-pyrroline-2-carboxylic acid (P2C), which is in equilibrium with α-keto-δ-amino-valeric acid; the other forms the product Δ′-pyrroline-5-carboxylic acid (P5C), which is in equilibrium with glutamic-γ-semialdehyde. The first-mentioned enzyme is induced when l-proline is the carbon source; the second appears to be constitutive, and is probably associated with the use of l-proline as a nitrogen source. The P2C-forming enzyme is specific for the l isomer of proline, and is inactive against l-hydroxyproline. The enzyme activity is at its peak when the mitochondria are prepared from logarithmically grown cells, and is rapidly reduced after cells reach the stationary phase of growth. Kinetic studies with varying concentrations of substrate indicate a Michaelis-Menten constant of 2.45 × 10−2m. Paper chromatographic studies, chemical tests with H2O2, sensitivity to freezing, and spectral measurements indicate that proline oxidase from H. subpelliculosa mitochondria forms a product from l-proline which is like, if not identical to, P2C formed by the action of sheep kidney d-proline oxidase upon dl-proline. The soluble portion of the cell extract contains NAD+ enzymes which use either P2C (α-keto-δ-amino-valeric acid) or P5C (glutamic-γ-semialdehyde) as substrates. No glutamic dehydrogenase activity could be detected when l-glutamic acid and the nicotinamide adenine dinucleotide (NAD+) cofactor were added to the supernatant solution with the
Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao
2017-01-01
Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149
Genetics Home Reference: cytochrome c oxidase deficiency
... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...
Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio
2015-03-24
L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra
2013-01-01
Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573
Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake
2015-12-01
The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.
Nana, Fernand W.; Hilou, Adama; Millogo, Jeanne F.; Nacoulma, Odile G.
2012-01-01
This paper describes a preliminary assessment of the nutraceutical value of Amaranthus cruentus (A. cruentus) and Amaranthus hybridus (A. hybridus), two food plant species found in Burkina Faso. Hydroacetonic (HAE), methanolic (ME), and aqueous extracts (AE) from the aerial parts were screened for in vitro antioxidant and xanthine oxidase inhibitory activities. Phytochemical analyses revealed the presence of polyphenols, tannins, flavonoids, steroids, terpenoids, saponins and betalains. Hydroacetonic extracts have shown the most diversity for secondary metabolites. The TLC analyses of flavonoids from HAE extracts showed the presence of rutin and other unidentified compounds. The phenolic compound contents of the HAE, ME and AE extracts were determined using the Folin–Ciocalteu method and ranged from 7.55 to 10.18 mg Gallic acid equivalent GAE/100 mg. Tannins, flavonoids, and flavonols ranged from 2.83 to 10.17 mg tannic acid equivalent (TAE)/100 mg, 0.37 to 7.06 mg quercetin equivalent (QE) /100 mg, and 0.09 to 1.31 mg QE/100 mg, respectively. The betacyanin contents were 40.42 and 6.35 mg Amaranthin Equivalent/100 g aerial parts (dry weight) in A. cruentus and A. hybridus, respectively. Free-radical scavenging activity expressed as IC50 (DPPH method) and iron reducing power (FRAP method) ranged from 56 to 423 µg/mL and from 2.26 to 2.56 mmol AAE/g, respectively. Xanthine oxidase inhibitory activities of extracts of A. cruentus and A. hybridus were 3.18% and 38.22%, respectively. The A. hybridus extract showed the best antioxidant and xanthine oxidase inhibition activities. The results indicated that the phytochemical contents of the two species justify their traditional uses as nutraceutical food plants. PMID:24281664
Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.
Castresana, J; Lübben, M; Saraste, M; Higgins, D G
1994-06-01
Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.
Altered gene expression in early postnatal monoamine oxidase A knockout mice.
Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C
2017-08-15
We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.
Fung, Shin Yee; Lee, Mui Li; Tan, Nget Hong
2015-03-01
Snake venom LAAOs have been reported to exhibit a wide range of pharmacological activities, including cytotoxic, edema-inducing, platelet aggregation-inducing/platelet aggregation-inhibiting, bactericidal and antiviral activities. A heat-stable form of l-amino acid oxidase isolated from king cobra (Ophiophagus hannah) venom (OH-LAAO) has been shown to exhibit very potent cytotoxicity against human tumorigenic cells but not in their non-tumorigenic counterparts, and the cytotoxicity was due to the apoptosis-inducing effect of the enzyme. In this work, the molecular mechanism of cell death induced by OH-LAAO was investigated. The enzyme exerts its apoptosis-inducing effect presumably via both intrinsic and extrinsic pathways as suggested by the increase in caspase-8 and -9 activities. Oligonucleotide microarray analysis showed that the expression of a total of 178 genes was significantly altered as a result of oxidative stress induced by the hydrogen peroxide generated by the enzyme. Of the 178 genes, at least 27 genes are involved in apoptosis and cell death. These alterations of gene expression was presumably caused by the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidative modifications of signaling molecules that eventually lead to apoptosis and cell death. The very substantial up-regulation of cytochrome P450 genes may also contribute to the potent cytotoxic action of OH-LAAO by producing excessive reactive oxygen species (ROS). In conclusion, the potent apoptosis inducing activity of OH-LAAO was likely due to the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidation of signalling molecules. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-01-01
Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H
2009-07-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li
2016-07-09
In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.
Youdim, M B H; Tipton, K F
2002-03-01
Rats were injected intraperitoneally with varying doses of l-deprenyl (selegiline) followed 2h later by 30 mg kg(-1) 2-phenylethylamine (PEA), administered in the same way, and the stereotypic behavioural response elicited was assessed. l-Deprenyl alone at doses of up to 5 mg kg(-1) caused no significant behavioural response. Administration of PEA without prior l-deprenyl treatment resulted in only a modest increase in stereotypic behaviour and this was not significantly enhanced by the prior administration 1 mg kg(-1) l-deprenyl. When the administered dose of l-deprenyl was increased to 2.5 or 5 mgkg(-1), however, the stereotypic behavioural response to PEA was greatly potentiated and in the latter case persisted for 60 min. A dose of 2.5 mg kg(-1) l-deprenyl and 1 mg kg(-1) rasagiline was shown to result in over 90% inhibition of the monoamine oxidase (MAO)-B from rat liver and striatum, whereas the inhibition of MAO-A was about 60 and 40% in liver and striatum, respectively. The recovery of MAO-B activity in rat striatum and liver following a single i.p. injection of 5 mg kg(-1) l-deprenyl gave first-order rate constants of 1.80 and 7.15 h(-1), respectively, which corresponded to half-lives of 9.23 and 2.33 days. Similar results were obtained with rasagiline. The corresponding indices of stereotypic response to PEA (30 mg kg(-1); i.p.) during recovery from the single dose of l-deprenyl were initially high, but had started to decline by the third day after l-deprenyl treatment and was not significant after day 4. At that time, less than 20% of the striatal monoamine oxidase-B activity had been regained, whereas the recovery of the liver enzyme was about 65%. These data are discussed in terms of the suggested involvement of PEA potentiation in the anti-parkinsonian actions of l-deprenyl and rasagiline and the duration of the 'wash-out' period used in studies on the effects of l-deprenyl on patients with Parkinson's disease. The longer duration of the recovery of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kasprzak, Kazimierz S.; Diwan, Bhalchandra A.; Kaczmarek, Monika Z.
2011-11-15
The aim of this study was to test a hypothesis that ascorbate depletion could enhance carcinogenicity and acute toxicity of nickel. Homozygous L-gulono- < gamma > -lactone oxidase gene knock-out mice (Gulo-/- mice) unable to produce ascorbate and wild-type C57BL mice (WT mice) were injected intramuscularly with carcinogenic nickel subsulfide (Ni{sub 3}S{sub 2}), and observed for the development of injection site tumors for 57 weeks. Small pieces of one of the induced tumors were transplanted subcutaneously into separate groups of Gulo-/- and WT mice and the growth of these tumors was measured for up to 3 months. The two strainsmore » of mice differed significantly with regard to (1) Ni{sub 3}S{sub 2} carcinogenesis: Gulo-/- mice were 40% more susceptible than WT mice; and (2) transplanted tumors development: Gulo-/- mice were more receptive to tumor growth than WT mice, but only in terms of a much shorter tumor latency; later in the exponential phase of growth, the growth rates were the same. And, with adequate ascorbate supplementation, the two strains were equally susceptible to acute toxicity of Ni{sub 3}S{sub 2}. Statistically significant effects of dietary ascorbate dosing levels were the following: (1) reduction in ascorbate supplementation increased acute toxicity of Ni{sub 3}S{sub 2} in Gulo-/- mice; (2) ascorbate supplementation extended the latency of transplanted tumors in WT mice. In conclusion, the lack of endogenous ascorbate synthesis makes Gulo-/- mice more susceptible to Ni{sub 3}S{sub 2} carcinogenesis. Dietary ascorbate tends to attenuate acute toxicity of Ni{sub 3}S{sub 2} and to extend the latency of transplanted tumors. The latter effects may be of practical importance to humans and thus deserve further studies. -- Highlights: Black-Right-Pointing-Pointer Ascorbate depletion enhances carcinogenicity and acute toxicity of nickel. Black-Right-Pointing-Pointer Gulo-/- mice unable to synthesize ascorbate were used in this study. Black
Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James
2017-11-30
Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.
The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis
Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel
2017-01-01
Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F
2011-02-01
Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
1986-04-17
This invention involves a new strategy for imaging the activity of the enzyme monoamine oxidase in the living body by using /sup 11/C-labeled enzyme inhibitors which bind irreversibly to an enzyme as a result of catalysis. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.
Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.
Bravo, Karent; Osorio, Edison
2016-04-15
Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730
USDA-ARS?s Scientific Manuscript database
Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...
Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P
2015-03-28
Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
African Swine Fever Virus pB119L Protein Is a Flavin Adenine Dinucleotide-Linked Sulfhydryl Oxidase
Rodríguez, Irene; Redrejo-Rodríguez, Modesto; Rodríguez, Javier M.; Alejo, Alí; Salas, José; Salas, María L.
2006-01-01
Protein pB119L of African swine fever virus belongs to the Erv1p/Alrp family of sulfhydryl oxidases and has been described as a late nonstructural protein required for correct virus assembly. To further our knowledge of the function of protein pB119L during the virus life cycle, we have investigated whether this protein possesses sulfhydryl oxidase activity, using a purified recombinant protein. We show that the purified protein contains bound flavin adenine dinucleotide and is capable of catalyzing the formation of disulfide bonds both in a protein substrate and in the small molecule dithiothreitol, the catalytic activity being comparable to that of the Erv1p protein. Furthermore, protein pB119L contains the cysteines of its active-site motif CXXC, predominantly in an oxidized state, and forms noncovalently bound dimers in infected cells. We also show in coimmunoprecipitation experiments that protein pB119L interacts with the viral protein pA151R, which contains a CXXC motif similar to that present in thioredoxins. Protein pA151R, in turn, was found to interact with the viral structural protein pE248R, which contains disulfide bridges and belongs to a class of myristoylated proteins related to vaccinia virus L1R, one of the substrates of the redox pathway encoded by this virus. These results suggest the existence in African swine fever virus of a system for the formation of disulfide bonds constituted at least by proteins pB119L and pA151R and identify protein pE248R as a possible final substrate of this pathway. PMID:16537584
African swine fever virus pB119L protein is a flavin adenine dinucleotide-linked sulfhydryl oxidase.
Rodríguez, Irene; Redrejo-Rodríguez, Modesto; Rodríguez, Javier M; Alejo, Alí; Salas, José; Salas, María L
2006-04-01
Protein pB119L of African swine fever virus belongs to the Erv1p/Alrp family of sulfhydryl oxidases and has been described as a late nonstructural protein required for correct virus assembly. To further our knowledge of the function of protein pB119L during the virus life cycle, we have investigated whether this protein possesses sulfhydryl oxidase activity, using a purified recombinant protein. We show that the purified protein contains bound flavin adenine dinucleotide and is capable of catalyzing the formation of disulfide bonds both in a protein substrate and in the small molecule dithiothreitol, the catalytic activity being comparable to that of the Erv1p protein. Furthermore, protein pB119L contains the cysteines of its active-site motif CXXC, predominantly in an oxidized state, and forms noncovalently bound dimers in infected cells. We also show in coimmunoprecipitation experiments that protein pB119L interacts with the viral protein pA151R, which contains a CXXC motif similar to that present in thioredoxins. Protein pA151R, in turn, was found to interact with the viral structural protein pE248R, which contains disulfide bridges and belongs to a class of myristoylated proteins related to vaccinia virus L1R, one of the substrates of the redox pathway encoded by this virus. These results suggest the existence in African swine fever virus of a system for the formation of disulfide bonds constituted at least by proteins pB119L and pA151R and identify protein pE248R as a possible final substrate of this pathway.
Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1
Smesrud, Logan; Tebo, Bradley M.
2016-01-01
ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the
Nestler, Josefine; Liu, Sanzhen; Wen, Tsui-Jung; Paschold, Anja; Marcon, Caroline; Tang, Ho Man; Li, Delin; Li, Li; Meeley, Robert B; Sakai, Hajime; Bruce, Wesley; Schnable, Patrick S; Hochholdinger, Frank
2014-09-01
Root hairs are instrumental for nutrient uptake in monocot cereals. The maize (Zea mays L.) roothairless5 (rth5) mutant displays defects in root hair initiation and elongation manifested by a reduced density and length of root hairs. Map-based cloning revealed that the rth5 gene encodes a monocot-specific NADPH oxidase. RNA-Seq, in situ hybridization and qRT-PCR experiments demonstrated that the rth5 gene displays preferential expression in root hairs but also accumulates to low levels in other tissues. Immunolocalization detected RTH5 proteins in the epidermis of the elongation and differentiation zone of primary roots. Because superoxide and hydrogen peroxide levels are reduced in the tips of growing rth5 mutant root hairs as compared with wild-type, and Reactive oxygen species (ROS) is known to be involved in tip growth, we hypothesize that the RTH5 protein is responsible for establishing the high levels of ROS in the tips of growing root hairs required for elongation. Consistent with this hypothesis, a comparative RNA-Seq analysis of 6-day-old rth5 versus wild-type primary roots revealed significant over-representation of only two gene ontology (GO) classes related to the biological functions (i.e. oxidation/reduction and carbohydrate metabolism) among 893 differentially expressed genes (FDR <5%). Within these two classes the subgroups 'response to oxidative stress' and 'cellulose biosynthesis' were most prominently represented. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira
1995-12-18
The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Characterization of polyphenol oxidase from blueberry (Vaccinium corymbosum L.).
Siddiq, M; Dolan, K D
2017-03-01
Polyphenol oxidase (PPO) was extracted and characterized from high-bush blueberries. PPO showed an optimum activity at pH 6.1-6.3 and 35°C, with the enzyme showing significant activity over a wide temperature range (25-60°C). Catechol was the most readily oxidized substrate followed by 4-methylcatechol, DL-DOPA, and dopamine. Blueberry PPO showed a K m of 15mM and V max of 2.57 ΔA 420 nm/min×10 -1 , determined with catechol. PPO was completely inactivated in 20min at 85°C, however, after 30minat 75°C it showed about 10% residual activity. Thermal treatment at 55 and 65°C for 30min resulted in the partial inactivation of PPO. Ascorbic acid, sodium diethyldithiocarbamic acid, L-cysteine, and sodium metabisulfite were effective inhibitors of PPO at 1.0mM. Benzoic acid and cinnamic acid series inhibitors showed relatively weak inhibition of PPO (21.8-27.6%), even at as high as 2.0mM concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Liso, Rosalia; De Tullio, Mario C; Ciraci, Samantha; Balestrini, Raffaella; La Rocca, Nicoletta; Bruno, Leonardo; Chiappetta, Adriana; Bitonti, Maria Beatrice; Bonfante, Paola; Arrigoni, Oreste
2004-12-01
To understand the function of ascorbic acid (ASC) in root development, the distribution of ASC, ASC oxidase, and glutathione (GSH) were investigated in cells and tissues of the root apex of Cucubita maxima. ASC was regularly distributed in the cytosol of almost all root cells, with the exception of quiescent centre (QC) cells. ASC also occurred at the surface of the nuclear membrane and correspondingly in the nucleoli. No ASC could be observed in vacuoles. ASC oxidase was detected by immunolocalization mainly in cell walls and vacuoles. This enzyme was particularly abundant in the QC and in differentiating vascular tissues and was absent in lateral root primordia. Administration of the ASC precursor L-galactono-gamma-lactone markedly increased ASC content in all root cells, including the QC. Root treatment with the ASC oxidized product, dehydroascorbic acid (DHA), also increased ASC content, but caused ASC accumulation only in peripheral tissues, where DHA was apparently reduced at the expense of GSH. The different pattern of distribution of ASC in different tissues and cell compartments reflects its possible role in cell metabolism and root morphogenesis.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
2012-01-01
Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on
Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick
2005-03-01
The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.
Feed-back regulation of gibberellin biosynthesis and gene expression in Pisum sativum L.
Martin, D N; Proebsting, W M; Parks, T D; Dougherty, W G; Lange, T; Lewis, M J; Gaskin, P; Hedden, P
1996-01-01
Treatment of tall and dwarf (3 beta-hydroxylase impaired) genotypes of pea (Pisum sativum L.) with the synthetic, highly active gibberellin (GA), 2,2-dimethyl GA4, reduced the shoot contents of C19-GAs, including GA1, and increased the concentration of the C20-GA, GA19. In shoots of the slender (la crys) mutant, the content of C19-GAs was lower and GA19 content was higher than in those of the tall line. Metabolism of GA19 and GA20 in leaves of a severe (na) GA-deficient dwarf mutant was reduced by GA treatment. The results suggest feed-back regulation of the 20-oxidation and 3 beta-hydroxylation reactions. Feed-back regulation of GA 20-oxidation was studied further using a cloned GA 20-oxidase cDNA from pea. The cDNA, Ps074, was isolated using polymerase chain reaction with degenerate oligonucleotide primers based on pumpkin and Arabidopsis 20-oxidase sequences. After expression of this cDNA clone in Escherichia coli, the product oxidized GA12 to GA15, GA24 and the C19-GA, GA9, which was the major product. The 13-hydroxylated substrate GA53 was similarly oxidized, but less effectively than GA12, giving mainly GA44 with low yields of GA19 and GA20. Ps074 hybridized to polyadenylated RNA from expanding shoots of pea. Amounts of this transcript were less in the slender genotype than in the tall line and were reduced in GA-deficient genotypes by treatment with GA3, suggesting that there is feed-back regulation of GA 20-oxidase gene expression.
Recent advances in Parkinson's disease therapy: use of monoamine oxidase inhibitors.
Henchcliffe, Claire; Schumacher, H Christian; Burgut, F Tuna
2005-11-01
Monoamine oxidase inhibitors inhibit dopamine metabolism and are therefore effective in treating Parkinson's disease, a condition associated with progressive striatal dopamine deficiency secondary to degeneration of dopaminergic neurons in the substantia nigra. Selegiline is currently the most widely used monoamine oxidase-B inhibitor for Parkinson's disease, but has a low and variable bioavailability, and is metabolized to L-methamphetamine and L-amphetamine that carry a risk for potential neurotoxicity. There are two new approaches that circumvent these potential disadvantages. First, selegiline orally disintegrating tablets provide a novel delivery form of selegiline, avoiding first pass metabolism by rapid absorption through the oral mucosa, thus leading to significantly lower plasma concentrations of L-metamphetamine and L-amphetamine. Selegiline orally disintegrating tablets prove to be clinically effective and safe in patients with moderately advanced Parkinson's disease. Second, rasagiline is a new monoamine oxidase inhibitor, without known neurotoxic metabolites. In large clinical trials, rasagiline proves effective as monotherapy in early Parkinson's disease, as well as adjunctive therapy to levodopa in advanced disease. Clinical data suggest, in addition, a disease-modifying effect of rasagiline that may correlate with neuroprotective activity of monoamine oxidase-B inhibitors in animal models of Parkinson's disease.
Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho
2014-01-01
Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465
Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na
2018-03-16
Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.
Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo
2006-01-01
The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.
Zhang, Jianzhi; Li, Xi
2018-01-01
To enhance the efficiency of phenyllactic acid (PLA) production from L-phenylalanine (L-Phe) by introducing a novel artificial pathway into Escherichia coli RESULTS: The production of PLA from L-Phe by recombinant E. coli (ldh-lpox) coexpressing L-phenylalanine oxidase and L-lactate dehydrogenase was studied. The new PLA synthesis pathway was confirmed to be efficient in recombinant E. coli. Subsequently, two different biocatalyst processes were carried out and optimized for PLA production. In the whole cell biosynthesis process at high cell density using collected recombinant cells as catalyst, at optimal conditions (L-Phe 6 g/l, pH 7.5, 35 °C, CDW 24.5 g/l and 200 rpm), the recombinant E. coli (ldh-lpox) produced 1.62 g PLA/l with a conversion of 28% from L-Phe. Similarly, during the two-temperature-stage fermentation process in flasks using IPTG-induced cells, the temperature in the second stage was increased to 35 °C to benefit the biocatalyst process, and comparable phenyllactic acid production of 1.47 g/l was obtained from 12 g L-Phe/l. Recombinant E. coli (ldh-lpox) was efficient in PLA production realizing a high titer of several folds compared with studies using L-Phe as substrate.
Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan
2015-04-01
Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.
Purification and characterization of polyphenol oxidase from banana (Musa sapientum L.) pulp.
Yang, C P; Fujita, S; Ashrafuzzaman, M; Nakamura, N; Hayashi, N
2000-07-01
Polyphenol oxidase (EC 1.10.3.1, PPO) in the pulp of banana (Musa sapientum L.) was purified to 636-fold with a recovery of 3.0%, using dopamine as substrate. The purified enzyme exhibited a clear single band on polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS)-PAGE. The molecular weight of the enzyme was estimated to be about 41000 and 42000 by gel filtration and SDS-PAGE, respectively. The enzyme quickly oxidized dopamine, and its K(m) value for dopamine was 2.8 mM. The optimum pH was at 6.5, and the enzyme activity was stable in the range of pH 5-11 at 5 degrees C for 48 h. The enzyme had an optimum temperature of 30 degrees C and was stable even after a heat treatment at 70 degrees C for 30 min. The enzyme activity was completely inhibited by L-ascorbic acid, cysteine, sodium diethyldithiocarbamate, and potassium cyanide. Under a low buffer capacity, the enzyme was also strongly inhibited by citric acid and acetic acid at 10 mM.
Recovery of choline oxidase activity by in vitro recombination of individual segments.
Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T
2008-11-01
Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.
Liu, Lei
2012-01-01
Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.
2010-01-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Alós, Enriqueta; Rodrigo, María J; Zacarías, Lorenzo
2013-06-01
Sweet pepper (Capsicum annuum L.) is widely recognized among the vegetables with high content of ascorbic acid (AsA). However, the metabolic pathways involved in the biosynthesis, recycling and degradation of AsA and their relative contribution to the concentration of AsA have not been established yet. In the present work, the expression levels of selected genes involved in the AsA biosynthesis, degradation and recycling pathways were analyzed during development and ripening of pepper fruit cv. Palermo and in mature fruit of four cultivars (Lipari, C-116, Surrentino and Italverde) with different AsA concentrations. An inverse correlation was found between the expression of the biosynthetic genes and AsA concentrations, which could indicate that a feedback mechanism regulates AsA homeostasis in pepper fruits. Interestingly, analysis of mRNA levels of ascorbate oxidase, involved in the degradation of AsA, suggests that this enzyme plays a critical role in the regulation of the AsA pool during fruit development and ripening. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan
2017-01-15
In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.
Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying
2017-02-01
Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Genetics Home Reference: isolated sulfite oxidase deficiency
... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...
A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong
2014-01-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425
Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.
Clary, D O; Wolstenholme, D R
1983-01-01
Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo
2016-04-15
The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.
Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu
2014-01-01
POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.
Exploiting algal NADPH oxidase for biophotovoltaic energy
Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...
2015-01-29
Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1
Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.
2001-01-01
It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345
Y Chromosome Regulation of Autism Susceptibility Genes
2009-06-01
with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved
Todaro, Aldo; Peluso, Orazio; Catalano, Anna Eghle; Mauromicale, Giovanni; Spagna, Giovanni
2010-02-10
Several papers helped with the development of more methods to control browning, or study thermal polyphenol oxidase (PPO) inactivation, but did not provide any solutions to technological process problems and food process improvement. Artichokes [ Cynara cardunculus L. var. scolymus L. (Fiori)] are susceptible to browning; this alteration could affect and reduce the suitability for its use, fresh or processed. Within this study, the catecholase and cresolase activities of PPO from three different Sicilian artichokes cultivar were characterized with regard to substrate specificity and enzyme kinetics, optimum pH and temperature, temperature and pH stability, and inhibitor test; all of the results were used for technological purposes, particularly to optimize minimally processed productions (ready-to-eat and cook-chilled artichokes).
Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu
2013-01-01
Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H2O2 content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses. PMID:23326325
Lu, Yao; Li, Yajun; Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu
2013-01-01
Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H(2)O(2) content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses.
A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping
2014-09-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
The monoamine oxidase A gene promoter repeat and prostate cancer risk.
White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S
2012-11-01
Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292
Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans
1998-01-01
Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension
FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.
2010-01-01
Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...
Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa
2012-12-30
The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Identification of NADPH oxidase family members associated with cold stress in strawberry.
Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru
2018-04-01
NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.
Hiraka, Kentaro; Kojima, Katsuhiro; Lin, Chi-En; Tsugawa, Wakako; Asano, Ryutaro; La Belle, Jeffrey T; Sode, Koji
2018-04-30
l-lactate biosensors employing l-lactate oxidase (LOx) have been developed mainly to measure l-lactate concentration for clinical diagnostics, sports medicine, and the food industry. Some l-lactate biosensors employ artificial electron mediators, but these can negatively impact the detection of l-lactate by competing with the primary electron acceptor: molecular oxygen. In this paper, a strategic approach to engineering an AvLOx that minimizes the effects of oxygen interference on sensor strips was reported. First, we predicted an oxygen access pathway in Aerococcus viridans LOx (AvLOx) based on its crystal structure. This was subsequently blocked by a bulky amino acid substitution. The resulting Ala96Leu mutant showed a drastic reduction in oxidase activity using molecular oxygen as the electron acceptor and a small increase in dehydrogenase activity employing an artificial electron acceptor. Secondly, the Ala96Leu mutant was immobilized on a screen-printed carbon electrode using glutaraldehyde cross-linking method. Amperometric analysis was performed with potassium ferricyanide as an electron mediator under argon or atmospheric conditions. Under argon condition, the response current increased linearly from 0.05 to 0.5mM l-lactate for both wild-type and Ala96Leu. However, under atmospheric conditions, the response of wild-type AvLOx electrode was suppressed by 9-12% due to oxygen interference. The Ala96Leu mutant maintained 56-69% of the response current at the same l-lactate level and minimized the relative bias error to -19% from -49% of wild-type. This study provided significant insight into the enzymatic reaction mechanism of AvLOx and presented a novel approach to minimize oxygen interference in sensor applications, which will enable accurate detection of l-lactate concentrations. Copyright © 2017 Elsevier B.V. All rights reserved.
