Contribution of the NADH-oxidase (Nox) to the aerobic life of Lactobacillus sanfranciscensis DSM20451T.

PubMed

Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F

2011-02-01

Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.

Enzymatic production of α-ketoglutaric acid from l-glutamic acid via l-glutamate oxidase.

PubMed

Niu, Panqing; Dong, Xiaoxiang; Wang, Yuancai; Liu, Liming

2014-06-10

In this study, a novel strategy for α-ketoglutaric acid (α-KG) production from l-glutamic acid using recombinant l-glutamate oxidase (LGOX) was developed. First, by analyzing the molecular structure characteristics of l-glutamic acid and α-KG, LGOX was found to be the best catalyst for oxidizing the amino group of l-glutamic acid to a ketonic group without the need for exogenous cofactor. Then the LGOX gene was expressed in Escherichia coli BL21 (DE3) in a soluble and active form, and the recombinant LGOX activity reached to a maximum value of 0.59U/mL at pH 6.5, 30°C. Finally, the maximum α-KG concentration reached 104.7g/L from 110g/L l-glutamic acid in 24h, under the following optimum conditions: 1.5U/mL LGOX, 250U/mL catalase, 3mM MnCl2, 30°C, and pH 6.5. Copyright © 2014. Published by Elsevier B.V.

Arsenic biotransformation potential of microbial arsH responses in the biogeochemical cycling of arsenic-contaminated groundwater.

PubMed

Chang, Jin-Soo; Yoon, In-Ho; Kim, Kyoung-Woong

2018-01-01

ArsH encodes an oxidoreductase, an NAD(P)H-dependent mononucleotide reductase, with an unknown function, frequently within an ars operon, and is widely distributed in bacteria. Novel arsenite-oxidizing bacteria have been isolated from arsenic-contaminated groundwater and surface soil in Vietnam. We found that ArsH gene activity, with arsenite oxidase in the periplasm; it revealed arsenic oxidation potential of the arsH system. Batch experiment results revealed Citrobacter freundii strain VTan4 (DQ481466) and Pseudomonas putida strain VTw33 (DQ481482) completely oxidized 1 mM of arsenite to arsenate within 30-50 h. High concentrations of arsenic were detected in groundwater and surrounding soil obtained from Vinh Tru village in Ha Nam province (groundwater: 11.0 μg/L to 37.0 μg/L; and soil: 2.5 mg/kg, 390.1 mg/kg), respectively. An arsH gene encoding an organoarsenical oxidase protein was observed in arsenite-oxidizing Citrobacter freundii strain VTan4 (DQ481466), whereas arsB, arsH, and arsH were detected in Pseudomonas putida strain VTw33 (DQ481482). arsH gene in bacteria was first reported from Vietnam for resistance and arsenite oxidase. We proposed that residues, Ser 43, Arg 45, Ser 48, and Tyr 49 are required for arsenic binding and activation of arsH. The ars-mediated biotransformation strongly influenced potential arsenite oxidase enzyme of the operon encoding a homogeneous arsH. Results suggest that the further study of arsenite-oxidizing bacteria may lead to a better understanding of arsenite oxidase responses, such as those of arsH, that may be applied to control biochemical properties; for example, speciation, detoxification, bioremediation, biotransformation, and mobilization of arsenic in contaminated groundwater. Copyright © 2017 Elsevier Ltd. All rights reserved.

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

PubMed

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

Stamen-derived bioactive gibberellin is essential for male flower development of Cucurbita maxima L.

PubMed Central

Pimenta Lange, Maria João; Knop, Nicole; Lange, Theo

2012-01-01

Gibberellin (GA) signalling during pumpkin male flower development is highly regulated, including biosynthetic, perception, and transduction pathways. GA 20-oxidases, 3-oxidases, and 2-oxidases catalyse the final part of GA synthesis. Additionally, 7-oxidase initiates this part of the pathway in some cucurbits including Cucurbita maxima L. (pumpkin). Expression patterns for these GA-oxidase-encoding genes were examined by competitive reverse transcription-PCR (RT-PCR) and endogenous GA levels were determined during pumpkin male flower development. In young flowers, GA20ox3 transcript levels are high in stamens, followed by high levels of the GA precursor GA9. Later, just before flower opening, transcript levels for GA3ox3 and GA3ox4 increase in the hypanthium and stamens, respectively. In the stamen, following GA3ox4 expression, bioactive GA4 levels rise dramatically. Accordingly, catabolic GA2ox2 and GA2ox3 transcript levels are low in developing flowers, and increase in mature flowers. Putative GA receptor GID1b and DELLA repressor GAIPb transcript levels do not change in developing flowers, but increase sharply in mature flowers. Emasculation arrests floral development completely and leads to abscission of premature flowers. Application of GA4 (but not of its precursors GA12-aldehyde or GA9) restores normal growth of emasculated flowers. These results indicate that de novo GA4 synthesis in the stamen is under control of GA20ox3 and GA3ox4 genes just before the rapid flower growth phase. Stamen-derived bioactive GA is essential and sufficient for male flower development, including the petal and the pedicel growth. PMID:22268154

Influence of oxygen on NADH recycling and oxidative stress resistance systems in Lactobacillus panis PM1

PubMed Central

2013-01-01

Lactobacillus panis strain PM1 is an obligatory heterofermentative and aerotolerant microorganism that also produces 1,3-propanediol from glycerol. This study investigated the metabolic responses of L. panis PM1 to oxidative stress under aerobic conditions. Growth under aerobic culture triggered an early entrance of L. panis PM1 into the stationary phase along with marked changes in end-product profiles. A ten-fold higher concentration of hydrogen peroxide was accumulated during aerobic culture compared to microaerobic culture. This H2O2 level was sufficient for the complete inhibition of L. panis PM1 cell growth, along with a significant reduction in end-products typically found during anaerobic growth. In silico analysis revealed that L. panis possessed two genes for NADH oxidase and NADH peroxidase, but their expression levels were not significantly affected by the presence of oxygen. Specific activities for these two enzymes were observed in crude extracts from L. panis PM1. Enzyme assays demonstrated that the majority of the H2O2 in the culture media was the product of NADH: H2O2 oxidase which was constitutively-active under both aerobic and microaerobic conditions; whereas, NADH peroxidase was positively-activated by the presence of oxygen and had a long induction time in contrast to NADH oxidase. These observations indicated that a coupled NADH oxidase - NADH peroxidase system was the main oxidative stress resistance mechanism in L. panis PM1, and was regulated by oxygen availability. Under aerobic conditions, NADH is mainly reoxidized by the NADH oxidase - peroxidase system rather than through the production of ethanol (or 1,3-propanediol or succinic acid production if glycerol or citric acid is available). This system helped L. panis PM1 directly use oxygen in its energy metabolism by producing extra ATP in contrast to homofermentative lactobacilli. PMID:23369580

Comparison of the anti-scorbutic activity of L-ascorbic acid and Ester C in the non-ascorbate synthesizing Osteogenic Disorder Shionogi (ODS) rat.

PubMed

Verlangieri, A J; Fay, M J; Bannon, A W

1991-01-01

The Osteogenic Disorder Shionogi (ODS) rat, Clea Inc., Tokyo, Japan lacks the ability to synthesize L-ascorbic acid (AA). As with man, monkey and the guinea pig, this rat lacks L-gulonolactone oxidase necessary for the synthesis of AA from glucose. This study shows this animal to be an alternative to the guinea pig in AA studies. The anti-scorbutic potency of Ester C (EC), a calcium ascorbate and calcium threonate mixture, was compared with an AA dose of equal ascorbate activity equivalents (AAE) for anti-scorbutic activity in the ODS rat. The minimal anti-scorbutic dose of EC was determined to be 0.44 mg/kg/day (AAE), while an AA dose of 0.51 mg/kg/day (AAE) was not anti-scorbutic in a 24 day study. At 24 days EC rats gained 125% of initial body weight (BW) and the AA rats only 45% BW. Scorbutic signs at 24 days were scored on a 0 (min) to 3 (max) scale. The EC/AA ratio scores were: hemorrhage 0/1.4, behavior change 0/2.0, piloerection 0/2.2, mobility 0.4/2.2, dysbasia 0.6/2.8 and ataxia 0.4/1.0. Pearson's correlation coefficient for BW versus AAE was r = .34 for the AA group and r = .90 for the EC group. The morbidity index for EC was 0/5 and for the AA group 2/5. The AAE dose of AA which was 16% higher/day than the EC AAE dose was not anti-scorbutic, while the EC dose was anti-scorbutic. EC rats had 3.5X greater weight gain, a sensitive indicator of scurvy, than the AA rats. EC rats had 3-4 times less, if any, scorbutic signs than AA rats. The results clearly show that, based on ascorbate activity equivalents, EC has more available ascorbate activity/potency than AA. The mechanism of this increased potency is believed to be due to the facilitated transport of AAE into the cell by the threonate (a normal in vivo metabolite of AA) present in the EC product. In addition, previous studies have shown EC (AAE) to be higher in plasma and excreted less rapidly than the AAE derived from AA administered orally.

Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

PubMed

Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

2007-08-01

A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Treesearch

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

PubMed

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

Novel L-amino acid oxidase with algicidal activity against toxic cyanobacterium Microcystis aeruginosa synthesized by a bacterium Aquimarina sp.

PubMed

Chen, Wen Ming; Sheu, Fu Sian; Sheu, Shih Yi

2011-09-10

A brownish yellow pigmented bacterial strain, designated antisso-27, was recently isolated from a water area of saltpan in Southern Taiwan. Phylogenetic analyses based on 16S rRNA gene sequences indicate that strain antisso-27 belongs the genus Aquimarina in the family Flavobacteriacea and its only closest neighbor is Aquimarina spongiae (96.6%). Based on screening for algicidal activity, strain antisso-27 exhibits potent activity against the toxic cyanobacterium Microcystis aeruginosa. Both the strain antisso-27 bacterial culture and its culture filtrate show algicidal activity against the toxic cyanobacterium, indicating that an algicidal substance is released from strain antisso-27. The algicidal activity of strain antisso-27 occurs during the late stationary phase of bacterial growth. Strain antisso-27 can synthesize an algicidal protein with a molecular mass of 190 kDa, and its isoelectric point is approximately 9.4. This study explores the nature of this algicidal protein such as L-amino acid oxidase with broad substrate specificity. The enzyme is most active with L-leucine, L-isoleucine, L-methionine and L-valine and the hydrogen peroxide generated by its catalysis mediates algicidal activity. This is the first report on an Aquimarina strain algicidal to the toxic M. aeruginosa and the algicidal activity is generated through its enzymatic activity of L-amino acid oxidase. Copyright © 2011 Elsevier Inc. All rights reserved.

Heterologous Expression of Phanerochaete chrysoporium Glyoxal Oxidase and its Application for the Coupled Reaction with Manganese Peroxidase to Decolorize Malachite Green

PubMed Central

Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing

2012-01-01

cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

Recombinant expression, purification, and characterization of polyphenol oxidase 2 (VvPPO2) from "Shine Muscat" (Vitis labruscana Bailey × Vitis vinifera L.).

PubMed

Katayama-Ikegami, Ayako; Suehiro, Yuka; Katayama, Takane; Jindo, Kazushi; Itamura, Hiroyuki; Esumi, Tomoya

2017-12-01

Polyphenol oxidases (PPOs) catalyze browning reactions in various plant organs, therefore controlling the reactions is important for the food industry. PPOs have been assumed to be involved in skin browning of white grape cultivars; however, the molecular mechanism underlying PPO-mediated browning process remains elusive. We have recently identified a new PPO gene named VvPPO2 from "Shine Muscat" (Vitis labruscana Bailey × V. vinifera L.), and have shown that the gene is transcribed at a higher level than the previously identified VvPPO1 in browning, physiologically disordered berry skins at the maturation stage. In this study, we expressed VvPPO2 in Escherichia coli and, using the purified preparation, revealed unique physicochemical characteristics of the enzyme. Our study opens up a way to not only understand the berry skin browning process but also to elucidate the enzymatic maturation process of grape PPOs.

Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

PubMed

Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

2015-12-01

The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

PubMed

Beecher, Brian S; Carter, Arron H; See, Deven R

2012-05-01

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

Y Chromosome Regulation of Autism Susceptibility Genes

DTIC Science & Technology

2009-06-01

with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

PubMed

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

DNA Barcoding in Fragaria L. (Strawberry) Species

USDA-ARS?s Scientific Manuscript database

DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...

A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

PubMed

Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

1998-01-01

The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

PubMed

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

Selenium delays tomato fruit ripening by inhibiting ethylene biosynthesis and enhancing the antioxidant defense system.

PubMed

Zhu, Zhu; Chen, Yanli; Shi, Guoqing; Zhang, Xueji

2017-03-15

The antioxidant activity of selenium (Se) detoxifies reactive oxygen species (ROS) in plants and animals. In the present study, we elucidated the mechanism underlying Se induced fruit development and ripening. Our study showed that foliar pretreatment with 1mgL -1 sodium selenate effectively delayed fruit ripening and maintained fruit quality. Gene expression studies revealed that the repression of ethylene biosynthetic genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase decreased ethylene production and respiration rate. Moreover, Se treatment probably boosted the antioxidant defense system to reduce ROS generation and membrane damage. The enhanced antioxidative effect was attributed to higher glutathione content and increased activity of enzymes such as glutathione peroxidase and glutathione reductase. The upregulation of respiratory burst oxidase homologue genes in tomato fruit may also contribute to the enhanced antioxidative effect. Selenium treatment represents a promising strategy for delaying ripening and extending the shelf life of tomato fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

Molecular systematics and phylogeography of the genus Lagothrix (Atelidae, Primates) by means of the mitochondrial COII gene.

PubMed

Ruiz-Garcia, Manuel; Pinedo-Castro, Myreya Omayra

2010-01-01

We propose the first molecular systematic hypothesis on the origin and evolution of Lagothrix taxa based on an analysis of 720 base pairs of the cytochrome c oxidase subunit II mitochondrial gene in 97 Lagothrix specimens. All the current Lagothrix forms probably descended from the ancestor L. poeppigii or perhaps (less probably) that of L. lugens. We detected at least 2 lineages in L. poeppigii. L. cana and L. lagotricha were determined to be monophyletic and had lower gene diversity levels compared to L. poeppigii and L. lugens. The most basal ancestors of the current L. poeppigii lineages diverged from the other Lagothrix taxa around 2.5 million years ago, at the end of the Pliocene or at the beginning of the Pleistocene. Clearly, L. cana and L. lagotricha were the 2 most recently derived Lagothrix taxa. The diversification within L. lugens and L. poeppigii may coincide with the first and second Pleistocene glacial periods, respectively, while the diversification within L. cana and L. lagotricha could have occurred in the last 400,000 years, coinciding with the climatological changes provoked by the Illinois-Riss (third) and Wisconsin-Würm (fourth) glaciations. Copyright © 2010 S. Karger AG, Basel.

Molecular evidence for a single taxon, Anopheles nuneztovari s. l., from two endemic malaria regions in Colombia

PubMed Central

Jaramillo, Luz Marina; Gutiérrez, Lina A; Luckhart, Shirley; Conn, Jan E; Correa, Margarita M

2012-01-01

To elucidate the Anopheles nuneztovari s.l. taxonomic status at a microgeographic level in four malaria endemic localities from Antioquia and Córdoba, Colombia, fragments of the Cytochrome oxidase subunit I (COI) and the white gene were used. The COI analysis showed low genetic differentiation with FST levels between −0.02 and 0.137 and Nm values between 3 and infinity, indicating the presence of high gene flow among An. nuneztovari s.l. populations from the four localities. The COI network showed a single most common haplotype, 1 (n=55), present in all localities, as the likely ancestral haplotype. Analysis of the white gene showed that An. nuneztovari s.l. populations from both departments grouped with haplotypes 19 and 20, which are part of lineage 3 previously reported. The results of the present study suggest that An. nuneztovari s.l. is a single taxon in the area of the present study. PMID:22241127

AOX1-Subfamily Gene Members in Olea europaea cv. "Galega Vulgar"-Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting.

PubMed

Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia

2018-02-17

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.

Age-dependent redox status in the brain stem of NO-deficient hypertensive rats.

PubMed

Majzúnová, Miroslava; Pakanová, Zuzana; Kvasnička, Peter; Bališ, Peter; Čačányiová, Soňa; Dovinová, Ima

2017-09-11

The brain stem contains important nuclei that control cardiovascular function via the sympathetic nervous system (SNS), which is strongly influenced by nitric oxide. Its biological activity is also largely determined by oxygen free radicals. Despite many experimental studies, the role of AT1R-NAD(P)H oxidase-superoxide pathway in NO-deficiency is not yet sufficiently clarified. We determined changes in free radical signaling and antioxidant and detoxification response in the brain stem of young and adult Wistar rats during chronic administration of exogenous NO inhibitors. Young (4 weeks) and adult (10 weeks) Wistar rats were treated with 7-nitroindazole (7-NI group, 10 mg/kg/day), a specific nNOS inhibitor, with N G -nitro-L-arginine-methyl ester (L-NAME group, 50 mg/kg/day), a nonspecific NOS inhibitor, and with drinking water (Control group) during 6 weeks. Systolic blood pressure was measured by non-invasive plethysmography. Expression of genes (AT1R, AT2R, p22phox, SOD and NOS isoforms, HO-1, MDR1a, housekeeper GAPDH) was identified by real-time PCR. NOS activity was detected by conversion of [3H]-L-arginine to [3H]-L-citrulline and SOD activity was measured using UV VIS spectroscopy. We observed a blood pressure elevation and decrease in NOS activity only after L-NAME application in both age groups. Gene expression of nNOS (youngs) and eNOS (adults) in the brain stem decreased after both inhibitors. The radical signaling pathway triggered by AT1R and p22phox was elevated in L-NAME adults, but not in young rats. Moreover, L-NAME-induced NOS inhibition increased antioxidant response, as indicated by the observed elevation of mRNA SOD3, HO-1, AT2R and MDR1a in adult rats. 7-NI did not have a significant effect on AT1R-NADPH oxidase-superoxide pathway, yet it affected antioxidant response of mRNA expression of SOD1 and stimulated total activity of SOD in young rats and mRNA expression of AT2R in adult rats. Our results show that chronic NOS inhibition by two different NOS inhibitors has age-dependent effect on radical signaling and antioxidant/detoxificant response in Wistar rats. While 7-NI had neuroprotective effect in the brain stem of young Wistar rats, L-NAME- induced NOS inhibition evoked activation of AT1R-NAD(P)H oxidase pathway in adult Wistar rats. Triggering of the radical pathway was followed by activation of protective compensation mechanism at the gene expression level.

Involvement of polyamine oxidase in abscisic acid-induced cytosolic antioxidant defense in leaves of maize.

PubMed

Xue, Beibei; Zhang, Aying; Jiang, Mingyi

2009-03-01

Using pharmacological and biochemical approaches, the role of maize polyamine oxidase (MPAO) in abscisic acid (ABA)-induced antioxidant defense in leaves of maize (Zea mays L.) plants was investigated. Exogenous ABA treatment enhanced the expression of the MPAO gene and the activities of apoplastic MPAO. Pretreatment with two different inhibitors for apoplastic MPAO partly reduced hydrogen peroxide (H2O2) accumulation induced by ABA and blocked the ABA-induced expression of the antioxidant genes superoxide dismutase 4 and cytosolic ascorbate peroxidase and the activities of the cytosolic antioxidant enzymes. Treatment with spermidine, the optimum substrate of MPAO, also induced the expression and the activities of the antioxidant enzymes, and the upregulation of the antioxidant enzymes was prevented by two inhibitors of MPAO and two scavengers of H2O2. These results suggest that MPAO contributes to ABA-induced cytosolic antioxidant defense through H2O2, a Spd catabolic product.

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

PubMed

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

Vitamin C deficiency aggravates tumor necrosis factor α-induced insulin resistance.

PubMed

Qing, Zhou; Xiao-Hui, Wu; Xi-Mei, Wu; Chao-Chun, Zou

2018-06-15

Chronic low-grade inflammation plays a major role in the development of insulin resistance. The potential role and underlying mechanism of vitamin C, an antioxidant and anti-inflammatory agent, was investigated in tumor necrosis factor-α (TNF-α)-induced insulin resistance. Gulonolactone oxidase knockout (Gulo -/- ) mice genetically unable to synthesize vitamin C were used to induce insulin resistance by continuously pumping small doses of TNF-α for seven days, and human liver hepatocellular carcinoma cells (HepG2 cells) were used to induce insulin resistance by treatment with TNF-α. Vitamin C deficiency aggravated TNF-α-induced insulin resistance in Gulo -/- mice, resulting in worse glucose tolerance test (GTT) results, higher fasting plasma insulin level, and the inactivation of the protein kinase B (AKT)/glycogen synthase kinase-3β (GSK3β) pathway in the liver. Vitamin C deficiency also worsened liver lipid accumulation and inflammation in TNF-α-treated Gulo -/- mice. In HepG2 cells, vitamin C reversed the TNF-α-induced reduction of glucose uptake and glycogen synthesis, which were mediated by increasing GLUT2 levels and the activation of the insulin receptor substrate (IRS-1)/AKT/GSK3β pathway. Furthermore, vitamin C inhibited the TNF-α-induced activation of not only the mitogen-activated protein kinase (MAPKs), but also nuclear factor-kappa B (NF-κB) signaling. Taken together, vitamin C is essential for preventing and improving insulin resistance, and the supplementing with vitamin C may be an effective therapeutic intervention for metabolic disorders. Copyright © 2018 Elsevier B.V. All rights reserved.

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

PubMed Central

Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

2014-01-01

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L.

PubMed

Sircar, Debabrata; Cardoso, Hélia G; Mukherjee, Chiranjit; Mitra, Adinpunya; Arnholdt-Schmitt, Birgit

2012-05-01

Methyl-jasmonate (MJ)-treated hairy roots of Daucus carota L. were used to study the influence of alternative oxidase (AOX) in phenylpropanoid metabolism. Phenolic acid accumulation, as well as total flavonoids and lignin content of the MJ-treated hairy roots were decreased by treatment with salicylhydroxamic acid (SHAM), a known inhibitor of AOX. The inhibitory effect of SHAM was concentration dependent. Treatment with propyl gallate (PG), another inhibitor of AOX, also had a similar inhibitory effect on accumulation of phenolic acid, total flavonoids and lignin. The transcript levels of two DcAOX genes (DcAOX2a and DcAOX1a) were monitored at selected post-elicitation time points. A notable rise in the transcript levels of both DcAOX genes was observed preceding the MJ-induced enhanced accumulation of phenolics, flavonoids and lignin. An appreciable increase in phenylalanine ammonia-lyase (PAL) transcript level was also observed prior to enhanced phenolics accumulation. Both DcAOX genes showed differential transcript accumulation patterns after the onset of elicitation. The transcript levels of DcAOX1a and DcAOX2a attained peak at 6hours post elicitation (hpe) and 12hpe, respectively. An increase in the transcript levels of both DcAOX genes preceding the accumulation of phenylpropanoid-derivatives and lignin showed a positive correlation between AOX activity and phenylpropanoid biosynthesis. The results provide important new insight about the influence of AOX in phenylpropanoid biosynthesis. Copyright © 2012 Elsevier GmbH. All rights reserved.

Roothairless5, which functions in maize (Zea mays L.) root hair initiation and elongation encodes a monocot-specific NADPH oxidase.

PubMed

Nestler, Josefine; Liu, Sanzhen; Wen, Tsui-Jung; Paschold, Anja; Marcon, Caroline; Tang, Ho Man; Li, Delin; Li, Li; Meeley, Robert B; Sakai, Hajime; Bruce, Wesley; Schnable, Patrick S; Hochholdinger, Frank

2014-09-01

Root hairs are instrumental for nutrient uptake in monocot cereals. The maize (Zea mays L.) roothairless5 (rth5) mutant displays defects in root hair initiation and elongation manifested by a reduced density and length of root hairs. Map-based cloning revealed that the rth5 gene encodes a monocot-specific NADPH oxidase. RNA-Seq, in situ hybridization and qRT-PCR experiments demonstrated that the rth5 gene displays preferential expression in root hairs but also accumulates to low levels in other tissues. Immunolocalization detected RTH5 proteins in the epidermis of the elongation and differentiation zone of primary roots. Because superoxide and hydrogen peroxide levels are reduced in the tips of growing rth5 mutant root hairs as compared with wild-type, and Reactive oxygen species (ROS) is known to be involved in tip growth, we hypothesize that the RTH5 protein is responsible for establishing the high levels of ROS in the tips of growing root hairs required for elongation. Consistent with this hypothesis, a comparative RNA-Seq analysis of 6-day-old rth5 versus wild-type primary roots revealed significant over-representation of only two gene ontology (GO) classes related to the biological functions (i.e. oxidation/reduction and carbohydrate metabolism) among 893 differentially expressed genes (FDR <5%). Within these two classes the subgroups 'response to oxidative stress' and 'cellulose biosynthesis' were most prominently represented. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

PubMed

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Genetics Home Reference: cytochrome c oxidase deficiency

MedlinePlus

... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

PubMed

Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

2015-06-01

Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.

Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

PubMed Central

Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

2015-01-01

Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

AOX1-Subfamily Gene Members in Olea europaea cv. “Galega Vulgar”—Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting

PubMed Central

Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit

2018-01-01

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

PubMed

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

PubMed

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Snake Venom L-Amino Acid Oxidases: Trends in Pharmacology and Biochemistry

PubMed Central

Izidoro, Luiz Fernando M.; Sobrinho, Juliana C.; Mendes, Mirian M.; Costa, Tássia R.; Grabner, Amy N.; Rodrigues, Veridiana M.; da Silva, Saulo L.; Zanchi, Fernando B.; Zuliani, Juliana P.; Fernandes, Carla F. C.; Calderon, Leonardo A.; Stábeli, Rodrigo G.; Soares, Andreimar M.

2014-01-01

L-amino acid oxidases are enzymes found in several organisms, including venoms of snakes, where they contribute to the toxicity of ophidian envenomation. Their toxicity is primarily due to enzymatic activity, but other mechanisms have been proposed recently which require further investigation. L-amino acid oxidases exert biological and pharmacological effects, including actions on platelet aggregation and the induction of apoptosis, hemorrhage, and cytotoxicity. These proteins present a high biotechnological potential for the development of antimicrobial, antitumor, and antiprotozoan agents. This review provides an overview of the biochemical properties and pharmacological effects of snake venom L-amino acid oxidases, their structure/activity relationship, and supposed mechanisms of action described so far. PMID:24738050

Analysis of nodule senescence in pea (Pisum sativum L.) using laser microdissection, real-time PCR, and ACC immunolocalization.

PubMed

Serova, Tatiana A; Tikhonovich, Igor A; Tsyganov, Viktor E

2017-05-01

A delay in the senescence of symbiotic nodules could prolong active nitrogen fixation, resulting in improved crop yield and a reduced need for chemical fertilizers. The molecular genetic mechanisms underlying nodule senescence have not been extensively studied with a view to breeding varieties with delayed nodule senescence. In such studies, plant mutants with the phenotype of premature degradation of symbiotic structures are useful models to elucidate the genetic basis of nodule senescence. Using a dataset from transcriptome analysis of Medicago truncatula Gaertn. nodules and previous studies on pea (Pisum sativum L.) nodules, we developed a set of molecular markers based on genes that are known to be activated during nodule senescence. These genes encode cysteine proteases, a thiol protease, a bZIP transcription factor, enzymes involved in the biosynthesis of ethylene (ACS2 for ACC synthase and ACO1 for ACC oxidase) and ABA (AO3 for aldehyde oxidase), and an enzyme involved in catabolism of gibberellins (GA 2-oxidase). We analyzed the transcript levels of these genes in the nodules of two pea wild-types (cv. Sparkle and line Sprint-2) and two mutant lines, one showing premature nodule senescence (E135F (sym13)) and one showing no morphological signs of symbiotic structure degradation (Sprint-2Fix - (sym31)). Real-time PCR analyses revealed that all of the selected genes showed increased transcript levels during nodule aging in all phenotypes. Remarkably, at 4 weeks after inoculation (WAI), the transcript levels of all analyzed genes were significantly higher in the early senescent nodules of the mutant line E135F (sym13) and in nodules of the mutant Sprint-2Fix - (sym31) than in the active nitrogen-fixing nodules of wild-types. In contrast, the transcript levels of the same genes of both wild-types were significantly increased only at 6 WAI. We evaluated the expression of selected markers in the different histological nodule zones of pea cv. Sparkle and its mutant line E135F (sym13) by laser capture microdissection analysis. Finally, we analyzed ACC by immunolocalization in the nodules of both wild-type pea and their mutants. Together, the results indicate that nodule senescence is a general plant response to nodule ineffectiveness. Copyright © 2017 Elsevier GmbH. All rights reserved.

Development of Protoporphyrinogen Oxidase as an Efficient Selection Marker for Agrobacterium tumefaciens-Mediated Transformation of Maize

PubMed Central

Li, Xianggan; Volrath, Sandy L.; Nicholl, David B.G.; Chilcott, Charles E.; Johnson, Marie A.; Ward, Eric R.; Law, Marcus D.

2003-01-01

In this article, we report the isolation of plant protoporphyrinogen oxidase (PPO) genes and the isolation of herbicide-tolerant mutants. Subsequently, an Arabidopsis double mutant (Y426M + S305L) was used to develop a selectable marker system for Agrobacterium tumefaciens-mediated transformation of maize (Zea mays) and to obtain multiple events tolerant to the PPO family of herbicides. Maize transformants were produced via butafenacil selection using a flexible light regime to increase selection pressure. Butafenacil selection per se did not change transgene copy number distribution relative to other selectable marker systems, but the most tolerant events identified in the greenhouse were more likely to contain multiple copies of the introduced mutant PPO gene. To date, more than 2,500 independent transgenic maize events have been produced using butafenacil selection. The high frequency of A. tumefaciens-mediated transformation via PPO selection enabled us to obtain single-copy transgenic maize lines tolerant to field levels of butafenacil. PMID:12972658

Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

PubMed Central

Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

1998-01-01

Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

PubMed Central

Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

2010-01-01

The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

Molecular mechanism of cell death induced by king cobra (Ophiophagus hannah) venom l-amino acid oxidase.

PubMed

Fung, Shin Yee; Lee, Mui Li; Tan, Nget Hong

2015-03-01

Snake venom LAAOs have been reported to exhibit a wide range of pharmacological activities, including cytotoxic, edema-inducing, platelet aggregation-inducing/platelet aggregation-inhibiting, bactericidal and antiviral activities. A heat-stable form of l-amino acid oxidase isolated from king cobra (Ophiophagus hannah) venom (OH-LAAO) has been shown to exhibit very potent cytotoxicity against human tumorigenic cells but not in their non-tumorigenic counterparts, and the cytotoxicity was due to the apoptosis-inducing effect of the enzyme. In this work, the molecular mechanism of cell death induced by OH-LAAO was investigated. The enzyme exerts its apoptosis-inducing effect presumably via both intrinsic and extrinsic pathways as suggested by the increase in caspase-8 and -9 activities. Oligonucleotide microarray analysis showed that the expression of a total of 178 genes was significantly altered as a result of oxidative stress induced by the hydrogen peroxide generated by the enzyme. Of the 178 genes, at least 27 genes are involved in apoptosis and cell death. These alterations of gene expression was presumably caused by the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidative modifications of signaling molecules that eventually lead to apoptosis and cell death. The very substantial up-regulation of cytochrome P450 genes may also contribute to the potent cytotoxic action of OH-LAAO by producing excessive reactive oxygen species (ROS). In conclusion, the potent apoptosis inducing activity of OH-LAAO was likely due to the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidation of signalling molecules. Copyright © 2015 Elsevier Ltd. All rights reserved.

A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.

PubMed

Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T

2015-01-01

The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.

Microarray analysis of thyroid stimulating hormone, insulin-like growth factor-1, and insulin-induced gene expression in FRTL-5 thyroid cells.

PubMed

Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Park, Young Joo; Cho, Bo Youn

2007-10-01

To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation.

Microarray Analysis of Thyroid Stimulating Hormone, Insulin-Like Growth Factor-1, and Insulin-Induced Gene Expression in FRTL-5 Thyroid Cells

PubMed Central

Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Cho, Bo Youn

2007-01-01

To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation. PMID:17982240

Identification and statistical optimization of fermentation conditions for a newly isolated extracellular cholesterol oxidase-producing Streptomyces cavourensis strain NEAE-42.

PubMed

El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M; El-Ewasy, Sara M

2016-09-20

Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis strain NEAE-42. The optimization of different process parameters for cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 using Plackett-Burman experimental design and response surface methodology was carried out. Fifteen variables were screened using Plackett-Burman experimental design. Cholesterol, initial pH and (NH4)2SO4 were the most significant positive independent variables affecting cholesterol oxidase production. Central composite design was chosen to elucidate the optimal concentrations of the selected process variables on cholesterol oxidase production. It was found that, cholesterol oxidase production by Streptomyces cavourensis strain NEAE-42 after optimization process was 20.521U/mL which is higher than result obtained from the basal medium before screening process using Plackett-Burman (3.31 U/mL) with a fold of increase 6.19. The cholesterol oxidase level production obtained in this study (20.521U/mL) by the statistical method is higher than many of the reported values.

Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

PubMed

Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

2015-03-28

Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

Juvenile roach (Rutilus rutilus) increase their anaerobic metabolism in response to copper exposure in laboratory conditions.

PubMed

Maes, Virginie; Betoulle, Stéphane; Jaffal, Ali; Dedourge-Geffard, Odile; Delahaut, Laurence; Geffard, Alain; Palluel, Olivier; Sanchez, Wilfried; Paris-Palacios, Séverine; Vettier, Aurélie; David, Elise

2016-07-01

This study aims to determine the potential impairment of cell energy synthesis processes (glycolysis and respiratory chain pathways) by copper in juvenile roach at different regulation levels by using a multi-marker approach. Juvenile roach were exposed to 0, 10, 50, and 100 µg/L of copper for 7 days in laboratory conditions. The glycolysis pathway was assessed by measuring the relative expression levels of 4 genes encoding glycolysis enzymes. The respiratory chain was studied by assessing the electron transport system and cytochrome c oxidase gene expression. Muscle mitochondria ultrastructure was studied, and antioxidant responses were measured. Furthermore, the main energy reserves-carbohydrates, lipids, and proteins-were measured, and cellular energy was evaluated by measuring ATP, ADP, AMP and IMP concentrations. This study revealed a disturbance of the cell energy metabolism due to copper exposure, with a significant decrease in adenylate energy charge in roach exposed to 10 μg/L of copper after 1 day. Moreover, ATP concentrations significantly decreased in roach exposed to 10 μg/L of copper after 1 day. This significant decrease persisted in roach exposed to 50 µg/L of copper after 7 days. AMP concentrations increased in all contaminated fish after 1 day of exposure. In parallel, the relative expression of 3 genes encoding for glycolysis enzymes increased in all contaminated fish after 1 day of copper exposure. Focusing on the respiratory chain, cytochrome c oxidase gene expression also increased in all contaminated fish at the two time-points. The activity of the electron transport system was not disturbed by copper, except in roach exposed to 100 µg/L of copper after 1 day. Copper induced a metabolic stress. Juvenile roach seemed to respond to the ensuing high energy demand by increasing their anaerobic metabolism, but the energy produced by the anaerobic metabolism is unable to compensate for the stress induced by copper after 7 days. This multi-marker approach allows us to reach a greater understanding of the effects of copper on the physiological responses of juvenile roach.

Exploring the potential of anaerobic sulfate reduction process in treating sulfonated diazo dye: Microbial community analysis using bar-coded pyrosequencing.

PubMed

Rasool, Kashif; Shahzad, Asif; Lee, Dae Sung

2016-11-15

Anaerobic decolorization and biotransformation of azo dye was investigated in a sulfate-reducing environment. Batch reactor studies were performed with mixed cultures of anaerobic sulfate-reducing bacteria (SRBs) enriched from anaerobic digester sludge. Complete sulfate and color removal were achieved in batch experiments with different initial dye concentrations (50-2500mg/L) and 1000mg/L of sulfate. Induction of various oxidoreductive enzyme activities such as phenol oxidase, veratryl alcohol oxidase, lignin peroxidase, and azo reductase was studied to understand their involvement in dye metabolism under anoxic environment. The degradation of Cotton Red B was confirmed using high-performance liquid chromatography and gas chromatography-mass spectroscopy. Sulfidogenic sludge demonstrated excellent dye degradation and mineralization ability, producing aniline and 1,4-diamino benzene as metabolites. A barcoded 16S rRNA gene-pyrosequencing approach was used to assess the bacterial diversity in the sludge culture and a phylogenetic tree was constructed for sulfate-reducing bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

PubMed Central

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

PubMed

Nawathean, P; Maslov, D A

2000-08-01

By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

PubMed

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Distribution in microbial genomes of genes similar to lodA and goxA which encode a novel family of quinoproteins with amino acid oxidase activity.

PubMed

Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio

2015-03-24

L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome mining has revealed for the first time the broad distribution of LodA-like proteins containing a CTQ cofactor in many different microbial groups. This study provides a platform to explore the potentially novel enzymatic activities of the proteins detected, the mechanisms of post-translational modifications involved in their synthesis, as well as their biological relevance.

Use of the Yeast Pichia pastoris as an Expression Host for Secretion of Enterocin L50, a Leaderless Two-Peptide (L50A and L50B) Bacteriocin from Enterococcus faecium L50▿

PubMed Central

Basanta, Antonio; Gómez-Sala, Beatriz; Sánchez, Jorge; Diep, Dzung B.; Herranz, Carmen; Hernández, Pablo E.; Cintas, Luis M.

2010-01-01

In this work, we report the expression and secretion of the leaderless two-peptide (EntL50A and EntL50B) bacteriocin enterocin L50 from Enterococcus faecium L50 by the methylotrophic yeast Pichia pastoris X-33. The bacteriocin structural genes entL50A and entL50B were fused to the Saccharomyces cerevisiae gene region encoding the mating pheromone α-factor 1 secretion signal (MFα1s) and cloned, separately and together (entL50AB), into the P. pastoris expression and secretion vector pPICZαA, which contains the methanol-inducible alcohol oxidase promoter (PAOX1) to express the fusion genes. After transfer into the yeast, the recombinant plasmids were integrated into the genome, resulting in three bacteriocinogenic yeast strains able to produce and secrete the individual bacteriocin peptides EntL50A and EntL50B separately and together. The secretion was efficiently directed by MFα1s through the Sec system, and the precursor peptides were found to be correctly processed to form mature and active bacteriocin peptides. The present work describes for the first time the heterologous expression and secretion of a two-peptide non-pediocin-like bacteriocin by a yeast. PMID:20348300

Feed-back regulation of gibberellin biosynthesis and gene expression in Pisum sativum L.

PubMed

Martin, D N; Proebsting, W M; Parks, T D; Dougherty, W G; Lange, T; Lewis, M J; Gaskin, P; Hedden, P

1996-01-01

Treatment of tall and dwarf (3 beta-hydroxylase impaired) genotypes of pea (Pisum sativum L.) with the synthetic, highly active gibberellin (GA), 2,2-dimethyl GA4, reduced the shoot contents of C19-GAs, including GA1, and increased the concentration of the C20-GA, GA19. In shoots of the slender (la crys) mutant, the content of C19-GAs was lower and GA19 content was higher than in those of the tall line. Metabolism of GA19 and GA20 in leaves of a severe (na) GA-deficient dwarf mutant was reduced by GA treatment. The results suggest feed-back regulation of the 20-oxidation and 3 beta-hydroxylation reactions. Feed-back regulation of GA 20-oxidation was studied further using a cloned GA 20-oxidase cDNA from pea. The cDNA, Ps074, was isolated using polymerase chain reaction with degenerate oligonucleotide primers based on pumpkin and Arabidopsis 20-oxidase sequences. After expression of this cDNA clone in Escherichia coli, the product oxidized GA12 to GA15, GA24 and the C19-GA, GA9, which was the major product. The 13-hydroxylated substrate GA53 was similarly oxidized, but less effectively than GA12, giving mainly GA44 with low yields of GA19 and GA20. Ps074 hybridized to polyadenylated RNA from expanding shoots of pea. Amounts of this transcript were less in the slender genotype than in the tall line and were reduced in GA-deficient genotypes by treatment with GA3, suggesting that there is feed-back regulation of GA 20-oxidase gene expression.

The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

PubMed Central

Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

2001-01-01

Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

Testing the performance of a fragment of the COI gene to identify western Palaearctic stag beetle species (Coleoptera, Lucanidae).

PubMed

Cox, Karen; Thomaes, Arno; Antonini, Gloria; Zilioli, Michele; De Gelas, Koen; Harvey, Deborah; Solano, Emanuela; Audisio, Paolo; McKeown, Niall; Shaw, Paul; Minetti, Robert; Bartolozzi, Luca; Mergeay, Joachim

2013-12-30

Lucanidae) remains challenging, mainly due to the sexual dimorphism and the strong allometry in males. Such conjecture confounds taxonomic based conservation efforts that are urgently needed due to numerous threats to stag beetle biodiversity. Molecular tools could help solve the problem of identification of the different recognized taxa in the "Lucanus cervus complex" and in some related Palaearctic species. We investigated the potential use of a 670 bp region at the 3' end of the mitochondrial cytochrome c oxidase subunit I gene (COI) for barcoding purposes (different from the standard COI barcoding region). Well resolved species and subspecies were L. tetraodon, L. cervusakbesianus, L. c. laticornis, as well as the two eastern Asian outgroup taxa L. formosanus and L. hermani. Conversely, certain taxa could not be distinguished from each other based on K2P-distances and tree topologies: L. c. fabiani / L. (P.) barbarossa, L. c. judaicus / an unknown Lucanus species, L. c. cervus / L. c. turcicus / L. c. pentaphyllus / L. (P.) macrophyllus / L. ibericus. The relative roles of phenotypic plasticity, recurrent hybridisation and incomplete lineage sorting underlying taxonomic and phylogenetic discordances are discussed.

Size-selective QD@MOF core-shell nanocomposites for the highly sensitive monitoring of oxidase activities.

PubMed

Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan

2017-01-15

In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.

Glycerol metabolism of Lactobacillus rhamnosus ATCC 7469: cloning and expression of two glycerol kinase genes.

PubMed

Alvarez, María de Fátima; Medina, Roxana; Pasteris, Sergio E; Strasser de Saad, Ana M; Sesma, Fernando

2004-01-01

Lactobacillus rhamnosus ATCC 7469 was able to grow in glycerol as the sole source of energy in aerobic conditions, producing lactate, acetate, and diacetyl. A biphasic growth was observed in the presence of glucose. In this condition, glycerol consumption began after glucose was exhausted from the culture medium. Glycerol kinase activity was detected in L. rhamnosus ATCC 7469, a characteristic of microorganisms which catabolize glycerol in aerobic conditions. Genetic analysis revealed that this strain possesses two glycerol kinase genes: gykA and glpK, that encode for two different glycerol kinases GykA and GlpK, respectively. The glpK geneis associated in an operon with alpha-glycerophosphate oxidase (glpO) and glycerol facilitator (glpF) genes. Transcriptional analysis revealed that only glpK is expressed when L. rhamnosus was grown on glycerol. Copyright 2004 S. Karger AG, Basel

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

PubMed Central

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

PubMed

Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

2011-03-01

"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

PubMed

Castresana, J; Lübben, M; Saraste, M; Higgins, D G

1994-06-01

Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

Recovery of choline oxidase activity by in vitro recombination of individual segments.

PubMed

Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T

2008-11-01

Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

USDA-ARS?s Scientific Manuscript database

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

Genomic evaluation of oxalate-degrading transgenic soybean in response to Sclerotinia sclerotiorum infection

USDA-ARS?s Scientific Manuscript database

Oxalate oxidases catalyze the degradation of oxalic acid (OA). Highly resistant transgenic soybean carrying an oxalate oxidase (OxO) gene and its susceptible parent soybean line, AC Colibri, were tested for genome-wide gene expression in response to the necrotrophic, OA producing pathogen Sclerotini...

A novel proteolytic processing of prolysyl oxidase

PubMed Central

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

2012-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

A novel proteolytic processing of prolysyl oxidase.

PubMed

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

2011-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

Nano-copper-bearing stainless steel promotes fracture healing by accelerating the callus evolution process.

PubMed

Wang, Lei; Li, Guoyuan; Ren, Ling; Kong, Xiangdong; Wang, Yugang; Han, Xiuguo; Jiang, Wenbo; Dai, Kerong; Yang, Ke; Hao, Yongqiang

2017-01-01

Treatment for fractures requires internal fixation devices, which are mainly produced from stainless steel or titanium alloy without biological functions. Therefore, we developed a novel nano-copper-bearing stainless steel with nano-sized copper-precipitation (317L-Cu SS). Based on previous studies, this work explores the effect of 317L-Cu SS on fracture healing; that is, proliferation, osteogenic differentiation, osteogenesis-related gene expression, and lysyl oxidase activity of human bone mesenchymal stem cells were detected in vitro. Sprague-Dawley rats were used to build an animal fracture model, and fracture healing and callus evolution were investigated by radiology (X-ray and micro-CT), histology (H&E, Masson, and safranin O/fast green staining), and histomorphometry. Further, the Cu 2+ content and Runx2 level in the callus were determined, and local mechanical test of the fracture was performed to assess the healing quality. Our results revealed that 317L-Cu SS did not affect the proliferation of human bone mesenchymal stem cells, but promoted osteogenic differentiation and the expression of osteogenesis-related genes. In addition, 317L-Cu SS upregulated the lysyl oxidase activity. The X-ray and micro-CT results showed that the callus evolution efficiency and fracture healing speed were superior for 317L-Cu SS. Histological staining displayed large amounts of fibrous tissues at 3 weeks, and cartilage and new bone at 6 weeks. Further, histomorphometric analysis indicated that the callus possessed higher osteogenic efficiency at 6 weeks, and a high Cu 2+ content and increased Runx2 expression were observed in the callus for 317L-Cu SS. Besides, the mechanical strength of the fracture site was much better than that of the control group. Overall, we conclude that 317L-Cu SS possesses the ability to increase Cu 2+ content and promote osteogenesis in the callus, which could accelerate the callus evolution process and bone formation to provide faster and better fracture healing.

Nano-copper-bearing stainless steel promotes fracture healing by accelerating the callus evolution process

PubMed Central

Kong, Xiangdong; Wang, Yugang; Han, Xiuguo; Jiang, Wenbo; Dai, Kerong; Yang, Ke; Hao, Yongqiang

2017-01-01

Treatment for fractures requires internal fixation devices, which are mainly produced from stainless steel or titanium alloy without biological functions. Therefore, we developed a novel nano-copper-bearing stainless steel with nano-sized copper-precipitation (317L-Cu SS). Based on previous studies, this work explores the effect of 317L-Cu SS on fracture healing; that is, proliferation, osteogenic differentiation, osteogenesis-related gene expression, and lysyl oxidase activity of human bone mesenchymal stem cells were detected in vitro. Sprague–Dawley rats were used to build an animal fracture model, and fracture healing and callus evolution were investigated by radiology (X-ray and micro-CT), histology (H&E, Masson, and safranin O/fast green staining), and histomorphometry. Further, the Cu2+ content and Runx2 level in the callus were determined, and local mechanical test of the fracture was performed to assess the healing quality. Our results revealed that 317L-Cu SS did not affect the proliferation of human bone mesenchymal stem cells, but promoted osteogenic differentiation and the expression of osteogenesis-related genes. In addition, 317L-Cu SS upregulated the lysyl oxidase activity. The X-ray and micro-CT results showed that the callus evolution efficiency and fracture healing speed were superior for 317L-Cu SS. Histological staining displayed large amounts of fibrous tissues at 3 weeks, and cartilage and new bone at 6 weeks. Further, histomorphometric analysis indicated that the callus possessed higher osteogenic efficiency at 6 weeks, and a high Cu2+ content and increased Runx2 expression were observed in the callus for 317L-Cu SS. Besides, the mechanical strength of the fracture site was much better than that of the control group. Overall, we conclude that 317L-Cu SS possesses the ability to increase Cu2+ content and promote osteogenesis in the callus, which could accelerate the callus evolution process and bone formation to provide faster and better fracture healing. PMID:29225463

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

PubMed Central

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

2013-01-01

Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

PubMed Central

Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

2001-01-01

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

FnrL and Three Dnr Regulators Are Used for the Metabolic Adaptation to Low Oxygen Tension in Dinoroseobacter shibae

PubMed Central

Ebert, Matthias; Laaß, Sebastian; Thürmer, Andrea; Roselius, Louisa; Eckweiler, Denitsa; Daniel, Rolf; Härtig, Elisabeth; Jahn, Dieter

2017-01-01

The heterotrophic marine bacterium Dinoroseobacter shibae utilizes aerobic respiration and anaerobic denitrification supplemented with aerobic anoxygenic photosynthesis for energy generation. The aerobic to anaerobic transition is controlled by four Fnr/Crp family regulators in a unique cascade-type regulatory network. FnrL is utilizing an oxygen-sensitive Fe-S cluster for oxygen sensing. Active FnrL is inducing most operons encoding the denitrification machinery and the corresponding heme biosynthesis. Activation of gene expression of the high oxygen affinity cbb3-type and repression of the low affinity aa3-type cytochrome c oxidase is mediated by FnrL. Five regulator genes including dnrE and dnrF are directly controlled by FnrL. Multiple genes of the universal stress protein (USP) and cold shock response are further FnrL targets. DnrD, most likely sensing NO via a heme cofactor, co-induces genes of denitrification, heme biosynthesis, and the regulator genes dnrE and dnrF. DnrE is controlling genes for a putative Na+/H+ antiporter, indicating a potential role of a Na+ gradient under anaerobic conditions. The formation of the electron donating primary dehydrogenases is coordinated by FnrL and DnrE. Many plasmid encoded genes were DnrE regulated. DnrF is controlling directly two regulator genes including the Fe-S cluster biosynthesis regulator iscR, genes of the electron transport chain and the glutathione metabolism. The genes for nitrate reductase and CO dehydrogenase are repressed by DnrD and DnrF. Both regulators in concert with FnrL are inducing the photosynthesis genes. One of the major denitrification operon control regions, the intergenic region between nirS and nosR2, contains one Fnr/Dnr binding site. Using regulator gene mutant strains, lacZ-reporter gene fusions in combination with promoter mutagenesis, the function of the single Fnr/Dnr binding site for FnrL-, DnrD-, and partly DnrF-dependent nirS and nosR2 transcriptional activation was shown. Overall, the unique regulatory network of the marine bacterium D. shibae for the transition from aerobic to anaerobic growth composed of four Crp/Fnr family regulators was elucidated. PMID:28473807

Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

PubMed Central

Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

1999-01-01

Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

Identification and overexpression of a knotted1-like transcription factor in switchgrass ( Panicum virgatum L.) for lignocellulosic feedstock improvement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wuddineh, Wegi A.; Mazarei, Mitra; Zhang, Ji -Yi

High biomass production and wide adaptation has made switchgrass ( Panicum virgatum L.) an important candidate lignocellulosic bioenergy crop. One major limitation of this and other lignocellulosic feedstocks is the recalcitrance of complex carbohydrates to hydrolysis for conversion to biofuels. Lignin is the major contributor to recalcitrance as it limits the accessibility of cell wall carbohydrates to enzymatic breakdown into fermentable sugars. Therefore, genetic manipulation of the lignin biosynthesis pathway is one strategy to reduce recalcitrance. Here, we identified a switchgrass Knotted1 transcription factor, PvKN1, with the aim of genetically engineering switchgrass for reduced biomass recalcitrance for biofuel production. Genemore » expression of the endogenous PvKN1 gene was observed to be highest in young inflorescences and stems. Ectopic overexpression of PvKN1 in switchgrass altered growth, especially in early developmental stages. Transgenic lines had reduced expression of most lignin biosynthetic genes accompanied by a reduction in lignin content suggesting the involvement of PvKN1 in the broad regulation of the lignin biosynthesis pathway. Moreover, the reduced expression of the Gibberellin 20-oxidase (GA20ox) gene in tandem with the increased expression of Gibberellin 2-oxidase (GA2ox) genes in transgenic PvKN1 lines suggest that PvKN1 may exert regulatory effects via modulation of GA signaling. Furthermore, overexpression of PvKN1 altered the expression of cellulose and hemicellulose biosynthetic genes and increased sugar release efficiency in transgenic lines. Our findings demonstrated that switchgrass PvKN1 is a putative ortholog of maize KN1 that is linked to plant lignification and cell wall and development traits as a major regulatory gene. Therefore, targeted overexpression of PvKN1 in bioenergy feedstocks may provide one feasible strategy for reducing biomass recalcitrance and simultaneously improving plant growth characteristics.« less

Identification and overexpression of a knotted1-like transcription factor in switchgrass ( Panicum virgatum L.) for lignocellulosic feedstock improvement

DOE PAGES

Wuddineh, Wegi A.; Mazarei, Mitra; Zhang, Ji -Yi; ...