Basanta, Antonio; Gómez-Sala, Beatriz; Sánchez, Jorge; Diep, Dzung B.; Herranz, Carmen; Hernández, Pablo E.; Cintas, Luis M.
2010-01-01
In this work, we report the expression and secretion of the leaderless two-peptide (EntL50A and EntL50B) bacteriocin enterocin L50 from Enterococcus faecium L50 by the methylotrophic yeast Pichia pastoris X-33. The bacteriocin structural genes entL50A and entL50B were fused to the Saccharomyces cerevisiae gene region encoding the mating pheromone α-factor 1 secretion signal (MFα1s) and cloned, separately and together (entL50AB), into the P. pastoris expression and secretion vector pPICZαA, which contains the methanol-inducible alcohol oxidase promoter (PAOX1) to express the fusion genes. After transfer into the yeast, the recombinant plasmids were integrated into the genome, resulting in three bacteriocinogenic yeast strains able to produce and secrete the individual bacteriocin peptides EntL50A and EntL50B separately and together. The secretion was efficiently directed by MFα1s through the Sec system, and the precursor peptides were found to be correctly processed to form mature and active bacteriocin peptides. The present work describes for the first time the heterologous expression and secretion of a two-peptide non-pediocin-like bacteriocin by a yeast. PMID:20348300
Yang, C P; Fujita, S; Kohno, K; Kusubayashi, A; Ashrafuzzaman, M; Hayashi, N
2001-03-01
Polyphenol oxidase (EC 1.10.3.1, o-diphenol: oxygen oxidoreductase, PPO) of banana (Musa sapientum L.) peel was partially purified about 460-fold with a recovery of 2.2% using dopamine as substrate. The enzyme showed a single peak on Toyopearl HW55-S chromatography. However, two bands were detected by staining with Coomassie brilliant blue on PAGE: one was very clear, and the other was faint. Molecular weight for purified PPO was estimated to be about 41 000 by gel filtration. The enzyme quickly oxidized dopamine, and its Km value (Michaelis constant) for dopamine was 3.9 mM. Optimum pH was 6.5 and the PPO activity was quite stable in the range of pH 5-11 for 48 h. The enzyme had an optimum temperature at 30 degrees C and was stable up to 60 degrees C after heat treatment for 30 min. The enzyme activity was strongly inhibited by sodium diethyldithiocarbamate, potassium cyanide, L-ascorbic acid, and cysteine at 1 mM. Under a low buffer capacity, the enzyme was also strongly inhibited by citric acid and acetic acid at 10 mM.
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
MipLAAO, a new L-amino acid oxidase from the redtail coral snake Micrurus mipartitus
2018-01-01
L-amino acid oxidases (LAAOs) are ubiquitous enzymes in nature. Bioactivities described for these enzymes include apoptosis induction, edema formation, induction or inhibition of platelet aggregation, as well as antiviral, antiparasite, and antibacterial actions. With over 80 species, Micrurus snakes are the representatives of the Elapidae family in the New World. Although LAAOs in Micrurus venoms have been predicted by venom gland transcriptomic studies and detected in proteomic studies, no enzymes of this kind have been previously purified from their venoms. Earlier proteomic studies revealed that the venom of M. mipartitus from Colombia contains ∼4% of LAAO. This enzyme, here named MipLAAO, was isolated and biochemically and functionally characterized. The enzyme is found in monomeric form, with an isotope-averaged molecular mass of 59,100.6 Da, as determined by MALDI-TOF. Its oxidase activity shows substrate preference for hydrophobic amino acids, being optimal at pH 8.0. By nucleotide sequencing of venom gland cDNA of mRNA transcripts obtained from a single snake, six isoforms of MipLAAO with minor variations among them were retrieved. The deduced sequences present a mature chain of 483 amino acids, with a predicted pI of 8.9, and theoretical masses between 55,010.9 and 55,121.0 Da. The difference with experimentally observed mass is likely due to glycosylation, in agreement with the finding of three putative N-glycosylation sites in its amino acid sequence. A phylogenetic analysis of MmipLAAO placed this new enzyme within the clade of homologous proteins from elapid snakes, characterized by the conserved Serine at position 223, in contrast to LAAOs from viperids. MmipLAAO showed a potent bactericidal effect on S. aureus (MIC: 2 µg/mL), but not on E. coli. The former activity could be of interest to future studies assessing its potential as antimicrobial agent. PMID:29900074
MipLAAO, a new L-amino acid oxidase from the redtail coral snake Micrurus mipartitus.
Rey-Suárez, Paola; Acosta, Cristian; Torres, Uday; Saldarriaga-Córdoba, Mónica; Lomonte, Bruno; Núñez, Vitelbina
2018-01-01
L-amino acid oxidases (LAAOs) are ubiquitous enzymes in nature. Bioactivities described for these enzymes include apoptosis induction, edema formation, induction or inhibition of platelet aggregation, as well as antiviral, antiparasite, and antibacterial actions. With over 80 species, Micrurus snakes are the representatives of the Elapidae family in the New World. Although LAAOs in Micrurus venoms have been predicted by venom gland transcriptomic studies and detected in proteomic studies, no enzymes of this kind have been previously purified from their venoms. Earlier proteomic studies revealed that the venom of M. mipartitus from Colombia contains ∼4% of LAAO. This enzyme, here named MipLAAO, was isolated and biochemically and functionally characterized. The enzyme is found in monomeric form, with an isotope-averaged molecular mass of 59,100.6 Da, as determined by MALDI-TOF. Its oxidase activity shows substrate preference for hydrophobic amino acids, being optimal at pH 8.0. By nucleotide sequencing of venom gland cDNA of mRNA transcripts obtained from a single snake, six isoforms of MipLAAO with minor variations among them were retrieved. The deduced sequences present a mature chain of 483 amino acids, with a predicted pI of 8.9, and theoretical masses between 55,010.9 and 55,121.0 Da. The difference with experimentally observed mass is likely due to glycosylation, in agreement with the finding of three putative N-glycosylation sites in its amino acid sequence. A phylogenetic analysis of MmipLAAO placed this new enzyme within the clade of homologous proteins from elapid snakes, characterized by the conserved Serine at position 223, in contrast to LAAOs from viperids. MmipLAAO showed a potent bactericidal effect on S. aureus (MIC: 2 µg/mL), but not on E. coli . The former activity could be of interest to future studies assessing its potential as antimicrobial agent.
Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brunner, H.G.; Nelen, M.; Ropers, H.H.
1993-10-22
Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less
Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo
2017-06-05
Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.
Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.
Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T
2001-06-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.
Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori
Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo
2001-01-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170
Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu
2015-02-01
To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.
Kinetic mechanism of L-α-glycerophosphate oxidase from Mycoplasma pneumoniae.
Maenpuen, Somchart; Watthaisong, Pratchaya; Supon, Pacharee; Sucharitakul, Jeerus; Parsonage, Derek; Karplus, P Andrew; Claiborne, Al; Chaiyen, Pimchai
2015-08-01
L-α-glycerophosphate oxidase is an FAD-dependent enzyme that catalyzes the oxidation of L-α-glycerophosphate (Glp) by molecular oxygen to generate dihydroxyacetone phosphate (DHAP) and hydrogen peroxide (H2O2). The catalytic properties of recombinant His6-GlpO from Mycoplasma pneumoniae (His6-MpGlpO) were investigated through transient and steady-state kinetics and ligand binding studies. The results indicate that the reaction mechanism of His6-MpGlpO follows a ping-pong model. Double-mixing mode stopped-flow experiments show that, after flavin-mediated substrate oxidation, DHAP leaves rapidly prior to the oxygen reaction. The values determined for the individual rate constants and kcat (4.2 s(-1) at 4 °C), in addition to the finding that H2 O2 binds to the oxidized enzyme, suggest that H2O2 release is the rate-limiting step for the overall reaction. The results indicate that His6 -MpGlpO contains mixed populations of fast- and slow-reacting species. It is predominantly the fast-reacting species that participates in turnover. In contrast to other GlpO enzymes previously described, His6-MpGlpO is able to catalyze the reverse reaction of reduced enzyme and DHAP. This result may be explained by the standard reduction potential value of His6-MpGlpO (-167 ± 1 mV), which is lower than those of GlpO from other species. We found that D,L-glyceraldehyde 3-phosphate (GAP) may be used as a substrate in the His6-MpGlpO reaction, although it exhibited an approximately 100-fold lower kcat value in comparison with the reaction of Glp. These results also imply involvement of GlpO in glycolysis, as well as in lipid and glycerol metabolism. The kinetic models and distinctive properties of His6-MpGlpO reported here should be useful for future drug development against Mycoplasma pneumoniae infection. © 2015 FEBS.
Marles, M A Susan; Vandenberg, Albert; Bett, Kirstin E
2008-08-27
Postharvest darkening of pinto bean (Phaseolus vulgaris L.) was evaluated in a population of recombinant inbred lines derived from a cross between CDC Pintium (a regular-darkening line) and 1533-15 (a slow-darkening line). Flavonoid metabolite concentrations, polyphenol oxidase activity, lignin concentration, and seed coat anatomy characteristics were assessed for cosegregation with the darkening phenotype. Significantly lower kaempferol concentrations (p = 0.00001) together with differences in polyphenol oxidase activity (p = 0.0045) were two of the key findings associated with these recombinant inbred lines. In addition, two different assays (thioglycolic acid and Klason lignin) to quantify lignin together with an assessment of extractable condensed tannin were used to estimate the contribution of these polymers to changes in the seed coat tissue. This is the first report of precise biochemical characterization of polyphenolics that associate with postharvest darkening in legumes.
El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M; El-Ewasy, Sara M
2016-09-20
Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis strain NEAE-42. The optimization of different process parameters for cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 using Plackett-Burman experimental design and response surface methodology was carried out. Fifteen variables were screened using Plackett-Burman experimental design. Cholesterol, initial pH and (NH4)2SO4 were the most significant positive independent variables affecting cholesterol oxidase production. Central composite design was chosen to elucidate the optimal concentrations of the selected process variables on cholesterol oxidase production. It was found that, cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 after optimization process was 20.521U/mL which is higher than result obtained from the basal medium before screening process using Plackett-Burman (3.31 U/mL) with a fold of increase 6.19. The cholesterol oxidase level production obtained in this study (20.521U/mL) by the statistical method is higher than many of the reported values.
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda
2017-01-01
Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251
Fox, M A; Panessiti, M G; Moya, P R; Tolliver, T J; Chen, K; Shih, J C; Murphy, D L
2013-12-01
A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ∼2.6-3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ∼4.5-6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes.
Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL
2012-01-01
A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922
González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.
2004-01-01
The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034
Wang, Wei; Liu, Ji-Hong
2015-01-25
Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.
FUN-L: gene prioritization for RNAi screens.
Lees, Jonathan G; Hériché, Jean-Karim; Morilla, Ian; Fernández, José M; Adler, Priit; Krallinger, Martin; Vilo, Jaak; Valencia, Alfonso; Ellenberg, Jan; Ranea, Juan A; Orengo, Christine
2015-06-15
Most biological processes remain only partially characterized with many components still to be identified. Given that a whole genome can usually not be tested in a functional assay, identifying the genes most likely to be of interest is of critical importance to avoid wasting resources. Given a set of known functionally related genes and using a state-of-the-art approach to data integration and mining, our Functional Lists (FUN-L) method provides a ranked list of candidate genes for testing. Validation of predictions from FUN-L with independent RNAi screens confirms that FUN-L-produced lists are enriched in genes with the expected phenotypes. In this article, we describe a website front end to FUN-L. The website is freely available to use at http://funl.org © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys
Peck, Ammon B.; Khan, Saeed R.
2013-01-01
A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917
CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity
Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin
2013-01-01
Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a
QCD on the BlueGene/L Supercomputer
NASA Astrophysics Data System (ADS)
Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.
2005-03-01
In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo
2016-01-01
Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247
Haritos, V S; Dojchinov, G
2003-10-01
Volatile alkyl formates are potential replacements for the ozone-depleting fumigant, methyl bromide, as postharvest insecticides and here we have investigated their mode of insecticidal action. Firstly, a range of alkyl esters, ethanol and formic acid were tested in mortality bioassays with adults of the rice weevil, Sitophilus oryzae (L.) and the grain borer, Rhyzopertha dominica (F.) to determine whether the intact ester or one of its components was the toxic moiety. Volatile alkyl formates and formic acid caused similar levels of mortality (LC(50) 131-165 micromol l(-1)) to S. oryzae and were more potent than non-formate containing alkyl esters and ethanol (LC(50)>275 micromol l(-1)). The order of potency was the same in R. dominica. Ethyl formate was rapidly metabolised in vitro to formic acid when incubated with insect homogenates, presumably through the action of esterases. S. oryzae and R. dominica fumigated with a lethal dose of ethyl formate had eight and 17-fold higher concentrations of formic acid, respectively, in their bodies than untreated controls. When tested against isolated mitochondria from S. oryzae, alkyl esters, alcohols, acetate and propionate salts were not inhibitory towards cytochrome c oxidase (EC 1.9.3.1), but sodium cyanide and sodium formate were inhibitory with IC(50) values of 0.0015 mM and 59 mM, respectively. Volatile formate esters were more toxic than other alkyl esters, and this was found to be due, at least in part, to their hydrolysis to formic acid and its inhibition of cytochrome c oxidase.
Vanlerberghe, G C; McIntosh, L
1992-09-01
Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30 degrees C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18 degrees C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30 degrees C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18 degrees C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein.
Characterization of a Mobile clpL Gene from Lactobacillus rhamnosus
Suokko, Aki; Savijoki, Kirsi; Malinen, Erja; Palva, Airi; Varmanen, Pekka
2005-01-01
Two genes encoding ClpL ATPase proteins were identified in a probiotic Lactobacillus rhamnosus strain, E-97800. Sequence analyses revealed that the genes, designated clpL1 and clpL2, share 80% identity. The clpL2 gene showed the highest degree of identity (98.5%) to a clpL gene from Lactobacillus plantarum WCFSI, while it was not detected in three other L. rhamnosus strains studied. According to Northern analyses, the expression of clpL1 and the clpL2 were induced during heat shock by >20- and 3-fold, respectively. The functional promoter regions were determined by primer extension analyses, and the clpL1 promoter was found to be overlapped by an inverted repeat structure identical to the conserved CIRCE element, indicating that clpL1 belongs to the HrcA regulon in L. rhamnosus. No consensus binding sites for HrcA or CtsR could be identified in the clpL2 promoter region. Interestingly, the clpL2 gene was found to be surrounded by truncated transposase genes and flanked by inverted repeat structures nearly identical to the terminal repeats of the ISLpl1 from L. plantarum HN38. Furthermore, clpL2 was shown to be mobilized during prolonged cultivation at elevated temperature. The presence of a gene almost identical to clpL2 in L. plantarum and its absence in other L. rhamnosus strains suggest that the L. rhamnosus E-97800 has acquired the clpL2 gene via horizontal transfer. No change in the stress tolerance of the ClpL2-deficient derivative of E-97800 compared to the parental strain was observed. PMID:15812039
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.
Elanchezhian, R; Sakthivel, M; Geraldine, P; Thomas, P A
2010-03-30
Differential expression of apoptotic genes has been demonstrated in selenite-induced cataract. Acetyl-l-carnitine (ALCAR) has been shown to prevent selenite cataractogenesis by maintaining lenticular antioxidant enzyme and redox system components at near normal levels and also by inhibiting lenticular calpain activity. The aim of the present experiment was to investigate the possibility that ALCAR also prevents selenite-induced cataractogenesis by regulating the expression of antioxidant (catalase) and apoptotic [caspase-3, early growth response protein-1 (EGR-1) and cytochrome c oxidase subunit I (COX-I)] genes. The experiment was conducted on 9-day-old Wistar rat pups, which were divided into normal, cataract-untreated and cataract-treated groups. Putative changes in gene expression in whole lenses removed from the rats were determined by measuring mRNA transcript levels of the four genes by RT-PCR analysis, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The expression of lenticular caspase-3 and EGR-1 genes appeared to be upregulated, as inferred by detecting increased mRNA transcript levels, while that of COX-I and catalase genes appeared to be downregulated (lowered mRNA transcript levels) in the lenses of cataract-untreated rats. However, in rats treated with ALCAR, the lenticular mRNA transcript levels were maintained at near normal (control) levels. These results suggest that ALCAR may prevent selenite-induced cataractogenesis by preventing abnormal expression of lenticular genes governing apoptosis.
Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro
2010-11-01
Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.
Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.
2008-01-01
Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.
Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela
2014-01-01
Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.
Characterization and purification of polyphenol oxidase from artichoke (Cynara scolymus L.).
Dogan, Serap; Turan, Yusuf; Ertürk, Hatibe; Arslan, Oktay
2005-02-09
In this study, the polyphenol oxidase (PPO) of artichoke (Cynara scolymus L.) was first purified by a combination of (NH(4))(2)SO(4) precipitation, dialysis, and a Sepharose 4B-L-tyrosine-p-aminobenzoic acid affinity column. At the end of purification, 43-fold purification was achieved. The purified enzyme migrated as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Polyacrylamide gel electrophoresis indicated that PPO had a 57 kDa molecular mass. Second, the contents of total phenolic and protein of artichoke head extracts were determined. The total phenolic content of artichoke head was determined spectrophotometrically according to the Folin-Ciocalteu procedure and was found to be 425 mg 100 g(-1) on a fresh weight basis. Protein content was determined according to Bradford method. Third, the effects of substrate specificity, pH, temperature, and heat inactivation were investigated on the activity of PPO purified from artichoke. The enzyme showed activity to 4-methylcatechol, pyrogallol, catechol, and L-dopa. No activity was detected toward L-tyrosine, resorsinol, and p-cresol. According to V(max)/K(m) values, 4-methylcatechol (1393 EU min(-1) mM(-1)) was the best substrate, followed by pyrogallol (1220 EU min(-1) mM(-1)), catechol (697 EU min(-1) mM(-1)), and L-dopa (102 EU min(-1) mM(-1)). The optimum pH values for PPO were 5.0, 8.0, and 7.0 using 4-methylcatechol, pyrogallol, and catechol as substrate, respectively. It was found that optimum temperatures were dependent on the substrates studied. The enzyme activity decreased due to heat denaturation of the enzyme with increasing temperature and inactivation time for 4-methylcatechol and pyrogallol substrates. However, all inactivation experiments for catechol showed that the activity of artichoke PPO increased with mild heating, reached a maximum, and then decreased with time. Finally, inhibition of artichoke PPO was investigated with inhibitors such as L-cysteine, EDTA, ascorbic
Barak, S; Nejidat, A; Heimer, Y; Volokita, M
2001-03-01
The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.
Buades-Rotger, Macià; Gallardo-Pujol, David
2014-01-01
Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607
Zhou, Ning; Zhao, Chuntian
2013-01-01
L-amino acid oxidase (LAAO) is attracting increasing attention due to its important functions. Diverse detection methods with their own properties have been developed for characterization of LAAO. In the present study, a simple, rapid, sensitive, cost-effective and reproducible method for quantitative in-gel determination of LAAO activity based on the visualization of Prussian blue-forming reaction is described. Coupled with SDS-PAGE, this Prussian blue agar assay can be directly used to determine the numbers and approximate molecular weights of LAAO in one step, allowing straightforward application for purification and sequence identification of LAAO from diverse samples. PMID:23383337
Yadu, Bhumika; Chandrakar, Vibhuti; Korram, Jyoti; Satnami, Manmohan L; Kumar, Meetul; S, Keshavkant
2018-07-05
Application of engineered nanomaterials has increased these days due to their beneficial impacts on several sectors of the economy, including agriculture. Silver nanoparticles (AgNP) are commonly used to improve rate of seed germination, and growth and development of plants. The present study was aimed to monitor the role of engineered AgNP (non-dialysed) in the amelioration of fluoride (F)-induced oxidative injuries in Cajanus cajan L. Experimental results revealed that F-exposure inhibited growth and membrane stability index, while were enhanced with the augmentation of AgNP. The results also demonstrated that F treatment enhanced the accumulations of reactive oxygen species, malondialdehyde and oxidized glutathione, gene expression of NADPH oxidase, and activity of lipoxygenase, but were decreased by the addition of AgNP. The results indicated that exogenous application of AgNP provided tolerance against F-toxicity via enhancing the levels of proline, total and reduced glutathione, glyoxalase I and II activities, and expression of pyrroline-5-carboxylate synthetase gene. Conducted study uniquely suggested potential role of AgNP in the remediation of F-toxicity, at least in the Cajanus cajan L. radicles. Further research would be intended to unravel the molecular mechanism(s) involved precisely in the AgNP mediated alleviation of F-toxicity. Copyright © 2018 Elsevier B.V. All rights reserved.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Kurzik-Dumke, U; Kaymer, M; Gundacker, D; Debes, A; Labitzke, K
1997-10-24
In this paper, we describe the structure and temporal expression pattern of the Drosophila melanogaster genes l(2)not and l(2)rot located at locus 59F5 vis à vis the tumor suppressor gene l(2)tid described previously and exhibiting a gene within gene configuration. The l(2)not protein coding region, 1530 nt, is divided into two exons by an intron, 2645 nt, harboring the genes l(2)rot, co-transcribed from the same DNA strand, and l(2)tid, co-transcribed from the opposite DNA strand, located vis à vis. To determine proteins encoded by the genes described in this study polyclonal rabbit antibodies (Ab), anti-Not and anti-Rot, were generated. Immunostaining of developmental Western blots with the anti-Not Ab resulted in the identification of a 45-kDa protein, Not45, which is smaller than the Not56 protein predicted from the sequence. Its localization in endoplasmic reticulum (ER) was established by immunoelectron microscopy of Drosophila melanogaster Schneider 2 cells. Not45 shows significant homology to yeast ALG3 protein acting as a dolichol mannosyltransferase in the asparagine-linked glycosylation. It is synthesized ubiquitously throughout embryonic life. The protein predicted from the l(2)rot sequence, Rot57, shows a homology to the NS2B protein of the yellow fever virus1 (yefv1). The results of l(2)rot RNA analysis by developmental Northern blot and by in situ RNA localization, as well as the results of the protein analysis via Western blot and immunohistochemistry suggest that l(2)rot is transcribed but not translated. Since RNAs encoded by the genes l(2)tid and l(2)rot are complementary and l(2)rot is presumably not translated we performed preliminary experiments on the function of the l(2)rot RNA as a natural antisense RNA (asRNA) regulator of l(2)tid expression, expressed in the same temporal and spatial manner as the l(2)tid- and l(2)not RNA. l(2)tid knock-out by antisense RNA yielded late embryonic lethality resulting from multiple morphogenetic defects.
Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza
2011-01-01
Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.
Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui
2016-01-10
Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.
Kita, K; Konishi, K; Anraku, Y
1986-01-01
Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.
Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.
1999-01-01
Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819
Antiproliferative activity of king cobra (Ophiophagus hannah) venom L-amino acid oxidase.
Li Lee, Mui; Chung, Ivy; Yee Fung, Shin; Kanthimathi, M S; Hong Tan, Nget
2014-04-01
King cobra (Ophiophagus hannah) venom L-amino acid oxidase (LAAO), a heat-stable enzyme, is an extremely potent antiproliferative agent against cancer cells when compared with LAAO isolated from other snake venoms. King cobra venom LAAO was shown to exhibit very strong antiproliferative activities against MCF-7 (human breast adenocarcinoma) and A549 (human lung adenocarcinoma) cells, with an IC50 value of 0.04±0.00 and 0.05±0.00 μg/mL, respectively, after 72-hr treatment. In comparison, its cytotoxicity was about 3-4 times lower when tested against human non-tumourigenic breast (184B5) and lung (NL 20) cells, suggesting selective antitumour activity. Furthermore, its potency in MCF-7 and A549 cell lines was greater than the effects of doxorubicin, a clinically established cancer chemotherapeutic agent, which showed an IC50 value of 0.18±0.03 and 0.63±0.21 μg/mL, respectively, against the two cell lines. The selective cytotoxic action of the LAAO was confirmed by phycoerythrin (PE) annexin V/7-amino-actinomycin (AAD) apoptotic assay, in which a significant increase in apoptotic cells was observed in LAAO-treated tumour cells than in their non-tumourigenic counterparts. The ability of LAAO to induce apoptosis in tumour cells was further demonstrated using caspase-3/7 and DNA fragmentation assays. We also determined that this enzyme may target oxidative stress in its killing of tumour cells, as its cytotoxicity was significantly reduced in the presence of catalase (a H2O2 scavenger). In view of its heat stability and selective and potent cytotoxic action on cancer cells, king cobra venom LAAO can be potentially developed for treating solid tumours. © 2013 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing
2012-01-01
cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052
Du, Siqi; Wang, Yadi; Weatherly, Choyce A; Holden, Kylie; Armstrong, Daniel W
2018-05-01
D-amino acids are now recognized to be widely present in organisms and play essential roles in biological processes. Some D-amino acids are metabolized by D-amino acid oxidase (DAO), while D-Asp and D-Glu are metabolized by D-aspartate oxidase (DDO). In this study, levels of 22 amino acids and the enantiomeric compositions of the 19 chiral proteogenic entities have been determined in the whole brain of wild-type ddY mice (ddY/DAO +/+ ), mutant mice lacking DAO activity (ddY/DAO -/- ), and the heterozygous mice (ddY/DAO +/- ) using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). No significant differences were observed for L-amino acid levels among the three strains except for L-Trp which was markedly elevated in the DAO +/- and DAO -/- mice. The question arises as to whether this is an unknown effect of DAO inactivity. The three highest levels of L-amino acids were L-Glu, L-Asp, and L-Gln in all the three strains. The lowest L-amino acid level was L-Cys in ddY/DAO +/- and ddY/DAO -/- mice, while L-Trp showed the lowest level in ddY/DAO +/+ mice. The highest concentration of D-amino acid was found to be D-Ser, which also had the highest % D value (~ 25%). D-Glu had the lowest % D value (~ 0.01%) in all the three strains. Significant differences of D-Leu, D-Ala, D-Ser, D-Arg, and D-Ile were observed in ddY/DAO +/- and ddY/DAO -/- mice compared to ddY/DAO +/+ mice. This work provides the most complete baseline analysis of L- and D-amino acids in the brains of ddY/DAO +/+ , ddY/DAO +/- , and ddY/DAO -/- mice yet reported. It also provides the most effective and efficient analytical approach for measuring these analytes in biological samples. This study provides fundamental information on the role of DAO in the brain and may be relevant for future development involving novel drugs for DAO regulation.
Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia
2001-01-01
Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688
Vanlerberghe, Greg C.; McIntosh, Lee
1992-01-01
Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30°C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18°C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30°C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18°C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein. Images Figure 3 Figure 4 PMID:16652932
Santos Macedo, E; Sircar, D; Cardoso, H G; Peixe, A; Arnholdt-Schmitt, B
2012-09-01
Alternative oxidase (AOX) has been proposed as a functional marker candidate in a number of events involving cell differentiation, including rooting efficiency in semi-hardwood shoot cuttings of olive (Olea europaea L.). To ascertain the general importance of AOX in olive rooting, the auxin-induced rooting process was studied in an in vitro system for microshoot propagation. Inhibition of AOX by salicylhydroxamic acid (SHAM) significantly reduced rooting efficiency. However, the inhibitor failed to exhibit any effect on the preceding calli stage. This makes the system appropriate for distinguishing dedifferentiation and de novo differentiation during root induction. Metabolite analyses of microshoots showed that total phenolics, total flavonoids and lignin contents were significantly reduced upon SHAM treatment. It was concluded that the influence of alternative respiration on root formation was associated to adaptive phenylpropanoid and lignin metabolism. Transcript profiles of two olive AOX genes (OeAOX1a and OeAOX2) were examined during the process of auxin-induced root induction. Both genes displayed stable transcript accumulation in semi-quantitative RT-PCR analysis during all experimental stages. In contrary, when the reverse primer for OeAOX2 was designed from the 3'-UTR instead of the ORF, differential transcript accumulation was observed suggesting posttranscriptional regulation of OeAOX2 during metabolic acclimation. This result confirms former observations in olive semi-hardwood shoot cuttings on differential OeAOX2 expression during root induction. It further points to the importance of future studies on the functional role of sequence and length polymorphisms in the 3'-UTR of this gene. The manuscript reports the general importance of AOX in olive adventitious rooting and the association of alternative respiration to adaptive phenylpropanoid and lignin metabolism.
Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae
2010-10-01
DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.
Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band
2007-05-01
Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.
Zielonka, Jacek; Lambeth, J. David; Kalyanaraman, Balaraman
2014-01-01
L-012, a luminol-based chemiluminescent (CL) probe, is widely used in vitro and in vivo to detect NADPH oxidase (Nox)-derived superoxide (O2·−) and identify Nox inhibitors. Yet understanding of the free radical chemistry of L-012 probe is still lacking. We report that peroxidase and H2O2 induce superoxide dismutase (SOD)-sensitive, L-012-derived CL in the presence of oxygen. O2·− alone does not react with L-012 to emit luminescence. Self-generated O2·− during oxidation of L-012 and luminol-analogs artifactually induce CL inhibitable by SOD. These aspects make assays based on luminol analogs less than ideal for specific detection and identification of O2·− and NOX inhibitors. PMID:24080119
Wu, Ying-Hui; Fischer, David F; Swaab, Dick F
2007-09-05
Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.
Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N
2002-04-01
Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi
2013-06-01
Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.
Varona, Saray; García-Redondo, Ana B; Martínez-González, Jose; Salaices, Mercedes; Briones, Ana M; Rodríguez, Cristina
Lysyl oxidase (LOX) participates in the assembly of collagen and elastin fibres. The impact of vascular LOX over-expression on extracellular matrix (ECM) structure and its contribution to oxidative stress has been analysed. Studies were conducted on mice over-expressing LOX (Tg), specifically in smooth muscle cells (VSMC). Gene expression was assessed by real-time PCR analysis. Sirius Red staining, H 2 O 2 production and NADPH oxidase activity were analysed in different vascular beds. The size and number of fenestra of the internal elastic lamina were determined by confocal microscopy. LOX activity was up-regulated in VSMC of transgenic mice compared with cells from control animals. At the same time, transgenic cells deposited more organised elastin fibres and their supernatants induced a stronger collagen assembly in in vitro assays. Vascular collagen cross-linking was also higher in Tg mice, which showed a decrease in the size of fenestrae and an enhanced expression of Fibulin-5. Interestingly, higher H 2 O 2 production and NADPH oxidase activity was detected in the vascular wall from transgenic mice. The H 2 O 2 scavenger catalase attenuated the stronger deposition of mature elastin fibres induced by LOX transgenesis. LOX over-expression in VSMC was associated with a change in the structure of collagen and elastin fibres. LOX could constitute a novel source of oxidative stress that might participate in elastin changes and contribute to vascular remodelling. Copyright © 2017 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.
Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič
2018-04-23
Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.
Can, Zehra; Dincer, Barbaros; Sahin, Huseyin; Baltas, Nimet; Yildiz, Oktay; Kolayli, Sevgi
2014-12-01
In this study, firstly, antioxidant and polyphenol oxidase (PPO) properties of Yomra apple were investigated. Seventeen phenolic constituents were measured by reverse phase-high-performance liquid chromatography (RP-HPLC). Total phenolic compounds (TPCs), ferric reducing antioxidant power (FRAP) and 2, 2-diphenyl-1-picrylhydrazyl radical (DPPH) scavenging activities were performed to measure antioxidant capacity. Some kinetic parameters (Km, Vmax), and inhibition behaviors against five different substrates were measured in the crude extract. Catechin and chlorogenic acid were found as the major components in the methanolic extract, while ferulic acid, caffeic acid, p-hydroxybenzoic acid, quercetin and p-coumaric acid were small quantities. Km values ranged from 0.70 to 10.10 mM in the substrates, and also 3-(4-hydroxyphenyl) propanoic acid (HPPA) and L-DOPA showed the highest affinity. The inhibition constant of Ki were ranged from 0.05 to 14.90 mM against sodium metabisulphite, ascorbic acid, sodium azide and benzoic acid, while ascorbic acid and sodium metabisulphite were the best inhibitors.
NADPH oxidases in the arbuscular mycorrhizal symbiosis.
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.
NADPH oxidases in the arbuscular mycorrhizal symbiosis
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Bluestein, H G; Green, I; Benacerraf, B
1971-08-01
The ability of guinea pigs to make immune responses to GA, a linear random copolymer of L-glutamic acid and L-alanine, GT, a random linear copolymer of L-glutamic acid and L-tyrosine, and PLL, a linear homopolymer of L-lysine, is controlled by different autosomal dominant genes specific for each of those polymers. We have investigated the relationship between the PLL gene and the GA and GT immune response genes by simultaneously immunizing random-bred Hartley strain guinea pigs with GA and PLL, GT and PLL, or GA and GT. In most Hartley guinea pigs the ability to respond immunologically to GA and to PLL is inherited together; that is, most animals responding to GA respond to PLL and vice versa. However, a few animals respond to either GA or to PLL but not both, demonstrating that the GA and PLL immune response genes are not identical but linked in most Hartley animals. Conversely, when simultaneously immunized with GT and PLL, most Hartley guinea pigs respond to either PLL or GT but not both, indicating that GT and PLL responsiveness tends to segregate away from each other. Thus, the GT and PLL immune response genes also are not inherited independently but, rather, behave as alleles or pseudoalleles. Similar results are observed when Hartley guinea pigs are simultaneously immunized with GA and GT. The ability to respond to GA segregates away from the ability to respond to GT. Our studies demonstrated that the specific immune response genes thus far identified in guinea pigs controlling the ability to respond to GA, GT, and PLL, respectively, are found on the same chromosome. In most Hartley animals, the GA and PLL immune response genes are often linked, i.e. occur on the same chromosome strand, and tend to behave as alleles or pseudoalleles to the GT immune response gene.
Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity
NASA Astrophysics Data System (ADS)
Guo, Leilei; Huang, Kaixun; Liu, Hongmei
2016-03-01
Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na2SeO3 as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant ( K m) values and maximal reaction velocity ( V max) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.
Konaté, K; Souza, A; Coulibaly, A Y; Meda, N T R; Kiendrebeogo, M; Lamien-Meda, A; Millogo-Rasolodimby, J; Lamidi, M; Nacoulma, O G
2010-11-15
In this study polyphenol content, antioxidant activity, lipoxygenase (LOX) and Xanthine Oxidase (XO) inhibitory effects of n-hexane, dichloromethane, ethyl acetate and n-butanol fractions of aqueous acetone extracts from S. alba L., S. acuta Burn f and Cienfuegosia digitata Cav. were investigated. The total phenolics, flavonoids, flavonols and total tannins were determined by spectrophotometric methods using Folin-ciocalteu, AlCl3 reagents and tannic acid, respectively. The antioxidant potential was evaluated using three methods: inhibition of free radical 2,2-diphenyl-1-picrylhydramzyl (DPPH), ABTS radical cation decolorization assay and Iron (III) to iron (II) reduction activity (FRAP). For enzymatic activity, lipoxygenase and xanthine oxidase inhibitory activities were used. This study shows a relationship between polyphenol contents, antioxidant and enzymatic activities. Present results showed that ethyl acetate and dichloromethane fractions elicit the highest polyphenol content, antioxidant and enzymatic activities.
Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu
2016-01-01
The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723
Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia
2010-01-01
The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113
NASA Astrophysics Data System (ADS)
Karim, Abdul; Wahab, A. W.; Raya, I.; Natsir, H.; Arif, A. R.
2018-03-01
This research is aimed to utilize the diamine oxidase enzyme (DAO) which isolated from mung bean sprouts (Vigna radiata L) to develop histamine biosensors based on electode enzyme with the amperometric method (cyclic voltammetry).The DAO enzyme is trapped inside the membrane of chitin-cellulose acetate 2:1 and glutaraldehyde which super imposed on a Pt electrode. Histamine will be oxidized by DAO enzyme to produce aldehydes and H2O2 that acting as electron transfer mediators.The performance of biosensors will be measured at various concentrations of glutaraldehyde, temperature changes and different range of pH. Recently, it has been found that the optimal conditions obtained from the paramaters as follows; at 25% of glutaraldehyde, temperature of 37°C and pH of 7.4. Eventually, the results provided an expectation for applying histamine biosensors in determining the freshness and safety of fish specifically skombroidae families.
Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V
2017-12-28
Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.
Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver
2011-07-20
Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.
El-Naggar, Noura El-Ahmady; Soliman, Hoda M; El-Shweihy, Nancy M
2018-02-09
In recent years, microbial cholesterol oxidases have gained great attention due to its widespread use in medical applications for serum cholesterol determination. Streptomyces aegyptia strain NEAE-102 exhibited high level of extracellular cholesterol oxidase production using a minimum medium containing cholesterol as the sole source of carbon. Fifteen variables were screened using Plackett-Burman design for the enhanced cholesterol oxidase production. The most significant variables affecting enzyme production were further optimized by using the face-centered central composite design. The statistical optimization resulted in an overall 4.97-fold increase (15.631 UmL -1 ) in cholesterol oxidase production in the optimized medium as compared with the unoptimized medium before applying Plackett Burman design (3.1 UmL -1 ). The purified cholesterol oxidase was evaluated for its in vitro anticancer activities against five human cancer cell lines. The selectivity index values on rhabdomyosarcoma and breast cancer cell lines were 3.26 and 2.56; respectively. The in vivo anticancer activity of cholesterol oxidase was evaluated against Ehrlich solid tumor model. Compared with control mice, tumors growth was significantly inhibited in the mice injected with cholesterol oxidase alone, doxorubicin alone and cholesterol oxidase/doxorubicin combination by 60.97%, 72.99% and 97.04%; respectively. These results demonstrated that cholesterol oxidase can be used as a promising natural anticancer drug.
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Purification and characterization of polyphenol oxidase from cauliflower (Brassica oleracea L.).
Rahman, Andi Nur Faidah; Ohta, Mayumi; Nakatani, Kazuya; Hayashi, Nobuyuki; Fujita, Shuji
2012-04-11
Polyphenol oxidase (PPO) of cauliflower was purified to 282-fold with a recovery rate of 8.1%, using phloroglucinol as a substrate. The enzyme appeared as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The estimated molecular weight of the enzyme was 60 and 54 kDa by SDS-PAGE and gel filtration, respectively. The purified enzyme, called phloroglucinol oxidase (PhO), oxidized phloroglucinol (K(m) = 3.3 mM) and phloroglucinolcarboxylic acid. The enzyme also had peroxidase (POD) activity. At the final step, the activity of purified cauliflower POD was 110-fold with a recovery rate of 3.2%. The PhO and POD showed the highest activity at pH 8.0 and 4.0 and were stable in the pH range of 3.0-11.0 and 5.0-8.0 at 5 °C for 20 h, respectively. The optimum temperature was 55 °C for PhO and 20 °C for POD. The most effective inhibitor for PhO was sodium diethyldithiocarbamate at 10 mM (IC(50) = 0.64 and K(i) = 0.15 mM), and the most effective inhibitor for POD was potassium cyanide at 1.0 mM (IC(50) = 0.03 and K(i) = 29 μM).
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva; Micheli, Fabienne
2017-01-01
The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs.
Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva
2017-01-01
The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs. PMID:28459876
PiiL: visualization of DNA methylation and gene expression data in gene pathways.
Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred
2017-08-02
DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .
NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology
Ushio-Fukai, Masuko; Malik, Asrar B.
2009-01-01
Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313
Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming
2018-05-12
The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.
Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry
2015-01-01
Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Martínez-Bello, Liliam; Moritz, Thomas; López-Díaz, Isabel
2015-01-01
Gibberellins (GAs) are phytohormones that regulate a wide range of developmental processes in plants. Levels of active GAs are regulated by biosynthetic and catabolic enzymes like the GA 2-oxidases (GA2oxs). In tomato (Solanum lycopersicum L.) C19 GA2oxs are encoded by a small multigenic family of five members with some degree of redundancy. In order to investigate their roles in tomato, the silencing of all five genes in transgenic plants was induced. A significant increase in active GA4 content was found in the ovaries of transgenic plants. In addition, the transgenic unfertilized ovaries were much bigger than wild-type ovaries (about 30 times) and a certain proportion (5–37%) were able to develop parthenocarpically. Among the GA2ox family, genes GA2ox1 and -2 seem to be the most relevant for this phenotype since their expression was induced in unfertilized ovaries and repressed in developing fruits, inversely correlating with ovary growth. Interestingly, transgenic lines exhibited a significant inhibition of branching and a higher content of active GA4 in axillary buds. This phenotype was reverted, in transgenic plants, by the application of paclobutrazol, a GA biosynthesis inhibitor, suggesting a role for GAs as repressors of branching. In summary, this work demonstrates that GA 2-oxidases regulate gibberellin levels in ovaries and axillary buds of tomato plants and their silencing is responsible for parthenocarpic fruit growth and branching inhibition. PMID:26093022
Dijkman, Willem P.
2014-01-01
In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Xue, Beibei; Zhang, Aying; Jiang, Mingyi
2009-03-01
Using pharmacological and biochemical approaches, the role of maize polyamine oxidase (MPAO) in abscisic acid (ABA)-induced antioxidant defense in leaves of maize (Zea mays L.) plants was investigated. Exogenous ABA treatment enhanced the expression of the MPAO gene and the activities of apoplastic MPAO. Pretreatment with two different inhibitors for apoplastic MPAO partly reduced hydrogen peroxide (H2O2) accumulation induced by ABA and blocked the ABA-induced expression of the antioxidant genes superoxide dismutase 4 and cytosolic ascorbate peroxidase and the activities of the cytosolic antioxidant enzymes. Treatment with spermidine, the optimum substrate of MPAO, also induced the expression and the activities of the antioxidant enzymes, and the upregulation of the antioxidant enzymes was prevented by two inhibitors of MPAO and two scavengers of H2O2. These results suggest that MPAO contributes to ABA-induced cytosolic antioxidant defense through H2O2, a Spd catabolic product.
Phenol oxidase activity in secondary transformed peat-moorsh soils
NASA Astrophysics Data System (ADS)
Styła, K.; Szajdak, L.
2009-04-01
et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 μmol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 μmol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 μmol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzyńska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepański M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.
Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun
2015-01-01
Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822
Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu
2017-01-01
Jatropha curcas L. is an important biofuel plant with excellent tolerance of barren environments. However, studies on the regulatory mechanisms that operate in this plant in response to nitrogen (N) shortage are scarce. In this study, genome-wide transcriptional profiles of the roots and leaves of 8-week old physic nut seedlings were analyzed after 2 and 16 days of N starvation. Enrichment results showed that genes associated with N metabolism, processing and regulation of RNA, and transport predominated among those showing alterations in expression. Genes encoding transporter families underwent major changes in expression in both roots and leaves; in particular, those with roles in ammonia, amino acid and peptide transport were generally up-regulated after long-term starvation, while AQUAPORIN genes, whose products function in osmoregulation, were down-regulated. We also found that ASPARA−GINASE B1 and SARCOSINE OXIDASE genes were up-regulated in roots and leaves after 2 and 16 d N starvation. Genes associated with ubiquitination-mediated protein degradation were significantly up-regulated. In addition, genes in the JA biosynthesis pathway were strongly activated while expression of those in GA signaling was inhibited in leaves. We showed that four major classes of genes, those with roles in N uptake, N reutilization, C/N ratio balance, and cell structure and synthesis, were particularly influenced by long-term N limitation. Our discoveries may offer clues to the molecular mechanisms that regulate N reallocation and reutilization so as to maintain or increase plant performance even under adverse environmental conditions. PMID:28817702
Kuang, Qi; Zhang, Sheng; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-01-01
Jatropha curcas L. is an important biofuel plant with excellent tolerance of barren environments. However, studies on the regulatory mechanisms that operate in this plant in response to nitrogen (N) shortage are scarce. In this study, genome-wide transcriptional profiles of the roots and leaves of 8-week old physic nut seedlings were analyzed after 2 and 16 days of N starvation. Enrichment results showed that genes associated with N metabolism, processing and regulation of RNA, and transport predominated among those showing alterations in expression. Genes encoding transporter families underwent major changes in expression in both roots and leaves; in particular, those with roles in ammonia, amino acid and peptide transport were generally up-regulated after long-term starvation, while AQUAPORIN genes, whose products function in osmoregulation, were down-regulated. We also found that ASPARA-GINASE B1 and SARCOSINE OXIDASE genes were up-regulated in roots and leaves after 2 and 16 d N starvation. Genes associated with ubiquitination-mediated protein degradation were significantly up-regulated. In addition, genes in the JA biosynthesis pathway were strongly activated while expression of those in GA signaling was inhibited in leaves. We showed that four major classes of genes, those with roles in N uptake, N reutilization, C/N ratio balance, and cell structure and synthesis, were particularly influenced by long-term N limitation. Our discoveries may offer clues to the molecular mechanisms that regulate N reallocation and reutilization so as to maintain or increase plant performance even under adverse environmental conditions.
NADPH oxidase inhibitors: a patent review.
Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam
2011-08-01
NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.
Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei
2005-01-01
To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao
2003-06-01
To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281
Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.
Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C
2001-05-01
Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Li, Xianggan; Volrath, Sandy L.; Nicholl, David B.G.; Chilcott, Charles E.; Johnson, Marie A.; Ward, Eric R.; Law, Marcus D.
2003-01-01
In this article, we report the isolation of plant protoporphyrinogen oxidase (PPO) genes and the isolation of herbicide-tolerant mutants. Subsequently, an Arabidopsis double mutant (Y426M + S305L) was used to develop a selectable marker system for Agrobacterium tumefaciens-mediated transformation of maize (Zea mays) and to obtain multiple events tolerant to the PPO family of herbicides. Maize transformants were produced via butafenacil selection using a flexible light regime to increase selection pressure. Butafenacil selection per se did not change transgene copy number distribution relative to other selectable marker systems, but the most tolerant events identified in the greenhouse were more likely to contain multiple copies of the introduced mutant PPO gene. To date, more than 2,500 independent transgenic maize events have been produced using butafenacil selection. The high frequency of A. tumefaciens-mediated transformation via PPO selection enabled us to obtain single-copy transgenic maize lines tolerant to field levels of butafenacil. PMID:12972658
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
Munyaka, Ann Wambui; Makule, Edna Edward; Oey, Indrawati; Van Loey, Ann; Hendrickx, Marc
2010-05-01
The thermal stability of vitamin C (including l-ascorbic acid [l-AA] and dehydroascorbic acid [DHAA]) in crushed broccoli was evaluated in the temperature range of 30 to 90 degrees C whereas that of ascorbic acid oxidase (AAO) was evaluated in the temperature range of 20 to 95 degrees C. Thermal treatments (for 15 min) of crushed broccoli at 30 to 60 degrees C resulted in conversion of l-AA to DHAA whereas treatments at 70 to 90 degrees C retained vitamin C as l-AA. These observations indicated that enzymes (for example, AAO) could play a major role in the initial phase (that is, oxidation of l-AA to DHAA) of vitamin C degradation in broccoli. Consequently, a study to evaluate the temperature-time conditions that could result in AAO inactivation in broccoli was carried out. In this study, higher AAO activity was observed in broccoli florets than stalks. During thermal treatments for 10 min, AAO in broccoli florets and stalks was stable until around 50 degrees C. A 10-min thermal treatment at 80 degrees C almost completely inactivated AAO in broccoli. AAO inactivation followed 1st order kinetics in the temperature range of 55 to 65 degrees C. Based on this study, a thermal treatment above 70 degrees C is recommended for crushed vegetable products to prevent oxidation of l-AA to DHAA, the onset of vitamin C degradation. The results reported in this study are applicable for both domestic and industrial processing of vegetables into products such as juices, soups, and purees. In this report, we have demonstrated that processing crushed broccoli in a temperature range of 30 to 60 degrees C could result in the conversion of l-ascorbic acid to dehydroascorbic (DHAA), a very important reaction in regard to vitamin C degradation because DHAA could be easily converted to other compounds that do not have the biological activity of vitamin C.
Influence of Tridax procumbens on lysyl oxidase activity and wound healing.
Udupa, S L; Udupa, A L; Kulkarni, D R
1991-08-01
The effects of an indigenous drug, Tridax procumbens L. (Compositae), on developing granulation tissue in rats were studied. Subcutaneously harvested granuloma tissue formed on dead space wound was removed at 4 day intervals up to 32 days of wounding. Lysyl oxidase activity, protein content, specific activity, and breaking strength were all increased in drug-treated animals as compared to controls. A fall in the lysyl oxidase activity was observed in drug-treated animals after day 8. The drug may be having a dual role: one a stimulatory (direct) effect in the initial phase of wound healing and the other a depressant (indirect) effect in the later stage.
Francki, Michael G; Whitaker, Peta; Smith, Penelope M; Atkins, Craig A
2002-11-01
Seed triacylglycerols (TAGs) are stored as energy reserves and extracted for various end-product uses. In lupins, seed oil content varies from 16% in Lupinus mutabilisto 8% in L. angustifolius. We have shown that TAGs rapidly accumulate during mid-stages of seed development in L. mutabilis compared to the lower seed oil species, L. angustifolius. In this study, we have targeted the key enzymes of the lipid biosynthetic pathway, acetyl-CoA carboxylase (ACCase) and diacylglycerol acyltransferase (DAGAT), to determine factors regulating TAG accumulation between two lupin species. A twofold increase in ACCase activity was observed in L. mutabilis relative to L. angustifolius and correlated with rapid TAG accumulation. No difference in DAGAT activity was detected. We have identified, cloned and partially characterised a novel gene differentially expressed during TAG accumulation between L. angustifolius and L. mutabilis. The gene has some identity to the glucose dehydrogenase family previously described in barley and bacteria and the significance of its expression levels during seed development in relation to TAG accumulation is discussed. DNA sequence analysis of the promoter in both L. angustifolius and L. mutabilis identified putative matrix attachment regions and recognition sequences for transcription binding sites similar to those found in the Adh1 gene from Arabidopsis. The identical promoter regions between species indicate that differential gene expression is controlled by alternative transcription factors, accessibility to binding sites or a combination of both.
Ramiro, Daniel Alves; Guerreiro-Filho, Oliveiro; Mazzafera, Paulo
2006-09-01
We examined the role of phenolic compounds, and the enzymes peroxidase and polyphenol oxidase, in the expression of resistance of coffee plants to Leucoptera coffeella (Lepidoptera: Lyonetiidae). The concentrations of total soluble phenols and chlorogenic acid (5-caffeoylquinic acid), and the activities of the oxidative enzymes peroxidase (POD) and polyphenol oxidase (PPO), were estimated in leaves of Coffea arabica, C. racemosa, and progenies of crosses between these species, which have different levels of resistance, before and after attack by this insect. The results indicate that phenols do not play a central role in resistance to the coffee leaf miner. Differences were detected between the parental species in terms of total soluble phenol concentrations and activities of the oxidative enzymes. However, resistant and susceptible hybrid plants did not differ in any of these characteristics. Significant induction of chlorogenic acid and PPO was only found in C. racemosa, the parental donator of the resistance genes against L. coffeella. High-performance liquid chromatography (HPLC) analysis also showed qualitative similarity between hybrids and the susceptible C. arabica. These results suggest that the phenolic content and activities of POD and PPO in response to the attack by the leaf miner may not be a strong evidence of their participation in direct defensive mechanisms.
[Establishment of L-periaxin gene knock-out RSC96 cell line].
Liang, Min; Peng, Tingting; Shi, Yawei
2016-12-25
Periaxin, a protein of noncompact myelin, is specifically expressed in the peripheral nervous system (PNS). There are two protein isoform L-periaxin and S-Periaxin by alternative splicing of periaxin gene, playing an important role in the initiation of myelin formation. So far, 18 different mutation sites in L-periaxin gene have been found to induce the peripheral demyelinating neurological charcot-marie-tooth diseases subtype 4F (CMT4F). The technique of activation of transcription activator-like effector nucleases (TALENS) was used to knock out the L-periaxin gene in RSC 96 cell line of Rattus. According to the design principle, the knock-out site of L-periaxin was assured to NLS domain of L-periaxin, which is target sequence of left and right arms of TALEN. The knock-out vectors of TALEN-L and TALEN-R were established and transfected into RSC96 cell. After puromycin screening, L-periaxin was knocked out successfully in RSC96 cell, which is confirmed by DNA sequence. The mutation efficiency is 21.6%. S-periaxin, not L-periaxin can be detected by Western blotting in L-periaxin gene knock-out RSC96 cell. The cell growth rate was decreased and the number of cells in G1 increased and decreased in S phase in L-periaxin gene knock-out RSC96 cell by flow cytometry and MTT assay.
Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao
2015-01-01
Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296
Targeting NADPH oxidases in vascular pharmacology
Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J
2012-01-01
Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
Yeşiller, Gülden; Sezgintürk, Mustafa Kemal
2015-11-10
In this research, a novel enzyme activity analysis methodology is introduced as a new perspective for this area. The activity of elastase enzyme, which is a digestive enzyme mostly of found in the digestive system of vertebrates, was determined by an electrochemical device composed of carbon nanotubes and a second enzyme, glucose oxidase, which was used as a signal generator enzyme. In this novel methodology, a complex bioactive layer was constructed by using carbon nanotubes, glucose oxidase and a supporting protein, gelatin on a solid, conductive substrate. The activity of elastase was determined by monitoring the hydrolysis rate of elastase enzyme in the bioactive layer. As a result of this hydrolysis of elastase, glucose oxidase was dissociated from the bioactive layer, and following this the electrochemical signal due to glucose oxidase was decreased. The progressive elastase-catalyzed digestion of the bioactive layer containing glucose oxidase decreased the layer's enzymatic efficiency, resulting in a decrease of the glucose oxidation current as a function of the enzyme activity. The ratio of the decrease was correlated to elastase activity level. In this study, optimization experiments of bioactive components and characterization of the resulting new electrochemical device were carried out. A linear calibration range from 0.0303U/mL to 0.0729U/mL of elastase was reported. Real sample analyses were also carried out by the new electrochemical device. Copyright © 2015 Elsevier B.V. All rights reserved.
Stamen-derived bioactive gibberellin is essential for male flower development of Cucurbita maxima L.
Pimenta Lange, Maria João; Knop, Nicole; Lange, Theo
2012-01-01
Gibberellin (GA) signalling during pumpkin male flower development is highly regulated, including biosynthetic, perception, and transduction pathways. GA 20-oxidases, 3-oxidases, and 2-oxidases catalyse the final part of GA synthesis. Additionally, 7-oxidase initiates this part of the pathway in some cucurbits including Cucurbita maxima L. (pumpkin). Expression patterns for these GA-oxidase-encoding genes were examined by competitive reverse transcription-PCR (RT-PCR) and endogenous GA levels were determined during pumpkin male flower development. In young flowers, GA20ox3 transcript levels are high in stamens, followed by high levels of the GA precursor GA9. Later, just before flower opening, transcript levels for GA3ox3 and GA3ox4 increase in the hypanthium and stamens, respectively. In the stamen, following GA3ox4 expression, bioactive GA4 levels rise dramatically. Accordingly, catabolic GA2ox2 and GA2ox3 transcript levels are low in developing flowers, and increase in mature flowers. Putative GA receptor GID1b and DELLA repressor GAIPb transcript levels do not change in developing flowers, but increase sharply in mature flowers. Emasculation arrests floral development completely and leads to abscission of premature flowers. Application of GA4 (but not of its precursors GA12-aldehyde or GA9) restores normal growth of emasculated flowers. These results indicate that de novo GA4 synthesis in the stamen is under control of GA20ox3 and GA3ox4 genes just before the rapid flower growth phase. Stamen-derived bioactive GA is essential and sufficient for male flower development, including the petal and the pedicel growth. PMID:22268154
Poyau, A; Buchet, K; Godinot, C
1999-12-03
The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.
Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo
2014-02-01
A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. © 2013.
Nishitani, Goh; Yoshida, Masaki
2018-06-01
This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
L-glutamine Induces Expression of Listeria monocytogenes Virulence Genes
Lobel, Lior; Burg-Golani, Tamar; Sigal, Nadejda; Rose, Jessica; Livnat-Levanon, Nurit; Lewinson, Oded; Herskovits, Anat A.
2017-01-01
The high environmental adaptability of bacteria is contingent upon their ability to sense changes in their surroundings. Bacterial pathogen entry into host poses an abrupt and dramatic environmental change, during which successful pathogens gauge multiple parameters that signal host localization. The facultative human pathogen Listeria monocytogenes flourishes in soil, water and food, and in ~50 different animals, and serves as a model for intracellular infection. L. monocytogenes identifies host entry by sensing both physical (e.g., temperature) and chemical (e.g., metabolite concentrations) factors. We report here that L-glutamine, an abundant nitrogen source in host serum and cells, serves as an environmental indicator and inducer of virulence gene expression. In contrast, ammonia, which is the most abundant nitrogen source in soil and water, fully supports growth, but fails to activate virulence gene transcription. We demonstrate that induction of virulence genes only occurs when the Listerial intracellular concentration of L-glutamine crosses a certain threshold, acting as an on/off switch: off when L-glutamine concentrations are below the threshold, and fully on when the threshold is crossed. To turn on the switch, L-glutamine must be present, and the L-glutamine high affinity ABC transporter, GlnPQ, must be active. Inactivation of GlnPQ led to complete arrest of L-glutamine uptake, reduced type I interferon response in infected macrophages, dramatic reduction in expression of virulence genes, and attenuated virulence in a mouse infection model. These results may explain observations made with other pathogens correlating nitrogen metabolism and virulence, and suggest that gauging of L-glutamine as a means of ascertaining host localization may be a general mechanism. PMID:28114430
Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan
2012-01-01
Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598
Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars.
Dezhbord, Mehrangiz; Esmaelizad, Majid; Khaki, Pejvak; Fotohi, Fariba; Zarehparvar Moghaddam, Athena
2014-06-11
Leptospirosis, caused by infection with pathogenic Leptospira species, is one of the most prevalent zoonotic diseases in the world. Current leptospiral vaccines are mainly multivalent dead whole-cell mixtures made of several local dominant serovars. Therefore, design and construction of an efficient recombinant vaccine for leptospirosis control is very important. OmpL1 is an immunogenic porin protein that could be of special significance in vaccination and serodiagnosis for leptospirosis. Three strains belonging to pathogenic L. interrogans were analyzed. The specific primers for proliferation of the ompL1 gene were designed. The amplified gene was cloned. In order to investigate the ompL1 nucleotide sequence and homological analysis of this gene, ompL1 genes cloned from standard vaccinal Leptospira serovars prevalent in Iran were sequenced and cloned. PCR amplification of the ompL1 gene using the designed primers resulted in a 963 bp ompL1 gene product. The PCR based on the ompL1 gene detected all pathogenic reference serovars of Leptospira spp. tested. Based on alignment and phylogenetic analysis, although the ompL1 nucleotide sequence was slightly different within three vaccinal serovars (100%-85% identity), amino acid alignment of the OmpL1 proteins revealed that there would be inconsiderable difference among them. The ompL1 gene of the three isolates was well conserved, differing only by a total of 6 bp and the proteins by 2 amino acids. The cloned gene could be further used for expression and recombinant OmpL1 as an efficient and conserved antigen, and may be a useful vaccine candidate against leptospirosis in our region.
The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.
Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul
2008-05-01
The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.
NADPH Oxidases in Vascular Pathology
Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta
2014-01-01
Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474
Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela
2017-02-01
Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.
A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family
Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina
2017-01-01
ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of
Iwalokun, B A; Bamiro, S B; Ogunledun, A
2006-12-01
Elevated plasma levels of xanthine oxidase and liver function parameters have been associated with inflammatory events in several human diseases. While xanthine oxidase provides in vitro protection against malaria, its pathophysiological functions in vivo and interactions with liver function parameters remain unclear. This study examined the interactions and plasma levels of xanthine oxidase (XO) and uric acid (UA), catalase (CAT) and liver function parameters GOT, GPT and bilirubin in asymptomatic (n=20), uncomplicated (n=32), and severe (n=18) falciparum malaria children aged 3-13 years. Compared to age-matched control (n=16), significant (p<0.05) elevation in xanthine oxidase by 100-550%, uric acid by 15.4-153.8%, GOT and GPT by 22.1-102.2%, and total bilirubin by 2.3-86% according to parasitaemia (geometric mean parasite density (GMPD)=850-87100 parasites/microL) was observed in the malarial children. Further comparison with control revealed higher CAT level (16.2+/-0.5 vs 14.6+/-0.4 U/L; p<0.05) lacking significant (p>0.05) correlation with XO, but lower CAT level (13.4-5.4 U/L) with improved correlations (r=-0.53 to -0.91; p<0.05) with XO among the asymptomatic and symptomatic malaria children studied. 75% of control, 45% of asymptomatic, 21.9% of uncomplicated, and none of severe malaria children had Hb level>11.0 g/dL. Multivariate analyses further revealed significant (p<0.05) correlations between liver function parameters and xanthine oxidase (r=0.57-0.64) only in the severe malaria group. We conclude that elevated levels of XO and liver enzymes are biochemical features of Plasmodium falciparum parasitaemia in Nigerian children, with both parameters interacting differently to modulate the catalase response in asymptomatic and symptomatic falciparum malaria.
Jaramillo, Luz Marina; Gutiérrez, Lina A; Luckhart, Shirley; Conn, Jan E; Correa, Margarita M
2012-01-01
To elucidate the Anopheles nuneztovari s.l. taxonomic status at a microgeographic level in four malaria endemic localities from Antioquia and Córdoba, Colombia, fragments of the Cytochrome oxidase subunit I (COI) and the white gene were used. The COI analysis showed low genetic differentiation with FST levels between −0.02 and 0.137 and Nm values between 3 and infinity, indicating the presence of high gene flow among An. nuneztovari s.l. populations from the four localities. The COI network showed a single most common haplotype, 1 (n=55), present in all localities, as the likely ancestral haplotype. Analysis of the white gene showed that An. nuneztovari s.l. populations from both departments grouped with haplotypes 19 and 20, which are part of lineage 3 previously reported. The results of the present study suggest that An. nuneztovari s.l. is a single taxon in the area of the present study. PMID:22241127
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-02-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto
2018-04-01
Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
Shu, Chang; Wang, Shanchen; Xu, Tianjun
2015-05-01
Dendritic cell-specific ICAM-3-grabbing non-integrin (DC-SIGN/CD209) and liver/lymph node-specific ICAM-grabbing non-integrin (L-SIGN/CD299) which are homologues of DC-SIGN are important members in C-type lectin receptors family as key molecules to recognize and eliminate pathogens in the innate immune system. DC-SIGN and L-SIGN have become hot topics in recent studies which both served as cell adhesion and phagocytic pathogen recognition receptors in mammals. However, there have been almost no studies of DC-SIGN and L-SIGN structure and characters in fish, only DC-SIGN in the zebrafish had been studied. In our study, we identified and characterized the full-length miiuy croaker (Miichthys miiuy) DC-SIGN (mmDC-SIGN) and L-SIGN (mmL-SIGN) genes. The sequence analysis results showed that mmDC-SIGN and mmL-SIGN have the same domains with other vertebrates except primates, and share some conserved motifs in CRD among all the vertebrates which play a crucial role in interacting with Ca(2+) and for recognizing mannose-containing motifs. Gene synteny of DC-SIGN and L-SIGN were analyzed for the first time and gene synteny of L-SIGN was conserved among the five fishes. Interestingly, one gene next to L-SIGN from gene synteny had high similarity with L-SIGN gene that was described as L-SIGN-like in fish species. While only one L-SIGN gene existed in other vertebrates, two L-SIGN in fish may be in consequence of the fish-specific genome duplication to adapt the specific environment. The evolutionary analysis showed that the ancestral lineages of L-SIGN gene in fishes experienced purifying selection and the current lineages of L-SIGN gene in fishes underwent positive selection, indicating that the ancestral lineages and current lineages of L-SIGN gene in fishes underwent different evolutionary patterns. Both mmDC-SIGN and mmL-SIGN were expressed in all tested tissues and ubiquitously up-regulated in infected liver, spleen and kidney at different sampling time points
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus
Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric
2016-01-01
ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin
2017-01-01
The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330
Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers
USDA-ARS?s Scientific Manuscript database
Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...
Permethrin Induces Overexpression of Cytochrome c Oxidase Subunit 3 in Aedes aegypti
USDA-ARS?s Scientific Manuscript database
Using quantitative PCR (QPCR), the relative transcriptional levels of cytochrome c oxidase subunit 3 (CO3) were studied in Aedes aegypti (L.) in response to treatments with acetone, permethrin, or fipronil. The transcriptional levels of CO3 were significantly (p <0.05) higher in acetone-treated Ae. ...
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
Cytokine-related genes and oxidation-related genes detected in preeclamptic placentas.
Lee, Gui Se Ra; Joe, Yoon Seong; Kim, Sa Jin; Shin, Jong Chul
2010-10-01
To investigate cytokine- and oxidation-related genes for preeclampsia using DNA microarray analysis. Placentas were collected from 13 normal pregnancies and 13 patients with preeclampsia. Gene expression was studied using DNA microarray. Among significantly expressed genes, we focused on genes associated with cytokines and oxidation, and the results were confirmed using quantitative real time-polymerase chain reaction (QRT-PCR). 415 genes out of 30,940 genes were altered by > or =2-fold in the microarray analysis. 121 up-regulated genes and 294 down-regulated genes were found to be in preeclamptic placenta. Six cytokine-related genes and 5 oxidation-related genes were found from among the 121 up-regulated genes. The cytokine-related genes studied included oncostatin M (OSM), fms-related tyrosine kinase (FLT1) and vascular endothelial growth factor A (VEGFA), and the oxidation-related genes studied included spermine oxidase (SMOX), l cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), acetate dehydrogenase A (LDHA). These six genes were also significantly higher in placentas from patients with preeclampsia than in those from women with normal pregnancies. The placental tissue of patients with preeclampsia showed significantly higher mRNA expression of these six genes than the normal group, using QRT-PCR. DNA microarray analysis is one of the great methods for simultaneously detecting the functionally associated genes of preeclampsia. The cytokine-related genes such as OSM, FLT1 and VEGFA, and the oxidation-related genes such as LDHA, CYP26A1 and SMOX might prove to be the starting point in the elucidation of the pathogenesis of preeclampsia.
SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE
Hirsch, James G.
1953-01-01
Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805
USDA-ARS?s Scientific Manuscript database
In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...
Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia
2018-02-17
Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.
Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen
2013-01-01
The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873
Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J
2015-01-01
Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other
Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y
2007-06-01
In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.
Blanca, Antonio J; Ruiz-Armenta, María V; Zambrano, Sonia; Salsoso, Rocío; Miguel-Carrasco, José L; Fortuño, Ana; Revilla, Elisa; Mate, Alfonso; Vázquez, Carmen M
2016-10-01
Leptin is a protein involved in the regulation of food intake and in the immune and inflammatory responses, among other functions. Evidences demonstrate that obesity is directly associated with high levels of leptin, suggesting that leptin may directly link obesity with the elevated cardiovascular and renal risk associated with increased body weight. Adverse effects of leptin include oxidative stress mediated by activation of NADPH oxidase. The aim of this study was to evaluate the effect of L-carnitine (LC) in rat renal epithelial cells (NRK-52E) exposed to leptin in order to generate a state of oxidative stress characteristic of obesity. Leptin increased superoxide anion (O2 (•) -) generation from NADPH oxidase (via PI3 K/Akt pathway), NOX2 expression and nitrotyrosine levels. On the other hand, NOX4 expression and hydrogen peroxide (H2 O2 ) levels diminished after leptin treatment. Furthermore, the expression of antioxidant enzymes, catalase, and superoxide dismutase, was altered by leptin, and an increase in the mRNA expression of pro-inflammatory factors was also found in leptin-treated cells. LC restored all changes induced by leptin to those levels found in untreated cells. In conclusion, stimulation of NRK-52E cells with leptin induced a state of oxidative stress and inflammation that could be reversed by preincubation with LC. Interestingly, LC induced an upregulation of NOX4 and restored the release of its product, hydrogen peroxide, which suggests a protective role of NOX4 against leptin-induced renal damage. J. Cell. Biochem. 117: 2281-2288, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Verlangieri, A J; Fay, M J; Bannon, A W
1991-01-01
The Osteogenic Disorder Shionogi (ODS) rat, Clea Inc., Tokyo, Japan lacks the ability to synthesize L-ascorbic acid (AA). As with man, monkey and the guinea pig, this rat lacks L-gulonolactone oxidase necessary for the synthesis of AA from glucose. This study shows this animal to be an alternative to the guinea pig in AA studies. The anti-scorbutic potency of Ester C (EC), a calcium ascorbate and calcium threonate mixture, was compared with an AA dose of equal ascorbate activity equivalents (AAE) for anti-scorbutic activity in the ODS rat. The minimal anti-scorbutic dose of EC was determined to be 0.44 mg/kg/day (AAE), while an AA dose of 0.51 mg/kg/day (AAE) was not anti-scorbutic in a 24 day study. At 24 days EC rats gained 125% of initial body weight (BW) and the AA rats only 45% BW. Scorbutic signs at 24 days were scored on a 0 (min) to 3 (max) scale. The EC/AA ratio scores were: hemorrhage 0/1.4, behavior change 0/2.0, piloerection 0/2.2, mobility 0.4/2.2, dysbasia 0.6/2.8 and ataxia 0.4/1.0. Pearson's correlation coefficient for BW versus AAE was r = .34 for the AA group and r = .90 for the EC group. The morbidity index for EC was 0/5 and for the AA group 2/5. The AAE dose of AA which was 16% higher/day than the EC AAE dose was not anti-scorbutic, while the EC dose was anti-scorbutic. EC rats had 3.5X greater weight gain, a sensitive indicator of scurvy, than the AA rats. EC rats had 3-4 times less, if any, scorbutic signs than AA rats. The results clearly show that, based on ascorbate activity equivalents, EC has more available ascorbate activity/potency than AA. The mechanism of this increased potency is believed to be due to the facilitated transport of AAE into the cell by the threonate (a normal in vivo metabolite of AA) present in the EC product. In addition, previous studies have shown EC (AAE) to be higher in plasma and excreted less rapidly than the AAE derived from AA administered orally.
Stepwise Hydrogen Atom and Proton Transfers in Dioxygen Reduction by Aryl-Alcohol Oxidase.
Carro, Juan; Ferreira, Patricia; Martínez, Angel T; Gadda, Giovanni
2018-03-20
The mechanism of dioxygen reduction by the flavoenzyme aryl-alcohol oxidase was investigated with kinetic isotope, viscosity, and pL (pH/pD) effects in rapid kinetics experiments by stopped-flow spectrophotometry of the oxidative half-reaction of the enzyme. Double mixing of the enzyme in a stopped-flow spectrophotometer with [α- 2 H 2 ]- p-methoxybenzyl alcohol and oxygen at varying aging times established a slow rate constant of 0.0023 s -1 for the wash-out of the D atom from the N5 atom of the reduced flavin. Thus, the deuterated substrate could be used to probe the cleavage of the N-H bond of the reduced flavin in the oxidative half-reaction. A significant and pH-independent substrate kinetic isotope effect (KIE) of 1.5 between pH 5.0 and 8.0 demonstrated that H transfer is partially limiting the oxidative half-reaction of the enzyme; a negligible solvent KIE of 1.0 between pD 5.0 and 8.0 proved a fast H + transfer reaction that does not contribute to determining the flavin oxidation rates. Thus, a mechanism for dioxygen reduction in which the H atom originating from the reduced flavin and a H + from a solvent exchangeable site are transferred in separate kinetic steps is proposed. The spectroscopic and kinetic data presented also showed a lack of stabilization of transient flavin intermediates. The substantial differences in the mechanistic details of O 2 reduction by aryl-alcohol oxidase with respect to other alcohol oxidases like choline oxidase, pyranose 2-oxidase, and glucose oxidase further demonstrate the high level of versatility of the flavin cofactor in flavoenzymes.
El-Naggar, Noura El-Ahmady; Deraz, Sahar F; Soliman, Hoda M; El-Deeb, Nehal M; El-Shweihy, Nancy M
2017-03-29
There is an increasing demand on cholesterol oxidase for its various industrial and clinical applications. The current research was focused on extracellular cholesterol oxidase production under submerged fermentation by a local isolate previously identified as Streptomyces aegyptia NEAE 102. The crude enzyme extract was purified by two purification steps, protein precipitation using ammonium sulfate followed by ion exchange chromatography using DEAE Sepharose CL-6B. The kinetic parameters of purified cholesterol oxidase from Streptomyces aegyptia NEAE 102 were studied. The best conditions for maximum cholesterol oxidase activity were found to be 105 min of incubation time, an initial pH of 7 and temperature of 37 °C. The optimum substrate concentration was found to be 0.4 mM. The higher thermal stability behavior of cholesterol oxidase was at 50 °C. Around 63.86% of the initial activity was retained by the enzyme after 20 min of incubation at 50 °C. The apparent molecular weight of the purified enzyme as sized by sodium dodecyl sulphate-polyacryalamide gel electrophoresis was approximately 46 KDa. On DEAE Sepharose CL-6B column cholesterol oxidase was purified to homogeneity with final specific activity of 16.08 U/mg protein and 3.14-fold enhancement. The amino acid analysis of the purified enzyme produced by Streptomyces aegyptia NEAE 102 illustrated that, cholesterol oxidase is composed of 361 residues with glutamic acid as the most represented amino acid with concentration of 11.49 μg/mL. Taking into account the extracellular production, wide pH tolerance, thermal stability and shelf life, cholesterol oxidase produced by Streptomyces aegyptia NEAE 102 suggested that the enzyme could be industrially useful.
Roy, Subhrajyoti; Dutta, Somit; Chaudhuri, Tapas Kumar
2015-07-01
Diplazium esculentum is the most commonly consumed edible fern throughout Asia and Oceania. Several studies have been performed so far to determine different functional properties of this plant, but there have been no reports on the anticholinesterase and nicotinamide adenine dinucleotide (NADH) oxidase inhibitory activities of this plant. Therefore, the present study was conducted to determine the anticholinesterase and NADH oxidase inhibitory activities of 70% methanolic extract of D. esculentum. The D. esculentum extract was investigated for its acetylcholinesterase and NADH oxidase inhibitory activities as well as its free radical scavenging and total antioxidant activities in the linoleic acid system. The free radical scavenging activity of the extract was determined by the 2,2-diphenyl-1-picryl-hydrazyl (DPPH) method. The total antioxidant activity of the extract was evaluated by ferric thiocyanate (FTC) and thiobarbituric acid (TBA) methods. The D. esculentum extract inhibited acetylcholinesterase and NADH oxidase in a dose-dependent manner, with IC50 values of 272.97±19.38 and 265.81±21.20 μg/mL, respectively. The extract also showed a potent DPPH radical scavenging activity with an IC50 value of 402.88±12.70 μg/mL. Moreover, the extract showed 27.41% and 33.22% of total antioxidant activities determined by FTC and TBA methods, respectively. Results indicated that 70% methanolic extract of D. esculentum effectively inhibited the enzymes acetylcholinesterase and NADH oxidase and acted as a potent antioxidant and free radical scavenger. These in vitro assays indicate that this plant extract is a significant source of natural antioxidants, which may be helpful in preventing the progression of various neurodegenerative disorders associated with oxidative stress.
Urate oxidase for the prevention and treatment of tumour lysis syndrome in children with cancer.
Cheuk, Daniel Kl; Chiang, Alan Ks; Chan, Godfrey Cf; Ha, Shau Yin
2017-03-08
under the curve of uric acid at four days (MD -201.00 mg/dLhr, 95% CI -258.05 mg/dLhr to -143.95 mg/dLhr; P < 0.00001) were significantly better in the treatment group.One CCT evaluated the primary outcome; no clear evidence of a difference was identified between the treatment and the control groups (RR 0.77, 95% CI 0.44 to 1.33; P = 0.34). Pooled results of three CCTs showed significantly lower mortality due to TLS in the treatment group (RR 0.05, 95% CI 0.00 to 0.89; P = 0.04); no clear evidence of a difference in all-cause mortality was identified between the groups (RR 0.19, 95% CI 0.01 to 3.42; P = 0.26). Pooled results from five CCTs showed significantly lower incidence of renal failure in the treatment group (RR 0.26, 95% CI 0.08 to 0.89; P = 0.03). Results of CCTs also showed significantly lower uric acid in the treatment group at two days (three CCTs: MD -3.80 mg/dL, 95% CI -7.37 mg/dL to -0.24 mg/dL; P = 0.04), three days (two CCTs: MD -3.13 mg/dL, 95% CI -6.12 mg/dL to -0.14 mg/dL; P = 0.04), four days (two CCTs: MD -4.60 mg/dL, 95% CI -6.39 mg/dL to -2.81 mg/dL; P < 0.00001), and seven days (one CCT: MD -1.74 mg/dL, 95% CI -3.01 mg/dL to -0.47 mg/dL; P = 0.007) after therapy, but not one day (three CCTs: MD -3.00 mg/dL, 95% CI -7.61 mg/dL to 1.60 mg/dL; P = 0.2), five days (one CCT: MD -1.02 mg/dL, 95% CI -2.24 mg/dL to 0.20 mg/dL; P = 0.1), and 12 days (one CCT: MD -0.80 mg/dL, 95% CI -2.51 mg/dL to 0.91 mg/dL; P = 0.36) after therapy. Pooled results from three CCTs showed higher frequency of adverse effects in participants who received urate oxidase (RR 9.10, 95% CI 1.29 to 64.00; P = 0.03).Another included RCT, with 30 participants, compared different doses of rasburicase (0.2 mg/kg versus 0.15 mg/kg). The primary outcome was not evaluated. No clear evidence of a difference in mortality (all-cause mortality (Fisher's exact test P = 1.0) and mortality due to TLS (no deaths in both groups)) and renal failure (no renal failure in both groups) was identified
Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer
2013-10-01
Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal
Shimomura, Takeshi; Sumiya, Touru; Ono, Masatoshi; Ito, Tetsuji; Hanaoka, Taka-aki
2012-02-10
A novel amperometric biosensor for the measurement of L-lactate has been developed. The device comprises a screen-printed carbon electrode containing cobalt phthalocyanine (CoPC-SPCE), coated with lactate oxidase (LOD) that is immobilized in mesoporous silica (FSM8.0) using a polymer matrix of denatured polyvinyl alcohol; a Nafion layer on the electrode surface acts as a barrier to interferents. The sampling unit attached to the SPCE requires only a small sample volume of 100 μL for each measurement. The measurement of l-lactate is based on the signal produced by hydrogen peroxide, the product of the enzymatic reaction. The behavior of the biosensor, LOD-FSM8.0/Naf/CoPC-SPCE, was examined in terms of pH, applied potential, sensitivity and operational range, selectivity, and storage stability. The sensor showed an optimum response at a pH of 7.4 and an applied potential of +450 mV. The determination range and the response time for L-lactate were 18.3 μM to 1.5 mM and approximately 90s, respectively. In addition, the sensor exhibited high selectivity for L-lactate and was quite stable in storage, showing no noticeable change in its initial response after being stored for over 9 months. These results indicate that our method provides a simple, cost-effective, high-performance biosensor for l-lactate. Copyright © 2011 Elsevier B.V. All rights reserved.
Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit
2018-01-01
Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998
Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere
2009-10-01
Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.
Pietan, Lucas L.; Spradling, Theresa A.
2016-01-01
In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589
Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae
2007-07-01
Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-01-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less
Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E
2014-01-01
Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.