2016-04-28

High biomass production and wide adaptation has made switchgrass ( Panicum virgatum L.) an important candidate lignocellulosic bioenergy crop. One major limitation of this and other lignocellulosic feedstocks is the recalcitrance of complex carbohydrates to hydrolysis for conversion to biofuels. Lignin is the major contributor to recalcitrance as it limits the accessibility of cell wall carbohydrates to enzymatic breakdown into fermentable sugars. Therefore, genetic manipulation of the lignin biosynthesis pathway is one strategy to reduce recalcitrance. Here, we identified a switchgrass Knotted1 transcription factor, PvKN1, with the aim of genetically engineering switchgrass for reduced biomass recalcitrance for biofuel production. Genemore » expression of the endogenous PvKN1 gene was observed to be highest in young inflorescences and stems. Ectopic overexpression of PvKN1 in switchgrass altered growth, especially in early developmental stages. Transgenic lines had reduced expression of most lignin biosynthetic genes accompanied by a reduction in lignin content suggesting the involvement of PvKN1 in the broad regulation of the lignin biosynthesis pathway. Moreover, the reduced expression of the Gibberellin 20-oxidase (GA20ox) gene in tandem with the increased expression of Gibberellin 2-oxidase (GA2ox) genes in transgenic PvKN1 lines suggest that PvKN1 may exert regulatory effects via modulation of GA signaling. Furthermore, overexpression of PvKN1 altered the expression of cellulose and hemicellulose biosynthetic genes and increased sugar release efficiency in transgenic lines. Our findings demonstrated that switchgrass PvKN1 is a putative ortholog of maize KN1 that is linked to plant lignification and cell wall and development traits as a major regulatory gene. Therefore, targeted overexpression of PvKN1 in bioenergy feedstocks may provide one feasible strategy for reducing biomass recalcitrance and simultaneously improving plant growth characteristics.« less

Insulin Reverses D-Glucose–Increased Nitric Oxide and Reactive Oxygen Species Generation in Human Umbilical Vein Endothelial Cells

PubMed Central

González, Marcelo; Rojas, Susana; Avila, Pía; Cabrera, Lissette; Villalobos, Roberto; Palma, Carlos; Aguayo, Claudio; Peña, Eduardo; Gallardo, Victoria; Guzmán-Gutiérrez, Enrique; Sáez, Tamara; Salsoso, Rocío; Sanhueza, Carlos; Pardo, Fabián; Leiva, Andrea; Sobrevia, Luis

2015-01-01

Vascular tone is controlled by the L-arginine/nitric oxide (NO) pathway, and NO bioavailability is strongly affected by hyperglycaemia-induced oxidative stress. Insulin leads to high expression and activity of human cationic amino acid transporter 1 (hCAT-1), NO synthesis and vasodilation; thus, a protective role of insulin on high D-glucose–alterations in endothelial function is likely. Vascular reactivity to U46619 (thromboxane A2 mimetic) and calcitonin gene related peptide (CGRP) was measured in KCl preconstricted human umbilical vein rings (wire myography) incubated in normal (5 mmol/L) or high (25 mmol/L) D-glucose. hCAT-1, endothelial NO synthase (eNOS), 42 and 44 kDa mitogen-activated protein kinases (p42/44mapk), protein kinase B/Akt (Akt) expression and activity were determined by western blotting and qRT-PCR, tetrahydrobiopterin (BH4) level was determined by HPLC, and L-arginine transport (0–1000 μmol/L) was measured in response to 5–25 mmol/L D-glucose (0–36 hours) in passage 2 human umbilical vein endothelial cells (HUVECs). Assays were in the absence or presence of insulin and/or apocynin (nicotinamide adenine dinucleotide phosphate-oxidase [NADPH oxidase] inhibitor), tempol or Mn(III)TMPyP (SOD mimetics). High D-glucose increased hCAT-1 expression and activity, which was biphasic (peaks: 6 and 24 hours of incubation). High D-glucose–increased maximal transport velocity was blocked by insulin and correlated with lower hCAT-1 expression and SLC7A1 gene promoter activity. High D-glucose–increased transport parallels higher reactive oxygen species (ROS) and superoxide anion (O2 •–) generation, and increased U46619-contraction and reduced CGRP-dilation of vein rings. Insulin and apocynin attenuate ROS and O2 •– generation, and restored vascular reactivity to U46619 and CGRP. Insulin, but not apocynin or tempol reversed high D-glucose–increased NO synthesis; however, tempol and Mn(III)TMPyP reversed the high D-glucose–reduced BH4 level. Insulin and tempol blocked the high D-glucose–increased p42/44mapk phosphorylation. Vascular dysfunction caused by high D-glucose is likely attenuated by insulin through the L-arginine/NO and O2 •–/NADPH oxidase pathways. These findings are of interest for better understanding vascular dysfunction in states of foetal insulin resistance and hyperglycaemia. PMID:25875935

Oxygen control of ethylene biosynthesis during seed development in Arabidopsis thaliana (L.) Heynh

NASA Technical Reports Server (NTRS)

Ramonell, K. M.; McClure, G.; Musgrave, M. E.

2002-01-01

An unforeseen side-effect on plant growth in reduced oxygen is the loss of seed production at concentrations around 25% atmospheric (50 mmol mol-1 O2). In this study, the model plant Arabidopsis thaliana (L.) Heynh. cv. 'Columbia' was used to investigate the effect of low oxygen on ethylene biosynthesis during seed development. Plants were grown in a range of oxygen concentrations (210 [equal to ambient], 160, 100, 50 and 25 mmol mol-1) with 0.35 mmol mol-1 CO2 in N2. Ethylene in full-sized siliques was sampled using gas chromatography, and viable seed production was determined at maturity. Molecular analysis of ethylene biosynthesis was accomplished using cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase in ribonuclease protection assays and in situ hybridizations. No ethylene was detected in siliques from plants grown at 50 and 25 mmol mol-1 O2. At the same time, silique ACC oxidase mRNA increased three-fold comparing plants grown under the lowest oxygen with ambient controls, whereas ACC synthase mRNA was unaffected. As O2 decreased, tissue-specific patterning of ACC oxidase and ACC synthase gene expression shifted from the embryo to the silique wall. These data demonstrate how low O2 modulates the activity and expression of the ethylene biosynthetic pathway during seed development in Arabidopsis.

Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

PubMed Central

Smesrud, Logan; Tebo, Bradley M.

2016-01-01

ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the deletion of FleQ, a regulator involved in both flagellum synthesis and biofilm synthesis in Pseudomonas aeruginosa. Therefore, these results are also an important step toward understanding the regulation of Mn(II) oxidation. PMID:27084014

Phytochrome Regulates Gibberellin Biosynthesis during Germination of Photoblastic Lettuce Seeds1

PubMed Central

Toyomasu, Tomonobu; Kawaide, Hiroshi; Mitsuhashi, Wataru; Inoue, Yasunori; Kamiya, Yuji

1998-01-01

Germination of lettuce (Lactuca sativa L.) seed is regulated by phytochrome. The requirement for red light is circumvented by the application of gibberellin (GA). We have previously shown that the endogenous content of GA1, the main bioactive GA in lettuce seeds, increases after red-light treatment. To clarify which step of GA1 synthesis is regulated by phytochrome, cDNAs encoding GA 20-oxidases (Ls20ox1 and Ls20ox2, for L. sativa GA 20-oxidase) and 3β-hydroxylases (Ls3h1 and Ls3h2 for L. sativa GA 3β-hydroxylase) were isolated from lettuce seeds by reverse-transcription polymerase chain reaction. Functional analysis of recombinant proteins expressed in Escherichia coli confirmed that the Ls20ox and Ls3h encode GA 20-oxidases and 3β-hydroxylases, respectively. Northern-blot analysis showed that Ls3h1 expression was dramatically induced by red-light treatment within 2 h, and that this effect was canceled by a subsequent far-red-light treatment. Ls3h2 mRNA was not detected in seeds that had been allowed to imbibe under any light conditions. Expression of the two Ls20ox genes was induced by initial imbibition alone in the dark. The level of Ls20ox2 mRNA decreased after the red-light treatment, whereas that of Ls20ox1 was unaffected by light. These results suggest that red light promotes GA1 synthesis in lettuce seeds by inducing Ls3h1 expression via phytochrome action. PMID:9847128

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

PubMed Central

Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

2017-01-01

Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

PubMed

Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

2018-03-16

Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

(/sup 11/C)clorgyline and (/sup 11/C)-L-deprenyl and their use in measuring functional monoamine oxidase activity in the brain using positron emission tomography

DOEpatents

Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.

1986-04-17

This invention involves a new strategy for imaging the activity of the enzyme monoamine oxidase in the living body by using /sup 11/C-labeled enzyme inhibitors which bind irreversibly to an enzyme as a result of catalysis. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.

Transcriptomic analysis of genes involved in the biosynthesis, recycling and degradation of L-ascorbic acid in pepper fruits (Capsicum annuum L.).

PubMed

Alós, Enriqueta; Rodrigo, María J; Zacarías, Lorenzo

2013-06-01

Sweet pepper (Capsicum annuum L.) is widely recognized among the vegetables with high content of ascorbic acid (AsA). However, the metabolic pathways involved in the biosynthesis, recycling and degradation of AsA and their relative contribution to the concentration of AsA have not been established yet. In the present work, the expression levels of selected genes involved in the AsA biosynthesis, degradation and recycling pathways were analyzed during development and ripening of pepper fruit cv. Palermo and in mature fruit of four cultivars (Lipari, C-116, Surrentino and Italverde) with different AsA concentrations. An inverse correlation was found between the expression of the biosynthetic genes and AsA concentrations, which could indicate that a feedback mechanism regulates AsA homeostasis in pepper fruits. Interestingly, analysis of mRNA levels of ascorbate oxidase, involved in the degradation of AsA, suggests that this enzyme plays a critical role in the regulation of the AsA pool during fruit development and ripening. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Isolation and Pathogenicity of Streptococcus iniae in Cultured Red Hybrid Tilapia in Malaysia.

PubMed

Rahmatullah, M; Ariff, M; Kahieshesfandiari, M; Daud, H M; Zamri-Saad, M; Sabri, M Y; Amal, M N A; Ina-Salwany, M Y

2017-12-01

This study describes the isolation and pathogenicity of Streptococcus iniae in cultured red hybrid tilapia (Nile Tilapia Oreochromis niloticus × Mozambique Tilapia O. mossambicus) in Malaysia. The isolated gram-positive S. iniae appeared punctiform, transparently white, catalase and oxidase negative and produced complete β-hemolysis on blood agar, while a PCR assay resulted in the amplification of the 16 S rRNA gene and lactate oxidase encoded genes. The isolate was sensitive to tetracycline, vancomycin, and bacitracin but was resistant to streptomycin, ampicillin, penicillin, and erythromycin. Pathogenicity trials conducted in local red hybrid tilapia (mean ± SE = 20.00 ± 0.45 g) showed 90.0, 96.7, and 100.0% mortality within 14 d postinfection following intraperitoneal exposure to 10 4 , 10 6 , and 10 8 CFU/mL of the pathogen, respectively. The clinical signs included erratic swimming, lethargy, and inappetance at 6 h postinfection, while mortality was recorded at less than 24 h postinfection in all infected groups. The LD 50-336 h of S. iniae against the red hybrid tilapia was 10 2 CFU/mL. The post mortem examinations revealed congested livers, kidneys, and spleens of the infected fish. This is the first report of S. iniae experimental infection in cultured red hybrid tilapia in Malaysia. Received January 20, 2017; accepted July 16, 2017.

Testing the performance of a fragment of the COI gene to identify western Palaearctic stag beetle species (Coleoptera, Lucanidae)

PubMed Central

Cox, Karen; Thomaes, Arno; Antonini, Gloria; Zilioli, Michele; De Gelas, Koen; Harvey, Deborah; Solano, Emanuela; Audisio, Paolo; McKeown, Niall; Shaw, Paul; Minetti, Robert; Bartolozzi, Luca; Mergeay, Joachim

2013-01-01

Abstract The taxonomy of stag beetles (Coleoptera: Lucanidae) remains challenging, mainly due to the sexual dimorphism and the strong allometry in males. Such conjecture confounds taxonomic based conservation efforts that are urgently needed due to numerous threats to stag beetle biodiversity. Molecular tools could help solve the problem of identification of the different recognized taxa in the “Lucanus cervus complex” and in some related Palaearctic species. We investigated the potential use of a 670 bp region at the 3’ end of the mitochondrial cytochrome c oxidase subunit I gene (COI) for barcoding purposes (different from the standard COI barcoding region). Well resolved species and subspecies were L. tetraodon, L. cervusakbesianus, L. c. laticornis, as well as the two eastern Asian outgroup taxa L. formosanus and L. hermani. Conversely, certain taxa could not be distinguished from each other based on K2P-distances and tree topologies: L. c. fabiani / L. (P.) barbarossa, L. c. judaicus / an unknown Lucanus species, L. c. cervus / L. c. turcicus / L. c. pentaphyllus / L. (P.) macrophyllus / L. ibericus. The relative roles of phenotypic plasticity, recurrent hybridisation and incomplete lineage sorting underlying taxonomic and phylogenetic discordances are discussed. PMID:24453554

Genetics Home Reference: hereditary xanthinuria

MedlinePlus

... xanthine dehydrogenase, described above, and another enzyme called aldehyde oxidase. Mutations in the MOCOS gene prevent xanthine dehydrogenase and aldehyde oxidase from being turned on (activated). The loss ...

Cloning and functional expression of the mitochondrial alternative oxidase gene (aox1) of Aspergillus niger in Lactococcus lactis and its induction by oxidizing conditions.

PubMed

Papagianni, Maria; Avramidis, Nicholaos

2012-01-05

Lactococcus lactis is a widely used food bacterium mainly known for its fermentation metabolism. An important, and for long time overlooked, trait of this species is its ability to perform respiratory metabolism in the presence of heme and under aerobic conditions. There is no evidence however for the presence of an alternative respiration pathway and AOX activity. In this study, a cDNA fragment encoding the mitochondrial alternative oxidase, the enzyme responsible for alternative respiration, from a citric acid producing Aspergillus niger strain was cloned and expressed in L. lactis as a host strain. Expression of aox1 conferred on this organism cyanide-resistant and salicylhydroxamate-sensitive growth. Bioreactor cultures under fully aerobic conditions of the transformed L. lactis showed that the alternative respiratory pathway operates and improves significantly the microorganism's response to oxidizing stress conditions as it enhances biomass production, suppresses lactate formation, and leads to accumulation of large amounts of nisin. Copyright © 2011 Elsevier Inc. All rights reserved.

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

Induction of defence gene expression by oligogalacturonic acid requires increases in both cytosolic calcium and hydrogen peroxide in Arabidopsis thaliana.

PubMed

Hu, Xiang Yang; Neill, Steven J; Cai, Wei Ming; Tang, Zhang Cheng

2004-06-01

Responses to oligogalacturonic acid (OGA) were determined in transgenic Arabidopsis thaliana seedlings expressing the calcium reporter protein aequorin. OGA stimulated a rapid, substantial and transient increase in the concentration of cytosolic calcium ([Ca2+]cyt) that peaked after ca. 15 s. This increase was dose-dependent, saturating at ca. 50 ug Gal equiv/ml of OGA. OGA also stimulated a rapid generation of H2O2. A small, rapid increase in H2O2 content was followed by a much larger oxidative burst, with H2O2 content peaking after ca. 60 min and declining thereafter. Induction of the oxidative burst by OGA was also dose-dependent, with a maximum response again being achieved at ca. 50 ug Gal equiv/mL. Inhibitors of calcium fluxes inhibited both increases in [Ca2+]cyt and [H2O2], whereas inhibitors of NADPH oxidase blocked only the oxidative burst. OGA increased strongly the expression of the defence-related genes CHS, GST, PAL and PR-1. This induction was suppressed by inhibitors of calcium flux or NADPH oxidase, indicating that increases in both cytosolic calcium and H2O2 are required for OGA-induced gene expression.

Functional genes and thermophilic microorganisms responsible for arsenite oxidation from the shallow sediment of an untraversed hot spring outlet.

PubMed

Yang, Ye; Mu, Yao; Zeng, Xian-Chun; Wu, Weiwei; Yuan, Jie; Liu, Yichen; Guoji, E; Luo, Feng; Chen, Xiaoming; Li, Hao; Wang, Jianing

2017-05-01

Hot Springs have unique geochemical features. Microorganisms-mediated arsenite oxidation is one of the major biogeochemical processes occurred in some hot springs. This study aimed to understand the diversities of genes and microorganisms involved in arsenite oxidation from the outlet of an untraversed hot spring located at an altitude of 4226 m. Microcosm assay indicated that the microbial community from the hot spring was able to efficiently oxidize As(III) using glucose, lactic acid, yeast extract or sodium bicarbonate as the sole carbon source. The microbial community contained 7 phyla of microorganisms, of which Proteobacteria and Firmicutes are largely dominant; this composition is unique and differs significantly from those of other described hot springs. Twenty one novel arsenite oxidase genes were identified from the samples, which are affiliated with the arsenite oxidase families of α-Proteobacteria, β-Proteobacteria or Archaea; this highlights the high diversity of the arsenite-oxidizing microorganisms from the hot spring. A cultivable arsenite-oxidizer Chelatococcu sp. GHS311 was also isolated from the sample using enrichment technique. It can completely convert 75.0 mg/L As(III) into As(V) in 18 days at 45 °C. The arsenite oxidase of GHS311 shares the maximal sequence identity (84.7%) to that of Hydrogenophaga sp. CL3, a non-thermotolerant bacterium. At the temperature lower than 30 °C or higher than 65 °C, the growth of this strain was completely inhibited. These data help us to better understand the diversity and functional features of the thermophilic arsenite-oxidizing microorganisms from hot springs.

Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

USDA-ARS?s Scientific Manuscript database

In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

Reactive oxygen species induced by heat stress during grain filling of rice (Oryza sativa L.) are involved in occurrence of grain chalkiness.

PubMed

Suriyasak, Chetphilin; Harano, Keisuke; Tanamachi, Koichiro; Matsuo, Kazuhiro; Tamada, Aina; Iwaya-Inoue, Mari; Ishibashi, Yushi

2017-09-01

Heat stress during grain filling increases rice grain chalkiness due to increased activity of α-amylase, which hydrolyzes starch. In rice and barley seeds, reactive oxygen species (ROS) produced after imbibition induce α-amylase activity via regulation of gibberellin (GA) and abscisic acid (ABA) levels during seed germination. Here, we examined whether ROS is involved in induction of grain chalkiness by α-amylase in developing rice grains under heat stress. To elucidate the role of ROS in grain chalkiness, we grew post-anthesis rice plants (Oryza sativa L. cv. Koshihikari) under control (25°C) or heat stress (30°C) conditions with or without antioxidant (dithiothreitol) treatment. The developing grains were analyzed for expression of NADPH oxidases, GA biosynthesis genes (OsGA3ox1, OsGA20ox1), ABA catabolism genes (OsABA8'OH1, OsABA8'OH2) and an α-amylase gene (OsAmy3E), endogenous H 2 O 2 content and the grain quality. In grains exposed to heat stress, the expression of NADPH oxidase genes (especially, OsRbohB, OsRbohD, OsRbohF and OsRbohI) and the ROS content increased. Heat stress also increased the expression of OsGA3ox1, OsGA20ox1, OsABA8'OH1, OsABA8'OH2 and OsAmy3E. On the other hand, dithiothreitol treatment reduced the effects of heat stress on the expression of these genes and significantly reduced grain chalkiness induced by heat stress. These results suggest that, similar to cereal seed germination mechanism, ROS produced under heat stress is involved in α-amylase induction in maturating rice grains through GA/ABA metabolism, and consequently caused grain chalkiness. Copyright © 2017 Elsevier GmbH. All rights reserved.

Recent advances in Parkinson's disease therapy: use of monoamine oxidase inhibitors.

PubMed

Henchcliffe, Claire; Schumacher, H Christian; Burgut, F Tuna

2005-11-01

Monoamine oxidase inhibitors inhibit dopamine metabolism and are therefore effective in treating Parkinson's disease, a condition associated with progressive striatal dopamine deficiency secondary to degeneration of dopaminergic neurons in the substantia nigra. Selegiline is currently the most widely used monoamine oxidase-B inhibitor for Parkinson's disease, but has a low and variable bioavailability, and is metabolized to L-methamphetamine and L-amphetamine that carry a risk for potential neurotoxicity. There are two new approaches that circumvent these potential disadvantages. First, selegiline orally disintegrating tablets provide a novel delivery form of selegiline, avoiding first pass metabolism by rapid absorption through the oral mucosa, thus leading to significantly lower plasma concentrations of L-metamphetamine and L-amphetamine. Selegiline orally disintegrating tablets prove to be clinically effective and safe in patients with moderately advanced Parkinson's disease. Second, rasagiline is a new monoamine oxidase inhibitor, without known neurotoxic metabolites. In large clinical trials, rasagiline proves effective as monotherapy in early Parkinson's disease, as well as adjunctive therapy to levodopa in advanced disease. Clinical data suggest, in addition, a disease-modifying effect of rasagiline that may correlate with neuroprotective activity of monoamine oxidase-B inhibitors in animal models of Parkinson's disease.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

PubMed

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

PubMed

Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

2001-05-04

The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Silencing C19-GA 2-oxidases induces parthenocarpic development and inhibits lateral branching in tomato plants

PubMed Central

Martínez-Bello, Liliam; Moritz, Thomas; López-Díaz, Isabel

2015-01-01

Gibberellins (GAs) are phytohormones that regulate a wide range of developmental processes in plants. Levels of active GAs are regulated by biosynthetic and catabolic enzymes like the GA 2-oxidases (GA2oxs). In tomato (Solanum lycopersicum L.) C19 GA2oxs are encoded by a small multigenic family of five members with some degree of redundancy. In order to investigate their roles in tomato, the silencing of all five genes in transgenic plants was induced. A significant increase in active GA4 content was found in the ovaries of transgenic plants. In addition, the transgenic unfertilized ovaries were much bigger than wild-type ovaries (about 30 times) and a certain proportion (5–37%) were able to develop parthenocarpically. Among the GA2ox family, genes GA2ox1 and -2 seem to be the most relevant for this phenotype since their expression was induced in unfertilized ovaries and repressed in developing fruits, inversely correlating with ovary growth. Interestingly, transgenic lines exhibited a significant inhibition of branching and a higher content of active GA4 in axillary buds. This phenotype was reverted, in transgenic plants, by the application of paclobutrazol, a GA biosynthesis inhibitor, suggesting a role for GAs as repressors of branching. In summary, this work demonstrates that GA 2-oxidases regulate gibberellin levels in ovaries and axillary buds of tomato plants and their silencing is responsible for parthenocarpic fruit growth and branching inhibition. PMID:26093022

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

Extracellular cholesterol oxidase production by Streptomyces aegyptia, in vitro anticancer activities against rhabdomyosarcoma, breast cancer cell-lines and in vivo apoptosis.

PubMed

El-Naggar, Noura El-Ahmady; Soliman, Hoda M; El-Shweihy, Nancy M

2018-02-09

In recent years, microbial cholesterol oxidases have gained great attention due to its widespread use in medical applications for serum cholesterol determination. Streptomyces aegyptia strain NEAE-102 exhibited high level of extracellular cholesterol oxidase production using a minimum medium containing cholesterol as the sole source of carbon. Fifteen variables were screened using Plackett-Burman design for the enhanced cholesterol oxidase production. The most significant variables affecting enzyme production were further optimized by using the face-centered central composite design. The statistical optimization resulted in an overall 4.97-fold increase (15.631 UmL -1 ) in cholesterol oxidase production in the optimized medium as compared with the unoptimized medium before applying Plackett Burman design (3.1 UmL -1 ). The purified cholesterol oxidase was evaluated for its in vitro anticancer activities against five human cancer cell lines. The selectivity index values on rhabdomyosarcoma and breast cancer cell lines were 3.26 and 2.56; respectively. The in vivo anticancer activity of cholesterol oxidase was evaluated against Ehrlich solid tumor model. Compared with control mice, tumors growth was significantly inhibited in the mice injected with cholesterol oxidase alone, doxorubicin alone and cholesterol oxidase/doxorubicin combination by 60.97%, 72.99% and 97.04%; respectively. These results demonstrated that cholesterol oxidase can be used as a promising natural anticancer drug.

Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.

PubMed

Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro

2002-07-19

The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.

Racemic resolution of some DL-amino acids using Aspergillus fumigatus L-amino acid oxidase.

PubMed

Singh, Susmita; Gogoi, Binod K; Bezbaruah, Rajib L

2011-07-01

The ability of Aspergillus fumigatus L-amino acid oxidase (L-aao) to cause the resolution of racemic mixtures of DL-amino acids was investigated with DL-alanine, DL-phenylalanine, DL-tyrosine, and DL-aspartic acid. A chiral column, Crownpak CR+ was used for the analysis of the amino acids. The enzyme was able to cause the resolution of the three DL-amino acids resulting in the production of optically pure D-alanine (100% resolution), D-phenylalanine (80.2%), and D-tyrosine (84.1%), respectively. The optically pure D-amino acids have many uses and thus can be exploited industrially. This is the first report of the use of A. fumigatus L: -amino acid oxidase for racemic resolution of DL-amino acids.

The structure and inhibition of human diamine oxidase†,‡

PubMed Central

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O.; Brown, Doreen E; Dooley, David M; Guss, J Mitchell

2009-01-01

Humans have three functioning genes that code for copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 Å. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9 % sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 Å and 2.2 Å, respectively. They bind non-covalently in the active site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

Identification, expression and tissue distribution of a renalase homologue from mouse.

PubMed

Wang, Jian; Qi, Shaoling; Cheng, Wei; Li, Li; Wang, Fu; Li, Ying-Zi; Zhang, Shu-Ping

2008-12-01

FAD (flavin adenine dinucleotide)-dependent monoamine oxidases play very important roles in many biological processes. A novel monoamine oxidase, named renalase, has been identified in human kidney recently and is found to be markedly reduced in patients with end-stage renal disease (ESRD). Here, we reported the identification of a renalase homologue from mouse, termed mMAO-C (mouse monoamine oxidase-C) after the monoamine oxidase-A and -B (MAO-A and -B). This gene locates on the mouse chromosome 19C1 and its coding region spans 7 exons. The deuced amino acid sequences were predicted to contain a typical secretive signal peptide and a conserved amine oxidase domain. Phylogenetic analysis and multiple sequences alignment indicated that mMAO-C-like sequences exist in all examined species and share significant similarities. This gene has been submitted to the NCBI GenBank database (Accession number: DQ788834). With expression vectors generated from the cloned mMAO-C gene, exogenous protein was effectively expressed in both prokaryotic and eukaryotic cells. Recombinant mMAO-C protein was secreted out of human cell lines, indicating the biological function of its signal peptide. Moreover, tissue expression pattern analysis revealed that mMAO-C gene is predominantly expressed in the mouse kidney and testicle, which implies that kidney and testicle are the main sources of renalase secretion. Shortly, this study provides an insight into understanding the physiological and biological functions of mMAO-C and its homologues in endocrine.

Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

PubMed Central

Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu

1999-01-01

We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

PubMed Central

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

PubMed

Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

2015-04-01

Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.

Involvement of alternative oxidase (AOX) in adventitious rooting of Olea europaea L. microshoots is linked to adaptive phenylpropanoid and lignin metabolism.

PubMed

Santos Macedo, E; Sircar, D; Cardoso, H G; Peixe, A; Arnholdt-Schmitt, B

2012-09-01

Alternative oxidase (AOX) has been proposed as a functional marker candidate in a number of events involving cell differentiation, including rooting efficiency in semi-hardwood shoot cuttings of olive (Olea europaea L.). To ascertain the general importance of AOX in olive rooting, the auxin-induced rooting process was studied in an in vitro system for microshoot propagation. Inhibition of AOX by salicylhydroxamic acid (SHAM) significantly reduced rooting efficiency. However, the inhibitor failed to exhibit any effect on the preceding calli stage. This makes the system appropriate for distinguishing dedifferentiation and de novo differentiation during root induction. Metabolite analyses of microshoots showed that total phenolics, total flavonoids and lignin contents were significantly reduced upon SHAM treatment. It was concluded that the influence of alternative respiration on root formation was associated to adaptive phenylpropanoid and lignin metabolism. Transcript profiles of two olive AOX genes (OeAOX1a and OeAOX2) were examined during the process of auxin-induced root induction. Both genes displayed stable transcript accumulation in semi-quantitative RT-PCR analysis during all experimental stages. In contrary, when the reverse primer for OeAOX2 was designed from the 3'-UTR instead of the ORF, differential transcript accumulation was observed suggesting posttranscriptional regulation of OeAOX2 during metabolic acclimation. This result confirms former observations in olive semi-hardwood shoot cuttings on differential OeAOX2 expression during root induction. It further points to the importance of future studies on the functional role of sequence and length polymorphisms in the 3'-UTR of this gene. The manuscript reports the general importance of AOX in olive adventitious rooting and the association of alternative respiration to adaptive phenylpropanoid and lignin metabolism.

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Treesearch

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Treesearch

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans.

PubMed

Fox, M A; Panessiti, M G; Moya, P R; Tolliver, T J; Chen, K; Shih, J C; Murphy, D L

2013-12-01

A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ∼2.6-3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ∼4.5-6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes.

Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans

PubMed Central

Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL

2012-01-01

A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

Possible interaction between MAOA and DRD2 genes associated with antisocial alcoholism among Han Chinese men in Taiwan.

PubMed

Wang, Tso-Jen; Huang, San-Yuan; Lin, Wei-Wen; Lo, Hsin-Yi; Wu, Pei-Lin; Wang, Yu-Shan; Wu, Yi-Syuan; Ko, Huei-Chen; Shih, Jean-Chen; Lu, Ru-Band

2007-01-30

Both monoamine oxidase A (MAOA) and dopamine D(2) receptor (DRD2) genes have been considered as candidate genes for antisocial personality disorder with alcoholism (Antisocial ALC) [Parsian, A., 1999. Sequence analysis of exon 8 of MAO-A gene in alcoholics with antisocial personality and normal controls. Genomics. 45, 290-295.; Samochowiec, J., Lesch, K.P., Rottmann, M., Smolka, M., Syagailo, Y.V., Okladnova, O., Rommelspacher, H., Winterer, G., Schmidt, L.G., Sander, T., 1999. Association of a regulatory polymorphism in the promoter region of the monoamine oxidase A gene with antisocial alcoholism. Psychiatry. Res. 86, 67-72.; Schmidt, L.vG., Sander, T., Kuhn, S., Smolka, M., Rommelspacher, H., Samochowiec, J., Lesch, K.P., 2000. Different allele distribution of a regulatory MAO-A gene promotor polymorphism in antisocial and anxious-depressive alcoholics. J. Neural .Transm. 107, 681-689.]. However, the association between alcoholism and MAOA or DRD2 gene has not been universally accepted [Lee, J.F., Lu, R.B., Ko, H.C., Chang, F.M., Yin, S.J., Pakstis, A.J., Kidd, K.K., 1999. No association between DRD(2) locus and alcoholism after controlling the ADH and ALDH genotypes in Chinese Han population. Alcohol. Clin. Exp. Res. 23, 592-599.; Lu, R.B., Lin, W.W., Lee, J.F., Ko, H.C., Shih, J.C., 2003. Neither antisocial personality disorder nor antisocial alcoholism association with MAOA gene among Han Chinese males in Taiwan. Alcohol. Clin. Exp. Res. 27, 889-893.]. Since dopamine is metabolized to 3,4-dihydroxyphenyl-acetaldehyde (DOPAL) via monoamine oxidase (MAO) [Westerink, B.H., de Vries, J.B., 1985. On the origin of dopamine and its metabolite in predominantly noradrenergic innervated brain areas. Brain. Res. 330, 164-166.], the interaction between MAOA and DRD2 genes might be related to Antisocial ALC. The present study aimed to determine whether Antisocial ALC might be associated with the possible interactions of DRD2 gene with MAOA gene. Of the 231 Han Chinese subjects who were recruited for the study, 73 participants were diagnosed with Antisocial ALC and 158 subjects were diagnosed with antisocial personality disorder without alcoholism (Antisocial Non-ALC). The DRD2 TaqI A and MAOA-uVNTR (variable number of tandem repeat located upstream) polymorphisms were not found to be associated with Antisocial ALC. However, an association between DRD2 TaqI A polymorphisms and Antisocial ALC was shown only after stratification for the MAOA-uVNTR 4-repeat polymorphism. Additionally, after multiple logistic regressions, we found that, under stratification of MAOA-uVNTR 4-repeat polymorphism and in comparison with the DRD2 A1/A1 genotype as a reference group, the DRD2 A1/A2 genotype has a possible protective effect against alcoholism in individuals with antisocial personality disorder (ASPD). We concluded that the possible interactions between MAOA-uVNTR polymorphism and DRD2 TaqI A polymorphism might be related to Antisocial ALC among Han Chinese men in Taiwan.

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification of NADPH oxidase family members associated with cold stress in strawberry.

PubMed

Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru

2018-04-01

NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.

The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

PubMed

Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

2006-01-01

The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

Identification of seven polyamine oxidase genes in tomato (Solanum lycopersicum L.) and their expression profiles under physiological and various stress conditions.

PubMed

Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo

2018-05-15

Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.

Ascorbic acid metabolism during sweet cherry (Prunus avium) fruit development

PubMed Central

Ni, Zhiyou; Lin, Lijin; Tang, Yi; Wang, Zhihui; Wang, Xun; Wang, Jin; Lv, Xiulan; Xia, Hui

2017-01-01

To elucidate metabolism of ascorbic acid (AsA) in sweet cherry fruit (Prunus avium ‘Hongdeng’), we quantified AsA concentration, cloned sequences involved in AsA metabolism and investigated their mRNA expression levels, and determined the activity levels of selected enzymes during fruit development and maturation. We found that AsA concentration was highest at the petal-fall period (0 days after anthesis) and decreased progressively during ripening, but with a slight increase at maturity. AsA did nevertheless continue to accumulate over time because of the increase in fruit fresh weight. Full-length cDNAs of 10 genes involved in the L-galactose pathway of AsA biosynthesis and 10 involved in recycling were obtained. Gene expression patterns of GDP-L-galactose phosphorylase (GGP2), L-galactono-1, 4-lactone dehydrogenase (GalLDH), ascorbate peroxidase (APX3), ascorbate oxidase (AO2), glutathione reductase (GR1), and dehydroascorbate reductase (DHAR1) were in accordance with the AsA concentration pattern during fruit development, indicating that genes involved in ascorbic acid biosynthesis, degradation, and recycling worked in concert to regulate ascorbic acid accumulation in sweet cherry fruit. PMID:28245268

Host Factors Contributing to Disability Following Sulfur Mustard Exposure

DTIC Science & Technology

1992-03-30

800 bp EGF fragment inserted (now called pGEGF), (c) pGEMEX with the larger pmEGF-26F12 4000 bp fragment, ( d ) pGEMEX with 8 DAMD17-90-C-0037 - March...xanthine oxidase, 21 DAMD17-90-C-0037 -- March 1992 - Midterm Report -- Arthur M. Dannenberg, Jr., M.D. D -amino acid oxidase, monoamine oxidase and alpha...mouse. J. Immunol. 141: 3081-3095, 1988. 4. Cooper, C.L., Mueller, C., Sinchaisri, T-A., Pirmez, D ., Chan, J., Kaplan, G., Young, S.M.M., Weissman, I.L

A Functional Polymorphism of the MAOA Gene Modulates Spontaneous Brain Activity in Pons

PubMed Central

Lei, Hui; Zhang, Xiaocui; Di, Xin; Rao, Hengyi; Ming, Qingsen; Zhang, Jibiao; Guo, Xiao; Jiang, Yali; Gao, Yidian; Yi, Jinyao; Zhu, Xiongzhao; Yao, Shuqiao

2014-01-01

Objective. To investigate the effects of a functional polymorphism of the monoamine oxidase A (MAOA) gene on spontaneous brain activity in healthy male adolescents. Methods. Thirty-one healthy male adolescents with the low-activity MAOA genotype (MAOA-L) and 25 healthy male adolescents with the high-activity MAOA genotype (MAOA-H) completed the 11-item Barratt Impulsiveness Scale (BIS-11) questionnaire and were subjected to resting-state functional magnetic resonance imaging (rs-fMRI) scans. The amplitude of low-frequency fluctuation (ALFF) of the blood oxygen level-dependent (BOLD) signal was calculated using REST software. ALFF data were related to BIS scores and compared between genotype groups. Results. Compared with the MAOA-H group, the MAOA-L group showed significantly lower ALFFs in the pons. There was a significant correlation between the BIS scores and the ALFF values in the pons for MAOA-L group, but not for the MAOA-H group. Further regression analysis showed a significant genotype by ALFF values interaction effect on BIS scores. Conclusions. Lower spontaneous brain activity in the pons of the MAOA-L male adolescents may provide a neural mechanism by which boys with the MAOA-L genotype confers risk for impulsivity and aggression. PMID:24971323

A functional polymorphism of the MAOA gene modulates spontaneous brain activity in pons.

PubMed

Lei, Hui; Zhang, Xiaocui; Di, Xin; Rao, Hengyi; Ming, Qingsen; Zhang, Jibiao; Guo, Xiao; Jiang, Yali; Gao, Yidian; Yi, Jinyao; Zhu, Xiongzhao; Yao, Shuqiao

2014-01-01

To investigate the effects of a functional polymorphism of the monoamine oxidase A (MAOA) gene on spontaneous brain activity in healthy male adolescents. Thirty-one healthy male adolescents with the low-activity MAOA genotype (MAOA-L) and 25 healthy male adolescents with the high-activity MAOA genotype (MAOA-H) completed the 11-item Barratt Impulsiveness Scale (BIS-11) questionnaire and were subjected to resting-state functional magnetic resonance imaging (rs-fMRI) scans. The amplitude of low-frequency fluctuation (ALFF) of the blood oxygen level-dependent (BOLD) signal was calculated using REST software. ALFF data were related to BIS scores and compared between genotype groups. Compared with the MAOA-H group, the MAOA-L group showed significantly lower ALFFs in the pons. There was a significant correlation between the BIS scores and the ALFF values in the pons for MAOA-L group, but not for the MAOA-H group. Further regression analysis showed a significant genotype by ALFF values interaction effect on BIS scores. Lower spontaneous brain activity in the pons of the MAOA-L male adolescents may provide a neural mechanism by which boys with the MAOA-L genotype confers risk for impulsivity and aggression.

[Cytochrome c oxydase-deficient Leigh syndrome with homozygous mutation in SURF1 gene].

PubMed

Monnot, S; Chabrol, B; Cano, A; Pellissier, J F; Collignon, P; Montfort, M F; Paquis-Flucklinger, V

2005-05-01

Leigh syndrome is a heterogeneous disorder, usually due to a defect in oxidative metabolism. Mutations in SURF1 gene have been identified in patients with cytochrome c oxidase deficiency. We report a homozygous splice site deletion [516-2_516-1delAG] in a young girl presenting with cytochrome c oxidase-deficient Leigh syndrome. Identification of molecular defect is indispensable for genetic counselling and prenatal diagnosis.

Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

PubMed

Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

2017-06-05

Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

A thermostable L-aspartate oxidase: a new tool for biotechnological applications.

PubMed

Bifulco, Davide; Pollegioni, Loredano; Tessaro, Davide; Servi, Stefano; Molla, Gianluca

2013-08-01

L-Amino acid oxidases (LAAOs) are homodimeric flavin adenine dinucleotide (FAD)-containing flavoproteins that catalyze the stereospecific oxidative deamination of L-amino acids to α-keto acids, ammonia, and hydrogen peroxide. Unlike the D-selective counterpart, the biotechnological application of LAAOs has not been thoroughly advanced because of the difficulties in their expression as recombinant protein in prokaryotic hosts. In this work, L-aspartate oxidase from the thermophilic archea Sulfolobus tokodaii (StLASPO, specific for L-aspartate and L-asparagine only) was efficiently produced as recombinant protein in E. coli in the active form as holoenzyme. This recombinant flavoenzyme shows the classical properties of FAD-containing oxidases. Indeed, StLASPO shows distinctive features that makes it attractive for biotechnological applications: high thermal stability (it is fully stable up to 80 °C) and high temperature optimum, stable activity in a broad range of pH (7.0-10.0), weak inhibition by the product oxaloacetate and by D-aspartate, and tight binding of the FAD cofactor. This latter property significantly distinguishes StLASPO from the E. coli counterpart. StLASPO represents an appropriate novel biocatalyst for the production of D-aspartate and a well-suited protein scaffold to evolve a LAAO activity by protein engineering.

Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

PubMed

Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

2013-06-01

Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

PubMed

Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

2003-10-01

Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.

Mammalian molybdo-flavoenzymes, an expanding family of proteins: structure, genetics, regulation, function and pathophysiology.

PubMed Central

Garattini, Enrico; Mendel, Ralf; Romão, Maria João; Wright, Richard; Terao, Mineko

2003-01-01

The molybdo-flavoenzymes are structurally related proteins that require a molybdopterin cofactor and FAD for their catalytic activity. In mammals, four enzymes are known: xanthine oxidoreductase, aldehyde oxidase and two recently described mouse proteins known as aldehyde oxidase homologue 1 and aldehyde oxidase homologue 2. The present review article summarizes current knowledge on the structure, enzymology, genetics, regulation and pathophysiology of mammalian molybdo-flavoenzymes. Molybdo-flavoenzymes are structurally complex oxidoreductases with an equally complex mechanism of catalysis. Our knowledge has greatly increased due to the recent crystallization of two xanthine oxidoreductases and the determination of the amino acid sequences of many members of the family. The evolution of molybdo-flavoenzymes can now be traced, given the availability of the structures of the corresponding genes in many organisms. The genes coding for molybdo-flavoenzymes are expressed in a cell-specific fashion and are controlled by endogenous and exogenous stimuli. The recent cloning of the genes involved in the biosynthesis of the molybdenum cofactor has increased our knowledge on the assembly of the apo-forms of molybdo-flavoproteins into the corresponding holo-forms. Xanthine oxidoreductase is the key enzyme in the catabolism of purines, although recent data suggest that the physiological function of this enzyme is more complex than previously assumed. The enzyme has been implicated in such diverse pathological situations as organ ischaemia, inflammation and infection. At present, very little is known about the pathophysiological relevance of aldehyde oxidase, aldehyde oxidase homologue 1 and aldehyde oxidase homologue 2, which do not as yet have an accepted endogenous substrate. PMID:12578558

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

PubMed

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Vitamin C in human health and disease is still a mystery ? An overview

PubMed Central

Naidu, K Akhilender

2003-01-01

Ascorbic acid is one of the important water soluble vitamins. It is essential for collagen, carnitine and neurotransmitters biosynthesis. Most plants and animals synthesize ascorbic acid for their own requirement. However, apes and humans can not synthesize ascorbic acid due to lack of an enzyme gulonolactone oxidase. Hence, ascorbic acid has to be supplemented mainly through fruits, vegetables and tablets. The current US recommended daily allowance (RDA) for ascorbic acid ranges between 100–120 mg/per day for adults. Many health benefits have been attributed to ascorbic acid such as antioxidant, anti-atherogenic, anti-carcinogenic, immunomodulator and prevents cold etc. However, lately the health benefits of ascorbic acid has been the subject of debate and controversies viz., Danger of mega doses of ascorbic acid? Does ascorbic acid act as a antioxidant or pro-oxidant ? Does ascorbic acid cause cancer or may interfere with cancer therapy? However, the Panel on dietary antioxidants and related compounds stated that the in vivo data do not clearly show a relationship between excess ascorbic acid intake and kidney stone formation, pro-oxidant effects, excess iron absorption. A number of clinical and epidemiological studies on anti-carcinogenic effects of ascorbic acid in humans did not show any conclusive beneficial effects on various types of cancer except gastric cancer. Recently, a few derivatives of ascorbic acid were tested on cancer cells, among them ascorbic acid esters showed promising anticancer activity compared to ascorbic acid. Ascorbyl stearate was found to inhibit proliferation of human cancer cells by interfering with cell cycle progression, induced apoptosis by modulation of signal transduction pathways. However, more mechanistic and human in vivo studies are needed to understand and elucidate the molecular mechanism underlying the anti-carcinogenic property of ascorbic acid. Thus, though ascorbic acid was discovered in 17th century, the exact role of this vitamin/nutraceutical in human biology and health is still a mystery in view of many beneficial claims and controversies. PMID:14498993

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-01-01

Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

PubMed Central

Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

2016-01-01

Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

PubMed Central

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

PubMed Central

Kües, Ursula; Rühl, Martin

2011-01-01

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Electrochemical l-Lactic Acid Sensor Based on Immobilized ZnO Nanorods with Lactate Oxidase

PubMed Central

Ibupoto, Zafar Hussain; Ali Shah, Syed Muhammad Usman; Khun, Kimleang; Willander, Magnus

2012-01-01

In this work, fabrication of gold coated glass substrate, growth of ZnO nanorods and potentiometric response of lactic acid are explained. The biosensor was developed by immobilizing the lactate oxidase on the ZnO nanorods in combination with glutaraldehyde as a cross linker for lactate oxidase enzyme. The potentiometric technique was applied for the measuring the output (EMF) response of l-lactic acid biosensor. We noticed that the present biosensor has wide linear detection range of concentration from 1 × 10−4–1 × 100 mM with acceptable sensitivity about 41.33 ± 1.58 mV/decade. In addition, the proposed biosensor showed fast response time less than 10 s, a good selectivity towards l-lactic acid in presence of common interfering substances such as ascorbic acid, urea, glucose, galactose, magnesium ions and calcium ions. The present biosensor based on immobilized ZnO nanorods with lactate oxidase sustained its stability for more than three weeks. PMID:22736960

Electrochemical L-lactic acid sensor based on immobilized ZnO nanorods with lactate oxidase.

PubMed

Ibupoto, Zafar Hussain; Shah, Syed Muhammad Usman Ali; Khun, Kimleang; Willander, Magnus

2012-01-01

In this work, fabrication of gold coated glass substrate, growth of ZnO nanorods and potentiometric response of lactic acid are explained. The biosensor was developed by immobilizing the lactate oxidase on the ZnO nanorods in combination with glutaraldehyde as a cross linker for lactate oxidase enzyme. The potentiometric technique was applied for the measuring the output (EMF) response of l-lactic acid biosensor. We noticed that the present biosensor has wide linear detection range of concentration from 1 × 10(-4)-1 × 10(0) mM with acceptable sensitivity about 41.33 ± 1.58 mV/decade. In addition, the proposed biosensor showed fast response time less than 10 s, a good selectivity towards l-lactic acid in presence of common interfering substances such as ascorbic acid, urea, glucose, galactose, magnesium ions and calcium ions. The present biosensor based on immobilized ZnO nanorods with lactate oxidase sustained its stability for more than three weeks.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

PubMed Central

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that cytochrome bd is an important terminal oxidase in M. smegmatis. PMID:11717265

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

Overexpression of Arabidopsis Molybdenum Cofactor Sulfurase Gene Confers Drought Tolerance in Maize (Zea mays L.)

PubMed Central

Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu

2013-01-01

Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H2O2 content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses. PMID:23326325

Overexpression of Arabidopsis molybdenum cofactor sulfurase gene confers drought tolerance in maize (Zea mays L.).

PubMed

Lu, Yao; Li, Yajun; Zhang, Jiachang; Xiao, Yitao; Yue, Yuesen; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu

2013-01-01

Abscisic acid (ABA) is a key component of the signaling system that integrates plant adaptive responses to abiotic stress. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene (LOS5) in maize markedly enhanced the expression of ZmAO and aldehyde oxidase (AO) activity, leading to ABA accumulation and increased drought tolerance. Transgenic maize (Zea mays L.) exhibited the expected reductions in stomatal aperture, which led to decreased water loss and maintenance of higher relative water content (RWC) and leaf water potential. Also, transgenic maize subjected to drought treatment exhibited lower leaf wilting, electrolyte leakage, malondialdehyde (MDA) and H(2)O(2) content, and higher activities of antioxidative enzymes and proline content compared to wild-type (WT) maize. Moreover, overexpression of LOS5 enhanced the expression of stress-regulated genes such as Rad 17, NCED1, CAT1, and ZmP5CS1 under drought stress conditions, and increased root system development and biomass yield after re-watering. The increased drought tolerance in transgenic plants was associated with ABA accumulation via activated AO and expression of stress-related gene via ABA induction, which sequentially induced a set of favorable stress-related physiological and biochemical responses.