Sagi, Yotam; Driguès, Noam; Youdim, Moussa B H
2005-01-01
The novel drugs, ladostigil (TV3326) and TV3279, are R and S isomers, respectively, derived from a combination of the carbamate cholinesterase (ChE) inhibitor, rivastigmine, and the pharmacophore of the monoamine oxidase (MAO) B inhibitor, rasagiline. They were developed for the treatment of comorbidity of dementia with Parkinsonism. In the present study, we determined the effects of these drugs on both aminergic neurotransmitter levels and motor behavioral activity in naïve and in L-dopa- or L-tryptophan-induced rats. Chronic treatment of rats with ladostigil (52 mg kg−1 for 21 days) inhibited hippocampal and striatal MAO A and B activities by >90%, increased striatal levels of dopamine and serotonin, and inhibited striatal ChE activity by ∼50%. Chronic TV3279 (26 mg kg−1 for 21 days) similarly inhibited ∼50% of striatal ChE activity, but did not affect MAO activity or amine levels. In sharp contrast to the inductive effect of the MAO A/B inhibitor, tranylcypromine (TCP), on stereotyped hyperactivity in response to L-dopa (50 mg kg−1) or L-tryptophan (100 mg kg−1), ladostigil completely inhibited these behavioral hyperactivity syndromes. Accordingly, acute rivastigmine (2 mg kg−1) and chronic TV3279 abolished the ability of TCP to initiate L-dopa-induced hyperactivity, while scopolamine (0.5 mg kg−1) reversed the inhibitory effect of chronic ladostigil on L-dopa-induced hyperactivity, suggesting that ladostigil may attenuate successive locomotion by activating central cholinergic muscarinic receptors. Finally, while chronic ladostigil administration to naïve rats resulted in preserved spontaneous motor behavior, acute treatment with ladostigil decreased motor performance, compared to control animals. In contrast, chronic as well as acute treatments with TV3279 reduced spontaneous motor activity. Thus, the aminergic potentiation by ladostigil may counteract its cholinergic inhibitory effect on spontaneous motor behavior
Glycosylation site-targeted PEGylation of glucose oxidase retains native enzymatic activity.
Ritter, Dustin W; Roberts, Jason R; McShane, Michael J
2013-04-10
Targeted PEGylation of glucose oxidase at its glycosylation sites was investigated to determine the effect on enzymatic activity, as well as the bioconjugate's potential in an optical biosensing assay. Methoxy-poly(ethylene glycol)-hydrazide (4.5kDa) was covalently coupled to periodate-oxidized glycosylation sites of glucose oxidase from Aspergillus niger. The bioconjugate was characterized using gel electrophoresis, liquid chromatography, mass spectrometry, and dynamic light scattering. Gel electrophoresis data showed that the PEGylation protocol resulted in a drastic increase (ca. 100kDa) in the apparent molecular mass of the protein subunit, with complete conversion to the bioconjugate; liquid chromatography data corroborated this large increase in molecular size. Mass spectrometry data proved that the extent of PEGylation was six poly(ethylene glycol) chains per glucose oxidase dimer. Dynamic light scattering data indicated the absence of higher-order oligomers in the PEGylated GOx sample. To assess stability, enzymatic activity assays were performed in triplicate at multiple time points over the course of 29 days in the absence of glucose, as well as before and after exposure to 5% w/v glucose for 24h. At a confidence level of 95%, the bioconjugate's performance was statistically equivalent to native glucose oxidase in terms of activity retention over the 29 day time period, as well as following the 24h glucose exposure. Finally, the bioconjugate was entrapped within a poly(2-hydroxyethyl methacrylate) hydrogel containing an oxygen-sensitive phosphor, and the construct was shown to respond approximately linearly with a 220±73% signal change (n=4, 95% confidence interval) over the physiologically-relevant glucose range (i.e., 0-400mg/dL); to our knowledge, this represents the first demonstration of PEGylated glucose oxidase incorporated into an optical biosensing assay. Copyright © 2013 Elsevier Inc. All rights reserved.
Mitochondrial Group II Introns, Cytochrome c Oxidase, and Senescence in Podospora anserina†
Begel, Odile; Boulay, Jocelyne; Albert, Beatrice; Dufour, Eric; Sainsard-Chanet, Annie
1999-01-01
Podospora anserina is a filamentous fungus with a limited life span. It expresses a degenerative syndrome called senescence, which is always associated with the accumulation of circular molecules (senDNAs) containing specific regions of the mitochondrial chromosome. A mobile group II intron (α) has been thought to play a prominent role in this syndrome. Intron α is the first intron of the cytochrome c oxidase subunit I gene (COX1). Mitochondrial mutants that escape the senescence process are missing this intron, as well as the first exon of the COX1 gene. We describe here the first mutant of P. anserina that has the α sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of wild-type cells. The integration site of the intron is slightly modified, and this change prevents efficient homing of intron α. We show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life span. These data clearly demonstrate that intron α is not the specific senescence factor but rather an accelerator or amplifier of the senescence process. They emphasize the role that intron α plays in the instability of the mitochondrial chromosome and the link between this instability and longevity. Our results strongly support the idea that in Podospora, “immortality” can be acquired not by the absence of intron α but rather by the lack of active cytochrome c oxidase. PMID:10330149
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-01-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902
NASA Technical Reports Server (NTRS)
Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)
1995-01-01
In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Huang, Jian; Tang, Ding; Shen, Yi; Qin, Baoxiang; Hong, Lilan; You, Aiqing; Li, Ming; Wang, Xin; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan
2010-01-01
Gibberellin (GA) 2-oxidase plays a key role in the GA catabolic pathway through 2beta-hydroxylation. In the present study, we isolated a CaMV 35S-enhancer activation tagged mutant, H032. This mutant exhibited a dominant dwarf and GA-deficient phenotype, with a final stature that was less than half of its wild-type counterpart. The endogenous bioactive GAs are markedly decreased in the H032 mutant, and application of bioactive GAs (GA(3) or GA(4)) can reverse the dwarf phenotype. The integrated T-DNA was detected 12.8 kb upstream of the OsGA2ox6 in the H032 genome by TAIL-PCR. An increased level of OsGA2ox6 mRNA was detected at a high level in the H032 mutant, which might be due to the enhancer role of the CaMV 35S promoter. RNAi and ectopic expression analysis of OsGA2ox6 indicated that the dwarf trait and the decreased levels of bioactive GAs in the H032 mutant were a result of the up-regulation of the OsGA2ox6 gene. BLASTP analysis revealed that OsGA2ox6 belongs to the class III of GA 2-oxidases, which is a novel type of GA2ox that uses C20-GAs (GA(12) and/or GA(53)) as the substrates. Interestingly, we found that a GA biosynthesis inhibitor, paclobutrazol, positively regulated the OsGA2ox6 gene. Unlike the over-expression of OsGA2ox1, which led to a high rate of seed abortion, the H032 mutant retained normal flowering and seed production. These results indicate that OsGA2ox6 mainly affects plant stature, and the dominant dwarf trait of the H032 mutant can be used as an efficient dwarf resource in rice breeding. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.
Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N
2001-02-01
Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives.
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase
Fisher, Susan H.; Wray, Lewis V.
2002-01-01
Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346
Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.
Fisher, Susan H; Wray, Lewis V
2002-04-01
Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.
Nile, Shivraj Hariram; Nile, Arti Shivraj; Keum, Young Soo; Sharma, Kavita
2017-11-15
This study aimed to determine the flavonol glycosides from onion solid waste (OSW) using HPLC analysis, with antioxidant and enzyme inhibitory activities. We found considerable amount of quercetin-4'-O-monoglucoside (QMG: 254.85), quercetin-3,4'-O-diglucoside (QDG: 162.34), quercetin (Q: 60.44), and isorhamnetin-3-glucoside (IMG: 23.92) (mg/100g) dry weight (DW) of OSW. For OSW, the methanol and ethanol showed the strongest antioxidant activities, followed by ethyl acetate, chloroform, and n-hexane extracts. Among the flavonols, Q and QDG possessed higher antioxidant activities. OSW and flavonol glycosides displayed significant enzyme inhibitory activity, with IC 50 values ranging from 12.5±0.11 to 32.5±0.28 for OSW, 8.2±0.07 to 16.8±0.02 for flavonol glycosides, and 4.2±0.05μg/mL for thiourea (positive control) towards urease; while 15.2±0.8 to 35.8±0.2 (μg/mL) for OSW, 10.5±0.06 to 20.8±0.05 (μg/mL) for flavonol glycosides, and 6.5±0.05μg/mL for allopurinol (positive control) towards xanthine oxidase, respectively. The OSW and flavonol glycosides may thus be considered as potential antioxidant and antigout agents. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nakata, Yukiko; Maeda, Nobuyo
2002-03-26
Oxidative stress is thought to play an important role in atherogenesis, suggesting that antioxidants could prevent coronary artery disease. However, the efficacy of vitamin C in reducing atherosclerosis is debatable in humans and has not been tested rigorously in animals. Gulo(-/-)Apoe(-/-) mice were used to test a hypothesis that chronic vitamin C deficiency enhances the initiation and development of atherosclerosis. These mice are dependent on dietary vitamin C because of the lack of L-gulonolactone-gamma-oxidase and are prone to develop atherosclerosis because of lacking apolipoprotein E. Beginning at 6 weeks of age, the Gulo(-/-)Apoe(-/-) mice were fed regular chow or Western-type diets containing high fat and supplemented with either 0.033 g or 3.3 g/L of vitamin C in their drinking water. This regimen produced mice with chronically low vitamin C (average 1.5 microg/mL in plasma) or high vitamin C (average 10 to 30 microg/mL in plasma). Morphometric analysis showed that within each sex, age, and diet group, the sizes of the atherosclerotic plaques were not different between low vitamin C mice and high vitamin C mice. However, advanced plaques in the low vitamin C mice had significantly reduced amounts of Sirius red-staining collagen (36.4+/-2.2% versus 54.8+/-2.3%, P<0.0001), larger necrotic cores within the plaques, and reduced fibroproliferation and neovascularization in the aortic adventitia. Chronic vitamin C deficiency does not influence the initiation or progression of atherosclerotic plaques but severely compromises collagen deposition and induces a type of plaque morphology that is potentially vulnerable to rupture.
Three cases with L1 syndrome and two novel mutations in the L1CAM gene.
Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco
2015-11-01
Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.
Mukherjee, Ashis K; Saviola, Anthony J; Mackessy, Stephen P
2018-04-24
The present study highlights the cellular mechanism of resistance in human adenocarcinoma (Colo-205) cells against apoptosis induction by Rusvinoxidase, an L-amino acid oxidase purified from Russell's Viper venom (RVV). The significantly lower cytotoxicity as well as apoptotic activity of Rusvinoxidase towards Colo-205 cells (compared to MCF-7 breast cancer cells) is correlated with lower depletion of cellular glutathione content and increased down-regulation of catalase activity of Colo-205 cells following Rusvinoxidase treatment. Exposure to Rusvinoxidase subsequently diminished reactive oxygen species (ROS) production and failed to impair mitochondrial membrane potential, resulting in apoptosis induction resistance in Colo-205 cells. Further, higher expression levels of caspase 8, compared to caspase 9, indicate that Rusvinoxidase preferentially triggers the extrinsic pathway of apoptosis in Colo-205 cells. A time-dependent lower ratio of the relative expression of Bax and Bcl-xL (pro- and anti-apoptotic proteins) in Colo-205 cells, compared to our previous study on MCF-7 cells, unambiguously supports a higher cellular resistance mechanism in Colo-205 cells against Rusvinoxidase-induced apoptosis. Copyright © 2018. Published by Elsevier B.V.
Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei
2014-01-01
Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
NASA Astrophysics Data System (ADS)
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.
Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T
2001-06-29
Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Łopieńska-Biernat, E; Zaobidna, E A; Dmitryjuk, M
2015-01-01
Trehalose and glycogen metabolism plays an important role in supporting life processes in many nematodes, including Anisakis simplex. Nematodes, cosmopolitan helminths parasitizing sea mammals and humans, cause a disease known as anisakiasis. The aim of this study was to investigate the expression of genes encoding the enzymes involved in the metabolism of trehalose and glycogen-trehalose-6-phosphate synthase (TPS), trehalose-6-phosphate phosphatase (TPP), glycogen synthase (GS), and glycogen phosphorylase (GP)-in stage L3 and stage L4 larvae of A. simplex. The expression of mRNA all four genes, tps, tpp, gs, and gp, was examined by real-time polymerase chain reaction. The A. simplex ribosomal gene (18S) was used as a reference gene. Enzymatic activity was determined. The expression of trehalose enzyme genes was higher in L3 than in L4 larvae, but an inverse relationship was noted for the expression of gs and gp genes.
Łopieńska-Biernat, E.; Zaobidna, E. A.; Dmitryjuk, M.
2015-01-01
Trehalose and glycogen metabolism plays an important role in supporting life processes in many nematodes, including Anisakis simplex. Nematodes, cosmopolitan helminths parasitizing sea mammals and humans, cause a disease known as anisakiasis. The aim of this study was to investigate the expression of genes encoding the enzymes involved in the metabolism of trehalose and glycogen—trehalose-6-phosphate synthase (TPS), trehalose-6-phosphate phosphatase (TPP), glycogen synthase (GS), and glycogen phosphorylase (GP)—in stage L3 and stage L4 larvae of A. simplex. The expression of mRNA all four genes, tps, tpp, gs, and gp, was examined by real-time polymerase chain reaction. The A. simplex ribosomal gene (18S) was used as a reference gene. Enzymatic activity was determined. The expression of trehalose enzyme genes was higher in L3 than in L4 larvae, but an inverse relationship was noted for the expression of gs and gp genes. PMID:26783451
He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry
2011-01-01
Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510
Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E
2013-09-10
Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.
Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long
2014-01-01
Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962
Erv1p from Saccharomyces cerevisiae is a FAD-linked sulfhydryl oxidase.
Lee, J; Hofhaus, G; Lisowsky, T
2000-07-14
The yeast ERV1 gene encodes a small polypeptide of 189 amino acids that is essential for mitochondrial function and for the viability of the cell. In this study we report the enzymatic activity of this protein as a flavin-linked sulfhydryl oxidase catalyzing the formation of disulfide bridges. Deletion of the amino-terminal part of Erv1p shows that the enzyme activity is located in the 15 kDa carboxy-terminal domain of the protein. This fragment of Erv1p still binds FAD and catalyzes the formation of disulfide bonds but is no longer able to form dimers like the complete protein. The carboxy-terminal fragment contains a conserved CXXC motif that is present in all homologous proteins from yeast to human. Thus Erv1p represents the first FAD-linked sulfhydryl oxidase from yeast and the first of these enzymes that is involved in mitochondrial biogenesis.
Takagi, H; Shichiri, M; Takemura, M; Mohri, M; Nakamori, S
2000-08-01
We discovered on the chromosome of Saccharomyces cerevisiae Sigma 1278b novel genes involved in L-proline analogue L-azetidine-2-carboxylic acid resistance which are not present in the standard laboratory strains. The 5.4 kb-DNA fragment was cloned from the genomic library of the L-azetidine-2-carboxylic acid-resistant mutant derived from a cross between S. cerevisiae strains S288C and Sigma 1278b. The nucleotide sequence of a 4.5-kb segment exhibited no identity with the sequence in the genome project involving strain S288C. Deletion analysis indicated that one open reading frame encoding a predicted protein of 229 amino acids is indispensable for L-azetidine-2-carboxylic acid resistance. The protein sequence was found to be a member of the N-acetyltransferase superfamily. Genomic Southern analysis and gene disruption showed that two copies of the novel gene with one amino acid change at position 85 required for L-azetidine-2-carboxylic acid resistance were present on chromosomes X and XIV of Sigma 1278b background strains. When this novel MPR1 or MPR2 gene (sigma 1278b gene for L-proline analogue resistance) was introduced into the other S. cerevisiae strains, all of the recombinants were resistant to L-azetidine-2-carboxylic acid, indicating that both MPR1 and MPR2 are expressed and have a global function in S. cerevisiae.
Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Park, Young Joo; Cho, Bo Youn
2007-10-01
To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation.
Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Cho, Bo Youn
2007-01-01
To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation. PMID:17982240
Lee, Mui Li; Tan, Nget Hong; Fung, Shin Yee; Sekaran, Shamala Devi
2011-03-01
The major l-amino acid oxidase (LAAO, EC 1.4.3.2) of king cobra (Ophiophagus hannah) venom is known to be an unusual form of snake venom LAAO as it possesses unique structural features and unusual thermal stability. The antibacterial effects of king cobra venom LAAO were tested against several strains of clinical isolates including Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Escherichia coli using broth microdilution assay. For comparison, the antibacterial effects of several antibiotics (cefotaxime, kanamycin, tetracycline, vancomycin and penicillin) were also examined using the same conditions. King cobra venom LAAO was very effective in inhibiting the two Gram-positive bacteria (S. aureus and S. epidermidis) tested, with minimum inhibitory concentration (MIC) of 0.78μg/mL (0.006μM) and 1.56μg/mL (0.012μM) against S. aureus and S. epidermidis, respectively. The MICs are comparable to the MICs of the antibiotics tested, on a weight basis. However, the LAAO was only moderately effective against three Gram-negative bacteria tested (P. aeruginosa, K. pneumoniae and E. coli), with MIC ranges from 25 to 50μg/mL (0.2-0.4μM). Catalase at the concentration of 1mg/mL abolished the antibacterial effect of LAAO, indicating that the antibacterial effect of the enzyme involves generation of hydrogen peroxide. Binding studies indicated that king cobra venom LAAO binds strongly to the Gram-positive S. aureus and S. epidermidis, but less strongly to the Gram-negative E. coli and P. aeruginosa, indicating that specific binding to bacteria is important for the potent antibacterial activity of the enzyme. Copyright © 2010 Elsevier Inc. All rights reserved.
Ruiz-Garcia, Manuel; Pinedo-Castro, Myreya Omayra
2010-01-01
We propose the first molecular systematic hypothesis on the origin and evolution of Lagothrix taxa based on an analysis of 720 base pairs of the cytochrome c oxidase subunit II mitochondrial gene in 97 Lagothrix specimens. All the current Lagothrix forms probably descended from the ancestor L. poeppigii or perhaps (less probably) that of L. lugens. We detected at least 2 lineages in L. poeppigii. L. cana and L. lagotricha were determined to be monophyletic and had lower gene diversity levels compared to L. poeppigii and L. lugens. The most basal ancestors of the current L. poeppigii lineages diverged from the other Lagothrix taxa around 2.5 million years ago, at the end of the Pliocene or at the beginning of the Pleistocene. Clearly, L. cana and L. lagotricha were the 2 most recently derived Lagothrix taxa. The diversification within L. lugens and L. poeppigii may coincide with the first and second Pleistocene glacial periods, respectively, while the diversification within L. cana and L. lagotricha could have occurred in the last 400,000 years, coinciding with the climatological changes provoked by the Illinois-Riss (third) and Wisconsin-Würm (fourth) glaciations. Copyright © 2010 S. Karger AG, Basel.
Colucci, Rocchina; Fornai, Matteo; Duranti, Emiliano; Antonioli, Luca; Rugani, Ilaria; Aydinoglu, Fatma; Ippolito, Chiara; Segnani, Cristina; Bernardini, Nunzia; Taddei, Stefano; Blandizzi, Corrado; Virdis, Agostino
2013-01-01
Background and Purpose NAD(P)H oxidase and COX-1 participate in vascular damage induced by angiotensin II. We investigated the effect of rosuvastatin on endothelial dysfunction, vascular remodelling, changes in extracellular matrix components and mechanical properties of small mesenteric arteries from angiotensin II-infused rats. Experimental Approach Male rats received angiotensin II (120 ng·kg−1·min−1, subcutaneously) for 14 days with or without rosuvastatin (10 mg·kg−1·day−1, oral gavage) or vehicle. Vascular functions and morphological parameters were assessed by pressurized myography. Key Results In angiotensin II-infused rats, ACh-induced relaxation was attenuated compared with controls, less sensitive to L-NAME, enhanced by SC-560 (COX-1 inhibitor) or SQ-29548 (prostanoid TP receptor antagonist), and normalized by the antioxidant ascorbic acid or NAD(P)H oxidase inhibitors. After rosuvastatin, relaxations to ACh were normalized, fully sensitive to L-NAME, and no longer affected by SC-560, SQ-29548 or NAD(P)H oxidase inhibitors. Angiotensin II enhanced intravascular superoxide generation, eutrophic remodelling, collagen and fibronectin depositions, and decreased elastin content, resulting in increased vessel stiffness. All these changes were prevented by rosuvastatin. Angiotensin II increased phosphorylation of NAD(P)H oxidase subunit p47phox and its binding to subunit p67phox, effects inhibited by rosuvastatin. Rosuvastatin down-regulated vascular Nox4/NAD(P)H isoform and COX-1 expression, attenuated the vascular release of 6-keto-PGF1α, and enhanced copper/zinc-superoxide dismutase expression. Conclusion and Implications Rosuvastatin prevents angiotensin II-induced alterations in resistance arteries in terms of function, structure, mechanics and composition. These effects depend on restoration of NO availability, prevention of NAD(P)H oxidase-derived oxidant excess, reversal of COX-1 induction and its prostanoid production, and stimulation of
Zainal Abidin, Syafiq Asnawi; Rajadurai, Pathmanathan; Hoque Chowdhury, Md Ezharul; Othman, Iekhsan; Naidu, Rakesh
2018-06-08
The aim of this study is to investigate the potential anti-cancer activity of l-amino acid oxidase (CP-LAAO) purified from the venom of Cryptelytrops purpureomaculatus on SW480 and SW620 human colon cancer cells. Mass spectrometry guided purification was able to identify and purify CP-LAAO. Amino acid variations identified from the partial protein sequence of CP-LAAO may suggest novel variants of these proteins. The activity of the purified CP-LAAO was confirmed with o-phenyldiamine (OPD)-based spectrophotometric assay. CP-LAAO demonstrated time- and dose-dependent cytotoxic activity and the EC 50 value was determined at 13 µg/mL for both SW480 and SW620 cells. Significant increase of caspase-3 activity, reduction of Bcl-2 levels, as well as morphological changes consistent with apoptosis were demonstrated by CP-LAAO. Overall, these data provide evidence on the potential anti-cancer activity of CP-LAAO from the venom of Malaysian C. purpureomaculatus for therapeutic intervention of human colon cancer.
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants
Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.
1980-01-01
Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438
Lermontova, Inna; Grimm, Bernhard
2000-01-01
The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251
Li, Shi-Weng; Leng, Yan; Feng, Lin; Zeng, Xiao-Ying
2014-01-01
In vitro experiments were conducted to investigate the effects of abscisic acid (ABA) and Cd on antioxidative defense systems and indole-3-acetic acid (IAA) oxidase during adventitious rooting in mung bean [Vigna radiata (L.) Wilczek] seedlings. The exogenous ABA significantly enhanced the number and fresh weight of the adventitious roots. CdCl2 strongly inhibited adventitious rooting. Pretreatment with 10 μM ABA clearly alleviated the inhibitory effect of Cd on rooting. ABA significantly reduced superoxide dismutase (SOD), ascorbate peroxidase (APX), peroxidase (POD), and catalase (CAT) activities, as well as the levels of glutathione (GSH) and ascorbic acid (ASA) during adventitious rooting. ABA strongly increased IAA-oxidase activity during the induction (0-12 h) and expression (after 48 h) phases and increased the phenols levels. Cd treatment significantly reduced the activities of SOD, APX, POD, and IAA oxidase, as well as GSH level. Cd strongly increased ASA levels. ABA pretreatment counteracted Cd-induced alterations of certain antioxidants and antioxidative enzymes, e.g., remarkably rescued APX and POD activities, reduced the elevated SOD and CAT activities and ASA levels, and recovered the reduced GSH levels, caused by Cd stress. Thus, the physiological effects of the combination of ABA and Cd treatments were opposite of those obtained with Cd treatment alone, suggesting that ABA involved in the regulation of antioxidative defense systems and the alleviation of wounding- and Cd-induced oxidative stress.
Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.
Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H
2008-10-05
Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.
Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing
2010-01-01
OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592
He, Jun; Tian, Yong; Li, Jinjun; Shen, Junda; Tao, Zhengrong; Fu, Yan; Niu, Dong; Lu, Lizhi
2013-01-01
Liver fatty acid binding protein (L-FABP) is a member of intracellular lipid-binding proteins responsible for the transportation of fatty acids. The expression pattern of duck L-FABP mRNA was examined in this study by quantitative RT-PCR. The results showed that duck L-FABP gene was expressed in many tissues, including heart, lung, kidney, muscle, ovary, brain, intestine, stomach and adipocyte tissues, and highly expressed in liver. Several lipid metabolism-related genes were selected to detect the regulation of L-FABP in duck. The expression of L-FABP and lipoprotein lipase was promoted by oleic acid. The L-FABP knockdown decreased the expression levels of peroxisome proliferator-activated receptor α (PPARα), fatty acid synthase and lipoprotein lipase by 61.1, 42.3 and 53.7 %, respectively (P < 0.05), but had no influences on the mRNA levels of PPARγ and leptin receptor. L-FABP might function through the PPARα to regulate the fat metabolism-related gene expression and play important roles in lipid metabolism in duck hepatocytes.
Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael
2017-01-01
In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.
Landmesser, Ulf; Spiekermann, Stephan; Dikalov, Sergey; Tatge, Helma; Wilke, Ragna; Kohler, Christoph; Harrison, David G; Hornig, Burkhard; Drexler, Helmut
2002-12-10
Impaired flow-dependent, endothelium-mediated vasodilation (FDD) in patients with chronic heart failure (CHF) results, at least in part, from accelerated degradation of nitric oxide by oxygen radicals. The mechanisms leading to increased vascular radical formation, however, remain unclear. Therefore, we determined endothelium-bound activities of extracellular superoxide dismutase (ecSOD), a major vascular antioxidant enzyme, and xanthine-oxidase, a potent radical producing enzyme, and their relation to FDD in patients with CHF. ecSOD and xanthine-oxidase activities, released from endothelium into plasma by heparin bolus injection, were determined in 14 patients with CHF and 10 control subjects. FDD of the radial artery was measured using high-resolution ultrasound and was assessed before and after administration of the antioxidant vitamin C (25 mg/min; IA). In patients with CHF, endothelium-bound ecSOD activity was substantially reduced (5.0+/-0.7 versus 14.4+/-2.6 U x mL(-1) x min(-1); P<0.01) and closely related to FDD (r=0.61). Endothelium-bound xanthine-oxidase activity was increased by >200% (38+/-10 versus 12+/-4 nmol O2*- x microL(-1); P<0.05) and inversely related to FDD (r=-0.35) in patients with CHF. In patients with low ecSOD and high xanthine-oxidase activity, a greater benefit of vitamin C on FDD was observed, ie, the portion of FDD inhibited by radicals correlated negatively with ecSOD (r=-0.71) but positively with xanthine-oxidase (r=0.75). These results demonstrate that both increased xanthine-oxidase and reduced ecSOD activity are closely associated with increased vascular oxidative stress in patients with CHF. This loss of vascular oxidative balance likely represents a novel mechanism contributing to endothelial dysfunction in CHF.
Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo
2013-01-01
Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID
Donmez, Soner; Arslan, Fatma; Sarı, Nurşen; Hasanoğlu Özkan, Elvan; Arslan, Halit
2017-09-01
In the present study, a novel biosensor that is sensitive to glucose was prepared using the microspheres modified with (4-formyl-3-methoxyphenoxymethyl)polystyrene (FMPS) with l-glycine. Polymeric microspheres having Schiff bases were prepared from FMPS using the glycine condensation method. Glucose oxidase enzyme was immobilized onto modified carbon paste electrode by cross-linking with glutaraldehyde. Oxidation of enzymatically produced H 2 O 2 (+0.5 V vs. Ag/AgCl) was used for determination of glucose. Optimal temperature and pH were found as 50 °C and 8.0, respectively. The glucose biosensor showed a linear working range from 5.0 × 10 -4 to 1.0 × 10 -2 M, R 2 = 0.999. Storage and operational stability of the biosensor were also investigated. The biosensor gave perfect reproducible results after 20 measurements with 3.3% relative standard deviation. It also had good storage stability. © 2016 International Union of Biochemistry and Molecular Biology, Inc.
Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.
Okamura, H; Murooka, Y; Harada, T
1976-01-01
Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974
Fitzpatrick, Paul F; Chadegani, Fatemeh; Zhang, Shengnan; Dougherty, Vi
2017-02-14
The flavoenzyme l-6-hydroxynicotine oxidase is a member of the monoamine oxidase family that catalyzes the oxidation of (S)-6-hydroxynicotine to 6-hydroxypseudooxynicotine during microbial catabolism of nicotine. While the enzyme has long been understood to catalyze oxidation of the carbon-carbon bond, it has recently been shown to catalyze oxidation of a carbon-nitrogen bond [Fitzpatrick, P. F., et al. (2016) Biochemistry 55, 697-703]. The effects of pH and mutagenesis of active site residues have now been utilized to study the mechanism and roles of active site residues. Asn166 and Tyr311 bind the substrate, while Lys287 forms a water-mediated hydrogen bond with flavin N5. The N166A and Y311F mutations result in ∼30- and ∼4-fold decreases in k cat /K m and k red for (S)-6-hydroxynicotine, respectively, with larger effects on the k cat /K m value for (S)-6-hydroxynornicotine. The K287M mutation results in ∼10-fold decreases in these parameters and a 6000-fold decrease in the k cat /K m value for oxygen. The shapes of the pH profiles are not altered by the N166A and Y311F mutations. There is no solvent isotope effect on the k cat /K m value for amines. The results are consistent with a model in which both the charged and neutral forms of the amine can bind, with the former rapidly losing a proton to a hydrogen bond network of water and amino acids in the active site prior to the transfer of hydride to the flavin.
Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells
Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.
2017-01-01
Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.
Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T
2015-01-01
The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.
Andres, Ryan J; Bowman, Daryl T; Kaur, Baljinder; Kuraparthy, Vasu
2014-01-01
A major leaf shape locus (L) was mapped with molecular markers and genomically targeted to a small region in the D-genome of cotton. By using expression analysis and candidate gene mapping, two LMI1 -like genes are identified as possible candidates for leaf shape trait in cotton. Leaf shape in cotton is an important trait that influences yield, flowering rates, disease resistance, lint trash, and the efficacy of foliar chemical application. The leaves of okra leaf cotton display a significantly enhanced lobing pattern, as well as ectopic outgrowths along the lobe margins when compared with normal leaf cotton. These phenotypes are the hallmark characteristics of mutations in various known modifiers of leaf shape that culminate in the mis/over-expression of Class I KNOX genes. To better understand the molecular and genetic processes underlying leaf shape in cotton, a normal leaf accession (PI607650) was crossed to an okra leaf breeding line (NC05AZ21). An F2 population of 236 individuals confirmed the incompletely dominant single gene nature of the okra leaf shape trait in Gossypium hirsutum L. Molecular mapping with simple sequence repeat markers localized the leaf shape gene to 5.4 cM interval in the distal region of the short arm of chromosome 15. Orthologous mapping of the closely linked markers with the sequenced diploid D-genome (Gossypium raimondii) tentatively resolved the leaf shape locus to a small genomic region. RT-PCR-based expression analysis and candidate gene mapping indicated that the okra leaf shape gene (L (o) ) in cotton might be an upstream regulator of Class I KNOX genes. The linked molecular markers and delineated genomic region in the sequenced diploid D-genome will assist in the future high-resolution mapping and map-based cloning of the leaf shape gene in cotton.
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
Shi, Deng-Ke; Zhu, Jing; Sun, Ze-Hua; Zhang, Guang; Liu, Rui; Zhang, Tian-Jun; Wang, Sheng-Li; Ren, Ang; Zhao, Ming-Wen
2017-10-01
The alternative oxidase (AOX), which forms a branch of the mitochondrial respiratory electron transport pathway, functions to sustain electron flux and alleviate reactive oxygen species (ROS) production. In this article, a homologous AOX gene was identified in Ganoderma lucidum. The coding sequence of the AOX gene in G. lucidum contains 1038 nucleotides and encodes a protein of 39.48 kDa. RNA interference (RNAi) was used to study the function of AOX in G. lucidum, and two silenced strains (AOXi6 and AOXi21) were obtained, showing significant decreases of approximately 60 and 50 %, respectively, in alternative pathway respiratory efficiency compared to WT. The content of ganoderic acid (GA) in the mutant strains AOXi6 and AOXi21 showed significant increases of approximately 42 and 44 %, respectively, compared to WT. Elevated contents of intermediate metabolites in GA biosynthesis and elevated transcription levels of corresponding genes were also observed in the mutant strains AOXi6 and AOXi21. In addition, the intracellular ROS content in strains AOXi6 and AOXi21 was significantly increased, by approximately 1.75- and 1.93-fold, respectively, compared with WT. Furthermore, adding N-acetyl-l-cysteine (NAC), a ROS scavenger, significantly depressed the intracellular ROS content and GA accumulation in AOX-silenced strains. These results indicate that AOX affects GA biosynthesis by regulating intracellular ROS levels. Our research revealed the important role of AOX in the secondary metabolism of G. lucidum.
Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James
2001-01-01
We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076
Xu, Yi; Zhang, Xia; Li, Qi; Cheng, Zhiyuan; Lou, Haijuan; Ge, Lei; An, Hailong
2015-01-01
Brassinosteroids (BRs), known as a kind of phytohormones, play essential roles in plant growth and development. Although the studies on the BR biosynthesis and signaling are extensive in Arabidopsis, little is known in temperate cereals. In this study, bdbrd1-1, a T-DNA insertion mutant from Brachypodium distachyon, was isolated and characterized in details. The bdbrd1-1 mutant showed lots of cellular and morphogenetic defects, including shortened cell shapes, severe dwarfing, twisted leaves and sterile spikes. Sequencing the flanking fragment of the T-DNA and complementation by genomic DNA in the mutant, confirmed that the developmental defects are caused by the T-DNA insertion in BdBRD1, a possible brassinosteroid C-6 oxidase gene. Application of 24-epicastasterone could partly rescue the bdbrd1-1 dwarfing phenotype. Expression analysis of BdBRD1 suggested that bdbrd1-1 is probably a null mutant and its wild type transcript is expressed in various tissues and highest in the leaf sheaths. Meanwhile, measurements on leaf numbers of the main stems or days to the emergence of the inflorescences suggested that bdbrd1-1 is late-flowering. The late-flowering phenotype could be converted by vernalization treatment, although there lacks a typical FLC gene in B. distachyon. The current data provide an insight into the relationship between BRs biosynthesis and individual development in B. distachyon, an emerging model plant for the temperate cereals. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J
2015-01-01
Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.
Characterization and expression profiles of MaACS and MaACO genes from mulberry (Morus alba L.)*
Liu, Chang-ying; Lü, Rui-hua; Li, Jun; Zhao, Ai-chun; Wang, Xi-ling; Diane, Umuhoza; Wang, Xiao-hong; Wang, Chuan-hong; Yu, Ya-sheng; Han, Shu-mei; Lu, Cheng; Yu, Mao-de
2014-01-01
1-Aminocyclopropane-1-carboxylic acid synthase (ACS) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) are encoded by multigene families and are involved in fruit ripening by catalyzing the production of ethylene throughout the development of fruit. However, there are no reports on ACS or ACO genes in mulberry, partly because of the limited molecular research background. In this study, we have obtained five ACS gene sequences and two ACO gene sequences from Morus Genome Database. Sequence alignment and phylogenetic analysis of MaACO1 and MaACO2 showed that their amino acids are conserved compared with ACO proteins from other species. MaACS1 and MaACS2 are type I, MaACS3 and MaACS4 are type II, and MaACS5 is type III, with different C-terminal sequences. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) expression analysis showed that the transcripts of MaACS genes were strongly expressed in fruit, and more weakly in other tissues. The expression of MaACO1 and MaACO2 showed different patterns in various mulberry tissues. MaACS and MaACO genes demonstrated two patterns throughout the development of mulberry fruit, and both of them were strongly up-regulated by abscisic acid (ABA) and ethephon. PMID:25001221
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan Xinjuan; Dai Yujie; Li Xing
2011-08-01
Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd
2016-01-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
NADPH oxidases of the brain: distribution, regulation, and function.
Infanger, David W; Sharma, Ram V; Davisson, Robin L
2006-01-01
The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.
Chan, Pei-Chi; Wang, Ya-Chin; Chen, Yi-Ling; Hsu, Wan-Ning; Tian, Yu-Feng; Hsieh, Po-Shiuan
2017-11-01
Elevations in C-reactive protein (CRP) levels are positively correlated with the progress of type 2 diabetes mellitus. However, the effect of CRP on pancreatic insulin secretion is unknown. Here, we showed that purified human CRP impaired insulin secretion in isolated mouse islets and NIT-1 insulin-secreting cells in dose- and time-dependent manners. CRP increased NADPH oxidase-mediated ROS (reactive oxygen species) production, which simultaneously promoted the production of nitrotyrosine (an indicator of RNS, reactive nitrogen species) and TNFα, to diminish cell viability, insulin secretion in islets and insulin-secreting cells. These CRP-mediated detrimental effects on cell viability and insulin secretion were significantly reversed by adding NAC (a potent antioxidant), apocynin (a selective NADPH oxidase inhibitor), L-NAME (a non-selective nitric oxide synthase (NOS) inhibitor), aminoguanidine (a selective iNOS inhibitor), PDTC (a selective NFκB inhibitor) or Enbrel (an anti-TNFα fusion protein). However, CRP-induced ROS production failed to change after adding L-NAME, aminoguanidine or PDTC. In isolated islets and NIT-1 cells, the elevated nitrotyrosine contents by CRP pretreatment were significantly suppressed by adding L-NAME but not PDTC. Conversely, CRP-induced increases in TNF-α production were significantly reversed by administration of PDTC but not L-NAME. In addition, wild-type mice treated with purified human CRP showed significant decreases in the insulin secretion index (HOMA-β cells) and the insulin stimulation index in isolated islets that were reversed by the addition of L-NAME, aminoguanidine or NAC. It is suggested that CRP-activated NADPH-oxidase redox signaling triggers iNOS-mediated RNS and NFκB-mediated proinflammatory cytokine production to cause β cell damage in state of inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.
Gravity Responsive NADH Oxidase of the Plasma Membrane
NASA Technical Reports Server (NTRS)
Morre, D. James (Inventor)
2002-01-01
A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.
Reductive trapping of substrate to bovine plasma amine oxidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hartmann, C.; Klinman, J.P.
1987-01-25
Plasma amine oxidases catalyze the oxidative deamination of amines to aldehydes, followed by a 2e- reduction of O/sub 2/ to H/sub 2/O/sub 2/. Pyrroloquinoline quinone (PQQ), previously believed to be restricted to prokaryotes, has recently been proposed to be the cofactor undergoing reduction in the first half-reaction of bovine plasma amine oxidase (Ameyama, M., Hayashi, U., Matsushita, K., Shinagawa, E., and Adachi, O. (1984) Agric. Biol. Chem. 48, 561-565; Lobenstein-Verbeek, C. L., Jongejan, J. A., Frank, J., and Duine, J. A. (1984) FEBS Lett. 170, 305-309). This result is unexpected, since model studies with PQQ implicate Schiff's base formation betweenmore » a reactive carbonyl and substrates, whereas experiments with bovine plasma amine oxidase have failed to provide evidence for a carbonyl cofactor. We have, therefore, re-examined putative adducts between substrate and enzyme-bound cofactor, employing a combination of (/sup 14/C)benzylamine and (/sup 3/H)NaCNBH/sub 3/. The use of the relatively weak reductant, NaCNBH/sub 3/, affords Schiff's base specificity and permits the study of enzyme below pH 7.0. As we show, enzyme can only be inactivated by NaCNBH/sub 3/ in the presence of substrate, leading to the incorporation of 1 mol of (/sup 14/C)benzylamine/mol of enzyme subunit at complete inactivation. By contrast, we are unable to detect any labeling with (/sup 3/H)NaCNBH/sub 3/, analogous to an earlier study with (/sup 3/H)NaCNBH/sub 4/ (Suva, R. H., and Abeles, R. H. (1978) Biochemistry 17, 3538-3545). We conclude, first, that our inability to obtain adducts containing both carbon 14 and tritium rules out the reductive trapping either of amine substrate with pyridoxal phosphate or of aldehyde product with a lysyl side chain and, second, that the observed pattern of labeling is fully consistent with the presence of PQQ at the active site of bovine plasma amine oxidase.« less
The ciliopathy gene Rpgrip1l is essential for hair follicle development.
Chen, Jiang; Laclef, Christine; Moncayo, Alejandra; Snedecor, Elizabeth R; Yang, Ning; Li, Li; Takemaru, Ken-Ichi; Paus, Ralf; Schneider-Maunoury, Sylvie; Clark, Richard A
2015-03-01
The primary cilium is essential for skin morphogenesis through regulating the Notch, Wnt, and hedgehog signaling pathways. Prior studies on the functions of primary cilia in the skin were based on the investigations of genes that are essential for cilium formation. However, none of these ciliogenic genes has been linked to ciliopathy, a group of disorders caused by abnormal formation or function of cilia. To determine whether there is a genetic and molecular link between ciliopathies and skin morphogenesis, we investigated the role of RPGRIP1L, a gene mutated in Joubert (JBTS) and Meckel (MKS) syndromes, two severe forms of ciliopathy, in the context of skin development. We found that RPGRIP1L is essential for hair follicle morphogenesis. Specifically, disrupting the Rpgrip1l gene in mice resulted in reduced proliferation and differentiation of follicular keratinocytes, leading to hair follicle developmental defects. These defects were associated with significantly decreased primary cilium formation and attenuated hedgehog signaling. In contrast, we found that hair follicle induction and polarization and the development of interfollicular epidermis were unaffected. This study indicates that RPGRIP1L, a ciliopathy gene, is essential for hair follicle morphogenesis likely through regulating primary cilia formation and the hedgehog signaling pathway.
Marty-Teysset, C.; de la Torre, F.; Garel, J.-R.
2000-01-01
The growth of Lactobacillus delbrueckii subsp. bulgaricus (L. delbrueckii subsp. bulgaricus) on lactose was altered upon aerating the cultures by agitation. Aeration caused the bacteria to enter early into stationary phase, thus reducing markedly the biomass production but without modifying the maximum growth rate. The early entry into stationary phase of aerated cultures was probably related to the accumulation of hydrogen peroxide in the medium. Indeed, the concentration of hydrogen peroxide in aerated cultures was two to three times higher than in unaerated ones. Also, a similar shift from exponential to stationary phase could be induced in unaerated cultures by adding increasing concentrations of hydrogen peroxide. A significant fraction of the hydrogen peroxide produced by L. delbrueckii subsp. bulgaricus originated from the reduction of molecular oxygen by NADH catalyzed by an NADH:H2O2 oxidase. The specific activity of this NADH oxidase was the same in aerated and unaerated cultures, suggesting that the amount of this enzyme was not directly regulated by oxygen. Aeration did not change the homolactic character of lactose fermentation by L. delbrueckii subsp. bulgaricus and most of the NADH was reoxidized by lactate dehydrogenase with pyruvate. This indicated that NADH oxidase had no (or a very small) energetic role and could be involved in eliminating oxygen. PMID:10618234
Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin
2017-01-01
Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407
New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.
Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C
2001-05-04
The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.
Immobilization of Pichia pastoris cells containing alcohol oxidase activity
Maleknia, S; Ahmadi, H; Norouzian, D
2011-01-01
Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090
DOE Office of Scientific and Technical Information (OSTI.GOV)
Long, C.M.; Rohrmann, G.F.; Merrill, G.F., E-mail: merrillg@onid.orst.ed
2009-06-05
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involvedmore » in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.« less
Long, C M; Rohrmann, G F; Merrill, G F
2009-06-05
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.
Alvarez, María de Fátima; Medina, Roxana; Pasteris, Sergio E; Strasser de Saad, Ana M; Sesma, Fernando
2004-01-01
Lactobacillus rhamnosus ATCC 7469 was able to grow in glycerol as the sole source of energy in aerobic conditions, producing lactate, acetate, and diacetyl. A biphasic growth was observed in the presence of glucose. In this condition, glycerol consumption began after glucose was exhausted from the culture medium. Glycerol kinase activity was detected in L. rhamnosus ATCC 7469, a characteristic of microorganisms which catabolize glycerol in aerobic conditions. Genetic analysis revealed that this strain possesses two glycerol kinase genes: gykA and glpK, that encode for two different glycerol kinases GykA and GlpK, respectively. The glpK geneis associated in an operon with alpha-glycerophosphate oxidase (glpO) and glycerol facilitator (glpF) genes. Transcriptional analysis revealed that only glpK is expressed when L. rhamnosus was grown on glycerol. Copyright 2004 S. Karger AG, Basel
Luo, Dong-jiao; Hu, Ye; Dennin, R H; Yan, Jie
2007-09-01
To reconstruct the nucleotide sequence of Leptospira interrogans lipL21 gene for increasing the output of prokaryotic expression and to understand the changes on immunogenicity of the expression products before and after reconstruction, and to determine the position of envelope lipoprotein LipL21 on the surface of leptospiral body. According to the preferred codons of E.coli, the nucleotide sequence of lipL21 gene was designed and synthesized, and then its prokaryotic expression system was constructed. By using SDS-PAGE plus BioRad agarose image analysor, the expression level changes of lipL21 genes before and after reconstruction were measured. A Western blot assay using rabbit anti-TR/Patoc I serum as the first antibody was performed to identify the immunoreactivity of the two target recombinant proteins rLipL21s before and after reconstruction. The changes of cross agglutination titers of antisera against two rLipL21s before and after reconstruction to the different leptospiral serogroups were demonstrated using microscope agglutination test (MAT). Immuno-electronmicroscopy was applied to confirm the location of LipL21s. The expression outputs of original and reconstructed lipL21 genes were 8.5 % and 46.5 % of the total bacterial proteins, respectively. Both the two rLipL21s could take place immune conjugation reaction with TR/Patoc I antiserum. After immunization with each of the two rLipL21s in rabbits, the animals could produce specific antibody. Similar MAT titers with 1:80 - 1:320 of the two antisera against rLipL21s were present. LipL21 was confirmed to locate on the surface of leptospiral envelope. LipL21 is a superficial antigen of Leptospira interrogans. The expression output of the reconstructed lipL21 gene is remarkably increased. The expression rLipL21 maintains fine antigenicity and immunoreactivity and its antibody still shows an extensive cross immunoagglutination activity. The high expression of the reconstructed lipL21 gene will offer a
Faccio, Greta; Kruus, Kristiina; Buchert, Johanna; Saloheimo, Markku
2010-08-20
Sulfhydryl oxidases are flavin-dependent enzymes that catalyse the formation of de novo disulfide bonds from free thiol groups, with the reduction of molecular oxygen to hydrogen peroxide. Sulfhydryl oxidases have been investigated in the food industry to remove the burnt flavour of ultraheat-treated milk and are currently studied as potential crosslinking enzymes, aiming at strengthening wheat dough and improving the overall bread quality. In the present study, potential sulfhydryl oxidases were identified in the publicly available fungal genome sequences and their sequence characteristics were studied. A representative sulfhydryl oxidase from Aspergillus oryzae, AoSOX1, was expressed in the fungus Trichoderma reesei. AoSOX1 was produced in relatively good yields and was purified and biochemically characterised. The enzyme catalysed the oxidation of thiol-containing compounds like glutathione, D/L-cysteine, beta-mercaptoethanol and DTT. The enzyme had a melting temperature of 57°C, a pH optimum of 7.5 and its enzymatic activity was completely inhibited in the presence of 1 mM ZnSO4. Eighteen potentially secreted sulfhydryl oxidases were detected in the publicly available fungal genomes analysed and a novel proline-tryptophan dipeptide in the characteristic motif CXXC, where X is any amino acid, was found. A representative protein, AoSOX1 from A. oryzae, was produced in T. reesei in an active form and had the characteristics of sulfhydryl oxidases. Further testing of the activity on thiol groups within larger peptides and on protein level will be needed to assess the application potential of this enzyme.
Walsh, M; Tangney, M; O'Neill, M J; Larkin, J O; Soden, D M; McKenna, S L; Darcy, R; O'Sullivan, G C; O'Driscoll, C M
2006-01-01
Recent success in phase I/II clinical trials (Konstan, M. W.; Davis, P. B.; Wagener, J. S.; Hilliard, K. A.; Stern, R. C.; Milgram, L. J.; Kowalczyk, T. H.; Hyatt, S. L.; Fink, T. L.; Gedeon, C. R.; Oette, S. M.; Payne, J. M.; Muhammad, O.; Ziady, A. G.; Moen, R. C.; Cooper, M. J. Hum. Gene Ther. 2004, 15 (12), 1255-69) has highlighted pegylated poly-L-lysine (C1K30-PEG) as a nonviral gene delivery agent capable of achieving clinically significant gene transfer levels in vivo. This study investigates the potential of a C1K30-PEG gene delivery system for cancer gene therapy and evaluates its mode of cellular entry with the purpose of developing an optimally formulated prototype for tumor cell transfection. C1K30-PEG complexes have a neutral charge and form rod-like and toroid-like nanoparticles. Comparison of the transfection efficiency achieved by C1K30-PEG with other cationic lipid and polymeric vectors demonstrates that C1K30-PEG transfects cells more efficiently than unpegylated poly-L-lysine and compares well to commercially available vectors. In vivo gene delivery by C1K30-PEG nanoparticles to a growing subcutaneous murine tumor was also demonstrated. To determine potential barriers to C1K30-PEG gene delivery, the entry mechanism and intracellular fate of rhodamine labeled complexes were investigated. Using cellular markers to delineate the pathway taken by the complexes upon cellular entry, only minor colocalization was observed with EEA-1, a marker of early endosomes. No colocalization was observed between the complexes and the transferrin receptor, which is a marker for clathrin-coated pits. In addition, complexes were not observed to enter late endosomes/lysosomes. Cellular entry of the complexes was completely inhibited by the macropinocytosis inhibitor, amiloride, indicating that the complexes enter cells via macropinosomes. Such mechanistic studies are an essential step to support future rational design of pegylated poly-L-lysine vectors to improve the
Crystal Structure of Alcohol Oxidase from Pichia pastoris
Valerius, Oliver; Feussner, Ivo; Ficner, Ralf
2016-01-01
FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908
Calcium transport in vesicles energized by cytochrome oxidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, Randy N.
1979-01-01
Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K + selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K + flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interactionmore » with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.« less
Ganas, Petra; Brandsch, Roderich
2009-06-01
The mechanism by which l-nicotine is taken up by bacteria that are able to grow on it is unknown. Nicotine degradation by Arthrobacter nicotinovorans, a Gram-positive soil bacterium, is linked to the presence of the catabolic megaplasmid pAO1. l-[(14)C]Nicotine uptake assays with A. nicotinovorans showed transport of nicotine across the cell membrane to be energy-independent and saturable with a K(m) of 6.2+/-0.1 microM and a V(max) of 0.70+/-0.08 micromol min(-1) (mg protein)(-1). This is in accord with a mechanism of facilitated diffusion, driven by the nicotine concentration gradient. Nicotine uptake was coupled to its intracellular degradation, and an A. nicotinovorans strain unable to degrade nicotine (pAO1(-)) showed no nicotine import. However, when the nicotine dehydrogenase genes were expressed in this strain, import of l-[(14)C]nicotine took place. A. nicotinovorans pAO1(-) and Escherichia coli were also unable to import 6-hydroxy-l-nicotine, but expression of the 6-hydroxy-l-nicotine oxidase gene allowed both bacteria to take up this compound. l-Nicotine uptake was inhibited by d-nicotine, 6-hydroxy-l-nicotine and 2-amino-l-nicotine, which may indicate transport of these nicotine derivatives by a common permease. Attempts to correlate nicotine uptake with pAO1 genes possessing similarity to amino acid transporters failed. In contrast to the situation at the blood-brain barrier, nicotine transport across the cell membrane by these bacteria was not by passive diffusion or active transport but by facilitated diffusion.
ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases
Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.
2012-01-01
Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.
Key role of alternative oxidase in lovastatin solid-state fermentation.
Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier
2017-10-01
Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.
Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F
1985-01-01
Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Kobayashi, Jyumpei; Sasaki, Daisuke; Hara, Kiyotaka Y; Hasunuma, Tomohisa; Kondo, Akihiko
2017-03-15
Oxidized glutathione (GSSG) is the preferred form for industrial mass production of glutathione due to its high stability compared with reduced glutathione (GSH). In our previous study, over-expression of the mitochondrial thiol oxidase ERV1 gene was the most effective for high GSSG production in Saccharomyces cerevisiae cells among three types of different thiol oxidase genes. We improved Erv1 enzyme activity for oxidation of GSH and revealed that S32 and N34 residues are critical for the oxidation. Five engineered Erv1 variant proteins containing S32 and/or N34 replacements exhibited 1.7- to 2.4-fold higher in vitro GSH oxidation activity than that of parental Erv1, whereas the oxidation activities of these variants for γ-glutamylcysteine were comparable. According to three-dimensional structures of Erv1 and protein stability assays, S32 and N34 residues interact with nearby residues through hydrogen bonding and greatly contribute to protein stability. These results suggest that increased flexibility by amino acid replacements around the active center decrease inhibitory effects on GSH oxidation. Over-expressions of mutant genes coding these Erv1 variants also increased GSSG and consequently total glutathione production in S. cerevisiae cells. Over-expression of the ERV1 S32A gene was the most effective for GSSG production in S. cerevisiae cells among the parent and other mutant genes, and it increased GSSG production about 1.5-fold compared to that of the parental ERV1 gene. This is the first study demonstrating the pivotal effects of S32 and N34 residues to high GSH oxidation activity of Erv1. Furthermore, in vivo validity of Erv1 variants containing these S32 and N34 replacements were also demonstrated. This study indicates potentials of Erv1 for high GSSG production.
Pacific oyster polyamine oxidase: a protein missing link in invertebrate evolution.
Cervelli, Manuela; Polticelli, Fabio; Angelucci, Emanuela; Di Muzio, Elena; Stano, Pasquale; Mariottini, Paolo
2015-05-01
Polyamine oxidases catalyse the oxidation of polyamines and acetylpolyamines and are responsible for the polyamine interconversion metabolism in animal cells. Polyamine oxidases from yeast can oxidize spermine, N(1)-acetylspermine, and N(1)-acetylspermidine, while in vertebrates two different enzymes, namely spermine oxidase and acetylpolyamine oxidase, specifically catalyse the oxidation of spermine, and N(1)-acetylspermine/N(1)-acetylspermidine, respectively. In this work we proved that the specialized vertebrate spermine and acetylpolyamine oxidases have arisen from an ancestor invertebrate polyamine oxidase with lower specificity for polyamine substrates, as demonstrated by the enzymatic activity of the mollusc polyamine oxidase characterized here. This is the first report of an invertebrate polyamine oxidase, the Pacific oyster Crassostrea gigas (CgiPAO), overexpressed as a recombinant protein. This enzyme was biochemically characterized and demonstrated to be able to oxidase both N(1)-acetylspermine and spermine, albeit with different efficiency. Circular dichroism analysis gave an estimation of the secondary structure content and modelling of the three-dimensional structure of this protein and docking studies highlighted active site features. The availability of this pluripotent enzyme can have applications in crystallographic studies and pharmaceutical biotechnologies, including anticancer therapy as a source of hydrogen peroxide able to induce cancer cell death.
Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E
2017-02-09
In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.
Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M
2014-07-15
Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.
El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-01-01
Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.
Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe
2013-01-01
1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837
Cloning and expression of L-asparaginase gene in Escherichia coli.
Wang, Y; Qian, S; Meng, G; Zhang, S
2001-08-01
The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.
Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo
2013-01-01
Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901
Monoamine Oxidase and Dopamine β-Hydroxylase Inhibitors from the Fruits of Gardenia jasminoides
Kim, Ji Ho; Kim, Gun Hee; Hwang, Keum Hee
2012-01-01
This research was designed to determine what components of Gardenia jasminoides play a major role in inhibiting the enzymes related antidepressant activity of this plant. In our previous research, the ethyl acetate fraction of G. jasminosides fruits inhibited the activities of both monoamine oxidase-A (MAO-A) and monoamine oxidase-B (MAO-B), and oral administration of the ethanolic extract slightly increased serotonin concentrations in the brain tissues of rats and decreased MAO-B activity. In addition, we found through in vitro screening test that the ethyl acetate fraction showed modest inhibitory activity on dopamine-β hydroxylase (DBH). The bioassay-guided fractionation led to the isolation of five bio-active compounds, protocatechuic acid (1), geniposide (2), 6'-O-trans-p-coumaroylgeniposide (3), 3,5-d-ihydroxy-1,7-bis (4-hydroxyphenyl) heptanes (4), and ursolic acid (5), from the ethyl acetate fraction of G. jasminoides fruits. The isolated compounds showed different inhibitory potentials against MAO-A, -B, and DBH. Protocatechuic acid showed potent inhibition against MAO-B (IC50 300 μmol/L) and DBH (334 μmol/L), exhibiting weak MAO-A inhibition (2.41 mmol/L). Two iridoid glycosides, geniposide (223 μmol/L) and 6'-O-trans-p-coumaroylgeniposide (127μmol/L), were selective MAO-B inhibitor. Especially, 6'-O-trans-p-coumaroylgeniposide exhibited more selective MAO-B inhibition than deprenyl, well-known MAO-B inhibitor for the treatment of early-stage Parkinson’s disease. The inhibitory activity of 3,5-di-hydroxy-1,7-bis (4-hydroxyphenyl) heptane was strong for MAO-B (196 μmol/L), modest for MAO-A (400 μmol/L), and weak for DBH (941 μmol/L). Ursolic acid exhibited significant inhibition of DBH (214 μmol/L), weak inhibition of MAO-B (780 μmol/L), and no inhibition against MAO-A. Consequently, G. jasminoides fruits are considerable for development of biofunctional food materials for the combination treatment of depression and neurodegenerative disorders
Papagianni, Maria; Avramidis, Nicholaos
2012-01-05
Lactococcus lactis is a widely used food bacterium mainly known for its fermentation metabolism. An important, and for long time overlooked, trait of this species is its ability to perform respiratory metabolism in the presence of heme and under aerobic conditions. There is no evidence however for the presence of an alternative respiration pathway and AOX activity. In this study, a cDNA fragment encoding the mitochondrial alternative oxidase, the enzyme responsible for alternative respiration, from a citric acid producing Aspergillus niger strain was cloned and expressed in L. lactis as a host strain. Expression of aox1 conferred on this organism cyanide-resistant and salicylhydroxamate-sensitive growth. Bioreactor cultures under fully aerobic conditions of the transformed L. lactis showed that the alternative respiratory pathway operates and improves significantly the microorganism's response to oxidizing stress conditions as it enhances biomass production, suppresses lactate formation, and leads to accumulation of large amounts of nisin. Copyright © 2011 Elsevier Inc. All rights reserved.
Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren
2015-01-01
Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054
Inhibition of Human Vascular NADPH Oxidase by Apocynin Derived Oligophenols
Mora-Pale, Mauricio; Weïwer, Michel; Yu, Jingjing; Linhardt, Robert J.; Dordick, Jonathan S.
2009-01-01
Enzymatic oxidation of apocynin, which may mimic in vivo metabolism, affords a large number of oligomers (apocynin oxidation products, AOP) that inhibit vascular NADPH oxidase. In vitro studies of NADPH oxidase activity were performed to identify active inhibitors, resulting in a trimer hydroxylated quinone (IIIHyQ) that inhibited NADPH oxidase with an IC50 = 31 nM. Apocynin itself possessed minimal inhibitory activity. NADPH oxidase is believed to be inhibited through prevention of the interaction between two NADPH oxidase subunits, p47phox and p22phox. To that end, while apocynin was unable to block the interaction of his-tagged p47phox with a surface immobilized biotinalyted p22phox peptide, the IIIHyQ product strongly interfered with this interaction (apparent IC50 = 1.6 μM). These results provide evidence that peroxidase-catalyzed AOP, which consist of oligomeric phenols and quinones, inhibit critical interactions that are involved in the assembly and activation of human vascular NADPH oxidase. PMID:19523836
Current status of NADPH oxidase research in cardiovascular pharmacology.
Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Alvarez, Ezequiel
2013-01-01
The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new
Current status of NADPH oxidase research in cardiovascular pharmacology
Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel
2013-01-01
The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new
Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei
2005-01-01
To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific
Lisko, Katherine A; Torres, Raquel; Harris, Rodney S; Belisle, Melinda; Vaughan, Martha M; Jullian, Berangère; Chevone, Boris I; Mendes, Pedro; Nessler, Craig L; Lorence, Argelia
2013-12-01
l-Ascorbic acid (vitamin C) is an abundant metabolite in plant cells and tissues. Ascorbate functions as an antioxidant, as an enzyme cofactor, and plays essential roles in multiple physiological processes including photosynthesis, photoprotection, control of cell cycle and cell elongation, and modulation of flowering time, gene regulation, and senescence. The importance of this key molecule in regulating whole plant morphology, cell structure, and plant development has been clearly established via characterization of low vitamin C mutants of Arabidopsis , potato, tobacco, tomato, and rice. However, the consequences of elevating ascorbate content in plant growth and development are poorly understood. Here we demonstrate that Arabidopsis lines over-expressing a myo -inositol oxygenase or an l-gulono-1,4-lactone oxidase, containing elevated ascorbate, display enhanced growth and biomass accumulation of both aerial and root tissues. To our knowledge this is the first study demonstrating such a marked positive effect in plant growth in lines engineered to contain elevated vitamin C content. In addition, we present evidence showing that these lines are tolerant to a wide range of abiotic stresses including salt, cold, and heat. Total ascorbate content of the transgenic lines remained higher than those of controls under the abiotic stresses tested. Interestingly, exposure to pyrene, a polycyclic aromatic hydrocarbon and known inducer of oxidative stress in plants, leads to stunted growth of the aerial tissue, reduction in the number of root hairs, and inhibition of leaf expansion in wild type plants, while these symptoms are less severe in the over-expressers. Our results indicate the potential of this metabolic engineering strategy to develop crops with enhanced biomass, abiotic stress tolerance, and phytoremediation capabilities.
Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.
2012-01-01
Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578
Oxygen activation in flavoprotein oxidases: the importance of being positive.
Gadda, Giovanni
2012-04-03
The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.
Góes, Luiz Gustavo Bentim; de Freitas, Antonio Carlos; Ferraz, Oilita Pereira; Rieger, Tania Tassinari; dos Santos, José Ferreira; Pereira, Alexandre; Beçak, Willy; Lindsey, Charles J.; de Cassia Stocco, Rita
2008-01-01
The development of a bovine papillomavirus (BPV) vaccine is an outstanding challenge. BPV protein L1 gene transfection in the Drosophila melanogaster S2 cell expression system failed to produce L1 protein notwithstanding correct L1 gene insertion. Severe genetic inbalance in the host cell line, including cytogenetic alterations, may account for the lack of protein expression. PMID:24031166
The First Mammalian Aldehyde Oxidase Crystal Structure
Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João
2012-01-01
Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336
Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V
2002-08-06
The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.
Involvement of the yciW gene in l-cysteine and l-methionine metabolism in Escherichia coli.
Kawano, Yusuke; Ohtsu, Iwao; Tamakoshi, Ai; Shiroyama, Maeka; Tsuruoka, Ai; Saiki, Kyohei; Takumi, Kazuhiro; Nonaka, Gen; Nakanishi, Tsuyoshi; Hishiki, Takako; Suematsu, Makoto; Takagi, Hiroshi
2015-03-01
We here analyzed a sulfur index of Escherichia coli using LC-MS/MS combined with thiol-specific derivatization by monobromobimane. The obtained sulfur index was then applied to evaluate the L-cysteine producer. E. coli cells overexpressing the yciW gene, a novel Cys regulon, accumulated l-homocysteine, suggesting that YciW is involved in L-methionine biosynthesis. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Purification and Characterization of Pyranose Oxidase from the White Rot Fungus Trametes multicolor
Leitner, Christian; Volc, Jindrich; Haltrich, Dietmar
2001-01-01
We purified an intracellular pyranose oxidase from mycelial extracts of the white rot fungus Trametes multicolor by using ammonium sulfate fractionation, hydrophobic interaction, ion-exchange chromatography, and gel filtration. The native enzyme has a molecular mass of 270 kDa as determined by equilibrium ultracentrifugation and is composed of four identical 68-kDa subunits as determined by matrix-assisted laser desorption ionization mass spectrometry. Each subunit contains one covalently bound flavin adenine dinucleotide as its prosthetic group. The enzyme oxidizes several aldopyranoses specifically at position C-2, and its preferred electron donor substrates are d-glucose, d-xylose, and l-sorbose. During this oxidation reaction electrons are transferred to oxygen, yielding hydrogen peroxide. In addition, the enzyme catalyzes the two-electron reduction of 1,4-benzoquinone, several substituted benzoquinones, and 2,6-dichloroindophenol, as well as the one-electron reduction of the ABTS [2,2′-azinobis(3-ethylbenzthiazolinesulfonic acid)] cation radical. As judged by the catalytic efficiencies (kcat/Km), some of these quinone electron acceptors are much better substrates for pyranose oxidase than oxygen. The optimum pH of the pyranose oxidase-catalyzed reaction depends strongly on the electron acceptor employed and varies from 4 to 8. It has been proposed that the main metabolic function of pyranose oxidase is as a constituent of the ligninolytic system of white rot fungi that provides peroxidases with H2O2. An additional function could be reduction of quinones, key intermediates that are formed during mineralization of lignin. PMID:11472941
Generating disulfides with the quiescin sulfhydryl oxidases
Heckler, Erin J.; Rancy, Pumtiwitt C.; Kodali, Vamsi K.; Thorpe, Colin
2008-01-01
The Quiescin-sulfhydryl oxidase (QSOX) family of flavoenzymes catalyzes the direct and facile insertion of disulfide bonds into unfolded reduced proteins with concomitant reduction of oxygen to hydrogen peroxide. This review discusses the chemical mechanism of these enzymes and the involvement of thioredoxin and flavin-binding domains in catalysis. The variability of CxxC motifs in the QSOX family is highlighted and attention is drawn to the steric factors that may promote efficient thiol/disulfide exchange during oxidative protein folding. The varied cellular location of these multi-domain sulfhydryl oxidases is reviewed and potential intracellular and extracellular roles are summarized. Finally, this review identifies important unresolved questions concerning this ancient family of sulfhydryl oxidases. PMID:17980160
Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.
2012-01-01
Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974
Shah, Syed Shoaib; Mohyuddin, Aisha; Colonna, Vincenza; Mehdi, Syed Qasim; Ayub, Qasim
2015-08-01
To investigate the association of monoamine oxidase Agene polymorphisms with aggression. The study was conducted in an ethnic community in Lahore, Pakistan, from August 2008 to December 2009 on the basis of data that was collected through a questionnaire between August 2004 and September 2005. It analysed 10 single nucleotide polymorphisms of monoamine oxidase A in unrelated males from the same ethnic background who were administered a Punjabi translation of the Buss and Perry aggression questionnaire. SPSS 13 was used for statistical analysis. Of the total 133 haplotypes studied, 52(39%) were Haplotype A, 58(43.6%) B, 8(6%) C, 3(2.3%) D, 9(6.8%) E and 3(2.3%) F. The six haplotypes were analysed for association with scores of the four subscales of the aggression questionnaire and multivariate analysis of variance showed no significant differences (p>0.05 each) in the error variances of the total scores and scores for three of the sub-scales across the haplotypes. The variance was significantly different only for the anger sub-scale (p<0.05). The association of an extended haplotype with low levels of self-reported aggression in this study should assist in characterisation of functional variants responsible for non-aggressive behaviour in male subjects.
Nota, Florencia; Cambiagno, Damián A; Ribone, Pamela; Alvarez, María E
2015-06-01
DNA glycosylases recognize and excise damaged or incorrect bases from DNA initiating the base excision repair (BER) pathway. Methyl-binding domain protein 4 (MBD4) is a member of the HhH-GPD DNA glycosylase superfamily, which has been well studied in mammals but not in plants. Our knowledge on the plant enzyme is limited to the activity of the Arabidopsis recombinant protein MBD4L in vitro. To start evaluating MBD4L in its biological context, we here characterized the structure, expression and effects of its gene, AtMBD4L. Phylogenetic analysis indicated that AtMBD4L belongs to one of the seven families of HhH-GPD DNA glycosylase genes existing in plants, and is unique on its family. Two AtMBD4L transcripts coding for active enzymes were detected in leaves and flowers. Transgenic plants expressing the AtMBD4L:GUS gene confined GUS activity to perivascular leaf tissues (usually adjacent to hydathodes), flowers (anthers at particular stages of development), and the apex of immature siliques. MBD4L-GFP fusion proteins showed nuclear localization in planta. Interestingly, overexpression of the full length MBD4L, but not a truncated enzyme lacking the DNA glycosylase domain, induced the BER gene LIG1 and enhanced tolerance to oxidative stress. These results suggest that endogenous MBD4L acts on particular tissues, is capable of activating BER, and may contribute to repair DNA damage caused by oxidative stress. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Rincón, J; Correia, D; Arcaya, J L; Finol, E; Fernández, A; Pérez, M; Yaguas, K; Talavera, E; Chávez, M; Summer, R; Romero, F
2015-03-01
Activation of the renin-angiotensin system (RAS), renal oxidative stress and inflammation are constantly present in experimental hypertension. Nitric oxide (NO) inhibition with N(w)-nitro-L-arginine methyl ester (L-NAME) has previously been reported to produce hypertension, increased expression of Angiotensin II (Ang II) and renal dysfunction. The use of Losartan, an Ang II type 1 receptor (AT1R) antagonist has proven to be effective reducing hypertension and renal damage; however, the mechanism by which AT1R blockade reduced kidney injury and normalizes blood pressure in this experimental model is still complete unknown. The current study was designed to test the hypothesis that AT1R activation promotes renal NAD(P)H oxidase up-regulation, oxidative stress and cytokine production during L-NAME induced-hypertension. Male Sprague-Dawley rats were distributed in three groups: L-NAME, receiving 70 mg/100ml of L-NAME, L-NAME+Los, receiving 70 mg/100ml of L-NAME and 40 mg/kg/day of Losartan; and Controls, receiving water instead of L-NAME or L-NAME and Losartan. After two weeks, L-NAME induced high blood pressure, renal overexpression of AT1R, NAD(P)H oxidase sub-units gp91, p22 and p47, increased levels of oxidative stress, interleukin-6 (IL-6) and interleukin-17 (IL-17). Also, we found increased renal accumulation of lymphocytes and macrophages. Losartan treatment abolished the renal expression of gp91, p22, p47, oxidative stress and reduced NF-κB activation and IL-6 expression. These findings indicate that NO induced-hypertension is associated with up-regulation of NADPH oxidase, oxidative stress production and overexpression of key inflammatory mediators. These events are associated with up-regulation of AT1R, as evidenced by their reversal with AT1R blocker treatment. Copyright © 2015 Elsevier Inc. All rights reserved.
Koo, Bon Hyeock; Yi, Bong Gu; Wang, Wi Kwang; Ko, In Young; Hoe, Kwang Lae; Kwon, Young Guen; Won, Moo Ho; Kim, Young Myeong; Lim, Hyun Kyo; Ryoo, Sungwoo
2018-05-01
Vascular smooth muscle cell (VSMC) proliferation induced by native low-density lipoprotein (nLDL) stimulation is dependent on superoxide production from activated NADPH oxidase. The present study aimed to investigate whether the novel arginase inhibitor limonin could suppress nLDL-induced VSMC proliferation and to examine related mechanisms. Isolated VSMCs from rat aortas were treated with nLDL, and cell proliferation was measured by WST-1 and BrdU assays. NADPH oxidase activation was evaluated by lucigenin-induced chemiluminescence, and phosphorylation of protein kinase C (PKC) βII and extracellular signal-regulated kinase (ERK) 1/2 was determined by western blot analysis. Mitochondrial reactive oxygen species (ROS) generation was assessed using MitoSOX-red, and intracellular L-arginine concentrations were determined by high-performance liquid chromatography (HPLC) in the presence or absence of limonin. Limonin inhibited arginase I and II activity in the uncompetitive mode, and prevented nLDL-induced VSMC proliferation in a p21Waf1/Cip1-dependent manner without affecting arginase protein levels. Limonin blocked PKCβII phosphorylation, but not ERK1/2 phosphorylation, and translocation of p47phox to the membrane was decreased, as was superoxide production in nLDL-stimulated VSMCs. Moreover, mitochondrial ROS generation was increased by nLDL stimulation and blocked by preincubation with limonin. Mitochondrial ROS production was responsible for the phosphorylation of PKCβII. HPLC analysis showed that arginase inhibition with limonin increases intracellular L-arginine concentrations, but decreases polyamine concentrations. L-Arginine treatment prevented PKCβII phosphorylation without affecting ERK1/2 phosphorylation. Increased L-arginine levels following limonin-dependent arginase inhibition prohibited NADPH oxidase activation in a PKCβII-dependent manner, and blocked nLDL-stimulated VSMC proliferation. © Copyright: Yonsei University College of Medicine 2018.
Wang, Wi-Kwang; Ko, In-Young; Hoe, Kwang-Lae; Kwon, Young-Guen; Won, Moo-Ho; Kim, Young-Myeong
2018-01-01
Purpose Vascular smooth muscle cell (VSMC) proliferation induced by native low-density lipoprotein (nLDL) stimulation is dependent on superoxide production from activated NADPH oxidase. The present study aimed to investigate whether the novel arginase inhibitor limonin could suppress nLDL-induced VSMC proliferation and to examine related mechanisms. Materials and Methods Isolated VSMCs from rat aortas were treated with nLDL, and cell proliferation was measured by WST-1 and BrdU assays. NADPH oxidase activation was evaluated by lucigenin-induced chemiluminescence, and phosphorylation of protein kinase C (PKC) βII and extracellular signal-regulated kinase (ERK) 1/2 was determined by western blot analysis. Mitochondrial reactive oxygen species (ROS) generation was assessed using MitoSOX-red, and intracellular L-arginine concentrations were determined by high-performance liquid chromatography (HPLC) in the presence or absence of limonin. Results Limonin inhibited arginase I and II activity in the uncompetitive mode, and prevented nLDL-induced VSMC proliferation in a p21Waf1/Cip1-dependent manner without affecting arginase protein levels. Limonin blocked PKCβII phosphorylation, but not ERK1/2 phosphorylation, and translocation of p47phox to the membrane was decreased, as was superoxide production in nLDL-stimulated VSMCs. Moreover, mitochondrial ROS generation was increased by nLDL stimulation and blocked by preincubation with limonin. Mitochondrial ROS production was responsible for the phosphorylation of PKCβII. HPLC analysis showed that arginase inhibition with limonin increases intracellular L-arginine concentrations, but decreases polyamine concentrations. L-Arginine treatment prevented PKCβII phosphorylation without affecting ERK1/2 phosphorylation. Conclusion Increased L-arginine levels following limonin-dependent arginase inhibition prohibited NADPH oxidase activation in a PKCβII-dependent manner, and blocked nLDL-stimulated VSMC proliferation. PMID
Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje
2014-01-01
Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
THE PREPARATION AND PROPERTIES OF HIGHLY PURIFIED ASCORBIC ACID OXIDASE
Powers, Wendell H.; Lewis, Stanley; Dawson, Charles R.
1944-01-01
1. A method is described for the preparation of a highly purified ascorbic acid oxidase containing 0.24 per cent copper. 2. Using comparable activity measurements, this oxidase is about one and a half times as active on a dry weight basis as the hitherto most highly purified preparation described by Lovett-Janison and Nelson. The latter contained 0.15 per cent copper. 3. The oxidase activity is proportional to the copper content and the proportionality factor is the same as that reported by Lovett-Janison and Nelson. 4. When dialyzed free of salt, the blue concentrated oxidase solutions precipitate a dark green-blue protein which carries the activity. This may be prevented by keeping the concentrated solutions about 0.1 M in Na2HPO4. 5. When highly diluted for activity measurements the oxidase rapidly loses activity (irreversibly) previous to the measurement, unless the dilution is made with a dilute inert protein (gelatin) solution. Therefore activity values obtained using such gelatin-stabilized dilute solutions of the oxidase run considerably higher than values obtained by the Lovett-Janison and Nelson technique. 6. The effect of pH and substrate concentration on the activity of the purified oxidase in the presence and absence of inert protein was studied. PMID:19873382
Lange, T; Hedden, P; Graebe, J E
1994-01-01
In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.
Gudkova, O O; Latyshko, N V; Shandrenko, S G
2016-01-01
In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
USDA-ARS?s Scientific Manuscript database
Glyphosate-resistant (GR) canola expresses two transgenes: 1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and 2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshiki...
Biddle, Jennifer F.; Siebert, Jason R.; Staunton, Eric; Hegg, Eric L.; Matthysse, Ann G.; Teske, Andreas
2013-01-01
Orange, white, and yellow vacuolated Beggiatoaceae filaments are visually dominant members of microbial mats found near sea floor hydrothermal vents and cold seeps, with orange filaments typically concentrated toward the mat centers. No marine vacuolate Beggiatoaceae are yet in pure culture, but evidence to date suggests they are nitrate-reducing, sulfide-oxidizing bacteria. The nearly complete genome sequence of a single orange Beggiatoa (“Candidatus Maribeggiatoa”) filament from a microbial mat sample collected in 2008 at a hydrothermal site in Guaymas Basin (Gulf of California, Mexico) was recently obtained. From this sequence, the gene encoding an abundant soluble orange-pigmented protein in Guaymas Basin mat samples (collected in 2009) was identified by microcapillary reverse-phase high-performance liquid chromatography (HPLC) nano-electrospray tandem mass spectrometry (μLC–MS-MS) of a pigmented band excised from a denaturing polyacrylamide gel. The predicted protein sequence is related to a large group of octaheme cytochromes whose few characterized representatives are hydroxylamine or hydrazine oxidases. The protein was partially purified and shown by in vitro assays to have hydroxylamine oxidase, hydrazine oxidase, and nitrite reductase activities. From what is known of Beggiatoaceae physiology, nitrite reduction is the most likely in vivo role of the octaheme protein, but future experiments are required to confirm this tentative conclusion. Thus, while present-day genomic and proteomic techniques have allowed precise identification of an abundant mat protein, and its potential activities could be assayed, proof of its physiological role remains elusive in the absence of a pure culture that can be genetically manipulated. PMID:23220958
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P
1995-07-01
Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.
Malagnac, Fabienne; Lalucque, Hervé; Lepère, Gersende; Silar, Philippe
2004-11-01
NADPH oxidases are enzymes that produce reactive oxygen species (ROS) using electrons derived from intracellular NADPH. In plants and mammals, ROS have been proposed to be second messengers that signal defence responses or cell proliferation. By inactivating PaNox1 and PaNox2, two genes encoding NADPH oxidases, we demonstrate the crucial role of these enzymes in the control of two key steps of the filamentous fungus Podospora anserina life cycle. PaNox1 mutants are impaired in the differentiation of fruiting bodies from their progenitor cells, and the deletion of the PaNox2 gene specifically blocks ascospore germination. Furthermore, we show that PaNox1 likely acts upstream of PaASK1, a MAPKKK previously implicated in stationary phase differentiation and cell degeneration. Using nitro blue tetrazolium (NBT) and diaminobenzidine (DAB) assays, we detect a regulated secretion of both superoxide and peroxide during P. anserina vegetative growth. In addition, two oxidative bursts are shown to occur during fruiting body development and ascospore germination. Analysis of mutants establishes that PaNox1, PaNox2, and PaASK1, as well as a still unknown additional source of ROS, modulate these secretions. Altogether, our data point toward a role for NADPH oxidases in signalling fungal developmental transitions with respect to nutrient availability. These enzymes are conserved in other multicellular eukaryotes, suggesting that early eukaryotes were endowed with a redox network used for signalling purposes.
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-01-01
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag+-responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism. PMID:28304398
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-03-17
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.
Heterologous expression and characterization of mouse spermine oxidase.