Expression of Ascorbic Acid Oxidase in Zucchini Squash (Cucurbita pepo L.).

PubMed

Lin, L S; Varner, J E

1991-05-01

The expression of ascorbic acid oxidase was studied in zucchini squash (Cucurbita pepo L.), one of the most abundant natural sources of the enzyme. In the developing fruit, specific activity of ascorbic acid oxidase was highest between 4 and 6 days after anthesis. Protein and mRNA levels followed the same trend as enzyme activity. Highest growth rate of the fruit occurred before 6 days after anthesis. Within a given fruit, ascorbic acid oxidase activity and mRNA level were highest in the epidermis, and lowest in the central placental region. In leaf tissue, ascorbic acid oxidase activity was higher in young leaves, and very low in old leaves. Within a given leaf, enzyme activity was highest in the fast-growing region (approximately the lower third of the blade), and lowest in the slow-growing region (near leaf apex). High expression of ascorbic acid oxidase at a stage when rapid growth is occurring (in both fruits and leaves), and localization of the enzyme in the fruit epidermis, where cells are under greatest tension during rapid growth in girth, suggest that ascorbic acid oxidase might be involved in reorganization of the cell wall to allow for expansion. Based on the known chemistry of dehydroascorbic acid, the end product of the ascorbic acid oxidase-catalyzed reaction, we have proposed several hypotheses to explain how dehydroascorbic acid might cause cell wall "loosening."

Genetics Home Reference: isolated sulfite oxidase deficiency

MedlinePlus

... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

PubMed

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T

PubMed Central

Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong

2016-01-01

Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324

Androgen receptor and monoamine oxidase polymorphism in wild bonobos

PubMed Central

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

Component identification of electron transport chains in curdlan-producing Agrobacterium sp. ATCC 31749 and its genome-specific prediction using comparative genome and phylogenetic trees analysis.

PubMed

Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang

2011-06-01

Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.

Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

USDA-ARS?s Scientific Manuscript database

Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

Molecular evolution of the polyamine oxidase gene family in Metazoa

PubMed Central

2012-01-01

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS) mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO) and orthologous genes related by speciation events (PAOs, SMOs/APAOs). Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies. PMID:22716069

Molecular evolution of the polyamine oxidase gene family in Metazoa.

PubMed

Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

2012-06-20

Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS) mechanism. In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO) and orthologous genes related by speciation events (PAOs, SMOs/APAOs). Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies.

Streptococcus mutans Displays Altered Stress Responses While Enhancing Biofilm Formation by Lactobacillus casei in Mixed-Species Consortium

PubMed Central

Wen, Zezhang T.; Liao, Sumei; Bitoun, Jacob P.; De, Arpan; Jorgensen, Ashton; Feng, Shihai; Xu, Xiaoming; Chain, Patrick S. G.; Caufield, Page W.; Koo, Hyun; Li, Yihong

2017-01-01

Like Streptococcus mutans, lactobacilli are commonly isolated from carious sites, although their exact role in caries development remains unclear. This study used mixed-species models to analyze biofilm formation by major groups of oral lactobacilli, including L. casei, L. fermentum, L. rhamnosus, L. salivarius ssp. salivarius, and L. gasseri. The results showed that lactobacilli did not form good biofilms when grown alone, although differences existed between different species. When grown together with S. mutans, biofilm formation by L. gasseri and L. rhamnosus was increased by 2-log (P < 0.001), while biofilms by L. fermentum reduced by >1-log (P < 0.001). L. casei enhanced biofilm formation by ~2-log when grown with S. mutans wild-type, but no such effects were observed with S. mutans deficient of glucosyltransferase GtfB and adhesin P1. Both S. mutans and L. casei in dual-species enhanced resistance to acid killing with increases of survival rate by >1-log (P < 0.001), but drastically reduced the survival rates following exposure to hydrogen peroxide (P < 0.001), as compared to the respective mono-species cultures. When analyzed by RNA-seq, more than 134 genes were identified in S. mutans in dual-species with L. casei as either up- or down-regulated when compared to those grown alone. The up-regulated genes include those for superoxide dismutase, NADH oxidase, and members of the mutanobactin biosynthesis cluster. Among the down-regulated genes were those for GtfB and alternative sigma factor SigX. These results further suggest that interactions between S. mutans and oral lactobacilli are species-specific and may have significant impact on cariogenic potential of the community. PMID:29326887

Oxidant stress regulatory genetic variation in recipients and donors contributes to risk of primary graft dysfunction after lung transplantation

PubMed Central

Cantu, Edward; Shah, Rupal J.; Lin, Wei; Daye, Zhongyin J.; Diamond, Joshua M.; Suzuki, Yoshikazu; Ellis, John H.; Borders, Catherine F.; Andah, Gerald A.; Beduhn, Ben; Meyer, Nuala J.; Ruschefski, Melanie; Aplenc, Richard; Feng, Rui; Christie, Jason D.

2014-01-01

Objective Oxidant stress pathway activation during ischemia reperfusion injury may contribute to the development of primary graft dysfunction (PGD) after lung transplantation. We hypothesized oxidant stress gene variation in recipients and donors is associated with PGD. Methods Donors and recipients from the Lung Transplant Outcomes Group (LTOG) cohort were genotyped using the Illumina IBC chip filtered for oxidant stress pathway genes. Single nucleotide polymorphisms (SNPs) grouped into SNP-sets based on haplotype blocks within 49 oxidant stress genes selected from gene ontology pathways and literature review were tested for PGD association using a sequencing kernel association test. Analyses were adjusted for clinical confounding variables and population stratification. Results 392 donors and 1038 recipients met genetic quality control standards. 30% of subjects developed grade 3 PGD within 72 hours. Donor NADPH Oxidase 3 (NOX3) was associated with PGD (p=0.01) with 5 individual significant loci (p-values between 0.006 and 0.03). In recipients, variation in glutathione peroxidase (GPX1) and NRF-2 (NFE2L2) was significantly associated with PGD (p=0.01 for both). The GPX1 association included 3 individual loci (p-values between 0.006 and 0.049) and the NFE2L2 association included 2 loci (p=0.03 and 0.05). Significant epistatic effects influencing PGD susceptibility were evident between three different donor blocks of NOX3 and recipient NFE2L2 (p=0.026, p=0.017 and p=0.031). Conclusions Our study prioritizes GPX1, NOX3, and NFE2L2 genes for future research in PGD pathogenesis, and highlights a donor-recipient interaction of NOX3 and NFE2L2 that increases PGD risk. PMID:25439478

The promoting effects of alginate oligosaccharides on root development in Oryza sativa L. mediated by auxin signaling.

PubMed

Zhang, Yunhong; Yin, Heng; Zhao, Xiaoming; Wang, Wenxia; Du, Yuguang; He, Ailing; Sun, Kegang

2014-11-26

Alginate oligosaccharides (AOS), which are marine oligosaccharides, are involved in regulating plant root growth, but the promotion mechanism for AOS remains unclear. Here, AOS (10-80 mg/L) induced the expression of auxin-related gene (OsYUCCA1, OsYUCCA5, OsIAA11 and OsPIN1) in rice (Oryza sativa L.) tissues to accelerate auxin biosynthesis and transport, and reduced indole-3-acetic acid (IAA) oxidase activity in rice roots. These changes resulted in the increase of 37.8% in IAA concentration in rice roots, thereby inducing the expression of root development-related genes, promoting root growth in a dose-dependent manner, which were inhibited by auxin transport inhibitor 2,3,5-triiodo benzoic acid (TIBA) and calcium-chelating agent ethylene glycol bis (2-aminoethyl) tetraacetic acid (EGTA). AOS also induced calcium signaling generation in rice roots. Those results indicated that auxin mediated AOS regulation of root development, and calcium signaling may act mainly in the upstream of auxin in the regulation of AOS on rice root development. Copyright © 2014 Elsevier Ltd. All rights reserved.

Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

PubMed

Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

2003-05-01

Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

PubMed Central

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-01-01

Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of posttraumatic stress disorder guiding personalized treatment decisions on the use of antiadrenergic agents. PMID:29186431

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

PubMed

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of posttraumatic stress disorder guiding personalized treatment decisions on the use of antiadrenergic agents.

Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

PubMed

Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

2014-01-01

Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

Uptake of L-nicotine and of 6-hydroxy-L-nicotine by Arthrobacter nicotinovorans and by Escherichia coli is mediated by facilitated diffusion and not by passive diffusion or active transport.

PubMed

Ganas, Petra; Brandsch, Roderich

2009-06-01

The mechanism by which l-nicotine is taken up by bacteria that are able to grow on it is unknown. Nicotine degradation by Arthrobacter nicotinovorans, a Gram-positive soil bacterium, is linked to the presence of the catabolic megaplasmid pAO1. l-[(14)C]Nicotine uptake assays with A. nicotinovorans showed transport of nicotine across the cell membrane to be energy-independent and saturable with a K(m) of 6.2+/-0.1 microM and a V(max) of 0.70+/-0.08 micromol min(-1) (mg protein)(-1). This is in accord with a mechanism of facilitated diffusion, driven by the nicotine concentration gradient. Nicotine uptake was coupled to its intracellular degradation, and an A. nicotinovorans strain unable to degrade nicotine (pAO1(-)) showed no nicotine import. However, when the nicotine dehydrogenase genes were expressed in this strain, import of l-[(14)C]nicotine took place. A. nicotinovorans pAO1(-) and Escherichia coli were also unable to import 6-hydroxy-l-nicotine, but expression of the 6-hydroxy-l-nicotine oxidase gene allowed both bacteria to take up this compound. l-Nicotine uptake was inhibited by d-nicotine, 6-hydroxy-l-nicotine and 2-amino-l-nicotine, which may indicate transport of these nicotine derivatives by a common permease. Attempts to correlate nicotine uptake with pAO1 genes possessing similarity to amino acid transporters failed. In contrast to the situation at the blood-brain barrier, nicotine transport across the cell membrane by these bacteria was not by passive diffusion or active transport but by facilitated diffusion.

Polyamines and ethylene interact in rice grains in response to soil drying during grain filling.

PubMed

Chen, Tingting; Xu, Yunji; Wang, Jingchao; Wang, Zhiqin; Yang, Jianchang; Zhang, Jianhua

2013-05-01

This study tested the hypothesis that the interaction between polyamines and ethylene may mediate the effects of soil drying on grain filling of rice (Oryza sativa L.). Two rice cultivars were pot grown. Three treatments, well-watered, moderate soil drying (MD), and severe soil drying (SD), were imposed from 8 d post-anthesis until maturity. The endosperm cell division rate, grain-filling rate, and grain weight of earlier flowering superior spikelets showed no significant differences among the three treatments. However, those of the later flowering inferior spikelets were significantly increased under MD and significantly reduced under SD when compared with those which were well watered. The two cultivars showed the same tendencies. MD increased the contents of free spermidine (Spd) and free spermine (Spm), the activities of S-adenosyl-L-methionine decarboxylase and Spd synthase, and expression levels of polyamine synthesis genes, and decreased the ethylene evolution rate, the contents of 1-aminocylopropane-1-carboxylic acid (ACC) and hydrogen peroxide, the activities of ACC synthase, ACC oxidase, and polyamine oxidase, and the expression levels of ethylene synthesis genes in inferior spikelets. SD exhibited the opposite effects. Application of Spd, Spm, or an inhibitor of ethylene synthesis to rice panicles significantly reduced ethylene and ACC levels, but significantly increased Spd and Spm contents, grain-filling rate, and grain weight of inferior spikelets. The results were reversed when ACC or an inhibitor of Spd and Spm synthesis was applied. The results suggest that a potential metabolic interaction between polyamines and ethylene biosynthesis responds to soil drying and mediates the grain filling of inferior spikelets in rice.

Assessing the effect of selection with deltamethrin on biological parameters and detoxifying enzymes in Aedes aegypti (L.).

PubMed

Alvarez-Gonzalez, Leslie C; Briceño, Arelis; Ponce-Garcia, Gustavo; Villanueva-Segura, O Karina; Davila-Barboza, Jesus A; Lopez-Monroy, Beatriz; Gutierrez-Rodriguez, Selene M; Contreras-Perera, Yamili; Rodriguez-Sanchez, Iram P; Flores, Adriana E

2017-11-01

Resistance to insecticides through one or several mechanisms has a cost for an insect in various parameters of its biological cycle. The present study evaluated the effect of deltamethrin on detoxifying enzymes and biological parameters in a population of Aedes aegypti selected for 15 generations. The enzyme activities of alpha- and beta-esterases, mixed-function oxidases and glutathione-S-transferases were determined during selection, along with biological parameters. Overexpression of mixed-function oxidases as a mechanism of metabolic resistance to deltamethrin was found. There were decreases in percentages of eggs hatching, pupation and age-specific survival and in total survival at the end of the selection (F 16 ). Although age-specific fecundity was not affected by selection with deltamethrin, total fertility, together with lower survival, significantly affected gross reproduction rate, gradually decreasing due to deltamethrin selection. Similarly, net reproductive rate and intrinsic growth rate were affected by selection. Alterations in life parameters could be due to the accumulation of noxious effects or deleterious genes related to detoxifying enzymes, specifically those coding for mixed-function oxidases, along with the presence of recessive alleles of the V1016I and F1534C mutations, associating deltamethrin resistance with fitness cost in Ae. aegypti. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Phenol contents, oxidase activities, and the resistance of coffee to the leaf miner Leucoptera coffeella.

PubMed

Ramiro, Daniel Alves; Guerreiro-Filho, Oliveiro; Mazzafera, Paulo

2006-09-01

We examined the role of phenolic compounds, and the enzymes peroxidase and polyphenol oxidase, in the expression of resistance of coffee plants to Leucoptera coffeella (Lepidoptera: Lyonetiidae). The concentrations of total soluble phenols and chlorogenic acid (5-caffeoylquinic acid), and the activities of the oxidative enzymes peroxidase (POD) and polyphenol oxidase (PPO), were estimated in leaves of Coffea arabica, C. racemosa, and progenies of crosses between these species, which have different levels of resistance, before and after attack by this insect. The results indicate that phenols do not play a central role in resistance to the coffee leaf miner. Differences were detected between the parental species in terms of total soluble phenol concentrations and activities of the oxidative enzymes. However, resistant and susceptible hybrid plants did not differ in any of these characteristics. Significant induction of chlorogenic acid and PPO was only found in C. racemosa, the parental donator of the resistance genes against L. coffeella. High-performance liquid chromatography (HPLC) analysis also showed qualitative similarity between hybrids and the susceptible C. arabica. These results suggest that the phenolic content and activities of POD and PPO in response to the attack by the leaf miner may not be a strong evidence of their participation in direct defensive mechanisms.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

PubMed

Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

2016-07-09

In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

Lower growth temperature increases alternative pathway capacity and alternative oxidase protein in tobacco.

PubMed

Vanlerberghe, G C; McIntosh, L

1992-09-01

Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30 degrees C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18 degrees C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30 degrees C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18 degrees C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein.

Association of MAOA, 5-HTT, and NET promoter polymorphisms with gene expression and protein activity in human placentas

PubMed Central

Zhang, Huiping; Smith, Graeme N.; Liu, Xudong

2010-01-01

Monoamine oxidase A (MAOA) and the transporters for serotonin (5-HTT) and norepinephrine (NET) may play important roles in regulating maternal monoamine neurotransmitters transferred across the placenta to the fetus. We investigated whether promoter polymorphisms in MAOA (uVNTR), 5-HTT (5-HTTLPR), and NET (NETpPR AAGG4) could influence gene expression and protein activity in human placentas. Normal term human placentas (n = 73) were collected, and placental MAOA, 5-HTT, and NET mRNA levels and protein activity were determined. The mRNA levels or protein activities were compared between different genotype groups. Placentas hemizygous (male fetus) or homozygous (female fetus) for MAOA uVNTR 4-repeat allele had significantly higher MAOA mRNA levels than those hemizygous or homozygous for the 3-repeat allele (P = 0.001). However, no significant difference in MAOA enzyme activity was found for these two groups of genotypes (P = 0.161). Placentas with the 5-HTTLPR short (S)-allele (S/S+S/L) had significantly lower 5-HTT mRNA levels and serotonin uptake rate than those homozygous for the long (L)-allele (L/L) (mRNA: P < 0.001; serotonin transporting activity: P < 0.001). Placentas homozygous for the NET AAGG4 L4 allele had significantly higher NET mRNA levels, as well as dopamine and norepinephrine uptake rates, than those with the S4/L4 genotype (mRNA: P < 0.001; dopamine transporting activity: P = 0.012; norepinephrine transporting activity: P = 0.011). These findings suggest that the three promoter polymorphisms of MAOA, 5-HTT, and NET influence gene expression levels and protein activity of these genes in human placentas, potentially leading to different fetal levels of maternal monoamine neurotransmitters, which may have an impact on fetal neurodevelopment. PMID:20332182

Association of MAOA, 5-HTT, and NET promoter polymorphisms with gene expression and protein activity in human placentas.

PubMed

Zhang, Huiping; Smith, Graeme N; Liu, Xudong; Holden, Jeanette J A

2010-06-01

Monoamine oxidase A (MAOA) and the transporters for serotonin (5-HTT) and norepinephrine (NET) may play important roles in regulating maternal monoamine neurotransmitters transferred across the placenta to the fetus. We investigated whether promoter polymorphisms in MAOA (uVNTR), 5-HTT (5-HTTLPR), and NET (NETpPR AAGG(4)) could influence gene expression and protein activity in human placentas. Normal term human placentas (n = 73) were collected, and placental MAOA, 5-HTT, and NET mRNA levels and protein activity were determined. The mRNA levels or protein activities were compared between different genotype groups. Placentas hemizygous (male fetus) or homozygous (female fetus) for MAOA uVNTR 4-repeat allele had significantly higher MAOA mRNA levels than those hemizygous or homozygous for the 3-repeat allele (P = 0.001). However, no significant difference in MAOA enzyme activity was found for these two groups of genotypes (P = 0.161). Placentas with the 5-HTTLPR short (S)-allele (S/S+S/L) had significantly lower 5-HTT mRNA levels and serotonin uptake rate than those homozygous for the long (L)-allele (L/L) (mRNA: P < 0.001; serotonin transporting activity: P < 0.001). Placentas homozygous for the NET AAGG(4) L(4) allele had significantly higher NET mRNA levels, as well as dopamine and norepinephrine uptake rates, than those with the S(4)/L(4) genotype (mRNA: P < 0.001; dopamine transporting activity: P = 0.012; norepinephrine transporting activity: P = 0.011). These findings suggest that the three promoter polymorphisms of MAOA, 5-HTT, and NET influence gene expression levels and protein activity of these genes in human placentas, potentially leading to different fetal levels of maternal monoamine neurotransmitters, which may have an impact on fetal neurodevelopment.

Pivotal Advance: Eosinophilia in the MES rat strain is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba).

PubMed

Mori, Masayuki; Li, Guixin; Hashimoto, Maiko; Nishio, Ayako; Tomozawa, Hiroshi; Suzuki, Nobuyoshi; Usami, Shin-ichi; Higuchi, Keiichi; Matsumoto, Kiyoshi

2009-09-01

MES is a rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. Herein, we report that eosinophilia in MES rats is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba; also known as p22(phox)), which is an essential component of the superoxide-generating NADPH oxidase complex. The MES rat has a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. As a consequence of the deletion, a 51-nucleotide sequence of intron 4 is incorporated into the Cyba transcripts. Leukocytes from the MES strain lack both CYBA protein and NADPH oxidase activity. Nevertheless, unlike patients with chronic granulomatous disease, who suffer from infections with pathogens due to similar genetic defects in NADPH oxidase, MES rats retain normal innate immune defense against Staphylococcus aureus infection. This is due to large quantities of peritoneal eosinophils in MES rats, which phagocytose and kill the bacteria. MES rat has a balance defect due to impaired formation of otoconia in the utricles and saccules. Eosinophilia of the MES rat was normalized by introduction of a normal Cyba transgene. The mechanisms by which impairment of NADPH oxidase leads to eosinophilia in the MES rat are elusive. However, our study highlights the essential role of NADPH oxidase in homeostatic regulation of innate immunity beyond conventional microbicidial functions.

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

PubMed

Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

2007-06-01

Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

PubMed

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

PROLINE OXIDASES IN HANSENULA SUBPELLICULOSA

PubMed Central

Ling, Chung-Mei; Hedrick, L. R.

1964-01-01

Ling, Chung-Mei (Illinois Institute of Technology, Chicago), and L. R. Hedrick. Proline oxidases in Hansenula subpelliculosa. J. Bacteriol. 87:1462–1470. 1964—Cells of Hansenula subpelliculosa can use l-proline as a carbon and a nitrogen source after a 6- to 8-hr induction period. However, they cannot use l-glutamate as both nitrogen and carbon sources unless the induction period is of several days' duration. Two l-proline oxidases were demonstrated in the mitochondrial preparation of this yeast. One forms the product Δ′-pyrroline-2-carboxylic acid (P2C), which is in equilibrium with α-keto-δ-amino-valeric acid; the other forms the product Δ′-pyrroline-5-carboxylic acid (P5C), which is in equilibrium with glutamic-γ-semialdehyde. The first-mentioned enzyme is induced when l-proline is the carbon source; the second appears to be constitutive, and is probably associated with the use of l-proline as a nitrogen source. The P2C-forming enzyme is specific for the l isomer of proline, and is inactive against l-hydroxyproline. The enzyme activity is at its peak when the mitochondria are prepared from logarithmically grown cells, and is rapidly reduced after cells reach the stationary phase of growth. Kinetic studies with varying concentrations of substrate indicate a Michaelis-Menten constant of 2.45 × 10−2m. Paper chromatographic studies, chemical tests with H2O2, sensitivity to freezing, and spectral measurements indicate that proline oxidase from H. subpelliculosa mitochondria forms a product from l-proline which is like, if not identical to, P2C formed by the action of sheep kidney d-proline oxidase upon dl-proline. The soluble portion of the cell extract contains NAD+ enzymes which use either P2C (α-keto-δ-amino-valeric acid) or P5C (glutamic-γ-semialdehyde) as substrates. No glutamic dehydrogenase activity could be detected when l-glutamic acid and the nicotinamide adenine dinucleotide (NAD+) cofactor were added to the supernatant solution with the yeast enzymes. The presence of a dehydrogenase NAD+ enzyme for activity with P2C (α-keto-δ-amino-valeric acid) has not been previously reported. PMID:14188729

NADPH oxidase 2-derived reactive oxygen species in spinal cord microglia contribute to peripheral nerve injury-induced neuropathic pain

PubMed Central

Kim, Donghoon; You, Byunghyun; Jo, Eun-Kyeong; Han, Sang-Kyou; Simon, Melvin I.; Lee, Sung Joong

2010-01-01

Increasing evidence supports the notion that spinal cord microglia activation plays a causal role in the development of neuropathic pain after peripheral nerve injury; yet the mechanisms for microglia activation remain elusive. Here, we provide evidence that NADPH oxidase 2 (Nox2)-derived ROS production plays a critical role in nerve injury-induced spinal cord microglia activation and subsequent pain hypersensitivity. Nox2 expression was induced in dorsal horn microglia immediately after L5 spinal nerve transection (SNT). Studies using Nox2-deficient mice show that Nox2 is required for SNT-induced ROS generation, microglia activation, and proinflammatory cytokine expression in the spinal cord. SNT-induced mechanical allodynia and thermal hyperalgesia were similarly attenuated in Nox2-deficient mice. In addition, reducing microglial ROS level via intrathecal sulforaphane administration attenuated mechanical allodynia and thermal hyperalgesia in SNT-injured mice. Sulforaphane also inhibited SNT-induced proinflammatory gene expression in microglia, and studies using primary microglia indicate that ROS generation is required for proinflammatory gene expression in microglia. These studies delineate a pathway involving nerve damage leading to microglial Nox2-generated ROS, resulting in the expression of proinflammatory cytokines that are involved in the initiation of neuropathic pain. PMID:20679217

Redundant synthesis of a conidial polyketide by two distinct secondary metabolite clusters in Aspergillus fumigatus

PubMed Central

Throckmorton, Kurt; Lim, Fang Yun; Kontoyiannis, Dimitrios P.; Zheng, Weifa; Keller, Nancy P.

2016-01-01

Summary Filamentous fungi are renowned for the production of bioactive secondary metabolites. Typically, one distinct metabolite is generated from a specific secondary metabolite cluster. Here, we characterize the newly described trypacidin (tpc) cluster in the opportunistic human pathogen Aspergillus fumigatus. We find that this cluster as well as the previously characterized endocrocin (enc) cluster both contribute to the production of the spore metabolite endocrocin. Whereas trypacidin is eliminated when only tpc cluster genes are deleted, endocrocin production is only eliminated when both the tpc and enc non-reducing polyketide synthase-encoding genes, tpcC and encA, respectively, are deleted. EncC, an anthrone oxidase, converts the product released from EncA to endocrocin as a final product. In contrast, endocrocin synthesis by the tpc cluster likely results from incomplete catalysis by TpcK (a putative decarboxylase), as its deletion results in a nearly 10-fold increase in endocrocin production. We suggest endocrocin is likely a shunt product in all related non-reducing polyketide synthase clusters containing homologues of TpcK and TpcL (a putative anthrone oxidase), e.g. geodin and monodictyphenone. This finding represents an unusual example of two physically discrete secondary metabolite clusters generating the same natural product in one fungal species by distinct routes. PMID:26242966

An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

PubMed

Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

2016-09-01

Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5.

Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

PubMed

Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

2012-12-30

The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

1995-12-18

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

Alternative oxidase impacts ganoderic acid biosynthesis by regulating intracellular ROS levels in Ganoderma lucidum.

PubMed

Shi, Deng-Ke; Zhu, Jing; Sun, Ze-Hua; Zhang, Guang; Liu, Rui; Zhang, Tian-Jun; Wang, Sheng-Li; Ren, Ang; Zhao, Ming-Wen

2017-10-01

The alternative oxidase (AOX), which forms a branch of the mitochondrial respiratory electron transport pathway, functions to sustain electron flux and alleviate reactive oxygen species (ROS) production. In this article, a homologous AOX gene was identified in Ganoderma lucidum. The coding sequence of the AOX gene in G. lucidum contains 1038 nucleotides and encodes a protein of 39.48 kDa. RNA interference (RNAi) was used to study the function of AOX in G. lucidum, and two silenced strains (AOXi6 and AOXi21) were obtained, showing significant decreases of approximately 60 and 50 %, respectively, in alternative pathway respiratory efficiency compared to WT. The content of ganoderic acid (GA) in the mutant strains AOXi6 and AOXi21 showed significant increases of approximately 42 and 44 %, respectively, compared to WT. Elevated contents of intermediate metabolites in GA biosynthesis and elevated transcription levels of corresponding genes were also observed in the mutant strains AOXi6 and AOXi21. In addition, the intracellular ROS content in strains AOXi6 and AOXi21 was significantly increased, by approximately 1.75- and 1.93-fold, respectively, compared with WT. Furthermore, adding N-acetyl-l-cysteine (NAC), a ROS scavenger, significantly depressed the intracellular ROS content and GA accumulation in AOX-silenced strains. These results indicate that AOX affects GA biosynthesis by regulating intracellular ROS levels. Our research revealed the important role of AOX in the secondary metabolism of G. lucidum.

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

PubMed

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Alternative oxidase (AOX) constitutes a small family of proteins in Citrus clementina and Citrus sinensis L. Osb.

PubMed

Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva; Micheli, Fabienne

2017-01-01

The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs.

Alternative oxidase (AOX) constitutes a small family of proteins in Citrus clementina and Citrus sinensis L. Osb

PubMed Central

Araújo Castro, Jacqueline; Gomes Ferreira, Monique Drielle; Santana Silva, Raner José; Andrade, Bruno Silva

2017-01-01

The alternative oxidase (AOX) protein is present in plants, fungi, protozoa and some invertebrates. It is involved in the mitochondrial respiratory chain, providing an alternative route for the transport of electrons, leading to the reduction of oxygen to form water. The present study aimed to characterize the family of AOX genes in mandarin (Citrus clementina) and sweet orange (Citrus sinensis) at nucleotide and protein levels, including promoter analysis, phylogenetic analysis and C. sinensis gene expression. This study also aimed to do the homology modeling of one AOX isoform (CcAOXd). Moreover, the molecular docking of the CcAOXd protein with the ubiquinone (UQ) was performed. Four AOX genes were identified in each citrus species. These genes have an open reading frame (ORF) ranging from 852 bp to 1150 bp and a number of exons ranging from 4 to 9. The 1500 bp-upstream region of each AOX gene contained regulatory cis-elements related to internal and external response factors. CsAOX genes showed a differential expression in citrus tissues. All AOX proteins were predicted to be located in mitochondria. They contained the conserved motifs LET, NERMHL, LEEEA and RADE-H as well as several putative post-translational modification sites. The CcAOXd protein was modeled by homology to the AOX of Trypanosona brucei (45% of identity). The 3-D structure of CcAOXd showed the presence of two hydrophobic helices that could be involved in the anchoring of the protein in the inner mitochondrial membrane. The active site of the protein is located in a hydrophobic environment deep inside the AOX structure and contains a diiron center. The molecular docking of CcAOXd with UQ showed that the binding site is a recessed pocket formed by the helices and submerged in the membrane. These data are important for future functional studies of citrus AOX genes and/or proteins, as well as for biotechnological approaches leading to AOX inhibition using UQ homologs. PMID:28459876

Regulatory effect of acetyl-l-carnitine on expression of lenticular antioxidant and apoptotic genes in selenite-induced cataract.

PubMed

Elanchezhian, R; Sakthivel, M; Geraldine, P; Thomas, P A

2010-03-30

Differential expression of apoptotic genes has been demonstrated in selenite-induced cataract. Acetyl-l-carnitine (ALCAR) has been shown to prevent selenite cataractogenesis by maintaining lenticular antioxidant enzyme and redox system components at near normal levels and also by inhibiting lenticular calpain activity. The aim of the present experiment was to investigate the possibility that ALCAR also prevents selenite-induced cataractogenesis by regulating the expression of antioxidant (catalase) and apoptotic [caspase-3, early growth response protein-1 (EGR-1) and cytochrome c oxidase subunit I (COX-I)] genes. The experiment was conducted on 9-day-old Wistar rat pups, which were divided into normal, cataract-untreated and cataract-treated groups. Putative changes in gene expression in whole lenses removed from the rats were determined by measuring mRNA transcript levels of the four genes by RT-PCR analysis, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The expression of lenticular caspase-3 and EGR-1 genes appeared to be upregulated, as inferred by detecting increased mRNA transcript levels, while that of COX-I and catalase genes appeared to be downregulated (lowered mRNA transcript levels) in the lenses of cataract-untreated rats. However, in rats treated with ALCAR, the lenticular mRNA transcript levels were maintained at near normal (control) levels. These results suggest that ALCAR may prevent selenite-induced cataractogenesis by preventing abnormal expression of lenticular genes governing apoptosis.

Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements

PubMed Central

Whibley, Annabel; Urquhart, Jill; Dore, Jonathan; Willatt, Lionel; Parkin, Georgina; Gaunt, Lorraine; Black, Graeme; Donnai, Dian; Raymond, F Lucy

2010-01-01

Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3–p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypotonia and stereotypical hand movements. The clinical features accord with published reports of larger microdeletions and selective MAO-A and MAO-B deficiencies in humans and mouse models and suggest considerable functional compensation between MAO-A and MAO-B under normal conditions. PMID:20485326

Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

PubMed

Allam, Mai A; Saker, Mahmoud M

2017-01-01

The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

PubMed Central

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

An alternative agriculture system is defined by a distinct expression profile of select gene transcripts and proteins

PubMed Central

Kumar, Vinod; Mills, Douglas J.; Anderson, James D.; Mattoo, Autar K.

2004-01-01

Conventional agriculture has relied heavily on chemical inputs that have negatively impacted the environment and increased production costs. Transition to agricultural sustainability is a major challenge and requires that alternative agricultural practices are scientifically analyzed to provide a sufficiently informative knowledge base in favor of alternative farming practices. We show a molecular basis for delayed leaf senescence and tolerance to diseases in tomato plants cultivated in a legume (hairy vetch) mulch-based alternative agricultural system. In the hairy vetch-cultivated plants, expression of specific and select classes of genes is up-regulated compared to those grown on black polyethylene mulch. These include N-responsive genes such as NiR, GS1, rbcL, rbcS, and G6PD; chaperone genes such as hsp70 and BiP; defense genes such as chitinase and osmotin; a cytokinin-responsive gene CKR; and gibberellic acid 20 oxidase. We present a model of how their protein products likely complement one another in a field scenario to effect efficient utilization and mobilization of C and N, promote defense against disease, and enhance longevity. PMID:15249656

Vascular lysyl oxidase over-expression alters extracellular matrix structure and induces oxidative stress.

PubMed

Varona, Saray; García-Redondo, Ana B; Martínez-González, Jose; Salaices, Mercedes; Briones, Ana M; Rodríguez, Cristina

Lysyl oxidase (LOX) participates in the assembly of collagen and elastin fibres. The impact of vascular LOX over-expression on extracellular matrix (ECM) structure and its contribution to oxidative stress has been analysed. Studies were conducted on mice over-expressing LOX (Tg), specifically in smooth muscle cells (VSMC). Gene expression was assessed by real-time PCR analysis. Sirius Red staining, H 2 O 2 production and NADPH oxidase activity were analysed in different vascular beds. The size and number of fenestra of the internal elastic lamina were determined by confocal microscopy. LOX activity was up-regulated in VSMC of transgenic mice compared with cells from control animals. At the same time, transgenic cells deposited more organised elastin fibres and their supernatants induced a stronger collagen assembly in in vitro assays. Vascular collagen cross-linking was also higher in Tg mice, which showed a decrease in the size of fenestrae and an enhanced expression of Fibulin-5. Interestingly, higher H 2 O 2 production and NADPH oxidase activity was detected in the vascular wall from transgenic mice. The H 2 O 2 scavenger catalase attenuated the stronger deposition of mature elastin fibres induced by LOX transgenesis. LOX over-expression in VSMC was associated with a change in the structure of collagen and elastin fibres. LOX could constitute a novel source of oxidative stress that might participate in elastin changes and contribute to vascular remodelling. Copyright © 2017 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

A new moss salamander, genus Nototriton (Caudata: Plethodontidae), from the Cordillera de Talamanca, in the Costa Rica-Panama border region.

PubMed

Arias, Erick; Kubicki, Brian

2018-01-07

A new salamander belonging to the genus Nototriton, subgenus Nototriton, is described from the Caribbean slopes of the southeastern Cordillera de Talamanca in Costa Rica, within Parque Internacional La Amistad, at an elevation ca. 1500 m a.s.l. This new taxon is distinguished from its congeners by its morphological characteristics and by its differentiation in DNA sequences of the 16S rRNA, cytochrome oxidase subunit I (COI), and cytochrome b mitochondrial genes. This new species represents the southernmost extension known for the genus Nototriton.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiser, C.; McIntosh, L.

Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probedmore » with the potato gene to examine its expression in relation to the appearance of the 36kD protein.« less

Major Role of NAD-Dependent Lactate Dehydrogenases in the Production of l-Lactic Acid with High Optical Purity by the Thermophile Bacillus coagulans

PubMed Central

Wang, Limin; Cai, Yumeng; Zhu, Lingfeng; Guo, Honglian

2014-01-01

Bacillus coagulans 2-6 is an excellent producer of optically pure l-lactic acid. However, little is known about the mechanism of synthesis of the highly optically pure l-lactic acid produced by this strain. Three enzymes responsible for lactic acid production—NAD-dependent l-lactate dehydrogenase (l-nLDH; encoded by ldhL), NAD-dependent d-lactate dehydrogenase (d-nLDH; encoded by ldhD), and glycolate oxidase (GOX)—were systematically investigated in order to study the relationship between these enzymes and the optical purity of lactic acid. Lactobacillus delbrueckii subsp. bulgaricus DSM 20081 (a d-lactic acid producer) and Lactobacillus plantarum subsp. plantarum DSM 20174 (a dl-lactic acid producer) were also examined in this study as comparative strains, in addition to B. coagulans. The specific activities of key enzymes for lactic acid production in the three strains were characterized in vivo and in vitro, and the levels of transcription of the ldhL, ldhD, and GOX genes during fermentation were also analyzed. The catalytic activities of l-nLDH and d-nLDH were different in l-, d-, and dl-lactic acid producers. Only l-nLDH activity was detected in B. coagulans 2-6 under native conditions, and the level of transcription of ldhL in B. coagulans 2-6 was much higher than that of ldhD or the GOX gene at all growth phases. However, for the two Lactobacillus strains used in this study, ldhD transcription levels were higher than those of ldhL. The high catalytic efficiency of l-nLDH toward pyruvate and the high transcription ratios of ldhL to ldhD and ldhL to the GOX gene provide the key explanations for the high optical purity of l-lactic acid produced by B. coagulans 2-6. PMID:25217009

Major Role of NAD-Dependent Lactate Dehydrogenases in the Production of l-Lactic Acid with High Optical Purity by the Thermophile Bacillus coagulans.

PubMed

Wang, Limin; Cai, Yumeng; Zhu, Lingfeng; Guo, Honglian; Yu, Bo

2014-12-01

Bacillus coagulans 2-6 is an excellent producer of optically pure l-lactic acid. However, little is known about the mechanism of synthesis of the highly optically pure l-lactic acid produced by this strain. Three enzymes responsible for lactic acid production-NAD-dependent l-lactate dehydrogenase (l-nLDH; encoded by ldhL), NAD-dependent d-lactate dehydrogenase (d-nLDH; encoded by ldhD), and glycolate oxidase (GOX)-were systematically investigated in order to study the relationship between these enzymes and the optical purity of lactic acid. Lactobacillus delbrueckii subsp. bulgaricus DSM 20081 (a d-lactic acid producer) and Lactobacillus plantarum subsp. plantarum DSM 20174 (a dl-lactic acid producer) were also examined in this study as comparative strains, in addition to B. coagulans. The specific activities of key enzymes for lactic acid production in the three strains were characterized in vivo and in vitro, and the levels of transcription of the ldhL, ldhD, and GOX genes during fermentation were also analyzed. The catalytic activities of l-nLDH and d-nLDH were different in l-, d-, and dl-lactic acid producers. Only l-nLDH activity was detected in B. coagulans 2-6 under native conditions, and the level of transcription of ldhL in B. coagulans 2-6 was much higher than that of ldhD or the GOX gene at all growth phases. However, for the two Lactobacillus strains used in this study, ldhD transcription levels were higher than those of ldhL. The high catalytic efficiency of l-nLDH toward pyruvate and the high transcription ratios of ldhL to ldhD and ldhL to the GOX gene provide the key explanations for the high optical purity of l-lactic acid produced by B. coagulans 2-6. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

20 years since the introduction of DNA barcoding: from theory to application.

PubMed

Fišer Pečnikar, Živa; Buzan, Elena V

2014-02-01

Traditionally, taxonomic identification has relied upon morphological characters. In the last two decades, molecular tools based on DNA sequences of short standardised gene fragments, termed DNA barcodes, have been developed for species discrimination. The most common DNA barcode used in animals is a fragment of the cytochrome c oxidase (COI) mitochondrial gene, while for plants, two chloroplast gene fragments from the RuBisCo large subunit (rbcL) and maturase K (matK) genes are widely used. Information gathered from DNA barcodes can be used beyond taxonomic studies and will have far-reaching implications across many fields of biology, including ecology (rapid biodiversity assessment and food chain analysis), conservation biology (monitoring of protected species), biosecurity (early identification of invasive pest species), medicine (identification of medically important pathogens and their vectors) and pharmacology (identification of active compounds). However, it is important that the limitations of DNA barcoding are understood and techniques continually adapted and improved as this young science matures.

Liver Fatty Acid Binding Protein Gene-ablation Exacerbates Weight Gain in High-Fat Fed Female Mice

PubMed Central

McIntosh, Avery L.; Atshaves, Barbara P.; Landrock, Danilo; Landrock, Kerstin K.; Martin, Gregory G.; Storey, Stephen M.; Kier, Ann B.; Schroeder, Friedhelm

2013-01-01

Loss of liver fatty acid binding protein (L-FABP) decreases long chain fatty acid uptake and oxidation in primary hepatocytes and in vivo. On this basis, L-FABP gene ablation would potentiate high-fat diet-induced weight gain and weight gain/energy intake. While this was indeed the case when L-FABP null (−/−) mice on the C57BL/6NCr background were pair-fed high fat diet, whether this would also be observed under high-fat diet fed ad libitum was not known. Therefore, this possibility was examined in female L-FABP (−/−) mice on the same background. L-FABP (−/−) mice consumed equal amounts of defined high-fat or isocaloric control diets fed ad libitum. However, on the ad libitum fed high-fat diet the L-FABP (−/−) mice exhibited: 1) Decreased hepatic long chain fatty acid (LCFA) β-oxidation as indicated by lower serum β–hydroxybutyrate level; 2) Decreased hepatic protein levels of key enzymes mitochondrial (rate limiting carnitine palmitoyl acyltransferase A1, CPT1A; HMG-CoA synthase) and peroxisomal (acyl CoA oxidase 1, ACOX1) LCFA β-oxidation; 3) Increased fat tissue mass (FTM) and FTM/energy intake to the greatest extent; and 4) Exacerbated body weight gain, weight gain/energy intake, liver weight, and liver weight/body weight to the greatest extent. Taken together, these findings showed that L-FABP gene-ablation exacerbated diet-induced weight gain and fat tissue mass gain in mice fed high-fat diet ad libitum—consistent with the known biochemistry and cell biology of L-FABP. PMID:23539345

Ligand complex structures of l-amino acid oxidase/monooxygenase from Pseudomonas sp. AIU 813 and its conformational change.

PubMed

Im, Dohyun; Matsui, Daisuke; Arakawa, Takatoshi; Isobe, Kimiyasu; Asano, Yasuhisa; Fushinobu, Shinya

2018-03-01

l-Amino acid oxidase/monooxygenase from Pseudomonas sp. AIU 813 (l-AAO/MOG) catalyzes both the oxidative deamination and oxidative decarboxylation of the α-group of l-Lys to produce a keto acid and amide, respectively. l-AAO/MOG exhibits limited specificity for l-amino acid substrates with a basic side chain. We previously determined its ligand-free crystal structure and identified a key residue for maintaining the dual activities. Here, we determined the structures of l-AAO/MOG complexed with l-Lys, l-ornithine, and l-Arg and revealed its substrate recognition. Asp238 is located at the ceiling of a long hydrophobic pocket and forms a strong interaction with the terminal, positively charged group of the substrates. A mutational analysis on the D238A mutant indicated that the interaction is critical for substrate binding but not for catalytic control between the oxidase/monooxygenase activities. The catalytic activities of the D238E mutant unexpectedly increased, while the D238F mutant exhibited altered substrate specificity to long hydrophobic substrates. In the ligand-free structure, there are two channels connecting the active site and solvent, and a short region located at the dimer interface is disordered. In the l-Lys complex structure, a loop region is displaced to plug the channels. Moreover, the disordered region in the ligand-free structure forms a short helix in the substrate complex structures and creates the second binding site for the substrate. It is assumed that the amino acid substrate enters the active site of l-AAO/MOG through this route. The atomic coordinates and structure factors (codes 5YB6, 5YB7, and 5YB8) have been deposited in the Protein Data Bank (http://wwpdb.org/). 1.4.3.2 (l-amino acid oxidase), 1.13.12.2 (lysine 2-monooxygenase).

Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

PubMed

Poyau, A; Buchet, K; Godinot, C

1999-12-03

The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

Lower Growth Temperature Increases Alternative Pathway Capacity and Alternative Oxidase Protein in Tobacco 1

PubMed Central

Vanlerberghe, Greg C.; McIntosh, Lee

1992-01-01

Suspension cells of NT1 tobacco (Nicotiana tabacum L. cv bright yellow) have been used to study the effect of growth temperature on the CN-resistant, salicylhydroxamic acid-sensitive alternative pathway of respiration. Mitochondria isolated from cells maintained at 30°C had a low capacity to oxidize succinate via the alternative pathway, whereas mitochondria isolated from cells 24 h after transfer to 18°C displayed, on average, a 5-fold increase in this capacity (from 7 to 32 nanoatoms oxygen per milligram protein per minute). This represented an increase in alternative pathway capacity from 18 to 45% of the total capacity of electron transport. This increased capacity was lost upon transfer of cells back to 30°C. A monoclonal antibody to the terminal oxidase of the alternative pathway (the alternative oxidase) from Sauromatum guttatum (T.E. Elthon, R.L. Nickels, L. McIntosh [1989] Plant Physiology 89: 1311-1317) recognized a 35-kilodalton mitochondrial protein in tobacco. There was an excellent correlation between the capacity of the alternative path in isolated tobacco mitochondria and the levels of this 35-kilodalton alternative oxidase protein. Cycloheximide could inhibit both the increased level of the 35-kilodalton alternative oxidase protein and the increased alternative pathway capacity normally seen upon transfer to 18°C. We conclude that transfer of tobacco cells to the lower temperature increases the capacity of the alternative pathway due, at least in part, to de novo synthesis of the 35-kilodalton alternative oxidase protein. Images Figure 3 Figure 4 PMID:16652932

Indole-3-acetic acid modulates phytohormones and polyamines metabolism associated with the tolerance to water stress in white clover.

PubMed

Li, Zhou; Li, Yaping; Zhang, Yan; Cheng, Bizhen; Peng, Yan; Zhang, Xinquan; Ma, Xiao; Huang, Linkai; Yan, Yanhong

2018-06-09

Endogenous hormones and polyamines (PAs) could interact to regulate growth and tolerance to water stress in white clover. The objective of this study was to investigate whether the alteration of endogenous indole-3-acetic acid (IAA) level affected other hormones level and PAs metabolism contributing to the regulation of tolerance to water stress in white clover. Plants were pretreated with IAA or L-2-aminooxy-3-phenylpropionic acid (L-AOPP, the inhibitor of IAA biosynthesis) for 3 days and then subjected to water-sufficient condition and water stress induced by 15% polyethylene glycol 6000 for 8 days in growth chambers. Exogenous application of IAA significantly increased endogenous IAA, gibberellin (GA), abscisic acid (ABA), and polyamine (PAs) levels, but had no effect on cytokinin content under water stress. The increase in endogenous IAA level enhanced PAs anabolism via the improvement of enzyme activities and transcript level of genes including arginine decarboxylase, ornithine decarboxylase, and S-adenosylmethionine decarboxylase. Exogenous application of IAA also affected PAs catabolism, as manifested by an increase in diamine oxidase and a decrease in polyamine oxidase activities and genes expression. More importantly, the IAA deficiency in white clover decreased endogenous hormone levels (GA, ABA, and PAs) and PAs anabolism along with decline in antioxidant defense and osmotic adjustment (OA). On the contrary, exogenous IAA effectively alleviated stress-induced oxidative damage, growth inhibition, water deficit, and leaf senescence through the maintenance of higher chlorophyll content, OA, and antioxidant defense as well as lower transcript levels of senescence marker genes SAG101 and SAG102 in leaves under water stress. These results indicate that IAA-induced the crosstalk between endogenous hormones and PAs could be involved in the improvement of antioxidant defense and OA conferring tolerance to water stress in white clover. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

PubMed

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Genetic Characterization of Human-Derived Hydatid Cysts of Echinococcus granulosus Sensu Lato in Heilongjiang Province and the First Report of G7 Genotype of E. canadensis in Humans in China

PubMed Central

Zeng, Zhaolin; Zhao, Wei; Liu, Aiqin; Piao, Daxun; Jiang, Tao; Cao, Jianping; Shen, Yujuan; Liu, Hua; Zhang, Weizhe

2014-01-01

Cystic echinococcosis (CE) caused by the larval stage of Echinococcus granulosus sensu lato (s.l.) is one of the most important zoonotic parasitic diseases worldwide and 10 genotypes (G1–G10) have been reported. In China, almost all the epidemiological and genotyping studies of E. granulosus s.l. are from the west and northwest pasturing areas. However, in Heilongjiang Province of northeastern China, no molecular information is available on E. granulosus s.l. To understand and to speculate on possible transmission patterns of E. granulosus s.l., we molecularly identified and genotyped 10 hydatid cysts from hepatic CE patients in Heilongjiang Province based on mitochondrial cytochrome c oxidase subunit I (cox1), cytochrome b (cytb) and NADH dehydrogenase subunit 1 (nad1) genes. Two genotypes were identified, G1 genotype (n = 6) and G7 genotype (n = 4). All the six G1 genotype isolates were identical to each other at the cox1 locus; three and two different sequences were obtained at the cytb and nad1 loci, respectively, with two cytb gene sequences not being described previously. G7 genotype isolates were identical to each other at the cox1, cytb and nad1 loci; however, the cytb gene sequence was not described previously. This is the first report of G7 genotype in humans in China. Three new cytb gene sequences from G1 and G7 genotypes might reflect endemic genetic characterizations. Pigs might be the main intermediate hosts of G7 genotype in our investigated area by homology analysis. The results will aid in making more effective control strategies for the prevention of transmission of E. granulosus s.l. PMID:25329820

Levothyroxine replacement therapy with vitamin E supplementation prevents the oxidative stress and apoptosis in hippocampus of hypothyroid rats.

PubMed

Guo, Yanyun; Wan, Si Yuan; Zhong, Xing; Zhong, Ming Kui; Pan, Tian Rong

2014-01-01

To examine the effect of levothyroxine (L-T4), vitamin E or both on oxidative stress status and hippocampal apoptosis in a propylthiouracil (PTU)-induced hypothyroid rat model. Sprague-Dawley rats were randomly divided into five groups: Control, PTU+PTU+L-T4+PTU+Vit E, PTU+Vit E+L-T4. In each group we assessed levels of serum triiodothyronine (T3), tetraiodothyronine (T4), thyroid stimulating hormone (TSH), hippocampus cellular apoptosis index (AI), hippocampus nicotinamide adenine denucleotide hydrogen (NADPH)oxidase and superoxide dismutase (SOD). 1) Compared with the control group, NADPH oxidase levels were significantly increased, and SOD levels were significantly reduced in the PTU groups (p<0.05). 2) Compared to the PTU group, SOD levels were significantly increased in the PTU+Vit E and PTU+L-T4+Vit E group (p<0.05). NADPH oxidase levels were significantly decreased in the PTU+L-T4, PTU+Vit E and PTU+ L-T4+Vit E group (p<0.05). 3) Compared with the control group, hippocampus AI increased significantly in the PTU group (p<0.05). Compared with the PTU group, hippocampus AI was significantly reduced in the PTU+L-T4 group and PTU+L-T4+Vit E group (p<0.05). 4) Hippocampus AI was positively correlated with NADPH oxidase expression levels in hippocampus tissue (r=0.644, p<0.01). Levothyroxine replacement therapy combined with vitamin E reduces hippocampus AI by improving oxidative stress. This study suggested that the mechanisms of hippocampus tissue injury in a hypothyroid rat model is related to hippocampus apoptosis from increased oxidative stress.

A novel L-amino acid oxidase from Trichoderma harzianum ETS 323 associated with antagonism of Rhizoctonia solani.

PubMed

Yang, Chia-Ann; Cheng, Chi-Hua; Lo, Chaur-Tsuen; Liu, Shu-Ying; Lee, Jeng-Woei; Peng, Kou-Cheng

2011-05-11

Trichoderma spp. are used as biocontrol agents against phytopathogens such as Rhizoctonia solani, but their biocontrol mechanisms are poorly understood. A novel L-amino oxidase (Th-LAAO) was identified from the extracellular proteins of Trichoderma harzianum ETS 323. Here, we show a FAD-binding glycoprotein with the best substrate specificity constant for L-phenylalanine. Although the amino acid sequence of Th-LAAO revealed limited homology (16-24%) to other LAAO members, a highly conserved FAD-binding motif was identified in the N-terminus. Th-LAAO was shown to be a homodimeric protein, but the monomeric form was predominant when grown in the presence of deactivated Rhizoctonia solani. Furthermore, in vitro assays demonstrated that Th-LAAO had an antagonistic effect against Rhizoctonia solani and a stimulatory one on hyphal density and sporulation in T. harzianum ETS 323. These findings further our understanding of T. harzianum as a biocontrol agent and provide insight into the biological function of l-amino acid oxidase.

Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwater Bivalves.

PubMed

Yusseppone, Maria S; Rocchetta, Iara; Sabatini, Sebastian E; Luquet, Carlos M; Ríos de Molina, Maria Del Carmen; Held, Christoph; Abele, Doris

2018-01-01

Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O 2 /L), hypoxia (2 mg O 2 /L), and normoxia (9 mg O 2 /L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis . Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks.

Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwater Bivalves

PubMed Central

Yusseppone, Maria S.; Rocchetta, Iara; Sabatini, Sebastian E.; Luquet, Carlos M.; Ríos de Molina, Maria del Carmen; Held, Christoph; Abele, Doris

2018-01-01

Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L), hypoxia (2 mg O2/L), and normoxia (9 mg O2/L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks. PMID:29527172

Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.

PubMed

Kita, K; Konishi, K; Anraku, Y

1986-01-01

Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.

Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

PubMed

Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

2002-08-06

The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Treesearch

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

PubMed

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Levels and interactions of plasma xanthine oxidase, catalase and liver function parameters in Nigerian children with Plasmodium falciparum infection.

PubMed

Iwalokun, B A; Bamiro, S B; Ogunledun, A

2006-12-01

Elevated plasma levels of xanthine oxidase and liver function parameters have been associated with inflammatory events in several human diseases. While xanthine oxidase provides in vitro protection against malaria, its pathophysiological functions in vivo and interactions with liver function parameters remain unclear. This study examined the interactions and plasma levels of xanthine oxidase (XO) and uric acid (UA), catalase (CAT) and liver function parameters GOT, GPT and bilirubin in asymptomatic (n=20), uncomplicated (n=32), and severe (n=18) falciparum malaria children aged 3-13 years. Compared to age-matched control (n=16), significant (p<0.05) elevation in xanthine oxidase by 100-550%, uric acid by 15.4-153.8%, GOT and GPT by 22.1-102.2%, and total bilirubin by 2.3-86% according to parasitaemia (geometric mean parasite density (GMPD)=850-87100 parasites/microL) was observed in the malarial children. Further comparison with control revealed higher CAT level (16.2+/-0.5 vs 14.6+/-0.4 U/L; p<0.05) lacking significant (p>0.05) correlation with XO, but lower CAT level (13.4-5.4 U/L) with improved correlations (r=-0.53 to -0.91; p<0.05) with XO among the asymptomatic and symptomatic malaria children studied. 75% of control, 45% of asymptomatic, 21.9% of uncomplicated, and none of severe malaria children had Hb level>11.0 g/dL. Multivariate analyses further revealed significant (p<0.05) correlations between liver function parameters and xanthine oxidase (r=0.57-0.64) only in the severe malaria group. We conclude that elevated levels of XO and liver enzymes are biochemical features of Plasmodium falciparum parasitaemia in Nigerian children, with both parameters interacting differently to modulate the catalase response in asymptomatic and symptomatic falciparum malaria.

Physiological consequences of starvation in Pseudomonas putida: degradation of intracellular protein and loss of activity of the inducible enzymes of L-arginine catabolism.

PubMed

Fan, C L; Rodwell, V W

1975-12-01

We investigated the degradation of radioisotopically labeled intracellular protein in starved, intact cells of Pseudomonas putida P2 (ATCC 25571) and the regulation of this process. Intracellular protein isotopically labeled with L-[4,5-3H]leucine during log-phase growth at 30 C is degraded at rates of 1 to 2%/h in log-phase cells and 7 to 9%/h in starved cells. Rifampin, chloramphenicol, and tosyllysine chloromethylketone lower the rate of protein degradation by starved cells. Addition to starved cells of a nutrient upon which the culture is induced for growth rapidly lowers the rate of protein degradation from 7 to 9%/h to less than 1.5%/h. A nutrient that is oxidized but that cannot immediately support growth also lowers the rate of starvation-induced protein degradation. Proteolytic activity of cell extracts requires a divalent metal ion and may be inhibited up to 60% by tosyllysine chloromethylketone or p-toluenesulfonyl fluoride. Rifampin and chloramphenicol have no effect. In contrast to intact cells, extracts of growing or starving cells degrade protein at equivalent rates. We also investigated the stabilities of the inducible transport system and of four inducible intracellular enzymes of L-arginine catabolism. These include: the membrane-associated, L-arginine-specific transport system; L-arginine oxidase (oxidase); alpha-ketoarginine decarboxylase (decarboxylase); gamma-guanidinobutyraldehyde dehydrogenase ( dehydrogenase); and gamma-guanidinobutyrate amidinohydrolase (hydrolase). In starved cells, the rates of loss of activities were: transport and dehydrogenase activities, stable; oxidase and decarboxylase activities, 20 to 30%/h; hydrolase activity, 5 to 8%/h. Chloramphenicol decreases the rate of loss of oxidase, decarboxylase, and hydrolase activity, whereas p-toluenesulfonyl fluoride lowers the rate of loss of decarboxylase but not of oxidase or hydrolase activity. Addition to starved cells of a nutrient for which they are already induced for growth (e.g., malate, a noninducer of arginine catabolic enzymes) decreases the rate of loss of oxidase and decarboxylase activity but not that of the hydrolase.

Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

Deficiency of Rac1 Blocks NADPH Oxidase Activation, Inhibits Endoplasmic Reticulum Stress, and Reduces Myocardial Remodeling in a Mouse Model of Type 1 Diabetes

PubMed Central

Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing

2010-01-01

OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592

Adaptive responses of heart and skeletal muscle to spermine oxidase overexpression: Evaluation of a new transgenic mouse model.

PubMed

Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela

2017-02-01

Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

The MAOA gene predicts happiness in women.

PubMed

Chen, Henian; Pine, Daniel S; Ernst, Monique; Gorodetsky, Elena; Kasen, Stephanie; Gordon, Kathy; Goldman, David; Cohen, Patricia

2013-01-10

Psychologists, quality of life and well-being researchers have grown increasingly interested in understanding the factors that are associated with human happiness. Although twin studies estimate that genetic factors account for 35-50% of the variance in human happiness, knowledge of specific genes is limited. However, recent advances in molecular genetics can now provide a window into neurobiological markers of human happiness. This investigation examines association between happiness and monoamine oxidase A (MAOA) genotype. Data were drawn from a longitudinal study of a population-based cohort, followed for three decades. In women, low expression of MAOA (MAOA-L) was related significantly to greater happiness (0.261 SD increase with one L-allele, 0.522 SD with two L-alleles, P=0.002) after adjusting for the potential effects of age, education, household income, marital status, employment status, mental disorder, physical health, relationship quality, religiosity, abuse history, recent negative life events and self-esteem use in linear regression models. In contrast, no such association was found in men. This new finding may help explain the gender difference on happiness and provide a link between MAOA and human happiness. Copyright © 2012 Elsevier Inc. All rights reserved.

Organic Nitrogen Utilization by Phytoplankton: The Role of Cell-Surface Deaminases

DTIC Science & Technology

1989-06-01

Pleurochrysis carterae (Coccoll-N) is a coccolithless clone isolated by the authors from Coccoll. Emiliania huxleyi (12-1) was isolated from the Sargasso Sea...another coccolithophorid, Emiliania huxleyi from the Sargasso Sea (now 12-1, CCMP) for L-amino acid oxidase activity. No activity was found under log...acid oxidase regulation. Saturated oxidase rate constants (Vmax) are shown for Pleurochrysis isolates and one Emiliania huxleyi isolate (12-1). Nlim

Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.

PubMed

Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J

1979-12-01

Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

PubMed

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

PubMed

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

Role of Angiotensin II type 1 receptor on renal NAD(P)H oxidase, oxidative stress and inflammation in nitric oxide inhibition induced-hypertension.

PubMed

Rincón, J; Correia, D; Arcaya, J L; Finol, E; Fernández, A; Pérez, M; Yaguas, K; Talavera, E; Chávez, M; Summer, R; Romero, F

2015-03-01

Activation of the renin-angiotensin system (RAS), renal oxidative stress and inflammation are constantly present in experimental hypertension. Nitric oxide (NO) inhibition with N(w)-nitro-L-arginine methyl ester (L-NAME) has previously been reported to produce hypertension, increased expression of Angiotensin II (Ang II) and renal dysfunction. The use of Losartan, an Ang II type 1 receptor (AT1R) antagonist has proven to be effective reducing hypertension and renal damage; however, the mechanism by which AT1R blockade reduced kidney injury and normalizes blood pressure in this experimental model is still complete unknown. The current study was designed to test the hypothesis that AT1R activation promotes renal NAD(P)H oxidase up-regulation, oxidative stress and cytokine production during L-NAME induced-hypertension. Male Sprague-Dawley rats were distributed in three groups: L-NAME, receiving 70 mg/100ml of L-NAME, L-NAME+Los, receiving 70 mg/100ml of L-NAME and 40 mg/kg/day of Losartan; and Controls, receiving water instead of L-NAME or L-NAME and Losartan. After two weeks, L-NAME induced high blood pressure, renal overexpression of AT1R, NAD(P)H oxidase sub-units gp91, p22 and p47, increased levels of oxidative stress, interleukin-6 (IL-6) and interleukin-17 (IL-17). Also, we found increased renal accumulation of lymphocytes and macrophages. Losartan treatment abolished the renal expression of gp91, p22, p47, oxidative stress and reduced NF-κB activation and IL-6 expression. These findings indicate that NO induced-hypertension is associated with up-regulation of NADPH oxidase, oxidative stress production and overexpression of key inflammatory mediators. These events are associated with up-regulation of AT1R, as evidenced by their reversal with AT1R blocker treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

Electrophysiological responses of feedback processing are modulated by MAOA genotype in healthy male adolescents.

PubMed

Ma, Ren; Jia, Huiqiao; Yi, Fei; Ming, Qingsen; Wang, Xiang; Gao, Yidian; Yi, Jinyao; Yao, Shuqiao

2016-01-01

A functional polymorphism in the promoter region of the monoamine oxidase A (MAOA) gene is closely related to aggression. Although previous studies suggested that impaired ability of feedback processing might be associated with aggressive behaviour, studies concerning the MAOA gene-related aggression rarely focused on the link between MAOA gene and feedback processing. We therefore sought to investigate the effect of MAOA genotype on electrophysiological responses of feedback processing in 72 healthy male adolescents during a simple monetary gambling task. Feedback processing was investigated by measuring the feedback-related negativity (FRN) and the P300 as electrophysiological markers. We observed a decreased electrophysiological response of the loss-gain difference waves from 250 to 350 ms (dFRN) in individuals with the lower activity alleles (MAOA-L) during the task, an effect that was driven primarily by the considerably altered response to monetary gains. The reduced dFRN in MAOA-L group might indicate poor ability to learn from feedback, which is followed by adjusting future behaviour. And MAOA-L carriers exhibited lower P300 compared with subjects with higher activity alleles (MAOA-H), which suggested fewer attentional resources were allocated to feedback processing. In addition, MAOA-L carriers demonstrated higher aggression and the aggression were inversely correlated with dFRN across two groups; further analyses suggested that dFRN mediated the MAOA genotype-aggression relationship. Consequently, we concluded that it might be the altered feedback processing that makes MAOA-L carriers more vulnerable to aggressive behaviour. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Cortico-limbic connectivity in MAOA-L carriers is vulnerable to acute tryptophan depletion.

PubMed

Eisner, Patrick; Klasen, Martin; Wolf, Dhana; Zerres, Klaus; Eggermann, Thomas; Eisert, Albrecht; Zvyagintsev, Mikhail; Sarkheil, Pegah; Mathiak, Krystyna A; Zepf, Florian; Mathiak, Klaus

2017-03-01

A gene-environment interaction between expression genotypes of the monoamine oxidase A (MAOA) and adverse childhood experience increases the risk of antisocial behavior. However, the neural underpinnings of this interaction remain uninvestigated. A cortico-limbic circuit involving the prefrontal cortex (PFC) and the amygdala is central to the suppression of aggressive impulses and is modulated by serotonin (5-HT). MAOA genotypes may modulate the vulnerability of this circuit and increase the risk for emotion regulation deficits after specific life events. Acute tryptophan depletion (ATD) challenges 5-HT regulation and may identify vulnerable neuronal circuits, contributing to the gene-environment interaction. Functional magnetic resonance imaging measured the resting-state state activity in 64 healthy males in a double-blind, placebo-controlled study. Cortical maps of amygdala correlation identified the impact of ATD and its interaction with low- (MAOA-L) and high-expression variants (MAOA-H) of MAOA on cortico-limbic connectivity. Across all Regions of Interest (ROIs) exhibiting an ATD effect on cortico-limbic connectivity, MAOA-L carriers were more susceptible to ATD than MAOA-H carriers. In particular, the MAOA-L group exhibited a larger reduction of amygdala connectivity with the right prefrontal cortex and a larger increase of amygdala connectivity with the insula and dorsal PCC. MAOA-L carriers were more susceptable to a central 5-HT challenge in cortico-limbic networks. Such vulnerability of the cortical serotonergic system may contribute to the emergence of antisocial behavior after systemic challenges, observed as gene-environment interaction. Hum Brain Mapp 38:1622-1635, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Permanent draft genome of Thermithiobacillus tepidarius DSM 3134 T, a moderately thermophilic, obligately chemolithoautotrophic member of the Acidithiobacillia

DOE PAGES

Boden, Rich; Hutt, Lee P.; Huntemann, Marcel; ...

2016-09-26

Thermithiobacillus tepidarius DSM 3134 T was originally isolated (1983) from the waters of a sulfidic spring entering the Roman Baths (Temple of Sulis-Minerva) at Bath, United Kingdom and is an obligate chemolithoautotroph growing at the expense of reduced sulfur species. This strain has a genome size of 2,958,498 bp. Here we report the genome sequence, annotation and characteristics. The genome comprises 2,902 protein coding and 66 RNA coding genes. Genes responsible for the transaldolase variant of the Calvin-Benson-Bassham cycle were identified along with a biosynthetic horseshoe in lieu of Krebs' cycle sensu stricto. Terminal oxidases were identified, viz. cytochrome cmore » oxidase (cbb 3 , EC 1.9.3.1) and ubiquinol oxidase (bd, EC 1.10.3.10). Metalloresistance genes involved in pathways of arsenic and cadmium resistance were found. Evidence of horizontal gene transfer accounting for 5.9 % of the protein-coding genes was found, including transfer from Thiobacillus spp. and Methylococcus capsulatus Bath, isolated from the same spring. A sox gene cluster was found, similar in structure to those from other Acidithiobacillia - by comparison with Thiobacillus thioparus and Paracoccus denitrificans, an additional gene between soxA and soxB was found, annotated as a DUF302-family protein of unknown function. As the Kelly-Friedrich pathway of thiosulfate oxidation (encoded by sox) is not used in Thermithiobacillus spp., the role of the operon (if any) in this species remains unknown. We speculate that DUF302 and sox genes may have a role in periplasmic trithionate oxidation.« less

Permanent draft genome of Thermithiobacillus tepidarius DSM 3134 T, a moderately thermophilic, obligately chemolithoautotrophic member of the Acidithiobacillia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boden, Rich; Hutt, Lee P.; Huntemann, Marcel

Thermithiobacillus tepidarius DSM 3134 T was originally isolated (1983) from the waters of a sulfidic spring entering the Roman Baths (Temple of Sulis-Minerva) at Bath, United Kingdom and is an obligate chemolithoautotroph growing at the expense of reduced sulfur species. This strain has a genome size of 2,958,498 bp. Here we report the genome sequence, annotation and characteristics. The genome comprises 2,902 protein coding and 66 RNA coding genes. Genes responsible for the transaldolase variant of the Calvin-Benson-Bassham cycle were identified along with a biosynthetic horseshoe in lieu of Krebs' cycle sensu stricto. Terminal oxidases were identified, viz. cytochrome cmore » oxidase (cbb 3 , EC 1.9.3.1) and ubiquinol oxidase (bd, EC 1.10.3.10). Metalloresistance genes involved in pathways of arsenic and cadmium resistance were found. Evidence of horizontal gene transfer accounting for 5.9 % of the protein-coding genes was found, including transfer from Thiobacillus spp. and Methylococcus capsulatus Bath, isolated from the same spring. A sox gene cluster was found, similar in structure to those from other Acidithiobacillia - by comparison with Thiobacillus thioparus and Paracoccus denitrificans, an additional gene between soxA and soxB was found, annotated as a DUF302-family protein of unknown function. As the Kelly-Friedrich pathway of thiosulfate oxidation (encoded by sox) is not used in Thermithiobacillus spp., the role of the operon (if any) in this species remains unknown. We speculate that DUF302 and sox genes may have a role in periplasmic trithionate oxidation.« less

Silver nanoparticle modulates gene expressions, glyoxalase system and oxidative stress markers in fluoride stressed Cajanus cajan L.

PubMed

Yadu, Bhumika; Chandrakar, Vibhuti; Korram, Jyoti; Satnami, Manmohan L; Kumar, Meetul; S, Keshavkant

2018-07-05

Application of engineered nanomaterials has increased these days due to their beneficial impacts on several sectors of the economy, including agriculture. Silver nanoparticles (AgNP) are commonly used to improve rate of seed germination, and growth and development of plants. The present study was aimed to monitor the role of engineered AgNP (non-dialysed) in the amelioration of fluoride (F)-induced oxidative injuries in Cajanus cajan L. Experimental results revealed that F-exposure inhibited growth and membrane stability index, while were enhanced with the augmentation of AgNP. The results also demonstrated that F treatment enhanced the accumulations of reactive oxygen species, malondialdehyde and oxidized glutathione, gene expression of NADPH oxidase, and activity of lipoxygenase, but were decreased by the addition of AgNP. The results indicated that exogenous application of AgNP provided tolerance against F-toxicity via enhancing the levels of proline, total and reduced glutathione, glyoxalase I and II activities, and expression of pyrroline-5-carboxylate synthetase gene. Conducted study uniquely suggested potential role of AgNP in the remediation of F-toxicity, at least in the Cajanus cajan L. radicles. Further research would be intended to unravel the molecular mechanism(s) involved precisely in the AgNP mediated alleviation of F-toxicity. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

PubMed

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

PubMed Central

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

PubMed

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

2013-04-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

Molecular Characterization of Taenia multiceps Isolates from Gansu Province, China by Sequencing of Mitochondrial Cytochrome C Oxidase Subunit 1

PubMed Central

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu

2013-01-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species. PMID:23710087

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less

The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

PubMed Central

Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

2001-01-01

We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

Global gene expression analysis of the response of physic nut (Jatropha curcas L.) to medium- and long-term nitrogen deficiency

PubMed Central

Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu

2017-01-01

Jatropha curcas L. is an important biofuel plant with excellent tolerance of barren environments. However, studies on the regulatory mechanisms that operate in this plant in response to nitrogen (N) shortage are scarce. In this study, genome-wide transcriptional profiles of the roots and leaves of 8-week old physic nut seedlings were analyzed after 2 and 16 days of N starvation. Enrichment results showed that genes associated with N metabolism, processing and regulation of RNA, and transport predominated among those showing alterations in expression. Genes encoding transporter families underwent major changes in expression in both roots and leaves; in particular, those with roles in ammonia, amino acid and peptide transport were generally up-regulated after long-term starvation, while AQUAPORIN genes, whose products function in osmoregulation, were down-regulated. We also found that ASPARA−GINASE B1 and SARCOSINE OXIDASE genes were up-regulated in roots and leaves after 2 and 16 d N starvation. Genes associated with ubiquitination-mediated protein degradation were significantly up-regulated. In addition, genes in the JA biosynthesis pathway were strongly activated while expression of those in GA signaling was inhibited in leaves. We showed that four major classes of genes, those with roles in N uptake, N reutilization, C/N ratio balance, and cell structure and synthesis, were particularly influenced by long-term N limitation. Our discoveries may offer clues to the molecular mechanisms that regulate N reallocation and reutilization so as to maintain or increase plant performance even under adverse environmental conditions. PMID:28817702

Global gene expression analysis of the response of physic nut (Jatropha curcas L.) to medium- and long-term nitrogen deficiency.

PubMed

Kuang, Qi; Zhang, Sheng; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2017-01-01

Jatropha curcas L. is an important biofuel plant with excellent tolerance of barren environments. However, studies on the regulatory mechanisms that operate in this plant in response to nitrogen (N) shortage are scarce. In this study, genome-wide transcriptional profiles of the roots and leaves of 8-week old physic nut seedlings were analyzed after 2 and 16 days of N starvation. Enrichment results showed that genes associated with N metabolism, processing and regulation of RNA, and transport predominated among those showing alterations in expression. Genes encoding transporter families underwent major changes in expression in both roots and leaves; in particular, those with roles in ammonia, amino acid and peptide transport were generally up-regulated after long-term starvation, while AQUAPORIN genes, whose products function in osmoregulation, were down-regulated. We also found that ASPARA-GINASE B1 and SARCOSINE OXIDASE genes were up-regulated in roots and leaves after 2 and 16 d N starvation. Genes associated with ubiquitination-mediated protein degradation were significantly up-regulated. In addition, genes in the JA biosynthesis pathway were strongly activated while expression of those in GA signaling was inhibited in leaves. We showed that four major classes of genes, those with roles in N uptake, N reutilization, C/N ratio balance, and cell structure and synthesis, were particularly influenced by long-term N limitation. Our discoveries may offer clues to the molecular mechanisms that regulate N reallocation and reutilization so as to maintain or increase plant performance even under adverse environmental conditions.

Impact of SO(2) on Arabidopsis thaliana transcriptome in wildtype and sulfite oxidase knockout plants analyzed by RNA deep sequencing.

PubMed

Hamisch, Domenica; Randewig, Dörte; Schliesky, Simon; Bräutigam, Andrea; Weber, Andreas P M; Geffers, Robert; Herschbach, Cornelia; Rennenberg, Heinz; Mendel, Ralf R; Hänsch, Robert

2012-12-01

High concentrations of sulfur dioxide (SO(2) ) as an air pollutant, and its derivative sulfite, cause abiotic stress that can lead to cell death. It is currently unknown to what extent plant fumigation triggers specific transcriptional responses. To address this question, and to test the hypothesis that sulfite oxidase (SO) is acting in SO(2) detoxification, we compared Arabidopsis wildtype (WT) and SO knockout lines (SO-KO) facing the impact of 600 nl l(-1) SO(2) , using RNAseq to quantify absolute transcript abundances. These transcriptome data were correlated to sulfur metabolism-related enzyme activities and metabolites obtained from identical samples in a previous study. SO-KO plants exhibited remarkable and broad regulative responses at the mRNA level, especially in transcripts related to sulfur metabolism enzymes, but also in those related to stress response and senescence. Focusing on SO regulation, no alterations were detectable in the WT, whereas in SO-KO plants we found up-regulation of two splice variants of the SO gene, although this gene is not functional in this line. Our data provide evidence for the highly specific coregulation between SO and sulfur-related enzymes like APS reductase, and suggest two novel candidates for involvement in SO(2) detoxification: an apoplastic peroxidase, and defensins as putative cysteine mass storages. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Interaction between Nitric Oxide and Ethylene in the Induction of Alternative Oxidase in Ozone-Treated Tobacco Plants1[W

PubMed Central

Ederli, Luisa; Morettini, Roberta; Borgogni, Andrea; Wasternack, Claus; Miersch, Otto; Reale, Lara; Ferranti, Francesco; Tosti, Nicola; Pasqualini, Stefania

2006-01-01

The higher plant mitochondrial electron transport chain contains, in addition to the cytochrome chain, an alternative pathway that terminates with a single homodimeric protein, the alternative oxidase (AOX). We recorded temporary inhibition of cytochrome capacity respiration and activation of AOX pathway capacity in tobacco plants (Nicotiana tabacum L. cv BelW3) fumigated with ozone (O3). The AOX1a gene was used as a molecular probe to investigate its regulation by signal molecules such as hydrogen peroxide, nitric oxide (NO), ethylene (ET), salicylic acid, and jasmonic acid (JA), all of them reported to be involved in the O3 response. Fumigation leads to accumulation of hydrogen peroxide in mitochondria and early accumulation of NO in leaf tissues. Although ET accumulation was high in leaf tissues 5 h after the start of O3 fumigation, it declined during the recovery period. There were no differences in the JA and 12-oxo-phytodienoic acid levels of treated and untreated plants. NO, JA, and ET induced AOX1a mRNA accumulation. Using pharmacological inhibition of ET and NO, we demonstrate that both NO- and ET-dependent pathways are required for O3-induced up-regulation of AOX1a. However, only NO is indispensable for the activation of AOX1a gene expression. PMID:16935990

The role of the serotonergic system in suicidal behavior

PubMed Central

Sadkowski, Marta; Dennis, Brittany; Clayden, Robert C; ElSheikh, Wala; Rangarajan, Sumathy; DeJesus, Jane; Samaan, Zainab

2013-01-01

Serotonin is a widely investigated neurotransmitter in several psychopathologies, including suicidal behavior (SB); however, its role extends to several physiological functions involving the nervous system, as well as the gastrointestinal and cardiovascular systems. This review summarizes recent research into ten serotonergic genes related to SB. These genes – TPH1, TPH2, SLC6A4, SLC18A2, HTR1A, HTR1B, HTR2A, DDC, MAOA, and MAOB – encode proteins that are vital to serotonergic function: tryptophan hydroxylase; the serotonin transporter 5-HTT; the vesicular transporter VMAT2; the HTR1A, HTR1B, and HTR2A receptors; the L-amino acid decarboxylase; and the monoamine oxidases. This review employed a systematic search strategy and a narrative research methodology to disseminate the current literature investigating the link between SB and serotonin. PMID:24235834

Control of enzymatic browning in potato (Solanum tuberosum L.) by sense and antisense RNA from tomato polyphenol oxidase.

PubMed

Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N

2001-02-01

Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives.

A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

PubMed

Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

2013-06-01

The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

PubMed Central

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

PubMed

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers

USDA-ARS?s Scientific Manuscript database

Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...

Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

PubMed Central

Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

2015-01-01

Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

On the diversity of the laccase gene: a phylogenetic perspective from Botryosphaeria rhodina (Ascomycota: Fungi) and other related taxa.

PubMed

Castilho, Flávio J D; Torres, Rodrigo A; Barbosa, Aneli M; Dekker, Robert F H; Garcia, José E

2009-02-01

The present study is the first describing the sequencing of a fragment of the copper-oxidase domain of a laccase gene in the family Botryosphaeriaceae. The aim of this work was to assess the degree of genetic and evolutionary relationships of a laccase gene from Botryosphaeria rhodina MAMB-05 with other ascomycete and basidiomycete laccase genes. The 193-amino acid sequences of the copper-oxidase domain from several different fungi, insects, a plant, and a bacterial species were retrieved from GenBank and aligned. Phylogenetic analyses were performed using neighbor-joining, maximum parsimony, and Bayesian inference methods. The organisms studied clustered into five gene clades: fungi (ascomycetes and basidiomycetes), insects, plants, and bacteria. Also, the topologies showed that fungal laccases of the ascomycetes and basidiomycetes are clearly separated into two distinct clusters. This evidence indicated that B. rhodina MAMB-05 and other closely related ascomycetes are a new biological resource given the biotechnological potential of their laccase genes.

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

PubMed

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer

DTIC Science & Technology

2013-10-01

Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal

Associations between serotonin-related gene polymorphisms and panic disorder.

PubMed

Maron, Eduard; Lang, Aavo; Tasa, Gunnar; Liivlaid, Liivi; Tõru, Innar; Must, Anne; Vasar, Veiko; Shlik, Jakov

2005-06-01

Studies suggest that vulnerability to panic attacks and panic disorder (PD) may be related to a deficient serotonin (5-HT) neurotransmission. In the present case-control study we investigated possible associations between PD phenotype and five candidate polymorphisms including 5-HT transporter (5-HTTLPR and VNTR), monoamine oxidase A (MAOA promoter region), tryptophan hydroxylase 1 (TPH1 218A/C) and 5-HT1B receptor (5-HT1BR 861G/C) genes. The study sample consisted of 158 patients with PD and 215 healthy control subjects. The analysis showed higher frequencies of LL genotype (p = 0.016) and L allele variant (p = 0.007) of 5-HTTLPR in the patients. No significant associations were observed between PD and other candidate gene polymorphisms. However, a higher frequency of longer allele genotypes of the MAOA promoter region was observed in female PD patients with agoraphobia than in female controls (p = 0.016). These findings indicate that genetic variants conceivably related to lower 5-HT neurotransmission may be involved in the development of PD.

Permethrin Induces Overexpression of Cytochrome c Oxidase Subunit 3 in Aedes aegypti

USDA-ARS?s Scientific Manuscript database

Using quantitative PCR (QPCR), the relative transcriptional levels of cytochrome c oxidase subunit 3 (CO3) were studied in Aedes aegypti (L.) in response to treatments with acetone, permethrin, or fipronil. The transcriptional levels of CO3 were significantly (p <0.05) higher in acetone-treated Ae. ...

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

PubMed Central

Dijkman, Willem P.

2014-01-01

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

PubMed

Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

2008-05-01

The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

Rat striatal monoamine oxidase-B inhibition by l-deprenyl and rasagiline: its relationship to 2-phenylethylamine-induced stereotypy and Parkinson's disease.

PubMed

Youdim, M B H; Tipton, K F

2002-03-01

Rats were injected intraperitoneally with varying doses of l-deprenyl (selegiline) followed 2h later by 30 mg kg(-1) 2-phenylethylamine (PEA), administered in the same way, and the stereotypic behavioural response elicited was assessed. l-Deprenyl alone at doses of up to 5 mg kg(-1) caused no significant behavioural response. Administration of PEA without prior l-deprenyl treatment resulted in only a modest increase in stereotypic behaviour and this was not significantly enhanced by the prior administration 1 mg kg(-1) l-deprenyl. When the administered dose of l-deprenyl was increased to 2.5 or 5 mgkg(-1), however, the stereotypic behavioural response to PEA was greatly potentiated and in the latter case persisted for 60 min. A dose of 2.5 mg kg(-1) l-deprenyl and 1 mg kg(-1) rasagiline was shown to result in over 90% inhibition of the monoamine oxidase (MAO)-B from rat liver and striatum, whereas the inhibition of MAO-A was about 60 and 40% in liver and striatum, respectively. The recovery of MAO-B activity in rat striatum and liver following a single i.p. injection of 5 mg kg(-1) l-deprenyl gave first-order rate constants of 1.80 and 7.15 h(-1), respectively, which corresponded to half-lives of 9.23 and 2.33 days. Similar results were obtained with rasagiline. The corresponding indices of stereotypic response to PEA (30 mg kg(-1); i.p.) during recovery from the single dose of l-deprenyl were initially high, but had started to decline by the third day after l-deprenyl treatment and was not significant after day 4. At that time, less than 20% of the striatal monoamine oxidase-B activity had been regained, whereas the recovery of the liver enzyme was about 65%. These data are discussed in terms of the suggested involvement of PEA potentiation in the anti-parkinsonian actions of l-deprenyl and rasagiline and the duration of the 'wash-out' period used in studies on the effects of l-deprenyl on patients with Parkinson's disease. The longer duration of the recovery of brain monoamine oxidase B after its selective inhibition and the corresponding behavioural responses of the animals to PEA at same time points, indicate that PEA may have a major pharmacological role in the mechanism of the antiParkinson action of l-deprenyl and rasagiline. Brain monoamine oxidase B inhibition has previously been shown to significantly increases brain PEA and which is capable of releasing dopamine endogenously or that formed from L-dopa.

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

PubMed

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

PubMed Central

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-01-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

NASA Technical Reports Server (NTRS)

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

Microbial Metabolic Potential for Carbon Degradation and Nutrient (Nitrogen and Phosphorus) Acquisition in an Ombrotrophic Peatland

PubMed Central

Tfaily, Malak M.; Green, Stefan J.; Steinweg, J. Megan; Chanton, Patrick; Imvittaya, Aopeau; Chanton, Jeffrey P.; Cooper, William; Schadt, Christopher

2014-01-01

This study integrated metagenomic and nuclear magnetic resonance (NMR) spectroscopic approaches to investigate microbial metabolic potential for organic matter decomposition and nitrogen (N) and phosphorus (P) acquisition in soils of an ombrotrophic peatland in the Marcell Experimental Forest (MEF), Minnesota, USA. This analysis revealed vertical stratification in key enzymatic pathways and taxa containing these pathways. Metagenomic analyses revealed that genes encoding laccases and dioxygenases, involved in aromatic compound degradation, declined in relative abundance with depth, while the relative abundance of genes encoding metabolism of amino sugars and all four saccharide groups increased with depth in parallel with a 50% reduction in carbohydrate content. Most Cu-oxidases were closely related to genes from Proteobacteria and Acidobacteria, and type 4 laccase-like Cu-oxidase genes were >8 times more abundant than type 3 genes, suggesting an important and overlooked role for type 4 Cu-oxidase in phenolic compound degradation. Genes associated with sulfate reduction and methanogenesis were the most abundant anaerobic respiration genes in these systems, with low levels of detection observed for genes of denitrification and Fe(III) reduction. Fermentation genes increased in relative abundance with depth and were largely affiliated with Syntrophobacter. Methylocystaceae-like small-subunit (SSU) rRNA genes, pmoA, and mmoX genes were more abundant among methanotrophs. Genes encoding N2 fixation, P uptake, and P regulons were significantly enriched in the surface peat and in comparison to other ecosystems, indicating N and P limitation. Persistence of inorganic orthophosphate throughout the peat profile in this P-limiting environment indicates that P may be bound to recalcitrant organic compounds, thus limiting P bioavailability in the subsurface. Comparative metagenomic analysis revealed a high metabolic potential for P transport and starvation, N2 fixation, and oligosaccharide degradation at MEF relative to other wetland and soil environments, consistent with the nutrient-poor and carbohydrate-rich conditions found in this Sphagnum-dominated boreal peatland. PMID:24682299

Microbial metabolic potential for carbon degradation and nutrient (nitrogen and phosphorus) acquisition in an ombrotrophic peatland.

PubMed

Lin, Xueju; Tfaily, Malak M; Green, Stefan J; Steinweg, J Megan; Chanton, Patrick; Imvittaya, Aopeau; Chanton, Jeffrey P; Cooper, William; Schadt, Christopher; Kostka, Joel E

2014-06-01

This study integrated metagenomic and nuclear magnetic resonance (NMR) spectroscopic approaches to investigate microbial metabolic potential for organic matter decomposition and nitrogen (N) and phosphorus (P) acquisition in soils of an ombrotrophic peatland in the Marcell Experimental Forest (MEF), Minnesota, USA. This analysis revealed vertical stratification in key enzymatic pathways and taxa containing these pathways. Metagenomic analyses revealed that genes encoding laccases and dioxygenases, involved in aromatic compound degradation, declined in relative abundance with depth, while the relative abundance of genes encoding metabolism of amino sugars and all four saccharide groups increased with depth in parallel with a 50% reduction in carbohydrate content. Most Cu-oxidases were closely related to genes from Proteobacteria and Acidobacteria, and type 4 laccase-like Cu-oxidase genes were >8 times more abundant than type 3 genes, suggesting an important and overlooked role for type 4 Cu-oxidase in phenolic compound degradation. Genes associated with sulfate reduction and methanogenesis were the most abundant anaerobic respiration genes in these systems, with low levels of detection observed for genes of denitrification and Fe(III) reduction. Fermentation genes increased in relative abundance with depth and were largely affiliated with Syntrophobacter. Methylocystaceae-like small-subunit (SSU) rRNA genes, pmoA, and mmoX genes were more abundant among methanotrophs. Genes encoding N2 fixation, P uptake, and P regulons were significantly enriched in the surface peat and in comparison to other ecosystems, indicating N and P limitation. Persistence of inorganic orthophosphate throughout the peat profile in this P-limiting environment indicates that P may be bound to recalcitrant organic compounds, thus limiting P bioavailability in the subsurface. Comparative metagenomic analysis revealed a high metabolic potential for P transport and starvation, N2 fixation, and oligosaccharide degradation at MEF relative to other wetland and soil environments, consistent with the nutrient-poor and carbohydrate-rich conditions found in this Sphagnum-dominated boreal peatland.

Genes, blame and loss of control: is there a place in criminal law for a 'genetic defense'?

PubMed

Gavaghan, Colin; Bastani, Amir

2014-01-01

In 2002, Caspi and colleagues proposed that a specific gene by environment (GxE) interaction is related to antisocial tendencies. Since then, a substantial body of literature has examined the potential implications of such a correlation for the criminal justice system, and in particular, for the attribution of responsibility and blame that lies at the core of that system. It is probably accurate to say that the majority position among criminal theorists is that evidence of such a nature does not undermine or seriously challenge existing notions of responsibility, and could not constitute a full defense to a criminal charge - although it may have a role to play in sentencing. Less consideration, however, has been given to the role such evidence may play in so-called 'partial defenses' - those like diminished responsibility (DR), which serve not to exculpate the defendant entirely, but rather, to mitigate his responsibility for the criminal act. This paper aims to assess the most important feature of the Caspi Sudy - the low variant gene for the production of Monoamine Oxidase Acid A gene (MAOA-L) - and its possible role in a defense of DR. We argue that, following the approach of common law jurisdictions to analogous situations, there is no principled reason to exclude evidence of MAOA-L as a basis of DR.

Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.

PubMed

Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T

2001-06-29

Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.

Polymorphisms in the AOX2 gene are associated with the rooting ability of olive cuttings.

PubMed

Hedayati, Vahideh; Mousavi, Amir; Razavi, Khadijeh; Cultrera, Nicolò; Alagna, Fiammetta; Mariotti, Roberto; Hosseini-Mazinani, Mehdi; Baldoni, Luciana

2015-07-01

Different rooting ability candidate genes were tested on an olive cross progeny. Our results demonstrated that only the AOX2 gene was strongly induced. OeAOX2 was fully characterised and correlated to phenotypical traits. The formation of adventitious roots is a key step in the vegetative propagation of trees crop species, and this ability is under strict genetic control. While numerous studies have been carried out to identify genes controlling adventitious root formation, only a few loci have been characterised. In this work, candidate genes that were putatively involved in rooting ability were identified in olive (Olea europaea L.) by similarity with orthologs identified in other plant species. The mRNA levels of these genes were analysed by real-time PCR during root induction in high- (HR) and low-rooting (LR) individuals. Interestingly, alternative oxidase 2 (AOX2), which was previously reported to be a functional marker for rooting in olive cuttings, showed a strong induction in HR individuals. From the OeAOX2 full-length gene, alleles and effective polymorphisms were distinguished and analysed in the cross progeny, which were segregated based on rooting. The results revealed a possible correlation between two single nucleotide polymorphisms of OeAOX2 gene and rooting ability.

On the use of L-012, a luminol-based chemiluminescent probe, for detecting superoxide and identifying inhibitors of NADPH oxidase: A re-evaluation

PubMed Central

Zielonka, Jacek; Lambeth, J. David; Kalyanaraman, Balaraman

2014-01-01

L-012, a luminol-based chemiluminescent (CL) probe, is widely used in vitro and in vivo to detect NADPH oxidase (Nox)-derived superoxide (O2·−) and identify Nox inhibitors. Yet understanding of the free radical chemistry of L-012 probe is still lacking. We report that peroxidase and H2O2 induce superoxide dismutase (SOD)-sensitive, L-012-derived CL in the presence of oxygen. O2·− alone does not react with L-012 to emit luminescence. Self-generated O2·− during oxidation of L-012 and luminol-analogs artifactually induce CL inhibitable by SOD. These aspects make assays based on luminol analogs less than ideal for specific detection and identification of O2·− and NOX inhibitors. PMID:24080119

Effect of allyl isothiocyanate on ultra-structure and the activities of four enzymes in adult Sitophilus zeamais.

PubMed

Wu, Hua; Liu, Xue-ru; Yu, Dong-dong; Zhang, Xing; Feng, Jun-tao

2014-02-01

Rarefaction and vacuolization of the mitochondrial matrix of AITC-treated (allyl isothiocyanate-treated) adult Sitophilus zeamais were evident according to the ultra-structural by TEM. Four important enzymes in adult S. zeamais were further studied after fumigation treatment with allyl isothiocyanate (AITC) extracted from Armoracia rusticana roots and shoots. The enzymes were glutathione S-transferase (GST), catalase (CAT), cytochrome c oxidase, and acetylcholinesterase (AChE). The results indicated that the activities of the four enzymes were strongly time and dose depended. With prolonged exposure time, treatment with 0.74μg/mL AITC inhibited the activities of cytochrome c oxidase, AChE, and CAT, but induced the activity of GST. The activities of cytochrome c oxidase, AChE, and CAT were remarkably induced at a low AITC dosage (0.25μg/mL), but were restrained with increased AITC dosage. The activity of GST was inhibited at a low AITC dosage (0.5μg/mL), but was induced at a high AITC dosage (1.5μg/mL). According to the results of TEM, toxic symptoms and enzymes activities, it suggested that mitochondrial maybe the one site of action of AITC against the adult S. zeamais and it also suggested that cytochrome c oxidase maybe one target protein of AITC against the adult S. zeamais, which need to further confirmed by protein function tested. Copyright © 2014 Elsevier Inc. All rights reserved.

An economically and environmentally acceptable synthesis of chiral drug intermediate L-pipecolic acid from biomass-derived lysine via artificially engineered microbes.

PubMed

Cheng, Jie; Huang, Yuding; Mi, Le; Chen, Wujiu; Wang, Dan; Wang, Qinhong

2018-05-10

Deficiency in petroleum resources and increasing environmental concerns have pushed a bio-based economy to be built, employing a highly reproducible, metal contaminant free, sustainable and green biomanufacturing method. Here, a chiral drug intermediate L-pipecolic acid has been synthesized from biomass-derived lysine. This artificial bioconversion system involves the coexpression of four functional genes, which encode L-lysine α-oxidase from Scomber japonicus, glucose dehydrogenase from Bacillus subtilis, Δ 1 -piperideine-2-carboxylase reductase from Pseudomonas putida, and lysine permease from Escherichia coli. Besides, a lysine degradation enzyme has been knocked out to strengthen the process in this microbe. The overexpression of LysP improved the L-pipecolic acid titer about 1.6-folds compared to the control. This engineered microbial factory showed the highest L-pipecolic acid production of 46.7 g/L reported to date and a higher productivity of 2.41 g/L h and a yield of 0.89 g/g. This biotechnological L-pipecolic acid production is a simple, economic, and green technology to replace the presently used chemical synthesis.

Accuracy of Handheld Blood Glucose Meters at High Altitude

PubMed Central

de Vries, Suzanna T.; Fokkert, Marion J.; Dikkeschei, Bert D.; Rienks, Rienk; Bilo, Karin M.; Bilo, Henk J. G.

2010-01-01

Background Due to increasing numbers of people with diabetes taking part in extreme sports (e.g., high-altitude trekking), reliable handheld blood glucose meters (BGMs) are necessary. Accurate blood glucose measurement under extreme conditions is paramount for safe recreation at altitude. Prior studies reported bias in blood glucose measurements using different BGMs at high altitude. We hypothesized that glucose-oxidase based BGMs are more influenced by the lower atmospheric oxygen pressure at altitude than glucose dehydrogenase based BGMs. Methodology/Principal Findings Glucose measurements at simulated altitude of nine BGMs (six glucose dehydrogenase and three glucose oxidase BGMs) were compared to glucose measurement on a similar BGM at sea level and to a laboratory glucose reference method. Venous blood samples of four different glucose levels were used. Moreover, two glucose oxidase and two glucose dehydrogenase based BGMs were evaluated at different altitudes on Mount Kilimanjaro. Accuracy criteria were set at a bias <15% from reference glucose (when >6.5 mmol/L) and <1 mmol/L from reference glucose (when <6.5 mmol/L). No significant difference was observed between measurements at simulated altitude and sea level for either glucose oxidase based BGMs or glucose dehydrogenase based BGMs as a group phenomenon. Two GDH based BGMs did not meet set performance criteria. Most BGMs are generally overestimating true glucose concentration at high altitude. Conclusion At simulated high altitude all tested BGMs, including glucose oxidase based BGMs, did not show influence of low atmospheric oxygen pressure. All BGMs, except for two GDH based BGMs, performed within predefined criteria. At true high altitude one GDH based BGM had best precision and accuracy. PMID:21103399

NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

PubMed Central

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

A new methodology for the determination of enzyme activity based on carbon nanotubes and glucose oxidase.

PubMed

Yeşiller, Gülden; Sezgintürk, Mustafa Kemal

2015-11-10

In this research, a novel enzyme activity analysis methodology is introduced as a new perspective for this area. The activity of elastase enzyme, which is a digestive enzyme mostly of found in the digestive system of vertebrates, was determined by an electrochemical device composed of carbon nanotubes and a second enzyme, glucose oxidase, which was used as a signal generator enzyme. In this novel methodology, a complex bioactive layer was constructed by using carbon nanotubes, glucose oxidase and a supporting protein, gelatin on a solid, conductive substrate. The activity of elastase was determined by monitoring the hydrolysis rate of elastase enzyme in the bioactive layer. As a result of this hydrolysis of elastase, glucose oxidase was dissociated from the bioactive layer, and following this the electrochemical signal due to glucose oxidase was decreased. The progressive elastase-catalyzed digestion of the bioactive layer containing glucose oxidase decreased the layer's enzymatic efficiency, resulting in a decrease of the glucose oxidation current as a function of the enzyme activity. The ratio of the decrease was correlated to elastase activity level. In this study, optimization experiments of bioactive components and characterization of the resulting new electrochemical device were carried out. A linear calibration range from 0.0303U/mL to 0.0729U/mL of elastase was reported. Real sample analyses were also carried out by the new electrochemical device. Copyright © 2015 Elsevier B.V. All rights reserved.

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

PubMed

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

MAPK pathway activation by chronic lead-exposure increases vascular reactivity through oxidative stress/cyclooxygenase-2-dependent pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simões, Maylla Ronacher, E-mail: yllars@hotmail.com; Department of Pharmacology, Universidad Autonoma de Madrid, Instituto de Investigación Hospital Universitario La Paz; Aguado, Andrea

Chronic exposure to low lead concentration produces hypertension; however, the underlying mechanisms remain unclear. We analyzed the role of oxidative stress, cyclooxygenase-2-dependent pathways and MAPK in the vascular alterations induced by chronic lead exposure. Aortas from lead-treated Wistar rats (1st dose: 10 μg/100 g; subsequent doses: 0.125 μg/100 g, intramuscular, 30 days) and cultured aortic vascular smooth muscle cells (VSMCs) from Sprague Dawley rats stimulated with lead (20 μg/dL) were used. Lead blood levels of treated rats attained 21.7 ± 2.38 μg/dL. Lead exposure increased systolic blood pressure and aortic ring contractile response to phenylephrine, reduced acetylcholine-induced relaxation and didmore » not affect sodium nitroprusside relaxation. Endothelium removal and L-NAME left-shifted the response to phenylephrine more in untreated than in lead-treated rats. Apocynin and indomethacin decreased more the response to phenylephrine in treated than in untreated rats. Aortic protein expression of gp91(phox), Cu/Zn-SOD, Mn-SOD and COX-2 increased after lead exposure. In cultured VSMCs lead 1) increased superoxide anion production, NADPH oxidase activity and gene and/or protein levels of NOX-1, NOX-4, Mn-SOD, EC-SOD and COX-2 and 2) activated ERK1/2 and p38 MAPK. Both antioxidants and COX-2 inhibitors normalized superoxide anion production, NADPH oxidase activity and mRNA levels of NOX-1, NOX-4 and COX-2. Blockade of the ERK1/2 and p38 signaling pathways abolished lead-induced NOX-1, NOX-4 and COX-2 expression. Results show that lead activation of the MAPK signaling pathways activates inflammatory proteins such as NADPH oxidase and COX-2, suggesting a reciprocal interplay and contribution to vascular dysfunction as an underlying mechanisms for lead-induced hypertension. - Highlights: • Lead-exposure increases oxidative stress, COX-2 expression and vascular reactivity. • Lead exposure activates MAPK signaling pathway. • ROS and COX-2 activation by MAPK in lead exposure • Relationship between vascular ROS and COX-2 products in lead exposure.« less

Magnesium and calcium-enriched deep-sea water promotes mitochondrial biogenesis by AMPK-activated signals pathway in 3T3-L1 preadipocytes.

PubMed

Ha, Byung Geun; Moon, Deok-Soo; Kim, Hyeon Ju; Shon, Yun Hee

2016-10-01

Recent studies showed that deficiencies of essential minerals including Mg, Ca, and K, and trace minerals including Se, Zn, and V, have implications for the development, prevention, and treatment of several chronic diseases including obesity and type 2 diabetes. Our previous studies revealed that balanced deep-sea water (BDSW), which is composed of desalinated water enriched with Mg and Ca, has potential as a treatment for diabetes and obesity. In this study, to determine whether BDSW regulates mitochondrial biogenesis and function, we investigated its effects on mitochondrial DNA (mtDNA) content, mitochondrial enzyme activity, expression of key transcription factors and mitochondria-specific genes, phosphorylation of signaling molecules associated with mitochondrial biogenesis, and mitochondrial function in 3T3-L1 preadipocytes. BDSW increased mitochondrial biogenesis in a dose-dependent manner. Quantitative real-time PCR revealed that BDSW enhances expression of PGC1-α, NRF1, and TFAM genes. Upregulation of these genes was supported by increased mitochondria staining, CytC oxidase activity, and AMPK phosphorylation. The stimulatory effect of BDSW on mitochondrial biogenesis and function suggests a novel mechanism for BDSW-induced anti-diabetic and anti-obesity action. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Mitogenomes from type specimens, a genotyping tool for morphologically simple species: ten genomes of agar-producing red algae.

PubMed

Boo, Ga Hun; Hughey, Jeffery R; Miller, Kathy Ann; Boo, Sung Min

2016-10-14

DNA sequences from type specimens provide independent, objective characters that enhance the value of type specimens and permit the correct application of species names to phylogenetic clades and specimens. We provide mitochondrial genomes (mitogenomes) from archival type specimens of ten species in agar-producing red algal genera Gelidium and Pterocladiella. The genomes contain 43-44 genes, ranging in size from 24,910 to 24,970 bp with highly conserved gene synteny. Low Ka/Ks ratios of apocytochrome b and cytochrome oxidase genes support their utility as markers. Phylogenies of mitogenomes and cox1+rbcL sequences clarified classification at the genus and species levels. Three species formerly in Gelidium and Pterocladia are transferred to Pterocladiella: P. media comb. nov., P. musciformis comb. nov., and P. luxurians comb. and stat. nov. Gelidium sinicola is merged with G. coulteri because they share identical cox1 and rbcL sequences. We describe a new species, Gelidium millariana sp. nov., previously identified as G. isabelae from Australia. We demonstrate that mitogenomes from type specimens provide a new tool for typifying species in the Gelidiales and that there is an urgent need for analyzing mitogenomes from type specimens of red algae and other morphologically simple organisms for insight into their nomenclature, taxonomy and evolution.

Mitogenomes from type specimens, a genotyping tool for morphologically simple species: ten genomes of agar-producing red algae

PubMed Central

Boo, Ga Hun; Hughey, Jeffery R.; Miller, Kathy Ann; Boo, Sung Min

2016-01-01

DNA sequences from type specimens provide independent, objective characters that enhance the value of type specimens and permit the correct application of species names to phylogenetic clades and specimens. We provide mitochondrial genomes (mitogenomes) from archival type specimens of ten species in agar-producing red algal genera Gelidium and Pterocladiella. The genomes contain 43–44 genes, ranging in size from 24,910 to 24,970 bp with highly conserved gene synteny. Low Ka/Ks ratios of apocytochrome b and cytochrome oxidase genes support their utility as markers. Phylogenies of mitogenomes and cox1+rbcL sequences clarified classification at the genus and species levels. Three species formerly in Gelidium and Pterocladia are transferred to Pterocladiella: P. media comb. nov., P. musciformis comb. nov., and P. luxurians comb. and stat. nov. Gelidium sinicola is merged with G. coulteri because they share identical cox1 and rbcL sequences. We describe a new species, Gelidium millariana sp. nov., previously identified as G. isabelae from Australia. We demonstrate that mitogenomes from type specimens provide a new tool for typifying species in the Gelidiales and that there is an urgent need for analyzing mitogenomes from type specimens of red algae and other morphologically simple organisms for insight into their nomenclature, taxonomy and evolution. PMID:27739454

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

Vascular oxidative stress and endothelial dysfunction in patients with chronic heart failure: role of xanthine-oxidase and extracellular superoxide dismutase.

PubMed

Landmesser, Ulf; Spiekermann, Stephan; Dikalov, Sergey; Tatge, Helma; Wilke, Ragna; Kohler, Christoph; Harrison, David G; Hornig, Burkhard; Drexler, Helmut

2002-12-10

Impaired flow-dependent, endothelium-mediated vasodilation (FDD) in patients with chronic heart failure (CHF) results, at least in part, from accelerated degradation of nitric oxide by oxygen radicals. The mechanisms leading to increased vascular radical formation, however, remain unclear. Therefore, we determined endothelium-bound activities of extracellular superoxide dismutase (ecSOD), a major vascular antioxidant enzyme, and xanthine-oxidase, a potent radical producing enzyme, and their relation to FDD in patients with CHF. ecSOD and xanthine-oxidase activities, released from endothelium into plasma by heparin bolus injection, were determined in 14 patients with CHF and 10 control subjects. FDD of the radial artery was measured using high-resolution ultrasound and was assessed before and after administration of the antioxidant vitamin C (25 mg/min; IA). In patients with CHF, endothelium-bound ecSOD activity was substantially reduced (5.0+/-0.7 versus 14.4+/-2.6 U x mL(-1) x min(-1); P<0.01) and closely related to FDD (r=0.61). Endothelium-bound xanthine-oxidase activity was increased by >200% (38+/-10 versus 12+/-4 nmol O2*- x microL(-1); P<0.05) and inversely related to FDD (r=-0.35) in patients with CHF. In patients with low ecSOD and high xanthine-oxidase activity, a greater benefit of vitamin C on FDD was observed, ie, the portion of FDD inhibited by radicals correlated negatively with ecSOD (r=-0.71) but positively with xanthine-oxidase (r=0.75). These results demonstrate that both increased xanthine-oxidase and reduced ecSOD activity are closely associated with increased vascular oxidative stress in patients with CHF. This loss of vascular oxidative balance likely represents a novel mechanism contributing to endothelial dysfunction in CHF.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

PubMed

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

PubMed Central

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

PubMed

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Treesearch

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Heterologous pathway for the production of L-phenylglycine from glucose by E. coli.

PubMed

Liu, Shuang Ping; Liu, Rui Xia; El-Rotail, Ashraf A M M; Ding, Zhong Yang; Gu, Zheng Hua; Zhang, Liang; Shi, Gui Yang

2014-09-30

The aproteinogenic amino acid L-phenylglycine (L-Phg) is an important side chain building block for the preparation of several antibiotics and taxol. To biosynthesis L-Phg from glucose, an engineered Escherichia coli containing L-Phg synthetic genes was firstly developed by an L-phenylalanine producing chassis supplying phenylpyruvate. The enzymes HmaS (L-4-hydroxymandelate synthase), Hmo (L-4-hydroxymandelate oxidase) and HpgT (L-4-hydroxyphenylglycine transaminase) from Amycolatopsis orientalis as well as Streptomyces coelicolor were heterologously expressed in E. coli and purified to evaluate their abilities on L-Phg formation. HpgT conversing phenylglyoxylate to L-Phg uses an unusual amino donor L-phenylalanine, which releases another phenylpyruvate as the substrate of HmaS. Thus, a recycle reaction was developed to maximize the utilization of precursor phenylpyruvate. To amplify the accumulation of L-Phg, the effects of attenuating L-phenylalanine transamination was investigated. After deletion of tyrB and aspC, L-Phg yield increased by 12.6-fold. The limiting step in the L-Phg biosynthesis was also studied; the L-Phg yield was further improved by 14.9-fold after enhancing hmaS expression. Finally, by optimizing expression of hmaS, hmo and hpgT and attenuation of L-phenylalanine transamination, the L-Phg yield was increased by 224-fold comparing with the original strain. Copyright © 2014 Elsevier B.V. All rights reserved.

Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

PubMed

Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

2015-01-01

Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other advanced nanosystem based on directed nucleic acid assemblies, polyamine-induced DNA condensation, and bovine serum amine oxidase may be proposed for futuristic anticancer therapy utilizing nucleic acids, polyamines and BSAO. BSAO based nanoparticles can be employed for the generation of cytotoxic polyamine metabolites.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

PubMed Central

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiser, C.; Herdies, L.; McIntosh, L.

Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate themore » equivalent gene from potato and to examine its expression.« less

Thermodynamic and NMR analyses of NADPH binding to lipocalin-type prostaglandin D synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Shubin; Shimamoto, Shigeru; Maruno, Takahiro

2015-12-04

Lipocalin-type prostaglandin D synthase (L-PGDS) is one of the most abundant proteins in human cerebrospinal fluid (CSF) with dual functions as a prostaglandin D{sub 2} (PGD{sub 2}) synthase and a transporter of lipophilic ligands. Recent studies revealed that L-PGDS plays important roles in protecting against various neuronal diseases induced by reactive oxygen species (ROS). However, the molecular mechanisms of such protective actions of L-PGDS remain unknown. In this study, we conducted thermodynamic and nuclear magnetic resonance (NMR) analyses, and demonstrated that L-PGDS binds to nicotinamide coenzymes, including NADPH, NADP{sup +}, and NADH. Although a hydrophilic ligand is not common formore » L-PGDS, these ligands, especially NADPH showed specific interaction with L-PGDS at the upper pocket of its ligand-binding cavity with an unusually bifurcated shape. The binding affinity of L-PGDS for NADPH was comparable to that previously reported for NADPH oxidases and NADPH in vitro. These results suggested that L-PGDS potentially attenuates the activities of NADPH oxidases through interaction with NADPH. Given that NADPH is the substrate for NADPH oxidases that play key roles in neuronal cell death by generating excessive ROS, these results imply a novel linkage between L-PGDS and ROS. - Highlights: • Interactions of L-PGDS with nicotinamide coenzymes were studied by ITC and NMR. • The binding affinity of L-PGDS was strongest to NADPH among nicotinamide coenzymes. • NADPH binds to the upper part of L-PGDS ligand-binding cavity. • L-PGDS binds to both lipophilic and hydrophilic ligands. • This study implies a novel linkage between L-PGDS and reactive oxygen species.« less

Mediated effect of ultrasound treated Diclofenac on mussel hemocytes: First evidence for the involvement of respiratory burst enzymes in the induction of DCF-mediated unspecific mode of action.

PubMed

Toufexi, Eirini; Dailianis, Stefanos; Vlastos, Dimitris; Manariotis, Ioannis D

2016-06-01

The present study investigates the toxic behavior of diclofenac (DCF) before and after its ultrasound (US) treatment, as well as the involvement of intracellular target molecules, such as NADPH oxidase and NO synthase, in the DCF-induced adverse effects on hemocytes of mussel Mytilus galloprovincialis. In this context, appropriate volumes (350 and 500mL) of DCF solutions (at concentrations of 2, 2.5, 5 and 10mgL(-1)) were treated under different ultrasound operating conditions (frequency at 582 and 862kHz, electric power density at 133 and 167W) for assessing US method efficiency. In parallel, DCF and US DCF-mediated cytotoxic (in terms of cell viability measured with the use of neutral red uptake/NRU method), oxidative (in terms of superoxide anions/(.)O2(-), nitric oxides such as NO2(-) and lipid peroxidation products, such as malondialdehyde/MDA content) and genotoxic (DNA damage measured by the use of Comet assay method) effects were investigated in hemocytes exposed for 1h to 5, 10 and 100ngL(-1) and 1, 10 and 20μgL(-1) of DCF. The involvement of NADPH oxidase and NO synthase to the DCF-induced toxicity was further investigated by the use of 10μΜ L-NAME, a NO synthase inhibitor and 10μΜ DPI, a NADPH oxidase inhibitor. According to the results, 350mL of 2mgL(-1) DCF showed higher degradation (>50%) under 167W electric power density and frequency at 862kHz for 120min, compared to degradation in all other cases, followed by a significant elimination of its toxicity. Specifically, US DCF-treated hemocytes showed a significant attenuation of DCF-mediated cytotoxic, oxidative and genotoxic effects, which appeared to be caused by NADPH oxidase and NO synthase activation, since their inhibition was followed by a significant elimination of (.)O2(-) and NO2(-) generation and the concomitant oxidative damage within cells. The results of the present study showed for the first time that unspecific mode of action of DCF, associated with the induction of NADPH oxidase and NO synthase in mussel hemocytes, could be significantly diminished after partial US degradation of DCF, at least under optimized operating conditions currently tested. Copyright © 2016 Elsevier B.V. All rights reserved.

Sites and Regulation of Polyamine Catabolism in the Tobacco Plant. Correlations with Cell Division/Expansion, Cell Cycle Progression, and Vascular Development1

PubMed Central

Paschalidis, Konstantinos A.; Roubelakis-Angelakis, Kalliopi A.

2005-01-01

We previously gave a picture of the homeostatic characteristics of polyamine (PA) biosynthesis and conjugation in tobacco (Nicotiana tabacum) plant organs during development. In this work, we present the sites and regulation of PA catabolism related to cell division/expansion, cell cycle progression, and vascular development in the tobacco plant. Diamine oxidase (DAO), PA oxidase (PAO), peroxidases (POXs), and putrescine N-methyltransferase expressions follow temporally and spatially discrete patterns in shoot apical cells, leaves (apical, peripheral, and central regions), acropetal and basipetal petiole regions, internodes, and young and old roots in developing plants. DAO and PAO produce hydrogen peroxide, a plant signal molecule and substrate for POXs. Gene expression and immunohistochemistry analyses reveal that amine oxidases in developing tobacco tissues precede and overlap with nascent nuclear DNA and also with POXs and lignification. In mature and old tissues, flow cytometry indicates that amine oxidase and POX activities, as well as pao gene and PAO protein levels, coincide with G2 nuclear phase and endoreduplication. In young versus the older roots, amine oxidases and POX expression decrease with parallel inhibition of G2 advance and endoreduplication, whereas putrescine N-methyltransferase dramatically increases. In both hypergeous and hypogeous tissues, DAO and PAO expression occurs in cells destined to undergo lignification, suggesting a different in situ localization. DNA synthesis early in development and the advance in cell cycle/endocycle are temporally and spatially related to PA catabolism and vascular development. PMID:16040649

Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans

PubMed Central

Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen

2013-01-01

The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

Phylogeographical structure in mitochondrial DNA of eggplant fruit and shoot borer, Leucinodes orbonalis Guenée (Lepidoptera: Crambidae) in South and Southeast Asia.

PubMed

Chang, Jian-Cheng; Ponnath, Daniel W; Ramasamy, Srinivasan

2016-01-01

Leucinodes orbonalis is the most detrimental South and Southeast Asian insect pest of eggplant. To help reduce the impact of this pest, population genetic diversity and structure of L. orbonalis were examined in eight populations from six countries using mitochondrial cytochrome c oxidase subunit I DNA sequences. No correlation between genetic diversity and geographic distance was detected among populations. Low levels of haplotype and nucleotide diversities were observed in the Philippines population, suggesting recent colonization. No significant gene flow was found among local populations in different countries. The Vietnam population is highly differentiated, indicated by significant pairwise FST values, and may be ascribed to a new subspecies or race. India was confirmed to be the source of genetic variation in L. orbonalis populations. Our study showed that L. orbonalis formed subpopulations for each local region, and the corresponding pest management technology should be developed at the country scale.

In vitro effects of Blepharocalyx salicifolius (H.B.K.) O. Berg on the viability of Echinococcus ortleppi protoscoleces.

PubMed

Noal, Charlise Bolson; Monteiro, Danieli Urach; Brum, Thiele Faccim de; Emmanouilidis, Jessica; Zanette, Regis Adriel; Morel, Ademir Farias; Stefanon, Eliza Beti de Cassia; Frosi, Marina; la Rue, Mario Luiz de

2017-01-01

Scolicidal agents are important in the treatment of cystic echinococcosis. This study evaluated the scolicidal activity of the plant Blepharocalyx salicifolius (H.B.K.) Berg against Echinococcus ortleppi protoscoleces. The parasite species was identified by amplifying a fragment of the gene cytochrome c oxidase subunit 1 (COX 1). B. salicifolius crude extract at concentrations of 100, 200, 300 and 400 mg/mL was analyzed at different times (5, 10, 15, 30, 45 and 60 min). N-butanol and ethyl acetate fractions (100 and 200 mg/ mL) were also analyzed at 5, 10, 15 and 30 min. Both fractions showed 100% scolicidal activity at the concentration of 200 mg/mL at 5 min. Gallic acid, identified as the major compound of the ethyl acetate fraction- was responsible for the observed scolicidal activity. The results showed that crude extract and fractions of B. salicifolius have scolicidal effect against E. ortleppi protoscoleces.

Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

PubMed Central

Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

2017-01-01

Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

Identification of genes differentially expressed in B16 murine melanoma sublines with different metastatic potentials.

PubMed

Ishiguro, T; Nakajima, M; Naito, M; Muto, T; Tsuruo, T

1996-02-15

B16-F10 and B16-BL6 are B16 mouse melanoma sublines that preferentially metastasize to the lung following i.v. and s.c. injections, respectively. To study molecular mechanisms underlying the different metastatic behaviors exhibited by the B16 melanoma sublines, we performed differential hybridization of the genes transcribed in these cells and compared their expression levels. We isolated four genes that were highly expressed in B16-F10 cells but not in B16-BL6 cells: TI-225 (polyubiquitin), TI-229 (pyruvate kinase), TI-241 (LRF-1 homologue), and TI-227 (novel gene). Triosephosphate isomerase, 10-formyltetrahydrofolate dehydrogenase, tyrosinase-related protein 2, cytochrome c oxidase, ATP synthetase alpha subunit, RNA helicase, and ribosomal protein (L37, J1, acidic phosphoprotein), however, showed higher expression in B16-BL6 cells than in B16-F10 cells. Among these clones, transfection of TI-241 into the low metastatic clone F1 converted the parental cells from low- into high-metastatic cells. TI-241 may regulate the expression of various genes as a transcription factor in the complex process of metastasis.

Delayed inflammatory mRNA and protein expression after spinal cord injury

PubMed Central

2011-01-01

Background Spinal cord injury (SCI) induces secondary tissue damage that is associated with inflammation. We have previously demonstrated that inflammation-related gene expression after SCI occurs in two waves - an initial cluster that is acutely and transiently up-regulated within 24 hours, and a more delayed cluster that peaks between 72 hours and 7 days. Here we extend the microarray analysis of these gene clusters up to 6 months post-SCI. Methods Adult male rats were subjected to mild, moderate or severe spinal cord contusion injury at T9 using a well-characterized weight-drop model. Tissue from the lesion epicenter was obtained 4 hours, 24 hours, 7 days, 28 days, 3 months or 6 months post-injury and processed for microarray analysis and protein expression. Results Anchor gene analysis using C1qB revealed a cluster of genes that showed elevated expression through 6 months post-injury, including galectin-3, p22PHOX, gp91PHOX, CD53 and progranulin. The expression of these genes occurred primarily in microglia/macrophage cells and was confirmed at the protein level using both immunohistochemistry and western blotting. As p22PHOX and gp91PHOX are components of the NADPH oxidase enzyme, enzymatic activity and its role in SCI were assessed and NADPH oxidase activity was found to be significantly up-regulated through 6 months post-injury. Further, treating rats with the nonspecific, irreversible NADPH oxidase inhibitor diphenylene iodinium (DPI) reduced both lesion volume and expression of chronic gene cluster proteins one month after trauma. Conclusions These data demonstrate that inflammation-related genes are chronically up-regulated after SCI and may contribute to further tissue loss. PMID:21975064

Importance of NADPH oxidase-mediated redox signaling in the detrimental effect of CRP on pancreatic insulin secretion.

PubMed

Chan, Pei-Chi; Wang, Ya-Chin; Chen, Yi-Ling; Hsu, Wan-Ning; Tian, Yu-Feng; Hsieh, Po-Shiuan

2017-11-01

Elevations in C-reactive protein (CRP) levels are positively correlated with the progress of type 2 diabetes mellitus. However, the effect of CRP on pancreatic insulin secretion is unknown. Here, we showed that purified human CRP impaired insulin secretion in isolated mouse islets and NIT-1 insulin-secreting cells in dose- and time-dependent manners. CRP increased NADPH oxidase-mediated ROS (reactive oxygen species) production, which simultaneously promoted the production of nitrotyrosine (an indicator of RNS, reactive nitrogen species) and TNFα, to diminish cell viability, insulin secretion in islets and insulin-secreting cells. These CRP-mediated detrimental effects on cell viability and insulin secretion were significantly reversed by adding NAC (a potent antioxidant), apocynin (a selective NADPH oxidase inhibitor), L-NAME (a non-selective nitric oxide synthase (NOS) inhibitor), aminoguanidine (a selective iNOS inhibitor), PDTC (a selective NFκB inhibitor) or Enbrel (an anti-TNFα fusion protein). However, CRP-induced ROS production failed to change after adding L-NAME, aminoguanidine or PDTC. In isolated islets and NIT-1 cells, the elevated nitrotyrosine contents by CRP pretreatment were significantly suppressed by adding L-NAME but not PDTC. Conversely, CRP-induced increases in TNF-α production were significantly reversed by administration of PDTC but not L-NAME. In addition, wild-type mice treated with purified human CRP showed significant decreases in the insulin secretion index (HOMA-β cells) and the insulin stimulation index in isolated islets that were reversed by the addition of L-NAME, aminoguanidine or NAC. It is suggested that CRP-activated NADPH-oxidase redox signaling triggers iNOS-mediated RNS and NFκB-mediated proinflammatory cytokine production to cause β cell damage in state of inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.

Putrescine differently influences the effect of salt stress on polyamine metabolism and ethylene synthesis in rice cultivars differing in salt resistance

PubMed Central

Quinet, Muriel; Lefèvre, Isabelle; Lambillotte, Béatrice; Dupont-Gillain, Christine C.; Lutts, Stanley

2010-01-01

Effects of salt stress on polyamine metabolism and ethylene production were examined in two rice (Oryza sativa L.) cultivars [I Kong Pao (IKP), salt sensitive; and Pokkali, salt resistant] grown for 5 d and 12 d in nutrient solution in the presence or absence of putrescine (1 mM) and 0, 50, and 100 mM NaCl. The salt-sensitive (IKP) and salt-resistant (Pokkali) cultivars differ not only in their mean levels of putrescine, but also in the physiological functions assumed by this molecule in stressed tissues. Salt stress increased the proportion of conjugated putrescine in salt-resistant Pokkali and decreased it in the salt-sensitive IKP, suggesting a possible protective function in response to NaCl. Activities of the enzymes ornithine decarboxylase (ODC; EC 4.1.1.17) and arginine decarboxylase (ADC; EC 4.1.1.19) involved in putrescine synthesis were higher in salt-resistant Pokkali than in salt-sensitive IKP. Both enzymes were involved in the response to salt stress. Salt stress also increased diamine oxidase (DAO; 1.4.3.6) and polyamine oxidase (PAO EC 1.5.3.11) activities in the roots of salt-resistant Pokkali and in the shoots of salt-sensitive IKP. Gene expression followed by reverse transcription-PCR suggested that putrescine could have a post-translational impact on genes coding for ADC (ADCa) and ODC (ODCa and ODCb) but could induce a transcriptional activation of genes coding for PAO (PAOb) mainly in the shoot of salt-stressed plants. The salt-resistant cultivar Pokkali produced higher amounts of ethylene than the salt-sensitive cultivar IKP, and exogenous putrescine increased ethylene synthesis in both cultivars, suggesting no direct antagonism between polyamine and ethylene pathways in rice. PMID:20472577

A Novel Gene, OZONE-RESPONSIVE APOPLASTIC PROTEIN1, Enhances Cell Death in Ozone Stress in Rice1

PubMed Central

Ueda, Yoshiaki; Siddique, Shahid; Frei, Michael

2015-01-01

A novel protein, OZONE-RESPONSIVE APOPLASTIC PROTEIN1 (OsORAP1), was characterized, which was previously suggested as a candidate gene underlying OzT9, a quantitative trait locus for ozone stress tolerance in rice (Oryza sativa). The sequence of OsORAP1 was similar to that of ASCORBATE OXIDASE (AO) proteins. It was localized in the apoplast, as shown by transient expression of an OsORAP1/green fluorescent protein fusion construct in Nicotiana benthamiana leaf epidermal and mesophyll cells, but did not possess AO activity, as shown by heterologous expression of OsORAP1 in Arabidopsis (Arabidopsis thaliana) mutants with reduced background AO activity. A knockout rice line of OsORAP1 showed enhanced tolerance to ozone stress (120 nL L−1 average daytime concentration, 20 d), as demonstrated by less formation of leaf visible symptoms (i.e. cell death), less lipid peroxidation, and lower NADPH oxidase activity, indicating reduced active production of reactive oxygen species. In contrast, the effect of ozone on chlorophyll content was not significantly different among the lines. These observations suggested that OsORAP1 specifically induced cell death in ozone stress. Significantly enhanced expression of jasmonic acid-responsive genes in the knockout line implied the involvement of the jasmonic acid pathway in symptom mitigation. Sequence analysis revealed extensive polymorphisms in the promoter region of OsORAP1 between the ozone-susceptible cv Nipponbare and the ozone-tolerant cv Kasalath, the OzT9 donor variety, which could be responsible for the differential regulation of OsORAP1 reported earlier. These pieces of evidence suggested that OsORAP1 enhanced cell death in ozone stress, and its expression levels could explain the effect of a previously reported quantitative trait locus. PMID:26220952

Isolated sulfite oxidase deficiency.

PubMed

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Molecular-clinical correlation in a family with a novel heteroplasmic Leigh syndrome missense mutation in the mitochondrial cytochrome c oxidase III gene.

PubMed

Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza

2011-01-01

Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.

Screening of Bothrops snake venoms for L-amino acid oxidase activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pessati, M.L.; Fontana, J.D.; Guimaraes, M.F.

1995-12-31

Toxins, enzymes, and biologically active peptides are the main components of snake venoms from the genus Bothrops. Following the venom inoculation, the local effects are hemorrhage, edema, and myonecrosis. Nineteen different species of Brazilian Bothrops were screened for protein content and L-amino acid oxidase activity. B. cotiara, formerly found in the South of Brazil, is now threatened with extinction. Its venom contains a highly hemorrhagic fraction and, as expected from the deep yellow color of the corresponding lyophilized powder, a high L-amino acid oxidase (LAO) activity was also characterized. Flavin adenine dinucleotide (FAD) is its associate coenzyme. B. cotiara venommore » LAO catalyzed the oxidative deamination of several L-amino acids, and the best substrates were methionine, leucine, tryptophan, and phenylalanine, hence, its potential application for the use in biosensors for aspartame determination and for the removal of amino acids from plasma. High levels for LAO were also found in other species than B. cotiara. In addition, the technique of isoelectric focusing (IEF) was employed as a powerful tool to study the iso- or multi-enzyme distribution for LAO activity in the B. cotiara snake venom.« less

Mechanism of resistance to cyhalofop-butyl in Chinese sprangletop (Leptochloa chinensis (L.) Nees).

PubMed

Yu, Jiaxing; Gao, Haitao; Pan, Lang; Yao, Zhenwei; Dong, Liyao

2017-11-01

Chinese sprangletop (Leptochloa chinensis (L.) Nees) is a serious grass weed in rice paddies. In some areas, L. chinensis has become resistant to the herbicide cyhalofop-butyl because of its frequent and extensive use over the past five years. In this study, whole-plant dose-response assays were conducted, and a L. chinensis population (ZHYH) had a 75.8-fold resistance index to cyhalofop-butyl. Molecular analyses revealed that this resistance was attributed to a tryptophan (Trp)-2027-to-cysteine (Cys) substitution in the CT domain of the ACCase gene. To our knowledge, this is the first report revealing the mechanism underlying cyhalofop-butyl resistance in L. chinensis. Furthermore, a derived cleaved amplified polymorphic (dCAPS) assay was developed to rapidly detect the Trp-2027-Cys mutation. Of the 100 ZHYH plants analyzed, 52 were heterozygous mutants and 48 were susceptible homozygous plants. In addition, the cyhalofop-butyl-resistant L. chinensis was cross-resistant to aryloxyphenoxypropionate and phenylpyrazoline herbicides, but not to cyclohexanedione, acetolactate synthase-inhibiting, protoporphyrinogen oxidase, and urea herbicides, and had only slight resistance to the hormonal herbicide quinclorac. Copyright © 2016 Elsevier Inc. All rights reserved.

Genomes of ubiquitous marine and hypersaline Hydrogenovibrio, Thiomicrorhabdus and Thiomicrospira spp. encode a diversity of mechanisms to sustain chemolithoautotrophy in heterogeneous environments.

PubMed

Scott, Kathleen M; Williams, John; Porter, Cody M B; Russel, Sydney; Harmer, Tara L; Paul, John H; Antonen, Kirsten M; Bridges, Megan K; Camper, Gary J; Campla, Christie K; Casella, Leila G; Chase, Eva; Conrad, James W; Cruz, Mercedez C; Dunlap, Darren S; Duran, Laura; Fahsbender, Elizabeth M; Goldsmith, Dawn B; Keeley, Ryan F; Kondoff, Matthew R; Kussy, Breanna I; Lane, Marannda K; Lawler, Stephanie; Leigh, Brittany A; Lewis, Courtney; Lostal, Lygia M; Marking, Devon; Mancera, Paola A; McClenthan, Evan C; McIntyre, Emily A; Mine, Jessica A; Modi, Swapnil; Moore, Brittney D; Morgan, William A; Nelson, Kaleigh M; Nguyen, Kimmy N; Ogburn, Nicholas; Parrino, David G; Pedapudi, Anangamanjari D; Pelham, Rebecca P; Preece, Amanda M; Rampersad, Elizabeth A; Richardson, Jason C; Rodgers, Christina M; Schaffer, Brent L; Sheridan, Nancy E; Solone, Michael R; Staley, Zachery R; Tabuchi, Maki; Waide, Ramond J; Wanjugi, Pauline W; Young, Suzanne; Clum, Alicia; Daum, Chris; Huntemann, Marcel; Ivanova, Natalia; Kyrpides, Nikos; Mikhailova, Natalia; Palaniappan, Krishnaveni; Pillay, Manoj; Reddy, T B K; Shapiro, Nicole; Stamatis, Dimitrios; Varghese, Neha; Woyke, Tanja; Boden, Rich; Freyermuth, Sharyn K; Kerfeld, Cheryl A

2018-03-09

Chemolithoautotrophic bacteria from the genera Hydrogenovibrio, Thiomicrorhabdus and Thiomicrospira are common, sometimes dominant, isolates from sulfidic habitats including hydrothermal vents, soda and salt lakes and marine sediments. Their genome sequences confirm their membership in a deeply branching clade of the Gammaproteobacteria. Several adaptations to heterogeneous habitats are apparent. Their genomes include large numbers of genes for sensing and responding to their environment (EAL- and GGDEF-domain proteins and methyl-accepting chemotaxis proteins) despite their small sizes (2.1-3.1 Mbp). An array of sulfur-oxidizing complexes are encoded, likely to facilitate these organisms' use of multiple forms of reduced sulfur as electron donors. Hydrogenase genes are present in some taxa, including group 1d and 2b hydrogenases in Hydrogenovibrio marinus and H. thermophilus MA2-6, acquired via horizontal gene transfer. In addition to high-affinity cbb 3 cytochrome c oxidase, some also encode cytochrome bd-type quinol oxidase or ba 3 -type cytochrome c oxidase, which could facilitate growth under different oxygen tensions, or maintain redox balance. Carboxysome operons are present in most, with genes downstream encoding transporters from four evolutionarily distinct families, which may act with the carboxysomes to form CO 2 concentrating mechanisms. These adaptations to habitat variability likely contribute to the cosmopolitan distribution of these organisms. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

BdBRD1, a brassinosteroid C-6 oxidase homolog in Brachypodium distachyon L., is required for multiple organ development.

PubMed

Xu, Yi; Zhang, Xia; Li, Qi; Cheng, Zhiyuan; Lou, Haijuan; Ge, Lei; An, Hailong

2015-01-01

Brassinosteroids (BRs), known as a kind of phytohormones, play essential roles in plant growth and development. Although the studies on the BR biosynthesis and signaling are extensive in Arabidopsis, little is known in temperate cereals. In this study, bdbrd1-1, a T-DNA insertion mutant from Brachypodium distachyon, was isolated and characterized in details. The bdbrd1-1 mutant showed lots of cellular and morphogenetic defects, including shortened cell shapes, severe dwarfing, twisted leaves and sterile spikes. Sequencing the flanking fragment of the T-DNA and complementation by genomic DNA in the mutant, confirmed that the developmental defects are caused by the T-DNA insertion in BdBRD1, a possible brassinosteroid C-6 oxidase gene. Application of 24-epicastasterone could partly rescue the bdbrd1-1 dwarfing phenotype. Expression analysis of BdBRD1 suggested that bdbrd1-1 is probably a null mutant and its wild type transcript is expressed in various tissues and highest in the leaf sheaths. Meanwhile, measurements on leaf numbers of the main stems or days to the emergence of the inflorescences suggested that bdbrd1-1 is late-flowering. The late-flowering phenotype could be converted by vernalization treatment, although there lacks a typical FLC gene in B. distachyon. The current data provide an insight into the relationship between BRs biosynthesis and individual development in B. distachyon, an emerging model plant for the temperate cereals. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Ozone-Sensitive Arabidopsis Mutants with Deficiencies in Photorespiratory Enzymes.

PubMed

Saji, Shoko; Bathula, Srinivas; Kubo, Akihiro; Tamaoki, Masanori; Aono, Mitsuko; Sano, Tomoharu; Tobe, Kazuo; Timm, Stefan; Bauwe, Hermann; Nakajima, Nobuyoshi; Saji, Hikaru

2017-05-01

An ozone-sensitive mutant was isolated from T-DNA-tagged lines of Arabidopsis thaliana. The T-DNA was inserted at a locus on chromosome 3, where two genes encoding glycolate oxidases, GOX1 and GOX2, peroxisomal enzymes involved in photorespiration, reside contiguously. The amounts of the mutant's foliar transcripts for these genes were reduced, and glycolate oxidase activity was approximately 60% of that of the wild-type plants. No difference in growth and appearance was observed between the mutant and the wild-type plants under normal conditions with ambient air under a light intensity of 100 µmol photons m-2 s-1. However, signs of severe damage, such as chlorosis and ion leakage from the tissue, rapidly appeared in mutant leaves in response to ozone treatment at a concentration of 0.2 µl l-1 under a higher light intensity of 350 µmol photons m-2 s-1 that caused no such symptoms in the wild-type plant. The mutant also exhibited sensitivity to sulfur dioxide and long-term high-intensity light. Arabidopsis mutants with deficiencies in other photorespiratory enzymes such as glutamate:glyoxylate aminotransferase and hydroxypyruvate reductase also exhibited ozone sensitivities. Therefore, photorespiration appears to be involved in protection against photooxidative stress caused by ozone and other abiotic factors under high-intensity light. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Nitric Oxide and Hydrogen Peroxide Mediate Wounding-Induced Freezing Tolerance through Modifications in Photosystem and Antioxidant System in Wheat

PubMed Central

Si, Tong; Wang, Xiao; Wu, Lin; Zhao, Chunzhao; Zhang, Lini; Huang, Mei; Cai, Jian; Zhou, Qin; Dai, Tingbo; Zhu, Jian-Kang; Jiang, Dong

2017-01-01

Mechanical wounding is a common stress caused by herbivores or manual and natural manipulations, whereas its roles in acclimation response to a wide spectrum of abiotic stresses remain unclear. The present work showed that local mechanical wounding enhanced freezing tolerance in untreated systemic leaves of wheat plants (Triticum aestivum L.), and meanwhile the signal molecules hydrogen peroxide (H2O2) and nitric oxide (NO) were accumulated systemically. Pharmacological study showed that wounding-induced NO synthesis was substantially arrested by pretreatment with scavengers of reactive oxygen species and an inhibitor of NADPH oxidase (respiratory burst oxidase homolog, RBOH). On the contrary, wounding-induced H2O2 accumulation was not sensitive to NO synthetic inhibitors or scavenger, indicating that H2O2 acts upstream of NO in wounding signal transduction pathways. Cytochemical and vascular tissues localizations approved that RBOH-dependent H2O2 acts as long-distance signal in wounding response. Transcriptome analysis revealed that 279 genes were up-regulated in plants treated with wounding and freezing, but not in plants treated with freezing alone. Importantly, freezing- and wounding-induced genes were significantly enriched in the categories of “photosynthesis” and “signaling.” These results strongly supported that primary mechanical wounding can induce freezing tolerance in wheat through the systemic accumulation of NO and H2O2, and further modifications in photosystem and antioxidant system. PMID:28769973

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

PubMed Central

2014-01-01

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts. PMID:24618103

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

2014-03-11

Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts.

Increased Production of Hydrogen Peroxide by Lactobacillus delbrueckii subsp. bulgaricus upon Aeration: Involvement of an NADH Oxidase in Oxidative Stress

PubMed Central

Marty-Teysset, C.; de la Torre, F.; Garel, J.-R.

2000-01-01

The growth of Lactobacillus delbrueckii subsp. bulgaricus (L. delbrueckii subsp. bulgaricus) on lactose was altered upon aerating the cultures by agitation. Aeration caused the bacteria to enter early into stationary phase, thus reducing markedly the biomass production but without modifying the maximum growth rate. The early entry into stationary phase of aerated cultures was probably related to the accumulation of hydrogen peroxide in the medium. Indeed, the concentration of hydrogen peroxide in aerated cultures was two to three times higher than in unaerated ones. Also, a similar shift from exponential to stationary phase could be induced in unaerated cultures by adding increasing concentrations of hydrogen peroxide. A significant fraction of the hydrogen peroxide produced by L. delbrueckii subsp. bulgaricus originated from the reduction of molecular oxygen by NADH catalyzed by an NADH:H2O2 oxidase. The specific activity of this NADH oxidase was the same in aerated and unaerated cultures, suggesting that the amount of this enzyme was not directly regulated by oxygen. Aeration did not change the homolactic character of lactose fermentation by L. delbrueckii subsp. bulgaricus and most of the NADH was reoxidized by lactate dehydrogenase with pyruvate. This indicated that NADH oxidase had no (or a very small) energetic role and could be involved in eliminating oxygen. PMID:10618234

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

PubMed

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

PubMed Central

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

Characterization of two brassinosteroid C-6 oxidase genes in pea.

PubMed

Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

2007-04-01

C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Metabolic engineering of β-oxidation in Penicillium chrysogenum for improved semi-synthetic cephalosporin biosynthesis.

PubMed

Veiga, Tânia; Gombert, Andreas K; Landes, Nils; Verhoeven, Maarten D; Kiel, Jan A K W; Krikken, Arjen M; Nijland, Jeroen G; Touw, Hesselien; Luttik, Marijke A H; van der Toorn, John C; Driessen, Arnold J M; Bovenberg, Roel A L; van den Berg, Marco A; van der Klei, Ida J; Pronk, Jack T; Daran, Jean-Marc

2012-07-01

Industrial production of semi-synthetic cephalosporins by Penicillium chrysogenum requires supplementation of the growth media with the side-chain precursor adipic acid. In glucose-limited chemostat cultures of P. chrysogenum, up to 88% of the consumed adipic acid was not recovered in cephalosporin-related products, but used as an additional carbon and energy source for growth. This low efficiency of side-chain precursor incorporation provides an economic incentive for studying and engineering the metabolism of adipic acid in P. chrysogenum. Chemostat-based transcriptome analysis in the presence and absence of adipic acid confirmed that adipic acid metabolism in this fungus occurs via β-oxidation. A set of 52 adipate-responsive genes included six putative genes for acyl-CoA oxidases and dehydrogenases, enzymes responsible for the first step of β-oxidation. Subcellular localization of the differentially expressed acyl-CoA oxidases and dehydrogenases revealed that the oxidases were exclusively targeted to peroxisomes, while the dehydrogenases were found either in peroxisomes or in mitochondria. Deletion of the genes encoding the peroxisomal acyl-CoA oxidase Pc20g01800 and the mitochondrial acyl-CoA dehydrogenase Pc20g07920 resulted in a 1.6- and 3.7-fold increase in the production of the semi-synthetic cephalosporin intermediate adipoyl-6-APA, respectively. The deletion strains also showed reduced adipate consumption compared to the reference strain, indicating that engineering of the first step of β-oxidation successfully redirected a larger fraction of adipic acid towards cephalosporin biosynthesis. Copyright © 2012 Elsevier Inc. All rights reserved.

New biosensing platforms based on the layer-by-layer self-assembling of polyelectrolytes on Nafion/carbon nanotubes-coated glassy carbon electrodes.

PubMed

Rivas, Gustavo A; Miscoria, Silvia A; Desbrieres, Jacques; Barrera, Gustavo D

2007-01-15

We are proposing for the first time the use of a Nafion/multi-walled carbon nanotubes dispersion deposited on glassy carbon electrodes (GCE) as a new platform for developing enzymatic biosensors based on the self-assembling of a chitosan derivative and different oxidases. The electrodes are obtained by deposition of a layer of Nafion/multi-wall carbon nanotubes dispersion on glassy carbon electrodes, followed by the adsorption of a chitosan derivative as polycation and glucose oxidase, l-aminoacid oxidase or polyphenol oxidase, as polyanions and biorecognition elements. The optimum configuration for glucose biosensors has allowed a highly sensitive (sensitivity=(0.28+/-0.02)muAmM(-1), r=0.997), fast (4s in reaching the maximum response), and highly selective (0% interference of ascorbic acid and uric acid at maximum physiological levels) glucose quantification at 0.700V with detection and quantification limits of 0.035 and 0.107mM, respectively. The repetitivity for 10 measurements was 5.5%, while the reproducibility was 8.4% for eight electrodes. The potentiality of the new platform was clearly demonstrated by using the carbon nanotubes/Nafion layer as a platform for the self-assembling of l-aminoacid oxidase and polyphenol oxidase. Therefore, the platform we are proposing here, that combines the advantages of nanostructured materials with those of the layer-by-layer self-assembling of polyelectrolytes, opens the doors to new and exciting possibilities for the development of enzymatic and affinity biosensors using different transdution modes.

Polyphenol oxidase activity from three sicilian artichoke [ Cynara cardunculus L. Var. scolymus L. (Fiori)] cultivars: studies and technological application on minimally processed production.

PubMed

Todaro, Aldo; Peluso, Orazio; Catalano, Anna Eghle; Mauromicale, Giovanni; Spagna, Giovanni

2010-02-10

Several papers helped with the development of more methods to control browning, or study thermal polyphenol oxidase (PPO) inactivation, but did not provide any solutions to technological process problems and food process improvement. Artichokes [ Cynara cardunculus L. var. scolymus L. (Fiori)] are susceptible to browning; this alteration could affect and reduce the suitability for its use, fresh or processed. Within this study, the catecholase and cresolase activities of PPO from three different Sicilian artichokes cultivar were characterized with regard to substrate specificity and enzyme kinetics, optimum pH and temperature, temperature and pH stability, and inhibitor test; all of the results were used for technological purposes, particularly to optimize minimally processed productions (ready-to-eat and cook-chilled artichokes).

Co-expression of NCED and ALO improves vitamin C level and tolerance to drought and chilling in transgenic tobacco and stylo plants.

PubMed

Bao, Gegen; Zhuo, Chunliu; Qian, Chunmei; Xiao, Ting; Guo, Zhenfei; Lu, Shaoyun

2016-01-01

Abscisic acid (ABA) regulates plant adaptive responses to various environmental stresses, while L-ascorbic acid (AsA) that is also named vitamin C is an important antioxidant and involves in plant stress tolerance and the immune system in domestic animals. Transgenic tobacco (Nicotiana tabacum L.) and stylo [Stylosanthes guianensis (Aublet) Swartz], a forage legume, plants co-expressing stylo 9-cis-epoxycarotenoid dioxygenase (SgNCED1) and yeast D-arabinono-1,4-lactone oxidase (ALO) genes were generated in this study, and tolerance to drought and chilling was analysed in comparison with transgenic tobacco overexpressing SgNCED1 or ALO and the wild-type plants. Compared to the SgNCED1 or ALO transgenic plants, in which only ABA or AsA levels were increased, both ABA and AsA levels were increased in transgenic tobacco and stylo plants co-expressing SgNCED1 and ALO genes. Compared to the wild type, an enhanced drought tolerance was observed in SgNCED1 transgenic tobacco plants with induced expression of drought-responsive genes, but not in ALO plants, while an enhanced chilling tolerance was observed in ALO transgenic tobaccos with induced expression of cold-responsive genes, but not in SgNCED1 plants. Co-expression of SgNCED1 and ALO genes resulted in elevated tolerance to both drought and chilling in transgenic tobacco and stylo plants with induced expression of both drought and cold-responsive genes. Our result suggests that co-expression of SgNCED1 and ALO genes is an effective way for use in forage plant improvement for increased tolerance to drought and chilling and nutrition quality. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

In vitro antioxidant, lipoxygenase and xanthine oxidase inhibitory activities of fractions from Cienfuegosia digitata Cav., Sida alba L. and Sida acuta Burn f. (Malvaceae).

PubMed

Konaté, K; Souza, A; Coulibaly, A Y; Meda, N T R; Kiendrebeogo, M; Lamien-Meda, A; Millogo-Rasolodimby, J; Lamidi, M; Nacoulma, O G

2010-11-15

In this study polyphenol content, antioxidant activity, lipoxygenase (LOX) and Xanthine Oxidase (XO) inhibitory effects of n-hexane, dichloromethane, ethyl acetate and n-butanol fractions of aqueous acetone extracts from S. alba L., S. acuta Burn f and Cienfuegosia digitata Cav. were investigated. The total phenolics, flavonoids, flavonols and total tannins were determined by spectrophotometric methods using Folin-ciocalteu, AlCl3 reagents and tannic acid, respectively. The antioxidant potential was evaluated using three methods: inhibition of free radical 2,2-diphenyl-1-picrylhydramzyl (DPPH), ABTS radical cation decolorization assay and Iron (III) to iron (II) reduction activity (FRAP). For enzymatic activity, lipoxygenase and xanthine oxidase inhibitory activities were used. This study shows a relationship between polyphenol contents, antioxidant and enzymatic activities. Present results showed that ethyl acetate and dichloromethane fractions elicit the highest polyphenol content, antioxidant and enzymatic activities.

Polyphenol oxidase activity and differential accumulation of polyphenolics in seed coats of pinto bean (Phaseolus vulgaris L.) characterize postharvest color changes.

PubMed

Marles, M A Susan; Vandenberg, Albert; Bett, Kirstin E

2008-08-27

Postharvest darkening of pinto bean (Phaseolus vulgaris L.) was evaluated in a population of recombinant inbred lines derived from a cross between CDC Pintium (a regular-darkening line) and 1533-15 (a slow-darkening line). Flavonoid metabolite concentrations, polyphenol oxidase activity, lignin concentration, and seed coat anatomy characteristics were assessed for cosegregation with the darkening phenotype. Significantly lower kaempferol concentrations (p = 0.00001) together with differences in polyphenol oxidase activity (p = 0.0045) were two of the key findings associated with these recombinant inbred lines. In addition, two different assays (thioglycolic acid and Klason lignin) to quantify lignin together with an assessment of extractable condensed tannin were used to estimate the contribution of these polymers to changes in the seed coat tissue. This is the first report of precise biochemical characterization of polyphenolics that associate with postharvest darkening in legumes.

Enzymatic browning and biochemical alterations in black spots of pineapple [Ananas comosus (L.) Merr.].

PubMed

Avallone, Sylvie; Guiraud, Joseph-Pierre; Brillouet, Jean-Marc; Teisson, Claude

2003-08-01

Penicillium funiculosum Thom. was consistently isolated from pineapple-infected fruitlet (black spots). Polyphenol oxidase, peroxidase, and laccase activities were determined in extracts from contiguous and infected fruitlets. Healthy fruitlets showed a rather high level of polyphenol oxidase (optimum pH 7.0), and this activity was tremendously increased (X 10) in contiguous infected fruitlets. Furthermore, infected fruitlets also exhibited laccase activity (optimum pH 4.0), while peroxidase was rather constant in both fruitlets. Browning reactions were attributed to qualitative and quantitative modifications of the enzymatic equipment (polyphenol oxidase and laccase) (p < 0.0001). In infected fruiltets, sucrose and L-malic acid were present at significantly lower amounts than in healthy ones, likely owing to fungal metabolism (p < 0.0001), whereas cell wall material was three times higher, which could be viewed as a defense mechanism to limit expansion of the mycelium.

Jasmonic Acid Modulates the Physio-Biochemical Attributes, Antioxidant Enzyme Activity, and Gene Expression in Glycine max under Nickel Toxicity

PubMed Central

Sirhindi, Geetika; Mir, Mudaser Ahmad; Abd-Allah, Elsayed Fathi; Ahmad, Parvaiz; Gucel, Salih

2016-01-01

In present study, we evaluated the effects of Jasmonic acid (JA) on physio-biochemical attributes, antioxidant enzyme activity, and gene expression in soybean (Glycine max L.) plants subjected to nickel (Ni) stress. Ni stress decreases the shoot and root length and chlorophyll content by 37.23, 38.31, and 39.21%, respectively, over the control. However, application of JA was found to improve the chlorophyll content and length of shoot and root of Ni-fed seedlings. Plants supplemented with JA restores the chlorophyll fluorescence, which was disturbed by Ni stress. The present study demonstrated increase in proline, glycinebetaine, total protein, and total soluble sugar (TSS) by 33.09, 51.26, 22.58, and 49.15%, respectively, under Ni toxicity over the control. Addition of JA to Ni stressed plants further enhanced the above parameters. Ni stress increases hydrogen peroxide (H2O2) by 68.49%, lipid peroxidation (MDA) by 50.57% and NADPH oxidase by 50.92% over the control. Supplementation of JA minimizes the accumulation of H2O2, MDA, and NADPH oxidase, which helps in stabilization of biomolecules. The activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) increases by 40.04, 28.22, 48.53, and 56.79%, respectively, over the control in Ni treated seedlings and further enhancement in the antioxidant activity was observed by the application of JA. Ni treated soybean seedlings showed increase in expression of Fe-SOD by 77.62, CAT by 15.25, POD by 58.33, and APX by 80.58% over the control. Nevertheless, application of JA further enhanced the expression of the above genes in the present study. Our results signified that Ni stress caused negative impacts on soybean seedlings, but, co-application of JA facilitate the seedlings to combat the detrimental effects of Ni through enhanced osmolytes, activity of antioxidant enzymes and gene expression. PMID:27242811

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

The α Glycerophosphate Cycle in Drosophila melanogaster V. Molecular Analysis of α Glycerophosphate Dehydrogenase and α Glycerophosphate Oxidase Mutants

PubMed Central

Carmon, Amber; Chien, Jeff; Sullivan, David

2010-01-01

Two enzymes, α glycerophosphate dehydrogenase (GPDH-1) in the cytoplasm and α glycerophosphate oxidase (GPO-1) in the mitochondrion cooperate in Drosophila flight muscles to generate the ATP needed for muscle contraction. Null mutants for either enzyme cannot fly. Here, we characterize 15 ethyl methane sulfonate (EMS)-induced mutants in GPDH-1 at the molecular level and assess their effects on structural and evolutionarily conserved domains of this enzyme. In addition, we molecularly characterize 3 EMS-induced GPO-1 mutants and excisions of a P element insertion in the GPO-1 gene. The latter represent the best candidate for null or amorphic mutants in this gene. PMID:19995806

The alpha glycerophosphate cycle in Drosophila melanogaster V. molecular analysis of alpha glycerophosphate dehydrogenase and alpha glycerophosphate oxidase mutants.

PubMed

Carmon, Amber; Chien, Jeff; Sullivan, David; MacIntyre, Ross

2010-01-01

Two enzymes, alpha glycerophosphate dehydrogenase (GPDH-1) in the cytoplasm and alpha glycerophosphate oxidase (GPO-1) in the mitochondrion cooperate in Drosophila flight muscles to generate the ATP needed for muscle contraction. Null mutants for either enzyme cannot fly. Here, we characterize 15 ethyl methane sulfonate (EMS)-induced mutants in GPDH-1 at the molecular level and assess their effects on structural and evolutionarily conserved domains of this enzyme. In addition, we molecularly characterize 3 EMS-induced GPO-1 mutants and excisions of a P element insertion in the GPO-1 gene. The latter represent the best candidate for null or amorphic mutants in this gene.

Characterization and expression profiles of MaACS and MaACO genes from mulberry (Morus alba L.)*

PubMed Central

Liu, Chang-ying; Lü, Rui-hua; Li, Jun; Zhao, Ai-chun; Wang, Xi-ling; Diane, Umuhoza; Wang, Xiao-hong; Wang, Chuan-hong; Yu, Ya-sheng; Han, Shu-mei; Lu, Cheng; Yu, Mao-de

2014-01-01

1-Aminocyclopropane-1-carboxylic acid synthase (ACS) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) are encoded by multigene families and are involved in fruit ripening by catalyzing the production of ethylene throughout the development of fruit. However, there are no reports on ACS or ACO genes in mulberry, partly because of the limited molecular research background. In this study, we have obtained five ACS gene sequences and two ACO gene sequences from Morus Genome Database. Sequence alignment and phylogenetic analysis of MaACO1 and MaACO2 showed that their amino acids are conserved compared with ACO proteins from other species. MaACS1 and MaACS2 are type I, MaACS3 and MaACS4 are type II, and MaACS5 is type III, with different C-terminal sequences. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) expression analysis showed that the transcripts of MaACS genes were strongly expressed in fruit, and more weakly in other tissues. The expression of MaACO1 and MaACO2 showed different patterns in various mulberry tissues. MaACS and MaACO genes demonstrated two patterns throughout the development of mulberry fruit, and both of them were strongly up-regulated by abscisic acid (ABA) and ethephon. PMID:25001221

Cytokine-related genes and oxidation-related genes detected in preeclamptic placentas.

PubMed

Lee, Gui Se Ra; Joe, Yoon Seong; Kim, Sa Jin; Shin, Jong Chul

2010-10-01

To investigate cytokine- and oxidation-related genes for preeclampsia using DNA microarray analysis. Placentas were collected from 13 normal pregnancies and 13 patients with preeclampsia. Gene expression was studied using DNA microarray. Among significantly expressed genes, we focused on genes associated with cytokines and oxidation, and the results were confirmed using quantitative real time-polymerase chain reaction (QRT-PCR). 415 genes out of 30,940 genes were altered by > or =2-fold in the microarray analysis. 121 up-regulated genes and 294 down-regulated genes were found to be in preeclamptic placenta. Six cytokine-related genes and 5 oxidation-related genes were found from among the 121 up-regulated genes. The cytokine-related genes studied included oncostatin M (OSM), fms-related tyrosine kinase (FLT1) and vascular endothelial growth factor A (VEGFA), and the oxidation-related genes studied included spermine oxidase (SMOX), l cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), acetate dehydrogenase A (LDHA). These six genes were also significantly higher in placentas from patients with preeclampsia than in those from women with normal pregnancies. The placental tissue of patients with preeclampsia showed significantly higher mRNA expression of these six genes than the normal group, using QRT-PCR. DNA microarray analysis is one of the great methods for simultaneously detecting the functionally associated genes of preeclampsia. The cytokine-related genes such as OSM, FLT1 and VEGFA, and the oxidation-related genes such as LDHA, CYP26A1 and SMOX might prove to be the starting point in the elucidation of the pathogenesis of preeclampsia.

Monoamine oxidase A polymorphism moderates stability of attention problems and susceptibility to life stress during adolescence.

PubMed

Zohsel, K; Bianchi, V; Mascheretti, S; Hohm, E; Schmidt, M H; Esser, G; Brandeis, D; Banaschewski, T; Nobile, M; Laucht, M

2015-11-01

Attention problems affect a substantial number of children and adolescents and are predictive of academic underachievement and lower global adaptive functioning. Considerable variability has been observed with regard to the individual development of attention problems over time. In particular, the period of adolescence is characterized by substantial maturation of executive functioning including attentional processing, with the influence of genetic and environmental factors on individual trajectories not yet well understood. In the present investigation, we evaluated whether the monoamine oxidase A functional promoter polymorphism, MAOA-LPR, plays a role in determining continuity of parent-rated attention problems during adolescence. At the same time, a potential effect of severe life events (SLEs) was taken into account. A multi-group path analysis was used in a sample of 234 adolescents (149 males, 85 females) who took part in an epidemiological cohort study at the ages of 11 and 15 years. Attention problems during early adolescence were found to be a strong predictor of attention problems in middle adolescence. However, in carriers of the MAOA-LPR low-activity variant (MAOA-L), stability was found to be significantly higher than in carriers of the high-activity variant (MAOA-H). Additionally, only in MAOA-L carriers did SLEs during adolescence significantly impact on attention problems at the age of 15 years, implying a possible gene × environment interaction. To conclude, we found evidence that attention problems during adolescence in carriers of the MAOA-L allele are particularly stable and malleable to life stressors. The present results underline the usefulness of applying a more dynamic GxE perspective. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Elevating vitamin C content via overexpression of myo-inositol oxygenase and l-gulono-1,4-lactone oxidase in Arabidopsis leads to enhanced biomass and tolerance to abiotic stresses.

PubMed

Lisko, Katherine A; Torres, Raquel; Harris, Rodney S; Belisle, Melinda; Vaughan, Martha M; Jullian, Berangère; Chevone, Boris I; Mendes, Pedro; Nessler, Craig L; Lorence, Argelia

2013-12-01

l-Ascorbic acid (vitamin C) is an abundant metabolite in plant cells and tissues. Ascorbate functions as an antioxidant, as an enzyme cofactor, and plays essential roles in multiple physiological processes including photosynthesis, photoprotection, control of cell cycle and cell elongation, and modulation of flowering time, gene regulation, and senescence. The importance of this key molecule in regulating whole plant morphology, cell structure, and plant development has been clearly established via characterization of low vitamin C mutants of Arabidopsis , potato, tobacco, tomato, and rice. However, the consequences of elevating ascorbate content in plant growth and development are poorly understood. Here we demonstrate that Arabidopsis lines over-expressing a myo -inositol oxygenase or an l-gulono-1,4-lactone oxidase, containing elevated ascorbate, display enhanced growth and biomass accumulation of both aerial and root tissues. To our knowledge this is the first study demonstrating such a marked positive effect in plant growth in lines engineered to contain elevated vitamin C content. In addition, we present evidence showing that these lines are tolerant to a wide range of abiotic stresses including salt, cold, and heat. Total ascorbate content of the transgenic lines remained higher than those of controls under the abiotic stresses tested. Interestingly, exposure to pyrene, a polycyclic aromatic hydrocarbon and known inducer of oxidative stress in plants, leads to stunted growth of the aerial tissue, reduction in the number of root hairs, and inhibition of leaf expansion in wild type plants, while these symptoms are less severe in the over-expressers. Our results indicate the potential of this metabolic engineering strategy to develop crops with enhanced biomass, abiotic stress tolerance, and phytoremediation capabilities.

Modulation of IgE-dependent COX-2 gene expression by reactive oxygen species in human neutrophils.

PubMed

Vega, Antonio; Chacón, Pedro; Alba, Gonzalo; El Bekay, Rajaa; Martín-Nieto, José; Sobrino, Francisco

2006-07-01

Cyclooxygenase (COX) is a key enzyme in prostaglandin (PG) synthesis. Up-regulation of its COX-2 isoform is responsible for the increased PG release, taking place under inflammatory conditions, and also, is thought to be involved in allergic and inflammatory diseases. In the present work, we demonstrate that COX-2 expression becomes highly induced by anti-immunoglobulin E (IgE) antibodies and by antigens in human neutrophils from allergic patients. This induction was detected at mRNA and protein levels and was accompanied by a concomitant PGE(2) and thromboxane A(2) release. We also show evidence that inhibitors of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, such as 4-(2-aminoethyl)benzenesulphonyl fluoride and 4-hydroxy-3-methoxyaceto-phenone, completely cancelled anti-IgE-induced COX-2 protein up-regulation, suggesting that this process is mediated by reactive oxygen species (ROS) derived from NADPH oxidase activity. Moreover, the mitogen-activated protein kinases (MAPKs), p38 and extracellular signal-regulated kinase, and also, the transcription factor, nuclear factor (NF)-kappaB, are involved in the up-regulation of COX-2 expression, as specific chemical inhibitors of these two kinases, such as SB203580 and PD098059, and of the NF-kappaB pathway, such as N(alpha)-benzyloxycarbonyl-l-leucyl-l-leucyl-l-leucinal, abolished IgE-dependent COX-2 induction. Evidence is also presented, using Fe(2)(+)/Cu(2)(+) ions, that hydroxyl radicals generated from hydrogen peroxide through Fenton reactions could constitute candidate modulators able to directly trigger anti-IgE-elicited COX-2 expression through MAPK and NF-kappaB pathways. Present results underscore a new role for ROS as second messengers in the modulation of COX-2 expression by human neutrophils in allergic conditions.

Cryptochrome and Phytochrome Cooperatively but Independently Reduce Active Gibberellin Content in Rice Seedlings under Light Irradiation

PubMed Central

Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto

2012-01-01

In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4–OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants. PMID:22764280

Cryptochrome and phytochrome cooperatively but independently reduce active gibberellin content in rice seedlings under light irradiation.

PubMed

Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto

2012-09-01

In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4-OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants.

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

PubMed Central

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

Bioluminescent bioreporter sensing of foodborne toxins

NASA Astrophysics Data System (ADS)

Fraley, Amanda C.; Ripp, Steven; Sayler, Gary S.

2004-06-01

Histamine is the primary etiological agent in the foodborne disease scombrotoxicosis, one of the most common food toxicities related to fish consumption. Procedures for detecting histamine in fish products are available, but are often too expensive or too complex for routine use. As an alternative, a bacterial bioluminescent bioreporter has been constructed to develop a biosensor system that autonomously responds to low levels of histamine. The bioreporter contains a promoterless Photorhabdus luminescens lux operon (luxCDABE) fused with the Vibrio anguillarum angR regulatory gene promoter of the anguibactin biosynthetic operon. The bioreporter emitted 1.46 times more bioluminescence than background, 30 minutes after the addition of 100mM histamine. However, specificity was not optimal, as this biosensor generated significant bioluminescence in the presence of L-proline and L-histidine. As a means towards improving histamine specificity, the promoter region of a histamine oxidase gene from Arthrobacter globiformis was cloned upstream of the promotorless lux operon from Photorhabdus luminescens. This recently constructed whole-cell, lux-based bioluminescent bioreporter is currently being tested for optimal performance in the presence of histamine in order to provide a rapid, simple, and inexpensive model sensor for the detection of foodborne toxins.

Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

USDA-ARS?s Scientific Manuscript database

Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...

The dinoflagellates Durinskia baltica and Kryptoperidinium foliaceum retain functionally overlapping mitochondria from two evolutionarily distinct lineages

PubMed Central

Imanian, Behzad; Keeling, Patrick J

2007-01-01

Background The dinoflagellates Durinskia baltica and Kryptoperidinium foliaceum are distinguished by the presence of a tertiary plastid derived from a diatom endosymbiont. The diatom is fully integrated with the host cell cycle and is so altered in structure as to be difficult to recognize it as a diatom, and yet it retains a number of features normally lost in tertiary and secondary endosymbionts, most notably mitochondria. The dinoflagellate host is also reported to retain mitochondrion-like structures, making these cells unique in retaining two evolutionarily distinct mitochondria. This redundancy raises the question of whether the organelles share any functions in common or have distributed functions between them. Results We show that both host and endosymbiont mitochondrial genomes encode genes for electron transport proteins. We have characterized cytochrome c oxidase 1 (cox1), cytochrome oxidase 2 (cox2), cytochrome oxidase 3 (cox3), cytochrome b (cob), and large subunit of ribosomal RNA (LSUrRNA) of endosymbiont mitochondrial ancestry, and cox1 and cob of host mitochondrial ancestry. We show that all genes are transcribed and that those ascribed to the host mitochondrial genome are extensively edited at the RNA level, as expected for a dinoflagellate mitochondrion-encoded gene. We also found evidence for extensive recombination in the host mitochondrial genes and that recombination products are also transcribed, as expected for a dinoflagellate. Conclusion Durinskia baltica and K. foliaceum retain two mitochondria from evolutionarily distinct lineages, and the functions of these organelles are at least partially overlapping, since both express genes for proteins in electron transport. PMID:17892581

Targeting Mechanisms of Resistance to Taxane-Based Chemotherapy

DTIC Science & Technology

2008-09-01

12]. Another interesting gene ; monoamine oxidase A ( MAOA ) was upregulated in patients with PSA relapse (Figure 8A). Quantitative real-time PCR (qRT...from prostate. After excluding genes previously shown to be influenced by the radical prostatectomy procedure, we identified 51 genes with significant...analyses confirmed overexpression of GDF15 may confer resistance to chemotherapy in prostate cancer cells. Gene expression changes after

Activation of Polyphenol Oxidase in Dormant Wild Oat Caryopses by a Seed-Decay Isolate of Fusarium avenaceum

USDA-ARS?s Scientific Manuscript database

Incubation of dormant wild oat (Avena fatua L., isoline M73) caryopses for 1 to 3 days with Fusarium avenaceum seed-decay isolate F.a.1 induced activity of the plant defense enzyme polyphenol oxidase (PPO). Both extracts and leachates obtained from F.a.1-treated caryopses had decreased abundance of ...

The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-anchored glycoprotein involved in directional root growth

NASA Technical Reports Server (NTRS)

Sedbrook, John C.; Carroll, Kathleen L.; Hung, Kai F.; Masson, Patrick H.; Somerville, Chris R.

2002-01-01

To investigate how roots respond to directional cues, we characterized a T-DNA-tagged Arabidopsis mutant named sku5 in which the roots skewed and looped away from the normal downward direction of growth on inclined agar surfaces. sku5 roots and etiolated hypocotyls were slightly shorter than normal and exhibited a counterclockwise (left-handed) axial rotation bias. The surface-dependent skewing phenotype disappeared when the roots penetrated the agar surface, but the axial rotation defect persisted, revealing that these two directional growth processes are separable. The SKU5 gene belongs to a 19-member gene family designated SKS (SKU5 Similar) that is related structurally to the multiple-copper oxidases ascorbate oxidase and laccase. However, the SKS proteins lack several of the conserved copper binding motifs characteristic of copper oxidases, and no enzymatic function could be assigned to the SKU5 protein. Analysis of plants expressing SKU5 reporter constructs and protein gel blot analysis showed that SKU5 was expressed most strongly in expanding tissues. SKU5 was glycosylated and modified by glycosyl phosphatidylinositol and localized to both the plasma membrane and the cell wall. Our observations suggest that SKU5 affects two directional growth processes, possibly by participating in cell wall expansion.

A Systems Biology Study in Tomato Fruit Reveals Correlations between the Ascorbate Pool and Genes Involved in Ribosome Biogenesis, Translation, and the Heat-Shock Response

PubMed Central

Stevens, Rebecca G.; Baldet, Pierre; Bouchet, Jean-Paul; Causse, Mathilde; Deborde, Catherine; Deschodt, Claire; Faurobert, Mireille; Garchery, Cécile; Garcia, Virginie; Gautier, Hélène; Gouble, Barbara; Maucourt, Mickaël; Moing, Annick; Page, David; Petit, Johann; Poëssel, Jean-Luc; Truffault, Vincent; Rothan, Christophe

2018-01-01

Changing the balance between ascorbate, monodehydroascorbate, and dehydroascorbate in plant cells by manipulating the activity of enzymes involved in ascorbate synthesis or recycling of oxidized and reduced forms leads to multiple phenotypes. A systems biology approach including network analysis of the transcriptome, proteome and metabolites of RNAi lines for ascorbate oxidase, monodehydroascorbate reductase and galactonolactone dehydrogenase has been carried out in orange fruit pericarp of tomato (Solanum lycopersicum). The transcriptome of the RNAi ascorbate oxidase lines is inversed compared to the monodehydroascorbate reductase and galactonolactone dehydrogenase lines. Differentially expressed genes are involved in ribosome biogenesis and translation. This transcriptome inversion is also seen in response to different stresses in Arabidopsis. The transcriptome response is not well correlated with the proteome which, with the metabolites, are correlated to the activity of the ascorbate redox enzymes—ascorbate oxidase and monodehydroascorbate reductase. Differentially accumulated proteins include metacaspase, protein disulphide isomerase, chaperone DnaK and carbonic anhydrase and the metabolites chlorogenic acid, dehydroascorbate and alanine. The hub genes identified from the network analysis are involved in signaling, the heat-shock response and ribosome biogenesis. The results from this study therefore reveal one or several putative signals from the ascorbate pool which modify the transcriptional response and elements downstream. PMID:29491875

Positron emitter labeled enzyme inhibitors

DOEpatents

Fowler, Joanna S.; MacGregor, Robert R.; Wolf, Alfred P.; Langstrom, Bengt

1990-01-01

This invention involves a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography.

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

Biotransformation of arsenite and bacterial aox activity in drinking water produced from surface water of floating houses: Arsenic contamination in Cambodia.

PubMed

Chang, Jin-Soo

2015-11-01

The potential arsenite bioteansformation activity of arsenic was investigated by examining bacterial arsenic arsenite-oxidizing gene such as aoxS, aoxR, aoxA, aoxB, aoxC, and aoxD in high arsenic-contaminated drinking water produced from the surface water of floating houses. There is a biogeochemical cycle of activity involving arsenite oxidase aox system and the ars (arsenic resistance system) gene operon and aoxR leader gene activity in Alcaligenes faecalis SRR-11 and aoxS leader gene activity in Achromobacter xylosoxidans TSL-66. Batch experiments showed that SRR-11 and TSL-66 completely oxidized 1 mM of As (III) to As (V) within 35-40 h. The leaders of aoxS and aoxR are important for gene activity, and their effects in arsenic bioremediation and mobility in natural water has a significant ecological role because it allows arsenite oxidase in bacteria to control the biogeochemical cycle of arsenic-contaminated drinking water produced from surface water of floating houses. Copyright © 2015 Elsevier Ltd. All rights reserved.

Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

PubMed

Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

2002-04-01

Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

Design, synthesis, and molecular docking studies of N-(9,10-anthraquinone-2-carbonyl)amino acid derivatives as xanthine oxidase inhibitors.

PubMed

Zhang, Ting-Jian; Li, Song-Ye; Yuan, Wei-Yan; Zhang, Yi; Meng, Fan-Hao

2018-04-01

A series of N-(9,10-anthraquinone-2-carbonyl)amino acid derivatives (1a-j) was designed and synthesized as novel xanthine oxidase inhibitors. Among them, the L/D-phenylalanine derivatives (1d and 1i) and the L/D-tryptophan derivatives (1e and 1j) were effective with micromolar level potency. In particular, the L-phenylalanine derivative 1d (IC 50  = 3.0 μm) and the D-phenylalanine derivative 1i (IC 50  = 2.9 μm) presented the highest potency and were both more potent than the positive control allopurinol (IC 50  = 8.1 μm). Preliminary SAR analysis pointed that an aromatic amino acid fragment, for example, phenylalanine or tryptophan, was essential for the inhibition; the D-amino acid derivative presented equal or greater potency compared to its L-enantiomer; and the 9,10-anthraquinone moiety was welcome for the inhibition. Molecular simulations provided rational binding models for compounds 1d and 1i in the xanthine oxidase active pocket. As a result, compounds 1d and 1i could be promising lead compounds for further investigation. © 2017 John Wiley & Sons A/S.

POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

PubMed

Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

2014-01-01

POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

Exploiting algal NADPH oxidase for biophotovoltaic energy

DOE PAGES

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

2015-01-29

Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

PubMed

Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

2017-12-28

Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the expression of pathogenesis-related protein-encoding genes and genes involved in ROS production or related to cell wall biogenesis. Furthermore, we identified genes that were upregulated specifically in flax genotypes resistant to Fusarium wilt. We suggest that the identified genes in resistant cultivars and BC 2 F 5 populations showing induced expression in response to F. oxysporum infection are the most promising resistance gene candidates.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

PubMed Central

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

PubMed

Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

2001-02-01

Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.

Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruvolo, M.; Disotell, T.R.; Allard, M.W.

1991-02-15

Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yieldmore » trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.« less

In vitro assessment of anticholinesterase and NADH oxidase inhibitory activities of an edible fern, Diplazium esculentum.

PubMed

Roy, Subhrajyoti; Dutta, Somit; Chaudhuri, Tapas Kumar

2015-07-01

Diplazium esculentum is the most commonly consumed edible fern throughout Asia and Oceania. Several studies have been performed so far to determine different functional properties of this plant, but there have been no reports on the anticholinesterase and nicotinamide adenine dinucleotide (NADH) oxidase inhibitory activities of this plant. Therefore, the present study was conducted to determine the anticholinesterase and NADH oxidase inhibitory activities of 70% methanolic extract of D. esculentum. The D. esculentum extract was investigated for its acetylcholinesterase and NADH oxidase inhibitory activities as well as its free radical scavenging and total antioxidant activities in the linoleic acid system. The free radical scavenging activity of the extract was determined by the 2,2-diphenyl-1-picryl-hydrazyl (DPPH) method. The total antioxidant activity of the extract was evaluated by ferric thiocyanate (FTC) and thiobarbituric acid (TBA) methods. The D. esculentum extract inhibited acetylcholinesterase and NADH oxidase in a dose-dependent manner, with IC50 values of 272.97±19.38 and 265.81±21.20 μg/mL, respectively. The extract also showed a potent DPPH radical scavenging activity with an IC50 value of 402.88±12.70 μg/mL. Moreover, the extract showed 27.41% and 33.22% of total antioxidant activities determined by FTC and TBA methods, respectively. Results indicated that 70% methanolic extract of D. esculentum effectively inhibited the enzymes acetylcholinesterase and NADH oxidase and acted as a potent antioxidant and free radical scavenger. These in vitro assays indicate that this plant extract is a significant source of natural antioxidants, which may be helpful in preventing the progression of various neurodegenerative disorders associated with oxidative stress.

Inhibition of arsenic induced-rat liver injury by grape seed exact through suppression of NADPH oxidase and TGF-{beta}/Smad activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan Xinjuan; Dai Yujie; Li Xing

2011-08-01

Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. > GSE reduced arsenic-mediated Smad2/3 phosphorylation and NADPH oxidase subunits (Nox2, Nox4 and p47phox). > Beneficial effects of GSE on As-induced liver injury was via inhibition of NADPH oxidase and TGF-{beta}/Smad activation.« less

Designing and Creating a Synthetic Omega Oxidation Pathway in Saccharomyces cerevisiae Enables Production of Medium-Chain α, ω-Dicarboxylic Acids

PubMed Central

Han, Li; Peng, Yanfeng; Zhang, Yuangyuan; Chen, Wujiu; Lin, Yuping; Wang, Qinhong

2017-01-01

Medium-chain (C8–C14) α, ω-dicarboxylic acids (α, ω-DCAs), which have numerous applications as raw materials for producing various commodities and polymers in chemical industry, are mainly produced from chemical or microbial conversion of petroleum-derived alkanes or plant-derived fatty acids at present. Recently, significant attention has been gained to microbial production of medium-chain α, ω-DCAs from simple renewable sugars. Here, we designed and created a synthetic omega oxidation pathway in Saccharomyces cerevisiae to produce C10 and C12 α, ω-DCAs from renewable sugars and fatty acids by introducing a heterogeneous cytochrome P450 CYP94C1 and cytochrome reductase ATR1. Furthermore, the deletion of fatty acyl-CoA synthetase genes FAA1 and FAA4 increased the production of medium-chain α, ω-DCAs from 4.690 ± 0.088 mg/L to 12.177 ± 0.420 mg/L and enabled the production of C14 and C16 α, ω-DCAs at low percentage. But blocking β-oxidation pathway by deleting fatty-acyl coenzyme A oxidase gene POX1 and overexpressing different thioesterase genes had no significant impact on the production and the composition of α, ω-dicarboxylic acids. Overall, our study indicated the potential of microbial production of medium-chain α, ω-DCAs from renewable feedstocks using engineered yeast. PMID:29163455

Silencing of ACO decreases reproduction and energy metabolism in triazophos-treated female brown plant hoppers, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

PubMed

Liu, Zong-Yu; Jiang, Yi-Ping; Li, Lei; You, Lin-Lin; Wu, You; Xu, Bin; Ge, Lin-Quan; Wu, Jin-Cai

2016-03-01

The brown plant hopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), is a major pest affecting rice in Asia, and outbreaks of this pest are closely linked to pesticide-induced stimulation of reproduction. Therefore, the BPH is a classic example of a resurgent pest. However, the effects of different genes on the regulation of pesticide-induced reproductive stimulation in the BPH are unclear. In this study, the regulatory effects of acyl-coenzyme A oxidase (ACO) on the reproduction and biochemistry of the BPH were investigated with gene silencing. The number of eggs laid per female by triazophos (TZP)+dsACO BPH females was significantly lower than those of TZP-treated (without ACO silencing) or TZP+GFP females (negative control), with the number of eggs decreasing by 30.8% (from 529.5 to 366.3) and 32.0% (from 540.5 to 366.3), respectively. The preoviposition period, oviposition period, and longevity of the TZP-treated females were also influenced by dsACO treatment. Additionally, the amounts of crude fat, protein, and some fatty acids (oleic acid, palmitic acid, linoleic acid, stearic acid, and myristoleic acid) in TZP+dsACO females were significantly lower than in TZP-treated females. Thus, ACO is one of the key genes regulating the TZP-induced stimulation of reproduction in BPH females. Copyright © 2015 Elsevier Inc. All rights reserved.

Arginase Inhibition Suppresses Native Low-Density Lipoprotein-Stimulated Vascular Smooth Muscle Cell Proliferation by NADPH Oxidase Inactivation.

PubMed

Koo, Bon Hyeock; Yi, Bong Gu; Wang, Wi Kwang; Ko, In Young; Hoe, Kwang Lae; Kwon, Young Guen; Won, Moo Ho; Kim, Young Myeong; Lim, Hyun Kyo; Ryoo, Sungwoo

2018-05-01

Vascular smooth muscle cell (VSMC) proliferation induced by native low-density lipoprotein (nLDL) stimulation is dependent on superoxide production from activated NADPH oxidase. The present study aimed to investigate whether the novel arginase inhibitor limonin could suppress nLDL-induced VSMC proliferation and to examine related mechanisms. Isolated VSMCs from rat aortas were treated with nLDL, and cell proliferation was measured by WST-1 and BrdU assays. NADPH oxidase activation was evaluated by lucigenin-induced chemiluminescence, and phosphorylation of protein kinase C (PKC) βII and extracellular signal-regulated kinase (ERK) 1/2 was determined by western blot analysis. Mitochondrial reactive oxygen species (ROS) generation was assessed using MitoSOX-red, and intracellular L-arginine concentrations were determined by high-performance liquid chromatography (HPLC) in the presence or absence of limonin. Limonin inhibited arginase I and II activity in the uncompetitive mode, and prevented nLDL-induced VSMC proliferation in a p21Waf1/Cip1-dependent manner without affecting arginase protein levels. Limonin blocked PKCβII phosphorylation, but not ERK1/2 phosphorylation, and translocation of p47phox to the membrane was decreased, as was superoxide production in nLDL-stimulated VSMCs. Moreover, mitochondrial ROS generation was increased by nLDL stimulation and blocked by preincubation with limonin. Mitochondrial ROS production was responsible for the phosphorylation of PKCβII. HPLC analysis showed that arginase inhibition with limonin increases intracellular L-arginine concentrations, but decreases polyamine concentrations. L-Arginine treatment prevented PKCβII phosphorylation without affecting ERK1/2 phosphorylation. Increased L-arginine levels following limonin-dependent arginase inhibition prohibited NADPH oxidase activation in a PKCβII-dependent manner, and blocked nLDL-stimulated VSMC proliferation. © Copyright: Yonsei University College of Medicine 2018.

Arginase Inhibition Suppresses Native Low-Density Lipoprotein-Stimulated Vascular Smooth Muscle Cell Proliferation by NADPH Oxidase Inactivation

PubMed Central

Wang, Wi-Kwang; Ko, In-Young; Hoe, Kwang-Lae; Kwon, Young-Guen; Won, Moo-Ho; Kim, Young-Myeong

2018-01-01

Purpose Vascular smooth muscle cell (VSMC) proliferation induced by native low-density lipoprotein (nLDL) stimulation is dependent on superoxide production from activated NADPH oxidase. The present study aimed to investigate whether the novel arginase inhibitor limonin could suppress nLDL-induced VSMC proliferation and to examine related mechanisms. Materials and Methods Isolated VSMCs from rat aortas were treated with nLDL, and cell proliferation was measured by WST-1 and BrdU assays. NADPH oxidase activation was evaluated by lucigenin-induced chemiluminescence, and phosphorylation of protein kinase C (PKC) βII and extracellular signal-regulated kinase (ERK) 1/2 was determined by western blot analysis. Mitochondrial reactive oxygen species (ROS) generation was assessed using MitoSOX-red, and intracellular L-arginine concentrations were determined by high-performance liquid chromatography (HPLC) in the presence or absence of limonin. Results Limonin inhibited arginase I and II activity in the uncompetitive mode, and prevented nLDL-induced VSMC proliferation in a p21Waf1/Cip1-dependent manner without affecting arginase protein levels. Limonin blocked PKCβII phosphorylation, but not ERK1/2 phosphorylation, and translocation of p47phox to the membrane was decreased, as was superoxide production in nLDL-stimulated VSMCs. Moreover, mitochondrial ROS generation was increased by nLDL stimulation and blocked by preincubation with limonin. Mitochondrial ROS production was responsible for the phosphorylation of PKCβII. HPLC analysis showed that arginase inhibition with limonin increases intracellular L-arginine concentrations, but decreases polyamine concentrations. L-Arginine treatment prevented PKCβII phosphorylation without affecting ERK1/2 phosphorylation. Conclusion Increased L-arginine levels following limonin-dependent arginase inhibition prohibited NADPH oxidase activation in a PKCβII-dependent manner, and blocked nLDL-stimulated VSMC proliferation. PMID:29611398

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

PubMed

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Bacterial sulfite dehydrogenases in organotrophic metabolism: separation and identification in Cupriavidus necator H16 and in Delftia acidovorans SPH-1.

PubMed

Denger, Karin; Weinitschke, Sonja; Smits, Theo H M; Schleheck, David; Cook, Alasdair M

2008-01-01

The utilization of organosulfonates as carbon sources by aerobic or nitrate-reducing bacteria usually involves a measurable, uncharacterized sulfite dehydrogenase. This is tacitly assumed to be sulfite : ferricytochrome-c oxidoreductase [EC 1.8.2.1], despite negligible interaction with (eukaryotic) cytochrome c: the enzyme is assayed at high specific activity with ferricyanide as electron acceptor. Purified periplasmic sulfite dehydrogenases (SorAB, SoxCD) are known from chemoautotrophic growth and are termed 'sulfite oxidases' by bioinformatic services. The catalytic unit (SorA, SoxC; termed 'sulfite oxidases' cd02114 and cd02113, respectively) binds a molybdenum-cofactor (Moco), and involves a cytochrome c (SorB, SoxD) as electron acceptor. The genomes of several bacteria that express a sulfite dehydrogenase during heterotrophic growth contain neither sorAB nor soxCD genes; others contain at least four paralogues, for example Cupriavidus necator H16, which is known to express an inducible sulfite dehydrogenase during growth with taurine (2-aminoethanesulfonate). This soluble enzyme was enriched 320-fold in four steps. The 40 kDa protein (denatured) had an N-terminal amino acid sequence which started at position 42 of the deduced sequence of H16_B0860 (termed 'sulfite oxidase' cd02114), which we named SorA. The neighbouring gene is an orthologue of sorB, and the sorAB genes were co-transcribed. Cell fractionation showed SorA to be periplasmic. The corresponding enzyme in Delftia acidovorans SPH-1 was enriched 270-fold, identified as Daci_0055 (termed 'sulfite oxidase' cd02110) and has a cytochrome c encoded downstream. We presume, from genomic data for bacteria and archaea, that there are several subgroups of sulfite dehydrogenases, which all contain a Moco, and transfer electrons to a specific cytochrome c.

Urate oxidase for the prevention and treatment of tumour lysis syndrome in children with cancer.

PubMed

Cheuk, Daniel Kl; Chiang, Alan Ks; Chan, Godfrey Cf; Ha, Shau Yin

2017-03-08

Tumour lysis syndrome (TLS) is a serious complication of malignancies and can result in renal failure or death. Previous reviews did not find clear evidence of benefit of urate oxidase in children with cancer. This review is the second update of a previously published Cochrane review. To assess the effects and safety of urate oxidase for the prevention and treatment of TLS in children with malignancies. In March 2016 we searched CENTRAL, MEDLINE, Embase, and CINAHL. In addition, we searched the reference lists of all identified relevant papers, trials registers and other databases. We also screened conference proceedings and we contacted experts in the field and the manufacturer of rasburicase, Sanofi-aventis. Randomised controlled trials (RCT) and controlled clinical trials (CCT) of urate oxidase for the prevention or treatment of TLS in children under 18 years with any malignancy. Two review authors independently extracted trial data and assessed individual trial quality. We used risk ratios (RR) for dichotomous data and mean difference (MD) for continuous data. We included seven trials, involving 471 participants in the treatment groups and 603 participants in the control groups. No new studies were identified in the update. One RCT and five CCTs compared urate oxidase and allopurinol. Three trials tested Uricozyme, and three trials tested rasburicase for the prevention of TLS.The RCT did not evaluate the primary outcome (incidence of clinical TLS). It showed no clear evidence of a difference in mortality (both all-cause mortality (Fisher's exact test P = 0.23) and mortality due to TLS (no deaths in either group)), renal failure (Fisher's exact test P = 0.46), and adverse effects between the treatment and the control groups (Fisher's exact test P = 1.0). The frequency of normalisation of uric acid at four hours (10 out of 10 participants in the treatment group versus zero out of nine participants in the control group, Fisher's exact test P < 0.001) and area under the curve of uric acid at four days (MD -201.00 mg/dLhr, 95% CI -258.05 mg/dLhr to -143.95 mg/dLhr; P < 0.00001) were significantly better in the treatment group.One CCT evaluated the primary outcome; no clear evidence of a difference was identified between the treatment and the control groups (RR 0.77, 95% CI 0.44 to 1.33; P = 0.34). Pooled results of three CCTs showed significantly lower mortality due to TLS in the treatment group (RR 0.05, 95% CI 0.00 to 0.89; P = 0.04); no clear evidence of a difference in all-cause mortality was identified between the groups (RR 0.19, 95% CI 0.01 to 3.42; P = 0.26). Pooled results from five CCTs showed significantly lower incidence of renal failure in the treatment group (RR 0.26, 95% CI 0.08 to 0.89; P = 0.03). Results of CCTs also showed significantly lower uric acid in the treatment group at two days (three CCTs: MD -3.80 mg/dL, 95% CI -7.37 mg/dL to -0.24 mg/dL; P = 0.04), three days (two CCTs: MD -3.13 mg/dL, 95% CI -6.12 mg/dL to -0.14 mg/dL; P = 0.04), four days (two CCTs: MD -4.60 mg/dL, 95% CI -6.39 mg/dL to -2.81 mg/dL; P < 0.00001), and seven days (one CCT: MD -1.74 mg/dL, 95% CI -3.01 mg/dL to -0.47 mg/dL; P = 0.007) after therapy, but not one day (three CCTs: MD -3.00 mg/dL, 95% CI -7.61 mg/dL to 1.60 mg/dL; P = 0.2), five days (one CCT: MD -1.02 mg/dL, 95% CI -2.24 mg/dL to 0.20 mg/dL; P = 0.1), and 12 days (one CCT: MD -0.80 mg/dL, 95% CI -2.51 mg/dL to 0.91 mg/dL; P = 0.36) after therapy. Pooled results from three CCTs showed higher frequency of adverse effects in participants who received urate oxidase (RR 9.10, 95% CI 1.29 to 64.00; P = 0.03).Another included RCT, with 30 participants, compared different doses of rasburicase (0.2 mg/kg versus 0.15 mg/kg). The primary outcome was not evaluated. No clear evidence of a difference in mortality (all-cause mortality (Fisher's exact test P = 1.0) and mortality due to TLS (no deaths in both groups)) and renal failure (no renal failure in both groups) was identified. It demonstrated no clear evidence of a difference in uric acid normalisation (RR 1.07, 95% CI 0.89 to 1.28; P = 0.49) and uric acid level at four hours (MD 8.10%, 95% CI -0.99% to 17.19%; P = 0.08). Common adverse events of urate oxidase included hypersensitivity, haemolysis, and anaemia, but no clear evidence of a difference between treatment groups was identified (RR 0.54, 95% CI 0.12 to 2.48; P = 0.42).The quality of evidence ranks from very low to low because of imprecise results, and all included trials were highly susceptible to biases. Although urate oxidase might be effective in reducing serum uric acid, it is unclear whether it reduces clinical TLS, renal failure, or mortality. Adverse effects might be more common for urate oxidase compared with allopurinol. Clinicians should weigh the potential benefits of reducing uric acid and uncertain benefits of preventing mortality or renal failure from TLS against the potential risk of adverse effects.

DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

PubMed

Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

1994-10-01

We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

The BLI-3/TSP-15/DOXA-1 Dual Oxidase Complex Is Required for Iodide Toxicity in Caenorhabditis elegans

PubMed Central

Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long

2014-01-01

Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962

Characterization of oxidative phosphorylation in the colorless chlorophyte Polytomella sp. Its mitochondrial respiratory chain lacks a plant-like alternative oxidase.

PubMed

Reyes-Prieto, Adrián; El-Hafidi, Mohammed; Moreno-Sánchez, Rafael; González-Halphen, Diego

2002-07-01

The presence of an alternative oxidase (AOX) in Polytomella sp., a colorless relative of Chlamydomonas reinhardtii, was explored. Oxygen uptake in Polytomella sp. mitochondria was inhibited by KCN (94%) or antimycin (96%), and the remaining cyanide-resistant respiration was not blocked by the AOX inhibitors salicylhydroxamic acid (SHAM) or n-propylgallate. No stimulation of an AOX activity was found upon addition of either pyruvate, alpha-ketoglutarate, or AMP, or by treatment with DTT. An antibody raised against C. reinhardtii AOX did not recognized any polypeptide band of Polytomella sp. mitochondria in Western blots. Also, PCR experiments and Southern blot analysis failed to identify an Aox gene in this colorless alga. Finally, KCN exposure of cell cultures failed to stimulate an AOX activity. Nevertheless, KCN exposure of Polytomella sp. cells induced diminished mitochondrial respiration (20%) and apparent changes in cytochrome c oxidase affinity towards cyanide. KCN-adapted cells exhibited a significant increase of a-type cytochromes, suggesting accumulation of inactive forms of cytochrome c oxidase. Another effect of KCN exposure was the reduction of the protein/fatty acid ratio of mitochondrial membranes, which may affect the observed respiratory activity. We conclude that Polytomella lacks a plant-like AOX, and that its corresponding gene was probably lost during the divergence of this colorless genus from its close photosynthetic relatives.

A pathogenesis assay using Saccharomyces cerevisiae and Caenorhabditis elegans reveals novel roles for yeast AP-1, Yap1, and host dual oxidase BLI-3 in fungal pathogenesis.

PubMed

Jain, Charu; Yun, Meijiang; Politz, Samuel M; Rao, Reeta Prusty

2009-08-01

Treatment of systemic fungal infections is difficult because of the limited number of antimycotic drugs available. Thus, there is an immediate need for simple and innovative systems to assay the contribution of individual genes to fungal pathogenesis. We have developed a pathogenesis assay using Caenorhabditis elegans, an established model host, with Saccharomyces cerevisiae as the invading fungus. We have found that yeast infects nematodes, causing disease and death. Our data indicate that the host produces reactive oxygen species (ROS) in response to fungal infection. Yeast mutants sod1Delta and yap1Delta, which cannot withstand ROS, fail to cause disease, except in bli-3 worms, which carry a mutation in a dual oxidase gene. Chemical inhibition of the NADPH oxidase activity abolishes ROS production in worms exposed to yeast. This pathogenesis assay is useful for conducting systematic, whole-genome screens to identify fungal virulence factors as alternative targets for drug development and exploration of host responses to fungal infections.

Investigating the Production of Foreign Membrane Proteins in Tobacco Chloroplasts: Expression of an Algal Plastid Terminal Oxidase

PubMed Central

Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.

2012-01-01

Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

PubMed

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Mechanism and characteristics of stimuli-dependent ROS generation in undifferentiated HL-60 cells.

PubMed

Muranaka, Shikibu; Fujita, Hirofumi; Fujiwara, Takuzo; Ogino, Tetsuya; Sato, Eisuke F; Akiyama, Jitsuo; Imada, Isuke; Inoue, Masayasu; Utsumi, Kozo

2005-01-01

It has been widely believed that undifferentiated human promyelocytic leukemia cells (HL-60) have no ability to generate reactive oxygen species (ROS) responding to stimuli. We report here that undifferentiated HL-60 cells possess NADPH oxidase and that generation of superoxide can be measured using a highly sensitive chemiluminescence dye, L-012. Five subunits of NADPH oxidase, namely, gp91(phox), p22(phox), p67(phox), p47(phox), and Rac 2, were detected in undifferentiated HL-60 cells by immunoblotting analysis. The contents of these NADPH oxidase components in the cells were increased with the differentiation induced by phorbol myristate acetate (PMA), except for p22(phox). Messenger RNAs of these subunits were also detected by the RT-PCR method, and their expressions increased except that of p22(phox) with the differentiation induced by PMA. Kinetic analysis using L-012 revealed that HL-60 cells generated substantial amounts of ROS by various stimulants, including formylmethionyl-leucyl-phenylalanine, PMA, myristic acid, and a Ca2+ ionophore, A23187. Both diphenyleneiodonium (an inhibitor of FAD-dependent oxidase) and apocynin (a specific inhibitor of NADPH oxidase) suppressed this stimuli-dependent ROS generation. Genistein, staurosporine, uric acid, and sodium azide inhibited the ROS generation in undifferentiated HL-60 cells in a similar way to that in undifferentiated neutrophils. These results suggested that the mechanism of ROS generation in undifferentiated HL-60 cells is the same as that in primed neutrophils.

Membrane-bound oxygen reductases of the anaerobic sulfate-reducing Desulfovibrio vulgaris Hildenborough: roles in oxygen defence and electron link with periplasmic hydrogen oxidation.

PubMed

Ramel, F; Amrani, A; Pieulle, L; Lamrabet, O; Voordouw, G; Seddiki, N; Brèthes, D; Company, M; Dolla, A; Brasseur, G

2013-12-01

Cytoplasmic membranes of the strictly anaerobic sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough contain two terminal oxygen reductases, a bd quinol oxidase and a cc(b/o)o3 cytochrome oxidase (Cox). Viability assays pointed out that single Δbd, Δcox and double ΔbdΔcox deletion mutant strains were more sensitive to oxygen exposure than the WT strain, showing the involvement of these oxygen reductases in the detoxification of oxygen. The Δcox strain was slightly more sensitive than the Δbd strain, pointing to the importance of the cc(b/o)o3 cytochrome oxidase in oxygen protection. Decreased O2 reduction rates were measured in mutant cells and membranes using lactate, NADH, ubiquinol and menadiol as substrates. The affinity for oxygen measured with the bd quinol oxidase (Km, 300 nM) was higher than that of the cc(b/o)o3 cytochrome oxidase (Km, 620 nM). The total membrane activity of the bd quinol oxidase was higher than that of the cytochrome oxidase activity in line with the higher expression of the bd oxidase genes. In addition, analysis of the ΔbdΔcox mutant strain indicated the presence of at least one O2-scavenging membrane-bound system able to reduce O2 with menaquinol as electron donor with an O2 affinity that was two orders of magnitude lower than that of the bd quinol oxidase. The lower O2 reductase activity in mutant cells with hydrogen as electron donor and the use of specific inhibitors indicated an electron transfer link between periplasmic H2 oxidation and membrane-bound oxygen reduction via the menaquinol pool. This linkage is crucial in defence of the strictly anaerobic bacterium Desulfovibrio against oxygen stress.

Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*

PubMed Central

Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

2014-01-01

Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

[Molecular identification of human Diphyllobothrium nihonkaiense using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence].

PubMed

Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro

2010-11-01

Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.

Cloning and expression of 1-aminocyclopropane-1-carboxylate oxidase cDNA induced by thidiazuron during somatic embryogenesis of alfalfa (Medicago sativa).

PubMed

Feng, Bi-Hong; Wu, Bei; Zhang, Chun-Rong; Huang, Xia; Chen, Yun-Feng; Huang, Xue-Lin

2012-01-15

Embryogenic callus (EC) induced from petioles of alfalfa (Medicago sativa L. cv. Jinnan) on B5h medium turned green, compact and non-embryogenic when the kinetin (KN) in the medium was replaced partially or completely by thidiazuron (TDZ). The application of CoCl₂, which is an inhibitor of 1-aminocyclopropane-1-carboxylate oxidase (ACO), counteracted the effect of TDZ. Ethylene has been shown to be involved in the modulation of TDZ-induced morphogenesis responses. However, very little is known about the genes involved in ethylene formation during somatic embryogenesis (SE). To investigate whether ethylene mediated by ACO is involved in the effect of TDZ on inhibition of embryogenic competence of the alfalfa callus. In this study we cloned full-length ACO cDNA from the alfalfa callus, named MsACO, and observed changes in this gene expression during callus formation and induction of SE under treatment with TDZ or TDZ plus CoCl₂. RNA blot analysis showed that during the EC subcultural period, the expression level of MsACO in EC was significantly increased on the 2nd day, rose to the highest level on the 8th day and remained at this high level until the 21st day. However, the ACO expression in the TDZ (0.93 μM)-treated callus was higher than in the EC especially on the 8th day. Moreover the ACO expression level increased with increasing TDZ concentration during the subcultural/maintenance period of the callus. It is worth noting that comparing the treatment with TDZ alone, the treatment with 0.93 μM TDZ plus 50 μM CoCl₂ reduced both of the ACO gene expressions and ACO activity in the treated callus. These results indicate that the effect of TDZ could be counteracted by CoCl₂ either on the ACO gene expression level or ACO activity. Thus, a TDZ inhibitory effect on embryogenic competence of alfalfa callus could be mediated by ACO gene expression. Crown Copyright © 2011. Published by Elsevier GmbH. All rights reserved.

Investigating Proteome and Transcriptome Defense Response of Apples Induced by Yarrowia lipolytica.

PubMed

Zhang, Hongyin; Chen, Liangliang; Sun, Yiwen; Zhao, Lina; Zheng, Xiangfeng; Yang, Qiya; Zhang, Xiaoyun

2017-04-01

A better understanding of the mode of action of postharvest biocontrol agents on fruit surfaces is critical for the advancement of successful implementation of postharvest biocontrol products. This is due to the increasing importance of biological control of postharvest diseases over chemical and other control methods. However, most of the mechanisms involved in biological control remain unknown and need to be explored. Yarrowia lipolytica significantly inhibited blue mold decay of apples caused by Penicillium expansum. The findings also demonstrated that Y. lipolytica stimulated the activities of polyphenoloxidase, peroxidase, chitinase, l-phenylalanine ammonia lyase involved in enhancing defense responses in apple fruit tissue. Proteomic and transcriptomic analysis revealed a total of 35 proteins identified as up- and down-regulated in response to the Y. lipolytica inducement. These proteins were related to defense, biotic stimulus, and stress responses, such as pathogenesis-related proteins and dehydrin. The analysis of the transcriptome results proved that the induced resistance was mediated by a crosstalk between salicylic acid (SA) and ethylene/jasmonate (ET/JA) pathways. Y. lipolytica treatment activated the expression of isochorismate synthase gene in the SA pathway, which up-regulates the expression of PR4 in apple. The expression of 1-aminocyclopropane-1-carboxylate oxidase gene and ET-responsive transcription factors 2 and 4, which are involved in the ET pathway, were also activated. In addition, cytochrome oxidase I, which plays an important role in JA signaling for resistance acquisition, was also activated. However, not all of the genes had a positive effect on the SA and ET/JA signal pathways. As transcriptional repressors in JA signaling, TIFY3B and TIFY11B were triggered by the yeast, but the gene expression levels were relatively low. Taken together, Y. lipolytica induced the SA and ET/JA signal mediating the defense pathways by stimulating defense response genes, such as peroxidase, thaumatin-like protein, and chitinase 4-like, which are involved in defense response in apple. [Formula: see text] Copyright © 2017 The Author(s) This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Isolation and characterization of the pea cytochrome c oxidase Vb gene.

PubMed

Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi

2006-11-01

Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.

A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067.

PubMed

Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I

2007-04-01

Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

Efficient Production of Hydroxylated Human-Like Collagen Via the Co-Expression of Three Key Genes in Escherichia coli Origami (DE3).

PubMed

Tang, Yunping; Yang, Xiuliang; Hang, Baojian; Li, Jiangtao; Huang, Lei; Huang, Feng; Xu, Zhinan

2016-04-01

Mature collagen is abundant in human bodies and very valuable for a range of industrial and medical applications. The biosynthesis of mature collagen requires post-translational modifications to increase the stability of collagen triple helix structure. By co-expressing the human-like collagen (HLC) gene with human prolyl 4-hydroxylase (P4H) and D-arabinono-1, 4-lactone oxidase (ALO) in Escherichia coli, we have constructed a prokaryotic expression system to produce the hydroxylated HLC. Then, five different media, as well as the induction conditions were investigated with regard to the soluble expression of such protein. The results indicated that the highest soluble expression level of target HLC obtained in shaking flasks was 49.55 ± 0.36 mg/L, when recombinant cells were grew in MBL medium and induced by 0.1 mM IPTG at the middle stage of exponential growth phase. By adopting the glucose feeding strategy, the expression level of target HLC can be improved up to 260 mg/L in a 10 L bench-top fermentor. Further, HPLC analyses revealed that more than 10 % of proline residues in purified HLC were successfully hydroxylated. The present work has provided a solid base for the large-scale production of hydroxylated HLC in E. coli.

Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.

PubMed

Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T

2001-06-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.

Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori

PubMed Central

Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo

2001-01-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170

Positron emitter labeled enzyme inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.

This invention involves a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline andmore » L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography.« less

Positron emitter labeled enzyme inhibitors

DOEpatents

Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.

1987-05-22

This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.

Positron emitter labeled enzyme inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.

This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgylinemore » and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.« less

Influence of Tridax procumbens on lysyl oxidase activity and wound healing.

PubMed

Udupa, S L; Udupa, A L; Kulkarni, D R

1991-08-01

The effects of an indigenous drug, Tridax procumbens L. (Compositae), on developing granulation tissue in rats were studied. Subcutaneously harvested granuloma tissue formed on dead space wound was removed at 4 day intervals up to 32 days of wounding. Lysyl oxidase activity, protein content, specific activity, and breaking strength were all increased in drug-treated animals as compared to controls. A fall in the lysyl oxidase activity was observed in drug-treated animals after day 8. The drug may be having a dual role: one a stimulatory (direct) effect in the initial phase of wound healing and the other a depressant (indirect) effect in the later stage.

NADPH oxidase activity and reactive oxygen species production in brain and kidney of adult male hypertensive Ren-2 transgenic rats.

PubMed

Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J

2015-01-01

Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.

Exploiting the synthetic lethality between terminal respiratory oxidases to kill Mycobacterium tuberculosis and clear host infection

PubMed Central

Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin

2017-01-01

The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330

Corticostriatal Connectivity in Antisocial Personality Disorder by MAO-A Genotype and Its Relationship to Aggressive Behavior.

PubMed

Kolla, Nathan J; Dunlop, Katharine; Meyer, Jeffrey H; Downar, Jonathan

2018-05-09

The influence of genetic variation on resting-state neural networks represents a burgeoning line of inquiry in psychiatric research. Monoamine oxidase A, an X-linked gene, is one example of a molecular target linked to brain activity in psychiatric illness. Monoamine oxidase A genetic variants, including the high and low variable nucleotide tandem repeat polymorphisms, have been shown to differentially affect brain functional connectivity in healthy humans. However, it is currently unknown whether these same polymorphisms influence resting-state brain activity in clinical conditions. Given its high burden on society and strong connection to violent behavior, antisocial personality disorder is a logical condition to study, since in vivo markers of monoamine oxidase A brain enzyme are reduced in key affect-modulating regions, and striatal levels of monoamine oxidase A show a relation with the functional connectivity of this same region. We utilized monoamine oxidase A genotyping and seed-to-voxel-based functional connectivity to investigate the relationship between genotype and corticostriatal connectivity in 21 male participants with severe antisocial personality disorder and 19 male healthy controls. Dorsal striatal connectivity to the frontal pole and anterior cingulate gyrus differentiated antisocial personality disorder subjects and healthy controls by monoamine oxidase A genotype. Furthermore, the linear relationship of proactive aggression to superior ventral striatal-angular gyrus functional connectivity differed by monoamine oxidase A genotype in the antisocial personality disorder groups. These results suggest that monoamine oxidase A genotype may affect corticostriatal connectivity in antisocial personality disorder and that these functional connections may also underlie use of proactive aggression in a genotype-specific manner.

Inducible antisense suppression of glycolate oxidase reveals its strong regulation over photosynthesis in rice.

PubMed

Xu, Huawei; Zhang, Jianjun; Zeng, Jiwu; Jiang, Linrong; Liu, Ee; Peng, Changlian; He, Zhenghui; Peng, Xinxiang

2009-01-01

Photorespiration is one of the most intensively studied topics in plant biology. While a number of mutants deficient in photorespiratory enzymes have been identified and characterized for their physiological functions, efforts on glycolate oxidase (GLO; EC 1.1.3.15) have not been so successful. This is a report about the generation of transgenic rice (Oryza sativa L.) plants carrying a GLO antisense gene driven by an estradiol-inducible promoter, which allowed for controllable suppressions of GLO and its detailed functional analyses. The GLO-suppressed plants showed typical photorespiration-deficient phenotypes. More intriguingly, it was found that a positive and linear correlation existed between GLO activities and the net photosynthetic rates (P(N)), and photoinhibition subsequently occurred once P(N) reduction surpassed 60%, indicating GLO can exert a strong regulation over photosynthesis. Various expression analyses identified that Rubisco activase was transcriptionally suppressed in the GLO-suppressed plants, consistent with the decreased Rubisco activation states. While the substrate glycolate accumulated substantially, few changes were observed for the product glyoxylate, and for some other downstream metabolites or genes as well in the transgenic plants. Further analyses revealed that isocitrate lyase and malate synthase, two key enzymes in the glyoxylate cycle, were highly up-regulated under GLO deficiency. Taken together, the results suggest that GLO is a typical photorespiratory enzyme and that it can exert a strong regulation over photosynthesis, possibly through a feed-back inhibition on Rubisco activase, and that the glyoxylate cycle may be partially activated to compensate for the photorespiratory glyoxylate when GLO is suppressed in rice.

In-Gel Determination of L-Amino Acid Oxidase Activity Based on the Visualization of Prussian Blue-Forming Reaction

PubMed Central

Zhou, Ning; Zhao, Chuntian

2013-01-01

L-amino acid oxidase (LAAO) is attracting increasing attention due to its important functions. Diverse detection methods with their own properties have been developed for characterization of LAAO. In the present study, a simple, rapid, sensitive, cost-effective and reproducible method for quantitative in-gel determination of LAAO activity based on the visualization of Prussian blue-forming reaction is described. Coupled with SDS-PAGE, this Prussian blue agar assay can be directly used to determine the numbers and approximate molecular weights of LAAO in one step, allowing straightforward application for purification and sequence identification of LAAO from diverse samples. PMID:23383337

Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

PubMed

Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

2016-01-10

Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.

Role of VPO1, a newly identified heme-containing peroxidase, in ox-LDL induced endothelial cell apoptosis

PubMed Central

Bai, Yong-Ping; Hu, Chang-Ping; Yuan, Qiong; Peng, Jun; Shi, Rui-Zheng; Yang, Tian-Lun; Cao, Ze-Hong; Li, Yuan-Jian; Cheng, Guangjie; Zhang, Guo-Gang

2013-01-01

Myeloperoxidase (MPO) is an important enzyme involved in the genesis and development of atherosclerosis. Vascular peroxidase 1 (VPO1) is a newly discovered member of the peroxidase family that is mainly expressed in vascular endothelial cells and smooth muscle cells and has structural characteristics and biological activity similar to those of MPO. Our specific aims were to explore the effects of VPO1 on endothelial cell apoptosis induced by oxidized low-density lipoprotein (ox-LDL) and the underlying mechanisms. The results showed that ox-LDL induced endothelial cell apoptosis and the expression of VPO1 in endothelial cells in a concentration- and time-dependent manner concomitant with increased intracellular reactive oxygen species (ROS) and hypochlorous acid (HOCl) generation, and up-regulated protein expression of the NADPH oxidase gp91phox subunit and phosphorylation of p38 MAPK. All these effects of ox-LDL were inhibited by VPO1 gene silencing and NADPH oxidase gp91phox subunit gene silencing or by pretreatment with the NADPH oxidase inhibitor apocynin or diphenyliodonium. The p38 MAPK inhibitor SB203580 or the caspase-3 inhibitor DEVD-CHO significantly inhibited ox-LDL-induced endothelial cell apoptosis, but had no effect on intracellular ROS and HOCl generation or the expression of NADPH oxidase gp91phox subunit or VPO1. Collectively, these findings suggest for the first time that VPO1 plays a critical role in ox-LDL-induced endothelial cell apoptosis and that there is a positive feedback loop between VPO1/HOCl and the now-accepted dogma that the NADPH oxidase/ROS/p38 MAPK/caspase-3 pathway is involved in ox-LDL-induced endothelial cell apoptosis. PMID:21820048

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

PubMed

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Batch production of Pyranose 2-oxidase from Trametes versicolor (ATCC 11235) in medium with a lignocellulosic substrate and enzymatic bleaching of cotton fabrics.

PubMed

Pazarlioglu, Nurdan Kasikara; Erden, Emre; Ucar, M Cigdem; Akkaya, Alper; Sariisik, A Merih

2012-04-01

The aim of this work was to determine new, different and low-cost substrates that can be used for enzyme production from the white rot fungus Trametes versicolor (ATCC 11235) by taking advantage of the broad substrate specificity of pyranose 2-oxidase. In this report, we investigated the production of pyranose 2-oxidase from T. versicolor (ATCC 11235) using ten different agricultural residues such as clover straw, almond shells, hazelnut cobs, grass and others. Pyranose 2-oxidase activity was determined as 2.332 U/g at the 9th day in a submerged culture containing clover straw and tap water shaken at 150 rpm and 26°C, and the optimum clover straw concentration was determined to be 12 g/l. The effects of different glucose, nitrogen and phosphate sources on the production of pyranose 2-oxidase were studied in the clover straw medium. Analyses of biomass, protein, reduced sugar and nitrogen concentrations were also monitored in a clover straw medium that did not contain carbon or nitrogen and phosphate sources under the parameters determined. The produced pyranose 2-oxidase was used for improving the properties of cotton fabrics.

Monoamine oxidase B layer-by-layer film fabrication and characterization toward dopamine detection.

PubMed

Miyazaki, Celina Massumi; Pereira, Tamyris Paschoal; Mascagni, Daniela Branco Tavares; de Moraes, Marli Leite; Ferreira, Marystela

2016-01-01

In this work nanostructured film composites of the monoamine oxidase B (MAO-B) enzyme, free or encapsulated in liposomes, were fabricated by the layer-by-layer (LbL) self-assembly technique, employing polyethylene imine (PEI) as polycation. Initially, the MAO-B enzyme was incorporated into liposomes in order to preserve its enzymatic structure ensuring their activity and catalytic stability. The LbL film growth was monitored by surface plasmon resonance (SPR) by gold resonance angle shift analysis after each bilayer deposition. Subsequently, the films were applied as amperometric biosensors for dopamine detection using Prussian Blue (PB) as the electron mediator. The biosensor fabricated by MAO-B incorporated into liposomes composed of DPPG:POPG in the ratio (1:4) (w/w) showed the best performance with a sensitivity of 0.86 (μA cm(-2))/(mmol L(-1)) and a detection limit of 0.33 mmol L(-1).

The use of glucose oxidase and catalase for the enzymatic reduction of the potential ethanol content in wine.

PubMed

Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred

2016-11-01

Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. Copyright © 2016. Published by Elsevier Ltd.

Association of LOXL1 Polymorphisms With Pseudoexfoliation, Glaucoma, Intraocular Pressure, and Systemic Diseases in a Greek Population. The Thessaloniki Eye Study

PubMed Central

Anastasopoulos, Eleftherios; Coleman, Anne L.; Wilson, M. Roy; Sinsheimer, Janet S.; Yu, Fei; Katafigiotis, Sokratis; Founti, Panayiota; Salonikiou, Angeliki; Pappas, Theofanis; Koskosas, Archimidis; Katopodi, Theodora; Lambropoulos, Alexandros; Topouzis, Fotis

2014-01-01

Purpose. To investigate the association of the two single-nucleotide polymorphisms (SNPs) in the lysyl oxidase-like 1 (LOXL1) gene with pseudoexfoliation syndrome (PEX), pseudoexfoliative glaucoma (PEXG), and primary open-angle glaucoma (POAG) in a Greek population–based setting, from the Thessaloniki Eye study. Methods. A total of 233 subjects with successful DNA extraction, PCR amplification, and genotyping were included in the genetic analysis of G153D and R141L SNPs of LOXL1 gene and classified into four groups: controls (n = 93); subjects with PEX (n = 40); POAG (n = 66); and PEXG (n = 34). Multinomial logistic regression was used to test their association with LOXL1 SNPs with adjustment for covariates. The association of LOXL1 with IOP (in untreated subjects) and with systemic diseases was explored. Results. Both LOXL1 SNPs were present in high frequencies in controls and cases. The G153D was strongly associated with both PEX (odds ratio [OR] = 23.2, P = 0.003 for allele G) and PEXG (OR = 24.75, P = 0.003 for allele G) and was not associated with POAG (P = 0.451). In contrast, the R141L was not associated with PEX (P = 0.81), PEXG (P = 0.063), or POAG (P = 0.113). No association of the G153D with either intraocular pressure (IOP) or systemic diseases was found. Conclusions. In the Thessaloniki Eye Study, the G153D SNP of LOXL1 gene was strongly associated with both PEX and PEXG, whereas the R141L was not associated. No association of the LOXL1 with IOP or with systemic diseases was found. These findings further support the hypothesis that the LOXL1 gene contributes to onset of PEXG through PEX. Gene variants of LOXL1 do not help to identify those with PEX at increased risk for glaucoma development. PMID:24917141

Tetrodotoxin detection and species identification of pufferfish in retail roasted fish fillet by DNA barcoding in China.

PubMed

Li, Nan; Shen, Qing; Wang, Jiahui; Han, Chunhui; Ji, Rong; Li, Fengqin; Jiang, Tao

2015-01-01

This study identifies the pufferfish species and detects tetrodotoxin (TTX) in roasted fish fillet samples collected in Beijing, Qingdao and Xiamen, China. The cytochrome c oxidase I (COI) gene was used as the target gene for identification of the pufferfish species in the samples. Enzyme-linked immunosorbent assay (ELISA) screened the TTX levels in samples that had been detected as containing pufferfish by DNA barcode. A total of 125 samples were identified by DNA barcodes; 32 (26%) samples contained pufferfish composition and, among them, 26 (81%) were the highly toxic species Lagocephalus lunaris. All 32 samples containing the pufferfish composition were positive for TTX with levels ranging from 100 to 63,800 ng g(-1). Most of the 32 samples contained the highly toxic L. lunaris. Based on the results, we suggest that the monitoring of roasted fish fillet should be strengthened and the processing procedures should be standardised to minimise TTX poisoning caused by pufferfish.

Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.

PubMed

Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M

2003-12-01

Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

Role of redox signaling in the autonomous proliferative response of endothelial cells to hypoxia.

PubMed

Schäfer, M; Schäfer, C; Ewald, N; Piper, H M; Noll, Th

2003-05-16

Endothelial cells exhibit an autonomous proliferative response to hypoxia, independent of paracrine effectors. In cultured endothelial cells of porcine aorta, we analyzed the signaling of this response, with a focus on the roles of redox signaling and the MEK/ERK pathway. Transient hypoxia (1 hour) stimulated proliferation by 61+/-4% (n=16; P<0.05 versus control), quantified after 24 hours normoxic postincubation. Hypoxia induced an activation of ERK2 and of NAD(P)H oxidase and a burst of reactive oxygen species (ROS), determined by DCF fluorescence. To inhibit the MEK/ERK pathway, we used PD 98059 (PD, 20 micromol/L); to downregulate NAD(P)H oxidase, we applied p22phox antisense oligonucleotides; and to inhibit mitochondrial ROS generation, we used the ubiquinone derivate mitoQ (MQ, 10 micromol/L). All three inhibitions suppressed the proliferative response: PD inhibited NAD(P)H oxidase activation; p22phox antisense transfection did not inhibit ERK2 activation, but suppressed ROS production; and MQ inhibited ERK2 activation and ROS production. The autonomous proliferative response depends on the MEK/ERK pathway and redox signaling steps upstream and downstream of ERK. Located upstream is ROS generation by mitochondria, downstream is NAD(P)H oxidase.

Ectopic expression of pumpkin gibberellin oxidases alters gibberellin biosynthesis and development of transgenic Arabidopsis plants.

PubMed

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-02-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.

Recent Progress on the Characterization of Aldonolactone Oxidoreductases

PubMed Central

Aboobucker, Siddique I; Lorence, Argelia

2015-01-01

l-Ascorbic acid (ascorbate, AsA, vitamin C) is essential for animal and plant health. Despite our dependence on fruits and vegetables to fulfill our requirement for this vitamin, the metabolic network leading to its formation in plants is just being fully elucidated. There is evidence supporting the operation of at least four biosynthetic pathways leading to AsA formation in plants. These routes use d-mannose/l-Galactose, l-gulose, d-galacturonate, and myo-inositol as the main precursors. This review focuses on aldonolactone oxidoreductases, a subgroup of the vanillyl alcohol oxidase (VAO; EC 1.1.3.38) superfamily, enzymes that catalyze the terminal step in AsA biosynthesis in bacteria, protozoa, animals, and plants. In this report, we review the properties of well characterized aldonolactone oxidoreductases to date. A shared feature in these proteins is the presence of a flavin cofactor as well as a thiol group. The flavin cofactor in many cases is bound to the N terminus of the enzymes or to a recently discovered HWXK motif in the C terminus. The binding between the flavin moiety and the protein can be either covalent or non-covalent. Substrate specificity and subcellular localization differ among the isozymes of each kingdom. All oxidases among these enzymes possess dehydrogenase activity, however, exclusive dehydrogenases are also found. We also discuss recent evidence indicating that plants have both l-gulono-1,4-lactone oxidases and l-Galactono-1,4-lactone dehydrogenases involved in AsA biosynthesis. PMID:26696130

Combined sequence and structure analysis of the fungal laccase family.

PubMed

Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

2003-08-20

Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal laccases. The identified motifs, L1-L4, can be useful in searching the newly sequenced genomes for putative laccase enzymes. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 83: 386-394, 2003.

Chemoheterotrophic Growth of the Cyanobacterium Anabaena sp. Strain PCC 7120 Dependent on a Functional Cytochrome c Oxidase

PubMed Central

Stebegg, Ronald; Wurzinger, Bernhard; Mikulic, Markus

2012-01-01

Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium commonly used as a model organism for studying cyanobacterial cell differentiation and nitrogen fixation. For many decades, this cyanobacterium was considered an obligate photo-lithoautotroph. We now discovered that this strain is also capable of mixotrophic, photo-organoheterotrophic, and chemo-organoheterotrophic growth if high concentrations of fructose (at least 50 mM and up to 200 mM) are supplied. Glucose, a substrate used by some facultatively organoheterotrophic cyanobacteria, is not effective in Anabaena sp. PCC 7120. The gtr gene from Synechocystis sp. PCC 6803 encoding a glucose carrier was introduced into Anabaena sp. PCC 7120. Surprisingly, the new strain containing the gtr gene did not grow on glucose but was very sensitive to glucose, with a 5 mM concentration being lethal, whereas the wild-type strain tolerated 200 mM glucose. The Anabaena sp. PCC 7120 strain containing gtr can grow mixotrophically and photo-organoheterotrophically, but not chemo-organoheterotrophically with fructose. Anabaena sp. PCC 7120 contains five respiratory chains ending in five different respiratory terminal oxidases. One of these enzymes is a mitochondrial-type cytochrome c oxidase. As in almost all cyanobacteria, this enzyme is encoded by three adjacent genes called coxBAC1. When this locus was disrupted, the cells lost the capability for chemo-organoheterotrophic growth. PMID:22730128

Improvement of the intracellular environment for enhancing l-arginine production of Corynebacterium glutamicum by inactivation of H2O2-forming flavin reductases and optimization of ATP supply.

PubMed

Man, Zaiwei; Rao, Zhiming; Xu, Meijuan; Guo, Jing; Yang, Taowei; Zhang, Xian; Xu, Zhenghong

2016-11-01

l-arginine, a semi essential amino acid, is an important amino acid in food flavoring and pharmaceutical industries. Its production by microbial fermentation is gaining more and more attention. In previous work, we obtained a new l-arginine producing Corynebacterium crenatum (subspecies of Corynebacterium glutamicum) through mutation breeding. In this work, we enhanced l-arginine production through improvement of the intracellular environment. First, two NAD(P)H-dependent H 2 O 2 -forming flavin reductases Frd181 (encoded by frd1 gene) and Frd188 (encoded by frd2) in C. glutamicum were identified for the first time. Next, the roles of Frd181 and Frd188 in C. glutamicum were studied by overexpression and deletion of the encoding genes, and the results showed that the inactivation of Frd181 and Frd188 was beneficial for cell growth and l-arginine production, owing to the decreased H 2 O 2 synthesis and intracellular reactive oxygen species (ROS) level, and increased intracellular NADH and ATP levels. Then, the ATP level was further increased by deletion of noxA (encoding NADH oxidase) and amn (encoding AMP nucleosidase), and overexpression of pgk (encoding 3-phosphoglycerate kinase) and pyk (encoding pyruvate kinase), and the l-arginine production and yield from glucose were significantly increased. In fed-batch fermentation, the l-arginine production and yield from glucose of the final strain reached 57.3g/L and 0.326g/g, respectively, which were 49.2% and 34.2% higher than those of the parent strain, respectively. ROS and ATP are important elements of the intracellular environment, and l-arginine biosynthesis requires a large amount of ATP. For the first time, we enhanced l-arginine production and yield from glucose through reducing the H 2 O 2 synthesis and increasing the ATP supply. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Activation of gibberellin 2-oxidase 6 decreases active gibberellin levels and creates a dominant semi-dwarf phenotype in rice (Oryza sativa L.).

PubMed

Huang, Jian; Tang, Ding; Shen, Yi; Qin, Baoxiang; Hong, Lilan; You, Aiqing; Li, Ming; Wang, Xin; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan

2010-01-01

Gibberellin (GA) 2-oxidase plays a key role in the GA catabolic pathway through 2beta-hydroxylation. In the present study, we isolated a CaMV 35S-enhancer activation tagged mutant, H032. This mutant exhibited a dominant dwarf and GA-deficient phenotype, with a final stature that was less than half of its wild-type counterpart. The endogenous bioactive GAs are markedly decreased in the H032 mutant, and application of bioactive GAs (GA(3) or GA(4)) can reverse the dwarf phenotype. The integrated T-DNA was detected 12.8 kb upstream of the OsGA2ox6 in the H032 genome by TAIL-PCR. An increased level of OsGA2ox6 mRNA was detected at a high level in the H032 mutant, which might be due to the enhancer role of the CaMV 35S promoter. RNAi and ectopic expression analysis of OsGA2ox6 indicated that the dwarf trait and the decreased levels of bioactive GAs in the H032 mutant were a result of the up-regulation of the OsGA2ox6 gene. BLASTP analysis revealed that OsGA2ox6 belongs to the class III of GA 2-oxidases, which is a novel type of GA2ox that uses C20-GAs (GA(12) and/or GA(53)) as the substrates. Interestingly, we found that a GA biosynthesis inhibitor, paclobutrazol, positively regulated the OsGA2ox6 gene. Unlike the over-expression of OsGA2ox1, which led to a high rate of seed abortion, the H032 mutant retained normal flowering and seed production. These results indicate that OsGA2ox6 mainly affects plant stature, and the dominant dwarf trait of the H032 mutant can be used as an efficient dwarf resource in rice breeding. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

African Swine Fever Virus pB119L Protein Is a Flavin Adenine Dinucleotide-Linked Sulfhydryl Oxidase

PubMed Central

Rodríguez, Irene; Redrejo-Rodríguez, Modesto; Rodríguez, Javier M.; Alejo, Alí; Salas, José; Salas, María L.

2006-01-01

Protein pB119L of African swine fever virus belongs to the Erv1p/Alrp family of sulfhydryl oxidases and has been described as a late nonstructural protein required for correct virus assembly. To further our knowledge of the function of protein pB119L during the virus life cycle, we have investigated whether this protein possesses sulfhydryl oxidase activity, using a purified recombinant protein. We show that the purified protein contains bound flavin adenine dinucleotide and is capable of catalyzing the formation of disulfide bonds both in a protein substrate and in the small molecule dithiothreitol, the catalytic activity being comparable to that of the Erv1p protein. Furthermore, protein pB119L contains the cysteines of its active-site motif CXXC, predominantly in an oxidized state, and forms noncovalently bound dimers in infected cells. We also show in coimmunoprecipitation experiments that protein pB119L interacts with the viral protein pA151R, which contains a CXXC motif similar to that present in thioredoxins. Protein pA151R, in turn, was found to interact with the viral structural protein pE248R, which contains disulfide bridges and belongs to a class of myristoylated proteins related to vaccinia virus L1R, one of the substrates of the redox pathway encoded by this virus. These results suggest the existence in African swine fever virus of a system for the formation of disulfide bonds constituted at least by proteins pB119L and pA151R and identify protein pE248R as a possible final substrate of this pathway. PMID:16537584

African swine fever virus pB119L protein is a flavin adenine dinucleotide-linked sulfhydryl oxidase.

PubMed

Rodríguez, Irene; Redrejo-Rodríguez, Modesto; Rodríguez, Javier M; Alejo, Alí; Salas, José; Salas, María L

2006-04-01

Protein pB119L of African swine fever virus belongs to the Erv1p/Alrp family of sulfhydryl oxidases and has been described as a late nonstructural protein required for correct virus assembly. To further our knowledge of the function of protein pB119L during the virus life cycle, we have investigated whether this protein possesses sulfhydryl oxidase activity, using a purified recombinant protein. We show that the purified protein contains bound flavin adenine dinucleotide and is capable of catalyzing the formation of disulfide bonds both in a protein substrate and in the small molecule dithiothreitol, the catalytic activity being comparable to that of the Erv1p protein. Furthermore, protein pB119L contains the cysteines of its active-site motif CXXC, predominantly in an oxidized state, and forms noncovalently bound dimers in infected cells. We also show in coimmunoprecipitation experiments that protein pB119L interacts with the viral protein pA151R, which contains a CXXC motif similar to that present in thioredoxins. Protein pA151R, in turn, was found to interact with the viral structural protein pE248R, which contains disulfide bridges and belongs to a class of myristoylated proteins related to vaccinia virus L1R, one of the substrates of the redox pathway encoded by this virus. These results suggest the existence in African swine fever virus of a system for the formation of disulfide bonds constituted at least by proteins pB119L and pA151R and identify protein pE248R as a possible final substrate of this pathway.

Effects of the lipid regulating drug clofibric acid on PPARα-regulated gene transcript levels in common carp (Cyprinus carpio) at pharmacological and environmental exposure levels.

PubMed

Corcoran, Jenna; Winter, Matthew J; Lange, Anke; Cumming, Rob; Owen, Stewart F; Tyler, Charles R

2015-04-01

In mammals, the peroxisome proliferator-activated receptor α (PPARα) plays a key role in regulating various genes involved in lipid metabolism, bile acid synthesis and cholesterol homeostasis, and is activated by a diverse group of compounds collectively termed peroxisome proliferators (PPs). Specific PPs have been detected in the aquatic environment; however little is known on their pharmacological activity in fish. We investigated the bioavailability and persistence of the human PPARα ligand clofibric acid (CFA) in carp, together with various relevant endpoints, at a concentration similar to therapeutic levels in humans (20mg/L) and for an environmentally relevant concentration (4μg/L). Exposure to pharmacologically-relevant concentrations of CFA resulted in increased transcript levels of a number of known PPARα target genes together with increased acyl-coA oxidase (Acox1) activity, supporting stimulation of lipid metabolism pathways in carp which are known to be similarly activated in mammals. Although Cu,Zn-superoxide dismutase (Sod1) activity was not affected, mRNA levels of several biotransformation genes were also increased, paralleling previous reports in mammals and indicating a potential role in hepatic detoxification for PPARα in carp. Importantly, transcription of some of these genes (and Acox1 activity) were affected at exposure concentrations comparable with those reported in effluent discharges. Collectively, these data suggest that CFA is pharmacologically active in carp and has the potential to invoke PPARα-related responses in fish exposed in the environment, particularly considering that CFA may represent just one of a number of PPAR-active compounds present to which wild fish may be exposed. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Effects of the lipid regulating drug clofibric acid on PPARα-regulated gene transcript levels in common carp (Cyprinus carpio) at pharmacological and environmental exposure levels

PubMed Central

Corcoran, Jenna; Winter, Matthew J.; Lange, Anke; Cumming, Rob; Owen, Stewart F.; Tyler, Charles R.

2015-01-01

In mammals, the peroxisome proliferator-activated receptor α (PPARα) plays a key role in regulating various genes involved in lipid metabolism, bile acid synthesis and cholesterol homeostasis, and is activated by a diverse group of compounds collectively termed peroxisome proliferators (PPs). Specific PPs have been detected in the aquatic environment; however little is known on their pharmacological activity in fish. We investigated the bioavailability and persistence of the human PPARα ligand clofibric acid (CFA) in carp, together with various relevant endpoints, at a concentration similar to therapeutic levels in humans (20 mg/L) and for an environmentally relevant concentration (4 μg/L). Exposure to pharmacologically-relevant concentrations of CFA resulted in increased transcript levels of a number of known PPARα target genes together with increased acyl-coA oxidase (Acox1) activity, supporting stimulation of lipid metabolism pathways in carp which are known to be similarly activated in mammals. Although Cu,Zn-superoxide dismutase (Sod1) activity was not affected, mRNA levels of several biotransformation genes were also increased, paralleling previous reports in mammals and indicating a potential role in hepatic detoxification for PPARα in carp. Importantly, transcription of some of these genes (and Acox1 activity) were affected at exposure concentrations comparable with those reported in effluent discharges. Collectively, these data suggest that CFA is pharmacologically active in carp and has the potential to invoke PPARα-related responses in fish exposed in the environment, particularly considering that CFA may represent just one of a number of PPAR-active compounds present to which wild fish may be exposed. PMID:25749508

The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

ERIC Educational Resources Information Center

Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

2011-01-01

Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

Cognitive Function in Prepubertal Children with Obstructive Sleep Apnea: A Modifying Role for NADPH Oxidase p22 Subunit Gene Polymorphisms?

PubMed Central

Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan

2012-01-01

Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunner, H.G.; Nelen, M.; Ropers, H.H.

1993-10-22

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

PubMed

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

High-level expression of a sika deer (Cervus nippon) Cu/Zn superoxide dismutase in Pichia pastoris and its characterization.

PubMed

Li, Ren-Kuan; Fu, Cai-Li; Chen, Ping; Ng, Tzi Bun; Ye, Xiu-Yun

2013-03-01

Production of a sika deer Cu/Zn-SOD was achieved in Pichia pastoris after the reconstituted expression vector pPIC9K was transformed into the strain GS115. By employing Saccharomyces cerevisiae secretion signal peptide (α-factor) under the regulation of the methanol-inducible promoter of the gene of alcohol oxidase 1 (AOX1), sika deer Cu/Zn-SOD with a molecular mass of 16kDa was expressed while recombinant sika deer Cu/Zn-SOD with an activity of 3500U/mL was obtained from a 5L bioreactor. After two successive steps of chromatography on DEAE-650C and Superdex75, recombinant sika deer Cu/Zn-SOD was obtained with 13.8% yield, 14.5-fold purification, and a specific activity of 3447U/mg. Its optimum temperature and optimum pH were 40°C and 7.0, respectively. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

Acetyl-L-carnitine supplementation to old rats partially reverts the age-related mitochondrial decay of soleus muscle by activating peroxisome proliferator-activated receptor gamma coactivator-1alpha-dependent mitochondrial biogenesis.

PubMed

Pesce, Vito; Fracasso, Flavio; Cassano, Pierluigi; Lezza, Angela Maria Serena; Cantatore, Palmiro; Gadaleta, Maria Nicola

2010-01-01

The age-related decay of mitochondrial function is a major contributor to the aging process. We tested the effects of 2-month-daily acetyl-L-carnitine (ALCAR) supplementation on mitochondrial biogenesis in the soleus muscle of aged rats. This muscle is heavily dependent on oxidative metabolism. Mitochondrial (mt) DNA content, citrate synthase activity, transcript levels of some nuclear- and mitochondrial-coded genes (cytochrome c oxidase subunit IV [COX-IV], 16S rRNA, COX-I) and of some factors involved in the mitochondrial biogenesis signaling pathway (peroxisome proliferator-activated receptor gamma [PPARgamma] coactivator-1alpha [PGC-1alpha], mitochondrial transcription factor A mitochondrial [TFAM], mitochondrial transcription factor 2B [TFB2]), as well as the protein content of PGC-1alpha were determined. The results suggest that the ALCAR treatment in old rats activates PGC-1alpha-dependent mitochondrial biogenesis, thus partially reverting the age-related mitochondrial decay.

Monoamine Oxidase and Dopamine β-Hydroxylase Inhibitors from the Fruits of Gardenia jasminoides

PubMed Central

Kim, Ji Ho; Kim, Gun Hee; Hwang, Keum Hee

2012-01-01

This research was designed to determine what components of Gardenia jasminoides play a major role in inhibiting the enzymes related antidepressant activity of this plant. In our previous research, the ethyl acetate fraction of G. jasminosides fruits inhibited the activities of both monoamine oxidase-A (MAO-A) and monoamine oxidase-B (MAO-B), and oral administration of the ethanolic extract slightly increased serotonin concentrations in the brain tissues of rats and decreased MAO-B activity. In addition, we found through in vitro screening test that the ethyl acetate fraction showed modest inhibitory activity on dopamine-β hydroxylase (DBH). The bioassay-guided fractionation led to the isolation of five bio-active compounds, protocatechuic acid (1), geniposide (2), 6'-O-trans-p-coumaroylgeniposide (3), 3,5-d-ihydroxy-1,7-bis (4-hydroxyphenyl) heptanes (4), and ursolic acid (5), from the ethyl acetate fraction of G. jasminoides fruits. The isolated compounds showed different inhibitory potentials against MAO-A, -B, and DBH. Protocatechuic acid showed potent inhibition against MAO-B (IC50 300 μmol/L) and DBH (334 μmol/L), exhibiting weak MAO-A inhibition (2.41 mmol/L). Two iridoid glycosides, geniposide (223 μmol/L) and 6'-O-trans-p-coumaroylgeniposide (127μmol/L), were selective MAO-B inhibitor. Especially, 6'-O-trans-p-coumaroylgeniposide exhibited more selective MAO-B inhibition than deprenyl, well-known MAO-B inhibitor for the treatment of early-stage Parkinson’s disease. The inhibitory activity of 3,5-di-hydroxy-1,7-bis (4-hydroxyphenyl) heptane was strong for MAO-B (196 μmol/L), modest for MAO-A (400 μmol/L), and weak for DBH (941 μmol/L). Ursolic acid exhibited significant inhibition of DBH (214 μmol/L), weak inhibition of MAO-B (780 μmol/L), and no inhibition against MAO-A. Consequently, G. jasminoides fruits are considerable for development of biofunctional food materials for the combination treatment of depression and neurodegenerative disorders. PMID:24116298

Two NADPH oxidase isoforms are required for sexual reproduction and ascospore germination in the filamentous fungus Podospora anserina.

PubMed

Malagnac, Fabienne; Lalucque, Hervé; Lepère, Gersende; Silar, Philippe

2004-11-01

NADPH oxidases are enzymes that produce reactive oxygen species (ROS) using electrons derived from intracellular NADPH. In plants and mammals, ROS have been proposed to be second messengers that signal defence responses or cell proliferation. By inactivating PaNox1 and PaNox2, two genes encoding NADPH oxidases, we demonstrate the crucial role of these enzymes in the control of two key steps of the filamentous fungus Podospora anserina life cycle. PaNox1 mutants are impaired in the differentiation of fruiting bodies from their progenitor cells, and the deletion of the PaNox2 gene specifically blocks ascospore germination. Furthermore, we show that PaNox1 likely acts upstream of PaASK1, a MAPKKK previously implicated in stationary phase differentiation and cell degeneration. Using nitro blue tetrazolium (NBT) and diaminobenzidine (DAB) assays, we detect a regulated secretion of both superoxide and peroxide during P. anserina vegetative growth. In addition, two oxidative bursts are shown to occur during fruiting body development and ascospore germination. Analysis of mutants establishes that PaNox1, PaNox2, and PaASK1, as well as a still unknown additional source of ROS, modulate these secretions. Altogether, our data point toward a role for NADPH oxidases in signalling fungal developmental transitions with respect to nutrient availability. These enzymes are conserved in other multicellular eukaryotes, suggesting that early eukaryotes were endowed with a redox network used for signalling purposes.

Contribution of cytochrome P450 1B1 to hypertension and associated pathophysiology: a novel target for antihypertensive agents.

PubMed

Malik, Kafait U; Jennings, Brett L; Yaghini, Fariborz A; Sahan-Firat, Seyhan; Song, Chi Young; Estes, Anne M; Fang, Xiao R

2012-08-01

The aim of this review is to discuss the contribution of cytochrome P450 (CYP) 1B1 in vascular smooth muscle cell growth, hypertension, and associated pathophysiology. CYP1B1 is expressed in cardiovascular and renal tissues, and mediates angiotensin II (Ang II)-induced activation of NADPH oxidase and generation of reactive oxygen species (ROS), and vascular smooth muscle cell migration, proliferation, and hypertrophy. Moreover, CYP1B1 contributes to the development and/or maintenance of hypertension produced by Ang II-, deoxycorticosterone (DOCA)-salt-, and N(ω)-nitro-L-arginine methyl ester-induced hypertension and in spontaneously hypertensive rats. The pathophysiological changes, including cardiovascular hypertrophy, increased vascular reactivity, endothelial and renal dysfunction, injury and inflammation associated with Ang II- and/or DOCA-salt induced hypertension in rats, and Ang II-induced hypertension in mice are minimized by inhibition of CYP1B1 activity with 2,4,3',5'-tetramethoxystilbene or by Cyp1b1 gene disruption in mice. These pathophysiological changes appear to be mediated by increased production of ROS via CYP1B1-dependent NADPH oxidase activity and extracellular signal-regulated kinase 1/2, p38 mitogen-activated protein kinase, and c-Src. Copyright © 2011 Elsevier Inc. All rights reserved.

Contribution of Cytochrome P450 1B1 to Hypertension and Associated Pathophysiology: A Novel Target for Antihypertensive Agents

PubMed Central

Malik, Kafait U.; Jennings, Brett L.; Yaghini, Fariborz A.; Sahan-Firat, Seyhan; Song, Chi Young; Estes, Anne M.; Fang, Xiao R.

2012-01-01

The aim of this review is to discuss the contribution of cytochrome P450 (CYP) 1B1 in vascular smooth muscle cell growth, hypertension, and associated pathophysiology. CYP1B1 is expressed in cardiovascular and renal tissues, and mediates angiotensin II (Ang II)-induced activation of NADPH oxidase and generation of reactive oxygen species (ROS), and vascular smooth muscle cell migration, proliferation, and hypertrophy. Moreover, CYP1B1 contributes to the development and/or maintenance of hypertension produced by Ang II-, deoxycorticosterone Nω-nitro-(DOCA)-salt-, and L-arginine methyl ester-induced hypertension and in spontaneously hypertensive rats. The pathophysiological changes, including cardiovascular hypertrophy, increased vascular reactivity, endothelial and renal dysfunction, injury and inflammation associated with Ang II- and/or DOCA-salt induced hypertension in rats, and Ang II-induced hypertension in mice are minimized by inhibition of CYP1B1 activity with 2,4,3′,5′-tetramethoxystilbene or by Cyp1b1 gene disruption in mice. These pathophysiological changes appear to be mediated by increased production of ROS via CYP1B1-dependent NADPH oxidase activity and extracellular signal-regulated kinase 1/2, p38 mitogen-activated protein kinase, and c-Src. PMID:22210049

Limitations of cytochrome oxidase I for the barcoding of Neritidae (Mollusca: Gastropoda) as revealed by Bayesian analysis.

PubMed

Chee, S Y

2015-05-25

The mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) gene has been universally and successfully utilized as a barcoding gene, mainly because it can be amplified easily, applied across a wide range of taxa, and results can be obtained cheaply and quickly. However, in rare cases, the gene can fail to distinguish between species, particularly when exposed to highly sensitive methods of data analysis, such as the Bayesian method, or when taxa have undergone introgressive hybridization, over-splitting, or incomplete lineage sorting. Such cases require the use of alternative markers, and nuclear DNA markers are commonly used. In this study, a dendrogram produced by Bayesian analysis of an mtDNA COI dataset was compared with that of a nuclear DNA ATPS-α dataset, in order to evaluate the efficiency of COI in barcoding Malaysian nerites (Neritidae). In the COI dendrogram, most of the species were in individual clusters, except for two species: Nerita chamaeleon and N. histrio. These two species were placed in the same subcluster, whereas in the ATPS-α dendrogram they were in their own subclusters. Analysis of the ATPS-α gene also placed the two genera of nerites (Nerita and Neritina) in separate clusters, whereas COI gene analysis placed both genera in the same cluster. Therefore, in the case of the Neritidae, the ATPS-α gene is a better barcoding gene than the COI gene.

Purification, characterization and amino acid content of cholesterol oxidase produced by Streptomyces aegyptia NEAE 102.

PubMed

El-Naggar, Noura El-Ahmady; Deraz, Sahar F; Soliman, Hoda M; El-Deeb, Nehal M; El-Shweihy, Nancy M

2017-03-29

There is an increasing demand on cholesterol oxidase for its various industrial and clinical applications. The current research was focused on extracellular cholesterol oxidase production under submerged fermentation by a local isolate previously identified as Streptomyces aegyptia NEAE 102. The crude enzyme extract was purified by two purification steps, protein precipitation using ammonium sulfate followed by ion exchange chromatography using DEAE Sepharose CL-6B. The kinetic parameters of purified cholesterol oxidase from Streptomyces aegyptia NEAE 102 were studied. The best conditions for maximum cholesterol oxidase activity were found to be 105 min of incubation time, an initial pH of 7 and temperature of 37 °C. The optimum substrate concentration was found to be 0.4 mM. The higher thermal stability behavior of cholesterol oxidase was at 50 °C. Around 63.86% of the initial activity was retained by the enzyme after 20 min of incubation at 50 °C. The apparent molecular weight of the purified enzyme as sized by sodium dodecyl sulphate-polyacryalamide gel electrophoresis was approximately 46 KDa. On DEAE Sepharose CL-6B column cholesterol oxidase was purified to homogeneity with final specific activity of 16.08 U/mg protein and 3.14-fold enhancement. The amino acid analysis of the purified enzyme produced by Streptomyces aegyptia NEAE 102 illustrated that, cholesterol oxidase is composed of 361 residues with glutamic acid as the most represented amino acid with concentration of 11.49 μg/mL. Taking into account the extracellular production, wide pH tolerance, thermal stability and shelf life, cholesterol oxidase produced by Streptomyces aegyptia NEAE 102 suggested that the enzyme could be industrially useful.

NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

PubMed Central

Ushio-Fukai, Masuko; Malik, Asrar B.

2009-01-01

Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

PubMed Central

Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

2008-01-01

Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

Tumour necrosis factor-alpha participates on the endothelin-1/nitric oxide imbalance in small arteries from obese patients: role of perivascular adipose tissue.

PubMed

Virdis, Agostino; Duranti, Emiliano; Rossi, Chiara; Dell'Agnello, Umberto; Santini, Eleonora; Anselmino, Marco; Chiarugi, Massimo; Taddei, Stefano; Solini, Anna

2015-04-01

We assessed the impact of vascular and perivascular tumour necrosis factor-alpha (TNF-α) on the endothelin (ET)-1/nitric oxide (NO) system and the molecular pathways involved in small arteries from visceral fat of obese patients (Obese) and Controls. Isolated small arteries from 16 Obese and 14 Controls were evaluated on a pressurized micromyograph. Endogenous ET-1 activity was assessed by the ETA blocker BQ-123. TNF-α and NO were tested by anti-TNF-α infliximab (IFX) and N(ω)-nitro-l-arginine methylester (L-NAME). Gene and protein expression of TNF-α, ET-1, ETA, and ETB receptors were determined by RT-PCR and IHC on arterial wall and in isolated adipocytes. Obese showed a blunted L-NAME-induced vasoconstriction, which was potentiated by IFX, and an increased relaxation to BQ-123, unaffected by L-NAME but attenuated by IFX. Perivascular adipose tissue (PVAT) removal reversed these effects. Obese showed intravascular superoxide excess, which was decreased by apocynin (NAD(P)H oxidase inhibitor), L-NAME, and BQ-123 incubations, and abolished by IFX. An increased vascular expression of ET-1, ETA, and ETB receptors, and higher vascular/perivascular TNF-α and TNF-α receptor expression were also detected. The arterial expression and phosphorylation of c-Jun N-terminal kinase (JNK) were higher in Obese vs. Controls, and downregulated by IFX. In small arteries of Obese, PVAT-derived TNF-α excess, and an increased vascular expression of ET-1 and ETA receptor, contribute to the ET-1/NO system imbalance, by impairing tonic NO release. Reactive oxygen species excess, via NAD(P)H oxidase activation, induces the endothelial nitric oxide synthase uncoupling, which in turn generates superoxide and impairs NO production. The up-regulated JNK pathway represents a crucial molecular signalling involved in this process. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

Enzymatic improvement of mitochondrial thiol oxidase Erv1 for oxidized glutathione fermentation by Saccharomyces cerevisiae.

PubMed

Kobayashi, Jyumpei; Sasaki, Daisuke; Hara, Kiyotaka Y; Hasunuma, Tomohisa; Kondo, Akihiko

2017-03-15

Oxidized glutathione (GSSG) is the preferred form for industrial mass production of glutathione due to its high stability compared with reduced glutathione (GSH). In our previous study, over-expression of the mitochondrial thiol oxidase ERV1 gene was the most effective for high GSSG production in Saccharomyces cerevisiae cells among three types of different thiol oxidase genes. We improved Erv1 enzyme activity for oxidation of GSH and revealed that S32 and N34 residues are critical for the oxidation. Five engineered Erv1 variant proteins containing S32 and/or N34 replacements exhibited 1.7- to 2.4-fold higher in vitro GSH oxidation activity than that of parental Erv1, whereas the oxidation activities of these variants for γ-glutamylcysteine were comparable. According to three-dimensional structures of Erv1 and protein stability assays, S32 and N34 residues interact with nearby residues through hydrogen bonding and greatly contribute to protein stability. These results suggest that increased flexibility by amino acid replacements around the active center decrease inhibitory effects on GSH oxidation. Over-expressions of mutant genes coding these Erv1 variants also increased GSSG and consequently total glutathione production in S. cerevisiae cells. Over-expression of the ERV1 S32A gene was the most effective for GSSG production in S. cerevisiae cells among the parent and other mutant genes, and it increased GSSG production about 1.5-fold compared to that of the parental ERV1 gene. This is the first study demonstrating the pivotal effects of S32 and N34 residues to high GSH oxidation activity of Erv1. Furthermore, in vivo validity of Erv1 variants containing these S32 and N34 replacements were also demonstrated. This study indicates potentials of Erv1 for high GSSG production.

Antioxidant and anti-inflammatory effects of Scoparia dulcis L.

PubMed

Coulibaly, Ahmed Y; Kiendrebeogo, Martin; Kehoe, Patrick G; Sombie, Pierre A E D; Lamien, Charles E; Millogo, Jeanne F; Nacoulma, Odile G

2011-12-01

Different extracts were obtained from Scoparia dulcis L. (Scrophulariaceae) by successive extraction with hexane, chloroform, and methanol. These extracts exhibited significant antioxidant capacity in various antioxidant models mediated (xantine oxidase and lipoxygenase) or not mediated (2,2-diphenyl-picrylhydrazyl, ferric-reducing antioxidant power, β-carotene bleaching, lipid peroxidation) by enzymes. The antioxidant activity of the extracts was related to their phytochemical composition in terms of polyphenol and carotenoid contents. The chloroform extract was richest in phytochemicals and had the highest antioxidant activity in the different antioxidant systems. All the extracts exhibited less than 50% inhibition on xanthine oxidase but more than 50% inhibition on lipid peroxidation and lipoxygenase. The extracts strongly inhibited lipid peroxidation mediated by lipoxygenase.

The interactive effect of the MAOA-VNTR genotype and childhood abuse on aggressive behaviors in Chinese male adolescents.

PubMed

Zhang, Yun; Ming, Qingsen; Wang, Xiang; Yao, Shuqiao

2016-06-01

Gene-environment interactions that moderate aggressive behavior have been identified in association with the MAOA (monoamine oxidase A) gene. The present study examined the moderating effect of MAOA-VNTR (variable number of tandem repeats) on aggression behavior relating to child abuse among Chinese adolescents. A sample of 507 healthy Chinese male adolescents completed the Child Trauma Questionnaire-Short Form (CTQ-SF) and Youth Self-report of the Child Behavior Checklist. The participants' buccal cells were sampled and subjected to DNA analysis. The effects of childhood abuse (CTQ-SF scores), MAOA-VNTR [high-activity allele (H) versus low-activity allele (L)], and their interaction in aggressive behaviors were analyzed by linear regression. Child maltreatment was found to be a significant independent factor in the manifestation of aggressive behavior, whereas MAOA activity was not. There was a significant interaction between MAOA-VNTR and childhood maltreatment in the exhibition of aggressive behaviors. In the context of physical or emotional abuse, boys in the MAOA-L group showed a greater tendency toward aggression than those in the MAOA-H group. Aggressive behavior arising from childhood maltreatment is moderated by MAOA-VNTR, which may be differentially sensitive to the subtype of childhood maltreatment experienced, among Chinese adolescents.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

Targeting Mechanisms of Resistance to Taxane-Based Chemotherapy

DTIC Science & Technology

2007-09-01

gene ; monoamine oxidase A ( MAOA ) was upregulated in patients with PSA relapse (Figure 5A). Quantitative real-time PCR (qRT-PCR) was performed to...resistance and uncover mechanisms or pathways suitable for targeting with the objective of improving tumor responses to chemotherapy. Gene expression...CXCL10 but not IL8 conferring chemoresistance to prostate cancer cells. When using longer term clinical outcome, we found genes correlated with PSA

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

PubMed

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

PubMed

Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

2013-09-10

Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

Arsenic bioremediation potential of a new arsenite-oxidizing bacterium Stenotrophomonas sp. MM-7 isolated from soil.

PubMed

Bahar, Md Mezbaul; Megharaj, Mallavarapu; Naidu, Ravi

2012-11-01

A new arsenite-oxidizing bacterium was isolated from a low arsenic-containing (8.8 mg kg(-1)) soil. Phylogenetic analysis based on 16S rRNA gene sequencing indicated that the strain was closely related to Stenotrophomonas panacihumi. Batch experiment results showed that the strain completely oxidized 500 μM of arsenite to arsenate within 12 h of incubation in a minimal salts medium. The optimum initial pH range for arsenite oxidation was 5-7. The strain was found to tolerate as high as 60 mM arsenite in culture media. The arsenite oxidase gene was amplified by PCR with degenerate primers. The deduced amino acid sequence showed the highest identity (69.1 %) with the molybdenum containing large subunit of arsenite oxidase derived from Bosea sp. Furthermore the amino acids involved in binding the substrate arsenite, were conserved with the arsenite oxidases of other arsenite oxidizing bacteria such as Alcaligenes feacalis and Herminnimonas arsenicoxydans. To our knowledge, this study constitutes the first report on arsenite oxidation using Stenotrophomonas sp. and the strain has great potential for application in arsenic remediation of contaminated water.

Khz-cp (crude polysaccharide extract obtained from the fusion of Ganoderma lucidum and Polyporus umbellatus mycelia) induces apoptosis by increasing intracellular calcium levels and activating P38 and NADPH oxidase-dependent generation of reactive oxygen species in SNU-1 cells.

PubMed

Kim, Tae Hwan; Kim, Ju Sung; Kim, Zoo Haye; Huang, Ren Bin; Chae, Young Lye; Wang, Ren Sheng

2014-07-10

Khz-cp is a crude polysaccharide extract that is obtained after nuclear fusion in Ganoderma lucidum and Polyporus umbellatus mycelia (Khz). It inhibits the growth of cancer cells. Khz-cp was extracted by solvent extraction. The anti-proliferative activity of Khz-cp was confirmed by using Annexin-V/PI-flow cytometry analysis. Intracellular calcium increase and measurement of intracellular reactive oxygen species (ROS) were performed by using flow cytometry and inverted microscope. SNU-1 cells were treated with p38, Bcl-2 and Nox family siRNA. siRNA transfected cells was employed to investigate the expression of apoptotic, growth and survival genes in SNU-1 cells. Western blot analysis was performed to confirm the expression of the genes. In the present study, Khz-cp induced apoptosis preferentially in transformed cells and had only minimal effects on non-transformed cells. Furthermore, Khz-cp was found to induce apoptosis by increasing the intracellular Ca2+ concentration ([Ca2+]i) and activating P38 to generate reactive oxygen species (ROS) via NADPH oxidase and the mitochondria. Khz-cp-induced apoptosis was caspase dependent and occurred via a mitochondrial pathway. ROS generation by NADPH oxidase was critical for Khz-cp-induced apoptosis, and although mitochondrial ROS production was also required, it appeared to occur secondary to ROS generation by NADPH oxidase. Activation of NADPH oxidase was shown by the translocation of the regulatory subunits p47phox and p67phox to the cell membrane and was necessary for ROS generation by Khz-cp. Khz-cp triggered a rapid and sustained increase in [Ca2+]i that activated P38. P38 was considered to play a key role in the activation of NADPH oxidase because inhibition of its expression or activity abrogated membrane translocation of the p47phox and p67phox subunits and ROS generation. In summary, these data indicate that Khz-cp preferentially induces apoptosis in cancer cells and that the signaling mechanisms involve an increase in [Ca2+]i, P38 activation, and ROS generation via NADPH oxidase and mitochondria.

Mitochondrial cytochrome c oxidase subunit 1 gene and nuclear rDNA regions of Enterobius vermicularis parasitic in captive chimpanzees with special reference to its relationship with pinworms in humans.

PubMed

Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo

2006-12-01

Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.

Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

PubMed Central

Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

2009-01-01

Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

Comparative genomics and transcriptome analysis of Aspergillus niger and metabolic engineering for citrate production

PubMed Central

Yin, Xian; Shin, Hyun-dong; Li, Jianghua; Du, Guocheng; Liu, Long; Chen, Jian

2017-01-01

Despite a long and successful history of citrate production in Aspergillus niger, the molecular mechanism of citrate accumulation is only partially understood. In this study, we used comparative genomics and transcriptome analysis of citrate-producing strains—namely, A. niger H915-1 (citrate titer: 157 g L−1), A1 (117 g L−1), and L2 (76 g L−1)—to gain a genome-wide view of the mechanism of citrate accumulation. Compared with A. niger A1 and L2, A. niger H915-1 contained 92 mutated genes, including a succinate-semialdehyde dehydrogenase in the γ-aminobutyric acid shunt pathway and an aconitase family protein involved in citrate synthesis. Furthermore, transcriptome analysis of A. niger H915-1 revealed that the transcription levels of 479 genes changed between the cell growth stage (6 h) and the citrate synthesis stage (12 h, 24 h, 36 h, and 48 h). In the glycolysis pathway, triosephosphate isomerase was up-regulated, whereas pyruvate kinase was down-regulated. Two cytosol ATP-citrate lyases, which take part in the cycle of citrate synthesis, were up-regulated, and may coordinate with the alternative oxidases in the alternative respiratory pathway for energy balance. Finally, deletion of the oxaloacetate acetylhydrolase gene in H915-1 eliminated oxalate formation but neither influence on pH decrease nor difference in citrate production were observed. PMID:28106122

Novel strategy for phenyllactic acid biosynthesis from phenylalanine by whole cell recombinant Escherichia coli coexpressing L-phenylalanine oxidase and L-lactate dehydrogenase.

PubMed

Zhang, Jianzhi; Li, Xi

2018-01-01

To enhance the efficiency of phenyllactic acid (PLA) production from L-phenylalanine (L-Phe) by introducing a novel artificial pathway into Escherichia coli RESULTS: The production of PLA from L-Phe by recombinant E. coli (ldh-lpox) coexpressing L-phenylalanine oxidase and L-lactate dehydrogenase was studied. The new PLA synthesis pathway was confirmed to be efficient in recombinant E. coli. Subsequently, two different biocatalyst processes were carried out and optimized for PLA production. In the whole cell biosynthesis process at high cell density using collected recombinant cells as catalyst, at optimal conditions (L-Phe 6 g/l, pH 7.5, 35 °C, CDW 24.5 g/l and 200 rpm), the recombinant E. coli (ldh-lpox) produced 1.62 g PLA/l with a conversion of 28% from L-Phe. Similarly, during the two-temperature-stage fermentation process in flasks using IPTG-induced cells, the temperature in the second stage was increased to 35 °C to benefit the biocatalyst process, and comparable phenyllactic acid production of 1.47 g/l was obtained from 12 g L-Phe/l. Recombinant E. coli (ldh-lpox) was efficient in PLA production realizing a high titer of several folds compared with studies using L-Phe as substrate.

Minimizing the effects of oxygen interference on l-lactate sensors by a single amino acid mutation in Aerococcus viridansl-lactate oxidase.

PubMed

Hiraka, Kentaro; Kojima, Katsuhiro; Lin, Chi-En; Tsugawa, Wakako; Asano, Ryutaro; La Belle, Jeffrey T; Sode, Koji

2018-04-30

l-lactate biosensors employing l-lactate oxidase (LOx) have been developed mainly to measure l-lactate concentration for clinical diagnostics, sports medicine, and the food industry. Some l-lactate biosensors employ artificial electron mediators, but these can negatively impact the detection of l-lactate by competing with the primary electron acceptor: molecular oxygen. In this paper, a strategic approach to engineering an AvLOx that minimizes the effects of oxygen interference on sensor strips was reported. First, we predicted an oxygen access pathway in Aerococcus viridans LOx (AvLOx) based on its crystal structure. This was subsequently blocked by a bulky amino acid substitution. The resulting Ala96Leu mutant showed a drastic reduction in oxidase activity using molecular oxygen as the electron acceptor and a small increase in dehydrogenase activity employing an artificial electron acceptor. Secondly, the Ala96Leu mutant was immobilized on a screen-printed carbon electrode using glutaraldehyde cross-linking method. Amperometric analysis was performed with potassium ferricyanide as an electron mediator under argon or atmospheric conditions. Under argon condition, the response current increased linearly from 0.05 to 0.5mM l-lactate for both wild-type and Ala96Leu. However, under atmospheric conditions, the response of wild-type AvLOx electrode was suppressed by 9-12% due to oxygen interference. The Ala96Leu mutant maintained 56-69% of the response current at the same l-lactate level and minimized the relative bias error to -19% from -49% of wild-type. This study provided significant insight into the enzymatic reaction mechanism of AvLOx and presented a novel approach to minimize oxygen interference in sensor applications, which will enable accurate detection of l-lactate concentrations. Copyright © 2017 Elsevier B.V. All rights reserved.

Rosuvastatin prevents angiotensin II-induced vascular changes by inhibition of NAD(P)H oxidase and COX-1

PubMed Central

Colucci, Rocchina; Fornai, Matteo; Duranti, Emiliano; Antonioli, Luca; Rugani, Ilaria; Aydinoglu, Fatma; Ippolito, Chiara; Segnani, Cristina; Bernardini, Nunzia; Taddei, Stefano; Blandizzi, Corrado; Virdis, Agostino

2013-01-01

Background and Purpose NAD(P)H oxidase and COX-1 participate in vascular damage induced by angiotensin II. We investigated the effect of rosuvastatin on endothelial dysfunction, vascular remodelling, changes in extracellular matrix components and mechanical properties of small mesenteric arteries from angiotensin II-infused rats. Experimental Approach Male rats received angiotensin II (120 ng·kg−1·min−1, subcutaneously) for 14 days with or without rosuvastatin (10 mg·kg−1·day−1, oral gavage) or vehicle. Vascular functions and morphological parameters were assessed by pressurized myography. Key Results In angiotensin II-infused rats, ACh-induced relaxation was attenuated compared with controls, less sensitive to L-NAME, enhanced by SC-560 (COX-1 inhibitor) or SQ-29548 (prostanoid TP receptor antagonist), and normalized by the antioxidant ascorbic acid or NAD(P)H oxidase inhibitors. After rosuvastatin, relaxations to ACh were normalized, fully sensitive to L-NAME, and no longer affected by SC-560, SQ-29548 or NAD(P)H oxidase inhibitors. Angiotensin II enhanced intravascular superoxide generation, eutrophic remodelling, collagen and fibronectin depositions, and decreased elastin content, resulting in increased vessel stiffness. All these changes were prevented by rosuvastatin. Angiotensin II increased phosphorylation of NAD(P)H oxidase subunit p47phox and its binding to subunit p67phox, effects inhibited by rosuvastatin. Rosuvastatin down-regulated vascular Nox4/NAD(P)H isoform and COX-1 expression, attenuated the vascular release of 6-keto-PGF1α, and enhanced copper/zinc-superoxide dismutase expression. Conclusion and Implications Rosuvastatin prevents angiotensin II-induced alterations in resistance arteries in terms of function, structure, mechanics and composition. These effects depend on restoration of NO availability, prevention of NAD(P)H oxidase-derived oxidant excess, reversal of COX-1 induction and its prostanoid production, and stimulation of endogenous vascular antioxidant defences. PMID:22817606

Psychromicrobium silvestre gen. nov., sp. nov., an actinobacterium isolated from alpine forest soils.

PubMed

Schumann, Peter; Zhang, De-Chao; França, Luís; Albuquerque, Luciana; da Costa, Milton S; Margesin, Rosa

2017-03-01

Two Gram-stain-variable, non-motile, catalase-positive and cytochrome c oxidase-negative bacteria, designated AK20-18 T and AM20-54, were isolated from forest soil samples collected in the Italian Alps. Growth occurred at a temperature range of 5-30 °C, at pH 6-9 and in the presence of 0-5 % (w/v) NaCl. The 16S rRNA gene sequence similarity between strains AK20-18 T and AM20-54 was 100 %. Phylogenetic analysis based on 16S rRNA gene sequence showed that strain AK20-18 T had highest 16S rRNA gene sequence similarity with the type strain of Arthrobacter psychrochitiniphilus (96.9 %). The cell-wall peptidoglycan structure of strain AK20-18 T was of the type A3alpha l-Lys-l-Thr-l-Ala2 (A11.27). The whole-cell sugars were galactose, ribose and lesser amounts of mannose. The major respiratory quinone of the two strains was menaquinone 9(H2) [MK-9(H2)], whereas MK-10(H2) was a minor component. The polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and unknown glycolipids. The major cellular fatty acids were anteiso-C15 : 0, iso-C15 : 0, iso-C16 : 0 and anteiso-C17 : 0. The genomic DNA G+C content was 59.9 mol%. Combined data of phylogenetic, phenotypic and chemotaxonomic analyses demonstrated that strains AK20-18 T and AM20-54 represent a novel genus and species, for which the name Psychromicrobium silvestre gen. nov., sp. nov. is proposed. The type strain of Psychromicrobium silvestregen. nov., sp. nov. is AK20-18 T (=DSM 102047 T =LMG 29369 T ).

Highly sensitive luminol electrochemiluminescence immunosensor based on ZnO nanoparticles and glucose oxidase decorated graphene for cancer biomarker detection.

PubMed

Cheng, Yinfeng; Yuan, Ruo; Chai, Yaqin; Niu, Huan; Cao, Yaling; Liu, Huijing; Bai, Lijuan; Yuan, Yali

2012-10-01

In this work, we reported a sandwiched luminol electrochemiluminescence (ECL) immunosensor using ZnO nanoparticles (ZnONPs) and glucose oxidase (GOD) decorated graphene as labels and in situ generated hydrogen peroxide as coreactant. In order to construct the base of the immunosensor, a hybrid architecture of Au nanoparticles and graphene by reduction of HAuCl(4) and graphene oxide (GO) with ascorbic acid was prepared. The resulted hybrid architecture modified electrode provided an excellent platform for immobilization of antibody with good bioactivity and stability. Then, ZnONPs and GOD functionalized graphene labeled secondary antibody was designed for fabricating a novel sandwiched ECL immunosensor. Enhanced sensitivity was obtained by in situ generating hydrogen peroxide with glucose oxidase and the catalysis of ZnONPs to the ECL reaction of luminol-H(2)O(2) system. The as-prepared ECL immunosensor exhibited excellent analytical property for the detection of carcinoembryonic antigen (CEA) in the range from 10 pg mL(-1) to 80 ng mL(-1) and with a detection limit of 3.3 pg mL(-1) (SN(-1)=3). The amplification strategy performed good promise for clinical application of screening of cancer biomarkers. Copyright © 2012 Elsevier B.V. All rights reserved.

Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1

PubMed Central

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-01-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

Interactions between ethylene and auxin are crucial to the control of grape (Vitis vinifera L.) berry ripening.

PubMed

Böttcher, Christine; Burbidge, Crista A; Boss, Paul K; Davies, Christopher

2013-12-23

Fruit development is controlled by plant hormones, but the role of hormone interactions during fruit ripening is poorly understood. Interactions between ethylene and the auxin indole-3-acetic acid (IAA) are likely to be crucial during the ripening process, since both hormones have been shown to be implicated in the control of ripening in a range of different fruit species. Grapevine (Vitis vinifera L.) homologues of the TRYPTOPHAN AMINOTRANSFERASE RELATED (TAR) and YUCCA families, functioning in the only characterized pathway of auxin biosynthesis, were identified and the expression of several TAR genes was shown to be induced by the pre-ripening application of the ethylene-releasing compound Ethrel. The induction of TAR expression was accompanied by increased IAA and IAA-Asp concentrations, indicative of an upregulation of auxin biosynthesis and conjugation. Exposure of ex planta, pre-ripening berries to the ethylene biosynthesis inhibitor aminoethoxyvinylglycine resulted in decreased IAA and IAA-Asp concentrations. The delayed initiation of ripening observed in Ethrel-treated berries might therefore represent an indirect ethylene effect mediated by increased auxin concentrations. During berry development, the expression of three TAR genes and one YUCCA gene was upregulated at the time of ripening initiation and/or during ripening. This increase in auxin biosynthesis gene expression was preceded by high expression levels of the ethylene biosynthesis genes 1-aminocyclopropane-1-carboxylate synthase and 1-aminocyclopropane-1-carboxylate oxidase. In grape berries, members of both gene families involved in the two-step pathway of auxin biosynthesis are expressed, suggesting that IAA is produced through the combined action of TAR and YUCCA proteins in developing berries. The induction of TAR expression by Ethrel applications and the developmental expression patterns of auxin and ethylene biosynthesis genes indicate that elevated concentrations of ethylene prior to the initiation of ripening might lead to an increased production of IAA, suggesting a complex involvement of this auxin and its conjugates in grape berry ripening.

Interactions between ethylene and auxin are crucial to the control of grape (Vitis vinifera L.) berry ripening

PubMed Central

2013-01-01

Background Fruit development is controlled by plant hormones, but the role of hormone interactions during fruit ripening is poorly understood. Interactions between ethylene and the auxin indole-3-acetic acid (IAA) are likely to be crucial during the ripening process, since both hormones have been shown to be implicated in the control of ripening in a range of different fruit species. Results Grapevine (Vitis vinifera L.) homologues of the TRYPTOPHAN AMINOTRANSFERASE RELATED (TAR) and YUCCA families, functioning in the only characterized pathway of auxin biosynthesis, were identified and the expression of several TAR genes was shown to be induced by the pre-ripening application of the ethylene-releasing compound Ethrel. The induction of TAR expression was accompanied by increased IAA and IAA-Asp concentrations, indicative of an upregulation of auxin biosynthesis and conjugation. Exposure of ex planta, pre-ripening berries to the ethylene biosynthesis inhibitor aminoethoxyvinylglycine resulted in decreased IAA and IAA-Asp concentrations. The delayed initiation of ripening observed in Ethrel-treated berries might therefore represent an indirect ethylene effect mediated by increased auxin concentrations. During berry development, the expression of three TAR genes and one YUCCA gene was upregulated at the time of ripening initiation and/or during ripening. This increase in auxin biosynthesis gene expression was preceded by high expression levels of the ethylene biosynthesis genes 1-aminocyclopropane-1-carboxylate synthase and 1-aminocyclopropane-1-carboxylate oxidase. Conclusions In grape berries, members of both gene families involved in the two-step pathway of auxin biosynthesis are expressed, suggesting that IAA is produced through the combined action of TAR and YUCCA proteins in developing berries. The induction of TAR expression by Ethrel applications and the developmental expression patterns of auxin and ethylene biosynthesis genes indicate that elevated concentrations of ethylene prior to the initiation of ripening might lead to an increased production of IAA, suggesting a complex involvement of this auxin and its conjugates in grape berry ripening. PMID:24364881

A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

PubMed Central

Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

2013-01-01

Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID:23840306

Membrane-Associated Transporter Protein (MATP) Regulates Melanosomal pH and Influences Tyrosinase Activity

PubMed Central

Bin, Bum-Ho; Bhin, Jinhyuk; Yang, Seung Ha; Shin, Misun; Nam, Yeon-Ju; Choi, Dong-Hwa; Shin, Dong Wook; Lee, Ai-Young; Hwang, Daehee; Cho, Eun-Gyung; Lee, Tae Ryong

2015-01-01

The SLC45A2 gene encodes a Membrane-Associated Transporter Protein (MATP). Mutations of this gene cause oculocutaneous albinism type 4 (OCA4). However, the molecular mechanism of its action in melanogenesis has not been elucidated. Here, we discuss the role of MATP in melanin production. The SLC45A2 gene is highly enriched in human melanocytes and melanoma cell lines, and its protein, MATP, is located in melanosomes. The knockdown of MATP using siRNAs reduced melanin content and tyrosinase activity without any morphological change in melanosomes or the expression of melanogenesis-related proteins. Interestingly, the knockdown of MATP significantly lowered the melanosomal pH, as verified through DAMP analysis, suggesting that MATP regulates melanosomal pH and therefore affects tyrosinase activity. Finally, we found that the reduction of tyrosinase activity associated with the knockdown of MATP was readily recovered by copper treatment in the in vitro L-DOPA oxidase activity assay of tyrosinase. Considering that copper is an important element for tyrosinase activity and that its binding to tyrosinase depends on melanosomal pH, MATP may play an important role in regulating tyrosinase activity via controlling melanosomal pH. PMID:26057890

The Relationship between Academic Self-Efficacy and Academic-Related Boredom: "MAOA" Gene as a Moderator

ERIC Educational Resources Information Center

Liu, Yangyang; Lu, Zuhong

2017-01-01

The present study sought to examine the relationship between Chinese high school students' academic self-efficacy and their academic-related boredom. Another objective was to explore the moderating effects of mono-amine-oxidase type A ("MAOA") gene polymorphism on this relationship. In a sample of 514 Chinese high school students, we…

Enzymatic and phytochemical stabilization of orange-strawberry-banana beverages by high hydrostatic pressure and mild heat.

PubMed

Escobedo-Avellaneda, Zamantha; Pérez-Simón, Izaskun; Lavilla-Martín, María; Baranda-González, Ana; Welti-Chanes, Jorge

2017-03-01

A new approach to the use of high hydrostatic pressure is its combination with high and intermediate temperatures applied to obtain safe foods of high quality. The effect of high hydrostatic pressure on color, residual polyphenol oxidase and pectin methylesterase activity, and total phenolic and l-ascorbic acid contents of orange-strawberry-banana beverages was evaluated. Beverages were treated at 500 and 600 MPa at 19-64 ℃ during 2-10 min. The effect of the come up time was also evaluated and results were compared with the untreated and the thermally processed (80 ℃/7 min) products. Untreated beverages had total phenolic content of 210.2±12.3 mg gallic acid/100 g and 19.1 ± 0.6 mg l-ascorbic acid/100 g. For most high hydrostatic pressure treatment conditions, total phenolic content, l-ascorbic acid, and color did not change significantly. Maximum levels of inactivation of polyphenol oxidase and pectin methylesterase were 96.2 and 48% at 600 MPa/64 ℃/10 min, while the thermal treatment led to inactivation of 99.6 and 94.1% of both enzymes, but with negative color changes. l-ascorbic acid content was slightly decreased with the thermal treatment while total phenolic content was not affected. High hydrostatic pressure treatments of beverages at 600 MPa/64 ℃/10 min are recommended to retain maximal total phenolic content and l-ascorbic acid and achieve an acceptable polyphenol oxidase inactivation level.

Whole Genome Association Mapping of Plant Height in Winter Wheat (Triticum aestivum L.)

PubMed Central

Zanke, Christine D.; Ling, Jie; Plieske, Jörg; Kollers, Sonja; Ebmeyer, Erhard; Korzun, Viktor; Argillier, Odile; Stiewe, Gunther; Hinze, Maike; Neumann, Kerstin; Ganal, Martin W.; Röder, Marion S.

2014-01-01

The genetic architecture of plant height was investigated in a set of 358 recent European winter wheat varieties plus 14 spring wheat varieties based on field data in eight environments. Genotyping of diagnostic markers revealed the Rht-D1b mutant allele in 58% of the investigated varieties, while the Rht-B1b mutant was only present in 7% of the varieties. Rht-D1 was significantly associated with plant height by using a mixed linear model and employing a kinship matrix to correct for population stratification. Further genotyping data included 732 microsatellite markers, resulting in 770 loci, of which 635 markers were placed on the ITMI map plus a set of 7769 mapped SNP markers genotyped with the 90 k iSELECT chip. When Bonferroni correction was applied, a total of 153 significant marker-trait associations (MTAs) were observed for plant height and the SSR markers (−log10 (P-value) ≥4.82) and 280 (−log10 (P-value) ≥5.89) for the SNPs. Linear regression between the most effective markers and the BLUEs for plant height indicated additive effects for the MTAs of different chromosomal regions. Analysis of syntenic regions in the rice genome revealed closely linked rice genes related to gibberellin acid (GA) metabolism and perception, i.e. GA20 and GA2 oxidases orthologous to wheat chromosomes 1A, 2A, 3A, 3B, 5B, 5D and 7B, ent-kaurenoic acid oxidase orthologous to wheat chromosome 7A, ent-kaurene synthase on wheat chromosome 2B, as well as GA-receptors like DELLA genes orthologous to wheat chromosomes 4B, 4D and 7A and genes of the GID family orthologous to chromosomes 2B and 5B. The data indicated that besides the widely used GA-insensitive dwarfing genes Rht-B1 and Rht-D1 there is a wide spectrum of loci available that could be used for modulating plant height in variety development. PMID:25405621

Development of an On-Line Biological Detector

DTIC Science & Technology

1976-07-31

ib . Pert...chemical (Kit 0510). This kit uses the enzymes, glucose oxidase ( Aspergillus niger) and peroxidase (horseradish). In the presence of glucose oxidase, "D...tt -h l o)w the(m to( peteltl rate bt v 1tn t ;w I ib r .I "Flow i i | ;t t r ,I h--Ut cii I r’. 2 Iit I ii I iii t icý, ind M - ) i n i I.t r, i

Biocompatibility selenium nanoparticles with an intrinsic oxidase-like activity

NASA Astrophysics Data System (ADS)

Guo, Leilei; Huang, Kaixun; Liu, Hongmei

2016-03-01

Selenium nanoparticles (SeNPs) are considered to be the new selenium supplement forms with high biological activity and low toxicity; however, the molecular mechanism by which SeNPs exert the biological function is unclear. Here, we reported that biocompatibility SeNPs possessed intrinsic oxidase-like activity. Using Na2SeO3 as a precursor and glutathione as a reductant, biocompatibility SeNPs were synthesized by the wet chemical reduction method in the presence of bovine serum albumin (BSA). The results of structure characterization revealed that synthesized SeNPs were amorphous red elementary selenium with spherical morphology, and ranged in size from 25 to 70 nm size with a narrow distribution (41.4 ± 6.7 nm). The oxidase-like activity of the as-synthesized SeNPs was tested with 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate. The results indicated that SeNPs could catalyze the oxidization of TMB by dissolved oxygen. These SeNPs showed an optimum catalytic activity at pH 4 and 30 °C, and the oxidase-like activity was higher as the concentration of SeNPs increased and the size of SeNPs decreased. The Michaelis constant ( K m) values and maximal reaction velocity ( V max) of the SeNPs for TMB oxidation were 0.0083 mol/L and 3.042 μmol/L min, respectively.

Simultaneous immobilization of glucose oxidase on the surface and cavity of hollow gold nanospheres as labels for highly sensitive electrochemical immunoassay of tumor marker.

PubMed

Song, Zhongju; Yuan, Ruo; Chai, Yaqin; Jiang, Wen; Su, Huilan; Che, Xin; Ran, Xiaoqi

2011-01-15

A novel tracer, glucose oxidase (GOD)-functionalized hollow gold nanospheres encapsulating glucose oxidase (Au(shell)@GOD), was designed to label the ferrocenemonocarboxylic-grafted secondary antibodies (Fc@Ab(2)) for highly sensitive detection of tumor marker using carboxyl group functionalized multiwall carbon nanotubes as platform. Initially, Au(shell)@GOD was synthesized specially by reverse micelle approach, and then the labeling of antibody and the preparation of GOD-functionalized Au(shell)@GOD were performed by one-pot assembly of Fc@Ab(2) and GOD on the surface of Au(shell)@GOD. The ferrocene used to label antibodies acted as a mediator of electron transfer between GOD and electrode surface. The high-content glucose oxidase in the tracer (on the surface and in the cavity) could significantly amplify the amperometric signal for sandwich-type immunoassay. Using carcinoembryonic antigen (CEA) as model analyte, the designed tracer showed linear range from 0.02 to 5.0 ng mL(-1) with the detection limit down to 6.7 pg mL(-1). The assay results of serum samples with the proposed method were in an acceptable agreement with the reference values. The new protocol showed acceptable stability and reproducibility, high sensitivity, and good precision, which could provide a promising potential for clinical screening and diagnosis of tumor disease. Copyright © 2010 Elsevier B.V. All rights reserved.

A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

PubMed

Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

2007-09-05

Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.

PubMed

Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

2014-01-01

A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively.

Phylogeography of Littorina sitkana in the northwestern Pacific Ocean: evidence of eastward trans-Pacific colonization after the Last Glacial Maximum.

PubMed

Azuma, Noriko; Zaslavskaya, Nadezhda I; Yamazaki, Tomoyasu; Nobetsu, Takahiro; Chiba, Susumu

2017-04-01

We investigated genetic diversity and population structure of the Sitka periwinkle Littorina sitkana along the coastlines of the northwestern Pacific (NWP) to evaluate the possibility of trans-Pacific colonization of this species from the NWP to the northeastern Pacific (NEP) after the Last Glacial Maximum. We sampled L. sitkana from 32 populations in the NWP, and sequenced a region of the mitochondrial cytochrome b oxidase gene for population genetic analyses. The results were compared with those of previous reports from the NEP. The genetic diversity of L. sitkana was much higher in the NWP than in the NEP. Genetic connectivity between the NWP and NEP populations was indicated by an extremely abundant haplotype in the NEP that was also present in eastern Hokkaido and the Kuril Islands. To confirm these results, we compared sequences of the longest intron of the aminopeptidase N gene (APN54) in the nuclear genome in four populations of L. sitkana in the NWP with previous results from the NEP. Again, much higher genetic diversity was found in the NWP than in the NEP and genetic connectivity was supported between the Kuril Islands and the NEP. These results imply postglacial colonization of this species from the NWP to the NEP, probably along the Kuril and Aleutian Island chains. This study is the first report of possible trans-Pacific postglacial colonization of a direct-developing gastropod, inferred from genetic data.

Tea polyphenols alleviate high fat and high glucose-induced endothelial hyperpermeability by attenuating ROS production via NADPH oxidase pathway.

PubMed

Zuo, Xuezhi; Tian, Chong; Zhao, Nana; Ren, Weiye; Meng, Yi; Jin, Xin; Zhang, Ying; Ding, Shibin; Ying, Chenjiang; Ye, Xiaolei

2014-03-02

Hyperglycemia-induced endothelial hyperpermeability is crucial to cardiovascular disorders and macro-vascular complications in diabetes mellitus. The objective of this study is to investigate the effects of green tea polyphenols (GTPs) on endothelial hyperpermeability and the role of nicotinamide adenine dinucleotide phosphate (NADPH) pathway. Male Wistar rats fed on a high fat diet (HF) were treated with GTPs (0, 0.8, 1.6, 3.2 g/L in drinking water) for 26 weeks. Bovine aortic endothelial cells (BAECs) were treated with high glucose (HG, 33 mmol/L) and GTPs (0.0, 0.4, or 4 μg/mL) for 24 hours in vitro. The endothelial permeabilities in rat aorta and monolayer BAECs were measured by Evans blue injection method and efflux of fluorescein isothiocyanate (FITC)-dextran, respectively. The reactive oxygen species (ROS) levels in rat aorta and monolayer BAECs were measured by dihydroethidium (DHE) and 2', 7'-dichloro-fluorescein diacetate (DCFH-DA) fluorescent probe, respectively. Protein levels of NADPH oxidase subunits were determined by Western-blot. HF diet-fed increased the endothelial permeability and ROS levels in rat aorta while HG treatments increased the endothelial permeability and ROS levels in cultured BAECs. Co-treatment with GTPs alleviated those changes both in vivo and in vitro. In in vitro studies, GTPs treatments protected against the HG-induced over-expressions of p22phox and p67phox. Diphenylene iodonium chloride (DPI), an inhibitor of NADPH oxidase, alleviated the hyperpermeability induced by HG. GTPs could alleviate endothelial hyperpermeabilities in HF diet-fed rat aorta and in HG treated BAECs. The decrease of ROS production resulting from down-regulation of NADPH oxidase contributed to the alleviation of endothelial hyperpermeability.

Phytochemical Composition, Antioxidant and Xanthine Oxidase Inhibitory Activities of Amaranthus cruentus L. and Amaranthus hybridus L. Extracts

PubMed Central

Nana, Fernand W.; Hilou, Adama; Millogo, Jeanne F.; Nacoulma, Odile G.

2012-01-01

This paper describes a preliminary assessment of the nutraceutical value of Amaranthus cruentus (A. cruentus) and Amaranthus hybridus (A. hybridus), two food plant species found in Burkina Faso. Hydroacetonic (HAE), methanolic (ME), and aqueous extracts (AE) from the aerial parts were screened for in vitro antioxidant and xanthine oxidase inhibitory activities. Phytochemical analyses revealed the presence of polyphenols, tannins, flavonoids, steroids, terpenoids, saponins and betalains. Hydroacetonic extracts have shown the most diversity for secondary metabolites. The TLC analyses of flavonoids from HAE extracts showed the presence of rutin and other unidentified compounds. The phenolic compound contents of the HAE, ME and AE extracts were determined using the Folin–Ciocalteu method and ranged from 7.55 to 10.18 mg Gallic acid equivalent GAE/100 mg. Tannins, flavonoids, and flavonols ranged from 2.83 to 10.17 mg tannic acid equivalent (TAE)/100 mg, 0.37 to 7.06 mg quercetin equivalent (QE) /100 mg, and 0.09 to 1.31 mg QE/100 mg, respectively. The betacyanin contents were 40.42 and 6.35 mg Amaranthin Equivalent/100 g aerial parts (dry weight) in A. cruentus and A. hybridus, respectively. Free-radical scavenging activity expressed as IC50 (DPPH method) and iron reducing power (FRAP method) ranged from 56 to 423 µg/mL and from 2.26 to 2.56 mmol AAE/g, respectively. Xanthine oxidase inhibitory activities of extracts of A. cruentus and A. hybridus were 3.18% and 38.22%, respectively. The A. hybridus extract showed the best antioxidant and xanthine oxidase inhibition activities. The results indicated that the phytochemical contents of the two species justify their traditional uses as nutraceutical food plants. PMID:24281664

Draft Genome Sequence of Roseovarius sp. A-2, an Iodide-Oxidizing Bacterium Isolated from Natural Gas Brine Water, Chiba, Japan.

PubMed

Yuliana, Tri; Nakajima, Nobuyoshi; Yamamura, Shigeki; Tomita, Masaru; Suzuki, Haruo; Amachi, Seigo

2017-01-01

Roseovarius sp. A-2 is a heterotrophic iodide (I - )-oxidizing bacterium isolated from iodide-rich natural gas brine water in Chiba, Japan. This strain oxidizes iodide to molecular iodine (I 2 ) by means of an extracellular multicopper oxidase. Here we report the draft genome sequence of strain A-2. The draft genome contained 46 tRNA genes, 1 copy of a 16S-23S-5S rRNA operon, and 4,514 protein coding DNA sequences, of which 1,207 (27%) were hypothetical proteins. The genome contained a gene encoding IoxA, a multicopper oxidase previously found to catalyze the oxidation of iodide in Iodidimonas sp. Q-1. This draft genome provides detailed insights into the metabolism and potential application of Roseovarius sp. A-2.

Comparative in Silico Analysis of Ferric Reduction Oxidase (FRO) Genes Expression Patterns in Response to Abiotic Stresses, Metal and Hormone Applications.

PubMed

Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming

2018-05-12

The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.

Regulation of EPS production in Lactobacillus casei LC2W through metabolic engineering.

PubMed

Li, N; Huang, Y; Liu, Z; You, C; Guo, B

2015-12-01

Lactobacillus casei LC2W is an exopolysaccharide(EPS)-producing strain with probiotic effects. The low efficiency and unclear regulation mechanism of EPS biosynthesis have become main constraints for its application in food industry. To investigate the major rate-limiting factors of EPS biosynthesis and to improve its yield, metabolic engineering was applied to this strain. Eight relevant genes related to central metabolism, sugar-nucleotides supply, glycosyltransferase and cofactor engineering were cloned and overexpressed. The results suggested that nox, pfk, rfbB and galT genes were the largest contributors to EPS biosynthesis in this study, which elevated EPS yield by 46·0, 20, 17·4 and 19·6% respectively. Notably, under aerobic condition which was not a suitable condition for lactobacilli to grow in, recombinant strain LC-nox achieved the highest EPS yield of 263·7 mg l(-1) , which was increased by 75% compared to that of the starting strain. The oxygen stress was excluded since the phenomenon was not observed in the control strain under the same condition. Therefore, it was probably that higher NADH oxidase activity led to a decreased NADH availability and reduced lactate concentration, which resulted in the elevation of EPS yield. This study contributed to the understanding of EPS biosynthesis in Lact. casei through metabolic engineering and provided a starting point for introducing cofactor engineering into this strain. Overexpression of NADH oxidase was found to have a most significant effect on the EPS production. It is the first report that EPS could be accumulated to such a high level under aerobic condition in lactobacilli. Our results provided a novel strategy for the improvement of EPS production in lactic acid bacteria. © 2015 The Society for Applied Microbiology.

The obligate respiratory supercomplex from Actinobacteria.

PubMed

Kao, Wei-Chun; Kleinschroth, Thomas; Nitschke, Wolfgang; Baymann, Frauke; Neehaul, Yashvin; Hellwig, Petra; Richers, Sebastian; Vonck, Janet; Bott, Michael; Hunte, Carola

2016-10-01

Actinobacteria are closely linked to human life as industrial producers of bioactive molecules and as human pathogens. Respiratory cytochrome bcc complex and cytochrome aa3 oxidase are key components of their aerobic energy metabolism. They form a supercomplex in the actinobacterial species Corynebacterium glutamicum. With comprehensive bioinformatics and phylogenetic analysis we show that genes for cyt bcc-aa3 supercomplex are characteristic for Actinobacteria (Actinobacteria and Acidimicrobiia, except the anaerobic orders Actinomycetales and Bifidobacteriales). An obligatory supercomplex is likely, due to the lack of genes encoding alternative electron transfer partners such as mono-heme cyt c. Instead, subunit QcrC of bcc complex, here classified as short di-heme cyt c, will provide the exclusive electron transfer link between the complexes as in C. glutamicum. Purified to high homogeneity, the C. glutamicum bcc-aa3 supercomplex contained all subunits and cofactors as analyzed by SDS-PAGE, BN-PAGE, absorption and EPR spectroscopy. Highly uniform supercomplex particles in electron microscopy analysis support a distinct structural composition. The supercomplex possesses a dimeric stoichiometry with a ratio of a-type, b-type and c-type hemes close to 1:1:1. Redox titrations revealed a low potential bcc complex (Em(ISP)=+160mV, Em(bL)=-291mV, Em(bH)=-163mV, Em(cc)=+100mV) fined-tuned for oxidation of menaquinol and a mixed potential aa3 oxidase (Em(CuA)=+150mV, Em(a/a3)=+143/+317mV) mediating between low and high redox potential to accomplish dioxygen reduction. The generated molecular model supports a stable assembled supercomplex with defined architecture which permits energetically efficient coupling of menaquinol oxidation and dioxygen reduction in one supramolecular entity. Copyright © 2016 Elsevier B.V. All rights reserved.

Localization of ascorbic acid, ascorbic acid oxidase, and glutathione in roots of Cucurbita maxima L.

PubMed

Liso, Rosalia; De Tullio, Mario C; Ciraci, Samantha; Balestrini, Raffaella; La Rocca, Nicoletta; Bruno, Leonardo; Chiappetta, Adriana; Bitonti, Maria Beatrice; Bonfante, Paola; Arrigoni, Oreste

2004-12-01

To understand the function of ascorbic acid (ASC) in root development, the distribution of ASC, ASC oxidase, and glutathione (GSH) were investigated in cells and tissues of the root apex of Cucubita maxima. ASC was regularly distributed in the cytosol of almost all root cells, with the exception of quiescent centre (QC) cells. ASC also occurred at the surface of the nuclear membrane and correspondingly in the nucleoli. No ASC could be observed in vacuoles. ASC oxidase was detected by immunolocalization mainly in cell walls and vacuoles. This enzyme was particularly abundant in the QC and in differentiating vascular tissues and was absent in lateral root primordia. Administration of the ASC precursor L-galactono-gamma-lactone markedly increased ASC content in all root cells, including the QC. Root treatment with the ASC oxidized product, dehydroascorbic acid (DHA), also increased ASC content, but caused ASC accumulation only in peripheral tissues, where DHA was apparently reduced at the expense of GSH. The different pattern of distribution of ASC in different tissues and cell compartments reflects its possible role in cell metabolism and root morphogenesis.

Characterization of three multicopper oxidases in the filamentous fungus Podospora anserina: A new role of an ABR1-like protein in fungal development?

PubMed

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence

2018-07-01

The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.

Permanent draft genome of Thiobacillus thioparus DSM 505T, an obligately chemolithoautotrophic member of the Betaproteobacteria

DOE PAGES

Hutt, Lee P.; Huntemann, Marcel; Clum, Alicia; ...

2017-01-19

Thiobacillus thioparus DSM 505 T is one of first two isolated strains of inorganic sulfur-oxidising Bacteria. The original strain of T. thioparus was lost almost 100 years ago and the working type strain is Culture C T (=DSM 505 T = ATCC 8158 T ) isolated by Starkey in 1934 from agricultural soil at Rutgers University, New Jersey, USA. It is an obligate chemolithoautotroph that conserves energy from the oxidation of reduced inorganic sulfur compounds using the Kelly-Trudinger pathway and uses it to fix carbon dioxide It is not capable of heterotrophic or mixotrophic growth. The strain has a genomemore » size of 3,201,518 bp. Here we report the genome sequence, annotation and characteristics. The genome contains 3,135 protein coding and 62 RNA coding genes. Genes encoding the transaldolase variant of the Calvin-Benson-Bassham cycle were also identified and an operon encoding carboxysomes, along with Smith's biosynthetic horseshoe in lieu of Krebs' cycle sensu stricto. Terminal oxidases were identified, viz. cytochrome c oxidase (cbb3, EC 1.9.3.1) and ubiquinol oxidase (bd, EC 1.10.3.10). There is a partial sox operon of the Kelly-Friedrich pathway of inorganic sulfur-oxidation that contains soxXYZAB genes but lacking soxCDEF, there is also a lack of the DUF302 gene previously noted in the sox operon of other members of the 'Proteobacteria' that can use trithionate as an energy source. In spite of apparently not growing anaerobically with denitrification, the nar, nir, nor and nos operons encoding enzymes of denitrification are found in the T. thioparus genome, in the same arrangements as in the true denitrifier T. denitrificans.« less

The genome sequence of the metal-mobilizing, extremely thermoacidophilic archaeon Metallosphaera sedula provides insights into bioleaching-associated metabolism.

PubMed

Auernik, Kathryne S; Maezato, Yukari; Blum, Paul H; Kelly, Robert M

2008-02-01

Despite their taxonomic description, not all members of the order Sulfolobales are capable of oxidizing reduced sulfur species, which, in addition to iron oxidation, is a desirable trait of biomining microorganisms. However, the complete genome sequence of the extremely thermoacidophilic archaeon Metallosphaera sedula DSM 5348 (2.2 Mb, approximately 2,300 open reading frames [ORFs]) provides insights into biologically catalyzed metal sulfide oxidation. Comparative genomics was used to identify pathways and proteins involved (directly or indirectly) with bioleaching. As expected, the M. sedula genome contains genes related to autotrophic carbon fixation, metal tolerance, and adhesion. Also, terminal oxidase cluster organization indicates the presence of hybrid quinol-cytochrome oxidase complexes. Comparisons with the mesophilic biomining bacterium Acidithiobacillus ferrooxidans ATCC 23270 indicate that the M. sedula genome encodes at least one putative rusticyanin, involved in iron oxidation, and a putative tetrathionate hydrolase, implicated in sulfur oxidation. The fox gene cluster, involved in iron oxidation in the thermoacidophilic archaeon Sulfolobus metallicus, was also identified. These iron- and sulfur-oxidizing components are missing from genomes of nonleaching members of the Sulfolobales, such as Sulfolobus solfataricus P2 and Sulfolobus acidocaldarius DSM 639. Whole-genome transcriptional response analysis showed that 88 ORFs were up-regulated twofold or more in M. sedula upon addition of ferrous sulfate to yeast extract-based medium; these included genes for components of terminal oxidase clusters predicted to be involved with iron oxidation, as well as genes predicted to be involved with sulfur metabolism. Many hypothetical proteins were also differentially transcribed, indicating that aspects of the iron and sulfur metabolism of M. sedula remain to be identified and characterized.

Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

PubMed Central

González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

2004-01-01

The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

Permanent draft genome of Thiobacillus thioparus DSM 505T, an obligately chemolithoautotrophic member of the Betaproteobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hutt, Lee P.; Huntemann, Marcel; Clum, Alicia

Thiobacillus thioparus DSM 505 T is one of first two isolated strains of inorganic sulfur-oxidising Bacteria. The original strain of T. thioparus was lost almost 100 years ago and the working type strain is Culture C T (=DSM 505 T = ATCC 8158 T ) isolated by Starkey in 1934 from agricultural soil at Rutgers University, New Jersey, USA. It is an obligate chemolithoautotroph that conserves energy from the oxidation of reduced inorganic sulfur compounds using the Kelly-Trudinger pathway and uses it to fix carbon dioxide It is not capable of heterotrophic or mixotrophic growth. The strain has a genomemore » size of 3,201,518 bp. Here we report the genome sequence, annotation and characteristics. The genome contains 3,135 protein coding and 62 RNA coding genes. Genes encoding the transaldolase variant of the Calvin-Benson-Bassham cycle were also identified and an operon encoding carboxysomes, along with Smith's biosynthetic horseshoe in lieu of Krebs' cycle sensu stricto. Terminal oxidases were identified, viz. cytochrome c oxidase (cbb3, EC 1.9.3.1) and ubiquinol oxidase (bd, EC 1.10.3.10). There is a partial sox operon of the Kelly-Friedrich pathway of inorganic sulfur-oxidation that contains soxXYZAB genes but lacking soxCDEF, there is also a lack of the DUF302 gene previously noted in the sox operon of other members of the 'Proteobacteria' that can use trithionate as an energy source. In spite of apparently not growing anaerobically with denitrification, the nar, nir, nor and nos operons encoding enzymes of denitrification are found in the T. thioparus genome, in the same arrangements as in the true denitrifier T. denitrificans.« less

The Genome Sequence of the Metal-Mobilizing, Extremely Thermoacidophilic Archaeon Metallosphaera sedula Provides Insights into Bioleaching-Associated Metabolism▿ †

PubMed Central

Auernik, Kathryne S.; Maezato, Yukari; Blum, Paul H.; Kelly, Robert M.

2008-01-01

Despite their taxonomic description, not all members of the order Sulfolobales are capable of oxidizing reduced sulfur species, which, in addition to iron oxidation, is a desirable trait of biomining microorganisms. However, the complete genome sequence of the extremely thermoacidophilic archaeon Metallosphaera sedula DSM 5348 (2.2 Mb, ∼2,300 open reading frames [ORFs]) provides insights into biologically catalyzed metal sulfide oxidation. Comparative genomics was used to identify pathways and proteins involved (directly or indirectly) with bioleaching. As expected, the M. sedula genome contains genes related to autotrophic carbon fixation, metal tolerance, and adhesion. Also, terminal oxidase cluster organization indicates the presence of hybrid quinol-cytochrome oxidase complexes. Comparisons with the mesophilic biomining bacterium Acidithiobacillus ferrooxidans ATCC 23270 indicate that the M. sedula genome encodes at least one putative rusticyanin, involved in iron oxidation, and a putative tetrathionate hydrolase, implicated in sulfur oxidation. The fox gene cluster, involved in iron oxidation in the thermoacidophilic archaeon Sulfolobus metallicus, was also identified. These iron- and sulfur-oxidizing components are missing from genomes of nonleaching members of the Sulfolobales, such as Sulfolobus solfataricus P2 and Sulfolobus acidocaldarius DSM 639. Whole-genome transcriptional response analysis showed that 88 ORFs were up-regulated twofold or more in M. sedula upon addition of ferrous sulfate to yeast extract-based medium; these included genes for components of terminal oxidase clusters predicted to be involved with iron oxidation, as well as genes predicted to be involved with sulfur metabolism. Many hypothetical proteins were also differentially transcribed, indicating that aspects of the iron and sulfur metabolism of M. sedula remain to be identified and characterized. PMID:18083856

NADPH oxidases in the arbuscular mycorrhizal symbiosis.

PubMed

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

PubMed Central

Lermontova, Inna; Grimm, Bernhard

2000-01-01

The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

Characterization of oxidative phosphorylation enzymes in Euglena gracilis and its white mutant strain W(gm)ZOflL.

PubMed

Krnáčová, Katarína; Rýdlová, Ivana; Vinarčíková, Michaela; Krajčovič, Juraj; Vesteg, Matej; Horváth, Anton

2015-03-12

The enzymes involved in Euglena oxidative phosphorylation (OXPHOS) were characterized in this study. We have demonstrated that Euglena gracilis strain Z and its stable bleached non-photosynthetic mutant strain WgmZOflL both possess fully functional OXPHOS apparatus as well as pathways requiring terminal alternative oxidase(s) and alternative mitochondrial NADH-dehydrogenase(s). Light (or dark) and plastid (non)functionality seem to have little effect on oxygen consumption, the activities of the enzymes involved in OXPHOS and the action of respiration inhibitors in Euglena. This study also demonstrates biochemical properties of complex III (cytochrome c reductase) in Euglena. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruz Vieira, I. da; Fatibello-Filho, O.

An amperometric biosensor for the determination of phenols is proposed using a crude extract of sweet potato (Ipomoea batatas (L.) Lam.) as an enzymatic source of polyphenol oxidase (PPO; tyrosinase; catechol oxidase; EC 1.14.18.1). The biosensor is constructed by the immobilization of sweet potato crude extract with glutaraldehyde and bovine serum albumin onto an oxygen membrane. This biosensor provides a linear response for catechol, pyrogallol, phenol and p-cresol in the concentration ranges of 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.5more » x 10{sup -4} mol L{sup -1} and 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1}, respectively. The response time was about 3-5 min for the useful response range, and the lifetime of this electrode was excellent for fifteen days (over 220 determinations for each enzymatic membrane). Application of this biosensor for the determination of phenols in industrial wastewaters is presented.« less

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F., E-mail: merrillg@onid.orst.ed

2009-06-05

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involvedmore » in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.« less

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase.

PubMed

Long, C M; Rohrmann, G F; Merrill, G F

2009-06-05

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Molecular diagnosis of chronic granulomatous disease.

PubMed

Roos, D; de Boer, M

2014-02-01

Patients with chronic granulomatous disease (CGD) suffer from recurrent, life-threatening bacterial and fungal infections of the skin, the airways, the lymph nodes, liver, brain and bones. Frequently found pathogens are Staphylococcus aureus, Aspergillus species, Klebsiella species, Burkholderia cepacia and Salmonella species. CGD is a rare (∼1:250 000 births) disease caused by mutations in any one of the five components of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase in phagocytes. This enzyme generates superoxide and is essential for intracellular killing of pathogens by phagocytes. Molecular diagnosis of CGD involves measuring NADPH oxidase activity in phagocytes, measuring protein expression of NADPH oxidase components and mutation analysis of genes encoding these components. Residual oxidase activity is important to know for estimation of the clinical course and the chance of survival of the patient. Mutation analysis is mandatory for genetic counselling and prenatal diagnosis. This review summarizes the different assays available for the diagnosis of CGD, the precautions to be taken for correct measurements, the flow diagram to be followed, the assays for confirmation of the diagnosis and the determinations for carrier detection and prenatal diagnosis. © 2013 British Society for Immunology.

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589