Cervelli, Manuela; Polticelli, Fabio; Federico, Rodolfo; Mariottini, Paolo
2003-02-14
Polyamine oxidases are key enzymes responsible of the polyamine interconversion metabolism in animal cells. Recently, a novel enzyme belonging to this class of enzymes has been characterized for its capability to oxidize preferentially spermine and designated as spermine oxidase. This is a flavin adenine dinucleotide-containing enzyme, and it has been expressed both in vitro and in vivo systems. The primary structure of mouse spermine oxidase (mSMO) was deduced from a cDNA clone (Image Clone 264769) recovered by a data base search utilizing the human counterpart of polyamine oxidases, PAOh1. The open reading frame predicts a 555-amino acid protein with a calculated M(r) of 61,852.30, which shows a 95.1% identity with PAOh1. To understand the biochemical properties of mSMO and its structure/function relationship, the mSMO cDNA has been subcloned and expressed in secreted and secreted-tagged forms into Escherichia coli BL21 DE3 cells. The recombinant enzyme shows an optimal pH value of 8.0 and is able to oxidize rapidly spermine to spermidine and 3-aminopropanal and fails to act upon spermidine and N(1)-acetylpolyamines. The purified recombinant-tagged form enzyme (M(r) approximately 68,000) has K(m) and k(cat) values of 90 microm and 4.5 s(-1), respectively, using spermine as substrate at pH 8.0. Molecular modeling of mSMO protein based on maize polyamine oxidase three-dimensional structure suggests that the general features of maize polyamine oxidase active site are conserved in mSMO.
Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong
2016-01-01
Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324
A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.
Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y
2001-02-01
Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.
Xu, Man K.; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J. S.; Croudace, Tim J.; Barnett, Jennifer H.; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B.
2017-01-01
Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits. PMID:29075213
Xu, Man K; Gaysina, Darya; Tsonaka, Roula; Morin, Alexandre J S; Croudace, Tim J; Barnett, Jennifer H; Houwing-Duistermaat, Jeanine; Richards, Marcus; Jones, Peter B
2017-01-01
Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene ( MAOA ) on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD). The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606). Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG) was associated with lower extraversion score at age 16 (β = -0.167; CI: -0.289, -0.045; p = 0.007, FDRp = 0.042), as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036). No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.
Kim, Hong-Il; Kim, Jong-Hyeon; Park, Young-Jin
2016-03-09
Corynebacterium glutamicum is widely used for amino acid production. In the present study, 543 genes showed a significant change in their mRNA expression levels in L-lysine-producing C. glutamicum ATCC21300 than that in the wild-type C. glutamicum ATCC13032. Among these 543 differentially expressed genes (DEGs), 28 genes were up- or downregulated. In addition, 454 DEGs were functionally enriched and categorized based on BLAST sequence homologies and gene ontology (GO) annotations using the Blast2GO software. Interestingly, NCgl0071 (bioB, encoding biotin synthase) was expressed at levels ~20-fold higher in the L-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain. Five other genes involved in biotin metabolism or transport--NCgl2515 (bioA, encoding adenosylmethionine-8-amino-7-oxononanoate aminotransferase), NCgl2516 (bioD, encoding dithiobiotin synthetase), NCgl1883, NCgl1884, and NCgl1885--were also expressed at significantly higher levels in the L-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain, which we determined using both next-generation RNA sequencing and quantitative real-time PCR analysis. When we disrupted the bioB gene in C. glutamicum ATCC21300, L-lysine production decreased by approximately 76%, and the three genes involved in biotin transport (NCgl1883, NCgl1884, and NCgl1885) were significantly downregulated. These results will be helpful to improve our understanding of C. glutamicum for industrial amino acid production.
Putting together a plasma membrane NADH oxidase: a tale of three laboratories.
Löw, Hans; Crane, Frederick L; Morré, D James
2012-11-01
The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.
Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R
1994-10-01
We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.
Reyes-Prieto, Adrián; El-Hafidi, Mohammed; Moreno-Sánchez, Rafael; González-Halphen, Diego
2002-07-01
The presence of an alternative oxidase (AOX) in Polytomella sp., a colorless relative of Chlamydomonas reinhardtii, was explored. Oxygen uptake in Polytomella sp. mitochondria was inhibited by KCN (94%) or antimycin (96%), and the remaining cyanide-resistant respiration was not blocked by the AOX inhibitors salicylhydroxamic acid (SHAM) or n-propylgallate. No stimulation of an AOX activity was found upon addition of either pyruvate, alpha-ketoglutarate, or AMP, or by treatment with DTT. An antibody raised against C. reinhardtii AOX did not recognized any polypeptide band of Polytomella sp. mitochondria in Western blots. Also, PCR experiments and Southern blot analysis failed to identify an Aox gene in this colorless alga. Finally, KCN exposure of cell cultures failed to stimulate an AOX activity. Nevertheless, KCN exposure of Polytomella sp. cells induced diminished mitochondrial respiration (20%) and apparent changes in cytochrome c oxidase affinity towards cyanide. KCN-adapted cells exhibited a significant increase of a-type cytochromes, suggesting accumulation of inactive forms of cytochrome c oxidase. Another effect of KCN exposure was the reduction of the protein/fatty acid ratio of mitochondrial membranes, which may affect the observed respiratory activity. We conclude that Polytomella lacks a plant-like AOX, and that its corresponding gene was probably lost during the divergence of this colorless genus from its close photosynthetic relatives.
NADPH oxidases: novel therapeutic targets for neurodegenerative diseases.
Gao, Hui-Ming; Zhou, Hui; Hong, Jau-Shyong
2012-06-01
Oxidative stress is a key pathologic factor in neurodegenerative diseases such as Alzheimer and Parkinson diseases (AD, PD). The failure of free-radical-scavenging antioxidants in clinical trials pinpoints an urgent need to identify and to block major sources of oxidative stress in neurodegenerative diseases. As a major superoxide-producing enzyme complex in activated phagocytes, phagocyte NADPH oxidase (PHOX) is essential for host defense. However, recent preclinical evidence has underscored a pivotal role of overactivated PHOX in chronic neuroinflammation and progressive neurodegeneration. Deficiency in PHOX subunits mitigates neuronal damage induced by diverse insults/stresses relevant to neurodegenerative diseases. More importantly, suppression of PHOX activity correlates with reduced neuronal impairment in models of neurodegenerative diseases. The discovery of PHOX and non-phagocyte NADPH oxidases in astroglia and neurons further reinforces the crucial role of NADPH oxidases in oxidative stress-mediated chronic neurodegeneration. Thus, proper modulation of NADPH oxidase activity might hold therapeutic potential for currently incurable neurodegenerative diseases. Published by Elsevier Ltd.
Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du
2016-12-01
Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.
Howard, John; Finch, Nicole A; Ochrietor, Judith D
2010-07-01
The purpose of this study was to determine the binding affinities of Basigin gene products and neural cell adhesion molecule L1cam for monocarboxylate transporter-1 (MCT1). ELISA binding assays were performed in which recombinant proteins of the transmembrane domains of Basigin gene products and L1cam were incubated with MCT1 captured from mouse brain. It was determined that Basigin gene products bind MCT1 with moderate affinity, but L1cam does not bind MCT1. Despite a high degree of sequence conservation between Basigin gene products and L1cam, the sequences are different enough to prevent L1cam from interacting with MCT1.
O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F
1984-08-15
The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.
Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.
Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M
2003-12-01
Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.
Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D
2004-06-18
To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.
In vitro study of 6-mercaptopurine oxidation catalysed by aldehyde oxidase and xanthine oxidase.
Rashidi, Mohammad-Reza; Beedham, Christine; Smith, John S; Davaran, Soodabeh
2007-08-01
In spite of over 40 years of clinical use of 6-mercaptopurine, many aspects of complex pharmacology and metabolism of this drug remain unclear. It is thought that 6-mercaptopurine is oxidized to 6-thiouric acid through 6-thioxanthine or 8-oxo-6-mercaptopurine by one of two molybdenum hydroxylases, xanthine oxidase (XO), however, the role of other molybdenum hydroxylase, aldehyde oxidase (AO), in the oxidation of 6-mercaptopurine and possible interactions of AO substrates and inhibitors has not been investigated in more details. In the present study, the role of AO and XO in the oxidation of 6- mercaptopurine has been investigated. 6-mercaptopurine was incubated with bovine milk xanthine oxidase or partially purified guinea pig liver molybdenum hydroxylase fractions in the absence and presence of XO and AO inhibitor/substrates, and the reactions were monitored by spectrophotometric and HPLC methods. According to the results obtained from the inhibition studies, it is more likely that 6- mercaptopurine is oxidized to 6-thiouric acid via 6-thioxanthine rather than 8-oxo-6-mercaptopurine. The first step which is the rate limiting step is catalyzed solely by XO, whereas both XO and AO are involved in the oxidation of 6-thioxanthine to 6-thiouric acid.
Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo
2006-12-01
Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.
Tamayo-Ramos, Juan A; Flipphi, Michel; Pardo, Ester; Manzanares, Paloma; Orejas, Margarita
2012-02-21
Little is known about the structure and regulation of fungal α-L-rhamnosidase genes despite increasing interest in the biotechnological potential of the enzymes that they encode. Whilst the paradigmatic filamentous fungus Aspergillus nidulans growing on L-rhamnose produces an α-L-rhamnosidase suitable for oenological applications, at least eight genes encoding putative α-L-rhamnosidases have been found in its genome. In the current work we have identified the gene (rhaE) encoding the former activity, and characterization of its expression has revealed a novel regulatory mechanism. A shared pattern of expression has also been observed for a second α-L-rhamnosidase gene, (AN10277/rhaA). Amino acid sequence data for the oenological α-L-rhamnosidase were determined using MALDI-TOF mass spectrometry and correspond to the amino acid sequence deduced from AN7151 (rhaE). The cDNA of rhaE was expressed in Saccharomyces cerevisiae and yielded pNP-rhamnohydrolase activity. Phylogenetic analysis has revealed this eukaryotic α-L-rhamnosidase to be the first such enzyme found to be more closely related to bacterial rhamnosidases than other α-L-rhamnosidases of fungal origin. Northern analyses of diverse A. nidulans strains cultivated under different growth conditions indicate that rhaA and rhaE are induced by L-rhamnose and repressed by D-glucose as well as other carbon sources, some of which are considered to be non-repressive growth substrates. Interestingly, the transcriptional repression is independent of the wide domain carbon catabolite repressor CreA. Gene induction and glucose repression of these rha genes correlate with the uptake, or lack of it, of the inducing carbon source L-rhamnose, suggesting a prominent role for inducer exclusion in repression. The A. nidulans rhaE gene encodes an α-L-rhamnosidase phylogenetically distant to those described in filamentous fungi, and its expression is regulated by a novel CreA-independent mechanism. The identification of
Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.
Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W
2016-11-04
By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B
2008-02-01
The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.
Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin
2016-09-01
Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5.
Adenovirus-mediated p53 gene delivery inhibits 9L glioma growth in rats.
Badie, B; Drazan, K E; Kramar, M H; Shaked, A; Black, K L
1995-06-01
Adenoviral vectors have recently been shown to effectively deliver genes into a variety of tissues. Since these vectors have some advantages over the more extensively investigated retroviruses, we studied the effect of two replication-defective adenovectors bearing human wild type tumor suppressor gene p53 (Adp53) and Escherichia coli beta-galactosidase gene (AdLacZ) on 9L glioma cells. Successful in vitro gene transfer was shown by DNA polymerase chain reaction (PCR), and expression was confirmed by reverse transcriptase RNA PCR and Western blot analyses. Transduction of 9L cells with the Adp53 inhibited cell growth and induced phenotypic changes consistent with cell death at low titers, while AdLacZ caused cytopathic changes only at high titers. Stereotactic injection of AdLacZ (10(7) plaque forming units) into tumor bed stained 25 to 30% of tumor cells at the site of vector delivery. Injection of Adp53 (10(7) plaque forming units), but not AdLacZ (controls), into established 4-day old 9L glioma brain tumors decreased tumor volume by 40% after 14 days. As a step toward gene therapy of brain tumors using replication-defective adenoviruses, these data support the use of tumor suppressor gene transfer for in vivo treatment of whole animal brain tumor models.
Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo
2016-10-01
Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process.
Plant sterol biosynthesis: identification of two distinct families of sterol 4alpha-methyl oxidases.
Darnet, Sylvain; Rahier, Alain
2004-01-01
In plants, the conversion of cycloartenol into functional phytosterols requires the removal of the two methyl groups at C-4 by an enzymic complex including a sterol 4alpha-methyl oxidase (SMO). We report the cloning of candidate genes for SMOs in Arabidopsis thaliana, belonging to two distinct families termed SMO1 and SMO2 and containing three and two isoforms respectively. SMO1 and SMO2 shared low sequence identity with each other and were orthologous to the ERG25 gene from Saccharomyces cerevisiae which encodes the SMO. The plant SMO amino acid sequences possess all the three histidine-rich motifs (HX3H, HX2HH and HX2HH), characteristic of the small family of membrane-bound non-haem iron oxygenases that are involved in lipid oxidation. To elucidate the precise functions of SMO1 and SMO2 gene families, we have reduced their expression by using a VIGS (virus-induced gene silencing) approach in Nicotiana benthamiana. SMO1 and SMO2 cDNA fragments were inserted into a viral vector and N. benthamiana inoculated with the viral transcripts. After silencing with SMO1, a substantial accumulation of 4,4-dimethyl-9beta,19-cyclopropylsterols (i.e. 24-methylenecycloartanol) was obtained, whereas qualitative and quantitative levels of 4alpha-methylsterols were not affected. In the case of silencing with SMO2, a large accumulation of 4alpha-methyl-Delta7-sterols (i.e. 24-ethylidenelophenol and 24-ethyllophenol) was found, with no change in the levels of 4,4-dimethylsterols. These clear and distinct biochemical phenotypes demonstrate that, in contrast with animals and fungi, in photosynthetic eukaryotes, these two novel families of cDNAs are coding two distinct types of C-4-methylsterol oxidases controlling the level of 4,4-dimethylsterol and 4alpha-methylsterol precursors respectively. PMID:14653780
d-Aspartate oxidase influences glutamatergic system homeostasis in mammalian brain.
Cristino, Luigia; Luongo, Livio; Squillace, Marta; Paolone, Giovanna; Mango, Dalila; Piccinin, Sonia; Zianni, Elisa; Imperatore, Roberta; Iannotta, Monica; Longo, Francesco; Errico, Francesco; Vescovi, Angelo Luigi; Morari, Michele; Maione, Sabatino; Gardoni, Fabrizio; Nisticò, Robert; Usiello, Alessandro
2015-05-01
We have investigated the relevance of d-aspartate oxidase, the only enzyme known to selectively degrade d-aspartate (d-Asp), in modulating glutamatergic system homeostasis. Interestingly, the lack of the Ddo gene, by raising d-Asp content, induces a substantial increase in extracellular glutamate (Glu) levels in Ddo-mutant brains. Consistent with an exaggerated and persistent N-methyl-d-aspartate receptor (NMDAR) stimulation, we documented in Ddo knockouts severe age-dependent structural and functional alterations mirrored by expression of active caspases 3 and 7 along with appearance of dystrophic microglia and reactive astrocytes. In addition, prolonged elevation of d-Asp triggered in mutants alterations of NMDAR-dependent synaptic plasticity associated to reduction of hippocampal GluN1 and GluN2B subunits selectively located at synaptic sites and to increase in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-to-N-methyl-d-aspartate ratio. These effects, all of which converged on a progressive hyporesponsiveness at NMDAR sites, functionally resulted in a greater vulnerability to phencyclidine-induced prepulse inhibition deficits in mutants. In conclusion, our results indicate that d-aspartate oxidase, by strictly regulating d-Asp levels, impacts on the homeostasis of glutamatergic system, thus preventing accelerated neurodegenerative processes. Copyright © 2015 Elsevier Inc. All rights reserved.
Molitor, Christian; Mauracher, Stephan Gerhard
2016-01-01
Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571
Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T
1987-01-01
The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486
Stebegg, Ronald; Wurzinger, Bernhard; Mikulic, Markus
2012-01-01
Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium commonly used as a model organism for studying cyanobacterial cell differentiation and nitrogen fixation. For many decades, this cyanobacterium was considered an obligate photo-lithoautotroph. We now discovered that this strain is also capable of mixotrophic, photo-organoheterotrophic, and chemo-organoheterotrophic growth if high concentrations of fructose (at least 50 mM and up to 200 mM) are supplied. Glucose, a substrate used by some facultatively organoheterotrophic cyanobacteria, is not effective in Anabaena sp. PCC 7120. The gtr gene from Synechocystis sp. PCC 6803 encoding a glucose carrier was introduced into Anabaena sp. PCC 7120. Surprisingly, the new strain containing the gtr gene did not grow on glucose but was very sensitive to glucose, with a 5 mM concentration being lethal, whereas the wild-type strain tolerated 200 mM glucose. The Anabaena sp. PCC 7120 strain containing gtr can grow mixotrophically and photo-organoheterotrophically, but not chemo-organoheterotrophically with fructose. Anabaena sp. PCC 7120 contains five respiratory chains ending in five different respiratory terminal oxidases. One of these enzymes is a mitochondrial-type cytochrome c oxidase. As in almost all cyanobacteria, this enzyme is encoded by three adjacent genes called coxBAC1. When this locus was disrupted, the cells lost the capability for chemo-organoheterotrophic growth. PMID:22730128
Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T
2013-11-01
Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.
Nag, Sangram; Lehmann, Lutz; Heinrich, Tobias; Thiele, Andrea; Kettschau, Georg; Nakao, Ryuji; Gulyás, Balázs; Halldin, Christer
2011-10-27
The aim in this project was to synthesize and to study fluorine-18 labeled analogues of l-deprenyl which bind selectively to the enzyme monoamine oxidase B (MAO-B). Three fluorinated l-deprenyl analogues have been generated in multistep organic syntheses. The most promising fluorine-18 compound N-[(2S)-1-[(18)F]fluoro-3-phenylpropan-2-yl]-N-methylprop-2-yn-1-amine (4c) was synthesized by a one-step fluorine-18 nucleophilic substitution reaction. Autoradiography on human brain tissue sections demonstrated specific binding for compound 4c to brain regions known to have a high content of MAO-B. In addition, the corresponding nonradioactive fluorine-19 compound (13) inhibited recombinant human MAO-B with an IC(50) of 170.5 ± 29 nM but did not inhibit recombinant human MAO-A (IC(50) > 2000 nM), demonstrating its specificity. Biodistribution of 4c in mice showed high initial brain uptake leveling at 5.2 ± 0.04%ID/g after 2 min post injection. In conclusion, compound 4c is a specific inhibitor of MAO-B with high initial brain uptake in mice and is, therefore, a candidate for further investigation in PET.
USDA-ARS?s Scientific Manuscript database
Incubation of dormant wild oat (Avena fatua L., isoline M73) caryopses for 1 to 3 days with Fusarium avenaceum seed-decay isolate F.a.1 induced activity of the plant defense enzyme polyphenol oxidase (PPO). Both extracts and leachates obtained from F.a.1-treated caryopses had decreased abundance of ...
Oxygen control of ethylene biosynthesis during seed development in Arabidopsis thaliana (L.) Heynh
NASA Technical Reports Server (NTRS)
Ramonell, K. M.; McClure, G.; Musgrave, M. E.
2002-01-01
An unforeseen side-effect on plant growth in reduced oxygen is the loss of seed production at concentrations around 25% atmospheric (50 mmol mol-1 O2). In this study, the model plant Arabidopsis thaliana (L.) Heynh. cv. 'Columbia' was used to investigate the effect of low oxygen on ethylene biosynthesis during seed development. Plants were grown in a range of oxygen concentrations (210 [equal to ambient], 160, 100, 50 and 25 mmol mol-1) with 0.35 mmol mol-1 CO2 in N2. Ethylene in full-sized siliques was sampled using gas chromatography, and viable seed production was determined at maturity. Molecular analysis of ethylene biosynthesis was accomplished using cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase in ribonuclease protection assays and in situ hybridizations. No ethylene was detected in siliques from plants grown at 50 and 25 mmol mol-1 O2. At the same time, silique ACC oxidase mRNA increased three-fold comparing plants grown under the lowest oxygen with ambient controls, whereas ACC synthase mRNA was unaffected. As O2 decreased, tissue-specific patterning of ACC oxidase and ACC synthase gene expression shifted from the embryo to the silique wall. These data demonstrate how low O2 modulates the activity and expression of the ethylene biosynthetic pathway during seed development in Arabidopsis.
Three-dimensional organization of three-domain copper oxidases: A review
NASA Astrophysics Data System (ADS)
Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.
2008-01-01
“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.
NADPH OXIDASE: STRUCTURE AND ACTIVATION MECHANISMS (REVIEW). NOTE I.
Filip-Ciubotaru, Florina; Manciuc, Carmen; Stoleriu, Gabriela; Foia, Liliana
2016-01-01
NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase), with its generically termed NOX isoforms, is the major source of ROS (reactive oxigen species) in biological systems. ROS are small oxygen-derived molecules with an important role in various biological processes (physiological or pathological). If under physiological conditions some processes are beneficial and necessary for life, under pathophysiological conditions they are noxious, harmful. NADPH oxidases are present in phagocytes and in a wide variety of nonphagocytic cells. The enzyme generates superoxide by transferring electrons from NADPH inside the cell across the membrane and coupling them to molecular oxygen to produce superoxide anion, a reactive free-radical. Structurally, NADPH oxidase is a multicomponent enzyme which includes two integral membrane proteins, glycoprotein gp9 1 Phox and adaptor protein p22(phox), which together form the heterodimeric flavocytochrome b558 that constitutes the core of the enzyme. During the resting state, the multidomain regulatory subunits p40P(phox), p47(phox), p67(Phox) are located in the cytosol organized as a complex. The activation of phagocytic NADPH oxidase occurs through a complex series of protein interactions.
Ebert, Matthias; Laaß, Sebastian; Thürmer, Andrea; Roselius, Louisa; Eckweiler, Denitsa; Daniel, Rolf; Härtig, Elisabeth; Jahn, Dieter
2017-01-01
The heterotrophic marine bacterium Dinoroseobacter shibae utilizes aerobic respiration and anaerobic denitrification supplemented with aerobic anoxygenic photosynthesis for energy generation. The aerobic to anaerobic transition is controlled by four Fnr/Crp family regulators in a unique cascade-type regulatory network. FnrL is utilizing an oxygen-sensitive Fe-S cluster for oxygen sensing. Active FnrL is inducing most operons encoding the denitrification machinery and the corresponding heme biosynthesis. Activation of gene expression of the high oxygen affinity cbb3-type and repression of the low affinity aa3-type cytochrome c oxidase is mediated by FnrL. Five regulator genes including dnrE and dnrF are directly controlled by FnrL. Multiple genes of the universal stress protein (USP) and cold shock response are further FnrL targets. DnrD, most likely sensing NO via a heme cofactor, co-induces genes of denitrification, heme biosynthesis, and the regulator genes dnrE and dnrF. DnrE is controlling genes for a putative Na+/H+ antiporter, indicating a potential role of a Na+ gradient under anaerobic conditions. The formation of the electron donating primary dehydrogenases is coordinated by FnrL and DnrE. Many plasmid encoded genes were DnrE regulated. DnrF is controlling directly two regulator genes including the Fe-S cluster biosynthesis regulator iscR, genes of the electron transport chain and the glutathione metabolism. The genes for nitrate reductase and CO dehydrogenase are repressed by DnrD and DnrF. Both regulators in concert with FnrL are inducing the photosynthesis genes. One of the major denitrification operon control regions, the intergenic region between nirS and nosR2, contains one Fnr/Dnr binding site. Using regulator gene mutant strains, lacZ-reporter gene fusions in combination with promoter mutagenesis, the function of the single Fnr/Dnr binding site for FnrL-, DnrD-, and partly DnrF-dependent nirS and nosR2 transcriptional activation was shown. Overall
Beerlage, Christiane; Greb, Jessica; Kretschmer, Dorothee; Assaggaf, Mohammad; Trackman, Philip C.; Hansmann, Martin-Leo; Bonin, Michael; Eble, Johannes A.; Peschel, Andreas; Brüne, Bernhard
2013-01-01
Hypoxia-inducible factor 1 (HIF-1) is the key transcription factor involved in the adaptation of mammals to hypoxia and plays a crucial role in cancer angiogenesis. Recent evidence suggests a leading role for HIF-1 in various inflammatory and infectious diseases. Here we describe the role of HIF-1 in Staphylococcus aureus infections by investigating the HIF-1-dependent host cell response. For this purpose, transcriptional profiling of HIF-1α-deficient HepG2 and control cells, both infected with Staphylococcus aureus, was performed. Four hours after infection, the expression of 190 genes, 24 of which were regulated via HIF-1, was influenced. LOX (encoding lysyl oxidase) was one of the upregulated genes with a potential impact on the course of S. aureus infection. LOX is an amine oxidase required for biosynthetic cross-linking of extracellular matrix components. LOX was upregulated in vitro in different cell cultures infected with S. aureus and also in vivo, in kidney abscesses of mice intravenously infected with S. aureus and in clinical skin samples from patients with S. aureus infections. Inhibition of LOX by β-aminopropionitrile (BAPN) did not affect the bacterial load in kidneys or blood but significantly influenced abscess morphology and collagenization. Our data provide evidence for a crucial role of HIF-1-regulated LOX in abscess formation. PMID:23649089
Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred
2016-11-01
Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. Copyright © 2016. Published by Elsevier Ltd.
Pazarlioglu, Nurdan Kasikara; Erden, Emre; Ucar, M Cigdem; Akkaya, Alper; Sariisik, A Merih
2012-04-01
The aim of this work was to determine new, different and low-cost substrates that can be used for enzyme production from the white rot fungus Trametes versicolor (ATCC 11235) by taking advantage of the broad substrate specificity of pyranose 2-oxidase. In this report, we investigated the production of pyranose 2-oxidase from T. versicolor (ATCC 11235) using ten different agricultural residues such as clover straw, almond shells, hazelnut cobs, grass and others. Pyranose 2-oxidase activity was determined as 2.332 U/g at the 9th day in a submerged culture containing clover straw and tap water shaken at 150 rpm and 26°C, and the optimum clover straw concentration was determined to be 12 g/l. The effects of different glucose, nitrogen and phosphate sources on the production of pyranose 2-oxidase were studied in the clover straw medium. Analyses of biomass, protein, reduced sugar and nitrogen concentrations were also monitored in a clover straw medium that did not contain carbon or nitrogen and phosphate sources under the parameters determined. The produced pyranose 2-oxidase was used for improving the properties of cotton fabrics.
Yusseppone, Maria S.; Rocchetta, Iara; Sabatini, Sebastian E.; Luquet, Carlos M.; Ríos de Molina, Maria del Carmen; Held, Christoph; Abele, Doris
2018-01-01
Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L), hypoxia (2 mg O2/L), and normoxia (9 mg O2/L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks. PMID:29527172
Yusseppone, Maria S; Rocchetta, Iara; Sabatini, Sebastian E; Luquet, Carlos M; Ríos de Molina, Maria Del Carmen; Held, Christoph; Abele, Doris
2018-01-01
Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O 2 /L), hypoxia (2 mg O 2 /L), and normoxia (9 mg O 2 /L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis . Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks.